WO2022012636A1

WO2022012636A1 - Genetically modified non-human animal with human or chimeric il17a and/or il17f

Info

Publication number: WO2022012636A1
Application number: PCT/CN2021/106559
Authority: WO
Inventors: Yuelei SHEN; Meiling Zhang; Rui Huang; yang BAI; Chaoshe GUO; Lei Zhao
Original assignee: Biocytogen Pharmaceuticals (Beijing) Co., Ltd.
Priority date: 2020-07-15
Filing date: 2021-07-15
Publication date: 2022-01-20
Also published as: CN113603765A; CN113603765B

Abstract

Provided are genetically modified non-human animals that express a human or chimeric (e.g., humanized) IL17A and/or IL17F, and methods of use thereof.

Description

GENETICALLY MODIFIED NON-HUMAN ANIMAL WITH HUMAN OR CHIMERIC IL17A AND/OR IL17F

CLAIM OF PRIORITY

This application claims the benefit of Chinese Patent Application No. CN202010681755.8, filed on July 15, 2020 and Chinese Patent Application No. CN202011586262.2, filed on December 28, 2020. The entire contents of the foregoing applications are incorporated herein by reference.

TECHNICAL FIELD

This disclosure relates to genetically modified animal expressing human or chimeric (e.g., humanized) IL17A and/or IL17F, and methods of use thereof.

BACKGROUND

The immune system has developed multiple mechanisms to prevent deleterious activation of immune cells. One such mechanism is the intricate balance between positive and negative costimulatory signals delivered to immune cells. Targeting the stimulatory or inhibitory pathways for the immune system is considered to be a potential approach for the treatment of various diseases, e.g., cancers and autoimmune diseases.

The traditional drug research and development for these stimulatory or inhibitory pathways typically use in vitro screening approaches. However, these screening approaches cannot provide the body environment (such as tumor microenvironment, stromal cells, extracellular matrix components and immune cell interaction, etc. ) , resulting in a higher rate of failure in drug development. In addition, in view of the differences between humans and animals, the test results obtained from the use of conventional experimental animals for in vivo pharmacological test may not reflect the real disease state and the interaction at the targeting sites, resulting in that the results in many clinical trials are significantly different from the animal experimental results. Therefore, the development of humanized animal models that are suitable for human antibody screening and evaluation will significantly improve the efficiency of new drug development and reduce the cost for drug research and development.

SUMMARY

This disclosure is related to an animal model with human IL17A or chimeric IL17A. The animal model can express human IL17A or chimeric IL17A (e.g., humanized IL17A) protein in its body. It can be used in the studies on the function of IL17A gene, and can be used in the screening and evaluation of anti-human IL17A antibodies. This disclosure is also related to an animal model with human IL17F or chimeric IL17F. The animal model can express human IL17F or chimeric IL17F (e.g., humanized IL17F) protein in its body. It can be used in the studies on the function of IL17F gene, and can be used in the screening and evaluation of anti-human IL17F antibodies. In some embodiments, the disclosure is related to IL17F/IL17A double gene humanized mice.

In addition, the animal models prepared by the methods described herein can be used in drug screening, pharmacodynamics studies, treatments for immune-related diseases (e.g., autoimmune disorders) , and cancer therapy for human IL17A and/or IL17F target sites; they can also be used to facilitate the development and design of new drugs, and save time and cost. In summary, this disclosure provides a powerful tool for studying the function of IL17A and/or IL17F protein and a platform for screening drugs, e.g., antibodies, against autoimmune disorders (e.g., psoriasis) .

In one aspect, the disclosure is related to a genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric interleukin 17F (IL17F) .

In some embodiments, the sequence encoding the human or chimeric IL17F is operably linked to an endogenous regulatory element at the endogenous IL17F gene locus in the at least one chromosome.

In some embodiments, the sequence encoding a human or chimeric IL17F is operably linked to an endogenous 5’ untranslated region (5’ UTR) and/or an endogenous 3’ untranslated region (3'-UTR) .

In some embodiments, the sequence encoding a human or chimeric IL17F comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human IL17F (SEQ ID NO: 8) .

In some embodiments, the sequence encoding a human or chimeric IL17F comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 31-163 of human IL17F (SEQ ID NO: 8) .

In some embodiments, the sequence encoding a human or chimeric IL17F comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 16.

In some embodiments, the sequence comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 12, 13, 14, 15, or 56.

In some embodiments, the animal is a mammal, e.g., a monkey, a rodent, or a mouse. In some embodiments, the mammal is a mouse.

In some embodiments, the animal does not express endogenous IL17F or expresses a decreased level of endogenous IL17F as compared to that of an animal without genetic modification.

In some embodiments, the animal has one or more cells expressing human or chimeric IL17F.

In some embodiments, the expressed human or chimeric IL17F can form a homodimer that can interact with an IL17 receptor complex (e.g., formed by interleukin 17 Receptor C (IL17RC) and interleukin 17 Receptor A (IL17RA) ) . In some embodiments, the expressed human or chimeric IL17F can bind to human interleukin 17A (IL17A) , forming a heterodimer that can interact with an IL17 receptor complex (e.g., formed by IL17RC and IL17RA) . In some embodiments, the expressed human or chimeric IL17F can bind to endogenous IL17A, forming a heterodimer that can interact with an IL17 receptor complex (e.g., formed by IL17RC and IL17RA) .

In some embodiments, the genome of the animal comprises a replacement of a sequence encoding a region of endogenous IL17F with a sequence encoding a corresponding region of human IL17F at an endogenous IL17F gene locus.

In some embodiments, the sequence encoding the corresponding region of human IL17F is operably linked to an endogenous regulatory element at the endogenous IL17F locus.

In some embodiments, the animal does not express endogenous IL17F, and the animal has one or more cells expressing human or chimeric IL17F.

In some embodiments, the replaced sequence encoding a region of endogenous IL17F comprises exon 1, exon 2, and/or exon 3, or a part thereof, of endogenous IL17F gene. In some embodiments, the animal is a mouse, and the replaced sequence starts within exon 2 and ends within exon 3 of endogenous mouse IL17F gene.

In some embodiments, the replaced sequence encodes an endogenous IL17F without an endogenous signal peptide sequence.

In some embodiments, the animal is heterozygous with respect to the replacement at the endogenous IL17F gene locus. In some embodiments, the animal is homozygous with respect to the replacement at the endogenous IL17F gene locus.

In one aspect, the disclosure is related to a method for making a genetically-modified, non-human animal, comprising: replacing in at least one cell of the animal, at an endogenous IL17F gene locus, a sequence encoding a region of an endogenous IL17F with a sequence encoding a corresponding region of human IL17F.

In some embodiments, the sequence encoding the corresponding region of human IL17F comprises exon 1, exon 2, and/or exon 3, or a part thereof, of a human IL17F gene.

In some embodiments, the sequence encoding the corresponding region of human IL17F encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 31-163 of SEQ ID NO: 8.

In some embodiments, the endogenous IL17F locus comprises exon 1, exon 2, and/or exon 3, or a part thereof, of the endogenous IL17F gene.

In some embodiments, the animal is a mouse, and the sequence encoding a region of an endogenous IL17F starts within exon 2 and ends within exon 3 of the endogenous mouse IL17F gene.

In one aspect, the disclosure is related to a non-human animal comprising at least one cell comprising a nucleotide sequence encoding a human or chimeric IL17F polypeptide, in some embodiments, the human or chimeric IL17F polypeptide comprises at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, or at least 130 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human IL17F, in some embodiments, the animal expresses the human or chimeric IL17F.

In some embodiments, the human or chimeric IL17F polypeptide comprises an amino acid sequence that is at least 90%, 95%, or 99%identical to amino acids 31-163 of SEQ ID NO: 8.

In some embodiments, the nucleotide sequence is operably linked to an endogenous IL17F regulatory element of the animal.

In some embodiments, the nucleotide sequence is integrated to an endogenous IL17F gene locus of the animal.

In some embodiments, the chimeric IL17F polypeptide has at least one mouse IL17F polypeptide activity and/or at least one human IL17F polypeptide activity.

In some embodiments, the animal in its genome comprises, preferably from 5’ to 3’: a mouse 5’ UTR, a sequence encoding the signal peptide of endogenous IL17F, a sequence encoding the mature chain (without signal peptide) of human IL17F, and a mouse 3’ UTR.

In one aspect, the disclosure is related to a method of making a genetically-modified non-human animal cell that expresses a human or chimeric IL17F, the method comprising: replacing at an endogenous IL17F gene locus, a nucleotide sequence encoding a region of endogenous IL17F with a nucleotide sequence encoding a corresponding region of human IL17F, thereby generating a genetically-modified non-human animal cell that includes a nucleotide sequence that encodes the human or chimeric IL17F, in some embodiments, the non-human animal cell expresses the human or chimeric IL17F.

In some embodiments, the nucleotide sequence encoding the human or chimeric IL17F is operably linked to an endogenous IL17F regulatory region, e.g., promoter.

In some embodiments, the animal further comprises a sequence encoding an additional human or chimeric protein. In some embodiments, the additional human or chimeric protein is interleukin 17A (IL17A) , interleukin 17 Receptor C (IL17RC) , interleukin 17 Receptor A (IL17RA) , programmed cell death protein 1 (PD-1) , cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) , Lymphocyte Activating 3 (LAG-3) , IL15 receptor, B And T Lymphocyte Associated (BTLA) , Programmed Cell Death 1 Ligand 1 (PD-L1) , CD3, CD27, CD28, CD47, CD137, CD154, T-Cell Immunoreceptor With Ig And ITIM Domains (TIGIT) , T-cell Immunoglobulin and Mucin-Domain Containing-3 (TIM-3) , Glucocorticoid-Induced TNFR-Related Protein (GITR) , Signal regulatory protein α (SIRPα) or TNF Receptor Superfamily Member 4 (OX40) . In some embodiments, the additional human or chimeric protein is IL17A and the animal expresses the human or chimeric IL17A.

In one aspect, the disclosure is related to a genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric interleukin 17A (IL17A) .

In some embodiments, the sequence encoding the human or chimeric IL17A is operably linked to an endogenous regulatory element at the endogenous IL17A gene locus in the at least one chromosome.

In some embodiments, the sequence encoding a human or chimeric IL17A is operably linked to an endogenous 5’ untranslated region (5'-UTR) and/or an endogenous 3’ untranslated region (3’ UTR) .

In some embodiments, the sequence encoding a human or chimeric IL17A comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human IL17A (SEQ ID NO: 2) .

In some embodiments, the sequence comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 6.

In some embodiments, the animal does not express endogenous IL17A or expresses a decreased level of endogenous IL17A as compared to that of an animal without genetic modification.

In some embodiments, the animal has one or more cells expressing human or chimeric IL17A.

In some embodiments, the expressed human or chimeric IL17A can form a homodimer that can interact with an IL17 receptor complex (e.g., formed by interleukin 17 Receptor C (IL17RC) and interleukin 17 Receptor A (IL17RA) ) . In some embodiments, the expressed human or chimeric IL17A can bind to human interleukin 17F (IL17F) , forming a heterodimer that can interact with an IL17 receptor complex (e.g., formed by IL17RC and IL17RA) . In some embodiments, the expressed human or chimeric IL17A can bind to endogenous IL17F, forming a heterodimer that can interact with an IL17 receptor complex (e.g., formed by IL17RC and IL17RA) .

In one aspect, the disclosure is related to a genetically-modified, non-human animal, in some embodiments, the genome of the animal comprises a replacement of a sequence encoding a region of endogenous IL17A with a sequence encoding a corresponding region of human IL17A at an endogenous IL17A gene locus.

In some embodiments, the sequence encoding the corresponding region of human IL17A is operably linked to an endogenous regulatory element at the endogenous IL17A locus.

In some embodiments, the animal does not express endogenous IL17A, and the animal has one or more cells expressing human or chimeric IL17A.

In some embodiments, the replaced sequence encoding a region of endogenous IL17A comprises exon 1, exon 2, and/or exon 3, or a part thereof, of endogenous IL17A gene. In some embodiments, the animal is a mouse, and the replaced sequence starts within exon 1 (e.g., from the start codon ATG) and ends within exon 3 (e.g., to the stop codon TAA) of endogenous mouse IL17A gene.

In some embodiments, the animal is heterozygous with respect to the replacement at the endogenous IL17A gene locus. In some embodiments, the animal is homozygous with respect to the replacement at the endogenous IL17A gene locus.

In one aspect, the disclosure is related to a method for making a genetically-modified, non-human animal, comprising: replacing in at least one cell of the animal, at an endogenous IL17A gene locus, a sequence encoding a region of an endogenous IL17A with a sequence encoding a corresponding region of human IL17A.

In some embodiments, the sequence encoding the corresponding region of human IL17A comprises exon 1, exon 2, and/or exon 3, or a part thereof, of a human IL17A gene.

In some embodiments, the sequence encoding the corresponding region of human IL17A encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 2.

In some embodiments, the endogenous IL17A locus comprises exon 1, exon 2, and/or exon 3, or a part thereof, of the endogenous IL17A gene.

In some embodiments, the animal is a mouse, and the sequence encoding a region of an endogenous IL17A starts within exon 1 (e.g., from the start codon ATG) and ends within exon 3 (e.g., to the stop codon TAA) of the endogenous mouse IL17A gene.

In one aspect, the disclosure is related to a non-human animal comprising at least one cell comprising a nucleotide sequence encoding an exogenous IL17A polypeptide, in some embodiments, the exogenous IL17A polypeptide comprises at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, or at least 150 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human IL17A, in some embodiments, the animal expresses the exogenous IL17A.

In some embodiments, the exogenous IL17A polypeptide comprises an amino acid sequence that is at least 90%, 95%, or 99%identical to SEQ ID NO: 2.

In some embodiments, the nucleotide sequence is operably linked to an endogenous IL17A regulatory element of the animal.

In some embodiments, the nucleotide sequence is integrated to an endogenous IL17A gene locus of the animal.

In some embodiments, the animal in its genome comprises, from 5’ to 3’: a mouse 5’ UTR, a sequence encoding the exogenous IL17A polypeptide, and a mouse 3’ UTR.

In one aspect, the disclosure is related to a method of making a genetically-modified non-human animal cell that expresses a human or chimeric IL17A, the method comprising: replacing at an endogenous IL17A gene locus, a nucleotide sequence encoding a region of endogenous IL17A with a nucleotide sequence encoding a corresponding region of human IL17A, thereby generating a genetically-modified non-human animal cell that includes a nucleotide sequence that encodes the human or chimeric IL17A, in some embodiments, the non-human animal cell expresses the human or chimeric IL17A.

In some embodiments, the nucleotide sequence encoding the human or chimeric IL17A is operably linked to an endogenous IL17A regulatory region, e.g., promoter.

In some embodiments, the animal further comprises a sequence encoding an additional human or chimeric protein. In some embodiments, the additional human or chimeric protein is interleukin 17F (IL17F) , interleukin 17 Receptor C (IL17RC) , interleukin 17 Receptor A (IL17RA) , programmed cell death protein 1 (PD-1) , cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) , Lymphocyte Activating 3 (LAG-3) , IL15 receptor, B And T Lymphocyte Associated (BTLA) , Programmed Cell Death 1 Ligand 1 (PD-L1) , CD3, CD27, CD28, CD47, CD137, CD154, T-Cell Immunoreceptor With Ig And ITIM Domains (TIGIT) , T-cell Immunoglobulin and Mucin-Domain Containing-3 (TIM-3) , Glucocorticoid-Induced TNFR-Related Protein (GITR) , Signal regulatory protein α (SIRPα) or TNF Receptor Superfamily Member 4 (OX40) . In some embodiments, the additional human or chimeric protein is IL17F and the animal expresses the human or chimeric IL17F.

In one aspect, the disclosure is related to a method of determining effectiveness of a therapeutic agent for treating an allergic disorder, comprising: a) administering the therapeutic agent to the animal as described herein, in some embodiments, the animal has the allergic disorder; and b) determining effects of the therapeutic agent in treating the allergic disorder. In some embodiments, the therapeutic agent is an anti-IL17A antibody or an anti-IL17F antibody. In some embodiments, the allergic disorder is allergy, asthma, and/or atopic dermatitis.

In one aspect, the disclosure is related to a method of determining effectiveness of a therapeutic agent for reducing an inflammation, comprising: a) administering the therapeutic agent to the animal as described herein, in some embodiments, the animal has the inflammation; and b) determining effects of the therapeutic agent for reducing the inflammation. In some embodiments, the therapeutic agent is an anti-IL17A antibody or an anti-IL17F antibody.

In one aspect, the disclosure is related to a method of determining effectiveness of a therapeutic agent for treating an autoimmune disorder, comprising: a) administering the agent to the animal as described herein, in some embodiments, the animal has the autoimmune disorder; and b) determining effects of the therapeutic agent for treating the autoimmune disorder. In some embodiments, the therapeutic agent is an anti-IL17A antibody, an anti-IL17F antibody, or a corticosteroid (e.g., dexamethasone) . In some embodiments, the autoimmune disorder is rheumatoid arthritis, Psoriatic Arthritis, Ankylosing Spondylitis, Non-radiographic Axial Spondyloarthritis, Crohn’s disease, systemic lupus erythematosus, ankylosing spondylitis, inflammatory bowel diseases (IBD) , ulcerative colitis, multiple sclerosis, systemic juvenile idiopathic arthritis (SJIA) , and/or scleroderma. In some embodiments, the autoimmune disorder is psoriasis.

In one aspect, the disclosure is related to a method of determining effectiveness of a therapeutic agent for treating a cancer, comprising: a) administering the therapeutic agent to the animal as described herein, in some embodiments, the animal has the cancer; and b) determining inhibitory effects of the therapeutic agent for treating the cancer. In some embodiments, the therapeutic agent is an anti-IL17A antibody or/and an anti-IL17F antibody. In some embodiments, the cancer is a tumor, and determining the inhibitory effects of the treatment involves measuring the tumor volume in the animal. In some embodiments, the cancer comprises one or more cancer cells that are injected into the animal. In some embodiments, the cancer is a colon cancer, rectal cancer, stomach cancer, ovarian cancer, or prostate cancer.

In one aspect, the disclosure is related to a method of determining toxicity of an anti-IL17A or anti-IL17F antibody, the method comprising a) administering the anti-IL17F or anti-IL17F antibody to the animal as described herein; and b) determining weight change of the animal. In some embodiments, the method further comprises performing a blood test (e.g., determining red blood cell count) .

In one aspect, the disclosure is related to a protein comprising an amino acid sequence, in some embodiments, the amino acid sequence is one of the following: (a) an amino acid sequence set forth in SEQ ID NO: 1, 2, 7, 8, or 16; (b) an amino acid sequence that is at least 90% identical to SEQ ID NO: 1, 2, 7, 8, or 16; (c) an amino acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 1, 2, 7, 8, or 16; (d) an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 1, 2, 7, 8, or 16 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid; and (e) an amino acid sequence that comprises a substitution, a deletion and /or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 1, 2, 7, 8, or 16.

In one aspect, the disclosure is related to a nucleic acid comprising a nucleotide sequence, in some embodiments, the nucleotide sequence is one of the following: (a) a sequence that encodes the protein as described herein; (b) SEQ ID NO: 3, 4, 5, 6, 9, 10, 11, 12, 13, 14, 15, 24, 25, 55, or 56; (c) a sequence that is at least 90 %identical to SEQ ID NO: 3, 4, 5, 6, 9, 10, 11, 12, 13, 14, 15, 24, 25, 55, or 56; and (d) a sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, 4, 5, 6, 9, 10, 11, 12, 13, 14, 15, 24, 25, 55, or 56.

In one aspect, the disclosure is related to a cell comprising the protein as described herein and/or the nucleic acid as described herein. In one aspect, the disclosure is related to an animal comprising the protein as described herein and/or the nucleic acid as described herein.

In one aspect, the disclosure is related to a cell comprising the protein and/or the nucleic acid as described herein. In one aspect, the disclosure is related to an animal comprising the protein and/or the nucleic acid as described herein.

The disclosure further relates to a IL17A and/or IL17F genomic DNA sequence of a humanized mouse, a DNA sequence obtained by a reverse transcription of the mRNA obtained by transcription thereof is consistent with or complementary to the DNA sequence; a construct expressing the amino acid sequence thereof; a cell comprising the construct thereof; a tissue comprising the cell thereof.

The disclosure further relates to the use of the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal, the animal model generated through the method as described herein in the development of a product related to an immunization processes of human cells, the manufacture of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.

The disclosure also relates to the use of the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal, the animal model generated through the method as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and /or a therapeutic strategy.

The disclosure further relates to the use of the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal, the animal model generated through the methods as described herein, in the screening, verifying, evaluating or studying the IL17A and/or IL17F gene function, human IL17A antibodies, human IL17F antibodies, the drugs or efficacies for human IL17A and/or IL17F targeting sites, and the drugs for immune-related diseases and antitumor drugs.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.

DESCRIPTION OF DRAWINGS

FIG. 1A is a schematic diagram showing mouse IL17A gene locus.

FIG. 1B is a schematic diagram showing human IL17A gene locus.

FIG. 2 is a schematic diagram showing humanized IL17A gene locus.

FIG. 3 is a schematic diagram showing a IL17A gene targeting strategy.

FIG. 4 shows the body weight of control group mice (G1 and G3) and MOG-immunized model group mice (G2 and G4) after induction of experimental autoimmune encephalomyelitis (EAE) mouse model using IL17A gene humanized mice.

FIG. 5 shows the clinical score of control group mice (G1 and G3) and MOG-immunized model group mice (G2 and G4) after induction of experimental autoimmune encephalomyelitis (EAE) mouse model using IL17A gene humanized mice.

FIG. 6A shows an image of the spinal cord tissue section of control group mice (G1) stained with hematoxylin and eosin (HE) . The scale bar represents 500 μm.

FIG. 6B shows an image of the spinal cord tissue section of MOG-immunized model group mice (G2) stained with hematoxylin and eosin (HE) . The scale bar represents 500 μm.

FIG. 7A shows an image of the spinal cord tissue section of control group mice (G1) by IHC (immunohistochemistry) stain.

FIG. 7B shows an image of the spinal cord tissue section of MOG-immunized model group mice (G2) by IHC (immunohistochemistry) stain.

FIG. 8A is a flow cytometry result showing the percentages of hIL17+ CD3+ CD4+ T cells and IFNγ+ T cells in CD3+ CD4+ T cells in lymph nodes of control group mice (G1) .

FIG. 8B is a flow cytometry result showing the percentages of hIL17+ CD3+ CD4+ T cells and IFNγ+ T cells in CD3+ CD4+ T cells in lymph nodes of MOG-immunized model group mice (G2) .

FIG. 9A is a schematic diagram showing mouse IL17F gene locus.

