WO2022014237A1

WO2022014237A1 - Nucleic acid amplification reaction device provided with magnetic bead stirring mechanism

Info

Publication number: WO2022014237A1
Application number: PCT/JP2021/022712
Authority: WO
Inventors: 正靖 ▲桑▼原; 博仁藤田
Original assignee: 学校法人日本大学
Priority date: 2020-07-16
Filing date: 2021-06-15
Publication date: 2022-01-20
Also published as: JP2022024331A

Abstract

The present invention addresses the problem of providing a device for more efficiently performing a nucleic acid amplification reaction using a primer fixed to a magnetic bead. The present invention provides a device for performing a nucleic acid amplification reaction in a reactor vessel accommodating a reaction reagent containing a primer oligonucleotide fixed to a magnetic bead, the device comprising: a coil that can be connected to an AC power source; and a support which is installed inside the coil and made of a thermally conductive magnetic material on which the reaction vessel can be placed, wherein the device further comprises a heater that heats the support.

Description

Nucleic acid amplification reaction device equipped with a magnetic bead stirring mechanism

The present invention relates to a method for efficiently performing a nucleic acid amplification reaction and a nucleic acid amplification reaction apparatus used therein, which are used in the fields of examination and research.

Nucleic acid amplification reaction is a technology that is widely used for detection of pathogens such as viruses and genetic testing, but in order to efficiently perform detection and testing, a simpler and faster method is required.

The inventors have developed a SATIC method that uses a single-stranded circular DNA and a primer to form a tripartite complex of a target (template) nucleic acid, a single-stranded circular DNA, and a primer, and amplifies the nucleic acid at an isothermal temperature (patented). Document 1). In order to further simplify the SATIC method, the inventors have disclosed that a primer is immobilized on magnetic beads to carry out the reaction (Patent Document 2).

WO 2016/152936 WO 2020/213700

As described above, the detection sensitivity of the SATIC method was improved by immobilizing the primer on the magnetic beads, but further improvement of the detection sensitivity and shortening of the detection time were required.
Therefore, it is an object of the present invention to provide a method and an apparatus capable of more efficiently advancing a nucleic acid amplification reaction using a primer immobilized on magnetic beads.

The present inventors have made diligent studies to solve the above problems. First, it was found that the detection time in the SATIC method can be remarkably shortened by stirring the reaction solution containing the magnetic beads.
Then, as a result of examining a device capable of automatically performing stirring, a support made of a coil that can be connected to an AC power source and a heat-conducting magnetic material that is installed inside the coil and on which the reaction vessel can be placed. By applying an AC magnetic field to the coil using a device containing We have found that a device capable of controlling the reaction temperature and rapidly carrying out the SATIC reaction can be easily produced by heating, and have completed the present invention.

The gist of the present invention is as follows.
[1] A device for advancing a nucleic acid amplification reaction in a reaction vessel containing a reaction reagent containing a primer oligonucleotide immobilized on magnetic beads.
A device comprising a coil that can be connected to an AC power source and a support made of a thermally conductive magnetic material that is installed inside the coil and on which the reaction vessel can be placed.
[2] The device according to [1], wherein the support has one or a plurality of recesses into which a reaction vessel can be inserted.
[3] The apparatus according to [1] or [2], wherein the magnetic material is an iron-containing alloy.
[4] The device according to any one of [1] to [3], further comprising a heater for heating the support.
[5] The apparatus according to any one of [1] to [4], wherein the nucleic acid amplification reaction is a SATIC reaction.
[6] A method for advancing a nucleic acid amplification reaction in a reaction vessel containing a reaction reagent containing a primer oligonucleotide immobilized on magnetic beads. The reaction vessel is placed in an AC magnetic field, and the magnetic beads in the reaction vessel are placed. A method characterized by carrying out a nucleic acid amplification reaction while stirring with an AC magnetic field.
[7] The method according to [6], wherein the AC magnetic field is a magnetic field in a coil connected to an AC power supply.
[8] The method according to [6] or [7], wherein the AC frequency is 1 to 50 Hz.
[9] The method according to any one of [6] to [8], wherein the AC voltage is 10 to 50V.
[10] The method according to any one of [6] to [9], wherein the reaction vessel is placed on the support of the apparatus according to any one of [1] to [4] to carry out the reaction.
[11] The method according to any one of [6] to [10], wherein the nucleic acid amplification reaction is a SATIC reaction.

According to the method and apparatus of the present invention, a nucleic acid amplification reaction such as a SATIC reaction can be performed while stirring magnetic beads under a controlled temperature, so that it is easy and quick without using a shaker or the like. Nucleic acid amplification reaction can be carried out.

The schematic diagram which shows one aspect of the apparatus of this invention. A is a schematic diagram of a device in which A is a coil, B is a support, and C is a support in the coil. It is a schematic diagram which shows one aspect of the use mode of the apparatus of this invention. It is a schematic diagram of the SATIC method.

