WO2022222958A1

WO2022222958A1 - Genetically modified non-human animal with human or chimeric genes

Info

Publication number: WO2022222958A1
Application number: PCT/CN2022/087916
Authority: WO
Inventors: Ruili LV; Shujin Zhang; Suman ZHAO; Chonghui LIU
Original assignee: Biocytogen Pharmaceuticals (Beijing) Co., Ltd.
Priority date: 2021-04-20
Filing date: 2022-04-20
Publication date: 2022-10-27
Also published as: CN114853871A; CN114853871B

Abstract

Provided are genetically modified non-human animals that express a human or chimeric (e.g., humanized) CSF1R and/or a human or chimeric (e.g., humanized) CSF 1, and methods of use thereof.

Description

GENETICALLY MODIFIED NON-HUMAN ANIMAL WITH HUMAN OR CHIMERIC GENES

CLAIM OF PRIORITY

This application claims the benefit of Chinese Patent Application App. No. 202110425356. X, filed on April 20, 2021 and Chinese Patent Application App. No. 202210185622.0, filed on February 28, 2022. The entire contents of the foregoing application are incorporated herein by reference.

TECHNICAL FIELD

This disclosure relates to genetically modified animal expressing human or chimeric (e.g., humanized) CSF1R and/or CSF1 genes, and methods of use thereof.

BACKGROUND

Macrophage colony-stimulating factor (CSF1) , also known as colony-stimulating factor-1 (CSF1) , and its receptor CSF1R have been correlated with poor prognosis in many cancer types including breast cancer. There is substantial evidence showing that targeting CSF1/CSF1R pathway can be a therapeutic strategy for treating cancers in humans.

The traditional drug research and development for therapeutic agents that target CSF1/CSF1R pathway typically use in vitro screening approaches. However, these screening approaches are still different from what happens in the in vivo environment (such as cell microenvironment, extracellular matrix components and immune cell interaction, etc. ) , resulting in a high rate of failure in drug development. There is a need for humanized animal models that are suitable for human antibody screening and efficacy evaluation.

SUMMARY

This disclosure is related to an animal model with human CSF1R and/or CSF1 or chimeric CSF1R and/or CSF1. The animal model can express human CSF1R and/or CSF1 or chimeric CSF1R and/or CSF1 (e.g., humanized CSF1R and/or CSF1) protein in its body. It can be used in the studies on the function of CSF1R and/or CSF1 gene, and can be used in the screening and evaluation of anti-human CSF1R and anti-human CSF1 antibodies. In addition, the animal models prepared by the methods described herein can be used in drug screening, pharmacodynamics studies, and treatments for cancers. They can also be used to facilitate the development and design of new drugs, and save time and cost. In summary, this disclosure provides a powerful tool for studying the function of CSF1R and/or CSF1 protein and a platform for screening treatments for immune-related diseases.

In one aspect, the disclosure is related to a genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric colony stimulating factor 1 receptor (CSF1R) . In some embodiments, the sequence encoding the human or chimeric CSF1R is operably linked to an endogenous regulatory element at the endogenous CSF1R gene locus in the at least one chromosome. In some embodiments, the sequence encoding the human or chimeric CSF1R comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human CSF1R (NP_005202.2; SEQ ID NO: 35) . In some embodiments, the sequence encoding a human or chimeric CSF1R comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 43. In some embodiments, the sequence encoding a human or chimeric CSF1R comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 20-517 of SEQ ID NO: 35. In some embodiments, the animal is a mammal, e.g., a monkey, a rodent or a mouse. In some embodiments, the animal is a mouse. In some embodiments, the animal does not express endogenous CSF1R, or expresses a decreased level of endogenous CSF1R as compared to CSF1R expression level in a wild-type animal. In some embodiments, the animal has one or more cells expressing human or chimeric CSF1R. In some embodiments, the animal has one or more cells expressing human or chimeric CSF1R, and endogenous CSF1 or IL34 can bind to the expressed human or chimeric CSF1R. In some embodiments, the animal has one or more cells expressing human or chimeric CSF1R, and human CSF1 or IL34 can bind to the expressed human or chimeric CSF1R.

In one aspect, the disclosure is related to a genetically-modified, non-human animal, in some embodiments, the genome of the animal comprises a replacement of a sequence encoding a region of endogenous CSF1R with a sequence encoding a corresponding region of human CSF1R at an endogenous CSF1R gene locus. In some embodiments, the sequence encoding the corresponding region of human CSF1R is operably linked to an endogenous regulatory element at the endogenous CSF1R locus, and one or more cells of the animal express a human or chimeric CSF1R. In some embodiments, the animal does not express endogenous CSF1R, or expresses a decreased level of endogenous CSF1R as compared to CSF1R expression level in a wild-type animal. In some embodiments, the replaced sequence encodes the extracellular region of CSF1R. In some embodiments, the animal has one or more cells expressing a chimeric CSF1R having an extracellular region, in some embodiments, the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, or 99%identical to the extracellular region of human CSF1R. In some embodiments, the extracellular region of the chimeric CSF1R has a sequence that has at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 498 contiguous amino acids that are identical to a contiguous sequence present in the extracellular region of human CSF1R. In some embodiments, the animal is a mouse, and the replaced endogenous CSF1R region is a portion of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and/or a portion of exon 11 of the endogenous mouse CSF1R gene. In some embodiments, the animal is heterozygous with respect to the replacement at the endogenous CSF1R gene locus. In some embodiments, the animal is homozygous with respect to the replacement at the endogenous CSF1R gene locus.

In one aspect, the disclosure is related to a method for making a genetically-modified, non-human animal, comprising: replacing in at least one cell of the animal, at an endogenous CSF1R gene locus, a sequence encoding a region of an endogenous CSF1R with a sequence encoding a corresponding region of human CSF1R. In some embodiments, the sequence encoding the corresponding region of human CSF1R comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22, or a part thereof, of a human CSF1R gene. In some embodiments, the sequence encoding the corresponding region of human CSF1R comprises a portion of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and/or a portion of exon 11 of a human CSF1R gene. In some embodiments, the sequence encoding the corresponding region of human CSF1R comprises at least 30, 50, 100, 200, or 300 nucleotides of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and/or exon 11 of a human CSF1R gene. In some embodiments, the sequence encoding the corresponding region of human CSF1R encodes a sequence that is at least 90%identical to SEQ ID NO: 43. In some embodiments, the locus is located at the extracellular region of CSF1R. In some embodiments, the locus comprises a sequence encodes the extracellular region of CSF1R. In some embodiments, the sequence encoding a region of an endogenous CSF1R comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22, or a part thereof, of the endogenous CSF1R gene. In some embodiments, the animal is a mouse, and the sequence encoding a region of an endogenous CSF1R comprises a portion of exon 3, exon 4, exon 5, exons 6, exon 7, exon 8, exon 9, exon 10, and/or a portion of exon 11 of the mouse CSF1R gene.

In one aspect, the disclosure is related to a non-human animal comprising at least one cell comprising a nucleotide sequence encoding a chimeric CSF1R polypeptide, in some embodiments, the chimeric CSF1R polypeptide comprises at least 50 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human CSF1R, in some embodiments, the animal expresses the chimeric CSF1R polypeptide. In some embodiments, the chimeric CSF1R polypeptide has at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human CSF1R extracellular region. In some embodiments, the chimeric C SF1R polypeptide comprises a sequence that is at least 90%, 95%, or 99%identical of SEQ ID NO: 43. In some embodiments, the nucleotide sequence is operably linked to an endogenous CSF1R regulatory element of the animal. In some embodiments, the nucleotide sequence is integrated to an endogenous CSF1R gene locus of the animal. In some embodiments, the chimeric CSF1R polypeptide has at least one mouse CSF1R activity and/or at least one human CSF1R activity.

In one aspect, the disclosure is related to a method of making a genetically-modified non-human animal cell that expresses a chimeric CSF1R, the method comprising: replacing, at an endogenous mouse CSF1R gene locus, a nucleotide sequence encoding a region of endogenous CSF1R with a nucleotide sequence encoding a corresponding region of human CSF1R, thereby generating a genetically-modified non-human animal cell that includes a nucleotide sequence that encodes the chimeric CSF1R, in some embodiments, the cell expresses the chimeric CSF1R. In some embodiments, the animal is a mouse. In some embodiments, the chimeric CSF1R comprises: an extracellular region of human CSF1R; a transmembrane region of endogenous CSF1R; and/or a cytoplasmic region of endogenous CSF1R. In some embodiments, the nucleotide sequence encoding the chimeric CSF1R is operably linked to an endogenous CSF1R regulatory region, e.g., promoter.

In some embodiments, the animal described herein further comprises a sequence encoding an additional human or chimeric protein (e.g., colony stimulating factor 1 (CSF1) , programmed cell death protein 1 (PD-1) , programmed cell death 1 ligand 1 (PD-L1) , IL6, IL3, IL 15, colony stimulating factor 2 (CSF2) , thyroid peroxidase (TPO) , or CD40) . In some embodiments, the additional human or chimeric protein is CSF1.

In one aspect, the disclosure is related to a genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric CSF1. In some embodiments, the sequence encoding the human or chimeric CSF1 is operably linked to an endogenous regulatory element at the endogenous CSF1 gene locus in the at least one chromosome. In some embodiments, the sequence encoding a human or chimeric CSF1 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 38-554 or 1-554 of human CSF1 (NP_000748.4; SEQ ID NO: 2) . In some embodiments, the animal comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 10. In some embodiments, the animal is a mammal, e.g., a monkey, a rodent or a mouse. In some embodiments, the animal is a mouse. In some embodiments, the animal does not express endogenous CSF1, or expresses a decreased level of endogenous CSF1 as compared to CSF1 expression level in a wild-type animal. In some embodiments, the animal has one or more cells expressing human CSF1. In some embodiments, the animal has one or more cells expressing human or chimeric CSF1, and the expressed human or chimeric CSF1 can bind to endogenous CSF1R. In some embodiments, the animal has one or more cells expressing human or chimeric CSF1, and the expressed human or chimeric CSF1 can bind to human CSF1R.

In one aspect, the disclosure is related to a genetically-modified, non-human animal, in some embodiments, the genome of the animal comprises a replacement of a sequence encoding a region of endogenous CSF1 with a sequence encoding a corresponding region of human CSF1 at an endogenous CSF1 gene locus. In some embodiments, the sequence encoding the corresponding region of human CSF1 is operably linked to an endogenous regulatory element at the endogenous CSF1 locus, and one or more cells of the animal expresses a chimeric or human CSF1. In some embodiments, the animal does not express endogenous CSF1, or expresses a decreased level of endogenous CSF1 as compared to CSF1 expression level in a wild-type animal. In some embodiments, the replaced locus comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 10. In some embodiments, the animal is a mouse, and the replaced endogenous CSF1 region is a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and/or a portion of exon 8 of the endogenous mouse CSF1 gene. In some embodiments, the animal is heterozygous with respect to the replacement at the endogenous CSF1 gene locus. In some embodiments, the animal is homozygous with respect to the replacement at the endogenous CSF1 gene locus.

In one aspect, the disclosure is related to a method for making a genetically-modified, non-human animal, comprising: replacing in at least one cell of the animal, at an endogenous CSF1 gene locus, a sequence encoding a region of an endogenous CSF1 with a sequence encoding a corresponding region of human CSF1. In some embodiments, the sequence encoding the corresponding region of human CSF1 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9, or a part thereof, of a human CSF1 gene. In some embodiments, the sequence encoding the corresponding region of human CSF1 comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and/or a portion of exon 8 of a human CSF1 gene. In some embodiments, the sequence encoding the corresponding region of CSF1 comprises at least 30, 50, 100, 200, or 300 nucleotides of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and/or exon 8 of a human CSF1 gene. In some embodiments, the sequence encoding the corresponding region of human CSF1 encodes a sequence that is at least 90%identical to SEQ ID NO: 10. In some embodiments, the sequence encoding a region of an endogenous CSF1 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9, or a part thereof, of the endogenous CSF1 gene. In some embodiments, the animal is a mouse, and the sequence encoding a region of an endogenous CSF1 comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and a portion of exon 8 of the mouse CSF1 gene.

In one aspect, the disclosure is related to a non-human animal comprising at least one cell comprising a nucleotide sequence encoding a human or chimeric CSF1 polypeptide, in some embodiments, the human or chimeric CSF1 polypeptide comprises at least 50 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human CSF1, in some embodiments, the animal expresses the human or chimeric CSF1 polypeptide. In some embodiments, the human or chimeric CSF1 polypeptide has at least 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, or 517 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human CSF1. In some embodiments, the human or chimeric CSF1 polypeptide comprises a sequence that is at least 90%, 95%, or 99%identical of SEQ ID NO: 10. In some embodiments, the nucleotide sequence is operably linked to an endogenous CSF1 regulatory element of the animal. In some embodiments, the nucleotide sequence is integrated to an endogenous CSF1 gene locus of the animal. In some embodiments, the non-human animal comprises at least one cell comprising a nucleotide sequence encoding a chimeric CSF1 polypeptide, and the chimeric CSF1 polypeptide has at least one mouse CSF1 activity and/or at least one human CSF1 activity.

In one aspect, the disclosure is related to a method of making a genetically-modified non-human animal cell that expresses a human or chimeric CSF1, the method comprising: replacing, at an endogenous mouse CSF1 gene locus, a nucleotide sequence encoding a region of endogenous CSF1 with a nucleotide sequence encoding a corresponding region of human CSF1, thereby generating a genetically-modified non-human animal cell that includes a nucleotide sequence that encodes the human or chimeric CSF1, in some embodiments, the cell expresses the human or chimeric CSF1. In some embodiments, the animal is a mouse. In some embodiments, the nucleotide sequence encoding the human or chimeric CSF1 is operably linked to an endogenous CSF1 regulatory region, e.g., promoter.

In some embodiments, the animal described herein further comprises a sequence encoding an additional human or chimeric protein (e.g., colony stimulating factor 1 receptor (CSF1R) , programmed cell death protein 1 (PD-1) , programmed cell death 1 ligand 1 (PD-L1) , IL6, IL3, IL15, colony stimulating factor 2 (CSF2) , thyroid peroxidase (TPO) , or CD40) . In some embodiments, the additional human or chimeric protein is CSF1R.

In one aspect, the disclosure is related to a method of determining effectiveness of an CSF1/CSF1R pathway modulator for treating an immune disorder, comprising: administering the CSF1/CSF1R pathway modulator to the animal as described herein, in some embodiments, the animal has an immune disorder; and determining the effects of the CSF1/CSF1R pathway modulator. In some embodiments, the CSF1/CSF1R pathway modulator is an anti-human CSF1 antibody. In some embodiments, the CSF1/CSF1R pathway modulator is an anti-human CSF1R antibody. In some embodiments, the immune disorder is allergy, asthma, myocarditis, nephritis, hepatitis, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative Colitis, autoimmune liver disease, diabetes, pain or neurological disorders.

In one aspect, the disclosure is related to a method of determining effectiveness of an CSF1/CSF1R pathway modulator for reducing inflammation, comprising: administering the CSF1/CSF1R pathway modulator to the animal as described herein, in some embodiments, the animal has an inflammation; and determining the effects of the CSF1/CSF1R pathway modulator.

In one aspect, the disclosure is related to a method of determining effectiveness of an CSF1/CSF1R pathway modulator for treating cancer, comprising: administering the CSF1/CSF1R pathway modulator to the animal as described herein, in some embodiments, the animal has a cancer; and determining the effects of the CSF1/CSF1R pathway modulator. In some embodiments, the cancer is breast cancer, ovarian cancer, endometrial cancer, melanoma, kidney cancer, lung cancer, or liver cancer.

In one aspect, the disclosure is related to a method of determining effectiveness of an CSF1/CSF1R pathway modulator for treating an infectious disease, comprising: administering the CSF1/CSF1R pathway modulator to the animal as described herein, in some embodiments, the animal has an infectious disease; and determining the effects of the CSF1/CSF1R pathway modulator.

In one aspect, the disclosure is related to a method of determining toxicity of an anti-CSF1R antibody or an anti-CSF1 antibody, the method comprising administering the anti-CSF1R antibody or the anti-CSF1 antibody to the animal as described herein; and determining weight change of the animal. In some embodiments, the method further comprises performing a blood test (e.g., determining red blood cell count) .

In one aspect, the disclosure is related to a protein comprising an amino acid sequence, in some embodiments, the amino acid sequence is one of the following:

(a) an amino acid sequence set forth in SEQ ID NO: 1, 2, 10, 34, 35, or 43;

(b) an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 1, 2, 10, 34, 35, or 43;

(c) an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 1, 2, 10, 34, 35, or 43 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid; and

(d) an amino acid sequence that comprises a substitution, a deletion and/or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 1, 2, 10, 34, 35, or 43.

In one aspect, the disclosure is related to a nucleic acid comprising a nucleotide sequence, in some embodiments, the nucleotide sequence is one of the following:

(a) a sequence that encodes the protein as described herein;

(b) SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 36, 37, 38, 39, 40, 41, or 42; or

(c) a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 36, 37, 38, 39, 40, 41, or 42.

In one aspect, the disclosure is related to a cell comprising the protein and/or the nucleic acid as described herein. In one aspect, the disclosure is related to an animal comprising the protein and/or the nucleic acid as described herein.

In one aspect, the disclosure is related to a cell comprising the protein as described herein and/or the nucleic acid as described herein.

In one aspect, the disclosure is related to an animal comprising the protein as described herein and/or the nucleic acid as described herein.

The disclosure also relates to non-human mammal generated through the methods as described herein. In some embodiments, the genome thereof contains human gene (s) .

In some embodiments, the non-human mammal is a rodent. In some embodiments, the non-human mammal is a mouse. In some embodiments, the non-human mammal expresses human CSF1R and/or human CSF1.

The disclosure also relates to an offspring of the non-human mammal.

In one aspect, the disclosure relates to a non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein. In some embodiments, the non-human mammal is a rodent. In some embodiments, the non-human mammal is a mouse.

The disclosure also relates to a cell (e.g., stem cell or embryonic stem cell) or cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal. The disclosure further relates to the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal.

In one aspect, the disclosure relates to a tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.

The disclosure further relates to a CSF1R and/or CSF1 genomic DNA sequence of a humanized mouse, a DNA sequence obtained by a reverse transcription of the mRNA obtained by transcription thereof is consistent with or complementary to the DNA sequence; a construct expressing the amino acid sequence thereof; a cell comprising the construct thereof; a tissue comprising the cell thereof.

The disclosure further relates to the use of the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal, the animal model generated through the method as described herein in the development of a product related to an immunization processes of human cells, the manufacture of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.

The disclosure also relates to the use of the non-human mammal or an offspring thereof, or the non-human mammal, the animal model generated through the method as described herein in the production and utilization of an animal experimental disease model of immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and/or a therapeutic strategy.

The disclosure further relates to the use of the non-human mammal or an offspring thereof, or the non-human mammal, the animal model generated through the methods as described herein, in the screening, verifying, evaluating or studying the CSF1R and/or CSF1 gene function, anti-human CSF1R or anti-human CSF1 antibodies, the drugs or efficacies for human CSF1R and/or CSF1 targeting sites, and the drugs for immune-related diseases.

As used herein, the term “nucleotide” refers to native or modified ribonucleotide sequences or deoxyribonucleotide sequences (e.g., DNA, cDNA, pre-mRNA, mRNA, rRNA, hnRNA, miRNAs, scRNA, snRNA, siRNA, sgRNA, or tRNA)

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.

DESCRIPTION OF DRAWINGS

FIG. 1 is a schematic diagram showing mouse and human CSF1 gene loci.

FIG. 2 is a schematic diagram showing humanized CSF1 gene locus.

FIG. 3 is a schematic diagram showing a CSF1 gene targeting strategy.

FIG. 4 shows Southern Blot results of cells after recombination using the 5' Probe, 3' Probe, and Neo Probe. WT is a wild-type control.