FIG. 9B is a schematic diagram showing human IL17F gene locus.

FIG. 10 is a schematic diagram showing humanized IL17F gene locus.

FIG. 11 is a schematic diagram showing a IL17F gene targeting strategy.

FIG. 12 shows PCR identification results of F1 generation IL17F gene humanized mice by primers L-F1-F and L-F1-R. F1-01, F1-02, F1-03, and F1-04 are mouse numbers. M is a marker. WT is a wild-type control. H ₂O is a water control.

FIG. 13A shows PCR identification results of F1 generation IL17A/IL17F double-gene humanized mice by primers L-F1-F and L-F1-R. F1-01 and F1-02 are mouse numbers. M is a marker. WT is a wild-type control. PC is a positive control. H ₂O is a water control.

FIG. 13B shows PCR identification results of F1 generation IL17A/IL17F double-gene humanized mice by primers R-F1-F and R-F1-R. F1-01 and F1-02 are mouse numbers. M is a marker. WT is a wild-type control. PC is a positive control. H ₂O is a water control.

FIG. 13C shows PCR identification results of F1 generation IL17A/IL17F double-gene humanized mice by primers WT-F and Mut-R. F1-01 and F1-02 are mouse numbers. M is a marker. WT is a wild-type control. PC is a positive control. H ₂O is a water control.

FIG. 13D shows PCR identification results of F1 generation IL17A/IL17F double-gene humanized mice by primers WT-F and WT-R. F1-01 and F1-02 are mouse numbers. M is a marker. WT is a wild-type control. PC is a positive control. H ₂O is a water control.

FIG. 14 is a schematic diagram showing a IL17F gene targeting strategy.

FIG. 15A shows the activity detection results of sgRNA1, sgRNA2, sgRNA3, sgRNA4, sgRNA6, sgRNA7 and sgRNA8. Con is a negative control. PC is a positive control.

FIG. 15B shows the activity detection results of sgRNA9, sgRNA10, sgRNA11, sgRNA12, sgRNA13, sgRNA14, sgRNA15, and sgRNA16. Con is a negative control. PC is a positive control.

FIG. 16A shows PCR identification results of F0 generation mice by primers L-F1-F and L-F1-R. F0-01, F0-02, and F0-03 are mouse numbers. M is a marker. WT is a wild-type control. H ₂O is a water control.

FIG. 16B shows PCR identification results of F0 generation mice by primers R-F1-F and R-F1-R. F0-01, F0-02, and F0-03 are mouse numbers. M is a marker. WT is a wild-type control. H ₂O is a water control.

FIG. 16C shows PCR identification results of F0 generation mice by primers WT-F and Mut-R. F0-01, F0-02, and F0-03 are mouse numbers. M is a marker. WT is a wild-type control. H ₂O is a water control. PC1 and PC2 are positive controls.

FIG. 17A shows PCR identification results of F1 generation mice by primers L-F1-F and L-F1-R. F1-01, F1-02, F1-03, F1-04, F1-05, F1-06, F1-07, F1-08, and F1-09 are mouse numbers. M is a marker. WT is a wild-type control. H ₂O is a water control.

FIG. 17B shows PCR identification results of F1 generation mice by primers R-F1-F and R-F1-R. F1-01, F1-02, F1-03, F1-04, F1-05, F1-06, F1-07, F1-08, and F1-09 are mouse numbers. M is a marker. WT is a wild-type control. H ₂O is a water control.

FIG. 17C shows PCR identification results of F1 generation mice by primers WT-F and Mut-R. F1-01, F1-02, F1-03, F1-04, F1-05, F1-06, F1-07, F1-08, and F1-09 are mouse numbers. M is a marker. WT is a wild-type control. H ₂O is a water control. PC, PC1, and PC2 are positive controls.

FIG. 17D shows PCR identification results of F1 generation mice by primers WT-F and WT-R. F1-01, F1-02, F1-03, F1-04, F1-05, F1-06, F1-07, F1-08, and F1-09 are mouse numbers. M is a marker. WT is a wild-type control. H ₂O is a water control. PC, PC1, and PC2 are positive controls.

FIG. 18 shows Southern Blot results. F1-01, F1-02, F1-03, F1-04, F1-05, F1-06, F1-07, F1-08, and F1-09 are mouse numbers. WT is a wild-type control.

FIG. 19A shows the expression level of mouse IL17A protein in wild-type C57BL/6 mice or IL17A/IL17F double-gene humanized heterozygous mice.

FIG. 19B shows the expression level of human IL17A protein in wild-type C57BL/6 mice or IL17A/IL17F double-gene humanized heterozygous mice.

FIG. 20A shows the expression level of mouse IL17F protein in wild-type C57BL/6 mice or IL17A/IL17F double-gene humanized heterozygous mice.

FIG. 20B shows the expression level of human IL17F protein in wild-type C57BL/6 mice or IL17A/IL17F double-gene humanized heterozygous mice.

FIG. 21 shows the percentages of leukocyte subtypes in the spleen of wild-type C57BL/6 mice or IL17A/IL17F double-gene humanized homozygous mice (B-hIL17A/hIL17F) .

FIG. 22 shows the percentages of T cell subtypes in the spleen of wild-type C57BL/6 mice or IL17A/IL17F double-gene humanized homozygous mice (B-hIL17A/hIL17F) .

FIG. 23 shows the percentages of leukocyte subtypes in the lymph nodes of wild-type C57BL/6 mice or IL17A/IL17F double-gene humanized homozygous mice (B-hIL17A/hIL17F) .

FIG. 24 shows the percentages of T cell subtypes in the lymph nodes of wild-type C57BL/6 mice or IL17A/IL17F double-gene humanized homozygous mice (B-hIL17A/hIL17F) .

FIG. 25 shows the experimental design of using IL17A/IL17F double-gene humanized homozygous mice to evaluate an anti-human IL17A/IL17F antibody Ab in an IMQ-induced psoriasis model.

FIG. 26 shows the body weight of control group mice (G1) , model group mice (G2) , low-dose administration group mice (G3) and high-dose administration group mice (G4) using IL17A/IL17F double-gene humanized homozygous mice in an IMQ-induced psoriasis model.

FIG. 27 shows the erythema scores of control group mice (G1) , model group mice (G2) , low-dose administration group mice (G3) and high-dose administration group mice (G4) using IL17A/IL17F double-gene humanized homozygous mice in an IMQ-induced psoriasis model.

FIG. 28 shows the scaling scores of control group mice (G1) , model group mice (G2) , low-dose administration group mice (G3) and high-dose administration group mice (G4) using IL17A/IL17F double-gene humanized homozygous mice in an IMQ-induced psoriasis model.

FIG. 29 shows the comprehensive PASI (Psoriasis Area Severity Index) scores of control group mice (G1) , model group mice (G2) , low-dose administration group mice (G3) and high-dose administration group mice (G4) using IL17A/IL17F double-gene humanized homozygous mice in an IMQ-induced psoriasis model.

FIG. 30 shows the HE staining results of the back tissue sections of control group mice (G1) , model group mice (G2) , low-dose administration group mice (G3) and high-dose administration group mice (G4) using IL17A/IL17F double-gene humanized homozygous mice in an IMQ-induced psoriasis model.

FIG. 31 shows the epidermal thickness of the back tissues of control group mice (G1) , model group mice (G2) , low-dose administration group mice (G3) and high-dose administration group mice (G4) using IL17A/IL17F double-gene humanized homozygous mice in an IMQ-induced psoriasis model.

FIG. 32 shows the histology scores of the back skin of control group mice (G1) , model group mice (G2) , low-dose administration group mice (G3) and high-dose administration group mice (G4) using IL17A/IL17F double-gene humanized homozygous mice in an IMQ-induced psoriasis model.

FIG. 33 shows images of the back skin of control group mice (G1) , model group mice (G2) , low-dose administration group mice (G3) and high-dose administration group mice (G4) using IL17A/IL17F double-gene humanized homozygous mice in an IMQ-induced psoriasis model. Scabs are shown as white dots on mouse back skin.

FIG. 34A shows the RT-PCR detection results of mouse IL17A (mIL17A) , human IL17A (hIL17A) , and GAPDH in the spleen total RNA of wild-type mice (+/+) or IL17A/IL17F double-gene humanized homozygous mice (H/H) . H ₂O is a water control.

FIG. 34B shows the RT-PCR detection results of mouse IL17F (mIL17F) , human IL17F (hIL17F) , and GAPDH in the spleen total RNA of wild-type mice (+/+) or IL17A/IL17F double-gene humanized homozygous mice (H/H) . H ₂O is a water control.

FIG. 35 shows the percentages of leukocyte subtypes in the thymus of wild-type C57BL/6 mice or IL17A/IL17F double-gene humanized homozygous mice (IL17A/IL17F (H/H) ) .

FIG. 36 shows the percentages of T cell subtypes in the thymus of wild-type C57BL/6 mice or IL17A/IL17F double-gene humanized homozygous mice (IL17A/IL17F (H/H) ) .

FIG. 37 shows the detection results of blood routine examination of wild-type C57BL/6 mice or IL17A/IL17F double-gene humanized homozygous mice (IL17A/IL17F (H/H) ) .

FIG. 38 shows the detection results of blood biochemical index tests of wild-type C57BL/6 mice or IL17A/IL17F double-gene humanized homozygous mice (IL17A/IL17F (H/H) ) .

FIG. 39 shows the alignment between mouse IL17A amino acid sequence (NP_034682.1; SEQ ID NO: 1) and human IL17A amino acid sequence (NP_002181.1; SEQ ID NO: 2) .

FIG. 40 shows the alignment between rat IL17A amino acid sequence (NP_001100367.1; SEQ ID NO: 73) and human IL17A amino acid sequence (NP_002181.1; SEQ ID NO: 2) .

FIG. 41 shows the alignment between mouse IL17F amino acid sequence (NP_665855.2; SEQ ID NO: 7) and human IL17A amino acid sequence (NP_443104.1; SEQ ID NO: 8) .

FIG. 42 shows the alignment between rat IL17F amino acid sequence (NP_001015011.2; SEQ ID NO: 74) and human IL17A amino acid sequence (NP_443104.1; SEQ ID NO: 8) .

DETAILED DESCRIPTION

This disclosure relates to transgenic non-human animal with human or chimeric (e.g., humanized) IL17A and/or IL17F, and methods of use thereof.

Interleukin 17 family (IL17 family) is a family of pro-inflammatory cystine knot cytokines. They are produced by a group of T helper cell known as T helper 17 (Th17) cell in response to their stimulation with IL-23.

IL-17A, originally termed CTLA-8, was cloned from a rodent-activated T cell hybridoma. Its amino acid sequence is unusual for a cytokine, being 58%identical to the open reading frame of the T cell-tropic gammaherpesvirus Herpesvirus samiri. In the early 2000s, genomic sequencing led to the identification of several proteins structurally related to IL-17A: IL-17B, IL-17C, IL-17D, IL-17E (also called IL-25) and IL-17F. Together, these cytokines are known as the IL-17 family. IL-17F shares the highest homology with IL-17A (55%) and is often co-expressed with IL-17A. IL-17B, IL-17D, and IL-17C sequences overlap from 29 to 23%with IL-17A, while IL-17E appears to be the most divergent member of the family, sharing only 16%sequence homology. The members of the IL-17 family exert their functions as disulfide-linked homodimers, with a molecular weight of the monomer ranging from 17 to 21 kDa. As an exception to the rule, IL-17A and IL-17F can also form heterodimers.

The biologically active IL-17 interacts with type I cell surface receptor IL-17R. In turn, there are at least three variants of IL-17R referred to as IL17RA, IL17RB, and IL17RC. After binding to the receptor, IL-17 activates several signaling cascades that, in turn, lead to the induction of chemokines. Exemplary downstream pathways include: MAP kinase pathway, NF-kB pathway, mRNA stabilization signal pathway, ERK signal pathway and JAK/STAT signal pathway, etc. Acting as chemoattractants, these chemokines recruit the immune cells, such as monocytes and neutrophils to the site of inflammation. Typically, the signaling events mentioned above follow an invasion of the body by pathogens. Promoting the inflammation, IL-17 acts in concert with tumor necrosis factor and interleukin-1. Moreover, an activation of IL-17 signaling is often observed in the pathogenesis of various autoimmune disorders, such as psoriasis.

As the main effector secreted by Th17 cells, IL17A and IL17F have strong homology, and have similar regulation, signal pathways and functions. Activated Th17 cells can not only secrete the homodimer of IL17A and IL17F, but also express a heterodimer composed of IL17A and IL17F (IL17A/IL17F) , which can bind to aheterodimeric receptor complex formed byIL17RC and IL17RA of the IL17 receptor family. The binding with IL17RC/IL17RA receptor complex can then initiate downstream cell signaling pathways, and induce a series of pro-inflammatory cytokines, chemotactic factors and matrix metalloproteinases (MMPs) to promote tissue inflammation and damage.

A detailed description of the IL-17 family and its function can be found, e.g., in Monin, et al. "Interleukin 17 family cytokines: signaling mechanisms, biological activities, and therapeutic implications. " Cold Spring Harbor Perspectives in Biology 10.4 (2018) : a028522; Brembilla, et al. "The IL-17 family of cytokines in psoriasis: IL-17A and beyond. " Frontiers in Immunology 9 (2018) : 1682; McGeachy, et al. "The IL-17 family of cytokines in health and disease. " Immunity 50.4 (2019) : 892-906; Dubin, et al. "Interleukin-17A and interleukin-17F: a tale of two cytokines. " Immunity 30.1 (2009) : 9-11; and de Morales, et al. "Critical role of interleukin (IL) -17 in inflammatory and immune disorders: an updated review of the evidence focusing in controversies. " Autoimmunity Reviews 19.1 (2020) : 102429; each of which is incorporated herein by reference in its entirety. Thus, antibodies targeting the IL-17 family members can be potentially used to treat immune disorders (e.g., psoriasis) or cancers.

Experimental animal models are an indispensable research tool for studying the effects of these antibodies (e.g., IL17A or IL17F antibodies) . Common experimental animals include mice, rats, guinea pigs, hamsters, rabbits, dogs, monkeys, pigs, fish and so on. However, there are many differences between human and animal genes and protein sequences, and many human proteins cannot bind to the animal’s homologous proteins to produce biological activity, leading to that the results of many clinical trials do not match the results obtained from animal experiments. A large number of clinical studies are in urgent need of better animal models. With the continuous development and maturation of genetic engineering technologies, the use of human cells or genes to replace or substitute an animal’s endogenous similar cells or genes to establish a biological system or disease model closer to human, and establish the humanized experimental animal models (humanized animal model) has provided an important tool for new clinical approaches or means. In this context, the genetically engineered animal model, that is, the use of genetic manipulation techniques, the use of human normal or mutant genes to replace animal homologous genes, can be used to establish the genetically modified animal models that are closer to human gene systems. The humanized animal models have various important applications. For example, due to the presence of human or humanized genes, the animals can express or express in part of the proteins with human functions, so as to greatly reduce the differences in clinical trials between humans and animals, and provide the possibility of drug screening at animal levels.

Particularly, the present disclosure demonstrates that a replacement with human IL17A sequence at an endogenous IL17A locus under control of endogenous regulatory elements provides a physiologically appropriate expression pattern and level that results in a useful humanized animal. As shown in the present disclosure, while the human IL17A sequence is quite different from the animal IL17A sequence (see e.g., FIGs. 39-40) , the human IL17A gene sequences are properly spliced in the animal, and the expressed human IL17A is functional and can properly interact with the endogenous IL17 receptor. The present disclosure also demonstrates that a replacement with human IL17F sequence at an endogenous IL17F locus under control of endogenous regulatory elements provides a physiologically appropriate expression pattern and level that results in a useful humanized animal. As shown in the present disclosure, while the human IL17F sequence is quite different from the animal IL17F sequence (see e.g., FIGs. 41-42) , the human IL17F gene sequences are properly spliced in the animal, and the expressed human IL17F is functional and can properly interact with the endogenous IL17F receptor. Both genetically modified animals that are heterozygous or homozygous for humanized IL17A and/or IL17F are grossly normal and can be used to evaluate the efficacy of anti-human ILIB or anti-human IL17F antibodies in an immune disorder model.

Unless otherwise specified, the practice of the methods described herein can take advantage of the techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA and immunology.

IL17A

Interleukin 17A (IL-17A or IL17A) , is by far the best characterized member of the IL-17 family and can exist as a homodimer or in a heterodimer with IL-17F and signals through an obligate dimeric IL-17RA and IL-17RC receptor complex. On binding to a receptor, IL-17A upregulates inflammatory gene expression either by inducing de novo gene transcription or by stabilizing mRNA of pro-inflammatory cytokines and chemokines.

IL17A is a proinflammatory cytokine produced by activated T cells. This cytokine regulates the activities of NF-κB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2) , as well as enhance the production of nitric oxide (NO) . Lymphocytes including CD4+, CD8+, gamma-delta T (γδ-T) , invariant NKT and innate lymphoid cells (ILCs) are primary sources of IL-17A. Non-T cells, such as neutrophils, have also been reported to produce IL-17A under certain circumstances. IL-17A producing T helper cells (Th17 cells) are a distinct lineage from the Th1 and Th2 CD4+lineages and the differentiation of Th17 cells requires STAT3 and RORC. IL-17A receptor A (IL-17RA) was first isolated and cloned from mouse EL4 thymoma cells and the bioactivity of IL-17A was confirmed by stimulating the transcriptional factor NF-κB activity and interleukin-6 (IL-6) secretion in fibroblasts. IL-17RA pairs with IL-17RC to allow binding and signaling of IL-17A and IL-17F.

High levels of this cytokine are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis. Elevated levels of IL-17A have been found in the sputum and in bronchoalveolar lavage fluid of patients with asthma and a positive correlation between IL-17A production and asthma severity has been established. In host defense, IL-17A has been shown to be mostly beneficial against infection caused by extracellular bacteria and fungi. In tumorigenesis, IL-17A has been shown to recruit myeloid derived suppressor cells (MDSCs) to dampen anti-tumor immunity.

A detailed description of IL17A and its function can be found, e.g., inMcGonagle, et al. "The role of IL-17A in axial spondyloarthritis and psoriatic arthritis: recent advances and controversies. " Annals of the Rheumatic Diseases 78.9 (2019) : 1167-1178; Von Stebut, et al. "IL-17A in psoriasis and beyond: cardiovascular and metabolic implications. " Frontiers in Immunology 10 (2020) : 3096; Brembilla, et al. "The IL-17 family of cytokines in psoriasis: IL-17A and beyond. " Frontiers in Immunology 9 (2018) : 1682; each of which is incorporated by reference in its entirety.

In human genomes, IL17A gene (Gene ID: 3605) locus has 3 exons, exon 1, exon 2, and exon 3 (FIG. 1B) . The nucleotide sequence for human IL17A mRNA is NM_002190.3, and the amino acid sequence for human IL17A is NP_002181.1 (SEQ ID NO: 2) . The location for each exon and each region in human IL17A nucleotide sequence and amino acid sequence is listed below:

Table 1

The human IL17A gene (Gene ID: 3605) is located in Chromosome 6 of the human genome, which is located from 52186375 to 52190638 of NC_000006.12 (GRCh38. p13 (GCF_000001405.39) ) . The 5’-UTR is from 52,186,375 to 52,186,431, exon 1 is from 52,186,375 to 52,186,458, the first intron is from 52,186,459 to 52,187,602, exon 2 is from 52,187,603 to 52,187,805, the second intron is from 52,187,806 to 52,189,054, exon 3 is from 52,189,055 to 52,190,638, and the 3’-UTR is from 52,189,293 to 52,190,638, based on transcript NM_002190.3. All relevant information for human IL17A locus can be found in the NCBI website with Gene ID: 3605, which is incorporated by reference herein in its entirety.

According to the UniProt Database (UniProt ID: Q16552) , a signal peptide corresponds to amino acids 1-23 of SEQ ID NO: 2, and a mature protein chain corresponds to amino acids 24-155 of SEQ ID NO: 2.

In mice, IL17A gene locus has 3 exons, exon 1, exon 2, and exon 3 (FIG. 1A) . The nucleotide sequence for mouse IL17A mRNA is NM_010552.3, the amino acid sequence for mouse IL17A is NP_034682.1 (SEQ ID NO: 1) . The location for each exon and each region in the mouse IL17A nucleotide sequence and amino acid sequence is listed below:

Table 2

The mouse IL17A gene (Gene ID: 16171) is located in Chromosome 1 of the mouse genome, which is located from 20,730,905 to 20,734,496, of NC_000067.6 (GRCm38. p6 (GCF_000001635.26) ) . The 5’-UTR is from 20,730,905 to 20,730,961, exon 1 is from 20,730,905 to 20,730,988, the first intron is from 20,730,989 to 20,732,095, exon 2 is from 20,732,096 to 20,732,307, the second intron is from 20,732,308 to 20,733,621, exon 3 is from 20,733,622 to 20,733,859, and the 3’-UTR is from 20,733,860 to 20,734,496, based on transcript NM_010552.3. All relevant information for mouse IL17A locus can be found in the NCBI website with Gene ID: 16171, which is incorporated by reference herein in its entirety.

According to the UniProt Database (UniProt ID: Q62386) , a signal peptide corresponds to amino acids 1-25 of SEQ ID NO: 1, and a mature protein chain corresponds to amino acids 26-158 of SEQ ID NO: 1.

FIG. 39 shows the alignment between mouse IL17A amino acid sequence (NP_034682.1; SEQ ID NO: 1) and human IL17A amino acid sequence (NP_002181.1; SEQ ID NO: 2) . Thus, the corresponding amino acid residue or region between mouse and humanIL17A can be found in FIG. 39.

IL17A genes, proteins, and locus of the other species are also known in the art. For example, the gene ID for IL17A in Rattus norvegicus (rat) is 301289, the gene ID for IL17A in Macaca mulatta (Rhesus monkey) is 708123, the gene ID for IL17A in Sus scrofa (pig) is 449530, the gene ID for IL17A in Oryctolagus cuniculus (rabbit) is 100339322, and the gene ID for IL17A in Canis lupus familiaris (dog) is481837. The relevant information for these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, e.g., in NCBI database, which is incorporated by reference herein in its entirety. FIG. 40 shows the alignment between rodent IL17A amino acid sequence (NP_001100367.1; SEQ ID NO: 73and human IL17A amino acid sequence (NP_002181.1; SEQ ID NO: 2) . Thus, the corresponding amino acid residue or region between rodent and human IL17A can be found in FIG. 40.