The method of the present invention is a method for advancing a nucleic acid amplification reaction in a reaction vessel containing a reaction reagent containing a primer oligonucleotide immobilized on magnetic beads, in which the reaction vessel is placed in an AC magnetic field and inside the reaction vessel. It is characterized in that a nucleic acid amplification reaction is carried out while stirring the magnetic beads of No. 1 by an AC magnetic field.

<Nucleic acid amplification reaction>
The nucleic acid amplification reaction is a reaction in which a primer is hybridized to a template nucleic acid containing a target gene sequence and a polynucleotide chain is extended by a nucleic acid polymerase, and the method uses a primer immobilized on magnetic beads. Although it is good, the isothermal reaction is preferable, and the SATIC method described later is more preferable.

The magnetic beads are particulate insoluble carriers having an average particle size of, for example, 10 nm to 100 μm, preferably 30 nm to 10 μm, more preferably 30 nm to 1 μm, and even more preferably 30 nm to 500 nm. .. The material of the beads is not particularly limited as long as it is a magnetic material, and examples thereof include iron oxide such as ferrite and magnetite, and magnetic materials such as chromium oxide and cobalt.

It is sufficient that one or more types of primers are immobilized on the magnetic beads, and in the case of the SATIC method, the first primer and the second primer are immobilized on the same magnetic beads as described later. preferable.

A known method can be adopted for immobilizing the primer on the magnetic beads. For example, a biotin, an amino group, an aldehyde group, an SH group or the like is modified at the 5'end of the primer, and avidin or a derivative thereof (for example, streptavidin, neutralvidin, etc.) is introduced on the surface of the magnetic beads, or an amino group is introduced. , A functional group that reacts with an aldehyde group, an SH group, or the like is introduced, and by reacting both of them, the primer can be immobilized on the magnetic beads.

In addition to the above-mentioned primers, the reaction solution for nucleic acid amplification reaction includes a nucleic acid polymerase that performs a nucleic acid amplification reaction, deoxynucleotide triphosphate (dNTP _S ) that is a substrate for a nucleic acid extension reaction, and, if necessary, a reaction buffer. A surfactant or the like may be included.

The reaction vessel is not particularly limited, but for example, a microtube or a multi-well plate (for example, 96 holes or 384 holes) can be used.

<Nucleic acid amplification reaction device>
The apparatus of the present invention is an apparatus for advancing a nucleic acid amplification reaction in a reaction vessel containing a reaction reagent containing a primer oligonucleotide (hereinafter, simply referred to as a primer) immobilized on magnetic beads, and is an AC power source. Includes a coil that can be connected to the capacitor and a support made of a thermally conductive magnetic material that is installed inside the coil and on which the reaction vessel can be placed.

The coil is not particularly limited as long as it can generate a magnetic field inside, and a normal coil can be used. For example, it can be manufactured by winding a metal wire such as a copper wire coated with polyurethane or enamel or a conductive wire such as carbon fiber around a tubular body. The tubular body is not particularly limited as long as it can conduct magnetism, and may be a metal material such as stainless steel or a plastic material.
When a columnar support is used, the coil can also be manufactured by winding a conductive wire directly around the support.
Further, both ends of the conductive wire constituting the coil may have a connection plug or the like so that they can be connected to an AC power supply.
The coil characteristics (inductance) are preferably 10 to 500 mH, more preferably 50 to 200 mH. The coil characteristics can be adjusted by the number of turns and the diameter of the coil.

The support placed inside the coil can function as a core material (magnetic core) that can enhance the magnetic field inside the coil, and is a material that can be heated to the reaction temperature by a heater, that is, a thermally conductive magnetic material. The material is not particularly limited, and examples thereof include iron, iron oxide such as ferrite, and iron-containing alloys such as stainless steel.

The shape of the support is not particularly limited as long as it can be arranged in the coil and the reaction vessel can be placed, but it is, for example, a columnar shape, preferably (omitted) a columnar shape. Preferably, the upper surface of the support is shaped so that the reaction vessel can be placed, and may be, for example, a flat surface, or when a reaction tube is used as the reaction vessel, one or more recesses into which the reaction tube can be inserted. May have (eg, FIG. 2).
When the above-mentioned tubular body and the support are formed of the same material, the tubular body and the magnetic body may be integrally molded.
On the other hand, since it is sufficient for the support to be placed in the coil during the reaction, the support and the coil are prepared separately, and the support on which the reaction vessel is placed is placed in the coil for a certain period of time during the reaction. The nucleic acid amplification reaction may proceed with.

Further, the placement is not particularly limited as long as the reaction liquid in the reaction vessel is heated by receiving heat from the support.

The support is connected to a heater (heating means) and heated to the reaction temperature. A device including a coil and a support may be placed on a heater having a heating plate such as a hot plate, and the support may be heated by contacting the support with the heating plate.