FIG. 5 is a schematic diagram showing the FRT recombination process in CFR1 gene humanized mice.

FIG. 6A shows mouse tail PCR identification results of F1 generation mice by primers WT-F and WT-R. M is a marker. PC is a positive control. WT is a wild-type control. H ₂O is a water control.

FIG. 6B shows mouse tail PCR identification results of F1 generation mice by primers WT-F and Mut-R. M is a marker. PC is a positive control. WT is a wild-type control. H ₂O is a water control.

FIG. 6C shows mouse tail PCR identification results of F1 generation mice by primers Frt-F and Frt-R. M is a marker. PC is a positive control. WT is a wild-type control. H ₂O is a water control.

FIG. 6D shows mouse tail PCR identification results of F1 generation mice by primers Flp-F and Flp-R. M is a marker. PC is a positive control. WT is a wild-type control. H ₂O is a water control.

FIGS. 7A-7C show RT-PCR detection results of mouse CSF1 mRNA, humanized CSF1 mRNA, and GAPDH mRNA, respectively, in spleen tissues of wild-type C57BL/6 mice (WT) and CSF1 gene humanized heterozygous mice (H/+) . M is a marker. H ₂O is a water control. GAPDH is an internal reference.

FIGS. 8A-8B show ELISA detection results of mouse CSF1 protein and humanized CSF1 protein, respectively, in spleen tissues of wild-type C57BL/6 mice (WT) and CSF1 gene humanized heterozygous mice (H/+) .

FIG. 9 is a schematic diagram showing mouse and human CSF1R gene loci.

FIG. 10 is a schematic diagram showing humanized CSF1R gene locus.

FIG. 11 is a schematic diagram showing a CSF1R gene targeting strategy.

FIG. 12A shows a flow cytometry detection result of spleen cells from wild-type C57BL/6 mice (WT) , stained by mCSF1R-APC and mCD11b-V450.

FIG. 12B shows a flow cytometry detection result of spleen cells from F1 generation CSF1R gene humanized heterozygous mice (H/+) , stained by mCSF1R-APC and mCD11b-V450.

FIG. 12C shows a flow cytometry detection result of spleen cells from wild-type C57BL/6 mice (WT) , stained by hCSF1R-PE and mCD11b-V450.

FIG. 12D shows a flow cytometry detection result of spleen cells from F1 generation CSF1R gene humanized heterozygous mice (H/+) , stained by hCSF1R-PE and mCD11b-V450.

FIGS. 13A-13B show ELISA detection results of mouse CSF1 protein (mCSF1) and humanized CSF1 protein (hCSF1) , respectively, in spleen tissues of wild-type C57BL/6 mice (WT) and CSF1/CSF1R double-gene humanized homozygous mice (H/H) .

FIG. 14A shows a flow cytometry detection result of peripheral blood cells from wild-type C57BL/6 mice (WT) , stained by hCSF1R-PE, Brilliant Violet 510 ^TM anti-mouse CD45 Antibody, and mCD11b-V450.

FIG. 14B shows a flow cytometry detection result of peripheral blood cells from CSF1/CSF1R double-gene humanized homozygous mice (H/H) , stained by hCSF1R-PE, Brilliant Violet 510 ^TM anti-mouse CD45 Antibody, and mCD11b-V450.

FIG. 14C shows a flow cytometry detection result of peripheral blood cells from wild-type C57BL/6 mice (WT) , stained by mCSF1R-APC, Brilliant Violet 510 ^TM anti-mouse CD45 Antibody, and mCD11b-V450.

FIG. 14D shows a flow cytometry detection result of peripheral blood cells from CSF1/CSF1R double-gene humanized homozygous mice (H/H) , stained by mCSF1R-APC, Brilliant Violet 510 ^TM anti-mouse CD45 Antibody, and mCD11b-V450.

FIG. 15 shows the body weight of C SF1/CSF1R double-gene humanized homozygous mice that were xenografted with mouse colon cancer cells (MC38) , and then treated with anti-human CSF1R antibodies AMG-820 analog (G2) , axatilimab analog (G3) , cabiralizumab analog (G4) , emactuzumab analog (G5) , and IMC-CS4 analog (G6) at 3 mg/kg. G1 group mice were injected with PBS (G1) as a control.

FIG. 16 shows the body weight change of CSF1/CSF1R double-gene humanized homozygous mice that were xenografted with mouse colon cancer cells (MC38) , and then treated with anti-human CSF1R antibodies AMG-820 analog (G2) , axatilimab analog (G3) , cabiralizumab analog (G4) , emactuzumab analog (G5) , and IMC-CS4 analog (G6) at 3 mg/kg. G1 group mice were injected with PBS (G1) as a control.

FIG. 17 shows the tumor volume of CSF1/CSF1R double-gene humanized homozygous mice that were xenografted with mouse colon cancer cells (MC38) , and then treated with anti-human CSF1R antibodies AMG-820 analog (G2) , axatilimab analog (G3) , cabiralizumab analog (G4) , emactuzumab analog (G5) , and IMC-CS4 analog (G6) at 3 mg/kg. G1 group mice were injected with PBS (G1) as a control.

FIG. 18 shows the alignment between human CSF1 amino acid sequence (NP_000748.4; SEQ ID NO: 2) and mouse CSF1 amino acid sequence (NP_031804.3; SEQ ID NO: 1) .

FIG. 19 shows the alignment between human CSF1 amino acid sequence (NP_000748.4; SEQ ID NO: 2) and rat CSF1 amino acid sequence (NP_076471.3; SEQ ID NO: 52) .

FIG. 20 shows the alignment between human CSF1R amino acid sequence (NP_005202.2; SEQ ID NO: 35) and mouse CSF1R amino acid sequence (NP_001032948.2; SEQ ID NO: 34) .

FIG. 21 shows the alignment between human CSF1R amino acid sequence (NP_005202.2; SEQ ID NO: 35) and rat CSF1R amino acid sequence (NP_001025072.1; SEQ ID NO: 53) .

DETAILED DESCRIPTION

This disclosure relates to transgenic non-human animal with human or chimeric (e.g., humanized) CSF1R and/or CSF1, and methods of use thereof.

Macrophages are known to be a highly plastic cell type that adapts to the particular stromal environment present in malignant tumors, characterized by tissue necrosis, low oxygen pressure, and high concentrations of lactate and pyruvate. Macrophages have been described as responding to this micromilieu with either a pro-inflammatory or an anti-inflammatory phenotype (also referred to as “fight” versus “fix” macrophages, respectively) . In early stage as well as metastatic cancer, the dominant tumor-associated macrophage (TAM) phenotype is reported to be anti-inflammatory, immune-regulatory, and therefore tumor-promoting (also termed alternatively activated or M2 macrophages) as opposed to pro-inflammatory and tumoricidal (classically activated or M1 macrophages) . The continuum of different macrophage phenotypes present within the tumor microenvironment (TME) is difficult to capture solely with the M1/M2 dichotomy. M2 macrophages/TAM have been reported to promote tumor growth, angiogenesis, invasion, and metastasis as well as resistance to therapy. In addition, TAM infiltration has been shown to have a negative prognostic relevance in most tumor types. This phenotype is a consequence of the continuous presence of growth factors such as colony-stimulating factor-1 (CSF1; or macrophage colony-stimulating factor) as well as the cluster of differentiation (CD) -4+ type 2 helper T-cell-derived (Th2) cytokines interleukin (IL) -4, IL-13, and IL-10 in the TME. In contrast, M1 macrophages are ascribed tumoricidal functions and are generated in the presence of granulocyte-macrophage colony-stimulating factor (GM-CSF or CSF2) and pro-inflammatory stimuli such as interferon (IFN) -γ, lipopolysaccharide, or tumor necrosis factor α.

CSF1 receptor (CSF1R) -mediated signaling is crucial for the differentiation and survival of the mononuclear phagocyte system and macrophages in particular. CSF1R belongs to the type III protein tyrosine kinase receptor family, and binding of CSF1 or IL-34, induces homodimerization of the receptor and subsequent activation of receptor signaling. As the intratumoral presence of CSF1R+ macrophages correlates with poor survival in various tumor types, targeting CSF1R signaling in tumor-promoting TAM represents an attractive strategy to eliminate or repolarize these cells. Thus, it is promising to target CSF1/CSF1R in cancer therapy.

Experimental animal models are an indispensable research tool for studying the effects of these antibodies before clinical trials. Common experimental animals include mice, rats, guinea pigs, hamsters, rabbits, dogs, monkeys, pigs, fish and so on. However, there are differences between human and animal genes and protein sequences, and many human proteins cannot bind to the animal's homologous proteins to produce biological activity, leading to that the results of many clinical trials do not match the results obtained from animal experiments. A large number of clinical studies are in urgent need of better animal models. With the continuous development and maturation of genetic engineering technologies, the use of human cells or genes to replace or substitute an animal's endogenous similar cells or genes to establish a biological system or disease model closer to human, and establish the humanized experimental animal models (humanized animal model) has provided an important tool for new clinical approaches or means. In this context, the genetically engineered animal model, that is, the use of genetic manipulation techniques, the use of human normal or mutant genes to replace animal homologous genes, can be used to establish the genetically modified animal models that are closer to human gene systems. The humanized animal models have various important applications. For example, due to the presence of human or humanized genes, the animals can express or express in part of the proteins with human functions, so as to greatly reduce the differences in clinical trials between humans and animals, and provide the possibility of drug screening at animal levels. Furthermore, because of interaction between human CSF1R and human CSF1, a desirable animal model for the investigation of anti-CSF1R or anti-CSF1 antibodies should faithfully mimic the interaction between human CSF1R and human CSF1, elicit robust responses from both the innate and adaptive immunity, and exhibit similar side effects of CSF1R blockade in human patients.

Unless otherwise specified, the practice of the methods described herein can take advantage of the techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA and immunology. These techniques are explained in detail in the following literature, for examples: Molecular Cloning A Laboratory Manual, 2nd Ed., ed. By Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989) ; DNA Cloning, Volumes I and II (D.N. Glovered., 1985) ; Oligonucleotide Synthesis (M.J. Gaited., 1984) ; Mullisetal U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B.D. Hames&S.J. Higginseds. 1984) ; Transcription And Translation (B.D. Hames&S.J. Higginseds. 1984) ; Culture Of Animal Cell (R.I. Freshney, Alan R. Liss, Inc., 1987) ; Immobilized Cells And Enzymes (IRL Press, 1986) ; B. Perbal, A Practical Guide To Molecular Cloning (1984) , the series, Methods In ENZYMOLOGY (J. Abelson and M. Simon, eds. -in-chief, Academic Press, Inc., New York) , specifically, Vols. 154 and 155 (Wuetal. eds. ) and Vol. 185, “Gene Expression Technology” (D. Goeddel, ed. ) ; Gene Transfer Vectors For Mammalian Cells (J.H. Miller and M.P. Caloseds., 1987, Cold Spring Harbor Laboratory) ; Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987) ; Hand book Of Experimental Immunology, Volumes V (D.M. Weir and C.C. Blackwell, eds., 1986) ; and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986) ; each of which is incorporated herein by reference in its entirety.

CSF1

The colony stimulating factor 1 (CSF1) , also known as macrophage colony-stimulating factor (M-CSF) , is a secreted cytokine which causes hematopoietic stem cells to differentiate into macrophages or other related cell types. Eukaryotic cells also produce CSF1 in order to combat intercellular viral infection. It is one of the three experimentally described colony-stimulating factors. CSF1 binds to the colony stimulating factor 1 receptor (CSF1R) . It may also be involved in development of the placenta.

CSF1 is a cytokine, being a smaller protein involved in cell signaling. The active form of the protein is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. Four transcript variants encoding three different isoforms (a proteoglycan, glycoprotein and cell surface protein) have been found for this gene.

CSF-1 is a hematopoietic growth factor that is involved in the proliferation, differentiation, and survival of monocytes, macrophages, and bone marrow progenitor cells. CSF1 affects macrophages and monocytes in several ways, including stimulating increased phagocytic and chemotactic activity, and increased tumor cell cytotoxicity. The role of CSF1 is not only restricted to the monocyte/macrophage cell lineage. By interacting with its membrane receptor (e.g., CSF1R) , CSF1 also modulates the proliferation of earlier hematopoietic progenitors and influence numerous physiological processes involved in immunology, metabolism, fertility and pregnancy.

CSF1 released by osteoblasts (as a result of endocrine stimulation by parathyroid hormone) exerts paracrine effects on osteoclasts. CSF1 binds to receptors on osteoclasts inducing differentiation, and ultimately leading to increased plasma calcium levels-through the resorption (breakdown) of bone. Additionally, high levels of CSF-1 expression are observed in the endometrial epithelium of the pregnant uterus as well as high levels of its receptor CSF1R in the placental trophoblast. Studies have shown that activation of trophoblastic CSF1R by local high levels of CSF-1 is essential for normal embryonic implantation and placental development. More recently, it was discovered that CSF-1 and its receptor CSF1R are implicated in the mammary gland during normal development and neoplastic growth.

A detailed description of CSF1 and its function can be found, e.g., in Hume, D.A., et al. "Therapeutic applications of macrophage colony-stimulating factor-1 (CSF-1) and antagonists of CSF-1 receptor (CSF-1R) signaling. " Blood, The Journal of the American Society of Hematology 119.8 (2012) : 1810-1820; Huang, L., et al. "The possible mechanisms of tumor progression via CSF-1/CSF-1R pathway activation. " Rom. J. Morphol. Embryol 55.2 Suppl (2014) : 501-506; Lin, W., et al. "Function of CSF1 and IL34 in macrophage homeostasis, inflammation, and cancer. " Frontiers in immunology (2019) ; each of which is incorporated by reference herein in the entirety.

In human genomes, CSF1 gene (Gene ID: 1435) locus has 9 exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and exon 9. The CSF1 protein has a signal peptide, an extracellular region, a transmembrane region, and a cytoplasmic region. The nucleotide sequence for human CSF1 mRNA is NM_000757.6, and the amino acid sequence for human CSF1 is NP_000748.4 (SEQ ID NO: 2) . The location for each exon and each region in human CSF1 nucleotide sequence and amino acid sequence is listed below:

Table 1

The human CSF1 gene (Gene ID: 1435) is located in Chromosome 1 of the human genome, which is located from 109910506 to 109930992 of NC_000001.11 (GRCh38. p13 (GCF_000001405.39) ) . The 5'-UTR is from 109, 910, 849 to109, 911, 023, exon 1 is from 109, 910, 849 to 109, 911, 062, the first intron is from 109, 911, 063 to 109, 914, 258, exon 2 is from 109, 914, 259 to 109, 914, 381, the second intron is from 109, 914, 382 to 109, 915, 633, exon 3 is from 109, 915, 634 to 109, 915, 696, the third intron is from 109, 915, 697 to 109, 917, 292, exon 4 is from 109, 917, 293 to 109, 917, 463, the fourth intron is from 109, 917, 464 to 109, 921, 846, exon 5 is from 109, 921, 847 to 109, 921, 994, the fifth intron is from 109, 921, 995 to 109, 923, 165, exon 6 is from 109, 923, 166 to 109, 924, 190, the sixth intron is from 109, 924, 191 to 109, 924, 775, exon 7 is from 109, 924, 776 to 109, 924, 828, the seventh intron is from 109, 924, 829 to 109, 925, 146, exon 8 is from 109, 925, 147 to 109, 925, 202, the eighth intron is from 109, 925, 203 to 109, 928, 851, exon 9 is from 109, 928, 852 to 109, 930, 992, and the 3’-UTR is from 109, 925, 190 to 109, 925, 202 and 109, 928, 852 to 109, 930, 992, based on transcript NM_000757.6. All relevant information for human CSF1 locus can be found in the NCBI website with Gene ID: 1435, which is incorporated by reference herein in its entirety.

In mice, CSF1 gene locus has 9 exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and exon 9. The mouse CSF1 protein also has a signal peptide, an extracellular region, a transmembrane region, and a cytoplasmic region. The nucleotide sequence for mouse CSF1 mRNA is NM_007778.4, the amino acid sequence for mouse CSF1 is NP_031804.3 (SEQ ID NO: 1) . The location for each exon and each region in the mouse CSF1 nucleotide sequence and amino acid sequence is listed below:

Table 2

The mouse CSF1 gene (Gene ID: 12977) is located in Chromosome 3 of the mouse genome, which is located from 107648364 to 107668048, ofNC_000069.7 (GRCm39 (GCF_000001635.27) ) . The 5’-UTR is from 107, 760, 469 to 107, 760, 064, exon 1 is from 107, 760, 469 to 107, 760, 025, the first intron is from 107, 760, 024 to 107, 756, 740, exon 2 is from 107, 756, 739 to 107, 756, 617, the second intron is from 107, 756, 616 to 107, 755, 494, exon 3 is from 107, 755, 493 to 107, 755, 431, the third intron is from 107, 755, 430 to 107, 753, 903, exon 4 is from 107, 753, 902 to 107, 753, 732, the fourth intron is from 107, 753, 731 to 107, 750, 459, exon 5 is from 107, 750, 458 to 107, 750, 311, the fifth intron is from 107, 750, 310 to 107, 749, 170, exon 6 is from 107, 749, 169 to 107, 748, 154, the sixth intron is from 107, 748, 153 to 107, 747, 160, exon 7 is from 107, 747, 159 to 107, 747, 107, the seventh intron is from 107, 747, 106 to 107, 746, 785, exon 8 is from 107, 746, 784 to 107, 746, 726, the eighth intron is from 107, 746, 725 to 107, 743, 146, exon 9 is from 107, 743, 145 to 107, 741, 048, and the 3’-UTR is from 107, 746, 738 to 107, 746, 726 and 107, 743, 145 to 107, 741, 048, based on transcript NM_007778.4. All relevant information for mouse Csf1 locus can be found in the NCBI website with Gene ID: 12977, which is incorporated by reference herein in its entirety.

FIG. 18 shows the alignment between human CSF1 amino acid sequence (NP_000748.4; SEQ ID NO: 2) and mouse CSF1 amino acid sequence (NP_031804.3; SEQ ID NO: 1) . Thus, the corresponding amino acid residue or region between human and mouse CSF1 can also be found in FIG. 18.

CSF1 genes, proteins, and locus of the other species are also known in the art. For example, the gene ID for CSF1 in Rattus norvegicus is 78965, the gene ID for CSF1 in Macaca mulatta (Rhesus monkey) is 702532, the gene ID for CSF1 in Sus scrofa (pig) is 100513084, and the gene ID for CSF1 in Canis lupus familiaris (dog) is 611795. The relevant information for these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, e.g., in NCBI database, which are incorporated herein by reference in the entirety. FIG. 19 shows the alignment between human CSF1 amino acid sequence (NP_000748.4; SEQ ID NO: 2) and rat CSF1 amino acid sequence (NP_076471.3; SEQ ID NO: 52) . Thus, the corresponding amino acid residue or region between human and rodent CSF1 can be found in FIG. 19.

The present disclosure provides human or chimeric (e.g., humanized) CSF1 nucleotide sequence and/or amino acid sequences. In some embodiments, the entire sequence of mouse CSF1 signal peptide, extracellular domain, transmembrane domain, cytoplasmic domain, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9, is replaced by the corresponding human sequence. In some embodiments, a “region” or “portion” of mouse signal peptide, extracellular domain, transmembrane domain, cytoplasmic domain, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9 is replaced by the corresponding human sequence. The term “region” or “portion” can refer to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, or 1600 nucleotides, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 517, or 520 amino acid residues. In some embodiments, the “region” or “portion” can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to signal peptide, extracellular domain, transmembrane domain, cytoplasmic domain, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9. In some embodiments, a region, a portion, or the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9 (e.g., a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and a portion of exon 8) is replaced by a region, a portion, or the entire sequence of human exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9 (e.g., a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and a portion of exon 8) .

In some embodiments, a “region” or “portion” of mouse signal peptide, extracellular domain, transmembrane domain, cytoplasmic domain, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9 is deleted.