The present disclosure provides human or chimeric (e.g., humanized) IL17A nucleotide sequence and/or amino acid sequences. In some embodiments, the entire sequence of mouse exon 1, exon 2, exon 3, signal peptide, and/or mature IL17A, are replaced by the corresponding human sequence. In some embodiments, a “region” or a “portion” of mouse exon 1, exon 2, exon 3, signal peptide, and/or mature IL17A, are replaced by the corresponding human sequence. The term “region” or “portion” can refer to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, or 500 nucleotides, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 amino acid residues. In some embodiments, the “region” or “portion” can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to exon 1, exon 2, exon 3, signal peptide, or mature IL17A. In some embodiments, a region, a portion, or the entire sequence of mouse exon 1, exon 2, and/or exon 3 (e.g., a portion of exon 1, exon 2, and a portion of exon 3 of mouse IL17A gene) are replaced by human exon 1, exon 2, and/or exon 3 (e.g., a portion of exon 1, exon 2, and a portion of exon 3 of human IL17A gene) sequence.

In some embodiments, the genetically-modified non-human animal described herein comprises a sequence encoding a humanized IL17A protein. In some embodiments, the humanized IL17A protein comprises a humanized signal peptide. In some embodiments, the humanized IL17A protein comprises an endogenous signal peptide. In some embodiments, the humanized IL17A protein comprises a humanized mature IL17A chain (e.g., without signal peptide) .

In some embodiments, the genetically-modified non-human animal described herein comprises a humanized IL17A gene. In some embodiments, the humanized IL17A gene comprises 3 exons. In some embodiments, the humanized IL17A gene comprises humanized exon 1, humanized exon 2, and/or humanized exon 3.

In some embodiments, the present disclosure also provides a chimeric (e.g., humanized) or human IL17A nucleotide sequence and/or amino acid sequences, wherein in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%of the sequence are identical to or derived from mouse IL17A mRNA sequence (e.g., NM_010552.3) , mouse IL17A amino acid sequence (e.g., NP_034682.1; SEQ ID NO: 1) , or a portion thereof (e.g., a portion of exon 1 and a portion of exon 3 of NM_010552.3) ; and in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%of the sequence are identical to or derived from human IL17A mRNA sequence (e.g., NM_002190.3) , human IL17A amino acid sequence (e.g., NP_002181.1; SEQ ID NO: 2) , or a portion thereof (e.g., a portion of exon 1, exon 2, and a portion of exon 3 of NM_002190.3) .

In some embodiments, the sequence encoding amino acids 1-158 of mouse IL17A (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human IL17A (e.g., amino acids 1-155 of human IL17A (SEQ ID NO: 2) ) .

In some embodiments, the sequence encoding amino acids 26-158 of mouse IL17A (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human IL17A (e.g., amino acids 24-155 of human IL17A (SEQ ID NO: 2) ) .

In some embodiments, the sequence encoding an endogenous mature IL17A protein (e.g., an amino acid sequence corresponding to amino acids 26-158 of SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human IL17A (e.g., an amino acid sequence corresponding to amino acids 24-155 of SEQ ID NO: 2) .

In some embodiments, the nucleic acid sequence described herein are operably linked to a promotor or regulatory element, e.g., an endogenous mouse IL17A promotor, an inducible promoter, an enhancer, and/or mouse or human regulatory elements. In some embodiments, the nucleic acid sequence described herein is connected to an endogenous 5’ UTR. In some embodiments, the 5’UTR is identical to nucleic acid positions 1-58 of exon 1 ofNM_002190.3. In some embodiments, the nucleic acid sequence described herein is connected to a human 5’ UTR. In some embodiments, the nucleic acid sequence described herein is connected to an endogenous 3’ UTR. In some embodiments, the nucleic acid sequence described herein is connected to a human 3’ UTR.

In some embodiments, the nucleic acid sequence described herein has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is different from a portion of or the entire mouse IL17A nucleotide sequence (e.g., a portion of exon 1, exon 2, and a portion of exon 3 of NM_010552.3) .

In some embodiments, the nucleic acid sequence described herein has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire mouse IL17A nucleotide sequence (e.g., a portion of exon 1 and a portion of exon 3 of NM_010552.3) .

In some embodiments, the nucleic acid sequence described herein has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is different from a portion of or the entire human IL17A nucleotide sequence (e.g., a portion of exon 1 and a portion of exon 2of NM_002190.3) .

In some embodiments, the nucleic acid sequence described herein has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire human IL17A nucleotide sequence (e.g., a portion of exon 1, exon 2, and a portion of exon 3 of NM_002190.3) .

In some embodiments, the amino acid sequence described herein has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire mouse IL17A amino acid sequence (e.g., NP_034682.1 (SEQ ID NO: 1) ) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire mouse IL17A amino acid sequence (e.g., NP_034682.1 (SEQ ID NO: 1) ) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire human IL17A amino acid sequence (e.g., NP_002181.1 (SEQ ID NO: 2) ) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire human IL17A amino acid sequence (e.g., NP_002181.1 (SEQ ID NO: 2) ) .

IL17F

Interleukin 17F (IL-17F or IL17F) , discovered in 2001 on chromosome 6p12, is the most homologous cytokine to IL-17A and signals via a receptor composed by the IL-17RA and IL-17RC subunits. IL-17F levels are elevated in sera and lesional psoriatic skin compared to non-lesional tissue. Despite that, no specific polymorphisms in the IL-17F gene have so far been associated with psoriasis susceptibility, although the IL-17F polymorphism rs763780 was linked to a better response to anti-TNF therapy. IL-17F is also increased in sera of atopic dermatitis patients and positively correlates with higher clinical score. Additional evidence of the involvement of IL-17F in psoriatic inflammation comes from experiments in mice models. Indeed, IL-17F together with IL-17A and IL-22, are rapidly induced upon imiquimod application, as result of infiltration of γδ T cells and RORγt + innate lymphocytes. Of interest, IL-17F ^-/-mice show a higher disease resistance than IL-17A ^-/-mice.

Both IL-17A and IL-17F are expressed by the same immune cell types, including Th17 cells, γδ T cells and ILC3. Human IL17A and IL17F genes are found in the same locus and are genetically co-regulated, thus it is not surprising that these cytokines are often co-expressed. IL-23 participates in IL-17A and IL-17F co-production in Th17 cells. IL-17A and IL-17F can also be secreted as homodimers or IL-17A/IL-17F heterodimers. IL-17F has been shown to stimulate in vitro a qualitative similar pattern of genes than IL-17A, although being generally weaker, with IL-17A/IL-17F heterodimers having an intermediate potency. However, this is not always true, either in cell-and target-specific situations or because of synergism with other inflammatory mediators. Thus, IL-17F was shown to be more potent than IL-17A, or even TNF, to induce IL-8 and IL-6 production in normal human epidermal keratinocytes. Or, though less potent in absolute terms, IL-17F was shown to be almost as potent as IL-17A when combined with TNF in RA synoviocytes. Moreover, IL-17A and IL-17F have been shown to synergistically act, since their dual neutralization leads to greater downregulation of inflammatory mediators than IL-17A blockade alone in skin and joint fibroblasts.

With respect to their similar functions, both cytokines are needed for effective responses against mucoepithelial bacterial infections and synergistically cooperate to protect the host from fungal infections. Consistently, inborn errors of IL-17F, as well as of IL-17RA or ACT1, display chronic mucocutaneous candidiasis. Candida infections are also a common adverse event observed upon anti-IL-17A or anti-IL-17RA-targeted therapies. Whether bi-specific antibodies blocking both IL-17A and IL-17F have an increased risk of Candidiasis is not yet known. Despite having similar, and sometimes even synergistic actions in vitro, knock-out experiments in mice revealed also diverse roles of IL-17A and IL-17F in complex in vivo inflammatory settings. This might well reflect tissue-specific functions and the capacity of IL-17 cytokines to synergize with other inflammatory mediators. IL-17F, at difference to IL-17A, is not required in several T-cell-dependent autoimmune diseases in mice, while being pathogenic in DSS colitis model and in acute allergic responses in the lung. Nevertheless, IL-17F gene expression is increased in human active Crohn’s disease (CD) and multiple sclerosis. Finally, IL-17F was associated with increased susceptibility in many forms of human cancer, while playing rather a protective role in colon tumorigenesis in mice.

A detailed description of IL17F and its function can be found, e.g., in Brembilla, et al. "The IL-17 family of cytokines in psoriasis: IL-17A and beyond. " Frontiers in Immunology 9 (2018) : 1682; Chang, et al. "IL-17F: regulation, signaling and function in inflammation. " Cytokine 46.1 (2009) : 7-11; each of which is incorporated by reference in its entirety.

In human genomes, IL17F gene (Gene ID: 112744) locus has 3 exons, exon 1, exon 2, and exon 3 (FIG. 9B) . The nucleotide sequence for human IL17F mRNA is NM_052872.4, and the amino acid sequence for human IL17F is NP_443104.1 (SEQ ID NO: 8) . The location for each exon and each region in human IL17F nucleotide sequence and amino acid sequence is listed below:

Table 3

The human IL17F gene (Gene ID: 112744) is located in Chromosome 6 of the human genome, which is located from 52,236,681 to 52,245,689 of NC_000006.12 GRCh38. p13 (GCF_000001405.39) ) . The 5’-UTR is from 52,244,500 to 52,244,429, exon 1 is from 52,244,500 to 52,244,397, the first intron is from 52,244,396 to 52,238,951, exon 2 is from 52,238,950 to 52,238,730, the second intron is from 52,238,729 to 52,237,169, exon 3 is from 52,237, 168 to 52,236,681, and the 3’-UTR is from 52,236,930 to 52,236,681, based on transcript NM_052872.4. All relevant information for human IL17F locus can be found in the NCBI website with Gene ID: 112744, which is incorporated by reference herein in its entirety.

According to the UniProt Database (UniProt ID: Q96PD4) , human IL17F protein includes a signal peptide corresponds to amino acids 1-30 of SEQ ID NO: 8, and a mature protein chain corresponds to amino acids 31-163 of SEQ ID NO: 8.

In mice, IL17F gene locus has 3 exons, exon 1, exon 2, and exon 3 (FIG. 9A) . The nucleotide sequence for mouse IL17F mRNA is NM_145856.2, the amino acid sequence for mouse IL17F is NP_665855.2 (SEQ ID NO: 7) . The location for each exon and each region in the mouse IL17F nucleotide sequence and amino acid sequence is listed below:

Table 4

The mouse IL17F gene (Gene ID: 257630) is located in Chromosome 1 of the mouse genome, which is located from 20,777,146 to 20,785,274 of NC_000067.6 (GRCm38. p6 (GCF_000001635.26) ) . The 5’-UTR is from 20,784,270 to 20,784,200, exon 1 is from 20,784,270 to 20,784,173, the first intron is from 20,784,172 to 20,779,512, exon 2 is from20,779,511 to 20,779,291, the second intron is from 20,779,290 to 20,778,005, exon 3 is from 20,778,004 to 20,777,146, and the 3’-UTR is from 20,777,766 to 20,777,146, based on transcript NM_145856.2. All relevant information for mouse IL17F locus can be found in the NCBI website with Gene ID: 257630, which is incorporated by reference herein in its entirety.

According to the UniProt Database (UniProt ID: Q7TNI7) , mouse IL17F protein includes a signal peptide corresponds to amino acids 1-28 of SEQ ID NO: 7, and a mature protein chain corresponds to amino acids 29-161 of SEQ ID NO: 7.

FIG. 41 shows the alignment between mouse IL17F amino acid sequence (NP_665855.2; SEQ ID NO: 7) and human IL17F amino acid sequence (NP_443104.1; SEQ ID NO: 8) . Thus, the corresponding amino acid residue or region between mouse and humanIL17F can be found in FIG. 41.

IL17F genes, proteins, and locus of the other species are also known in the art. For example, the gene ID for IL17F in Rattus norvegicus (rat) is 301291, the gene ID for IL17F in Macaca mulatta (Rhesus monkey) is 708220, the gene ID for IL17F in Equus caballus (horse) is 100069094, the gene ID for IL17F in Oryctolagus cuniculus (rabbit) is 100339570, and the gene ID for IL17F in Felis catus (domestic cat) is101095826. The relevant information for these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, e.g., in NCBI database, which is incorporated by reference herein in its entirety. FIG. 42 shows the alignment between rodent IL17F amino acid sequence (NP_001015011.2; SEQ ID NO: 74) and human IL17F amino acid sequence (NP_443104.1; SEQ ID NO: 8) . Thus, the corresponding amino acid residue or region between rodent and human IL17F can be found in FIG. 42.

The present disclosure provides human or chimeric (e.g., humanized) IL17F nucleotide sequence and/or amino acid sequences. In some embodiments, the entire sequence of mouse exon 1, exon 2, exon 3, signal peptide, and/or mature IL17F, are replaced by the corresponding human sequence. In some embodiments, a “region” or a “portion” of mouse exon 1, exon 2, exon 3, signal peptide, and/or mature IL17F, are replaced by the corresponding human sequence. The term “region” or “portion” can refer to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, or 400 nucleotides, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, or 130amino acid residues. In some embodiments, the “region” or “portion” can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to exon 1, exon 2, exon 3, signal peptide, or mature IL17F. In some embodiments, a region, a portion, or the entire sequence of mouse exon 1, exon 2, and/or exon 3 (e.g., a portion of exon 2 and a portion of exon 3 of mouse IL17F gene) are replaced by human exon 1, exon 2, and/or exon 3 (e.g., a portion of exon 2 and a portion of exon 3 of human IL17F gene) sequence.

In some embodiments, the genetically-modified non-human animal described herein comprises a sequence encoding a humanized IL17F protein. In some embodiments, the humanized IL17F protein comprises a humanized signal peptide. In some embodiments, the humanized IL17F protein comprises an endogenous signal peptide. In some embodiments, the humanized IL17F protein comprises a humanized mature IL17F chain (e.g., without signal peptide) .

In some embodiments, the genetically-modified non-human animal described herein comprises a humanized IL17F gene. In some embodiments, the humanized IL17F gene comprises 3 exons. In some embodiments, the humanized IL17F gene comprises humanized exon 1, humanized exon 2, and/or humanized exon 3. In some embodiments, the humanized IL17F gene comprises endogenous exon 1, humanized exon 2, and/or humanized exon 3.

In some embodiments, the present disclosure also provides a chimeric (e.g., humanized) or human IL17F nucleotide sequence and/or amino acid sequences, wherein in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%of the sequence are identical to or derived from mouse IL17F mRNA sequence (e.g., NM_145856.2) , mouse IL17F amino acid sequence (e.g., NP_665855.2; SEQ ID NO: 7) , or a portion thereof (e.g., exon 1, a portion of exon 2, and a portion of exon 3 of NM_145856.2) ; and in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%of the sequence are identical to or derived from human IL17F mRNA sequence (e.g., NM_052872.4) , human IL17F amino acid sequence (e.g., NP_443104.1; SEQ ID NO: 8) , or a portion thereof (e.g., a portion of exon 2and a portion of exon 7of NM_052872.4) .

In some embodiments, the sequence encoding amino acids 1-161 of mouse IL17F (SEQ ID NO: 7) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human IL17F (e.g., amino acids 1-163 of human IL17F (SEQ ID NO: 8) ) .

In some embodiments, the sequence encoding amino acids 29-161 of mouse IL17F (SEQ ID NO: 7) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human IL17F (e.g., amino acids 31-163 of human IL17F (SEQ ID NO: 8) ) .

In some embodiments, the sequence encoding an endogenous mature IL17F protein (e.g., an amino acid sequence corresponding to amino acids 29-161 of SEQ ID NO: 7) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human IL17F (e.g., an amino acid sequence corresponding to amino acids 31-163 of SEQ ID NO: 8) .

In some embodiments, the nucleic acid sequence described herein are operably linked to a promotor or regulatory element, e.g., an endogenous mouse IL17F promotor, an inducible promoter, an enhancer, and/or mouse or human regulatory elements. In some embodiments, the nucleic acid sequence described herein is connected to an endogenous 5’ UTR. In some embodiments, the 5’ UTR is identical to nucleic acid positions 1-72 of exon 1 of NM_145856.2. In some embodiments, the nucleic acid sequence described herein is connected to a human 5’ UTR. In some embodiments, the nucleic acid sequence described herein is connected to an endogenous 3’ UTR. In some embodiments, the nucleic acid sequence described herein is connected to a human 3’ UTR.

In some embodiments, the nucleic acid sequence described herein has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is different from a portion of or the entire mouse IL17F nucleotide sequence (e.g., a portion of exon 2 and a portion of exon 3 of NM_145856.2) .

In some embodiments, the nucleic acid sequence described herein has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire mouse IL17F nucleotide sequence (e.g., exon 1, a portion of exon 2, and a portion of exon 3 of NM_145856.2) .

In some embodiments, the nucleic acid sequence described herein has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is different from a portion of or the entire human IL17F nucleotide sequence (e.g., exon 1, a portion of exon 2, and a portion of exon 3 of NM_052872.4) .

In some embodiments, the nucleic acid sequence described herein has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire human IL17F nucleotide sequence (e.g., a portion of exon 2 and a portion of exon 3 of NM_052872.4) .

In some embodiments, the amino acid sequence described herein has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire mouse IL17F amino acid sequence (e.g., NP_665855.2 (SEQ ID NO: 7) ) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire mouse IL17F amino acid sequence (e.g., NP_665855.2 (SEQ ID NO: 7) ) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire human IL17F amino acid sequence (e.g., NP_443104.1 (SEQ ID NO: 8) ) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire human IL17F amino acid sequence (e.g., NP_443104.1 (SEQ ID NO: 8) ) .

The present disclosure also provides a human or humanized IL17A amino acid sequence, or a human or humanized IL17F amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:

a) an amino acid sequence shown in SEQ ID NO: 1, 2, 7, 8, or 16;

b) an amino acid sequence having a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, 7, 8, or 16;

c) an amino acid sequence encoded by a nucleic acid sequence, wherein the nucleic acid sequence is able to hybridize to a nucleotide sequence encoding the amino acid shown in SEQ ID NO: 1, 2, 7, 8, or 16, under a low stringency condition or a strict stringency condition;

d) an amino acid sequence having a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, 7, 8, or 16;

e) an amino acid sequence that is different from the amino acid sequence shown in SEQ ID NO: 1, 2, 7, 8, or 16, by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or

f) an amino acid sequence that comprises a substitution, a deletion and/or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1, 2, 7, 8, or 16.

The present disclosure also relates to a IL17A nucleic acid (e.g., DNA or RNA) sequence, or a IL17F nucleic acid (e.g., DNA or RNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting of:

a) a nucleic acid sequence as shown in SEQ ID NO: 3, 4, 5, 6, 9, 10, 11, 12, 13, 14, 15, 24, 25, 55, or 56; a nucleic acid sequence encoding a homologous IL17A amino acid sequence of a humanized mouse IL17A; or a nucleic acid sequence encoding a homologous IL17F amino acid sequence of a humanized mouse IL17F;

b) a nucleic acid sequence that is shown in SEQ ID NO: 3, 4, 5, 6, 9, 10, 11, 12, 13, 14, 15, 24, 25, 55, or 56;

c) a nucleic acid sequence that is able to hybridize to the nucleotide sequence as shown in SEQ ID NO: 3, 4, 5, 6, 9, 10, 11, 12, 13, 14, 15, 24, 25, 55, or 56under a low stringency condition or a strict stringency condition;

d) a nucleic acid sequence that has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the nucleotide sequence as shown in SEQ ID NO: 3, 4, 5, 6, 9, 10, 11, 12, 13, 14, 15, 24, 25, 55, or 56;

e) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, 7, 8, or 16;

f) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%with, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, 7, 8, or 16;

g) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence is different from the amino acid sequence shown in SEQ ID NO: 1, 2, 7, 8, or 16 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and/or

h) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence comprises a substitution, a deletion and /or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1, 2, 7, 8, or 16.

The present disclosure also relates to a IL17A nucleic acid (e.g., DNA or RNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting of:

a) the transcribed mRNA sequence is all or part of the nucleotide sequence shown in SEQ ID NO: 6;

b) the transcribed mRNA sequence is at least 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or at least 99%identical to the nucleotide sequence shown in SEQ ID NO: 6;

c) the transcribed mRNA sequence differs from the nucleotide sequence shown in SEQ ID NO: 6 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide; and

d) the transcribed mRNA sequence is shown in the nucleotide sequence shown in SEQ ID NO: 6, including the nucleotide sequence of substitution, deletion and/or insertion of one or more nucleotides.

The present disclosure also relates to a IL17F nucleic acid (e.g., DNA or RNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting of:

a) the transcribed mRNA sequence is all or part of the nucleotide sequence shown in SEQ ID NO: 15;

b) the transcribed mRNA sequence is at least 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or at least 99%identical to the nucleotide sequence shown in SEQ ID NO: 15;

c) the transcribed mRNA sequence differs from the nucleotide sequence shown in SEQ ID NO: 15 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide; and

d) the transcribed mRNA sequence is shown in the nucleotide sequence shown inSEQ ID NO: 15, including the nucleotide sequence of substitution, deletion and/or insertion of one or more nucleotides.

The present disclosure further relates to an IL17A genomic DNA sequence of a humanized mouse IL17A, or an IL17F genomic DNA sequence of a humanized mouse IL17F. The DNA sequence is obtained by a reverse transcription of the mRNA obtained by transcription thereof is consistent with or complementary to the DNA sequence homologous to the sequence shown in SEQ ID NO: 5, 6, 11, or 15.

The disclosure also provides an amino acid sequence that has a homology of at least 90%with, or at least 90%identical to the sequence shown in SEQ ID NO: 1, 2, 7, 8, or 16, and has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 1, 2, 7, 8, or 16, is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 1, 2, 7, 8, or 16, is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

The disclosure also provides a nucleotide sequence that has a homology of at least 90%, or at least 90%identical to the sequence shown in SEQ ID NO: 5 or 6, and encodes a polypeptide that has IL17A protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 5 or 6 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

The disclosure also provides a nucleotide sequence that has a homology of at least 90%, or at least 90%identical to the sequence shown in SEQ ID NO: 11 or 15, and encodes a polypeptide that has IL17F protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 11 or 15 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 3, 4, 5, 6, 9, 10, 11, 12, 13, 14, 15, 24, 25, 55, or 56is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

The disclosure also provides a nucleic acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any nucleotide sequence as described herein, and an amino acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any amino acid sequence as described herein. In some embodiments, the disclosure relates to nucleotide sequences encoding any peptides that are described herein, or any amino acid sequences that are encoded by any nucleotide sequences as described herein. In some embodiments, the nucleic acid sequence is less than 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 150, 200, 250, 300, 350, 400, 500, or 600 nucleotides. In some embodiments, the amino acid sequence is less than 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 amino acid residues.

In some embodiments, the amino acid sequence (i) comprises an amino acid sequence; or (ii) consists of an amino acid sequence, wherein the amino acid sequence is any one of the sequences as described herein.