Hereinafter, the apparatus of the present invention and the nucleic acid amplification reaction using the apparatus will be described with reference to FIGS. 1 and 2.
As shown in FIG. 1 (A), the coil is formed by winding a metal wire (conductive wire) around a tubular body.
Then, by preparing a magnetic material having a cylindrical portion as shown in FIG. 1 (B) and installing it in the coil, a nucleic acid amplification reaction device can be configured (FIG. 1C). As for the coil, it is not necessary to wind the metal wire around the entire tubular body, and it is sufficient that the metal wire is wound so as to cover the outside of the portion where the magnetic material (support) exists in the coil.

FIG. 2 shows one aspect of the usage example.
First, a device 10 composed of a coil formed by winding a metal wire 11 around a tubular body 12 and a support 13 arranged in the coil is placed on a hot plate 14, and a magnetic body (support 13) is placed on the hot plate 14. Keep it heated.
Then, the reaction solution containing the reaction reagent containing the target nucleic acid and the primer and the enzyme immobilized on the magnetic beads is inserted into the recess (hole) provided in the upper part of the magnetic material into the reaction tube 15 containing the reaction solution. Is heated to 37 ° C, and the reaction is started.
In FIG. 2, a magnetic material having a dent was used to insert the reaction into the dent, but such a dent is not essential, and the reaction tube may be laid on the upper surface of the columnar magnetic material to react. good.

Then, an AC current is passed from an AC power supply connected to both ends of the conductive wire of the coil, and an AC magnetic field is applied. As a result, the magnetic field on the support changes, the magnetic beads in the tube are agitated, and the reaction proceeds efficiently.

In the method of the present invention, the reaction vessel containing the reaction reagent containing the primer oligonucleotide immobilized on the magnetic beads is placed in an AC magnetic field, so that the magnetic beads in the reaction vessel are stirred by the AC magnetic field. Since the nucleic acid amplification reaction can be carried out, it is not always necessary to use the above-mentioned device. For example, by placing the reaction vessel in a coil connected to an AC power source, the magnetic beads are agitated by the AC magnetic field, so the support is preferred but not essential to be used to enhance the magnetic field in the coil. .. For example, the reaction can be promoted by placing the coil on the heater, placing the reaction vessel directly on the heater in the coil, and passing an alternating current through the coil.

In the method of the present invention, the strength of the AC voltage (Vp-p) is preferably 10 to 50 V, more preferably 10 to 30 V. The frequency of the alternating current is preferably 1 to 50 Hz, more preferably 2 to 20 Hz. By adjusting to this range, the nucleic acid amplification reaction is not inhibited and the detection time can be shortened, which is particularly preferable.

Hereinafter, the SATIC method, which is a preferred embodiment of the nucleic acid amplification reaction, will be described.
The SATIC method uses a single-stranded circular DNA and a primer disclosed in Patent Document 1 to form a tripartite complex of a target (template) nucleic acid, a single-stranded circular DNA and a primer, and at an isothermal temperature (37 ° C). It is a method for amplifying nucleic acid, and preferably means a method using the first and second single-stranded circular DNAs and the first and second primers described below.

In the preferred SATIC mode,
(I) A sequence of 10 to 30 bases complementary to the first site of the target nucleic acid,
The 7-8 base first primer binding sequence adjacent to the 5'side of the sequence and
The second single-stranded circular DNA binding sequence and
First single-stranded circular DNA containing
(Ii) A sequence of 8 to 15 bases complementary to the second site adjacent to the 3'side of the first site of the target nucleic acid,
A sequence of 7 to 8 bases adjacent to the 3'side of the sequence and complementary to the first primer binding site of the first single-stranded circular DNA.
A first oligonucleotide primer containing
(Iii) The same sequence as the second single-stranded circular DNA binding sequence of the first single-stranded circular DNA,
The second primer binding sequence adjacent to the 5'side of the sequence and
2nd single-stranded circular DNA, including
(Iv) With the same sequence as the site adjacent to the 5'side of the 2nd single-stranded circular DNA binding sequence of the 1st single-stranded circular DNA.
A sequence complementary to the second primer binding sequence of the second single-stranded circular DNA adjacent to the 3'side of the sequence,
With a second oligonucleotide primer, including
Is used,
The first oligonucleotide primer is attached to a magnetic bead via its 5'end.
The second oligonucleotide primer is bound to the magnetic bead to which the first oligonucleotide primer is bound via its 5'end.

<1st single-stranded circular DNA>
The first single-stranded circular DNA contains a sequence of 10 to 30 bases complementary to the first site of the target nucleic acid.
A primer binding sequence of 7 to 8 bases adjacent to the 5'side of the sequence and a primer binding sequence of 7 to 8 bases.
The second single-stranded circular DNA binding sequence and
including.