In some embodiments, the present disclosure is related to a genetically-modified, non-human animal whose genome comprises a chimeric (e.g., humanized) CSF1 nucleotide sequence. In some embodiments, the chimeric (e.g., humanized) CSF1 nucleotide sequence encodes a CSF1 protein comprising a signal peptide. In some embodiments, the signal peptide described herein is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 1-32 of SEQ ID NO: 1. In some embodiments, the signal peptide described herein is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 1-32 of SEQ ID NO: 2. In some embodiments, the genome of the animal comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, or 9.

In some embodiments, the genetically-modified non-human animal described herein comprises a sequence encoding a human or humanized CSF1 protein. In some embodiments, the humanized CSF1 protein comprises a human or humanized cytoplasmic region. In some embodiments, the humanized CSF1 protein comprises an endogenous cytoplasmic region. In some embodiments, the humanized CSF1 protein comprises a human or humanized transmembrane region. In some embodiments, the humanized CSF1 protein comprises an endogenous transmembrane region. In some embodiments, the humanized CSF1 protein comprises a human or humanized extracellular region. In some embodiments, the humanized CSF1 protein comprises an endogenous extracellular region. In some embodiments, the humanized CSF1 protein comprises at least 1, 2, 3, 4, or 5 amino acids from the extracellular region of an endogenous CSF1 protein. In some embodiments, the humanized CSF1 protein comprises a human or humanized signal peptide. In some embodiments, the humanized CSF1 protein comprises an endogenous signal peptide.

In some embodiments, the human or humanized CSF1 protein described herein is a membrane-bound CSF1 protein. In some embodiments, the human or humanized CSF1 protein described herein is a soluble CSF1 protein (e.g., cleaved from membrane-bound CSF1 protein) .

In some embodiments, the genetically-modified non-human animal described herein comprises a human or humanized CSF1 gene. In some embodiments, the humanized CSF1 gene comprises 9 exons. In some embodiments, the humanized CSF1 gene comprises humanized exon 1, humanized exon 2, humanized exon 3, humanized exon 4, humanized exon 5, humanized exon 6, humanized exon 7, humanized exon 8, and/or humanized exon 9. In some embodiments, the humanized CSF1 gene comprises humanized intron 1, humanized intron 2, humanized intron 3, humanized intron 4, humanized intron 5, humanized intron 6, humanized intron 7, and/or humanized intron 8. In some embodiments, the humanized CSF1 gene comprises human or humanized 5’ UTR. In some embodiments, the humanized CSF1 gene comprises human or humanized 3’ UTR. In some embodiments, the humanized CSF1 gene comprises endogenous 5’ UTR. In some embodiments, the humanized CSF1 gene comprises endogenous 3’ UTR.

Thus, in some embodiments, the present disclosure also provides a chimeric (e.g., humanized) CSF1 nucleotide sequence and/or amino acid sequences, wherein in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%of the sequence are identical to or derived from mouse CSF1 mRNA sequence (e.g., NM_007778.4) , mouse CSF1 amino acid sequence (e.g., SEQ ID NO: 1) , or a portion thereof (e.g., exon 1, a portion of exon 2, a portion of exon 8, and exon 9) ; and in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%of the sequence are identical to or derived from human CSF1 mRNA sequence (e.g., NM_000757.6) , human CSF1 amino acid sequence (e.g., SEQ ID NO: 2) , or a portion thereof (e.g., a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and a portion of exon 8) .

In some embodiments, the sequence encoding amino acids 38-552 of mouse CSF1 (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human CSF1 (e.g., amino acids 38-554 of human CSF1 (SEQ ID NO: 2) ) .

In some embodiments, the sequence encoding amino acids 1-552 of mouse CSF1 (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human CSF1 (e.g., amino acids 1-554 of human CSF1 (SEQ ID NO: 2) ) .

In some embodiments, the sequence encoding amino acids 1-492 of mouse CSF1 (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human CSF1 (e.g., amino acids 1-496 of human CSF1 (SEQ ID NO: 2) ) .

In some embodiments, the sequence encoding amino acids 33-492 of mouse CSF1 (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human CSF1 (e.g., amino acids 33-496 of human CSF1 (SEQ ID NO: 2) ) .

In some embodiments, the sequence encoding amino acids 38-492 of mouse CSF1 (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human CSF1 (e.g., amino acids 38-496 of human CSF1 (SEQ ID NO: 2) ) .

In some embodiments, the nucleic acids as described herein are operably linked to a promotor or regulatory element, e.g., an endogenous mouse CSF1 promotor, a human CSF1 promotor, an inducible promoter, a human enhancer, a mouse enhancer, and/or mouse or human regulatory elements.

In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are different from a portion of or the entire mouse CSF1 nucleotide sequence (e.g., a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and a portion of exon 8 of NM_007778.4) .

In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire mouse CSF1 nucleotide sequence (e.g., exon 1, a portion of exon 2, a portion of exon 8, and exon 9 of NM_007778.4) .

In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are different from a portion of or the entire human CSF1 nucleotide sequence (e.g., exon 1, a portion of exon 2, a portion of exon 8, and exon 9 of NM_000757.6) .

In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire human CSF1 nucleotide sequence (e.g., a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and a portion of exon 8 of NM_000757.6) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire mouse CSF1 amino acid sequence (e.g., amino acids 38-552 of SEQ ID NO: 1) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire mouse CSF1 amino acid sequence (e.g., amino acids 1-37 of SEQ ID NO: 1) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire human CSF1 amino acid sequence (e.g., amino acids 1-37 or SEQ ID NO: 2) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire human CSF1 amino acid sequence (e.g., amino acids 38-554 of SEQ ID NO: 2) .

In some embodiments, the percentage identity of any of the amino acid sequence described herein with the sequence shown in SEQ ID NO: 1, 2, or 10 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

In one aspect, the disclosure relates to proteins comprising an amino acid sequence, wherein the amino acid sequence is one of the following:

a) an amino acid sequence shown in SEQ ID NO: 1, 2, or 10;

b) an amino acid sequence having a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 10;

c) an amino acid sequence encoded by a nucleic acid sequence, wherein the nucleic acid sequence is able to hybridize to a nucleotide sequence encoding the amino acid shown in SEQ ID NO: 1, 2, or 10 under a low stringency condition or a strict stringency condition;

d) an amino acid sequence having a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 10;

e) an amino acid sequence that is different from the amino acid sequence shown in SEQ ID NO: 1, 2, or 10 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or

f) an amino acid sequence that comprises a substitution, a deletion and/or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1, 2, or 10.

In some embodiments, provided herein are cells comprising the proteins disclosed herein. In some embodiments, provided herein are animals having the proteins disclosed herein.

In one aspect, the disclosure relates to a humanized CSF1 protein, wherein the amino acid sequence of the humanized CSF1 protein comprises one of the following groups:

a) all or part of the amino acids 38-554 of SEQ ID NO: 2;

b) an amino acid sequence having a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to amino acids 38-554 of SEQ ID NO: 2;

c) an amino acid sequence that is different from the amino acid sequence shown in amino acids 38-554 of SEQ ID NO: 2 byno more than 10, 9, 8, 7, 6, 5, 4, 3, 2 orno more than 1 amino acid; and

d) an amino acid sequence that comprises a substitution, a deletion and/or insertion of one or more amino acids to amino acids 38-554 of SEQ ID NO: 2.

The present disclosure also relates to a nucleic acid (e.g., DNA or RNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting off

a) a nucleic acid sequence as shown in SEQ ID NO: 9, or a nucleic acid sequence encoding a homologous CSF1 amino acid sequence of a humanized mouse CSF1;

b) a nucleic acid sequence that is able to hybridize to the nucleotide sequence as shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, or 9 under a low stringency condition or a strict stringency condition;

c) a nucleic acid sequence that has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the nucleotide sequence as shown in SEQ ID NO: 3, 4, 5, 6, 7, 8, or 9;

d) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 10;

e) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%with, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 10;

f) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence is different from the amino acid sequence shown in SEQ ID NO: 1, 2, or 10 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and/or

g) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence comprises a substitution, a deletion and/or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1, 2, or 10.

The present disclosure further relates to a DNA sequence of a humanized mouse. The DNA sequence is obtained by reverse transcription of the mRNA obtained by transcription thereof is consistent with or complementary to the DNA sequence homologous to the sequence shown in SEQ ID NO: 5 or 9.

The disclosure also provides an amino acid sequence that has a homology of at least 90%with, or at least 90%identical to the sequence shown in SEQ ID NO: 1, 2, or 10, and has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 1, 2, or 10 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

The disclosure also provides a nucleotide sequence that has a homology of at least 90%, or at least 90%identical to the sequence shown in SEQ ID NO: 5 or 9, and encodes a polypeptide that has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 5 or 9 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

Cells, tissues, and animals (e.g., mouse) are also provided that comprise the nucleotide sequences as described herein, as well as cells, tissues, and animals (e.g., mouse) that express human or chimeric (e.g., humanized) CSF1 from an endogenous non-human CSF1 locus.

In some embodiments, provided herein are cells comprising the nucleic acids disclosed herein. In some embodiments, provided herein are animals having the nucleic acids disclosed herein.

In one aspect, the disclosure also provides methods of determining effectiveness of an CSF1 antagonist (e.g., an anti-CSF1 antibody or CSF1 inhibitor) for reducing inflammation. The methods involve administering the CSF1 antagonist to the animal described herein, wherein the animal has an inflammation; and determining inhibitory effects of the CSF1 antagonist to the reduction of inflammation.

In one aspect, the disclosure also provides methods of determining effectiveness of an CSF1 antagonist (e.g., an anti-CSF1 antibody or CSF1 inhibitor) for treating autoimmune disorder or allergy. The methods involve administering the CSF1 antagonist to the animal described herein, wherein the animal has an autoimmune disorder or allergy; and determining inhibitory effects of the CSF1 antagonist to the treatment of autoimmune disorder or allergy.

In one aspect, the disclosure also provides methods of determining effectiveness of an CSF1 antagonist (e.g., an anti-CSF1 antibody or CSF1 inhibitor) for treating cancer. The methods involve administering the CSF1 antagonist to the animal described herein, wherein the animal has a tumor; and determining the inhibitory effects of the CSF1 antagonist to the tumor. In some embodiments, the tumor comprises one or more cancer cells that are injected into the animal. In some embodiments, the determining the inhibitory effects of the CSF1 antagonist (e.g., an anti-CSF1 antibody or CSF1 inhibitor) to the tumor involves measuring the tumor volume in the animal.

In another aspect, the disclosure also provides a genetically-modified, non-human animal whose genome comprise a disruption in the animal's endogenous CSF1 gene, wherein the disruption of the endogenous CSF1 gene comprises deletion of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9, or part thereof of the endogenous CSF1 gene.

In some embodiments, the disruption of the endogenous CSF1 gene further comprises deletion of one or more introns or part of introns selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, and/or intron 8, or part thereof of the endogenous CSF1 gene.

In some embodiments, wherein the deletion can comprise deleting at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 10, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500 or more nucleotides of endogenous CSF1 gene.

In some embodiments, the disruption of the endogenous CSF1 gene comprises the deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides ofexon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9.

CSF1R

Colony stimulating factor 1 receptor (CSF1R) , also known as macrophage colony-stimulating factor receptor (M-CSFR) , and CD115 (Cluster of Differentiation 115) , is a cell-surface protein encoded, in humans, by the CSF1R gene (known also as c-FMS) . CSF1R is a single pass type I membrane protein and acts as the receptor for CSF1, a cytokine which controls the production, differentiation, and function ofmacrophages. CSF1R belongs to the platelet-derived growth factor (PDGF) family. Similar to other family members, it possesses a highly glycosylated extracellular region comprised of five immunoglobulin domains (D1-D5, 498 amino acids) , a transmembrane domain (21 amino acids) , and an intracellular domain comprised of a juxtamembrane domain (JMD) (36 amino acids) and an intracellular tyrosine kinase domain (398 amino acids) that is interrupted by a kinase insert domain (73 amino acids) . This receptor mediates most, if not all, of the biological effects of this cytokine. Ligand binding activates CSF1R through a process of oligomerization and trans-phosphorylation.

CSF1R signaling regulates the differentiation of myeloid cells toward an M2 phenotype of macrophage, which within the tumor microenvironment promotes survival, proliferation, and metastatic potential of tumor cells, along with suppressing antitumor immunity. In animal models, CSF1R inhibition strongly reduces F4/80+ tumor-associated macrophages accompanied by an increase of the CD8+/CD4+ T-cell ratio. Increased levels of CSF1R1 are found in microglia in Alzheimer′s disease and after brain injuries. The increased receptor expression causes microglia to become more active. Both CSF1R, and its ligand CSF1 play an important role in the development of the mammary gland and may be involved in the process of mammary gland carcinogenesis. Mutations in CSF1R are associated with chronic myelomonocytic leukemia and type M4 acute myeloblastic leukemia. Mutations in the tyrosine kinase domain have been associated with hereditary diffuse leukoencephalopathy with spheroids.

A detailed description of CSF1R and its function can be found, e.g., in Cannarile, M.A., et al. "Colony-stimulating factor 1 receptor (CSF1R) inhibitors in cancer therapy. " Journal for Immunotherapy of Cancer 5.1 (2017) : 1-13; Stanley, E.R., et al. "CSF-1 receptor signaling in myeloid cells. " Cold Spring Harbor perspectives in biology 6.6 (2014) : a021857; Lin, C. "Clinical Development of Colony-Stimulating Factor 1 Receptor (CSF1R) Inhibitors. " Journal of Immunotherapy and Precision Oncology 4.2 (2021) : 105-114; each of which is incorporated by reference herein in the entirety.

In human genomes, CSF1R gene (Gene ID: 1436) locus has 22 exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and exon 22. The CSF1R protein has a signal peptide, an extracellular region, a transmembrane region, and a cytoplasmic region. The nucleotide sequence for human CSF1R mRNA is NM_005211.3, and the amino acid sequence for human CSF1R is NP_005202.2 (SEQ ID NO: 35) . The location for each exon and each region in human CSF1R nucleotide sequence and amino acid sequence is listed below:

Table 3

The human CSF1R gene (Gene ID: 1436) is located in Chromosome 5 of the human genome, which is located from 150053295 to 150113365 of NC_000005.10 (GRCh38. p14 (GCF_000001405.40) ) . The 5'-UTR is from 150113372 to 150113261 and 150086428 to 150086607, exon 1 is from 150113372 to 150113261, intron 1 is from 150113260 to 150086608, exon 2 is from 150086607 to 150086379, intron 2 is from 150086378 to 150081025, exon 3 is from 150081024 to 150080767, intron 3 is from 150080766 to 150080337, exon 4 is from 150080336 to 150080052, intron 4 is from 150080051 to 150078249, exon 5 is from 150078248 to 150078112, intron 5 is from 150078111 to 150077436, exon 6 is from 150077435 to 150077276, intron 6 is from 150077275 to 150073494, exon 7 is from 150073493 to 150073301, intron 7 is from 150073300 to 150070572, exon 8 is from 150070571 to 150070456, intron 8 is from 150070455 to 150070303, exon 9 is from 150070302 to 150070182, intron 9 is from 150070181 to 150070064, exon 10 is from 150070063 to 150069873, intron 10 is from 150069872 to 150068331, exon 11 is from 150068330 to 150068215, intron 11 is from 150068214 to 150061850, exon 12 is from 150061849 to 150061723, intron 12 is from 150061722 to 150061596, exon 13 is from 150061595 to 150061491, intron 13 is from 150061490 to 150060973, exon 14 is from 150060972 to 150060862, intron 14 is from 150060861 to 150059863, exon 15 is from 150059862 to 150059700, intron 15 is from 150059699 to 150057593, exon 16 is from 150057592 to 150057504, intron 16 is from 150057503 to 150057385, exon 17 is from 150057384 to 150057287, intron 17 is from 150057286 to 150056342, exon 18 is from 150056341 to 150056219, intron 18 is from 150056218 to 150056138, exon 19 is from 150056137 to 150056026, intron 19 is from 150056025 to 150055337, exon 20 is from 150055336 to 150055237, intron 20 is from 150055236 to 150054431, exon 21 is from 150054430 to 150054322, intron 21 is from 150054321 to 150054225, exon 22 is from 150054224 to 150053291, and the 3'-UTR is from 150053291 to 150054068, based on transcript NM_005211.3. All relevant information for human CSF1R locus can be found in the NCBI website with Gene ID: 1436, which is incorporated by reference herein in its entirety.

In mice, CSF1R gene locus has 22 exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and exon 22. The mouse CSF1R protein also has a signal peptide, an extracellular region, a transmembrane region, and a cytoplasmic region. The nucleotide sequence for mouse CSF1R mRNA is NM_001037859.2, the amino acid sequence for mouse CSF1R is NP_001032948.2 (SEQ ID NO: 34) . The location for each exon and each region in the mouse CSF1R nucleotide sequence and amino acid sequence is listed below:

Table 4

The mouse CSF1R gene (Gene ID: 12978) is located in Chromosome 18 of the mouse genome, which is located from 61, 105, 572 to 61, 131, 139 ofNC_000084.6 (GRCm38. p6 (GCF_000001635.26) ) . The 5'-UTR is from 61, 105, 572 to 61, 105, 949, exon 1 is from 61, 105, 572 to 61, 105, 684, the first intron is from 61, 105, 685 to 61, 105, 780, exon 2 is from 61, 105, 781 to 61, 105, 998, the second intron is from 61, 105, 999 to 61, 109, 615, exon 3 is from 61, 109, 616 to 61, 109, 873, the third intron is from 61, 109, 874 to 61, 110, 220, exon 4 is from 61, 110, 221 to 61, 110, 505, the forth intron is from 61, 110, 506 to 61, 111, 957, exon 5 is from 61, 111, 958 to 61, 112, 094, the fifth intron is from 61, 112, 095 to 61, 112, 701, exon 6 is from 61, 112, 702 to 61, 112, 861, the sixth intron is from 61, 112, 862 to 61, 114, 750, exon 7 is from 61, 114, 751 to 61, 114, 937, the seventh intron is from 61, 114, 938 to 61, 117, 040, exon 8 is from 61, 117, 041 to 61, 117, 156, the eighth intron is from 61, 117, 157 to 61, 117, 291, exon 9 is from 61, 117, 292 to 61, 117, 412, the ninth intron is from 61, 117, 413 to 61, 117, 531, exon 10 is from 61, 117, 532 to 61, 117, 722, the tenth intron is from 61, 117, 723 to 61, 118, 951, exon 11 is from 61, 118, 952 to 61, 119, 067, the 11th intron is from 61, 119, 068 to 61, 124, 198, exon 12 is from 61, 124, 199 to 61, 124, 325, the 12th intron is from 61, 124, 326 to 61, 124, 476, exon 13 is from 61, 124, 477 to 61, 124, 581, the 13th intron is from 61, 124, 582 to 61, 124, 812, exon 14 is from 61, 124, 813 to 61, 124, 923, the 14th intron is from 61, 124, 924 to 61, 125, 673, exon 15 is from 61, 125, 674 to 61, 125, 836, the 15th intron is from 61, 125, 837 to 61, 127, 864, exon 16 is from 61, 127, 865 to 61, 127, 953, the 16th intron is from 61, 127, 954 to 61, 128, 068, exon 17 is from 61, 128, 069 to 61, 128, 166, the 17th intron is from 61, 128, 167 to 61, 128, 986, exon 18 is from 61, 128, 987 to 61, 129, 109, the 18th intron is from 61, 129, 110 to 61, 129, 269, exon 19 is from 61, 129, 270 to 61, 129, 381, the 19th intron is from 61, 129, 382 to 61, 129, 702, exon 20 is from 61, 129, 703 to 61, 129, 802, the 20th intron is from 61, 129, 803 to 61, 130, 103, exon 21 is from 61, 130, 104 to 61, 130, 212, the 21th intron is from 61, 130, 213 to 61, 130, 303, exon 22 is from 61, 130, 304 to 61, 131, 134, and the 3'-UTR is from 61, 130, 481 to 61, 131, 134, based on transcript NM_001037859.2. All relevant information for mouse Csf1r locus can be found in the NCBI website with Gene ID: 12978, which is incorporated by reference herein in its entirety.