In some embodiments, the nucleic acid sequence (i) comprises a nucleic acid sequence; or (ii) consists of a nucleic acid sequence, wherein the nucleic acid sequence is any one of the sequences as described herein.

To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes) . The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. For illustration purposes, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.

The percentage of residues conserved with similar physicochemical properties (percent homology) , e.g. leucine and isoleucine, can also be used to measure sequence similarity. Families of amino acid residues having similar physicochemical properties have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine) , acidic side chains (e.g., aspartic acid, glutamic acid) , uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine) , nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) , beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine) . The homology percentage, in many cases, is higher than the identity percentage.

Cells, tissues, and animals (e.g., mouse) are also provided that comprise the nucleotide sequences as described herein, as well as cells, tissues, and animals (e.g., mouse) that express human or chimeric (e.g., humanized) IL17A and/or IL17F from an endogenous non-human IL17A locus and/or an endogenous non-human IL17F locus.

Genetically modified animals

As used herein, the term “genetically-modified non-human animal” refers to a non-human animal having exogenous DNA in at least one chromosome of the animal’s genome. In some embodiments, at least one or more cells, e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%of cells of the genetically-modified non-human animal have the exogenous DNA in its genome. The cell having exogenous DNA can be various kinds of cells, e.g., an endogenous cell, a somatic cell, an immune cell, a T cell, a B cell, an antigen presenting cell, a macrophage, a dendritic cell, a germ cell, a blastocyst, or an endogenous tumor cell. In some embodiments, genetically-modified non-human animals are provided that comprise a modified endogenous IL17A and/or IL17F locus that comprises an exogenous sequence (e.g., a human sequence) , e.g., a replacement of one or more non-human sequences with one or more human sequences. The animals are generally able to pass the modification to progeny, i.e., through germline transmission.

As used herein, the term “chimeric gene” or “chimeric nucleic acid” refers to a gene or a nucleic acid, wherein two or more portions of the gene or the nucleic acid are from different species, or at least one of the sequences of the gene or the nucleic acid does not correspond to the wild-type nucleic acid in the animal. In some embodiments, the chimeric gene or chimeric nucleic acid has at least one portion of the sequence that is derived from two or more different sources, e.g., sequences encoding different proteins or sequences encoding the same (or homologous) protein of two or more different species. In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized gene or humanized nucleic acid.

As used herein, the term “chimeric protein” or “chimeric polypeptide” refers to a protein or a polypeptide, wherein two or more portions of the protein or the polypeptide are from different species, or at least one of the sequences of the protein or the polypeptide does not correspond to wild-type amino acid sequence in the animal. In some embodiments, the chimeric protein or the chimeric polypeptide has at least one portion of the sequence that is derived from two or more different sources, e.g., same (or homologous) proteins of different species. In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized protein or a humanized polypeptide.

As used herein, the term “humanized protein” or “humanized polypeptide” refers to a protein or a polypeptide, wherein at least a portion of the protein or the polypeptide is from the human protein or human polypeptide. In some embodiments, the humanized protein or polypeptide is a human protein or polypeptide.

As used herein, the term “humanized nucleic acid” refers to a nucleic acid, wherein at least a portion of the nucleic acid is from the human. In some embodiments, the entire nucleic acid of the humanized nucleic acid is from human. In some embodiments, the humanized nucleic acid is a humanized exon. A humanized exon can be e.g., a human exon or a chimeric exon.

In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized IL17A gene or a humanized IL17A nucleic acid. In some embodiments, at least one or more portions of the gene or the nucleic acid is from the human IL17A gene. In some embodiments, the gene or the nucleic acid comprises a sequence that encodes a human or humanized IL17Aprotein. The encoded IL17A protein is functional or has at least one activity of the human IL17A protein and/or the non-human IL17A protein, e.g., interacting with human or non-human IL17F, forming a heterodimer that can interact with an IL17 receptor complex (e.g., formed by IL17RC and IL17RA) ; forming a homodimer that can interact with an IL17 receptor complex; stimulating expression of IL6 and PTGS2/COX-2; enhancing production of NO; stimulating NF-κB activity and IL6 in fibroblasts; and/or upregulating the immune response.

In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized IL17F gene or a humanized IL17F nucleic acid. In some embodiments, at least one or more portions of the gene or the nucleic acid is from the human IL17F gene. In some embodiments, the gene or the nucleic acid comprises a sequence that encodes a human or humanized IL17F protein. The encoded IL17F protein is functional or has at least one activity of the human IL17F protein and/or the non-human IL17F protein, e.g., interacting with human or non-human IL17A, forming a heterodimer that can interact with an IL17 receptor complex (e.g., formed by IL17RC and IL17RA) ; forming a homodimer that can interact withan IL17 receptor complex; inducing TGF-β and IL-2 expression in vein endothelial cells; inducing ICAM1 and GM-CSF expression in airway bronchial epithelial cells; upregulating the expression of IL6 and CXCL1 in fibroblasts and epithelial cells; and/or upregulating the immune response.

In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized IL17A protein or a humanized IL17A polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a human IL17A protein. The human IL17A protein or the humanized IL17A protein is functional or has at least one activity of the human IL17A protein or the non-human IL17A protein.

In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized IL17F protein or a humanized IL17F polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a human IL17F protein. The human IL17F protein or the humanized IL17F protein is functional or has at least one activity of the human IL17F protein or the non-human IL17F protein.

The genetically modified non-human animal can be various animals, e.g., a mouse, rat, rabbit, pig, bovine (e.g., cow, bull, buffalo) , deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey) . For the non-human animals where suitable genetically modifiable embryonic stem (ES) cells are not readily available, other methods are employed to make a non-human animal comprising the genetic modification. Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing nuclear transfer to transfer the modified genome to a suitable cell, e.g., an oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo. These methods are known in the art, and are described, e.g., in A. Nagy, et al., “Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition) , ” Cold Spring Harbor Laboratory Press, 2003, which is incorporated by reference herein in its entirety.

In one aspect, the animal is a mammal, e.g., of the superfamily Dipodoidea or Muroidea. In some embodiments, the genetically modified animal is a rodent. The rodent can be selected from a mouse, a rat, and a hamster. In some embodiments, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters) , Cricetidae (e.g., hamster, New World rats and mice, voles) , Muridae (true mice and rats, gerbils, spiny mice, crested rats) , Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice) , Platacanthomyidae (e.g., spiny dormice) , and Spalacidae (e.g., mole rates, bamboo rats, and zokors) . In some embodiments, the genetically modified rodent is selected from a true mouse or rat (family Muridae) , a gerbil, a spiny mouse, and a crested rat. In some embodiments, the non-human animal is a mouse.

In some embodiments, the animal is a mouse strain selected from BALB/c, A, A/He, A/J, A/WySN, AKR, AKR/A, AKR/J, AKR/N, TA1, TA2, RF, SWR, C3H, C57BR, SJL, C57L, DBA/2, KM, NIH, ICR, CFW, FACA, C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, C57BL/Ola, C57BL, C58, CBA/Br, CBA/Ca, CBA/J, CBA/st, or CBA/H. In some embodiments, the mouse is a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/SvIm) , 129S2, 129S4, 129S5, 129S9/SvEvH, 129S6 (129/SvEvTac) , 129S7, 129S8, 129T1, 129T2. These mice are described, e.g., in Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10: 836 (1999) ; Auerbach et al., Establishment and Chimera Analysis of 129/SvEv-and C57BL/6-Derived Mouse Embryonic Stem Cell Lines (2000) , both of which are incorporated herein by reference in the entirety. In some embodiments, the genetically modified mouse is a mix of the 129 strain and the C57BL/6 strain. In some embodiments, the mouse is a mix of the 129 strains, or a mix of the BL/6 strains. In some embodiments, the mouse is a BALB strain, e.g., BALB/c strain. In some embodiments, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50%BALB/c-50%12954/Sv; or 50%C57BL/6-50%129) .

In some embodiments, the animal is a rat. The rat can be selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In some embodiments, the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.

The animal can have one or more other genetic modifications, and/or other modifications, that are suitable for the particular purpose for which the humanized IL17A and/or IL17F animal is made. For example, suitable mice for maintaining a xenograft (e.g., a human cancer or tumor) , can have one or more modifications that compromise, inactivate, or destroy the immune system of the non-human animal in whole or in part. Compromise, inactivation, or destruction of the immune system of the non-human animal can include, for example, destruction of hematopoietic cells and/or immune cells by chemical means (e.g., administering a toxin) , physical means (e.g., irradiating the animal) , and/or genetic modification (e.g., knocking out one or more genes) . Non-limiting examples of such mice include, e.g., NOD-Prkdcscid IL-2rγ ^nullNOD mice, NOD-Rag 1-/--IL2rg-/- (NRG) mice, Rag 2-/--IL2rg-/- (RG) mice, SCID mice, NOD/SCID mice, IL2Rγknockout mice, NOD/SCID/γc ^null mice (Ito, M. et al., NOD/SCID/γcnull mouse: an excellent recipient mouse model for engraftment of human cells, Blood 100 (9) : 3175-3182, 2002) , nude mice, and Rag1 and/or Rag2 knockout mice. These mice can optionally be irradiated, or otherwise treated to destroy one or more immune cell type. Thus, in various embodiments, a genetically modified mouse is provided that can include a humanization of at least a portion of an endogenous non-human IL17A and/or IL17F locus, and further comprises a modification that compromises, inactivates, or destroys the immune system (or one or more cell types of the immune system) of the non-human animal in whole or in part. In some embodiments, modification is, e.g., selected from the group consisting of a modification that results in NOD-Prkdcscid IL-2rγ ^nullNOD mice, NOD-Rag 1-/--IL2rg-/- (NRG) mice, Rag 2-/--IL2rg-/- (RG) mice, NOD mice, SCID mice, NOD/SCID mice, IL-2Rγ knockout mice, NOD/SCID/γc null mice, nude mice, Rag1 and/or Rag2 knockout mice, and a combination thereof. These genetically modified animals are described, e.g., in US20150106961, which is incorporated herein by reference in its entirety.

In some embodiments, the non-human animal (e.g., mouse) can include a replacement of all or part of mature IL17A coding sequence with human mature IL17A coding sequence. In some embodiments, the non-human animal (e.g., mouse) can include a replacement of all or part of mature IL17A coding sequence with human mature IL17A coding sequence. In some embodiments, the non-human animal (e.g., mouse) can include a replacement of all or part of mature IL17F coding sequence with human mature IL17F coding sequence. In some embodiments, the non-human animal (e.g., mouse) can include a replacement of all or part of mature IL17F coding sequence with human mature IL17F coding sequence. In some embodiments, a mature protein described herein does not have a signal peptide.

In some embodiments, the genetically modified non-human animal comprises a modification of an endogenous non-human IL17A locus. In some embodiments, the modification can comprise a human nucleic acid sequence encoding at least a portion of a mature IL17A protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%or 100%identical to the mature IL17A protein sequence) . Although genetically modified cells are also provided that can comprise the modifications described herein (e.g., ES cells, somatic cells) , in many embodiments, the genetically modified non-human animals comprise the modification of the endogenous IL17A locus in the germline of the animal. In some embodiments, the genetically modified non-human animal comprises a modification of an endogenous non-human IL17F locus. In some embodiments, the modification can comprise a human nucleic acid sequence encoding at least a portion of a mature IL17F protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%or 100%identical to the mature IL17F protein sequence) . Although genetically modified cells are also provided that can comprise the modifications described herein (e.g., ES cells, somatic cells) , in many embodiments, the genetically modified non-human animals comprise the modification of the endogenous IL17F locus in the germline of the animal.

In some embodiments, the genetically modified mice express a human IL17A and/or a chimeric (e.g., humanized) IL17A from endogenous mouse loci, wherein the endogenous mouse IL17A gene has been replaced with a human IL17A gene and/or a nucleotide sequence that encodes a region of human IL17A sequence or an amino acid sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99%identical to the human IL17A sequence. In various embodiments, an endogenous non-human IL17A locus is modified in whole or in part to comprise human nucleic acid sequence encoding at least one protein-coding sequence of a mature IL17A protein. In some embodiments, the genetically modified mice express a human IL17F and/or a chimeric (e.g., humanized) IL17F from endogenous mouse loci, wherein the endogenous mouse IL17F gene has been replaced with a human IL17F gene and/or a nucleotide sequence that encodes a region of human IL17F sequence or an amino acid sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99%identical to the human IL17F sequence. In various embodiments, an endogenous non-human IL17F locus is modified in whole or in part to comprise human nucleic acid sequence encoding at least one protein-coding sequence of a mature IL17F protein.

In some embodiments, the genetically modified mice express the human IL17A and/or chimeric IL17A (e.g., humanized IL17A) from endogenous loci that are under control of mouse promoters and/or mouse regulatory elements. The replacement (s) at the endogenous mouse loci provide non-human animals that express human IL17A or chimeric IL17A (e.g., humanized IL17A) in appropriate cell types and in a manner that does not result in the potential pathologies observed in some other transgenic mice known in the art. The human IL17A or the chimeric IL17A (e.g., humanized IL17A) expressed in animal can maintain one or more functions of the wild-type mouse or human IL17A in the animal. For example, human or non-human IL17 receptors (e.g., formed by IL17RC and IL17RA) can bind to the expressed IL17A (a IL17A/IL17A homodimer or a IL17A/IL17F heterodimer) , and trigger an inflammatory cascade. Furthermore, in some embodiments, the animal does not express endogenous IL17A. As used herein, the term “endogenous IL17A” refers to IL17A protein that is expressed from an endogenous IL17A nucleotide sequence of the non-human animal (e.g., mouse) before any genetic modification.

In some embodiments, the genetically modified mice express the human IL17F and/or chimeric IL17F (e.g., humanized IL17F) from endogenous loci that are under control of mouse promoters and/or mouse regulatory elements. The replacement (s) at the endogenous mouse loci provide non-human animals that express human IL17F or chimeric IL17F (e.g., humanized IL17F) in appropriate cell types and in a manner that does not result in the potential pathologies observed in some other transgenic mice known in the art. The human IL17F or the chimeric IL17F (e.g., humanized IL17F) expressed in animal can maintain one or more functions of the wild-type mouse or human IL17F in the animal. For example, human or non-human IL17receptors (e.g., formed by IL17RC and IL17RA) can bind to the expressed IL17F (a IL17F/IL17F homodimer or a IL17A/IL17F heterodimer) , and trigger an inflammatory cascade. Furthermore, in some embodiments, the animal does not express endogenous IL17F. As used herein, the term “endogenous IL17F” refers to IL17F protein that is expressed from an endogenous IL17F nucleotide sequence of the non-human animal (e.g., mouse) before any genetic modification.

The genome of the animal can comprise a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human IL17A (e.g., NP_002181.1 (SEQ ID NO: 2) ) . In some embodiments, the genome comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 2. The genome of the animal can comprise a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human IL17F (e.g., NP_443104.1 (SEQ ID NO: 8) ) . In some embodiments, the genome comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 8.

The genome of the genetically modified animal can comprise a replacement at an endogenous IL17A gene locus of a sequence encoding a region of endogenous IL17A with a sequence encoding a corresponding region of human IL17A. In some embodiments, the sequence that is replaced is any sequence within the endogenous IL17A gene locus, e.g., exon 1, exon 2, exon 3, 5’-UTR, 3’-UTR, the first intron, the second intron, etc. In some embodiments, the sequence that is replaced is within the regulatory region of the endogenous IL17A gene. In some embodiments, the sequence that is replaced is exon 1, exon 2, exon 3, or a part thereof, of an endogenous mouse IL17A gene locus. In some embodiments, the sequence that is replaced starts within exon 1 and ends within exon 3 of an endogenous mouse IL17A gene locus. In some embodiments, the coding region (starting from the “A” of start codon ATG and ending at the second “A” of stop codon TAA) of endogenous mouse IL17A gene is replaced.

The genome of the genetically modified animal can comprise a replacement at an endogenous IL17F gene locus of a sequence encoding a region of endogenous IL17F with a sequence encoding a corresponding region of human IL17F. In some embodiments, the sequence that is replaced is any sequence within the endogenous IL17F gene locus, e.g., exon 1, exon 2, exon 3, 5’-UTR, 3’-UTR, the first intron, the second intron, etc. In some embodiments, the sequence that is replaced is within the regulatory region of the endogenous IL17F gene. In some embodiments, the sequence that is replaced is exon 2, exon 3, or a part thereof, of an endogenous mouse IL17F gene locus. In some embodiments, the sequence that is replaced starts within exon 2 and ends within exon 3 of an endogenous mouse IL17F gene locus. In some embodiments, the sequence that is replaced starts within exon 1 and ends within eon 3 of an endogenous mouse IL17F gene locus. In some embodiments, the coding region (starting from the “A” of start codon ATG and ending at the second “A” of stop codon TAA) of endogenous mouse IL17F gene is replaced.

In some embodiments, the genetically modified animal does not express endogenous IL17A. In some embodiments, the genetically modified animal expresses a decreased level of endogenous IL17A as compared to a wild-type animal. In some embodiments, the genetically modified animal does not express endogenous IL17F. In some embodiments, the genetically modified animal expresses a decreased level of endogenous IL17F as compared to a wild-type animal.

Furthermore, the genetically modified animal can be heterozygous with respect to the replacement at the endogenous IL17A locus, or homozygous with respect to the replacement at the endogenous IL17A locus. Furthermore, the genetically modified animal can be heterozygous with respect to the replacement at the endogenous IL17F locus, or homozygous with respect to the replacement at the endogenous IL17F locus.

In some embodiments, the humanized IL17A locus lacks a human IL17A 5’-UTR. In some embodiment, the humanized IL17A locus comprises a rodent (e.g., mouse) 5’-UTR. In some embodiments, the humanization comprises a human 3’-UTR. In some embodiments, the humanization comprises a mouse 3’-UTR. In appropriate cases, it may be reasonable to presume that the mouse and human IL17A genes appear to be similarly regulated based on the similarity of their 5’-flanking sequence. As shown in the present disclosure, humanized IL17A mice that comprise a replacement at an endogenous mouse IL17A locus, which retain mouse regulatory elements but comprise a humanization of IL17A encoding sequence, do not exhibit pathologies. Both genetically modified mice that are heterozygous or homozygous for humanized IL17A are grossly normal.

In some embodiments, the humanized IL17F locus lacks a human IL17F 5’-UTR. In some embodiment, the humanized IL17F locus comprises a rodent (e.g., mouse) 5’-UTR. In some embodiments, the humanization comprises a human 3’-UTR. In some embodiments, the humanization comprises a mouse 3’-UTR. In appropriate cases, it may be reasonable to presume that the mouse and human IL17F genes appear to be similarly regulated based on the similarity of their 5’-flanking sequence. As shown in the present disclosure, humanized IL17F mice that comprise a replacement at an endogenous mouse IL17F locus, which retain mouse regulatory elements but comprise a humanization of IL17F encoding sequence, do not exhibit pathologies. Both genetically modified mice that are heterozygous or homozygous for humanized IL17F are grossly normal.

The present disclosure further relates to a non-human mammal generated through the method mentioned above. In some embodiments, the genome thereof contains human gene (s) .

In some embodiments, the non-human mammal is a rodent, and preferably, the non-human mammal is a mouse.

In some embodiments, the non-human mammal expresses a protein encoded by a humanized IL17A gene. In some embodiments, the non-human mammal expresses a protein encoded by a humanized IL17F gene.

In addition, the present disclosure also relates to a tumor bearing non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein. In some embodiments, the non-human mammal is a rodent (e.g., a mouse) .

The present disclosure further relates to a cell or cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; and the tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.

The present disclosure also provides non-human mammals produced by any of the methods described herein. In some embodiments, a non-human mammal is provided; and the genetically modified animal contains the DNA encoding human or humanized IL17A in the genome of the mammal. The present disclosure also provides non-human mammals produced by any of the methods described herein. In some embodiments, a non-human mammal is provided; and the genetically modified animal contains the DNA encoding human or humanized IL17F in the genome of the mammal.

In some embodiments, the non-human mammal comprises the genetic construct as described herein (e.g., gene construct as shown in FIG. 2 or FIG. 10) . In some embodiments, a non-human mammal expressing human or humanized IL17A is provided. In some embodiments, a non-human mammal expressing human or humanized IL17F is provided. In some embodiments, the tissue-specific expression of human or humanized IL17A protein is provided. In some embodiments, the tissue-specific expression of human or humanized IL17F protein is provided.

In some embodiments, the expression of human or humanized IL17A in a genetically modified animal is controllable, as by the addition of a specific inducer or repressor substance. In some embodiments, the expression of human or humanized IL17F in a genetically modified animal is controllable, as by the addition of a specific inducer or repressor substance. In some embodiments, the specific inducer is selected from Tet-Off System/Tet-On System, or Tamoxifen System.

Non-human mammals can be any non-human animal known in the art and which can be used in the methods as described herein. Preferred non-human mammals are mammals, (e.g., rodents) . In some embodiments, the non-human mammal is a mouse.

Genetic, molecular and behavioral analyses for the non-human mammals described above can be performed. The present disclosure also relates to the progeny produced by the non-human mammal provided by the present disclosure mated with the same or other genotypes.

The present disclosure also provides a cell line or primary cell culture derived from the non-human mammal or a progeny thereof. A model based on cell culture can be prepared, for example, by the following methods. Cell cultures can be obtained by way of isolation from a non-human mammal, alternatively cell can be obtained from the cell culture established using the same constructs and the standard cell transfection techniques. The integration of genetic constructs containing DNA sequences encoding human IL17A and/or IL17F protein can be detected by a variety of methods.

There are many analytical methods that can be used to detect exogenous DNA, including methods at the level of nucleic acid (including the mRNA quantification approaches using reverse transcriptase polymerase chain reaction (RT-PCR) or Southern blotting, and in situ hybridization) and methods at the protein level (including histochemistry, immunoblot analysis and in vitro binding studies) . In addition, the expression level of the gene of interest can be quantified by ELISA techniques well known to those skilled in the art. Many standard analysis methods can be used to complete quantitative measurements. For example, transcription levels can be measured using RT-PCR and hybridization methods including RNase protection, Southern blot analysis, RNA dot analysis (RNAdot) analysis. Immunohistochemical staining, flow cytometry, Western blot analysis can also be used to assess the presence of human or humanized IL17A and/or IL17F protein.

In some embodiments, provided herein is a genetically modified non-human animal expressing a human or humanized IL17F protein. In some embodiments, the human or humanized IL17F protein can be selected from the group consisting of:

a) all or part of the amino acid sequence shown in amino acids 31-163 of SEQ ID NO: 8;

b) an amino acid sequence that is at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or at least 99%identical to amino acids 31-163 of SEQ ID NO: 8;

c) an amino acid sequence differs from the nucleotide sequence shown in amino acids 31-163 of SEQ ID NO: 8 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and d) an amino acid sequence that is shown in amino acids 31-163 of SEQ ID NO: 8, including substitution, deletion and/or insertion of one or more amino acids.