The SATIC method will be described with reference to FIG. However, in the case of single-stranded circular DNA, it is 5'→ 3'clockwise. Further, in FIG. 3, magnetic beads are not shown for convenience.
The first single-stranded circular DNA 20 contains a sequence 201 complementary to the first site 211 of the target nucleic acid 21, a primer-binding sequence 202 linked to the 5'side thereof, and a second single-stranded circular DNA-binding sequence 203. ..
The length of sequence 201 is usually 10 to 30 bases, preferably 15 to 25 bases, and the GC content is preferably 30 to 70%. The length of the sequence 202 is 7 or 8 bases, and the sequence is not particularly limited, but the GC content is preferably 30 to 70%. The total length of the first single-stranded circular DNA 20 is preferably 35 to 100 bases.

The first single-stranded circular DNA 20 can be obtained by circularizing the single-stranded DNA (ssDNA). Circulation of single-stranded DNA can be performed by any means, for example, CircLigase®, CircLigaseII®, ssDNALigase (Epicentre), ThermoPhageligase® single-stranded. It can be performed using DNA (Prokzyme).

<First oligonucleotide primer>
The first oligonucleotide primer 22 is linked to the sequence 221 of 8 to 15 bases complementary to the second site 212 adjacent to the 3'side of the first site 211 and the 3'side thereof of the target nucleic acid 21. It also contains a 7-8 base sequence 222 complementary to the primer binding site 202 of the first single-stranded circular DNA 20.

The first oligonucleotide primer 22 is attached to the magnetic beads via its 5'end.
Examples of the 5'end of the first oligonucleotide primer 22 include those modified with a biotin, an amino group, an aldehyde group, or an SH group. Examples of the magnetic beads include magnetic beads on which avidin (including derivatives thereof, that is, streptavidin, neutralvidin, etc.) are immobilized, and functional groups that react with amino groups, aldehyde groups, or SH groups. Examples thereof include magnetic beads surface-treated with a silane coupling agent having. Immobilization may follow a conventional method.

The magnetic beads immobilize the first oligonucleotide primer 22 and the second oligonucleotide primer 25, which will be described later, in the vicinity thereof. When both are present in the vicinity, the stage where the first amplification product 23 is amplified from the first oligonucleotide primer 22 and the stage where the second amplification product 26 is amplified from the second oligonucleotide primer 25 are efficiently performed. This is done and as a result a significant improvement in detection sensitivity is achieved.

The preferred shape of the magnetic beads is a particulate insoluble carrier, the average particle size thereof being, for example, 10 nm to 100 μm, preferably 30 nm to 10 μm, more preferably 30 nm to 1 μm, still more preferably 30 nm to 30 nm. It is 500 nm. The material of the magnetic beads is, for example, a magnetic material such as iron oxide such as ferrite or magnetite, chromium oxide, or cobalt.

<Second single-stranded circular DNA>
The second single-stranded circular DNA 24 has the same sequence 241 as the second single-stranded circular DNA binding sequence 203 of the first single-stranded circular DNA 20.
The second primer binding sequence 242 adjacent to the 5'side of the sequence and
including.
The length of sequence 203 is usually 10 to 30 bases, preferably 15 to 25 bases, and the GC content is preferably 30 to 70%. The length of the sequence 242 is 7 or 8 bases, and the sequence is not particularly limited, but the GC content is preferably 30 to 70%. The length of the sequence 242 is 7 or 8 bases, and the sequence is not particularly limited, but the GC content is preferably 30 to 70%. The total length of the second single-stranded circular DNA 24 is preferably 35 to 100 bases. The second single-stranded circular DNA 24 can be obtained by circularizing the single-stranded DNA (ssDNA) by the method described above.

The second single-stranded circular DNA 24 preferably contains a sequence complementary to the detection reagent binding sequence.
Examples of the detection reagent binding sequence include a guanine quadruple chain forming sequence.
The guanine quadruple chain forming sequence includes a sequence as described in Nat Rev Drug Discov. 2011 Apr; 10 (4): 261-275., G ₃ N _1-10 G ₃ N _1-10 G. _{It is represented by 3} N _1-10 G ₃ , and specifically, the sequence described in Patent Document 1 and the like are exemplified. Therefore, as the sequence 243 complementary to the guanine quadruple chain forming sequence, C ₃ N _1-10 C ₃ N _1-10 C ₃ N _1-10 C ₃ is exemplified. That is, it is a sequence in which three consecutive Cs are repeated four times with a sequence consisting of 1 to 10 (preferably 1 to 5) arbitrary bases (N = A, T, G or C) as a spacer. ..

<Second oligonucleotide primer>
The second oligonucleotide primer 25 has the same sequence 251 as the site 204 adjacent to the 5'side of the second single-stranded circular DNA binding sequence 203 of the first single-stranded circular DNA 20 (preferably a sequence of 8 to 15 bases). When,
A sequence 252 (preferably a sequence of 7 to 8 bases) complementary to the second primer binding sequence 242 of the second single-stranded circular DNA 24 adjacent to the 3'side of the sequence.
including.