FIG. 20 shows the alignment between human CSF1R amino acid sequence (NP_005202.2; SEQ ID NO: 35) and mouse CSF1R amino acid sequence (NP_001032948.2; SEQ ID NO: 34) . Thus, the corresponding amino acid residue or region between human and mouse CSF1R can also be found in FIG. 20.

CSF1R genes, proteins, and locus of the other species are also known in the art. For example, the gene ID for CSF1R in Rattus norvegicus is 307403, the gene ID for CSF1R in Macaca mulatta (Rhesus monkey) is 711512, the gene ID for CSF1R in Canis lupus familiaris (dog) is 489188, and the gene ID for CSF1R in Sus scrofa (pig) is 100517086. The relevant information for these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, e.g., in NCBI database. FIG. 21 shows the alignment between human CSF1R amino acid sequence (NP_005202.2; SEQ ID NO: 35) and rat CSF1R amino acid sequence (NP_001025072.1; SEQ ID NO: 53) . Thus, the corresponding amino acid residue or region between human and rodent CSF1R can be found in FIG. 21.

The present disclosure provides human or chimeric (e.g., humanized) CSF1R nucleotide sequence and/or amino acid sequences. In some embodiments, the entire sequence of mouse CSF1R signal peptide, extracellular region, transmembrane region, cytoplasmic region, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22, is replaced by the corresponding human sequence. In some embodiments, a “region” or “portion” of mouse CSF1R signal peptide, extracellular region, transmembrane region, cytoplasmic region, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22, is replaced by the corresponding human sequence. The term “region” or “portion” can refer to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, or 1500 nucleotides, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 498, or 500 amino acid residues. In some embodiments, the “region” or “portion” can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%identical to signal peptide, extracellular region, transmembrane region, cytoplasmic region exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22. In some embodiments, a region, a portion, or the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22 (e.g., apart of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and a part of exon 11) is replaced by a region, a portion, or the entire sequence of human exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22 (e.g., apart of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and a part of exon 11) .

In some embodiments, a “region” or “portion” of mouse signal peptide, extracellular region, transmembrane region, cytoplasmic region, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22 is deleted.

In some embodiments, the present disclosure is related to a genetically-modified, non-human animal whose genome comprises a chimeric (e.g., humanized ) CSF1R nucleotide sequence. In some embodiments, the chimeric (e.g., humanized ) CSF1R nucleotide sequence encodes a CSF1R protein comprising a signal peptide. In some embodiments, the signal peptide described herein is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 1-19 of SEQ ID NO: 34. In some embodiments, the signal peptide described herein is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 1-19 of SEQ ID NO: 35. In some embodiments, the chimeric (e.g., humanized ) CSF1R nucleotide sequence encodes a CSF1R protein comprising a an extracellular region. In some embodiments, the extracellular region described herein is at least 80%, 85%, 90%, 95%, or 100%identical to amino acids 20-517 of SEQ ID NO: 35. In some embodiments, the genome of the animal comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100%identical to SEQ ID NO: 36, 37, 38, 39, 40, 41, or 42.

In some embodiments, the genetically-modified non-human animal described herein comprises a sequence encoding a human or humanized CSF1R protein. In some embodiments, the humanized CSF1R protein comprises a human or humanized cytoplasmic region. In some embodiments, the humanized CSF1R protein comprises an endogenous cytoplasmic region. In some embodiments, the humanized CSF1R protein comprises a human or humanized transmembrane region. In some embodiments, the humanized CSF1R protein comprises an endogenous transmembrane region. In some embodiments, the humanized CSF1R protein comprises a human or humanized extracellular region. In some embodiments, the humanized CSF1R protein comprises an endogenous extracellular region. In some embodiments, the humanized CSF1R protein comprises a human or humanized signal peptide. In some embodiments, the humanized CSF1R protein comprises an endogenous signal peptide.

In some embodiments, the genetically-modified non-human animal described herein comprises a human or humanized CSF1R gene. In some embodiments, the humanized CSF1R gene comprises 22 exons. In some embodiments, the humanized CSF1R gene comprises humanized exon 1, humanized exon 2, humanized exon 3, humanized exon 4, humanized exon 5, humanized exon 6, humanized exon 7, humanized exon 8, humanized exon 9, humanized exon 10, humanized exon 11, humanized exon 12, humanized exon 13, humanized exon 14, humanized exon 15, humanized exon 16, humanized exon 17, humanized exon 18, humanized exon 19, humanized exon 20, humanized exon 21, and/or humanized exon 22. In some embodiments, the humanized CSF1R gene comprises humanized intron 1, humanized intron 2, humanized intron 3, humanized intron 4, humanized intron 5, humanized intron 6, humanized intron 7, humanized intron 8, humanized intron 9, humanized intron 10, humanized intron 11, humanized intron 12, humanized intron 13, humanized intron 14, humanized intron 15, humanized intron 16, humanized intron 17, humanized intron 18, humanized intron 19, humanized intron 20, and/or humanized intron 21. In some embodiments, the humanized CSF1R gene comprises human or humanized 5' UTR. In some embodiments, the humanized CSF1R gene comprises human or humanized 3' UTR. In some embodiments, the humanized CSF1R gene comprises endogenous 5’ UTR. In some embodiments, the humanized CSF1R gene comprises endogenous 3’ UTR.

Thus, in some embodiments, the present disclosure also provides a chimeric (e.g., humanized) CSF1R nucleotide sequence and/or amino acid sequences, wherein in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%of the sequence are identical to or derived from mouse CSF1R mRNA sequence (e.g., NM_001037859.2) , mouse CSF1R amino acid sequence (e.g., SEQ ID NO: 34) , or a portion thereof (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22) . In some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%of the sequence are identical to or derived from human CSF1R mRNA sequence (e.g., NM_005211.3) , human CSF1R amino acid sequence (e.g., SEQ ID NO: 35) , or a portion thereof (e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22) .

In some embodiments, the sequence encoding amino acids 20-515 of mouse CSF1R (SEQ ID NO: 34) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human CSF1R (e.g., amino acids 20-517 of human CSF1R (SEQ ID NO: 35) .

In some embodiments, the sequence encoding amino acids 1-515 of mouse CSF1R (SEQ ID NO: 34) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human CSF1R (e.g., amino acids 1-517 of human CSF1R (SEQ ID NO: 35) .

In some embodiments, the sequence encoding amino acids 1-977 of mouse CSF1R (SEQ ID NO: 34) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human CSF1R (e.g., amino acids 1-972 of human CSF1R (SEQ ID NO: 35) .

In some embodiments, the sequence encoding amino acids 20-977 of mouse CSF1R (SEQ ID NO: 34) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human CSF1R (e.g., amino acids 20-972 of human CSF1R (SEQ ID NO: 35) .

In some embodiments, the nucleic acids as described herein are operably linked to a promotor or regulatory element, e.g., an endogenous mouse CSF1R promotor, an inducible promoter, an enhancer, and/or mouse or human regulatory elements.

In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are different from a portion of or the entire mouse CSF1R nucleotide sequence (e.g., a portion of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and a portion of exon 11 of NM_001037859.2) .

In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire mouse CSF1R nucleotide sequence (e.g., exon 1, exon 2, a portion of exon 3, a portion of exon 11, exon 12, and exons 13-22 of NM_001037859.2) .

In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are different from a portion of or the entire human CSF1R nucleotide sequence (e.g., exon 1, exon 2, a portion of exon 3, a portion of exon 11, exon 12, and exons 13-22 of NM_005211.3) .

In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as a portion of or the entire human CSF1R nucleotide sequence (e.g., a portion of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and a portion of exon 11 of NM_005211.3) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire mouse CSF1R amino acid sequence (e.g., amino acids 20-515 of SEQ ID NO: 34) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire mouse CSF1R amino acid sequence (e.g., amino acids 1-19 and 516-977 of SEQ ID NO: 34) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from a portion of or the entire human CSF1R amino acid sequence (e.g., amino acids 1-19 and 518-972 of S EQ ID NO: 35) .

In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as a portion of or the entire human CSF1R amino acid sequence (e.g., amino acids 20-517 of SEQ ID NO: 35) .

In some embodiments, the percentage identity of any of the amino acid sequence described herein with the sequence shown in SEQ ID NO: 34, 35, or 43 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

Cells, tissues, and animals (e.g., mouse) are also provided that comprise the nucleotide sequences as described herein, as well as cells, tissues, and animals (e.g., mouse) that express human or chimeric (e.g., humanized) CSF1R from an endogenous non-human CSF1R locus.

In one aspect, the present disclosure also provides a humanized CSF1R mouse amino acid sequence, wherein the amino acid sequence is selected from the group consisting of:

a) an amino acid sequence shown in SEQ ID NO: 34, 35 or 43;

b) an amino acid sequence having a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 34, 35 or 43;

c) an amino acid sequence encoded by a nucleic acid sequence, wherein the nucleic acid sequence is able to hybridize to a nucleotide sequence encoding the amino acid shown in SEQ ID NO: 34, 35 or 43 under a low stringency condition or a strict stringency condition;

d) an amino acid sequence having a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 34, 35 or 43;

e) an amino acid sequence that is different from the amino acid sequence shown in SEQ ID NO: 34, 35 or 43 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or

f) an amino acid sequence that comprises a substitution, a deletion and/or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 34, 35 or 43.

In one aspect, the disclosure relates to a humanized CSF1R protein, wherein the amino acid sequence of the humanized CSF1R protein comprises one of the following groups:

a) all or part of the amino acids 20-517 of SEQ ID NO: 35;

b) an amino acid sequence having a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to amino acids 20-517 of SEQ ID NO: 35;

c) an amino acid sequence that is different from the amino acid sequence shown in amino acids 20-517 of SEQ ID NO: 35 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and

d) an amino acid sequence that comprises a substitution, a deletion and/or insertion of one or more amino acids to amino acids 20-517 of SEQ ID NO: 35.

The present disclosure also relates to a nucleic acid (e.g., DNA or RNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting of:

a) a nucleic acid sequence as shown in SEQ ID NO: 42, or a nucleic acid sequence encoding a homologous CSF1R amino acid sequence of a humanized mouse;

b) a nucleic acid sequence that is able to hybridize to the nucleotide sequence as shown in SEQ ID NO: 36, 37, 38, 39, 40, 41, or 42 under a low stringency condition or a strict stringency condition;

c) a nucleic acid sequence that has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the nucleotide sequence as shown in SEQ ID NO: 36, 37, 38, 39, 40, 41, or 42;

d) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%with or at least 90%identical to the amino acid sequence shown in SEQ ID NO: 34, 35, or 43;

e) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%with, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to the amino acid sequence shown in SEQ ID NO: 34, 35, or 43;

f) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence is different from the amino acid sequence shown in SEQ ID NO: 34, 35, or 43 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and/or

g) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence comprises a substitution, a deletion and/or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 34, 35, or 43.

The present disclosure further relates to a DNA sequence of a humanized mouse. The DNA sequence is obtained by a reverse transcription of the mRNA obtained by transcription thereof is consistent with or complementary to the DNA sequence homologous to the sequence shown in SEQ ID NO: 38 or 42.

The disclosure also provides an amino acid sequence that has a homology of at least 90%with, or at least 90%identical to the sequence shown in SEQ ID NO: 34, 35, or 43, and has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 34, 35, or 43 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

The disclosure also provides a nucleotide sequence that has a homology of at least 90%, or at least 90%identical to the sequence shown in SEQ ID NO: 38 or 42, and encodes a polypeptide that has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 38 or 42 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.

In one aspect, the disclosure also provides methods of determining effectiveness of an CSF1R antagonist (e.g., an anti-CSF1R antibody or CSF1R inhibitor) for reducing inflammation. The methods involve administering the CSF1R antagonist to the animal described herein, wherein the animal has an inflammation; and determining inhibitory effects of the CSF1R antagonist to the reduction of inflammation.

In one aspect, the disclosure also provides methods of determining effectiveness of an CSF1R antagonist (e.g., an anti-CSF1R antibody or CSF1R inhibitor) for treating autoimmune disorder or allergy. The methods involve administering the CSF1R antagonist to the animal described herein, wherein the animal has an autoimmune disorder or allergy; and determining inhibitory effects of the CSF1R antagonist to the treatment of autoimmune disorder or allergy.

In one aspect, the disclosure also provides methods of determining effectiveness of an CSF1R antagonist (e.g., an anti-CSF1R antibody or CSF1R inhibitor) for treating cancer. The methods involve administering the CSF1R antagonist to the animal described herein, wherein the animal has a tumor; and determining the inhibitory effects of the CSF1R antagonist to the tumor. In some embodiments, the tumor comprises one or more cancer cells that are injected into the animal. In some embodiments, the determining the inhibitory effects of the CSF1R antagonist (e.g., an anti-CSF1R antibody or CSF1R inhibitor) to the tumor involves measuring the tumor volume in the animal.

In another aspect, the disclosure also provides a genetically-modified, non-human animal whose genome comprise a disruption in the animal’s endogenous CSF1R gene, wherein the disruption of the endogenous CSF1R gene comprises deletion of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22, or part thereof of the endogenous CSF1R gene.

In some embodiments, the disruption of the endogenous CSF1R gene further comprises deletion of one or more introns or part of introns selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16, intron 17, intron 18, intron 19, intron 20, and/or intron 21, or part thereof of the endogenous CSF1R gene.

In some embodiments, wherein the deletion can comprise deleting at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 10, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500 or more nucleotides of endogenous CSF1R gene.

In some embodiments, the disruption of the endogenous CSF1R gene comprises the deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides ofexon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22.

The disclosure also provides a nucleic acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any nucleotide sequence as described herein, and an amino acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any amino acid sequence as described herein. In some embodiments, the disclosure relates to nucleotide sequences encoding any peptides that are described herein, or any amino acid sequences that are encoded by any nucleotide sequences as described herein. In some embodiments, the nucleic acid sequence is less than 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 150, 200, 250, 300, 350, 400, 500, or 600 nucleotides. In some embodiments, the amino acid sequence is less than 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 amino acid residues.

In some embodiments, the amino acid sequence (i) comprises an amino acid sequence; or (ii) consists of an amino acid sequence, wherein the amino acid sequence is any one of the sequences as described herein.

In some embodiments, the nucleic acid sequence (i) comprises a nucleic acid sequence; or (ii) consists of a nucleic acid sequence, wherein the nucleic acid sequence is any one of the sequences as described herein.

To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes) . The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. For example, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.

The percentage of residues conserved with similar physicochemical properties (percent homology) , e.g. leucine and isoleucine, can also be used to measure sequence similarity. Families of amino acid residues having similar physicochemical properties have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine) , acidic side chains (e.g., aspartic acid, glutamic acid) , uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine) , nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) , beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine) . The homology percentage, in many cases, is higher than the identity percentage.

Cells, tissues, and animals (e.g., mouse) are also provided that comprise the nucleotide sequences as described herein, as well as cells, tissues, and animals (e.g., mouse) that express human or chimeric (e.g., humanized) amino acid sequence from an endogenous non-human CSF1R or CSF1 locus.

Genetically modified animals

As used herein, the term “genetically-modified non-human animal” refers to a non-human animal having genetic modification (e.g., exogenous DNA) in at least one chromosome of the animal’s genome. In some embodiments, at least one or more cells, e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%of cells of the genetically-modified non-human animal have the genetic modification in its genome. The cell having exogenous DNA can be various kinds of cells, e.g., an endogenous cell, a somatic cell, an immune cell, a T cell, a B cell, a germ cell, a blastocyst, or an endogenous tumor cell. In some embodiments, genetically-modified non-human animals are provided that comprise a modified endogenous CSF1R locus and/or CSF1 locus that comprises an exogenous sequence (e.g., a human sequence) , e.g., a replacement of one or more non-human sequences with one or more human sequences. The animals are generally able to pass the modification to progeny, i.e., through germline transmission.

As used herein, the term “chimeric gene” or “chimeric nucleic acid” refers to a gene or a nucleic acid, wherein two or more portions of the gene or the nucleic acid are from different species, or at least one of the sequences of the gene or the nucleic acid does not correspond to the wild-type nucleic acid in the animal. In some embodiments, the chimeric gene or chimeric nucleic acid has at least one portion of the sequence that is derived from two or more different sources, e.g., sequences encoding different proteins or sequences encoding the same (or homologous) protein of two or more different species. In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized gene or humanized nucleic acid.

As used herein, the term “chimeric protein” or “chimeric polypeptide” refers to a protein or a polypeptide, wherein two or more portions of the protein or the polypeptide are from different species, or at least one portion of the sequences of the protein or the polypeptide does not correspond to wild-type amino acid sequence in the animal. In some embodiments, the chimeric protein or the chimeric polypeptide has at least one portion of the sequence that is derived from two or more different sources, e.g., same (or homologous) proteins of different species. In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized protein or a humanized polypeptide.

As used herein, the term “humanized protein” or “humanized polypeptide” refers to a protein or a polypeptide, wherein at least a portion of the protein or the polypeptide is from the human protein or human polypeptide. In some embodiments, the humanized protein or polypeptide is a human protein or polypeptide.

As used herein, the term “humanized nucleic acid” refers to a nucleic acid, wherein at least a portion of the nucleic acid is from the human. In some embodiments, the entire nucleic acid of the humanized nucleic acid is from human. In some embodiments, the humanized nucleic acid is a humanized exon. A humanized exon can be e.g., a human exon or a chimeric exon.

In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized CSF1R gene or a humanized CSF1R nucleic acid. In some embodiments, at least one or more portions of the gene or the nucleic acid is from the human CSF1R gene, and at least one or more portions of the gene or the nucleic acid is from a non-human CSF1 gene. In some embodiments, the gene or the nucleic acid comprises a sequence that encodes an CSF1R protein. In some embodiments, the encoded CSF1R protein is functional or has at least one activity of the human CSF1R protein or the non-human CSF1R protein, e.g., binding to human or non-human CSF1, and/or regulating the production, differentiation, and function of macrophages (e.g., tumor-associated microphages) .

In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized CSF1R protein or a humanized CSF1R polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a human CSF1R protein, and at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a non-human CSF1R protein. The humanized CSF1R protein or the humanized CSF1R polypeptide is functional or has at least one activity of the human CSF1R protein or the non-human CSF1R protein.

In some embodiments, the humanized CSF1R protein or the humanized CSF1R polypeptide can bind to mouse CSF1, and/or regulate the production, differentiation, and function of macrophages. In some embodiments, the humanized CSF1R protein or the humanized CSF1R polypeptide cannot bind to mouse CSF1, thus cannot regulate the production, differentiation, and function of macrophages.

In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized CSF1 gene or a humanized CSF1 nucleic acid. In some embodiments, at least one or more portions of the gene or the nucleic acid is from the human CSF1 gene, and at least one or more portions of the gene or the nucleic acid is from a non-human CSF1 gene. In some embodiments, the gene or the nucleic acid comprises a sequence that encodes a CSF1 protein. The encoded CSF1 protein is functional or has at least one activity of the human CSF1 protein or the non-human CSF1 protein, e.g., binding to human or non-human CSF1R, and/or regulating the production, differentiation, and function ofmacrophages (e.g., tumor-associated microphages) .

In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized CSF1 protein or a humanized CSF1 polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a human CSF1 protein, and at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a non-human CSF1 protein. The humanized CSF1 protein or the humanized CSF1 polypeptide is functional or has at least one activity of the human CSF1 protein or the non-human CSF1 protein.

In some embodiments, the humanized CSF1 protein or the humanized CSF1 polypeptide can bind to mouse CSF1R, and/or regulate the production, differentiation, and function of macrophages. In some embodiments, the humanized CSF1 protein or the humanized CSF1 polypeptide cannot bind to mouse CSF1R complex, thus cannot regulate the production, differentiation, and function of macrophages.