In some embodiments, the human or humanized IL17F protein comprises a sequence that is at least 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or at least 99%identical to amino acids 1-28 of SEQ ID NO: 7. In some embodiments, the human or humanized IL17F protein comprises a sequence that is identical to amino acids 1-28 of SEQ ID NO: 7.

The present disclosure also relates to a genetically modified non-human animal whose genome comprises a IL17A nucleic acid (e.g., DNA or RNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting of:

a) all or part of the nucleotide sequence shown in SEQ ID NO: 5 or 6;

b) a nucleic acid sequence is at least 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or at least 99%identical to the nucleotide sequence shown in SEQ ID NO: 5 or 6;

c) a nucleic acid sequence differs from the nucleotide sequence shown in SEQ ID NO: 5 or 6 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide; and

d) a nucleic acid that is shown in SEQ ID NO: 5 or 6, including substitution, deletion and/or insertion of one or more nucleotides.

The present disclosure also relates to a genetically modified non-human animal whose genome comprises a IL17F nucleic acid (e.g., DNA or RNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting of:

a) all or part of the nucleotide sequence shown in SEQ ID NO: 11, 15, or 55;

b) a nucleic acid sequence is at least 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%or at least 99%identical to the nucleotide sequence shown in SEQ ID NO: 11, 15, or 55;

c) a nucleic acid sequence differs from the nucleotide sequence shown in SEQ ID NO: 11, 15, or 55 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 nucleotide; and

d) a nucleic acid that is shown in SEQ ID NO: 11, 15, or 55, including substitution, deletion and/or insertion of one or more nucleotides.

Vectors

In one aspect, the present disclosure relates to a targeting vector, comprising: a) a DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) , which is selected from the IL17A gene genomic DNAs in the length of 100 to 10,000 nucleotides; b) a desired/donor DNA sequence encoding a donor region; and c) a second DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) , which is selected from the IL17A gene genomic DNAs in the length of 100 to 10,000 nucleotides.

In some embodiments, a) the DNA fragment homologous to the 5’ end of a conversion region to be altered (5’ arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000067.6; c) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000067.6.

In some embodiments, a) the DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) is selected from the nucleotides from the position 20727254 to the position 20730961 of the NCBI accession number NC_000067.6; c) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotides from the position 20735137 to the position 20739901 of the NCBI accession number NC_000067.6.

In some embodiments, the length of the selected genomic nucleotide sequence in the targeting vector can be more than about 1 kb, about 1.5 kb, about 2 kb, about 2.5 kb, 3 kb, about 3.5 kb, about 4 kb, about 4.5 kb, about 5 kb, about 5.5 kb, or about 6 kb.

In some embodiments, the region to be altered is exon 1, exon 2, exon 3 of IL17A gene (e.g., a portion of exon 1, exon 2, and a portion of exon 3 of mouse IL17A gene) .

The targeting vector can further include a selected gene marker.

In some embodiments, the sequence of the 5’ arm is shown in SEQ ID NO: 3; and the sequence of the 3’ arm is shown in SEQ ID NO: 4.

In some embodiments, the sequence is derived from human (e.g., 20735137-20739901 of NC_000067.6) . For example, the target region in the targeting vector is a part or entirety of the nucleotide sequence of a human IL17A, preferably comprising exon 1, exon 2, and/or exon 3, or a part thereof, of the human IL17A. In some embodiments, the nucleotide sequence of the humanized IL17A encodes the entire or the part of human IL17A protein with the NCBI accession number NP_002181.1 (SEQ ID NO: 2) .

In one aspect, the present disclosure relates to a targeting vector, comprising: a) a DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) , which is selected from the IL17F gene genomic DNAs in the length of 100 to 10,000 nucleotides; b) a desired/donor DNA sequence encoding a donor region; and c) a second DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) , which is selected from the IL17F gene genomic DNAs in the length of 100 to 10,000 nucleotides.

In some embodiments, a) the DNA fragment homologous to the 5’ end of a conversion region to be altered (5’ arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000067.6; the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000067.6.

In some embodiments, a) the DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) is selected from the nucleotides from the position 20782346 to the position 20779455 of the NCBI accession number NC_000067.6; the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotides from the position 20776845 to the position 20772788 of the NCBI accession number NC_000067.6.

In some embodiments, a) the DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) is selected from the nucleotides from the position 20781021 to the position 20779455 of the NCBI accession number NC_000067.6; the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotides from the position 20777766 to the position 20776366 of the NCBI accession number NC_000067.6.

In some embodiments, the region to be altered is exon 1, exon 2, and/or exon 3 of IL17Fgene (e.g., a portion of exon 2 and a portion of exon 3 of mouse IL17F gene) .

The targeting vector can further include a selected gene marker.

In some embodiments, the sequence of the 5’ arm is shown in SEQ ID NO: 9; and the sequence of the 3’ arm is shown in SEQ ID NO: 10. In some embodiments, the sequence of the 5’ arm is shown in SEQ ID NO: 24; and the sequence of the 3’ arm is shown in SEQ ID NO: 25.

In some embodiments, the sequence is derived from human (e.g., 52238893-52236931 of NC_000006.12) . For example, the target region in the targeting vector is a part or entirety of the nucleotide sequence of a human IL17F, preferably comprising exon 1, exon 2, and/or exon 3, or a part thereof, of the human IL17F. In some embodiments, the nucleotide sequence of the humanized IL17F encodes the entire or the part of human IL17F protein with the NCBI accession number NP_443104.1 (SEQ ID NO: 8) .

The disclosure also relates to a cell comprising the targeting vectors as described above.

In addition, the present disclosure further relates to a non-human mammalian cell, having any one of the foregoing targeting vectors, and one or more in vitro transcripts of the construct as described herein. In some embodiments, the cell includes Cas9 mRNA or an in vitro transcript thereof.

In some embodiments, the genes in the cell are heterozygous. In some embodiments, the genes in the cell are homozygous.

In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is an embryonic stem cell.

The disclosure also provides vectors for constructing a humanized animal model or a knock-out model. In some embodiments, the vectors comprise sgRNA sequence, wherein the sgRNA sequence target IL17A or IL17G gene, and the sgRNA is unique on the target sequence of the gene to be altered. In some embodiments, the sgRNA meets the sequence arrangement rule of 5’-NNN (20) -NGG3’ or 5’-CCN-N (20) -3’.

In some embodiments, the targeting site of the sgRNA in the mouse IL17F gene is located on the exon 1, exon 2, exon 3, intron 1, intron 2, upstream of exon 1, or downstream of exon 3 of the mouse IL17F gene. In some embodiments, the 5’ targeting site is located on exon 2 of the mouse IL17F gene. In some embodiments, the 3’ targeting site is located on exon 3 of the mouse IL17F gene.

In some embodiments, the 5’ targeting site sequences of the sgRNA are shown as SEQ ID NOs: 26-33, and the sgRNA recognizes the 5’ targeting site. In some embodiments, the 3’ targeting sequences for the sgRNA are shown as SEQ ID NOs: 34-41 and the sgRNA recognizes the 3’ targeting site. In some embodiments, the 5’ targeting sequence is SEQ ID NO: 29 and the 3’ targeting sequence is SEQ ID NO: 34. Thus, the disclosure provides sgRNA sequences for constructing a genetically modified animal model.

In some embodiments, the disclosure provides DNA sequences encoding the sgRNAs. In some embodiments, the disclosure relates to a plasmid construct (e.g., pT7-sgRNA) including the sgRNA sequence, and/or a cell including the construct.

Methods of making genetically modified animals

Genetically modified animals can be made by several techniques that are known in the art, including, e.g., non-homologous end-joining (NHEJ) , homologous recombination (HR) , zinc finger nucleases (ZFNs) , transcription activator-like effector-based nucleases (TALEN) , and the clustered regularly interspaced short palindromic repeats (CRISPR) -Cas system. In some embodiments, homologous recombination is used. In some embodiments, CRISPR-Cas9 genome editing is used to generate genetically modified animals. Many of these genome editing techniques are known in the art, and is described, e.g., in Yin et al., "Delivery technologies for genome editing, " Nature Reviews Drug Discovery 16.6 (2017) : 387-399, which is incorporated by reference in its entirety. Many other methods are also provided and can be used in genome editing, e.g., micro-injecting a genetically modified nucleus into an enucleated oocyte, and fusing an enucleated oocyte with another genetically modified cell.

Thus, in some embodiments, the disclosure provides replacing in at least one cell of the animal, at an endogenous IL17A gene locus, a sequence encoding a region of an endogenous IL17A with a sequence encoding a corresponding region of human or chimeric IL17A. In some embodiments, the disclosure provides replacing in at least one cell of the animal, at an endogenous IL17F gene locus, a sequence encoding a region of an endogenous IL17F with a sequence encoding a corresponding region of human or chimeric IL17F. In some embodiments, the replacement occurs in a germ cell, a somatic cell, a blastocyst, or a fibroblast, etc. The nucleus of a somatic cell or the fibroblast can be inserted into an enucleated oocyte.

FIG. 3 shows a humanization strategy for a mouse IL17A locus. In FIG. 3, the targeting strategy involves a vector comprising the 5’ end homologous arm, human IL17A gene fragment, 3’ homologous arm. The process can involve replacing endogenous IL17A sequence with human sequence by homologous recombination. In some embodiments, the cleavage at the upstream and the downstream of the target site (e.g., by zinc finger nucleases, TALEN or CRISPR) can result in DNA double strands break, and the homologous recombination is used to replace endogenous IL17A sequence with human IL17A sequence.

Thus, in some embodiments, the methods for making a genetically modified, humanized animal, can include the step of replacing at an endogenous IL17A locus (or site) , a nucleic acid encoding a sequence encoding a region of endogenous IL17A with a sequence encoding a corresponding region of human IL17A. The sequence can include a region (e.g., a part or the entire region) of exon 1, exon 2, and/or exon 3of an endogenous or human IL17A gene. In some embodiments, the sequence includes a region of exon 1, exon 2, and a region of exon 3 of a human IL17A gene (e.g., a sequence encoding amino acids 1-155 of SEQ ID NO: 2) . In some embodiments, the endogenous IL17A locus is exon 1, exon 2, and/or exon 3 of mouse IL17A gene (e.g., a sequence encoding amino acids 1-158 of SEQ ID NO: 1) .

In some embodiments, the methods of modifying a IL17A locus of a mouse to express a chimeric human/mouse IL17A peptide or human IL17A can include the steps of replacing at the endogenous mouse IL17A locus a nucleotide sequence encoding a mouse IL17A with a nucleotide sequence encoding a human IL17A, thereby generating a sequence encoding a chimeric human/mouse IL17A peptide or human IL17A.

In some embodiments, provided herein is a genetically-modified non-human animal whose genome comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 3, 4, 5. or 6.

FIG. 11 shows a humanization strategy for a mouse IL17F locus. In FIG. 11, the targeting strategy involves a vector comprising the 5’ end homologous arm, human IL17F gene fragment, 3’ homologous arm. The process can involve replacing endogenous IL17F sequence with human sequence by homologous recombination. In some embodiments, the cleavage at the upstream and the downstream of the target site (e.g., by zinc finger nucleases, TALEN or CRISPR) can result in DNA double strands break, and the homologous recombination is used to replace endogenous IL17F sequence with human IL17F sequence.

Thus, in some embodiments, the methods for making a genetically modified, humanized animal, can include the step of replacing at an endogenous IL17F locus (or site) , a nucleic acid encoding a sequence encoding a region of endogenous IL17F with a sequence encoding a corresponding region of human IL17F. The sequence can include a region (e.g., a part or the entire region) of exon 1, exon 2, and/or exon 3of an endogenous or human IL17F gene. In some embodiments, the sequence includes a region of exon 2and a region of exon 3 of a human IL17F gene (e.g., a sequence encoding amino acids 31-163 of SEQ ID NO: 8) . In some embodiments, the endogenous IL17F locus is exon 1, exon 2, and/or exon 3 of mouse IL17F gene (e.g., a sequence encoding amino acids 29-161 of SEQ ID NO: 7) .

In some embodiments, the methods of modifying a IL17F locus of a mouse to express a chimeric human/mouse IL17F peptide or human IL17F can include the steps of replacing at the endogenous mouse IL17F locus a nucleotide sequence encoding a mouse IL17F with a nucleotide sequence encoding a human IL17F, thereby generating a sequence encoding a chimeric human/mouse IL17F peptide or human IL17F.

In some embodiments, provided herein is a genetically-modified non-human animal whose genome comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 9, 10, 11, 12, 13, 14, 15, 24, 25, 55, or 56.

In some embodiments, the nucleotide sequences as described herein do not overlap with each other (e.g., the 5’ homologous arm, the “A fragment” , the “A1 fragment” , and/or the 3’ homologous arm do not overlap) . In some embodiments, the amino acid sequences as described herein do not overlap with each other.

The present disclosure further provides a method for establishing a IL17A and/or IL17F gene humanized animal model, involving the following steps:

(a) providing the cell (e.g. an embryonic stem cell) based on the methods described herein;

(b) culturing the cell in a liquid culture medium;

(c) transplanting the cultured cell to the fallopian tube or uterus of the recipient female non-human mammal, allowing the cell to develop in the uterus of the female non-human mammal;

(d) identifying the germline transmission in the offspring genetically modified humanized non-human mammal of the pregnant female in step (c) .

In some embodiments, the non-human mammal in the foregoing method is a mouse (e.g., a C57BL/6 mouse) .

In some embodiments, the non-human mammal in step (c) is a female with pseudopregnancy (or false pregnancy) .

In some embodiments, the embryonic stem cells for the methods described above are C57BL/6 embryonic stem cells. Other embryonic stem cells that can also be used in the methods as described herein include, but are not limited to, FVB/N embryonic stem cells, BALB/c embryonic stem cells, DBA/1 embryonic stem cells and DBA/2 embryonic stem cells.

Embryonic stem cells can come from any non-human animal, e.g., any non-human animal as described herein. In some embodiments, the embryonic stem cells are derived from rodents. The genetic construct can be introduced into an embryonic stem cell by microinjection of DNA. For example, by way of culturing an embryonic stem cell after microinjection, a cultured embryonic stem cell can be transferred to a false pregnant non-human animal, which then gives birth of a non-human mammal, so as to generate the non-human mammal mentioned in the methods described above.

Methods of using genetically modified animals

Replacement of non-human genes in a non-human animal with homologous or orthologous human genes or human sequences, at the endogenous non-human locus and under control of endogenous promoters and/or regulatory elements, can result in a non-human animal with qualities and characteristics that may be substantially different from a typical knockout- plus-transgene animal. In the typical knockout-plus-transgene animal, an endogenous locus is removed or damaged and a fully human transgene is inserted into the animal's genome and presumably integrates at random into the genome. Typically, the location of the integrated transgene is unknown; expression of the human protein is measured by transcription of the human gene and/or protein assay and/or functional assay.

In some cases, the transgene with human regulatory elements expresses in a manner that is unphysiological or otherwise unsatisfactory, and can be actually detrimental to the animal. The disclosure demonstrates that a replacement with human sequence at an endogenous locus under control of endogenous regulatory elements provides a physiologically appropriate expression pattern and level that results in a useful humanized animal whose physiology with respect to the replaced gene are meaningful and appropriate in the context of the humanized animal's physiology.

Genetically modified animals that express human or humanized IL17A and/or IL17F protein, e.g., in a physiologically appropriate manner, provide a variety of uses that include, but are not limited to, developing therapeutics for human diseases and disorders, and assessing the toxicity and/or the efficacy of these human therapeutics in the animal models.

In various aspects, genetically modified animals are provided that express human or humanized IL17A, which are useful for testing agents that can decrease or block the interaction between two IL17A molecules, the interaction betweenIL17A and IL17F, the interaction between IL17A and IL17 receptors (e.g., a receptor complex formed by IL17RC and IL17RA) , or the interaction between IL17A and anti-human IL17A antibodies, testing whether an agent can increase or decrease the immune response, and/or determining whether an agent is an IL17A agonist or antagonist. In various aspects, genetically modified animals are provided that express human or humanized IL17F, which are useful for testing agents that can decrease or block the interaction between two IL17A molecules, the interaction between IL17A and IL17F, the interaction betweenIL17F and IL17 receptors (e.g., a receptor complex formed by IL17RC and IL17RA) or the interaction between IL17F and anti-human IL17F antibodies, testing whether an agent can increase or decrease the immune response, and/or determining whether an agent is an IL17F agonist or antagonist. The genetically modified animals can be, e.g., an animal model of a human disease, e.g., the disease is induced genetically (a knock-in or knockout) . In various embodiments, the genetically modified non-human animals further comprise an impaired immune system, e.g., a non-human animal genetically modified to sustain or maintain a human xenograft, e.g., a human solid tumor or a blood cell tumor (e.g., a lymphocyte tumor, e.g., a B or T cell tumor) .

In one aspect, the disclosure also provides methods of determining effectiveness of an IL17A antagonist (e.g., an anti-IL17A antibody) for reducing inflammation. The methods involve administering the IL17A antagonist to the animal described herein, wherein the animal has an inflammation; and determining effects of the IL17A antagonist for reducing the inflammation. In one aspect, the disclosure also provides methods of determining effectiveness of an IL17F antagonist (e.g., an anti-IL17F antibody) for reducing inflammation. The methods involve administering the IL17F antagonist to the animal described herein, wherein the animal has an inflammation; and determining effects of the IL17F antagonist for reducing the inflammation.

In one aspect, the disclosure also provides methods of determining effectiveness of an IL17A antagonist (e.g., an anti-IL17A antibody) for treating an immune disorder (e.g., an autoimmune disorder or allergic disorder) . The methods involve administering the IL17A antagonist to the animal described herein, wherein the animal has an immune disorder; and determining effects of the IL17A antagonist for treating the immune disorder. In one aspect, the disclosure also provides methods of determining effectiveness of an IL17F antagonist (e.g., an anti-IL17F antibody) for treating an immune disorder (e.g., an autoimmune disorder or allergic disorder) . The methods involve administering the IL17F antagonist to the animal described herein, wherein the animal has an immune disorder; and determining effects of the IL17F antagonist for treating the immune disorder.

In one aspect, the disclosure also provides methods of determining effectiveness of a therapeutic agent for treating autoimmune disorder. The methods involve administering the therapeutic agent to the animal described herein, wherein the animal has an autoimmune disorder; and determining effects of the therapeutic agent for treating the autoimmune disorder. In some embodiments, the autoimmune disorder is psoriasis. In some embodiments, psoriasis is induced, e.g., by applying an immune response modifier (e.g., 5%imiquimod cream) to the skin of the animal (e.g., mouse) . In some embodiments, the immune response modifier induces local inflammatory effects of the skin. In some embodiments, the skin is shaved before applying the immune response modifier. In some embodiments, the therapeutic agent is a steroid or corticosteroid, e.g., bethamethasone, prednisone, prednisolone, triamcinolone, methylprednisolone, or dexamethasone. In some embodiments, the therapeutic agent is hydrocortisone, calamine lotion, camphor, or benzocaine. In some embodiments, the therapeutic agent is an anti-IL17A or anti-IL17F antibody. In some embodiments, the therapeutic agent is a non-steroidal anti-inflammatory drug, disease-modifying antirheumatic drug, or immunosuppressant. In some embodiments, the effects are evaluated by clinical scores (e.g., Psoriasis Area Severity Index to measure the severity and extent of psoriasis) . In some embodiments, the effects are evaluated by staining the relevant skin tissues, e.g., by hematoxylin and eosin (HE) staining. Details of imiquimod-induced psoriasis model can be found, e.g., in Sakai, Kent, et al. "Mouse model of imiquimod-induced psoriatic itch. " Pain 157.11 (2016) : 2536, which is incorporated herein by reference in its entirety.

In some embodiments, the genetically modified animals can be used for determining effectiveness of a therapeutic agent (e.g., an anti-IL17A antibody or an anti-IL17F antibody) for treating cancer. The methods involve administering the therapeutic agent to the animal as described herein, wherein the animal has a tumor; and determining the inhibitory effects of the therapeutic agent to the tumor. The inhibitory effects that can be determined include, e.g., a decrease of tumor size or tumor volume, a decrease of tumor growth, a reduction of the increase rate of tumor volume in a subject (e.g., as compared to the rate of increase in tumor volume in the same subject prior to treatment or in another subject without such treatment) , a decrease in the risk of developing a metastasis or the risk of developing one or more additional metastasis, an increase of survival rate, and an increase of life expectancy, etc. The tumor volume in a subject can be determined by various methods, e.g., as determined by direct measurement, MRI or CT.

In some embodiments, the anti-IL17A or anti-IL17F antibody is a monoclonal antibody. In some embodiments, the anti-IL17A or anti-IL17F antibody is Secukinumab, Ixekizumab, or Bimekizumab.

In some embodiments, the tumor comprises one or more cancer cells (e.g., human or mouse cancer cells) that are injected into the animal. In some embodiments, the anti-IL17A antibody prevents the IL17RA/IL17RC receptor complex from binding to IL17A. In some embodiments, the anti-IL17A antibody does not prevent the IL17RA/IL17RC receptor complex from binding to IL17A. In some embodiments, the anti-IL17F antibody prevents the IL17RA/IL17RC receptor complex from binding to IL17F. In some embodiments, the anti-IL17F antibody does not prevent the IL17RA/IL17RC receptor complex from binding to IL17F.

In some embodiments, the genetically modified animals can be used for determining whether an anti-IL17A antibody is a IL17A agonist or antagonist. In some embodiments, the methods as described herein are also designed to determine the effects of a therapeutic agent (e.g., a steroid (e.g., dexamethasone) , or anti-IL17A antibodies) on IL17A, e.g., reducing inflammation. In some embodiments, the genetically modified animals can be used for determining whether an anti-IL17F antibody is a IL17F agonist or antagonist. In some embodiments, the methods as described herein are also designed to determine the effects of a therapeutic agent (e.g., a steroid (e.g., dexamethasone) , or anti-IL17F antibodies) on IL17F, e.g., reducing inflammation. In some embodiments, the genetically modified animals can be used for determining the effective dosage of a therapeutic agent for treating a disease in the subject, e.g., an immune disorder, an allergy, or autoimmune diseases (e.g., psoriasis) .

The inhibitory effects on tumors can also be determined by methods known in the art, e.g., measuring the tumor volume in the animal, and/or determining tumor (volume) inhibition rate (TGI _TV) . The tumor growth inhibition rate can be calculated using the formula TGI _TV (%) = (1 –TVt/TVc) x 100, where TVt and TVc are the mean tumor volume (or weight) of treated and control groups.