The second oligonucleotide primer 25 is bound to the magnetic beads to which the first oligonucleotide primer 22 is bound via its 5'end.
That is, the 5'end of the first oligonucleotide primer 22 is modified with biotin or the like, and is bound to magnetic beads on which avidin or the like is immobilized via the biotin or the like, and the second oligonucleotide is used. It is preferable that the 5'end of the nucleotide primer 25 is modified with biotin or the like and is bound to the magnetic beads to which the first oligonucleotide primer 22 is bound via the biotin or the like.

The quantitative ratio of the first oligonucleotide primer 22 and the second oligonucleotide primer 25 immobilized on the magnetic beads is a molar ratio, preferably 1:10 to 1: 100, and more preferably 1:10 to 1. It is: 30, and more preferably 1:10 to 1:25.

The concentration of the first oligonucleotide primer 22 during the amplification reaction (during use) is preferably 0.0025 pmol / μL or more, more preferably 0.005 pmol / μL or more, while preferably 0.04 pmol / μL or less, more preferably. Is 0.02 pmol / μL or less.
The concentration of the second oligonucleotide primer 25 during the amplification reaction (during use) is preferably 0.0125 pmol / μL or more, more preferably 0.025 pmol / μL or more, while 0.8 pmol / μL or less, more preferably. Is less than 0.4 pmol / μL.

The amount ratio of the first single-stranded circular DNA 20 to the second single-stranded circular DNA 24 during the amplification reaction (during use) is a molar ratio, preferably 1: 2 to 1: 1000, more preferably 1: 3 to 1. : 500, more preferably 1: 4 to 1: 400.

The lower limit of the concentration of the first single-stranded circular DNA 20 during the amplification reaction (during use) is, for example, 0.1 nM or more, 1 nM or more, 10 nM or more, 50 nM or more, while the upper limit is, for example, 500 nM or less, 200 nM or less. Is.
The lower limit of the concentration of the second single-stranded circular DNA 24 during the amplification reaction (during use) is, for example, 20 nM or more, 40 nM or more, 100 nM or more, 200 nM or more, while the upper limit is, for example, 1000 nM or less, 500 nM or less. be.

<Amplification method>
As shown in FIG. 3, first, the target nucleic acid 21 is hybridized with the first single-stranded circular DNA 20 and the primer 22 to form a three-way complex, and then the target nucleic acid is formed by the rolling circle amplification (RCA) method. A nucleic acid amplification reaction based on 21 is performed.

Those skilled in the art can examine the combination of the single-stranded circular DNA 20, the target nucleic acid 21, and the primer and appropriately set the hybridization conditions.

The RCA method is described in Lizardi et al., Nature Genet. 19: 225-232 (1998); US Pat. Nos. 5,854,033 and 6,143,495; PCT application WO 97/19193 and the like. .. The RCA method can be carried out by using, for example, a strand-substituted DNA polymerase such as phi29 DNA polymerase as described above.

The DNA elongation reaction by RCA is carried out, for example, at a constant temperature in the range of 25 ° C to 65 ° C. The reaction temperature is appropriately set by a usual procedure based on the optimum temperature of the enzyme and the denaturation temperature based on the primer chain length (the temperature range in which the primer binds (anneals) / dissociates to DNA). Furthermore, it is also carried out at a constant relatively low temperature. For example, when phi29 DNA polymerase is used as a strand-substituted DNA synthase, the reaction is preferably at 25 ° C to 42 ° C, more preferably at about 30 to 37 ° C.

RCA amplifies the first amplification product 23 from primer 22 along the first single-stranded circular DNA 20 in a manner dependent on the target nucleic acid 21.

Since the amplification product 23 contains the sequence 233 complementary to the second single-stranded circular DNA binding sequence 203 of the first single-stranded circular DNA 20, the second single-stranded circular DNA 24 containing the same sequence 241 as this sequence 203. Hybridizes to sequence 233 of the first amplification product 23 via sequence 241.
The second oligonucleotide primer 25 hybridizes to the complex of the first amplification product 23 and the second single-stranded circular DNA 24 thus formed to form a tripartite complex.

That is, since the second oligonucleotide primer 25 has the same sequence 251 as the site 204 adjacent to the 5'side of the second single-stranded circular DNA-binding sequence 203 of the first single-stranded circular DNA 20, the first amplification product. It hybridizes to region 234 complementary to site 204 of the first single-stranded circular DNA 20 of 23 via sequence 251.

Further, since the second oligonucleotide primer 25 has a sequence 252 complementary to the second primer binding sequence 242 of the second single-stranded circular DNA 24 on the 3'side of the sequence 251, the second single-stranded circular DNA 24 has a sequence 252. Also hybridizes via sequence 252.

The second amplification product 26 is amplified by RCA from the tripartite complex of the first amplification product 23, the second single-stranded circular DNA 24, and the second oligonucleotide primer 25. The second amplification product 26 contains, for example, sequence 261 containing a guanine quadruple chain and is detected by the guanine quadruple chain detection reagent 262. The second single-stranded circular DNA 24 hybridizes to each of the regions 231 contained in the first amplification product 23, and an RCA reaction occurs.