The genetically modified non-human animal can be various animals, e.g., a mouse, rat, rabbit, pig, bovine (e.g., cow, bull, buffalo) , deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey) . For the non-human animals where suitable genetically modifiable embryonic stem (ES) cells are not readily available, other methods are employed to make a non-human animal comprising the genetic modification. Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing nuclear transfer to transfer the modified genome to a suitable cell, e.g., an oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo. These methods are known in the art, and are described, e.g., in A. Nagy, et al., “Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition) , ” Cold Spring Harbor Laboratory Press, 2003, which is incorporated by reference herein in its entirety.

In one aspect, the animal is a mammal, e.g., of the superfamily Dipodoidea or Muroidea. In some embodiments, the genetically modified animal is a rodent. The rodent can be selected from a mouse, a rat, and a hamster. In some embodiments, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters) , Cricetidae (e.g., hamster, New World rats and mice, voles) , Muridae (true mice and rats, gerbils, spiny mice, crested rats) , Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice) , Platacanthomyidae (e.g., spiny dormice) , and Spalacidae (e.g., mole rates, bamboo rats, and zokors) . In some embodiments, the genetically modified rodent is selected from a true mouse or rat (family Muridae) , a gerbil, a spiny mouse, and a crested rat. In some embodiments, the non-human animal is a mouse.

In some embodiments, the animal is a mouse of a C57BL strain selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, and C57BL/Ola. In some embodiments, the mouse is a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/SvIm) , 129S2, 129S4, 129S5, 129S9/SvEvH, 129S6 (129/SvEvTac) , 129S7, 129S8, 129T1, 129T2. These mice are described, e.g., in Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10: 836 (1999) ; Auerbach et al., Establishment and Chimera Analysis of 129/SvEv-and C57BL/6-Derived Mouse Embryonic Stem Cell Lines (2000) , both of which are incorporated herein by reference in the entirety. In some embodiments, the genetically modified mouse is a mix of the 129 strain and the C57BL/6 strain. In some embodiments, the mouse is a mix of the 129 strains, or a mix of the BL/6 strains. In some embodiments, the mouse is a BALB strain, e.g., BALB/c strain. In some embodiments, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50%BALB/c-50%12954/Sv; or 50%C57BL/6-50%129) . In some embodiments, the non-human animal is a rodent. In some embodiments, the non-human animal is a mouse having a BALB/c, A, A/He, A/J, A/WySN, AKR, AKR/A, AKR/J, AKR/N, TA1, TA2, RF, SWR, C3H, C57BR, SJL, C57L, DBA/2, KM, NIH, ICR, CFW, FACA, C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL (C57BL/10Cr and C57BL/Ola) , C58, CBA/Br, CBA/Ca, CBA/J, CBA/st, or CBA/H background.

In some embodiments, the animal is a rat. The rat can be selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In some embodiments, the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.

The animal can have one or more other genetic modifications, and/or other modifications, that are suitable for the particular purpose for which the humanized CSF1 and/or CSF1R animal is made. For example, suitable mice for maintaining a xenograft (e.g., a human cancer or tumor) , can have one or more modifications that compromise, inactivate, or destroy the immune system of the non-human animal in whole or in part. Compromise, inactivation, or destruction of the immune system of the non-human animal can include, for example, destruction of hematopoietic cells and/or immune cells by chemical means (e.g., administering a toxin) , physical means (e.g., irradiating the animal) , and/or genetic modification (e.g., knocking out one or more genes) . Non-limiting examples of such mice include, e.g., NOD mice, SCID mice, NOD/SCID mice, IL2Rγ knockout mice, NOD/SCID/γc ^null mice (Ito, M. et al., NOD/SCID/γc ^null mouse: an excellent recipient mouse model for engraftment of human cells, Blood 100 (9) : 3175-3182, 2002) , nude mice, and Rag1 and/or Rag2 knockout mice. These mice can optionally be irradiated, or otherwise treated to destroy one or more immune cell type. Thus, in various embodiments, a genetically modified mouse is provided that can include a humanization of at least a portion of an endogenous non-human CSF1 and/or CSF1R locus, and further comprises a modification that compromises, inactivates, or destroys the immune system (or one or more cell types of the immune system) of the non-human animal in whole or in part. In some embodiments, modification is, e.g., selected from the group consisting of a modification that results in NOD mice, SCID mice, NOD/SCID mice, IL-2Rγ knockout mice, NOD/SCID/γc ^null mice, nude mice, Rag 1 and/or Rag2 knockout mice, NOD-Prkdc ^scid IL-2rγ ^null mice, NOD-Rag 1 ^-/--IL2rg ^-/- (NRG) mice, Rag 2 ^-/--IL2rg ^-/- (RG) mice, and a combination thereof. These genetically modified animals are described, e.g., in US20150106961, which is incorporated herein by reference in its entirety. In some embodiments, the mouse can include a replacement of all or part of mature CSF1 and/or CSF1R coding sequence with human mature CSF1 and/or CSF1R coding sequence.

Genetically modified non-human animals can comprise a modification of an endogenous non-human CSF1 and/or CSF1R locus. In some embodiments, the modification can comprise a human nucleic acid sequence encoding at least a portion of a mature CSF1 or CSF1R protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99%identical to the mature CSF1 or CSF1R protein sequence) . Although genetically modified cells are also provided that can comprise the modifications described herein (e.g., ES cells, somatic cells) , in many embodiments, the genetically modified non-human animals comprise the modification of the endogenous CSF1 and/or CSF1R locus in the germline of the animal.

Genetically modified animals can express a human CSF1 and/or CSF1R, or a chimeric CSF1 and/or CSF1R from endogenous mouse loci, wherein the endogenous mouse gene has been replaced with a human gene and/or a nucleotide sequence that encodes a region of human CSF1 and/or CSF1R sequence or an amino acid sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70&, 80%, 90%, 95%, 96%, 97%, 98%, or 99%identical to the human CSF1 and/or CSF1R sequence. In various embodiments, an endogenous non-human locus is modified in whole or in part to comprise human nucleic acid sequence encoding at least one protein-coding sequence of a mature CSF1 and/or CSF1R protein.

In some embodiments, the genetically modified mice express the human CSF1 and/or CSF1R, or chimeric CSF1 and/or CSF1R, from endogenous loci that are under control of mouse promoters and/or mouse regulatory elements. The replacement (s) at the endogenous mouse loci provide non-human animals that express human protein or chimeric protein in appropriate cell types and in a manner that does not result in the potential pathologies observed in some other transgenic mice known in the art. The human protein or the chimeric protein expressed in animal can maintain one or more functions of the wild-type mouse or human protein in the animal. For example, human or non-human CSF1R ligands (e.g., CSF1) can bind to the expressed CSF1R, which can regulate the production, differentiation, and function of macrophages. Alternatively, human or non-human CSF1 receptors (e.g., CSF1R) can bind to the expressed CSF1, which can regulate the production, differentiation, and function ofmacrophages. As used herein, the term “endogenous CSF1R” refers to CSF1R protein that is expressed from an endogenous CSF1R nucleotide sequence of the non-human animal (e.g., mouse) before any genetic modification. Similarly, the term “endogenous CSF1” refers to CSF1 protein that is expressed from an endogenous CSF1 nucleotide sequence of the non-human animal (e.g., mouse) before any genetic modification.

The genome of the animal can comprise a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to 1, 2, 10, 34, 35, or 43.

The genome of the genetically modified animal can comprise a replacement at an endogenous CSF1R gene locus of a sequence encoding a region of endogenous CSF1R with a sequence encoding a corresponding region of human CSF1R. In some embodiments, the sequence that is replaced is any sequence within the endogenous CSF1R gene locus, e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, exon 22, 5'-UTR, 3'UTR, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16, intron 17, intron 18, intron 19, intron 20, intron 21, etc. In some embodiments, the sequence that is replaced is within the regulatory region of the endogenous CSF1R. In some embodiments, the sequence that is replaced is exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and exon 11, or part thereof, of an endogenous mouse CSF1R locus.

The genetically modified animal can have one or more cells expressing a human or chimeric CSF1R having an extracellular region, a transmembrane region, and a cytoplasmic region. In some embodiments, the extracellular region of the human or chimeric CSF1R described herein comprises a sequence that is at least or about 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the extracellular region of human CSF1R. In some embodiments, the extracellular region of the human or chimeric CSF1R has a sequence that has at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 amino acids (e.g., contiguously or non-contiguously) that are identical to human CSF1R. In some embodiments, the extracellular region of the human or chimeric CSF1R comprises a sequence that is the entire or a part of amino acids 20-517 of SEQ ID NO: 35.

In some embodiments, the transmembrane region of the human or chimeric CSF1R described herein comprises a sequence that is at least or about 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the transmembrane region of human CSF1R. In some embodiments, the transmembrane region of the human or chimeric CSF1R has a sequence that has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 amino acids (e.g., contiguously or non-contiguously) that are identical to human CSF1R. In some embodiments, the transmembrane region of the human or chimeric CSF1R comprises a sequence that is the entire of a part of amino acids 518-538 of SEQ ID NO: 35. In some embodiments, the transmembrane region of the chimeric CSF1R described herein comprises a sequence that is at least or about 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the transmembrane region of mouse CSF1R. In some embodiments, the transmembrane region of the chimeric CSF1R has a sequence that has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 amino acids (e.g., contiguously or non-contiguously) that are identical to mouse CSF1R. In some embodiments, the transmembrane region of the chimeric CSF1R comprises a sequence that is the entire of a part of amino acids 516-536 of SEQ ID NO: 34.

In some embodiments, the cytoplasmic region of the human or chimeric CSF1R described herein comprises a sequence that is at least or about 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the cytoplasmic region of human CSF1R. In some embodiments, the cytoplasmic region of the human or chimeric CSF1R has a sequence that has at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, or300 amino acids (e.g., contiguously or non-contiguously) that are identical to human CSF1R. In some embodiments, the cytoplasmic region of the human or chimeric CSF1R comprises a sequence that is the entire of a part of amino acids 539-972 of SEQ ID NO: 35. In some embodiments, the cytoplasmic region of the chimeric CSF1R described herein comprises a sequence that is at least or about 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the cytoplasmic region of mouse CSF1R. In some embodiments, the cytoplasmic region of the chimeric CSF1R has a sequence that has at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, or 300 amino acids (e.g., contiguously or non-contiguously) that are identical to mouse CSF1R. In some embodiments, the cytoplasmic region of the chimeric CSF1R comprises a sequence that is the entire of a part of amino acids 537-977 of SEQ ID NO: 34.

In some embodiments, the extracellular region comprises a signal peptide. In some embodiments, the signal peptide of the human or chimeric CSF1R described herein has a sequence that is at least or about 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the signal peptide of human CSF1R. In some embodiments, the signal peptide of the human or chimeric CSF1R has a sequence that has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 19 amino acids (e.g., contiguously or non-contiguously) that are identical to human CSF1R. In some embodiments, the signal peptide of the human or chimeric CSF1R comprises a sequence that is the entire of a part of amino acids 1-19 of SEQ ID NO: 35. In some embodiments, the signal peptide of the chimeric CSF1R described herein has a sequence that is at least or about 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the signal peptide of mouse CSF1R. In some embodiments, the signal peptide of the chimeric CSF1R has a sequence that has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 19 amino acids (e.g., contiguously or non-contiguously) that are identical to mouse CSF1R. In some embodiments, the signal peptide of the chimeric CSF1R comprises a sequence that is the entire of a part of amino acids 1-19 of SEQ ID NO: 34.

The genome of the genetically modified animal can comprise a replacement at an endogenous CSF1 gene locus of a sequence encoding a region of endogenous CSF1 with a sequence encoding a corresponding region of human CSF1. In some embodiments, the sequence that is replaced is any sequence within the endogenous CSF1 gene locus, e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, 5'-UTR, 3'UTR, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, etc. In some embodiments, the sequence that is replaced is within the regulatory region of the endogenous CSF1 gene. In some embodiments, the sequence that is replaced is within the regulatory region of the human CSF1 gene. In some embodiments, the sequence that is replaced is exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, or part thereof, of an endogenous mouse CSF1 locus.

The genetically modified animal can have one or more cells expressing a human or chimeric CSF1 having an extracellular region, a transmembrane region, and a cytoplasmic region. In some embodiments, the extracellular region of the human or chimeric CSF1 described herein comprises a sequence that is at least or about 50%, 60%, 70%, 80%, 90%, 95%, 99% identical to the extracellular region of human CSF1. In some embodiments, the extracellular region of the human or chimeric CSF1 has a sequence that has at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 amino acids (e.g., contiguously or non-contiguously) that are identical to human CSF1. In some embodiments, the extracellular region of the human or chimeric CSF1 comprises a sequence that is the entire or a part of amino acids 33-496 of SEQ ID NO: 2.

In some embodiments, the transmembrane region of the human or chimeric CSF1 described herein comprises a sequence that is at least or about 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the transmembrane region of human CSF1. In some embodiments, the transmembrane region of the human or chimeric CSF1 has a sequence that has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 amino acids (e.g., contiguously or non-contiguously) that are identical to human CSF1. In some embodiments, the transmembrane region of the human or chimeric CSF1 comprises a sequence that is the entire of a part of amino acids 497-517 of SEQ ID NO: 2.

In some embodiments, the cytoplasmic region of the human or chimeric CSF1 described herein comprises a sequence that is at least or about 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the cytoplasmic region of human CSF1. In some embodiments, the cytoplasmic region of the human or chimeric CSF1 has a sequence that has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 amino acids (e.g., contiguously or non-contiguously) that are identical to human CSF1. In some embodiments, the cytoplasmic region of the human or chimeric CSF1 comprises a sequence that is the entire of a part of amino acids 518-554 of SEQ ID NO: 2.

In some embodiments, the extracellular region comprises a signal peptide. In some embodiments, the signal peptide of the human or chimeric CSF1R described herein has a sequence that is at least or about 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the signal peptide of human CSF1. In some embodiments, the signal peptide of the human or chimeric CSF1 has a sequence that has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 amino acids (e.g., contiguously or non-contiguously) that are identical to human CSF1. In some embodiments, the signal peptide of the human or chimeric CSF1 comprises a sequence that is the entire of a part of amino acids 1-32 of SEQ ID NO: 2. In some embodiments, the signal peptide of the chimeric CSF1R described herein has a sequence that is at least or about 50%, 60%, 70%, 80%, 90%, 95%, 99%identical to the signal peptide of mouse CSF1. In some embodiments, the signal peptide of the chimeric CSF1 has a sequence that has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 amino acids (e.g., contiguously or non-contiguously) that are identical to mouse CSF1. In some embodiments, the signal peptide of the chimeric CSF1 comprises a sequence that is the entire of a part of amino acids 1-32 of SEQ ID NO: 1.

Because human protein and non-human protein sequences, in many cases, are different, antibodies that bind to human protein will not necessarily have the same binding affinity with non-human protein or have the same effects to non-human protein. Therefore, the genetically modified animal expressing human or humanized CSF1 and the genetically modified animal having a human or a humanized extracellular region of CSF1R can be used to better evaluate the effects of anti-CSF1 or anti-CSF1R antibodies in an animal model. In some embodiments, the genome of the genetically-modified animal comprises a sequence encoding an amino acid sequence that corresponds to part or the entire sequence of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and/or exon 11 of human CSF1R, part or the entire sequence of the extracellular region, the transmembrane region, and/or the cytoplasmic region of human CSF1R (with or without signal peptide) , or part or the entire sequence of amino acids 20-517 of SEQ ID NO: 35.

In some embodiments, the non-human animal can have, at an endogenous CSF1R gene locus, a nucleotide sequence encoding a chimeric human/non-human CSF1R polypeptide, wherein the human portion of the chimeric human/non-human CSF1R polypeptide comprises all or a portion of human CSF1R extracellular region, and wherein the animal expresses a functional CSF1R on a surface of a cell of the animal. The human portion of the chimeric human/non-human CSF1R polypeptide can comprise a part of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and a part of exon 11 of human CSF1R. In some embodiments, the human portion of the chimeric human/non-human CSF1R polypeptide can comprise a sequence that is at least 80%, 85%, 90%, 95%, or 99%identical to amino acids 20-517 of SEQ ID NO: 35.

In some embodiments, the non-human portion of the chimeric human/non-human CSF1R polypeptide comprises the cytoplasmic region of an endogenous non-human CSF1R polypeptide. There may be several advantages that are associated with the cytoplasmic regions of an endogenous non-human CSF1R polypeptide. For example, once CSF1 binds to CSF1 R, they can properly transmit extracellular signals into the cells and regulate the downstream pathway.

In some embodiments, the chimeric human/non-human CSF1R polypeptide comprises a transmembrane region from endogenous CSF1R.

In some embodiments, the humanized CSF1R locus lacks a human CSF1R 5’-UTR. In some embodiment, the humanized CSF1R locus comprises a rodent (e.g., mouse) 5’-UTR. In some embodiments, the humanization comprises a human 3’-UTR. In appropriate cases, it may be reasonable to presume that the mouse and human CSF1R genes appear to be similarly regulated based on the similarity of their 5’-flanking sequence. As shown in the present disclosure, humanized CSF1R mice that comprise a replacement at an endogenous mouse CSF1R locus, which retain mouse regulatory elements but comprise a humanization of CSF1R encoding sequence, do not exhibit obvious pathologies. Both genetically modified mice that are heterozygous or homozygous for humanized CSF1R are grossly normal.

In some embodiments, the humanized CSF1 locus has a human CSF1 5’-UTR or an endogenous CSF1 5’-UTR. In some embodiment, the humanized CSF1 locus comprises a rodent (e.g., mouse) 5’-UTR. In some embodiments, the humanization comprises a human 3’-UTR or an endogenous 3’-UTR. In appropriate cases, it may be reasonable to presume that the mouse and human CSF1 genes appear to be similarly regulated based on the similarity of their 5’-flanking sequence. As shown in the present disclosure, humanized CSF1 mice that comprise a replacement at an endogenous mouse CSF1 locus, which has mouse or human regulatory elements, do not exhibit obvious pathologies. Both genetically modified mice that are heterozygous or homozygous for humanized CSF1 are grossly normal.

The present disclosure further relates to a non-human mammal generated through the method mentioned above. In some embodiments, the genome thereof contains human gene (s) . In some embodiments, the non-human mammal is a rodent, and preferably, the non-human mammal is a mouse.

In some embodiments, the non-human mammal expresses a protein encoded by a humanized CSF1R or CSF1 gene.

In addition, the present disclosure also relates to a tumor bearing non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein. In some embodiments, the non-human mammal is a rodent (e.g., a mouse) .

The present disclosure further relates to a cell or cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; and the tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.

The present disclosure also provides non-human mammals produced by any of the methods described herein. In some embodiments, a non-human mammal is provided; and the genetically modified animal contains the DNA encoding human or humanized CSF1R or CSF1 in the genome of the animal.

In some embodiments, the non-human mammal comprises the genetic construct as described herein (e.g., gene construct as shown in FIGS. 2, 3, 5, 10, or 11) . In some embodiments, the non-human mammal comprises the genetic construct as described herein. In some embodiments, a non-human mammal expressing human or humanized CSF1R or CSF1 is provided. In some embodiments, the tissue-specific expression of human or humanized CSF1R or CSF1 protein is provided.

In some embodiments, the expression of human or humanized CSF1R or CSF1 in a genetically modified animal is controllable, as by the addition of a specific inducer or repressor substance. In some embodiments, the specific inducer is selected from Tet-Off System/Tet-On System, or Tamoxifen System.

Non-human mammals can be any non-human animal known in the art and which can be used in the methods as described herein. Preferred non-human mammals are mammals, (e.g., rodents) . In some embodiments, the non-human mammal is a mouse.

Genetic, molecular and behavioral analyses for the non-human mammals described above can performed. The present disclosure also relates to the progeny produced by the non-human mammal provided by the present disclosure mated with the same or other genotypes.