In some embodiments, the anti-IL17A antibody or the anti-IL17F antibody is designed for treating various cancers. As used herein, the term “cancer” refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. The term “tumor” as used herein refers to cancerous cells, e.g., a mass of cancerous cells. Cancers that can be treated or diagnosed using the methods described herein include malignancies of the various organ systems, such as affecting lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus.

In some embodiments, the anti-IL17A antibody or the anti-IL17F antibody is designed for treating breast cancer, non-small-cell lung cancer (NSCLC) , colorectal cancer, gastric cancer, hepatocellular carcinoma (HCC) , hepatobiliary cancer, pancreatic cancer, lung cancer, prostate cancer, kidney cancer, ovarian cancer, uterine cancer, endometrial cancer, cervical cancer, head and neck cancer, brain cancer, glioma, gingivitis and salivary cancer, skin cancer, squamous cell carcinoma, blood cancer, lymphoma, urothelial cancer, oral cancer, or bone cancer. In some embodiments, the anti-IL17A or anti-IL17F antibody is designed for treating solid tumor. In some embodiments, the anti-IL17A or anti-IL17F antibody is designed for treating metastatic solid tumors. In some embodiments, the anti-IL17A or anti-IL17F antibody is designed for reducing tumor growth, metastasis, and/or angiogenesis. In some embodiments, the anti-IL17A or anti-IL17F antibody is designed for treating hematopoietic malignancies.

In some embodiments, the cancer types as described herein include, but not limited to, lymphoma, non-small cell lung cancer (NSCLC) , leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, stomach cancer, bladder cancer, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, and sarcoma. In some embodiments, the leukemia is selected from acute lymphocytic (lymphoblastic) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myelogenous leukemia. In some embodiments, the lymphoma is selected from Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T cell lymphoma, and Waldenstrom macroglobulinemia. In some embodiments, the sarcoma is selected from osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, and chondrosarcoma. In some embodiments, the cancer is a colon cancer, rectal cancer, stomach cancer, ovarian cancer, or prostate cancer.

In some embodiments, the antibody is designed for treating various autoimmune diseases or allergy (e.g., psoriasis, allergic rhinitis, sinusitis, asthma, rheumatoid arthritis, atopic dermatitis, chronic obstructive pulmonary disease (COPD) , chronic bronchitis, emphysema, eczema, osteoarthritis, rheumatoid arthritis, systemic lupus erythematosus, polymyalgia rheumatica, autoimmune hemolytic anemia, systemic vasculitis, pernicious anemia, inflammatory bowel disease, ulcerative colitis, Crohn's disease, or multiple sclerosis) . Thus, the methods as described herein can be used to determine the effectiveness of an antibody in inhibiting immune response.

In some embodiments, the immune disorder orimmune-related diseases described here include but not limited to: allergies, asthma, psoriasis, myocarditis, nephritis, hepatitis, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, primary thrombocytopenic purpura, autoimmune hemolysis Anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain or neurological disorders. In one embodiment, the immune disorder or immune-related disease is psoriasis.

In some embodiments, the antibody is designed for reducing inflammation (e.g., inflammatory bowel disease, chronic inflammation, asthmatic inflammation, periodontitis, or wound healing) . Thus, the methods as described herein can be used to determine the effectiveness of an antibody for reducing inflammation. In some embodiments, the inflammation described herein can be inflammation of various tissues or organs, including acute and chronic inflammation. In some embodiments, the inflammation described herein is degenerative inflammation, exudative inflammation, serous inflammation, fibrinitis, purulent inflammation, hemorrhagic inflammation, necrotitis, catarrhal inflammation, proliferative inflammation, specific inflammation (e.g., tuberculosis, syphilis, Leprosy, lymphogranuloma, etc. ) . In one embodiment, the inflammation is ulcerative colitis or ankylosing spondylitis. In some embodiments, the inflammation is skin inflammation or chronic joint inflammation.

The present disclosure also provides methods of determining toxicity of an antibody (e.g., anti-IL17A or anti-IL17F antibody) . The methods involve administering the antibody to the animal as described herein. The animal is then evaluated for its weight change, red blood cell count, hematocrit, and/or hemoglobin. In some embodiments, the antibody can decrease the red blood cells (RBC) , hematocrit, or hemoglobin by more than 20%, 30%, 40%, or 50%.

The present disclosure also relates to the use of the animal model generated through the methods as described herein in the development of a product related to an immunization processes of human cells, the manufacturing of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.

In some embodiments, the disclosure provides the use of the animal model generated through the methods as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and/or a therapeutic strategy.

The disclosure also relates to the use of the animal model generated through the methods as described herein in the screening, verifying, evaluating or studying the IL17A gene function, human IL17A antibodies, drugs for human IL17A targeting sites, the drugs or efficacies for human IL17A targeting sites, the drugs for immune-related diseases and antitumor drugs. The disclosure also relates to the use of the animal model generated through the methods as described herein in the screening, verifying, evaluating or studying the IL17F gene function, human IL17F antibodies, drugs for human IL17F targeting sites, the drugs or efficacies for human IL17F targeting sites, the drugs for immune-related diseases and antitumor drugs.

In some embodiments, the disclosure provides a method to verify in vivo efficacy of TCR-T, CAR-T, and/or other immunotherapies (e.g., T-cell adoptive transfer therapies) . For example, the methods include transplanting human tumor cells into the animal described herein, and applying human CAR-T to the animal with human tumor cells. Effectiveness of the CAR-T therapy can be determined and evaluated. In some embodiments, the animal is selected from the IL17A and/or IL17F gene humanized non-human animal prepared by the methods described herein, the IL17A and/or IL17F gene humanized non-human animal described herein, the double-or multi-gene humanized non-human animal generated by the methods described herein (or progeny thereof) , a non-human animal expressing the human or humanized IL17A and/or IL17F protein, or the tumor-bearing or inflammatory animal models described herein. In some embodiments, the TCR-T, CAR-T, and/or other immunotherapies can treat the IL17A-associated or IL17F-associated diseases described herein. In some embodiments, the TCA-T, CAR-T, and/or other immunotherapies provides an evaluation method for treating the IL17A-associated or IL17F-associated diseases described herein.

Genetically modified animal model with two or more human or chimeric genes

The present disclosure further relates to methods for generating genetically modified animal model with two or more human or chimeric genes. The animal can comprise a human or chimeric IL17A and/or IL17F gene and a sequence encoding an additional human or chimeric protein.

In some embodiments, the additional human or chimeric protein can be interleukin 17A alpha (IL17A) , interleukin 17F (IL17F) , interleukin 17 Receptor C (IL17RC) , interleukin 17 Receptor A (IL17RA) , IL12, IL23, IL4R, IL6, programmed cell death protein 1 (PD-1) , cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) , Lymphocyte Activating 3 (LAG-3) , IL15 receptor, B And T Lymphocyte Associated (BTLA) , Programmed Cell Death 1 Ligand 1 (PD-L1) , CD3, CD27, CD28, CD47, CD137, CD154, T-Cell Immunoreceptor With Ig And ITIM Domains (TIGIT) , T-cell Immunoglobulin and Mucin-Domain Containing-3 (TIM-3) , Glucocorticoid-Induced TNFR-Related Protein (GITR) , Signal regulatory protein α (SIRPα) or TNF Receptor Superfamily Member 4 (OX40) .

The methods of generating genetically modified animal model with two or more human or chimeric genes (e.g., humanized genes) can include the following steps:

(a) using the methods of introducing human IL17A gene (or human IL17F gene) or chimeric IL17A gene (or chimeric IL17F gene) as described herein to obtain a genetically modified non-human animal;

(b) breeding the genetically modified non-human animal with another genetically modified non-human animal, and then screening the progeny to obtain a genetically modified non-human animal with two or more human or chimeric genes.

In some embodiments, in step (b) of the method, the genetically modified animal can be mated with a genetically modified non-human animal with human or chimeric IL17A, IL17F, IL17RC, IL17RA, IL12, IL23, IL4R, IL6, PD-1, CTLA-4, LAG-3, IL15 receptor, BTLA, PD-L1, CD3, CD27, CD28, CD47, CD137, CD154, TIGIT, TIM-3, GITR, SIRPα or OX40. Some of these genetically modified non-human animal are described, e.g., in PCT/CN2017/090320, PCT/CN2017/099577, PCT/CN2017/099575, PCT/CN2017/099576, PCT/CN2017/099574, PCT/CN2017/106024, PCT/CN2017/110494, PCT/CN2017/110435, PCT/CN2017/120388, PCT/CN2018/081628, PCT/CN2018/081629; each of which is incorporated herein by reference in its entirety.

In some embodiments, the IL17A and/or IL17F humanization is directly performed on a genetically modified animal having a human or chimeric IL17A, IL17F, IL17RC, IL17RA, IL12, IL23, IL4R, IL6, PD-1, CTLA-4, LAG-3, IL15 receptor, BTLA, PD-L1, CD3, CD27, CD28, CD47, CD137, CD154, TIGIT, TIM-3, GITR, SIRPα, or OX40 gene.

As these proteins may involve different mechanisms, a combination therapy that targets two or more of these proteins thereof may be a more effective treatment. In fact, many related clinical trials are in progress and have shown a good effect. The genetically modified animal model with two or more human or humanized genes can be used for determining effectiveness of a combination therapy that targets two or more of these proteins, e.g., an anti-IL17A or anti-IL17F antibody and an additional therapeutic agent for the treatment of cancer or an immune disorder. The methods include administering the anti-IL17A or anti-IL17F antibody and the additional therapeutic agent to the animal, wherein the animal has a tumor; and determining the inhibitory effects of the combined treatment to the tumor. In some embodiments, the additional therapeutic agent is an antibody that specifically binds to IL12, IL23, IL4R, IL6, PD-1, CTLA-4, LAG-3, IL15 receptor, BTLA, PD-L1, CD3, CD27, CD28, CD47, CD137, CD154, TIGIT, TIM-3, GITR, SIRPα or OX40. In some embodiments, the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab) , an anti-PD-1 antibody (e.g., nivolumab) , or an anti-PD-L1 antibody.

In some embodiments, the animal further comprises a sequence encoding a human or humanized PD-1, a sequence encoding a human or humanized PD-L1, or a sequence encoding a human or humanized CTLA-4. In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody (e.g., nivolumab, pembrolizumab) , an anti-PD-L1 antibody, or an anti-CTLA-4 antibody. In some embodiments, the tumor comprises one or more tumor cells that express CD80, CD86, PD-L1, and/or PD-L2.

In some embodiments, the combination treatment is designed for treating various cancer as described herein, e.g., breast cancer, non-small-cell lung cancer (NSCLC) , colorectal cancer, gastric cancer, hepatocellular carcinoma (HCC) , hepatobiliary cancer, pancreatic cancer, lung cancer, prostate cancer, kidney cancer, ovarian cancer, uterine cancer, endometrial cancer, cervical cancer, head and neck cancer, brain cancer, glioma, gingivitis and salivary cancer, skin cancer, squamous cell carcinoma, blood cancer, lymphoma, urothelial cancer, oral cancer, or bone cancer. In some embodiments, the cancer is a colon cancer, rectal cancer, stomach cancer, ovarian cancer, or prostate cancer.

In some embodiments, the methods described herein can be used to evaluate the combination treatment with some other methods. The methods of treating a cancer that can be used alone or in combination with methods described herein, include, e.g., treating the subject with chemotherapy, e.g., campothecin, doxorubicin, cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, adriamycin, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosurea, dactinomycin, daunorubicin, bleomycin, plicomycin, mitomycin, etoposide, verampil, podophyllotoxin, tamoxifen, taxol, transplatinum, 5-flurouracil, vincristin, vinblastin, and/or methotrexate. Alternatively or in addition, the methods can include performing surgery on the subject to remove at least a portion of the cancer, e.g., to remove a portion of or all of a tumor (s) , from the patient.

EXAMPLES

The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

Materials and Methods

The following materials were used in the following examples.

BbsI, EcoRI, BamHI, NcoI, and ScaI restriction enzymes were purchased from NEB with catalog numbers: R0539S, R0101M, R0136M, R0193M, and R3122M, respectively.

C57BL/6 mice and Flp transgenic mice were purchased from the China Food and Drugs Research Institute National Rodent Experimental Animal Center.

Ambion ^TM in vitro transcription kit was purchased from Ambion, Inc. The catalog number is AM1354.

Cas9 mRNA was obtained from SIGMA. The catalog number is CAS9MRNA-1EA.

UCA kit was obtained from BiocytogenPharmaceuticals (Beijing) Co., Ltd. The catalog number is BCG-DX-001.

Human IL17A ELISA kit was purchased from BioLegend. The catalog number is 433917.

Mouse IL17A ELISA kit was purchased from BioLegend. The catalog number is 432507.

Human IL17F ELISA kit was purchased from BioLegend. The catalog number is 435707.

Mouse IL17F ELISA kit was purchased from BioLegend. The catalog number is 436107.

PE anti-human IL17A antibody (anti-human IL17A PE) was purchased from BioLegend. The catalog number is 512305.

APC anti-mouse IFN-γ antibody (anti-mouse IFN-γ APC) was purchased from BioLegend. The catalog number is 505809.

Alexa

488 anti-mouse CD3 antibody was purchased from BioLegend. The catalog number is 100212.

Brilliant Violet 421 ^TM anti-mouse CD4 antibody was purchased from BioLegend. The catalog number is 100443.

Brilliant Violet 510 ^TM anti-mouse CD45 antibody was purchased from BioLegend. The catalog number is 103137.

eBioscience ^TM Foxp3/Transcription Factor Staining Buffer Set was purchased from ThermoFisher Scientific. The catalog number is 00-5523-00.

In VivoMAb anti-mouse CD3 antibody was purchased from Bio X Cell. The catalog number is BE0001-1.

In VivoMAb anti-mouse CD28 antibody was purchased from Bio X Cell. The catalog number is BE0015-5.

Ultra-LEAF ^TM Purified anti-mouse IFN-γ Antibody was purchased from BioLegend. The catalog number is 505834.

Recombinant Mouse TGF-beta1 Protein (mTGFβ) was purchased from R&D Systems, Inc. The catalog number is 7666-MB-005.

CD4+ T Cell Isolation Kit, mouse was purchased from MiltenyiBiotec. The catalog number is 130-104-454.

Ultra-LEAF ^TM Purified anti-mouse IL-4 Antibody was purchased from BioLegend. The catalog number is 504121.

Recombinant Mouse IL-6 (carrier-free) (mIL6) was purchased from BioLegend. The catalog number is 575702.

PMA (Phorbol 12-myristate 13-acetate) was purchased from Sigma. The catalog number is P1585.

Ionomycin was purchased from Sigma. The catalog number is 407952.

Imiquimod cream (250 mg: 12.5 mg) was purchased from 3M Health Care Limited. The approval number is H20160079.

MOG35-55 (100 mg) was purchased from ProSpec.

Pertussis toxin (PTX) was purchased from Millipore. The catalog number is 516560.

EXAMPLE 1: Mice with humanized IL17A gene

A gene sequence encoding the human IL17A protein can be introduced into the endogenous mouse IL17A locus, such that the mouse can express a human or humanized IL17A protein. The mouse IL17A gene (NCBI Gene ID: 16171, Primary source: MGI: 107364, UniProt ID: Q62386) comprises 3 exons, and is located at 20730905 to 20734496 of chromosome 1 (NC_000067.6) . The human IL17A gene (NCBI Gene ID: 3605, Primary source: HGNC: 5981, UniProt ID: Q16552) comprises 3 exons, and is located at 52186375 to 52190638 of chromosome 6 (NC_000006.12) . The mouse IL17A transcript sequence is NM_010552.3, and the corresponding protein sequence NP_034682.1 is set forth in SEQ ID NO: 1. The human IL17A transcript sequence isNM_002190.3, and the corresponding protein sequence NP_002181.1 is set forth in SEQ ID NO: 2. Mouse and human IL17A gene loci are shown in FIG. 1A and FIG. 1B, respectively.

The gene sequence encoding human IL17A protein can be introduced into the mouse endogenous IL17A locus, so that the mouse expresses human IL17A protein. Mouse cells can be modified by various gene-editing techniques, for example, replacement of specific mouse IL17A gene sequences with human IL17A gene sequences at the endogenous mouse IL17A locus. For example, a sequence of about 2.9 kb containing at least from the start codon ATG to the stop codon TAA of the mouse IL17A gene was replaced with the corresponding human DNA sequence, to obtain a humanized IL17A locus, thereby humanizing mouse IL17A gene (shown in FIG. 2) .

As shown in the schematic diagram of the targeting strategy in FIG. 3, the targeting vector contained homologous arm sequences upstream and downstream of mouse IL17A gene locus, and an “A fragment” comprising a human IL17A gene sequence. The upstream homologous arm sequence (5' homologous arm, SEQ ID NO: 3) is identical to nucleotide sequence of 20727254-20730961 of NCBI accession number NC_000067.6, and the downstream homologous arm sequence (3' homologous arm, SEQ ID NO: 4) is identical to nucleotide sequence of 20735137-20739901 of NCBI accession number NC_000067.6. The A fragment comprises a human genomic DNA sequence (SEQ ID NO: 5) which is identical to nucleotide sequence of 52186432-52189292 of NCBI accession number NC_000006.12. The mRNA sequence and corresponding protein sequence of the modified humanized mouse IL17A are shown in SEQ ID NO: 6 and SEQ ID NO: 2, respectively.

The targeting vector was constructed, e.g., by restriction enzyme digestion and ligation. The constructed targeting vector sequence was preliminarily verified by restriction enzyme digestion, followed by verification by sequencing. The correct targeting vector was electroporated and transfected into embryonic stem cells of C57BL/6 mice. The positive selectable marker gene was used to screen the cells, and the integration of exogenous genes was confirmed by PCR and Southern Blot. Specifically, positive clones identified by PCR were further confirmed by Southern Blot to screen out correct positive clone cells. The positive clones that had been screened (black mice) were introduced into isolated blastocysts (white mice) , and the resulted chimeric blastocysts were transferred to a culture medium for short-term culture and then transplanted to the fallopian tubes of the recipient mother (white mice) to produce the F0 chimeric mice (black and white) . The F2 generation homozygous mice were obtained by backcrossing the F0 generation chimeric mice with wild-type mice to obtain the F1 generation mice, and then breeding the F1 generation heterozygous mice with each other. The humanized mice disclosed herein can be induced to prepare a variety of human disease models, including multiple sclerosis, asthma, allergies and other models, which can be used to test the in vivo efficacy of human-specific antibodies. For example, an experimental autoimmune encephalomyelitis (EAE) mouse model was prepared as follows. The IL17A gene humanized mice (10 weeks old) prepared using the methods described herein were selected and immunized with MOG35-55 (MOG) once (on day 0) by subcutaneous injection (200 μg/mouse) . The immunized mice were also administered with pertussis toxin (PTX) twice (on day 0 and day 1) by intraperitoneal injection (400 μg/mouse) . After the first immunization, the mice are weighed and observed continuously every day, and the mice were grouped after the onset of disease. Multiple drug administration routes can be used, e.g., gavage, intraperitoneal injection, or tail vein injection. Multiple detection indicators, e.g., behavioral score, brain/spinal cord IHC (immunohistochemistry) pathology, HE pathology examination, Th17-type multi-cytokine detection of serum/brain homogenate, and flow cytometry analysis of CNS, spleen, and lymph nodes can be used to evaluate the in vivo efficacy of different human-specific drugs. The experimental groupings are shown the table below:

Table 5. Experimental grouping

Group	Immunization	Age (week)	Mouse No.	Gender	Mouse genotype
G1 (Control)	PBS	10	4	Female	IL17A (h/h)
G2 (Model)	MOG	10	5	Female	IL17A (h/h)
G3 (Control)	PBS	10	5	Male	IL17A (h/h)
G4 (Model)	MOG	10	5	Male	IL17A (h/h)

After induction using the above method, none of the mice in the PBS control groups (G1 and G3) became ill, and only mice in the modeling groups (G2 and G4) were found sick. Clinical symptoms included listlessness, weight loss, loss of tail tension, paralysis of hind limbs or limbs, and incontinence of urine and feces. Some mice also showed ataxia. All 10 mice in the two modeling groups (G2 and G4) became ill. The onset time was 10-12 days after the first immunization, and weight loss was observed in G1, G2 and G3 group mice. With the increase in the number of days after immunization, the number of cases gradually increased, and the clinical symptoms reached a peak 3-5 days after the onset. Afterwards, the mice entered a remission period, and the weight gradually increased, showing an "onset-remission" trend.

The incidence of female and male mice in the modeling groups were compared. Specifically, the animal body weight was recorded every day and the neurological indicators were evaluated according to a 4-point scale (clinical score) : 0=normal; 1=weak tail; 2=partial hind limb paralysis; 3= paralysis of all hind limbs; 4=paralysis of limbs. It was found that there was no significant difference in morbidity, onset time, peak time, and symptom severity in the modeling process between male and female mice, but the body weight and clinical symptoms of female mice recovered better as compared to those of male mice (FIG. 4 and FIG. 5) . At the end of the experiment (day 45) , spinal cord tissues of the female mice were isolated for paraformaldehyde fixation, paraffin-embedded section, as well as HE and IHC staining to observe histopathological changes. The longitudinal section of the white matter of spinal lumbar enlargement was stained. As shown in FIGS. 6A-6B and FIGS. 7A-7B, the spinal cord of MOG-immunized mice (in modeling group G2) had a large number of inflammatory cells infiltrated, and myelin protein was greatly reduced. By contrast, there was no abnormality in the spinal cord of mice in the control group G1.

In the EAE model, IL17A is mainly produced by CD4+Th17 cells during the disease progression. To detect the production of human IL17A in mice, lymph node cells from MOG- immunized IL17A humanized homozygous mice (female, n=5) were isolated. PMA and ionomycin were used to stimulate the cells for 6 hours in the presence of Brefeldin A. Cells producing IL17A and IFNγ were analyzed by FACS (fluorescence-activated cell sorting) . FIGS. 8A-8B showexemplary flow cytometry results. The results showed that the percentages of hIL17+CD3+CD4+ T cells and IFNγ+ T cells in CD3+CD4+ T cells in mouse lymph nodes increased after MOG immunization, which proved the successful construction of EAE model from the molecular level.

The above results indicate that the IL17A gene humanized mice prepared by the method described herein can be used to establish a stable EAE model.