By immobilizing the first oligonucleotide primer 22 and the second oligonucleotide primer 25 on the same magnetic beads, the first oligonucleotide primer 22 amplifies the first amplification product 23, and the second oligonucleotide primer. Since the step of amplifying the second amplification product 26 from 25 is performed in the vicinity, a significant improvement in detection sensitivity can be achieved.

Since the second single-stranded circular DNA 24 contains a sequence complementary to the detection reagent binding sequence, the second amplification product 26 obtained by RCA contains the detection reagent binding sequence. When the detection reagent binding sequence is a guanine quadruple chain forming sequence or the like, the amplification product obtained by RCA can be detected using a guanine quadruple chain binding reagent. Examples of the guanine quadruplex binding reagent include thioflavin T (ThT) disclosed in Patent Document 1 or a derivative thereof.

Further, a ThT derivative (ThT-PEG) containing the following PEG chain can also be used.
Here, R ¹ is an amino group, a hydroxyl group, an alkyl group, or a carboxyl group, and n is an integer of 4 to 50, preferably an integer of 5 to 20, and more preferably an integer of 8 to 15. , Particularly preferably 11. As ThT-PEG, ^{a compound in which R 1} is an amino group is more preferable. This compound is described as ThT-P42 in JP-A-2018-154564.

A ThT derivative (ThT-PEG-ThT) in which the following ThTs are linked by a PEG chain can also be used.
Here, n is an integer of 4 to 50, preferably an integer of 5 to 20, more preferably an integer of 8 to 15, and particularly preferably 11. Further, the PEG chain of ThT-PEG-ThT may be replaced with a spermine linker. This compound can be synthesized by the method described in the synthesis example described later.

For detection, for example, a ThT derivative is brought into contact with a sample containing an RCA product, and the ThT derivative bound to the guanine quadruplex structure is detected based on the fluorescence emitted by the ThT derivative. The heavy chain structure can be detected. The ThT derivative is preferably added to the reaction solution in advance.

When ThT-PEG or ThT-PEG-ThT is used as the guanine quadruplex binding reagent, specific aggregation occurs when ThT-PEG or ThT-PEG-ThT binds to the RCA product. By visually observing, the presence or absence of RCA amplification can be easily confirmed without using a fluorescence detection device. In addition, ThT-PEG and ThT-PEG-ThT may be used at the same time. The concentration of ThT-PEG or ThT-PEG-ThT is, for example, 5 to 50 μM, preferably 5 to 20 μM.

The reaction reagent containing the first primer and the magnetic beads on which the second primer was immobilized, the first and second single-stranded circular DNA, the nucleic acid polymerase, the nucleic acid substrate, the reaction buffer, etc. was placed in the reaction vessel. The nucleic acid-containing sample to be detected is added here.
Then, the SATIC reaction is started by placing this reaction vessel on the support of the apparatus of the present invention preheated to the reaction temperature.
Then, by applying an alternating current to the coil to generate an alternating magnetic field on the support, the magnetic beads in the reaction vessel are efficiently agitated, and the SATIC reaction proceeds efficiently.
Aggregation of magnetic beads based on the formation of nucleic acid amplification reactants is observed about 20 to 30 minutes after the start of the reaction, whereby the presence of the target nucleic acid can be visually confirmed.

Hereinafter, the present invention will be specifically described with reference to examples, but the present invention is not limited to the following embodiments.

SATIC method
1-1) Preparation of primer-immobilized nanoparticles (magnetic beads)
a) Preparation of biotinylated primer _{Dissolve biotinylated primer (P 1} ) and biotinylated primer (P ₂ ) in 1 × φ29 DNA polymerase reaction buffer, and P ₁ (1 μM), P ₂ (20 μM) P ₁ -A mixed solution of _{P 2 was prepared.}

b) Preparation and cleaning of nanoparticles before use
FG beads (FG beads streptavidin Tamagawa Seiki) were well vortexed, stirred until uniform particles, scooped 4 μL and placed in a 1.5 mL Eppendorf tube.
The tube was placed in a magnetic rack (vertical tube with magnet) and the magnetic beads and supernatant were separated (5 minutes). The supernatant was withdrawn, and 40 μL of 1 × φ29 DNA polymerase reaction buffer was added for pipetting.
The above operation was performed twice more.

c) Primer was immobilized on nanoparticles and washed. The tube was set in a magnetic rack (tube with magnet), and the magnetic beads and supernatant were separated (5 minutes). The supernatant was removed.
_{4 μL of the above P 1} and P ₂ mixed solution was added to the washed FG beads.
Incubated at 25 ° C for 30 minutes. At that time, vortex was performed every 5 minutes.
The tube was placed in a magnetic rack (vertical tube with magnet) and the magnetic beads and supernatant were separated (5 minutes). The supernatant was withdrawn, and 40 μL of 1 × φ29 DNA polymerase reaction buffer was added for pipetting.
The above operation was performed twice more.
The tube was placed in a magnetic rack (vertical tube with magnet) and the magnetic beads and supernatant were separated (5 minutes). The supernatant was withdrawn, 40 μL of water was added, and pipetting was performed.
The above operation was performed twice more. Refrigerated until used.