The present disclosure also provides a cell line or primary cell culture derived from the non-human mammal or a progeny thereof. A model based on cell culture can be prepared, for example, by the following methods. Cell cultures can be obtained by way of isolation from a non-human mammal, alternatively cell can be obtained from the cell culture established using the same constructs and the standard cell transfection techniques. The integration of genetic constructs containing DNA sequences encoding human or humanized CSF1R or CSF1 protein can be detected by a variety of methods.

There are many analytical methods that can be used to detect exogenous DNA, including methods at the level of nucleic acid (including the mRNA quantification approaches using reverse transcriptase polymerase chain reaction (RT-PCR) or Southern blotting, and in situ hybridization) and methods at the protein level (including histochemistry, immunoblot analysis and in vitro binding studies) . In addition, the expression level of the gene of interest can be quantified by ELISA techniques well known to those skilled in the art. Many standard analysis methods can be used to complete quantitative measurements. For example, transcription levels can be measured using RT-PCR and hybridization methods including RNase protection, Southern blot analysis, RNA dot analysis (RNAdot) analysis. Immunohistochemical staining, flow cytometry, Western blot analysis can also be used to assess the presence of human or humanized CSF1R and/or CSF1 protein.

Vectors

The present disclosure relates to a targeting vector, comprising: a) a DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) , which is selected from the CSF1R or CSF1 gene genomic DNAs in the length of 100 to 10,000 nucleotides; b) a desired/donor DNA sequence encoding a donor region; and c) a second DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) , which is selected from the CSF1R or CSF1 gene genomic DNAs in the length of 100 to 10, 000 nucleotides.

In some embodiments, a) the DNA fragment homologous to the 5’ end of a conversion region to be altered (5’ arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000069.7.6; c) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000069.7.

In some embodiments, a) the DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) is selected from the nucleotides from the position 107667454 to the position 107663984 of the NCBI accession number NC_000069.7; c) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotides from the position 107653604 to the position 107649963 of the NCBI accession number NC_000069.7.

In some embodiments, a) the DNA fragment homologous to the 5’ end of a conversion region to be altered (5’ arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000084.6; c) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotide sequences that have at least 90%homology to the NCBI accession number NC_000084.6.

In some embodiments, a) the DNA fragment homologous to the 5’ end of a region to be altered (5’ arm) is selected from the nucleotides from the position 61104995 to the position 61109623 of the NCBI accession number NC_000084.6; c) the DNA fragment homologous to the 3’ end of the region to be altered (3’ arm) is selected from the nucleotides from the position 61119606 to the position 61124121 of the NCBI accession number NC_000084.6.

In some embodiments, the length of the selected genomic nucleotide sequence in the targeting vector can be about or at least 3 kb, 4 kb, 5kb, 6kb, 7kb, 8kb, 9kb or 10kb.

In some embodiments, the region to be altered is exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and/or exon 8 of CSF1 gene (e.g., a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and a portion of exon 8 of mouse CSF1 gene) .

In some embodiments, the region to be altered is exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and/or exon 11 of CSF1R gene (e.g., a portion of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and a portion of exon 11 of mouse CSF1R gene) .

The targeting vector can further include a selected gene marker.

In some embodiments, the sequence of the 5’ arm is shown in SEQ ID NO: 3; and the sequence of the 3’ arm is shown in SEQ ID NO: 4.

In some embodiments, the sequence of the 5’ arm is shown in SEQ ID NO: 36; and the sequence of the 3’ arm is shown in SEQ ID NO: 37.

In some embodiments, the sequence is derived from human (e.g., 109914331-109925189 of NC_000001.11) . For example, the target region in the targeting vector is a part or entirety of the nucleotide sequence of a human CSF1, preferably exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and/or exon 8 of the human CSF1 gene. In some embodiments, the nucleotide sequence of the humanized CSF1 encodes the entire or a part of human CSF1 protein (e.g., SEQ ID NO: 2) .

In some embodiments, the sequence is derived from human (e.g., 150068290-150081016 of NC_000005.10) . For example, the target region in the targeting vector is a part or entirety of the nucleotide sequence of a human CSF1R, preferably exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and/or exon 11 of the human CSF1R. In some embodiments, the nucleotide sequence of the humanized CSF1R encodes the entire or a part of human CSF1R protein (e.g., SEQ ID NO: 35) .

In some embodiments, the nucleotide sequence of the human CSF1 encodes the human CSF1 protein with the NCBI accession number NP_000748.4 (SEQ ID NO: 2) . In some emboldens, the nucleotide sequence of the human CSF1 is selected from the nucleotides from the position 109914331 to the position 109925189 of NC_000001.11.

In some embodiments, the nucleotide sequence of the human CSF1R encodes the human CSF1R protein with the NCBI accession number NP_005202.2 (SEQ ID NO: 35) . In some emboldens, the nucleotide sequence of the human CSF1R is selected from the nucleotides from the position 150068290 to the position 150081016 of NC_000005.10.

The disclosure also relates to a cell comprising the targeting vectors as described herein.

In addition, the present disclosure further relates to a non-human mammalian cell, having any one of the foregoing targeting vectors, and one or more in vitro transcripts of the construct as described herein. In some embodiments, the cell includes Cas9 mRNA or an in vitro transcript thereof.

In some embodiments, the genes in the cell are heterozygous. In some embodiments, the genes in the cell are homozygous.

In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is an embryonic stem cell.

Methods of making genetically modified animals

Genetically modified animals can be made by several techniques that are known in the art, including, e.g., nonhomologous end-joining (NHEJ) , homologous recombination (HR) , zinc finger nucleases (ZFNs) , transcription activator-like effector-based nucleases (TALEN) , and the clustered regularly interspaced short palindromic repeats (CRISPR) -Cas system. In some embodiments, homologous recombination is used. In some embodiments, CRISPR-Cas9 genome editing is used to generate genetically modified animals. Many of these genome editing techniques are known in the art, and is described, e.g., in Yin et al., ″Delivery technologies for genome editing, ″Nature Reviews Drug Discovery 16.6 (2017) : 387-399, which is incorporated by reference in its entirety. Many other methods are also provided and can be used in genome editing, e.g., micro-injecting a genetically modified nucleus into an enucleated oocyte, and fusing an enucleated oocyte with another genetically modified cell.

Thus, in some embodiments, the disclosure provides replacing in at least one cell of the animal, at an endogenous CSF1R or CSF1 gene locus, a sequence encoding a region of an endogenous CSF1R or CSF1 with a sequence encoding a corresponding region of human or chimeric CSF1R or CSF1. In some embodiments, the replacement occurs in a germ cell, a somatic cell, a blastocyst, or a fibroblast, etc. The nucleus of a somatic cell or the fibroblast can be inserted into an enucleated oocyte.

FIG. 11 shows a humanization strategy for a mouse CSF1R locus. In FIG. 11, the targeting strategy involves a vector comprising the 5’ end homologous arm, human CSF1R gene fragment, 3’ homologous arm. The process can involve replacing endogenous CSF1R sequence with human sequence by homologous recombination. FIG. 3 shows a humanization strategy for a mouse CSF1 locus. In FIG. 3, the targeting strategy involves a vector comprising the 5’ end homologous arm, human CSF1 gene fragment, 3’ homologous arm. The process can involve replacing endogenous CSF1 sequence with human sequence by homologous recombination. In some embodiments, the cleavage at the upstream and the downstream of the target site (e.g., by zinc finger nucleases, TALEN or CRISPR) can result in DNA double strand break, and the homologous recombination is used to replace endogenous CSF1R or CSF1 sequence with human CSF1R or CSF1 sequence.

Thus, in some embodiments, the methods for making a genetically modified, humanized animal, can include the step of replacing at an endogenous CSF1R locus (or site) , a nucleic acid encoding a sequence encoding a region of endogenous CSF1R with a sequence encoding a corresponding region of human CSF1R. The sequence can include a region (e.g., a part or the entire region) of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22 of a human CSF1R gene. In some embodiments, the sequence includes a part of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and a part of exon 11 of a human CSF1R gene (e.g., nucleic acids 350-1843 of NM_005211.3) . In some embodiments, the region is located within the extracellular region, the transmembrane region, and/or the cytoplasmic region of a human CSF1R. In some embodiments, the endogenous CSF1R locus is exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22 of mouse CSF1R gene.

Thus, in some embodiments, the methods for making a genetically modified, humanized animal, can include the step of replacing at an endogenous CSF1 locus (or site) , a nucleic acid encoding a sequence encoding a region of endogenous CSF1 with a sequence encoding a corresponding region of human CSF1. The sequence can include a region (e.g., a part or the entire region) of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9 of a human CSF1 gene. In some embodiments, the sequence includes a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and a portion of exon 8 of a human CSF1 gene (e.g., nucleic acids 287-1840 of NM_000757.6) . In some embodiments, the endogenous CSF1 locus is exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9 of mouse CSF1.

In some embodiments, the methods of modifying an CSF1R or CSF1 locus of a mouse to express a chimeric human/mouse CSF1R or CSF1 peptide can include the steps of replacing at the endogenous mouse CSF1R or CSF1 locus a nucleotide sequence encoding a mouse CSF1R or CSF1 with a nucleotide sequence encoding a human CSF1R or CSF1, thereby generating a sequence encoding a chimeric human/mouse CSF1R or CSF1.

In some embodiments, the nucleotide sequence encoding the chimeric human/mouse CSF1R can include a first nucleotide sequence encoding the extracellular region of human CSF1R (with or without the mouse or human signal peptide sequence) ; and/or a second nucleotide sequence encoding the transmembrane region and the cytoplasmic region of mouse CSF1R.

In some embodiments, the nucleotide sequences as described herein do not overlap with each other (e.g., the first nucleotide sequence, and/or the second nucleotide sequence do not overlap) . In some embodiments, the amino acid sequences as described herein do not overlap with each other.

The present disclosure further provides a method for establishing an CSF1R or CSF1 gene humanized animal model, involving the following steps:

(a) providing the cell (e.g. a fertilized egg cell) based on the methods described herein;

(b) culturing the cell in a liquid culture medium;

(c) transplanting the cultured cell to the fallopian tube or uterus of the recipient female non-human mammal, allowing the cell to develop in the uterus of the female non-human mammal;

(d) identifying the germline transmission in the offspring genetically modified humanized non-human mammal of the pregnant female in step (c) .

In some embodiments, the non-human mammal in the foregoing method is a mouse (e.g., a C57BL/6 or BALB/c mouse) .

In some embodiments, the non-human mammal in step (c) is a female with pseudo pregnancy (or false pregnancy) .

In some embodiments, the fertilized eggs for the methods described above are C57BL/6 or BALB/c fertilized eggs. Other fertilized eggs that can also be used in the methods as described herein include, but are not limited to, FVB/N fertilized eggs, DBA/1 fertilized eggs and DBA/2 fertilized eggs.

Fertilized eggs can come from any non-human animal, e.g., any non-human animal as described herein. In some embodiments, the fertilized egg cells are derived from rodents. The genetic construct can be introduced into a fertilized egg by microinjection of DNA. For example, by way of culturing a fertilized egg after microinjection, a cultured fertilized egg can be transferred to a false pregnant non-human animal, which then gives birth of a non-human mammal, so as to generate the non-human mammal mentioned in the method described above.

Methods of using genetically modified animals

Replacement of non-human genes in a non-human animal with homologous or orthologous human genes or human sequences, at the endogenous non-human locus and under control of endogenous promoters and/or regulatory elements, can result in a non-human animal with qualities and characteristics that may be substantially different from a typical knockout-plus-transgene animal. In the typical knockout-plus-transgene animal, an endogenous locus is removed or damaged and a fully human transgene is inserted into the animal′s genome and presumably integrates at random into the genome. Typically, the location of the integrated transgene is unknown; expression of the human protein is measured by transcription of the human gene and/or protein assay and/or functional assay. Inclusion in the human transgene of upstream and/or downstream human sequences are apparently presumed to be sufficient to provide suitable support for expression and/or regulation of the transgene.

In some cases, the transgene with human regulatory elements expresses in a manner that is unphysiological or otherwise unsatisfactory, and can be actually detrimental to the animal. The disclosure demonstrates that a replacement with human sequence at an endogenous locus under control of endogenous regulatory elements provides a physiologically appropriate expression pattern and level that results in a useful humanized animal whose physiology with respect to the replaced gene are meaningful and appropriate in the context of the humanized animal′s physiology.

Genetically-modified animals that express human or humanized CSF1R and/or CSF1 protein, e.g., in a physiologically appropriate manner, provide a variety of uses that include, but are not limited to, developing therapeutics for human diseases and disorders, and assessing the toxicity and/or efficacy of these human therapeutics in the animal models.

In various aspects, genetically modified animals are provided that express human or humanized CSF1R and/or CSF1, which are useful for testing agents that can decrease or block the interaction between CSF1 and CSF1R, testing whether an agent can increase or decrease the immune response, and/or determining whether an agent is an CSF1/CSF1R pathway agonist or antagonist. The genetically modified animals can be, e.g., an animal model of a human disease, e.g., the disease is induced genetically (aknock-in or knockout) . In some embodiments, the anti- CSF1 or anti-CSF1R antibody blocks or inhibits the CSF1/CSF1R-related signaling pathways. In various embodiments, the genetically modified non-human animals further comprise an impaired immune system, e.g., a non-human animal genetically modified to sustain or maintain a human xenograft, e.g., a human solid tumor or a blood cell tumor (e.g., a lymphocyte tumor, e.g., a B or T cell tumor) .

In one aspect, the disclosure also provides methods of determining effectiveness of an CSF1/CSF1R pathway modulator (e.g., an anti-CSF1R or an anti-CSF1 antibody) for reducing inflammation. The methods involve administering the CSF1/CSF1R pathway modulator to the animal described herein, wherein the animal has an inflammation; and determining the effects of the agent to the reduction of inflammation.

In one aspect, the disclosure also provides methods of determining effectiveness of an CSF1/CSF1R pathway modulator (e.g., an anti-CSF1R or anti-CSF1 antibody) for treating an immune disorder (e.g., an autoimmune disease) . The methods involve administering the CSF1/CSF1R pathway modulator to the animal described herein, wherein the animal has an immune disorder; and determining the effects of the agent. In some embodiments, the immune disorder including but not limited to: allergy, asthma, myocarditis, nephritis, hepatitis, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative Colitis, autoimmune liver disease, diabetes, pain or neurological disorders.

In one aspect, the disclosure also provides methods of determining effectiveness of an CSF1/CSF1R pathway modulator (e.g., an anti-CSF1R or an anti-CSF1 antibody) for treating an infectious disease. The methods involve administering the CSF1/CSF1R pathway modulator to the animal described herein, wherein the animal has an infectious disease; and determining the effects of the CSF1/CSF1R pathway antagonist.

In one aspect, the disclosure also provides methods of determining effectiveness of an CSF1/CSF1R pathway modulator (e.g., an anti-CSF1R or an anti-CSF1 antibody) for treating cancer. The methods involve administering the CSF1/CSF1R pathway modulator to the animal described herein, wherein the animal has a tumor; and determining the effects of the CSF1/CSF1R pathway modulator to the tumor. In some embodiments, the tumor comprises one or more cancer cells that are injected into the animal. The inhibitory effects that can be determined include, e.g., a decrease of tumor size or tumor volume, a decrease of tumor growth, a reduction of the increase rate of tumor volume in a subject (e.g., as compared to the rate of increase in tumor volume in the same subject prior to treatment or in another subject without such treatment) , a decrease in the risk of developing a metastasis or the risk of developing one or more additional metastasis, an increase of survival rate, and an increase of life expectancy, etc. The tumor volume in a subject can be determined by various methods, e.g., as determined by direct measurement, MRI or CT. In some embodiments, the caner includes but not limited to: lymphoma, non-small cell lung cancer, cervical cancer, leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, glioma, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, stomach cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myeloproliferation abnormal syndromes, and sarcomas. In some embodiments, the leukemia is selected from acute lymphocytic (lymphoblastic) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myelogenous leukemia. In some embodiments, the lymphoma is selected from Hodgkin′slymphoma and non-Hodgkin′s lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and Waldenstrom macroglobulinemia. In some embodiments, the sarcoma is selected from the group consisting of osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, and chondrosarcoma. In some embodiments, the tumor is breast cancer, ovarian cancer, endometrial cancer, melanoma, kidney cancer, lung cancer, or liver cancer.

In some embodiments, the anti-CSF1R antibody or anti-CSF1 antibody prevents CSF1 from binding to CSF1R. In some embodiments, the anti-CSF1R antibody or anti-CSF1 antibody cannot prevent CSF1 from binding to CSF1R (e.g., endogenous, human, or humanized CSF1R) .

In some embodiments, the genetically modified animals can be used for determining whether an anti-CSF1R antibody is an CSF1R agonist or antagonist. In some embodiments, the genetically modified animals can be used for determining whether an anti-CSF1 antibody is an CSF1 agonist or antagonist. In some embodiments, the methods as described herein are also designed to determine the effects of the agent (e.g., anti-CSF1R or anti-CSF1 antibodies) on CSF1R and/or CSF1, e.g., whether the agent can upregulate the immune response or downregulate immune response. In some embodiments, the genetically modified animals can be used for determining the effective dosage of a therapeutic agent for treating a disease in the subject, e.g., a cancer, an infectious disease, or an immune disorder (e.g., an autoimmune disease) .

The inhibitory effects on tumors can also be determined by methods known in the art, e.g., measuring the tumor volume in the animal, and/or determining tumor (volume) inhibition rate (TGI _TV) . The tumor growth inhibition rate can be calculated using the formula TGI _TV (%) = (1-TVt/TVc) x 100, where TVt and TVc are the mean tumor volume (or weight) of treated and control groups.

In some embodiments, the anti-CSF1R or anti-CSF1 antibody is designed for treating various cancers. As used herein, the term “cancer” refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. The term “tumor” as used herein refers to cancerous cells, e.g., a mass of cancerous cells. Cancers that can be treated or diagnosed using the methods described herein include malignancies of the various organ systems, such as affecting lung, breast, thyroid, lymphoid, gastrointestinal, Melanoma and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus.

In some embodiments, the antibody is designed for treating various autoimmune diseases (e.g., asthma, systemic lupus erythematosus (SLE) , rheumatoid arthritis (RA) , Sjogren′s syndrome (SS) , multiple sclerosis (MS) , Crohn′s disease (CD) , inflammatory bowel disease (IBD) , or psoriasis) or allergy. Thus, the methods as described herein can be used to determine the effectiveness of an antibody in inhibiting immune response.

The present disclosure also provides methods of determining toxicity of an antibody (e.g., anti-CSF1R antibody, or anti-CSF1 antibody) . The methods involve administering the antibody to the animal as described herein. The animal is then evaluated for its weight change, red blood cell count, hematocrit, and/or hemoglobin. In some embodiments, the antibody can decrease the red blood cells (RBC) , hematocrit, or hemoglobin by more than 20%, 30%, 40%, or 50%.

The present disclosure also relates to the use of the animal model generated through the methods as described herein in the development of a product related to an immunization processes of human cells, the manufacturing of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.

In some embodiments, the disclosure provides the use of the animal model generated through the methods as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and/or a therapeutic strategy.

The disclosure also relates to the use of the animal model generated through the methods as described herein in the screening, verifying, evaluating or studying the CSF1R or CSF1 gene function, human CSF1R or CSF1 antibodies, drugs for human CSF1R or CSF1 targeting sites, the drugs or efficacies for human CSF1R or CSF1 targeting sites, the drugs for immune-related diseases and antitumor drugs.