EXAMPLE 2: Mice with humanized IL17F gene

A gene sequence encoding the human IL17F protein can be introduced into the endogenous mouse IL17F locus, such that the mouse can express a human or humanized IL17F protein. The mouse IL17F gene (NCBI Gene ID: 257630, Primary source: MGI: 2676631, UniProt ID: Q7TNI7) comprises 3 exons, and is located at 20777146 to 20785274 of chromosome 1 (NC_000067.6) . The human IL17F gene (NCBI Gene ID: 112744, Primary source: HGNC: 16404, UniProt ID: Q96PD4) comprises 3 exons, and is located at 52236681 to 52245689 of chromosome 6 (NC_000006.12) . The mouse IL17F transcript sequence is NM_145856.2, and the corresponding protein sequence NP_665855.2 is set forth in SEQ ID NO: 7. The human IL17F transcript sequence is NM_052872.4, and the corresponding protein sequence NP_443104.1 is set forth in SEQ ID NO: 8. Mouse and human IL17F gene loci are shown in FIG. 9A and FIG. 9B, respectively.

The gene sequence encoding human IL17F protein can be introduced into the mouse endogenous IL17F locus, so that the mouse expresses human IL17F protein. Mouse cells can be modified by various gene-editing techniques, for example, replacement of a specific DNA sequence starting within exon 2 and ending within exon 3 of mouse IL17F gene with a corresponding human IL17F gene sequences at the endogenous mouse IL17F locus, to obtain a humanized IL17F locus, thereby humanizing mouse IL17F gene (shown in FIG. 10) .

As shown in the schematic diagram of the targeting strategy in FIG. 11, the targeting vector contained homologous arm sequences upstream and downstream of mouse IL17F gene locus, and an “A1 fragment” comprising a human IL17F gene sequence. The upstream homologous arm sequence (5' homologous arm, SEQ ID NO: 9) is identical to nucleotide sequence of 20782346-20779455 of NCBI accession number NC_000067.6, and the downstream homologous arm sequence (3' homologous arm, SEQ ID NO: 10) is identical to nucleotide sequence of 20776845-20772788 of NCBI accession number NC_000067.6. The human IL17F gene sequence (SEQ ID NO: 11; corresponding mRNA sequence shown as SEQ ID NO: 55) is 99%homologous to nucleotide sequence of 52238893-52236931 of NCBI accession number NC_000006.12, and the difference is that the "G" at position 52237842 is replaced with "A" . The connection between the upstream of the human IL17F DNA sequence in the A1 fragment and the mouse gene was designed as: 5’-GTCAAGTCTTTGCTACTGTTGATGTTGGGACTTGCCATTCTGAGGGAGGTAG CAGCT

AATCCCCAAAGTAGGACATACTTTTTTCCAAAAGCCTGAG -3’ (SEQ ID NO: 56) , wherein the “T” in sequence “ CAGCT” is the last nucleotide of the mouse sequence, and the “C” in sequence

is the first nucleotide of the human IL17F DNA sequence. The connection between the downstream of the human IL17F DNA sequence in the A1 fragment and the mouse sequence was designed as: 5’-CTGCACCTGCGTCACCCCTGTCATCCACCATGTGC AGTAA

CTGCATACAAAAATCAGTTGAAGACTTCCACTGAG –3’ (SEQ ID NO: 12) , wherein the last “A” in sequence “ AGTAA” is the last nucleotide of the human IL17F DNA sequence, and the first “C” in sequence

is the first nucleotide of the mouse sequence.

The targeting vector also included an antibiotic resistance gene for positive clone screening (neomycin phosphotransferase gene, or Neo) , and two Frt recombination sites flanking the antibiotic resistance gene, that formed a Neo cassette. The connection between the upstream of the Neo cassette and the mouse sequence was designed as: 5’-TCATATCTGCTTTAGGTCCTGCCTTAAGTTCCTGC CAAAG

CGAATTCCGAAGTTCCTATTCTCTAGAAAGTATAG -3’ (SEQ ID NO: 13) , wherein the “G” in sequence “ CAAAG” is the last nucleotide of the mouse sequence, and “G” in sequence

is the first nucleotide of the Neo cassette. The downstream connection between the Neo cassette and the mouse sequence was designed as: 5’-GTATAGGAACTTCATCAGTCAGGTACATAATGGTG GATCC

TCCATGATGGAACTTGTAAACGTAACAATTCCAT -3’ (SEQ ID NO: 14) , wherein the last “C” in sequence “ GATCC” is the last nucleotide of the Neo cassette, and the first “C” in sequence

is the first nucleotide of the mouse sequence. In addition, a coding gene with a negative selectable marker (a gene encoding diphtheria toxin A subunit (DTA) ) was also inserted downstream of the 3' homologous arm of the targeting vector. The mRNA sequence and corresponding protein sequence of the modified humanized mouse IL17F are shown in SEQ ID NO: 15 and SEQ ID NO: 16, respectively.

The targeting vector was constructed, e.g., by restriction enzyme digestion and ligation. The constructed targeting vector sequence was preliminarily verified by restriction enzyme digestion, followed by verification by sequencing. The correct targeting vector was electroporated and transfected into embryonic stem cells of C57BL/6 mice. The positive selectable marker gene was used to screen the cells, and the integration of exogenous genes was confirmed by PCR and Southern Blot. Specifically, positive clones identified by PCR were further confirmed by Southern Blot to screen out correct positive clone cells. The positive clones that had been screened (black mice) were introduced into isolated blastocysts (white mice) , and the resulted chimeric blastocysts were transferred to a culture medium for short-term culture and then transplanted to the fallopian tubes of the recipient mother (white mice) to produce the F0 chimeric mice (black and white) . The F2 generation homozygous mice were obtained by backcrossing the F0 generation chimeric mice with wild-type mice to obtain the F1 generation mice, and then breeding the F1 generation heterozygous mice with each other. The positive mice were also bred with the Flp transgenic mice to remove the positive selectable marker gene, and then the humanized IL17F homozygous mice expressing human IL17F protein were obtained by breeding with each other. The genotype of somatic cells of offspring mice were identified by PCR. The identification results of exemplary F1 generation mice (with the Neo marker gene removed) are shown in FIG. 12. Mice numbered F1-01, F1-02, F1-03, and F1-04 were identified as positive heterozygous mice.

The PCR detection primer sequences are as follows:

L-F1-F (SEQ ID NO: 17) : 5’-CCGAACTATAGTGACTTTCAGTCTTGCT-3’

L-F1-R (SEQ ID NO: 18) : 5’-ATTTATCCTGCCAGCTTGCCATTGT-3’

EXAMPLE 3: Generation of double-or multi-gene humanized mice

The IL17A gene humanized mice prepared in Example 1 and the IL17F gene humanized mice prepared in Example 2 can also be used to prepare a double-or multi-gene humanized mouse model containing humanized IL17A and/or IL17F genes. For example, in Example 2, the embryonic stem (ES) cells used during electroporation were selected from the IL17A gene humanized positive clones obtained in Example 1, to obtain a double-gene humanized mice with humanized IL17A and IL17F genes. Alternatively, the IL17A and/or IL17F gene humanized homozygous or heterozygous mice can be bred with other genetically-modified homozygous or heterozygous mice, and the offspring can be screened. According to Mendel’s law, it is possible to generate double-gene or multi-gene modified heterozygous mice comprising humanized IL17A and/or IL17F genes and other genetic modifications. Then the heterozygous mice can be bred with each other to obtain homozygous double-gene or multi-gene humanized mice.

IL17A/IL17F double-gene humanized mice were generated as follows. Because both mouse IL17A and IL17F genes are located on chromosome 1, after the IL17A humanized positive ES cells were obtained, a second round of gene targeting was performed according to the method described in Example 2. After the positive offspring mice were screened, IL17A/IL17F double-gene humanized mice were obtained. The genotype of somatic cells of offspring mice can be identified by PCR. The identification results of exemplary F1 generation mice (with the Neo cassette gene removed) are shown in FIGS. 13A-13D (See the table below for PCR detection primer sequences and target fragment sizes) , in which, the mice numbered F1-01 and F1-02 were identified as positive heterozygous mice.

Table 6. PCR detection primer sequences and target fragment sizes

The primer L-F1-F is located upstream of the 5' homologous arm of the IL17F gene targeting vector sequence, and R-F1-R is located downstream of the 3' homologous arm of the IL17F gene targeting vector sequence. Both L-F1-R and R-F1-F are located on the human IL17F gene sequence of the IL17F gene targeting vector. Primer WT-F is located on the 5' homologous arm of the IL17A gene targeting vector. Mut-R is located on the human IL17A gene sequence of the IL17A gene targeting vector. WT-R is located on intron 1 of mouse IL17A gene.

Alternatively, the CRISPR/Cas gene editing system was used, and a targeting strategy is shown in FIG. 14. The targeting vector contains the homologous arm sequences upstream and downstream of the mouse IL17F gene, and a human IL17F DNA sequence. The upstream homologous arm sequence (5' homologous arm, SEQ ID NO: 24) is identical to nucleotide sequence of 20781021-20779455 of NCBI accession number NC_000067.6, and the downstream homologous arm sequence (3' homologous arm, SEQ ID NO: 25) is identical to nucleotide sequence of 20777766-20776366 of NCBI accession number NC_000067.6. The human IL17F DNA sequence is identical to the human IL17F DNA sequence of the A1 fragment as described in Example 2 (See FIG. 11) . The mRNA sequence and corresponding protein sequence of the modified humanized mouse IL17F are shown in SEQ ID NO: 15 and SEQ ID NO: 16, respectively.

The targeting vector was constructed, e.g., by restriction enzyme digestion and ligation. The constructed targeting vector sequence was preliminarily verified by restriction enzyme digestion, followed by verification by sequencing. The correct targeting vector was selected for subsequent experiments.

The target sequences are important for the targeting specificity of sgRNAs and the efficiency of Cas9-induced cleavage. Specific sgRNA sequences were designed and synthesized that recognize the 5’ end targeting site (sgRNA1-sgRNA8) and 3’ end targeting site (sgRNA9-sgRNA16) . The 5' end targeting sites are located on exon 2, and the 3' end targeting sites are located on exon 3 of the mouse IL17F gene. The targeting site sequence of each sgRNA on the IL17F gene locus is as follows:

sgRNA1 targeting site (SEQ ID NO: 26) : 5’-AGCGGTTCTGGAATTCACGTGGG-3’

sgRNA2targeting site (SEQ ID NO: 27) : 5’-GCTCGGAAGAACCCCAAAGCAGG-3’

sgRNA3targeting site (SEQ ID NO: 28) : 5’-CGAATCTTCAACCAAAACCAGGG-3’

sgRNA4targeting site (SEQ ID NO: 29) : 5’-ATGGGGAACTGGAGCGGTTCTGG-3’

sgRNA5targeting site (SEQ ID NO: 30) : 5’-ACAGTGTTATCCTCCAGGGGAGG-3’

sgRNA6targeting site (SEQ ID NO: 31) : 5’-CTCTCACAGTGTTATCCTCCAGG-3’

sgRNA7targeting site (SEQ ID NO: 32) : 5’-TGGGAACTGTCCTCCCCTGGAGG-3’

sgRNA8targeting site (SEQ ID NO: 33) : 5’-TTCCCAGCCTTCTGCAAGGCAGG-3’

sgRNA9targeting site (SEQ ID NO: 34) : 5’-AGCGTTGTCAGGCCGCTTGGTGG-3’

sgRNA10targeting site (SEQ ID NO: 35) : 5’-TGCAGCGTTGTCAGGCCGCTTGG-3’

sgRNA11targeting site (SEQ ID NO: 36) : 5’-CAGGCCGCTTGGTGGACAATGGG-3’

sgRNA12targeting site (SEQ ID NO: 37) : 5’-TCAGGCCGCTTGGTGGACAATGG-3’

sgRNA13targeting site (SEQ ID NO: 38) : 5’-GTGGACAATGGGCTTGACACAGG-3’

sgRNA14targeting site (SEQ ID NO: 39) : 5’-AGGGCTGTTCTAATTCCTTCAGG-3’

sgRNA15targeting site (SEQ ID NO: 40) : 5’-GAAGGAATTAGAACAGCCCTGGG-3’

sgRNA16targeting site (SEQ ID NO: 41) : 5’-GAGAAGATGCTCCTAAAAGTTGG-3’

Table 7. sgRNA relative activity test results

The UCA kit was used to detect the activities of sgRNAs. As shown in FIGS. 15A-15B and the table above, the results showed that the sgRNAs had different activities. In particular, sgRNA6 and sgRNA8 exhibited relatively low activities, which may be caused by sequence variations of their targeting sites. However, the relative activities of sgRNA6 and sgRNA8 were still significantly higher than that of the negative control (Con) . It is therefore concluded that sgRNA6 and sgRNA8 can suffice the requirement for gene editing experiment. sgRNA4 and sgRNA9 were randomly selected for subsequent experiments. Oligonucleotides were added to the 5’ end and a complementary strand to obtain a forward oligonucleotide and a reverse oligonucleotide (See the table below for the sequences) . After annealing, the products were ligated to the pT7-sgRNA plasmid (the plasmid was first linearized with BbsI) , respectively, to obtain expression vectors PT7-IL17F-4 and pT7-IL17F-9.

Table 8. sgRNA4 and sgRNA9 forward and reverse oligonucleotide sequences

The pT7-sgRNA vector was synthesized, which included a DNA fragment containing the T7 promoter and sgRNA scaffold (SEQ ID NO: 50) , and was ligated to the backbone vector (Takara, Catalog number: 3299) after restriction enzyme digestion (EcoRI and BamHI) . The resulting plasmid was confirmed by sequencing.

The pre-mixed Cas9 mRNA, the targeting vector, and in vitro transcription products of the pT7-IL17F-4, pT7-IL17F-9 plasmids (using Ambion ^TMin vitro transcription kit to carry out the transcription according to the method provided in the product instruction) were injected into the cytoplasm or nucleus of mouse fertilized eggs of the IL17A gene humanized mice obtained in Example 1 with a microinjection instrument. The embryo microinjection was carried out according to the method described, e.g., in A. Nagy, et al., “Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition) , ” Cold Spring Harbor Laboratory Press, 2006. The injected fertilized eggs were then transferred to a culture medium to culture for a short time and then was transplanted into the oviduct of the recipient mouse to produce the genetically modified mice (F0 generation) . The mouse population was further expanded by cross-breeding and self-breeding to establish stable homozygous mouse lines with genetically-modified IL17A/IL17F gene loci.

The genotype of somatic cells of F0 generation mice can be identified, e.g., by PCR analysis (using the same primers as described herein) . The identification results of some F0 generation mice are shown in FIGS. 16A-16C. Three mice numbered F0-01, F0-02, and F0-03 were identified as positive mice. The three positive clone mice were further confirmed by sequencing and no random insertions were detected.

The F0 generation of IL17A/IL17F double-gene humanized mice were bred with IL17A gene humanized mice to obtain F1 generation mice. The same PCR method described herein can be used for genotype identification of the F1 generation mice. As shown in FIGS. 17A-17D, the 9 mice numbered from F1-01 to F1-09 were all identified as positive mice. The F1 generation mice were further analyzed by Southern Blot (See the table below for the length of specific probes and target fragments) , to confirm whether random insertions were introduced. Specifically, mouse tail genomic DNA was extracted, digested with BspHI or EcoNIrestriction enzyme, transferred to a membrane, and then hybridized with probes. The 5’ Probe and 3’ Probe are located upstream of the 5’ homologous arm and on the 3’ homologous arm, respectively.

Table 9. The length of the specific probes and target fragments

Restriction Enzyme	Probe	Wild-type fragment size	Recombinant sequence fragment size
BspHI	5’ Probe	-	5.6 kb
EcoNI	3’ Probe	20.0 kb	11.4 kb

The following primers were used to synthesize probes used in Southern Blot assays:

5’Probe-F (SEQ ID NO: 51) : 5’-GCATCATCAATGAAAACCAGCGCGT-3’

5’Probe-R (SEQ ID NO: 52) : 5’-AGAACCCTCTCTTCCAACACAGGAA-3’

3’Probe-F (SEQ ID NO: 53) : 5’-CCTATCTGGGAGTTGGTTTGGGGTC-3’

3’Probe-R (SEQ ID NO: 54) : 5’-GAACTCGGAGCCTGCAGATCCAATC-3’

The detection result of Southern Blot is shown in FIG. 18. In view of the hybridization results by the 5’ Probe and 3’ Probe, in combination with verification by sequencing, no random insertions were detected in the F1 generation mice numbered F1-02, F1-03, F1-04, F1-08, and F1-09. The results also confirmed that the 5 mice were positive heterozygous mice and there was no random insertions. The results indicate that this method can be used to generate genetically-modified IL17A/IL17F double-gene humanized mice that can be passed stably without random insertions.

The expression of humanized IL17A mRNA and humanized IL17F mRNA in IL17A/IL17F double-gene humanized mice can be confirmed, e.g., by RT-PCR. Three 7-week-old wild-type C57BL/6 mice and three humanized IL17A/IL17F homozygous mice were selected, respectively. After euthanasia, the mouse spleen tissues were collected, and the total RNA of the spleen cells was extracted. The extracted total RNA was then reverse transcribed into cDNA using a reverse transcription kit, followed by PCR amplification. The primer sequences are shown in the table below.

Table 10. RT-PCR detection primer sequences and target fragment sizes

As shown in FIGS. 34A-34B, the detection results showed that in wild-type C57BL/6 mouse cells, mouse IL17F and IL17A mRNA expressionwas detected, whereas humanized IL17F and IL17A mRNA expressionwas not detected. By contrast, in humanized IL17A/IL17F homozygous mouse cells, the expression of humanized IL17F and humanized IL17A mRNA was detected, whereas the expression of mouse IL17F and IL17A mRNA was not detected. The expression of human IL17A protein and humanized IL17F protein in the positive mice can be further confirmed, e.g., by ELISA (enzyme-linked immunosorbent assay) . Three female wild-type C57BL/6 mice and three female IL17A/IL17F double-gene humanized heterozygous mice were selected. Each mouse was intraperitoneally injected with 7.5 μg of anti-mouse CD3 antibody (mCD3) and 4 μg of anti-mouse CD28 antibody (mCD28) . After 2 hours, serum was extracted to detect the expression of human IL17A protein. As shown in FIGS. 19A-19B, in wild-type C57BL/6 mice, the expression of mouse IL17A protein was detected, whereas the expression of human IL17A protein was not detected. By contrast, both mouse IL17A protein and human IL17A protein expression was detected in IL17A/IL17F double-gene humanized heterozygous mice. ELISA was also used to detect the expression of humanized IL17F protein in mice. Spleen cells from female wild-type C57BL/6 mice and female IL17A/IL17F double-gene humanized heterozygous mice were collected. CD4+ T cells were sorted and added to a 96-well plate that was pre-coated with 2μg/mL anti-mouse CD3 antibody and 5μg/mL anti-mouse CD28 antibody. Then, the CD4+ T cells were cultured with 3ng/mL mTGFβ, 20ng/mL mIL6, 10μg/mL anti-mouseIFN-γ, and 10μg/mL anti-mouse IL-4 antibody for 72 hours. 5 hours before the end of the culture, 50ng/mL PMA and 1μg/mL ionomycin were added to induce the CD4+Tcells to differentiate into Th17 cells. After the 72-hour culture was completed, centrifugation was performed and the culture supernatant was collected for ELISA detection. As shown in FIGS. 20A-20B, in wild-type C57BL/6 mice, the expression of mouse IL17F protein was detected, whereas the expression of humanized IL17F protein was not detected. By contrast, the expression of both mouse IL17F protein and humanized IL17F protein was detected in IL17A/IL17F double-gene humanized heterozygous mice.

Further analysis of immune cell subtypes in wild-type C57BL/6 mice and IL17A/IL17F double-gene humanized homozygous mice was performed by flow cytometry. FIG. 21 and FIG. 22 show the percentages of leukocyte subtypes and T cell subtypes in the spleen, respectively. FIG. 23 and FIG. 24 show the percentages of leukocyte subtypes and T cell subtypes in the lymph nodes, respectively. FIG. 35 and FIG. 36 show the percentages of leukocyte subtypes and T cell subtypes in the thymus, respectively. The results showed that the expression profile of leukocyte subtypes in humanized IL17A/IL17F double-gene humanized homozygous mice was similar to that of C57BL/6 mice. The results also indicate that humanization of IL17A and IL17F genes did not affect differentiation of T cells, B cells, NK cells, granulocytes, monocytes, dendritic cells, and macrophages. The results also indicate that humanization of IL17A and IL17F genes did not affect the differentiation of CD4+ T cells and CD8+ T cells in T cells.

One 8-week-old wild-type C57BL/6 mouse and one humanized IL17A/IL17F homozygous mouse were selected, and the peripheral blood was collected for blood routine examination and blood biochemical index tests. Blood routine examination includes white blood cell count (WBC) , red blood cell count (RBC) , hemoglobin concentration (HB) , hematocrit (HCT) , average red blood cell volume (MCV) , average red blood cell hemoglobin content (MCH) , average red blood cell hemoglobin concentration (MCHC) , platelet count (PLT) , lymphocyte count (LY) , monocyte count (MO) , neutrophil count (NEUT) , red blood cell distribution width (RDW) , and mean platelet volume (MPV) . Blood biochemical index tests include albumin (ALB) , alanine aminotransferase (ALT) , aspartate aminotransferase (AST) , total cholesterol (CHOL) , creatinine (CR) , blood glucose (GlU) , triglycerides (TG) , and urea (UREA) . The results of blood routine examination are shown in FIG. 37. Compared with wild-type mice, humanized IL17A/IL17F homozygous mice showed consistent blood routine parameters, indicating that the IL17A and IL17F gene humanization methods disclosed herein did not change blood cell composition and morphology. The blood biochemical index test results are shown in FIG. 38. Compared with wild-type mice, humanized IL17A/IL17F homozygous mice showed no statistically significant difference in serum ALT (alanine aminotransferase) and AST (aspartate aminotransferase) levels, indicating that the IL17A and IL17F gene humanization methods disclosed herein did not change mouse ALT and AST levels or liver health.

EXAMPLE 4: In vivo drug efficacy verification in animal models

The IL17A and/or IL17F gene humanized mice disclosed herein can be induced to prepare a variety of human disease models, including models of psoriasis, multiple sclerosis, asthma, allergy, etc., for testing the in vivo efficacy of human-specific antibodies. The IL17A/IL17F double-gene humanized homozygous mice prepared in Example 3 were induced by Imiquimod (IMQ) to establish a psoriasis model. The IL17A/IL17F double-gene humanized homozygous mice were placed into a control group (G1: Vaseline) , a model group (G2: IMQ+Vaseline) , a low-dose administration group (G3: 1mg/kg Ab) , and a high-dose administration group (G4: 3 mg/kg Ab) according to the body weight (5 mice in each group) . Three days before the experiment, the hair on the back of the mice was removed by a shaver to expose a 2 cm × 4 cm skin area. Three days later (day D0) , Imiquimod (IMQ) cream (10 mg/cm ²) was smeared at the back skin area every day for 6 consecutive days. The control mice were smeared with Vaseline. Mice in the administration groups (G3 and G4) were intraperitoneally injected with an anti-human IL17A/IL17F antibody (the antibodies were obtained by immunizing mice; See Janeway's Immunobiology (9th Edition) ) on day D0 and D3 for a total of 2 administrations. The entire experimental period was 8 days, and the specific experimental scheme is shown in FIG. 25.