1-2) Reaction using primer-immobilized nanoparticles
2 μL of P ₁ and P ₂ immobilized FG beads were scooped up and added to a 0.5 mL Eppendorf tube. The tube was placed in a magnetic rack (vertical tube with magnet) and the magnetic beads and supernatant were separated (1 minute). The supernatant was removed.

45 μL of the SATIC reagent shown in Table 1 was added, and 5 μL of the target RNA (2 copies / μL) was further added, and the reaction was carried out on a hot plate at 37 ° C. Two reaction sets were prepared, one of which was stirred with a stirrer (2 Hz) and the other of which was allowed to stand.

1-3) Visual observation The changes in nanoparticles were visually observed. As a result, when the reaction was carried out with stirring, the nanoparticles based on the amplified product of the SATIC reaction were settled in about 15 minutes, but when the reaction was carried out in a stationary state, about 55 minutes had passed. Finally, the precipitation of nanoparticles was seen.
From this, it was found that the detection time can be significantly shortened by stirring.

The sequences of the single-stranded circular DNA, the primer and the template RNA are as follows.
cT1: 67mer (SEQ ID NO: 1)
CCCCAAAAAGGAGCTTGAGGTTCTCCTTTAAAAAGAAGCTGTTGTATTGTTGTCGAAGAAGAAAAGT
cT2: 62mer (SEQ ID NO: 2)
CCCAACCCTACCCACCCTCAAGAAAAAAAAGTGATAATTGTTGGAAGAAGAAAAAAAATT
P1: 18mer (5'biotin) (SEQ ID NO: 3)
GGATCAGGCCATTTTTGG
P2: 18mer (5'biotin) (SEQ ID NO: 4)
GAAGCTGTTGTTATCACT
40mer target RNA: 40mer (SEQ ID NO: 5)
GGGUUGGCCAAAGGAGAACCUCAAGCUCCUGGCCUGAUCC

<Preparation of reaction device and SATIC method using the device>
Next, in order to automatically perform stirring by applying an AC magnetic field, a device for SATIC reaction was prepared (Fig. 2).
The coil was made by winding a polyurethane wire with a diameter of 0.29 mm 1200 times around a stainless tubular member with a diameter of 50 mm. The coil characteristics are approximately 100mH (100Hz).
In order to increase the magnetic force of the electromagnet, a stainless steel column was installed as a pedestal (reaction tube support) of the reaction field in the stainless tubular member.
Then, this was placed on a hot plate, and the hot plate was heated to 37 ° C.
The coil was connected to an AC power supply and an AC voltage of 20Vp-p (2Hz) was applied.

The reaction solution used is as shown in Table 1, and after adding the target RNA and accommodating a total of 50 μL in the reaction tube, the reaction tube was preheated to 37 ° C. to generate an AC magnetic field. The reaction was carried out by placing it on a pedestal (support) in stainless steel and stirring the magnetic beads with an AC magnetic field.
When the changes in the nanobeads in the reaction tube were observed over time, it was found that the beads settled in about 15 minutes, and the target amplification by the SATIC reaction occurred in a short time.

<Examination of the ease of forming aggregates depending on the given frequency>
In the same manner as above _{, add 45 μL of the SATIC reagent shown in Table 1 containing P 1} and P ₂ immobilized FG beads to the reaction tube, and add 5 μL of the target RNA (CIDEC: 40 mer and full-length RNA 2 copies / μL). Then, it was preheated to 37 ° C. and placed on a pedestal (support) in the stainless steel in which an AC magnetic field was generated, and the reaction was carried out while stirring the magnetic beads with the AC magnetic field. The frequency of the alternating current at this time was 2, 20, 200, or 2 kHz.

As a result of visually observing the changes in the nanoparticles in the reaction tube reacted in the AC magnetic field of each frequency over time, as shown in Table 2, when no AC current is passed through the coil, aggregates are finally seen in 55 minutes. However, it was found that aggregates were formed in a short time when an alternating current of 2 to 20 Hz was applied to the coil.

[Composite example]
Synthesis of ThT derivatives ThT-PEG-ThT was synthesized according to the following scheme. References (Kataoka, Y .; Fujita, H .; Afanaseva, A .; Nagao, C .; Mizuguchi, K .; Kasahara, Y .; Obika, S .; Kuwahara, M) for the synthesis method of ThT-AE. .Biochemistry, 2019, 58, 493.).