In some embodiments, the disclosure provides a method to verify in vivo efficacy of TCR-T, CAR-T, and/or other immunotherapies (e.g., T-cell adoptive transfer therapies) . For example, the methods include transplanting human tumor cells into the animal described herein, and applying human CAR-T to the animal with human tumor cells. Effectiveness of the CAR-T therapy can be determined and evaluated. In some embodiments, the animal is selected from the CSF1R or CSF1 gene humanized non-human animal prepared by the methods described herein, the CSF1R or CSF1 gene humanized non-human animal described herein, the double-or multi-humanized non-human animal generated by the methods described herein (or progeny thereof) , a non-human animal expressing the human or humanized CSF1R or CSF1 protein, or the tumor-bearing or inflammatory animal models described herein. In some embodiments, the TCR-T, CAR-T, and/or other immunotherapies can treat the CSF1/CSF1R pathway-associated diseases described herein. In some embodiments, the TCA-T, CAR-T, and/or other immunotherapies provides an evaluation method for treating the CSF1/CSF1R pathway-associated diseases described herein.

Genetically modified animal model with two or more human or chimeric genes

The present disclosure further relates to methods for generating genetically modified animal model with two or more human or chimeric genes. The animal can comprise a human or chimeric CSF1R gene and a sequence encoding one or more additional human or chimeric protein (e.g., CSF1) . Alternatively, the animal can comprise a human or chimeric CSF1 gene and a sequence encoding one or more additional human or chimeric protein (e.g., CSF1R) .

In some embodiments, the additional human or chimeric protein can be CSF1, CSF1R, programmed cell death protein 1 (PD-1) , programmed cell death 1 ligand 1 (PD-L1) , IL6, IL3, IL15, colony stimulating factor 2 (CSF2) , thyroid peroxidase (TPO) , or CD40.

The methods of generating genetically modified animal model with two or more human or chimeric genes (e.g., humanized genes) can include the following steps:

(a) using the methods of introducing human CSF1R gene or chimeric CSF1R gene as described herein to obtain a genetically modified non-human animal;

(b) mating the genetically modified non-human animal with another genetically modified non-human animal, and then screening the progeny to obtain a genetically modified non-human animal with two or more human or chimeric genes. In some embodiments, in step (b) of the method, the genetically modified animal can be mated with a genetically modified non-human animal with human or chimeric CSF1, PD-1, PD-L1, IL6, IL3, IL15, CSF2, TPO, or CD40.

Similarly, the methods of generating genetically modified animal model can include the following steps:

(a) using the methods of introducing human CSF1 gene or chimeric CSF1 gene as described herein to obtain a genetically modified non-human animal;

(b) mating the genetically modified non-human animal with another genetically modified non-human animal, and then screening the progeny to obtain a genetically modified non-human animal with two or more human or chimeric genes. In some embodiments, in step (b) of the method, the genetically modified animal can be mated with a genetically modified non-human animal with human or chimeric CSF1R, PD-1, PD-L1, IL6, IL3, IL15, CSF2, TPO, or CD40.

In some embodiments, the humanization is directly performed on a genetically modified animal having a human or chimeric CSF1, CSF1R, PD-1, PD-L1, IL6, IL3, IL15, CSF2, TPO, or CD40 gene.

In some embodiments, the CSF1R humanization is directly performed on a genetically modified animal having a human or chimeric CSF1. In some embodiments, the CSF1 humanization is directly performed on a genetically modified animal having a human or chimeric CSF1R.

As these proteins may involve different mechanisms, a combination therapy that targets two or more of these proteins thereof may be a more effective treatment. In fact, many related clinical trials are in progress and have shown a good effect. The genetically modified animal model with two or more human or humanized genes can be used for determining effectiveness of a combination therapy that targets two or more of these proteins, e.g., an anti-CSF1R or anti-CSF1 antibody and an additional therapeutic agent for the treatment. The methods include administering the anti-CSF1R antibody and/or the anti-CSF1 antibody, and the additional therapeutic agent to the animal, wherein the animal has a tumor; and determining the inhibitory effects of the combined treatment to the tumor. In some embodiments, the additional therapeutic agent is an antibody that specifically binds to IL6, IL3, IL15, CSF2, TPO, IL33, PD-1, CTLA-4, BTLA, PD-L1, CD27, CD28, TIGIT, TIM-3, GITR, CD137, OX40, CD47 or SIRPa. In some embodiments, the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab) , an anti-CD20 antibody (e.g., rituximab) , an anti-EGFR antibody (e.g., cetuximab) , and an anti-CD319 antibody (e.g., elotuzumab) , or anti-PD-1 antibody (e.g., nivolumab) .

EXAMPLES

The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

Materials and Methods

The following materials were used in the following examples.

Heraeus ^TM Microcentrifuge was purchased from Thermo Fisher Scientific (Model: Fresco ^TM 21) .

Mouse M-CSF ELISA Kit was purchased from RayBiotech Life, Inc. (Cat#: ELH-MCSF) .

Human M-CSF ELISA Kit was purchased from RayBiotech Life, Inc. (Cat#: ELM-MCSF) .

APC anti-mouse CD115 (CSF-1R) Antibody (mCSF1R-APC) was purchased from BioLegend (Cat#: 135509) .

PE anti-human CD115 (CSF-1R) Antibody (hCSF1R-PE) was purchased from BioLegend (Cat#: 347303) .

V450 Rat Anti-CD11b Antibody (mCD11b-V450) was purchased from BD Horizon (Cat#: 560455) .

BclI, DraIII, and HindIII restriction enzymes were purchased from NEB (Cat#: R0160S, R0510, and R0104M, respectively) .

Attune ^TM Nxt Acoustic Focusing Cytometer was purchased from Thermo Fisher (Model: Attune ^TM Nxt) .

PrimeScript ^TM 1st Strand cDNA Synthesis Kit was purchased from TAKARA (Cat#: 6110A) .

EXAMPLE 1: Preparation of humanized mice with CSF1 gene

In this example, a non-human animal (e.g., a mouse) was modified to include a nucleotide sequence encoding human CSF1 proteins, and the obtained genetically-modified non-human animal can express human or humanized CSF1 protein in vivo. The mouse CSF1 gene (NCBI Gene ID: 12977, Primary source: MGI: 1339753, UniProt ID: P07141) is located at 107648364 to 107668048 of chromosome 3 (NC_000069.7) , and the human CSF1 gene (NCBI Gene ID: 1435, Primary source: HGNC: 2432, UniProt ID: P09603) is located at 109910506 to 109930992 of chromosome 1 (NC_000001.11) . The mouse CSF1 transcript is NM_007778.4, and the corresponding protein sequence NP_031804.3 is set forth in SEQ ID NO: 1. The human CSF1 transcript is NM_000757.6, and the corresponding protein sequence NP_000748.4 is set forth in SEQ ID NO: 2. Mouse and human CSF1 gene loci are shown in FIG. 1.

All or part of nucleotide sequences encoding human CSF1 protein can be introduced into the mouse endogenous CSF1 locus, so that the mouse expresses human or humanized CSF1 protein. Specifically, mouse cells can be modified by various gene-editing techniques to replace specific mouse CSF1 gene sequences with human CSF1 gene sequences (e.g., genomic DNA sequence, cDNA sequence or CDS sequence) at the endogenous mouse CSF1 locus. For example, a 9929 bp sequence from exon 2 to exon 8 of the mouse CSF1 gene was replaced with the corresponding human DNA sequence, to obtain a humanized CSF1 gene locus as shown in FIG. 2, thereby humanizing mouse CSF1 gene.

As shown in the schematic diagram of the targeting strategy in FIG. 3, the targeting vector contains homologous arm sequences upstream and downstream of the mouse CSF1 gene, and an “A1 Fragment” containing DNA sequences of human CSF1 gene. Specifically, sequence of the upstream homologous arm (5′ homologous arm, SEQ ID NO: 3) is identical to nucleotide sequence of 107667454-107663984 of NCBI accession number NC_000069.7, and sequence of the downstream homologous arm (3′ homologous arm, SEQ ID NO: 4) is identical to nucleotide sequence of 107653604-107649963 of NCBI accession number NC_000069.7. The A1 Fragment contains a human genomic DNA sequence from CSF1 genes (SEQ ID NO: 5) , which is identical to nucleotide sequence of 109914331-109925189 of NCBI accession number NC_000001.11. The connection between the 3’ end of the human CSF1 DNA fragment in the A1 fragment and the mouse CSF1 gene was designed as:

wherein the last “G” of sequence “ TGTAG” is the last nucleotide of the human sequence, and the first “A” of sequence

is the first nucleotide of the mouse sequence.

The targeting vector also includes an antibiotic resistance gene for positive clone screening (neomycin phosphotransferase gene, or Neo) , and two Frt recombination sites flanking the antibiotic resistance gene, that formed a Neo cassette (within the A1 Fragment) . The connection between the 5’ end of the Neo cassette and the mouse sequence was designed as:

wherein the last “T” in sequence “ CAAAT” is the last nucleotide of the mouse sequence, and the first “C” in sequence

is the first nucleotide of the Neo cassette. The connection between the 3’ end of the Neo cassette and the mouse sequence was designed as: 5’- TCTCTAGAAAGTATAGGAACTTCATCAGTCAGGTACATAATGGTG GATCC

CTTATCTGGTCCTACTCCCAAGCCAAGGTTATTGCTGCCTCCCTG-3’ (SEQ ID NO: 8) , wherein the last “C” in sequence “ GATCC” is the last nucleotide of the Neo cassette, and the first “T” in sequence

is the first nucleotide of the mouse sequence. In addition, a coding gene with a negative selectable marker (a gene encoding diphtheria toxin A subunit (DTA) ) was also constructed downstream of the 3′ homologous arm of the targeting vector. The mRNA sequence of the engineered mouse CSF1 after humanization and its encoded protein sequence are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively.

The targeting vector was constructed, e.g., by restriction enzyme digestion and ligation. The constructed targeting vector sequences were preliminarily confirmed by restriction enzyme digestion, and then verified by sequencing. Embryonic stem cells of C57BL/6 mice were transfected with the correct targeting vector by electroporation. The positive selectable marker genes were used to screen the cells, and the integration of exogenous genes was confirmed by PCR and Southern Blot. Specifically, after mouse embryonic stem cells were transfected with targeting vectors, the clones identified as positive by PCR were then verified by Southern Blot (cell DNA was digested with BglII, DraIII, and HindIII, respectively, and hybridized with three probes) to screen out correct positive clone cells. The restriction enzymes, probes, and the size of target fragments are shown in the table below. The Southern Blot detection results are shown in FIG. 4. The results indicate that among the 12 PCR-positive embryonic stem cells, except for 3-G07, the other 11 clones were confirmed by sequencing to be positive clones without random insertions. The 11 clones included 1-A02, 1-B08, 1-E05, 2-A04, 2-A12, 2-D06, 3-C08, 3-D06, 3-D09, 3-E05, and 3-G02.

Table 5. Enzymes and probes used in Southern Blot

Restriction enzyme	Probe	wild-type fragment size	Recombinant fragment size
BclI	5’Probe	8.9kb	11.9kb
DraIII	3’Probe	13kb	9.2kb
HindIII	Neo Probe	-	6.2kb

The following PCR primers were used:

F1: 5’-GAGCCAGGGTGATTTCCCATAAA-3’ (SEQ ID NO: 11) ,

R1: 5’-CAGAGGTCCTAACTTTGGGAAGG-3’ (SEQ ID NO: 12) ;

F2: 5’-GCTCGACTAGAGCTTGCGGA-3’ (SEQ ID NO: 13) ,

R2: 5’-AGAGGGCACTTAAGCAAGTTGAG-3’ (SEQ ID NO: 14) .

The following primers were used for probe synthesis in Southern Blot assays:

5’ Probe:

5’ Probe-F: 5’-TTGAACAATGCATAGGAGGGAGC-3’ (SEQ ID NO: 15) ,

5’ Probe-R: 5’-GCTAGCTCTCTTCCCCGTCG-3’ (SEQ ID NO: 16) ;

3’ Probe:

3’ Probe-F: 5’-TTCCCGTAAAGGCATAAAGGCA-3’ (SEQ ID NO: 17) ,

3’ Probe-R: 5’-GAGGAGAGGCTGAAGGAAGTG-3’ (SEQ ID NO: 18) ;

Neo Probe:

Neo Probe-F: 5’-GGATCGGCCATTGAACAAGAT-3’ (SEQ ID NO: 19) ,

Neo Probe-R: 5’-CAGAAGAACTCGTCAAGAAGGC-3’ (SEQ ID NO: 20) .

The positive clones that had been screened (black mice) were introduced into isolated blastocysts (white mice) , and the resulted chimeric blastocysts were transferred to a culture medium for short-term culture and then transplanted to the fallopian tubes of the recipient mother (white mice) to produce the F0 chimeric mice (black and white) . The F2 generation homozygous mice were obtained by backcrossing the F0 generation chimeric mice with wild-type mice to obtain the F1 generation mice, and then breeding the F1 generation heterozygous mice with each other. The positive mice were also bred with the Flp transgenic mice to remove the positive selectable marker genes (schematic diagram shown in FIG. 5) , and then the humanized homozygous mice with a humanized CSF1 gene were obtained by breeding the heterozygous mice with each other.

The genotype of offspring mouse somatic cells can be verified by PCR using primers shown in the table below. The identification results of exemplary F1 generation mice (Neo cassette removed) are shown in FIGS. 6A-6D. The results showed that two mice numbered F1-01 and F1-02 were identified as positive heterozygous clones, indicating that genetically engineered mice with a humanized CSF1 gene and no random insertions can be constructed using the methods described herein.

Table 6. PCR primer sequences and target fragment sizes

The humanized CSF1 mRNA and protein expression in positive mice can be confirmed by various detection methods, e.g., RT-PCR and ELISA. Specifically, three 9-week-old wild-type C57BL/6 mice and three CSF1 gene humanized heterozygous mice (prepared by the methods described herein) were selected. The mice were stimulated by intraperitoneal injection of LPS (200 μg/200 μtl) . After 3 hours, spleen tissues were collected after euthanasia for RT-PCR and ELISA detection. The primers used in RT-PCR detection are shown in the table below, and the detection results are shown in FIGS. 7A-7C. In the spleen tissues of C57BL/6 wild-type mice, only mouse CSF1 mRNA was detected (FIG. 7A) , but humanized CSF1 mRNA was not detected (FIG. 7B) . In the spleen of CSF1 gene humanized heterozygous mice, both mouse CSF1 mRNA (FIG. 7A) and humanized CSF1 mRNA were detected (FIG. 7B) .

Table 7. RT-PCR primer sequences and target fragment sizes

ELISA results are shown in FIGS. 8A-8B. The results showed that expression of mouse CSF1 (mCSF1) protein was detected in the spleen tissues of C57BL/6 wild-type mice (FIG. 8A) , but expression of humanized CSF1 protein was not detected (FIG. 8B) . In contrast, expression of both mouse CSF1 protein (FIG. 8A) and humanized CSF1 protein was detected in the spleen tissues of CSF1 gene humanized heterozygous mice (FIG. 8B) .

EXAMPLE 2: Preparation of humanized mice with CSF1R gene

In this example, a non-human animal (e.g., a mouse) was modified to include a nucleotide sequence encoding human CSF1R proteins, and the obtained genetically-modified non-human animal can express human or humanized CSF1R protein in vivo. The mouse CSF1R gene (NCBI Gene ID: 12978, Primary source: MGI: 1339758, UniProt ID: P09581) is located at 61105572 to 61131139 of chromosome 18 (NC_000084.6) , and the human CSF1R gene (NCBI Gene ID: 1436, Primary source: HGNC: 2433, UniProt ID: P07333) is located at 150053291 to 150113372 of chromosome 5 (NC_000005.10) . The mouse CSF1R transcript is NM_001037859.2, and the corresponding protein sequence NP_001032948.2 is set forth in SEQ ID NO: 34. The human CSF1R transcript is NM_005211.3, and the corresponding protein sequence NP_005202.2 is set forth in SEQ ID NO: 35. Mouse and human CSF1R gene loci are shown in FIG. 9.

All or part of nucleotide sequences encoding human CSF1R protein can be introduced into the mouse endogenous CSF1R locus, so that the mouse expresses human or humanized CSF1R protein. Specifically, mouse cells can be modified by various gene-editing techniques to replace specific mouse CSF1R gene sequences with human CSF1R gene sequences (e.g., genomic DNA sequence, cDNA sequence or CDS sequence) at the endogenous mouse CSF1R locus. For example, a 9369 bp sequence from exon 3 to exon 11 of the mouse CSF1R gene was replaced with the corresponding human DNA sequence, to obtain a humanized CSF1R gene locus as shown in FIG. 10, thereby humanizing mouse CSF1R gene.

As shown in the schematic diagram of the targeting strategy in FIG. 11, the targeting vector contains homologous arm sequences upstream and downstream of the mouse CSF1R gene, and an “A Fragment” containing DNA sequences of human CSF1R gene. Specifically, sequence of the upstream homologous arm (5′ homologous arm, SEQ ID NO: 36) is identical to nucleotide sequence of 61104995-61109623 of NCBI accession number NC_000084.6, and sequence of the downstream homologous arm (3′ homologous arm, SEQ ID NO: 37) is identical to nucleotide sequence of 61119606-61124121 of NCBI accession number NC_000084.6. The A Fragment contains a human genomic DNA sequence from CSF1R genes (SEQ ID NO: 38) , which is identical to nucleotide sequence of 150068290-150081016 of NCBI accession number NC_000005.10. The connection between the 3’ end of the human CSFIR DNA fragment in the A fragment and the mouse CSF1R gene was designed as: 5’-AGCCCACACGCATCCCCCGGATGAGTTCCTCTTCA CACCA

GGTGGCCTGTATGTCTGTCATGTCTCTGCTGGTGC-3’ (SEQ ID NO: 39) , wherein the last “A” of sequence “ CACCA” is the last nucleotide of the human sequence, and the first “G” of sequence

is the first nucleotide of the mouse sequence.

The targeting vector also includes an antibiotic resistance gene for positive clone screening (neomycin phosphotransferase gene, or Neo) , and two Frt recombination sites flanking the antibiotic resistance gene, that formed a Neo cassette (within the A Fragment) . The connection between the 5’ end of the Neo cassette and the mouse sequence was designed as: 5’-CTGGTTGCTACTTAACCACTCAGACATAGCTTAGTCACTACCGTG ACTAC

CCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCAGGTCTGAA-3’ (SEQ ID NO: 40) , wherein the last “C” in sequence “ ACTAC” is the last nucleotide of the mouse sequence, and the “G”in sequence

is the first nucleotide of the Neo cassette. The connection between the 3’ end of the Neo cassette and the mouse sequence was designed as: 5’-GAAAGTATAGGAACTTCATCAGTCAGGTACATAATGGTGGATCCA ATATT

CTTGGAGAAACACAAAACCCTTCCTCATACGGAACTAAAAGCTGT-3’ (SEQ ID NO: 41) , wherein the last “T” in sequence “ ATATT” is the last nucleotide of the Neo cassette, and the first “C” in sequence

is the first nucleotide of the mouse sequence. In addition, a coding gene with a negative selectable marker (a gene encoding diphtheria toxin A subunit (DTA) ) was also constructed downstream of the 3′ homologous arm of the targeting vector. The mRNA sequence of the engineered mouse CSF1R after humanization and its encoded protein sequence are shown in SEQ ID NO: 42 and SEQ ID NO: 43, respectively.

The targeting vector was constructed, e.g., by restriction enzyme digestion and ligation. The constructed targeting vector sequences were preliminarily confirmed by restriction enzyme digestion, and then verified by sequencing. Embryonic stem cells of C57BL/6 mice were transfected with the correct targeting vector by electroporation. The positive selectable marker genes were used to screen the cells, and the integration of exogenous genes was confirmed by PCR and Southern Blot. The positive clones that had been screened (black mice) were introduced into isolated blastocysts (white mice) , and the resulted chimeric blastocysts were transferred to a culture medium for short-term culture and then transplanted to the fallopian tubes of the recipient mother (white mice) to produce the F0 chimeric mice (black and white) . The F2 generation homozygous mice were obtained by backcrossing the F0 generation chimeric mice with wild-type mice to obtain the F1 generation mice, and then breeding the F1 generation heterozygous mice with each other. The positive mice were also bred with the Flp transgenic mice to remove the positive selectable marker genes, and then the humanized homozygous mice with a humanized CSF1R gene were obtained by breeding the heterozygous mice with each other.