Starting from day D0, the mice were weighed every day, and photos were taken to record the mouse back skin conditions. The incidence of psoriasis was clinically scored. Scoring items included erythema and scales in mouse skin lesions. Each item was scaled into 0-4 points according to the severity, and the PASI (Psoriasis Area Severity Index) scoring standards were as follows: 0-none; 1-mild; 2-moderate; 3-severe; and 4-extremely severe. A PASI score is a tool used to measure the severity and extent of psoriasis. The average of each score and the average of the total scores of each group of mice were calculated and compared. At the end of the experiment (day D8) , the mouse back skin specimens were collected, sectioned, and stained with hematoxylin and eosin (HE) . The back erosion, spinous process appearance, hypokeratosis, and mixed inflammatory cell infiltration of each group of mice were scored according to the severity (0.5-2 points) : 0.5-slight, 1-slight, 1.5-moderate, and 2-severe. Stromal cell proliferation was also scored (0.5-2 points) : 0.5 was 2-4 layers, 1 was 4-6 layers, 1.5 was 6-8 layers, and 2 was 8-10 layers. Appearance of scab: 0.5 points. Results statistics and pathological analysis scores between groups were performed, and the epidermal thickness was measured.

According to the change of mouse body weight over time (FIG. 26) , the weight of the control group mice was stable throughout the experimental period. The body weight of the model group mice (G2) and the administration groups (G3 and G4) mice had the same changing trend over time, and they all showed a trend of falling first and then slowly rising. During the experiment, the body weight of mice from G2-G4 groups showed no observable difference. At the end of the experiment, the body weight of mice in all groups was close and there was no significant difference. The results of erythema, scaly, and comprehensive PASI scores on the back skin of the mice are shown in FIGS. 27-29. None of the mice in the control group (G1) became ill, while the model group (G2) and the administration group (G3 and G4) mice showed different degrees of disease progression. Compared with the model group, the mouse skin PASI scoresof the administration group mice (G3 and G4) were significantly lower than that of the model group mice (G2) , and the score of the 3 mg/kg treatment group (G4) was lower than that of the 1 mg/kg treatment group (G3) . The results showed that the anti-human IL17A/IL17F antibody treatment to mice in the administration groups exhibited a therapeutic effect on psoriasis, and different doses have different therapeutic effects on psoriasis in the treatment group. The therapeutic effect of the 3 mg/kg treatment group (G4) was better than that of the 1 mg/kg treatment group (G3) , indicating a dose-dependent trend. The HE staining results of the back tissue sections of the mice (FIG. 30) , the statistical results of the epidermal thickness of the back tissues (FIG. 31) and the pathological score statistical results of the back tissue sections (FIG. 32) showed that the pathological changes of the back skin of the administration group mice (G3 and G4) in terms of stromal cell proliferation and epidermal thickening were lower than those of the model group mice (G2) . In addition, some mice in the model group showed scabs on the back skin, but no such lesions were observed in the administration group mice (FIG. 33) , indicating that the skin of the mice in the model group had been ulcerated or eroded, and the severity of the lesions was higher than that in the administration group mice.

The above results prove that the humanized mice as described herein can be used to establish a psoriasis model to evaluate the in vivo efficacy of drugs against human IL17A/IL17F.

OTHER EMBODIMENTS

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

A genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric interleukin 17F (IL17F) .
The animal of claim 1, wherein the sequence encoding the human or chimeric IL17F is operably linked to an endogenous regulatory element at the endogenous IL17F gene locus in the at least one chromosome.
The animal of claim 1 or 2, wherein the sequence encoding a human or chimeric IL17F is operably linked to an endogenous 5’ untranslated region (5’ UTR) and/or an endogenous 3’ untranslated region (3'-UTR) .
The animal of any one of claims 1-3, wherein the sequence encoding a human or chimeric IL17F comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human IL17F (SEQ ID NO: 8) .
The animal of any one of claims 1-3, wherein the sequence encoding a human or chimeric IL17F comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 31-163 of human IL17F (SEQ ID NO: 8) .
The animal of any one of claims 1-3, wherein the sequence encoding a human or chimeric IL17F comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 16.
The animal of any one of claims 1-6, wherein the sequence comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 12, 13, 14, 15, or 56.
The animal of any one of claims 1-7, wherein the animal is a mammal, e.g., a monkey, a rodent, or a mouse.
The animal of claim 8, wherein the mammal is a mouse.
The animal of any one of claims 1-9, wherein the animal does not express endogenous IL17F or expresses a decreased level of endogenous IL17F as compared to that of an animal without genetic modification.
The animal of any one of claims 1-10, wherein the animal has one or more cells expressing human or chimeric IL17F.
The animal of any one of claims 1-11, wherein the expressed human or chimeric IL17F can form a homodimer that can interact with an IL17 receptor complex (e.g., formed by interleukin 17 Receptor C (IL17RC) and interleukin 17 Receptor A (IL17RA) ) .
The animal of any one of claims 1-12, wherein the expressed human or chimeric IL17F can bind to human interleukin 17A (IL17A) , forming a heterodimer that can interact with an IL17 receptor complex (e.g., formed by IL17RC and IL17RA) .
The animal of any one of claims 1-12, wherein the expressed human or chimeric IL17F can bind to endogenous IL17A, forming a heterodimer that can interact with an IL17 receptor complex (e.g., formed by IL17RC and IL17RA) .
A genetically-modified, non-human animal, wherein the genome of the animal comprises a replacement of a sequence encoding a region of endogenous IL17F with a sequence encoding a corresponding region of human IL17F at an endogenous IL17F gene locus.
The animal of claim 15, wherein the sequence encoding the corresponding region of human IL17F is operably linked to an endogenous regulatory element at the endogenous IL17F locus.
The animal of claim 15 or 16, wherein the animal does not express endogenous IL17F, and the animal has one or more cells expressinghuman or chimeric IL17F.
The animal of any one of claims 15-17, wherein the replaced sequence encoding a region of endogenous IL17F comprises exon 1, exon 2, and/or exon 3, or a part thereof, of endogenous IL17F gene.
The animal of claim 18, wherein the animal is a mouse, and the replaced sequence starts within exon 2 and ends within exon 3 of endogenous mouse IL17F gene.
The animal of any one of claims 15-19, wherein the replaced sequence encodes an endogenous IL17F without an endogenous signal peptide sequence.
The animal of any one of claims 15-20, wherein the animal is heterozygous with respect to the replacement at the endogenous IL17F gene locus.
The animal of any one of claims 15-20, wherein the animal is homozygous with respect to the replacement at the endogenous IL17F gene locus.
A method for making a genetically-modified, non-human animal, comprising:

replacing in at least one cell of the animal, at an endogenous IL17F gene locus, a sequence encoding a region of an endogenous IL17F with a sequence encoding a corresponding region of human IL17F.
The method of claim 23, wherein the sequence encoding the corresponding region of human IL17F comprises exon 1, exon 2, and/or exon 3, or a part thereof, of a human IL17F gene.
The method of claim 23 or 24, wherein the sequence encoding the corresponding region of human IL17F encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical toamino acids 31-163 of SEQ ID NO: 8.
The method of any one of claims 23-25, wherein the endogenous IL17F locus comprises exon 1, exon 2, and/or exon 3, or a part thereof, of the endogenous IL17F gene.
The method of any one of claims 23-26, whereinthe animal is a mouse, and the sequence encoding a region of an endogenous IL17F starts within exon 2 and ends within exon 3 of the endogenous mouse IL17F gene.
A non-human animal comprising at least one cell comprising a nucleotide sequence encoding a human or chimeric IL17F polypeptide, wherein the human or chimeric IL17F polypeptide comprises at least 50, at least 80, at least 110, or at least 130 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human IL17F, wherein the animal expresses the human or chimeric IL17F.
The animal of claim 28, wherein the human or chimeric IL17F polypeptide comprises an amino acid sequence that is at least 90%, 95%, or 99%identical to amino acids 31-163 of SEQ ID NO: 8.
The animal of claim 28 or 29, wherein the nucleotide sequence is operably linked to an endogenous IL17F regulatory element of the animal.
The animal of any one claims 28-30, wherein the nucleotide sequence is integrated to an endogenous IL17F gene locus of the animal.
The animal of any one of claims 28-31, wherein the chimeric IL17F polypeptide has at least one mouse IL17F polypeptide activity and/or at least one human IL17F polypeptide activity.
The animal of any one of claims 28-32, wherein the animal in its genome comprises, preferably from 5’ to 3’ : a mouse 5’ UTR, a sequence encoding the signal peptide of endogenous IL17F, a sequence encoding the mature chain (without signal peptide) of human IL17F, and a mouse 3’ UTR.
A method of making a genetically-modified non-human animal cell that expresses a human or chimeric IL17F, the method comprising:

replacing at an endogenous IL17F gene locus, a nucleotide sequence encoding a region of endogenous IL17F with a nucleotide sequence encoding a corresponding region of human IL17F, thereby generating a genetically-modified non-human animal cell that includes a nucleotide sequence that encodes the human or chimeric IL17F, wherein the non-human animal cell expresses the human or chimeric IL17F.
The method of claim 34, wherein the nucleotide sequence encoding the human or chimeric IL17F is operably linked to an endogenous IL17F regulatory region, e.g., promoter.
The animal of any one of claims 1-22 and 28-33, wherein the animal further comprises a sequence encoding an additional human or chimeric protein.
The animal of claim 36, wherein the additional human or chimeric protein is interleukin 17A (IL17A) , interleukin 17 Receptor C (IL17RC) , interleukin 17 Receptor A (IL17RA) , programmed cell death protein 1 (PD-1) , cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) , Lymphocyte Activating 3 (LAG-3) , IL15 receptor, B And T Lymphocyte Associated (BTLA) , Programmed Cell Death 1 Ligand 1 (PD-L1) , CD3, CD27, CD28, CD47, CD137, CD154, T-Cell Immunoreceptor With Ig And ITIM Domains (TIGIT) , T-cell Immunoglobulin and Mucin-Domain Containing-3 (TIM-3) , Glucocorticoid-Induced TNFR-Related Protein (GITR) , Signal regulatory protein α (SIRPα) or TNF Receptor Superfamily Member 4 (OX40) .
The animal of claim 36, wherein the additional human or chimeric protein is IL17A and the animal expresses the human or chimeric IL17A.
The method of any one of claims 23-27, 34, and 35, wherein the animal or mouse further comprises a sequence encoding an additional human or chimeric protein.
The method of claim 39, wherein the additional human or chimeric protein isIL17A, IL17RC, IL17RA, PD-1, CTLA-4, LAG-3, IL15 receptor, BTLA, PD-L1, CD3, CD27, CD28, CD47, CD137, CD154, TIGIT, TIM-3, GITR, SIRPα or OX40.
The method of claim 39, wherein the additional human or chimeric protein is IL17A and the and the animal expresses the human or chimeric IL17A.
A genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric interleukin 17A (IL17A) .
The animal of claim 42, wherein the sequence encoding the human or chimeric IL17A is operably linked to an endogenous regulatory element at the endogenous IL17A gene locus in the at least one chromosome.
The animal of claim 42 or 43, wherein the sequence encoding a human or chimeric IL17A is operably linked to an endogenous 5’ untranslated region (5'-UTR) and/or an endogenous 3’ untranslated region (3’ UTR) .
The animal of any one of claims 42-44, wherein the sequence encoding a human or chimeric IL17A comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human IL17A (SEQ ID NO: 2) .
The animal of any one of claims 42-45, wherein the sequence comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 6.
The animal of any one of claims 42-46, wherein the animal is a mammal, e.g., a monkey, a rodent, or a mouse.
The animal of claim 47, wherein the mammal is a mouse.
The animal of any one of claims 42-48, wherein the animal does not express endogenous IL17A or expresses a decreased level of endogenous IL17A as compared to that of an animal without genetic modification.
The animal of any one of claims 42-49, wherein the animal has one or more cells expressing human or chimeric IL17A.
The animal of any one of claims 42-50, wherein the expressed human or chimeric IL17A can form a homodimer that can interact with an IL17 receptor complex (e.g., formed by interleukin 17 Receptor C (IL17RC) and interleukin 17 Receptor A (IL17RA) ) .
The animal of any one of claims 42-51, wherein the expressed human or chimeric IL17A can bind to human interleukin 17F (IL17F) , forming a heterodimer that can interact with an IL17 receptor complex (e.g., formed by IL17RC and IL17RA) .
The animal of any one of claims 42-51, wherein the expressed human or chimeric IL17A can bind to endogenous IL17F, forming a heterodimer that can interact with an IL17 receptor complex (e.g., formed by IL17RC and IL17RA) .
A genetically-modified, non-human animal, wherein the genome of the animal comprises a replacement of a sequence encoding a region of endogenous IL17A with a sequence encoding a corresponding region of human IL17A at an endogenous IL17A gene locus.
The animal of claim 54, wherein the sequence encoding the corresponding region of human IL17A is operably linked to an endogenous regulatory element at the endogenous IL17A locus.
The animal of claim 54 or 55, wherein the animal does not express endogenous IL17A, and the animal has one or more cells expressing human or chimeric IL17A.
The animal of any one of claims 54-56, wherein the replaced sequence encoding a region of endogenous IL17A comprises exon 1, exon 2, and/or exon 3, or a part thereof, of endogenous IL17A gene.
The animal of claim 57, wherein the animal is a mouse, and the replaced sequence starts within exon 1 (e.g., from the start codon ATG) and ends within exon 3 (e.g., to the stop codon TAA) of endogenous mouse IL17A gene.
The animal of any one of claims 54-58, wherein the animal is heterozygous with respect to the replacement at the endogenous IL17A gene locus.
The animal of any one of claims 54-58, wherein the animal is homozygous with respect to the replacement at the endogenous IL17A gene locus.
A method for making a genetically-modified, non-human animal, comprising:

replacing in at least one cell of the animal, at an endogenous IL17A gene locus, a sequence encoding a region of an endogenous IL17A with a sequence encoding a corresponding region of human IL17A.
The method of claim 61, wherein the sequence encoding the corresponding region of human IL17A comprises exon 1, exon 2, and/or exon 3, or a part thereof, of a human IL17A gene.
The method of claim 61 or 62, wherein the sequence encoding the corresponding region of human IL17A encodes an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical toSEQ ID NO: 2.
The method of any one of claims 61-63, wherein the endogenous IL17A locus comprises exon 1, exon 2, and/or exon 3, or a part thereof, of the endogenous IL17A gene.
The method of any one of claims 61-64, wherein the animal is a mouse, and the sequence encoding a region of an endogenous IL17A starts within exon 1 (e.g., from the start codon ATG) and ends within exon 3 (e.g., to the stop codon TAA) of the endogenous mouse IL17A gene.
A non-human animal comprising at least one cell comprising a nucleotide sequence encoding an exogenous IL17A polypeptide, wherein the exogenous IL17A polypeptide comprises at least 50, at least 100, or at least 150 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human IL17A, wherein the animal expresses the exogenous IL17A.
The animal of claim 66, wherein the exogenous IL17A polypeptide comprises an amino acid sequence that is at least 90%, 95%, or 99%identical to SEQ ID NO: 2.
The animal of claim 66 or 67, wherein the nucleotide sequence is operably linked to an endogenous IL17A regulatory element of the animal.
The animal of any one claims 66-68, wherein the nucleotide sequence is integrated to an endogenous IL17A gene locus of the animal.
The animal of any one of claims 66-69, wherein the animal in its genome comprises, from 5’ to 3’ : a mouse 5’ UTR, a sequence encoding the exogenous IL17A polypeptide, and a mouse 3’ UTR.
A method of making a genetically-modified non-human animal cell that expresses a human or chimeric IL17A, the method comprising:

replacing at an endogenous IL17A gene locus, a nucleotide sequence encoding a region of endogenous IL17A with a nucleotide sequence encoding a corresponding region of human IL17A, thereby generating a genetically-modified non-human animal cell that includes a nucleotide sequence that encodes the human or chimeric IL17A, wherein the non-human animal cell expresses the human or chimeric IL17A.
The method of claim 71, wherein the nucleotide sequence encoding the human or chimeric IL17A is operably linked to an endogenous IL17A regulatory region, e.g., promoter.
The animal of any one of claims 42-60 and 61-65, wherein the animal further comprises a sequence encoding an additional human or chimeric protein.
The animal of claim 73, wherein the additional human or chimeric protein is interleukin 17F (IL17F) , interleukin 17 Receptor C (IL17RC) , interleukin 17 Receptor A (IL17RA) , programmed cell death protein 1 (PD-1) , cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) , Lymphocyte Activating 3 (LAG-3) , IL15 receptor, B And T Lymphocyte Associated (BTLA) , Programmed Cell Death 1 Ligand 1 (PD-L1) , CD3, CD27, CD28, CD47, CD137, CD154, T-Cell Immunoreceptor With Ig And ITIM Domains (TIGIT) , T-cell Immunoglobulin and Mucin-Domain Containing-3 (TIM-3) , Glucocorticoid-Induced TNFR-Related Protein (GITR) , Signal regulatory protein α (SIRPα) or TNF Receptor Superfamily Member 4 (OX40) .
The animal of claim 73, wherein the additional human or chimeric protein is IL17F and the animal expresses the human or chimeric IL17F.
The method of any one of claims 66-70, 71, and 72, wherein the animal or mouse further comprises a sequence encoding an additional human or chimeric protein.
The method of claim 76, wherein the additional human or chimeric protein isIL17F, IL17RC, IL17RA, PD-1, CTLA-4, LAG-3, IL15 receptor, BTLA, PD-L1, CD3, CD27, CD28, CD47, CD137, CD154, TIGIT, TIM-3, GITR, SIRPα or OX40.
The method of claim 76, wherein the additional human or chimeric protein is IL17Fand the animal expresses the human or chimeric IL17F.
A method of determining effectiveness of a therapeutic agent for treating an allergic disorder, comprising:

a) administering the therapeutic agent to the animal of any one of claims 1-22, 28-33, 36-38, 42-60, 66-70, and 73-75, wherein the animal has the allergic disorder; and

b) determining effects of the therapeutic agent in treating the allergic disorder.
The method of claim 79, wherein the therapeutic agent is an anti-IL17A antibody or an anti-IL17F antibody.
The method of claim 79 or 80, wherein the allergic disorder is allergy, asthma, and/or atopic dermatitis.
A method of determining effectiveness of a therapeutic agent for reducing an inflammation, comprising:

a) administering the therapeutic agent to the animal of any one of claims 1-22, 28-33, 36-38, 42-60, 66-70, and 73-75, wherein the animal has the inflammation; and

b) determining effects of the therapeutic agent for reducing the inflammation.
The method of claim 82, wherein the therapeutic agent is an anti-IL17A antibody or an anti-IL17F antibody.
A method of determining effectiveness of a therapeutic agent for treating an autoimmune disorder, comprising:

a) administering the agent to the animal of any one of claims 1-22, 28-33, 36-38, 42-60, 66-70, and 73-75, wherein the animal has the autoimmune disorder; and

b) determining effects of the therapeutic agent for treating the autoimmune disorder.
The method of claim 84, wherein the therapeutic agent is an anti-IL17A antibody, an anti-IL17F antibody, or a corticosteroid (e.g., dexamethasone) .
The method of claim 84 or 85, wherein the autoimmune disorder is rheumatoid arthritis, Psoriatic Arthritis, Ankylosing Spondylitis, Non-radiographic Axial Spondyloarthritis, Crohn’s disease, systemic lupus erythematosus, ankylosing spondylitis, inflammatory bowel diseases (IBD) , ulcerative colitis, multiple sclerosis, systemic juvenile idiopathic arthritis (SJIA) , and/or scleroderma.
The method of claim 84 or 85, wherein the autoimmune disorder is psoriasis.
A method of determining effectiveness of a therapeutic agent for treating a cancer, comprising:

a) administering the therapeutic agent to the animal of any one of claims 1-22, 28-33, 36-38, 42-60, 66-70, and 73-75, wherein the animal has the cancer; and

b) determining inhibitory effects of the therapeutic agent for treating the cancer.
The method of claim 88, wherein the therapeutic agent is an anti-IL17A antibody or/and an anti-IL17F antibody.
The method of claim 88 or 89, wherein the cancer is a tumor, and determining the inhibitory effects of the treatment involves measuring the tumor volume in the animal.
The method of any one of claims 88-90, wherein the cancer comprises one or more cancer cells that are injected into the animal.
The method of any one of claims 88-91, wherein the cancer is a colon cancer, rectal cancer, stomach cancer, ovarian cancer, or prostate cancer.
A method of determining toxicity of an anti-IL17A or anti-IL17F antibody, the method comprising

a) administering the anti-IL17F or anti-IL17F antibody to the animal of any one of claims 1-22, 28-33, 36-38, 42-60, 66-70, and 73-75; and

b) determining weight change of the animal.
The method of claim 93, the method further comprising performing a blood test (e.g., determining red blood cell count) .
A protein comprising an amino acid sequence, wherein the amino acid sequence is one of the following:

(a) an amino acid sequence set forth in SEQ ID NO: 1, 2, 7, 8, or 16;

(b) an amino acid sequence that is at least 90%identical to SEQ ID NO: 1, 2, 7, 8, or 16;

(c) an amino acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 1, 2, 7, 8, or 16;

(d) an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 1, 2, 7, 8, or 16 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid; and

(e) an amino acid sequence that comprises a substitution, a deletion and /or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 1, 2, 7, 8, or 16.
A nucleic acid comprising a nucleotide sequence, wherein the nucleotide sequence is one of the following:

(a) a sequence that encodes the protein of claim 95;

(b) SEQ ID NO: 3, 4, 5, 6, 9, 10, 11, 12, 13, 14, 15, 24, 25, 55, or 56;

(c) a sequence that is at least 90 %identical to SEQ ID NO: 3, 4, 5, 6, 9, 10, 11, 12, 13, 14, 15, 24, 25, 55, or 56; and

(d) a sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, 4, 5, 6, 9, 10, 11, 12, 13, 14, 15, 24, 25, 55, or 56.
A cell comprising the protein of claim 95 and/or the nucleic acid of claim 96.
An animal comprising the protein of claim 95 and/or the nucleic acid of claim 96.