Scheme. Synthesis of ThT derivatives

[Synthesis of compound T1]
_{Add dry Dichloromethane (CH 2} Cl ₂ ) (0.30 mL) to ThT-AE (32 mg, 0.10 mmol), stir, add Triethylamine (TEA) (85 μL, 0.61 mmol), and then Succinic anhydride (11). mg, 0.11 mmol) was added, and the mixture was stirred at room temperature for 30 minutes. After distilling off the reaction mixture under reduced pressure, the residue was suspended in water and washed with _{CH 2} Cl _2. Compound T1 was quantitatively obtained by distilling off the aqueous layer under reduced pressure. ESI-MS (positive ion mode) m / z, found = 412.15, calculated for [M ⁺ ] = 412.17.

[Synthesis of ThT-PEG-ThT]
Add dry DMF (0.3 mL) to ThT-PEG (10 mg, 10 μmol) (ThT-P42 of JP-A-2018-154564) and stir, and then HOBt · H ₂ O (4.2 mg, 26 μmol). , PyBOP (14 mg, 26 μmol) was added, followed by DIPEA (14 μL, 80 μmol). Compound T1 (5.6 mg, 13 μmol) dissolved in dry DMF (0.2 mL) was added thereto, and the mixture was stirred at room temperature for 5 hours. After distilling off the reaction mixture under reduced pressure, the residue was _{dissolved in CH 2} Cl ₂ and washed with water. The organic layer was distilled off under reduced pressure, and the mixture was subjected to solid-liquid extraction with diethyl ether and then purified by HPLC to obtain ThT-PEG-ThT.
Yield: 0.82 mg Yield: 6.1%

¹ H NMR (500 MHz, Deuterium oxide) δ 8.01 (2H, d) 7.97 (2H, s) 7.75 (6H, t) 6.95 (4H, d) 5.12 (4H, t) 3.86 (4H, s) 3.68 (44H) , q) 3.61 (4H, q) 3.42-3.35 (4H, m) 3.10 (12H, s) 2.65 (4H, t) 2.57 (3H, s) 2.54 (3H, t); ESI-MS (positive ion mode) m / z, found = 1348.51, calculated for [H ⁺ ] = 1348.67.

Device 10 ... Device, 11 ... Metal wire, 12 ... Cylindrical body, 13 ... Support, 14 ... Hot plate

20 ... Single-stranded circular DNA, 21 ... Target nucleic acid, 22 ... First oligonucleotide primer, 23 ... First amplification product, 24 ... Second single-stranded circular DNA, 25. Second oligonucleotide primer, 26 ... second amplification product, 201 ... sequence complementary to the first site, 202 ... first primer binding sequence, 203 ... second single strand Circular DNA binding sequence, 204 ... site adjacent to the 5'side of

sequence

203, 211 ... first site, 212 ... second site, 221 ... complementary to the second site Sequence 222 ... Sequence complementary to the first primer binding site 231 ... Complementary region of sequence 203 232 ... Region complementary to site 204 233 ... Sequence complementary to sequence 203 , 241 ... the same sequence as the second single-stranded circular DNA-binding

sequence

203, 242 ... the second primer-binding sequence, 243 ... a sequence complementary to the guanine quadruplex forming sequence, 251 ... Same sequence as

site

204, 252 ... sequence complementary to second primer binding sequence 242 of second single-stranded circular DNA, 261 ... sequence containing guanine quadruplex, 262 ... guanine quadruplex Chain detection reagent

Claims

A device for advancing a nucleic acid amplification reaction in a reaction vessel containing a reaction reagent containing a primer oligonucleotide immobilized on magnetic beads.
A coil that can be connected to an AC power supply, and a support made of a thermally conductive magnetic material that is installed inside the coil and on which the reaction vessel can be placed.
Including equipment.
The device of claim 1, wherein the support has one or more recesses into which the reaction vessel can be inserted.
The apparatus according to claim 1 or 2, wherein the magnetic material is an iron-containing alloy.
The device according to any one of claims 1 to 3, further comprising a heater for heating the support.
The apparatus according to any one of claims 1 to 4, wherein the nucleic acid amplification reaction is a SATIC reaction.
A method of advancing a nucleic acid amplification reaction in a reaction vessel containing a reaction reagent containing a primer oligonucleotide immobilized on magnetic beads. The reaction vessel is placed in an AC magnetic field, and the magnetic beads in the reaction vessel are placed in an AC magnetic field. A method characterized by carrying out a nucleic acid amplification reaction while stirring with a magnetic acid.
The method of claim 6, wherein the AC magnetic field is a magnetic field in a coil connected to an AC power source.
The method according to claim 6 or 7, wherein the AC frequency is 1 to 50 Hz.
The method according to any one of claims 6 to 8, wherein the AC voltage is 10 to 50 V.
The method according to any one of claims 6 to 9, wherein the reaction vessel is placed on a support of the apparatus according to any one of claims 1 to 4 to carry out a reaction.
The method according to any one of claims 6 to 10, wherein the nucleic acid amplification reaction is a SATIC reaction.