Expression of humanized CSF1R protein in positive mice can be confirmed by flow cytometry. Specifically, blood was collected from 6-week-old wild-type C57BL/6 mice and CSF1R gene humanized mice, respectively. The blood cells were stained with anti-mouse CSF1R antibody mCSF1R-APC or anti-human CSF1R antibody hCSF1R-PE, together with mCD11b-V450, and then subjected to flow cytometry detection. The results are in FIGS. 12A-12D. The results showed that mouse CSF1R protein (FIG. 12B) and humanized CSF1R protein (FIG. 12D) were both detected in CSF1R gene humanized heterozygous mice. However, in wild-type C57BL/6 mice, only mouse CSF1R protein was detected (FIG. 12A) , and no humanized CSF1R protein was detected (FIG. 12C) .

EXAMPLE 3: Generation of CSF1/CSF1R double-gene humanized mice

The CSF1 gene humanized mice obtained in Example 1 were bred with the CSF1R gene humanized mice obtained in Example 2, and their offspring were screened to obtain CSF1/CSF1R double-gene humanized homozygous mice. The expression of humanized CSF1 protein and CSF1R protein in the homozygous mice were detected by ELISA and flow cytometry, respectively. Specifically, three 7-week-old female wild-type C57BL/6 mice and three CSF1/CSF1R double-gene humanized homozygous mice obtained as described herein were selected. The mice were stimulated by intraperitoneal injection of LPS (200 μg/200 μtg) . After 3 hours, spleen cells were collected. The expression of mouse CSF1 and humanized CSF1 was detected by

Mouse M-CSF ELISA Kit and

Human M-CSF ELISA Kit, respectively. As shown in FIGS. 13A-13B, in wild-type C57BL/6 mice, only the expression of mouse CSF1 protein was detected (FIG. 13A) , and the expression of humanized CSF1 protein was not detected (FIG. 13B) . In CSF1/CSF1R double-gene humanized homozygous mice, only the expression of humanized CSF1 protein was detected (FIG. 13B) , and the expression of mouse CSF1 protein was not detected (FIG. 13A) .

CSF1R protein expression in mice was also detected by flow cytometry. Specifically, peripheral blood was collected from one 7-week-old female wild-type C57BL/6 mouse and one CSF1/CSF1R double-gene humanized homozygous mouse. The blood cells were stained with Brilliant Violet 510 ^TM anti-mouse CD45 Antibody (an anti-mouse CD45 antibody) , V450 Rat Anti-mouse CD11b (mCD11b-V450; an anti-mouse CD11b antibody) , and either APC anti-mouse CD115 (CSF1R) Antibody (mCSF1R-APC; an anti-mouse CD155 antibody) or PE anti-human CD115 (CSF1R) Antibody (hCSF1R-PE; an anti-human CD155 antibody) , and then subjected to flow cytometry detection. The results are shown in FIGS. 14A-14D. According to the results, expression of mouse CSF1R protein, but not humanized CSF1R protein, was detected in the wild-type C57BL/6 mouse (FIG. 14A and FIG. 14C) ; expression of humanized CSF1R protein, but not mouse CSF1R protein, was detected in the CSF1/CSF1R double-gene humanized homozygous mouse (FIG. 14B and FIG. 14D) .

EXAMPLE 4. Generation of double-or multi-gene humanized mice

The CSF1 and/or CSF1R gene humanized mice generated using the methods described herein can also be used to generate double-or multi-gene humanized mouse models. For example, in Example 1 or Example 2, the embryonic stem (ES) cells for blastocyst microinjection can be selected from mice comprising other genetic modifications such as modified (e.g., human or humanized) PD-1, PD-L1, IL6, IL3, IL15, CSF2, TPO, and CD40 genes. Alternatively, embryonic stem cells from CSF1 and/or CSF1R gene humanized mice described herein can be isolated, and gene recombination targeting technology can be used to obtain double-gene or multi-gene-modified mouse models of CSF1 and/or CSF1R and other gene modifications. In addition, it is also possible to breed the homozygous or heterozygous CSF1 and/or CSF1R gene humanized mice obtained by the methods described herein with other genetically modified homozygous or heterozygous mice, and the offspring can be screened. According to Mendel’s law, it is possible to generate double-gene or multi-gene modified heterozygous mice comprising modified (e.g., human or humanized) CSF1 and/or CSF1R gene and other genetic modifications. Then the heterozygous mice can be bred with each other to obtain homozygous double-gene or multi-gene modified mice. These double-gene or multi-gene modified mice can be used for in vivo validation of gene regulators targeting human CSF1 and/or CSF1R and other genes.

EXAMPLE 5. In vivo efficacy verification

AMG-820 is a fully human monoclonal IgG2 antibody against CSF1R developed by AmMax Bio and is currently in Phase II clinical trials. AMG-820 can be used as an intra-articular treatment for giant cell tumor of the tendon sheath of the knee joint. Details of AMG-820 can be found, e.g., in CN101802008B, which is incorporated herein by reference in its entirety.

Axatilimab (with full-length heavy chain (HC) sequence set forth in SEQ ID NO: 44 and full-length light chain (LC) sequence set forth in SEQ ID NO: 45) is a humanized monoclonal antibody against CSF1R developed by Syndax Pharmaceuticals. Axatilimab is currently in Phase II clinical trials for the treatment of hospitalized patients with respiratory signs and symptoms secondary to coronavirus diseases (e.g., COVID19) and for the treatment of patients with active chronic graft-versus-host diseases.

Cabiralizumab (with full-length heavy chain (HC) sequence set forth in SEQ ID NO: 46 and full-length light chain (LC) sequence set forth in SEQ ID NO: 47) is a humanized monoclonal antibody targeting CSF1R, co-developed by Amgen, Inc., Bristol-Myers Squibb and Ono Pharmaceutical. Cabiralizumab is currently in Phase I/II clinical trials for the treatment of oncology indications.

Emactuzumab (with full-length heavy chain (HC) sequence set forth in SEQ ID NO: 48 and full-length light chain (LC) sequence set forth in SEQ ID NO: 49) is a humanized anti-CSF1R monoclonal antibody developed by Roche. Emactuzumab is currently Phase I clinical trials for the treatment of solid tumors.

IMC-CS4 (with heavy chain variable region (VH) sequence set forth in SEQ ID NO: 50 and light chain variable region (VL) sequence set forth in SEQ ID NO: 51) is a human monoclonal antibody targeting CSF1R, developed by Eli Lilly and Company, for the treatment of advanced solid tumors.

The CSF1/CSF1R double-gene humanized homozygous mice prepared described herein were used to construct a tumor model to test the efficacy of drugs targeting human CSF1R. Specifically, the CSF1/CSF1R double-gene humanized homozygous mice (8-9 weeks old, female) prepared in Example 3 were selected and subcutaneously inoculated with mouse colon cancer cells MC38 (5 × 10 ⁵ per mouse) . When the tumor volume grew to about 100 mm ³, the mice were randomly placed into a control group (G1) and five treatment groups (G2-G6) based on tumor size (6 mice per group) . The treatment group mice were administered with anti-human CSF1R antibodies AMG-820 analog, axatilimab analog, cabiralizumab analog, emactuzumab analog, and IMC-CS4 analog, respectively, via intraperitoneal injection (i.p. ) , whereas the control group mice were injected with an equal volume of phosphate-buffered saline (PBS) . All mice were administered on the day of grouping. The frequency of administration was twice a week (6 times of administrations in total) . The tumor volume was measured twice a week and the body weight of the mice was weighed as well. Euthanasia was performed when the tumor volume of the mouse reached 3000 mm3. The specific grouping and dosing schedule are shown in the table below. The body weight, body weight change, and tumor volume measurement results of mice during the experimental period are shown in FIGS. 15-17, respectively.

Table 8.

The main data and analysis results of each experiment are listed in the table below, including tumor volume at the time of grouping (Day 0) , 14 days after grouping (Day 14) , and 21 days after grouping (Day 21) , survived mouse number on Day 21, tumor growth inhibition value based on tumor volume (TGI _TV) , and the statistical difference (P value) of body weight and tumor volume between the treatment group and control group.

Table 9.

Overall, the animals in each group were healthy, and the body weights of all the treatment group mice (G2-G6) and control group mice (G1) increased on Day 21, and were not significantly different from each other (P ＞ 0.05) during the experimental period (FIG. 15 and FIG. 16) . The results indicate that the treatment group mice tolerated the anti-human CSF 1R antibodies AMG-820 analog, axatilimab analog, cabiralizumab analog, emactuzumab analog, and IMC-CS4 analog well. According to the results shown in FIG. 17 and the table above, the tumor volume of all control group mice continued to grow during the experimental period. By contrast, all treatment group mice showed different degrees of tumor growth inhibition. And on Day 21, the tumor volumes of mice in G2, G3, G4, G5 and G6 group mice were 935 ± 193 mm ³, 526 ± 114 mm ³, 648 ± 150 mm ³, 808 ± 181mm ³, and 794 ± 145 mm ³, which were smaller than 1031 ± 126 mm ³ of the control group mice. Different treatment groups showed different treatment results. In particular, mice treated with axatilimab analog (G3) showed significant (P ＜0.05) inhibitory effect of tumor growth. The experimental results indicate that the CSF 1/CSF 1R double-gene humanized homozygous mice prepared by the method described herein can be used for the development and screening of drugs (e.g., antibody drugs) targeting human CSF1R.

OTHER EMBODIMENTS

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

A genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric colony stimulating factor 1 receptor (CSF1R) .
The animal of claim 1, wherein the sequence encoding the human or chimeric CSF1R is operably linked to an endogenous regulatory element at the endogenous CSF1R gene locus in the at least one chromosome.
The animal of claim 1 or 2, wherein the sequence encoding the human or chimeric CSF1R comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to human CSF1R (NP_005202.2; SEQ ID NO: 35) .
The animal of claim 1 or 2, wherein the sequence encoding a human or chimeric CSF1R comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 43.
The animal of claim 1 or 2, wherein the sequence encoding a human or chimeric CSF1R comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 20-517 of SEQ ID NO: 35.
The animal of any one of claims 1-5, wherein the animal is a mammal, e.g., a monkey, a rodent or a mouse.
The animal of any one of claims 1-6, wherein the animal is a mouse.
The animal of any one of claims 1-7, wherein the animal does not express endogenous CSF1R, or expresses a decreased level of endogenous CSF1R as compared to CSF1R expression level in a wild-type animal.
The animal of any one of claims 1-8, wherein the animal has one or more cells expressing human or chimeric CSF1R.
The animal of any one of claims 1-9, wherein the animal has one or more cells expressing human or chimeric CSF1R, and endogenous CSF1 or IL34 can bind to the expressed human or chimeric CSF1R.
The animal of any one of claims 1-9, wherein the animal has one or more cells expressing human or chimeric CSF1R, and human CSF1 or IL34 can bind to the expressed human or chimeric CSF1R.
A genetically-modified, non-human animal, wherein the genome of the animal comprises a replacement of a sequence encoding a region of endogenous CSF1R with a sequence encoding a corresponding region of human CSF1R at an endogenous CSF1R gene locus.
The animal of claim 12, wherein the sequence encoding the corresponding region of human CSF1R is operably linked to an endogenous regulatory element at the endogenous CSF1R locus, and one or more cells of the animal express a human or chimeric CSF1R.
The animal of claim 12 or 13, wherein the animal does not express endogenous CSF1R, or expresses a decreased level of endogenous CSF1R as compared to CSF1R expression level in a wild-type animal.
The animal of any one of claims 12-14, wherein the replaced sequence encodes the extracellular region of CSF1R.
The animal of any one of claims 12-15, wherein the animal has one or more cells expressing a chimeric CSF1R having an extracellular region, wherein the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, or 99%identical to the extracellular region of human CSF1R.
The animal of claim 16, wherein the extracellular region of the chimeric CSF1R has a sequence that has at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 498 contiguous amino acids that are identical to a contiguous sequence present in the extracellular region of human CSF1R.
The animal of any one of claims 12-17, wherein the animal is a mouse, and the replaced endogenous CSF1R region is a portion of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and/or a portion of exon 11 of the endogenous mouse CSF1R gene.
The animal of any one of claims 12-18, wherein the animal is heterozygous with respect to the replacement at the endogenous CSF1R gene locus.
The animal of any one of claims 12-18, wherein the animal is homozygous with respect to the replacement at the endogenous CSF1R gene locus.
A method for making a genetically-modified, non-human animal, comprising:

replacing in at least one cell of the animal, at an endogenous CSF1R gene locus, a sequence encoding a region of an endogenous CSF1R with a sequence encoding a corresponding region of human CSF1R.
The method of claim 21, wherein the sequence encoding the corresponding region of human CSF1R comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22, or a part thereof, of a human CSF1R gene.
The method of claim 21 or 22, wherein the sequence encoding the corresponding region of human CSF1R comprises a portion of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and/or a portion of exon 11 of a human CSF1R gene.
The method of any one of claims 21-23, wherein the sequence encoding the corresponding region of human CSF1R comprises at least 30, 50, 100, 200, or 300 nucleotides of exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, and/or exon 11 of a human CSF1R gene.
The method of any one of claims 21-24, wherein the sequence encoding the corresponding region of human CSF1R encodes a sequence that is at least 90%identical to SEQ ID NO: 43.
The method of any one of claims 21-25, wherein the locus is located at the extracellular region of CSF1R.
The method of any one of claims 21-26, wherein the locus comprises a sequence encodes the extracellular region of CSF1R.
The method of any one of claims 21-27, wherein the sequence encoding a region of an endogenous CSF1R comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, exon 20, exon 21, and/or exon 22, or a part thereof, of the endogenous CSF1R gene.
The method of claim 28, wherein the animal is a mouse, and the sequence encoding a region of an endogenous CSF1R comprises a portion of exon 3, exon 4, exon 5, exons 6, exon 7, exon 8, exon 9, exon 10, and/or a portion of exon 11 of the mouse CSF1R gene.
A non-human animal comprising at least one cell comprising a nucleotide sequence encoding a chimeric CSF1R polypeptide, wherein the chimeric CSF1R polypeptide comprises at least 50 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human CSF1R, wherein the animal expresses the chimeric CSF1R polypeptide.
The animal of claim 30, wherein the chimeric CSF1R polypeptide has at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human CSF1R extracellular region.
The animal of claim 30 or 31, wherein the chimeric CSF1R polypeptide comprises a sequence that is at least 90%, 95%, or 99%identical of SEQ ID NO: 43.
The animal of any one of claims 30-32, wherein the nucleotide sequence is operably linked to an endogenous CSF1R regulatory element of the animal.
The animal of any one of claims 30-33, wherein the nucleotide sequence is integrated to an endogenous CSF1R gene locus of the animal.
The animal of any one of claims 30-34, wherein the chimeric CSF1R polypeptide has at least one mouse CSF1R activity and/or at least one human CSF1R activity.
A method of making a genetically-modified non-human animal cell that expresses a chimeric CSF1R, the method comprising:

replacing, at an endogenous mouse CSF1R gene locus, a nucleotide sequence encoding a region of endogenous CSF1R with a nucleotide sequence encoding a corresponding region of human CSF1R, thereby generating a genetically-modified non-human animal cell that includes a nucleotide sequence that encodes the chimeric CSF1R, wherein the cell expresses the chimeric CSF1R.
The method of claim 36, wherein the animal is a mouse.
The method of claim 36 or 37, wherein the chimeric CSF1R comprises:

an extracellular region of human CSF1R;

a transmembrane region of endogenous CSF1R; and/or

a cytoplasmic region of endogenous CSF1R.
The method of any one of claims 36-38, wherein the nucleotide sequence encoding the chimeric CSF1R is operably linked to an endogenous CSF1R regulatory region, e.g., promoter.
The animal of any one of claims 1-20 and 30-35, wherein the animal further comprises a sequence encoding an additional human or chimeric protein (e.g., colony stimulating factor 1 (CSF1) , programmed cell death protein 1 (PD-1) , programmed cell death 1 ligand 1 (PD-L1) , IL6, IL3, IL15, colony stimulating factor 2 (CSF2) , thyroid peroxidase (TPO) , or CD40) .
The animal of claim 40, wherein the additional human or chimeric protein is CSF1.
The method of any one of claims 21-29 and 36-39, wherein the animal further comprises a sequence encoding an additional human or chimeric protein (e.g., CSF1, PD-1, PD-L1, IL6, IL3, IL15, CSF2, TPO, or CD40) .
The method of claim 42, wherein the additional human or chimeric protein is CSF1.
A genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric CSF1.
The animal of claim 44, wherein the sequence encoding the human or chimeric CSF1 is operably linked to an endogenous regulatory element at the endogenous CSF1 gene locus in the at least one chromosome.
The animal of claim 44 or 45, wherein the sequence encoding a human or chimeric CSF1 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to amino acids 38-554 or 1-554 of human CSF1 (NP_000748.4; SEQ ID NO: 2) .
The animal of claim 44 or 45, wherein the animal comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 10.
The animal of any one of claims 44-47, wherein the animal is a mammal, e.g., a monkey, a rodent or a mouse.
The animal of any one of claims 44-48, wherein the animal is a mouse.
The animal of any one of claims 44-49, wherein the animal does not express endogenous CSF1, or expresses a decreased level of endogenous CSF1 as compared to CSF1 expression level in a wild-type animal.
The animal of any one of claims 44-50, wherein the animal has one or more cells expressing human CSF1.
The animal of any one of claims 44-51, wherein the animal has one or more cells expressing human or chimeric CSF1, and the expressed human or chimeric CSF1 can bind to endogenous CSF1R.
The animal of any one of claims 44-51, wherein the animal has one or more cells expressing human or chimeric CSF1, and the expressed human or chimeric CSF1 can bind to human CSF1R.
A genetically-modified, non-human animal, wherein the genome of the animal comprises a replacement of a sequence encoding a region of endogenous CSF1 with a sequence encoding a corresponding region of human CSF1 at an endogenous CSF1 gene locus.
The animal of claim 54, wherein the sequence encoding the corresponding region of human CSF1 is operably linked to an endogenous regulatory element at the endogenous CSF1 locus, and one or more cells of the animal expresses a chimeric or human CSF1.
The animal of claim 54 or 55, wherein the animal does not express endogenous CSF1, or expresses a decreased level of endogenous CSF1 as compared to CSF1 expression level in a wild-type animal.
The animal of any one of claims 54-56, wherein the replaced locus comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%identical to SEQ ID NO: 10.
The animal of claim any one of claims 54-57, wherein the animal is a mouse, and the replaced endogenous CSF1 region is a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and/or a portion of exon 8 of the endogenous mouse CSF1 gene.
The animal of any one of claims 54-58, wherein the animal is heterozygous with respect to the replacement at the endogenous CSF1 gene locus.
The animal of any one of claims 54-58, wherein the animal is homozygous with respect to the replacement at the endogenous CSF1 gene locus.
A method for making a genetically-modified, non-human animal, comprising:

replacing in at least one cell of the animal, at an endogenous CSF1 gene locus, a sequence encoding a region of an endogenous CSF1 with a sequence encoding a corresponding region of human CSF1.
The method of claim 61, wherein the sequence encoding the corresponding region of human CSF1 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9, or a part thereof, of a human CSF1 gene.
The method of claim 61 or 62, wherein the sequence encoding the corresponding region of human CSF1 comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and/or a portion of exon 8 of a human CSF1 gene.
The method of any one of claims 61-63, wherein the sequence encoding the corresponding region of CSF1 comprises at least 30, 50, 100, 200, or 300 nucleotides of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and/or exon 8 of a human CSF1 gene.
The method of any one of claim 61-64, wherein the sequence encoding the corresponding region of human CSF1 encodes a sequence that is at least 90%identical to SEQ ID NO: 10.
The method of any one of claims 61-65, wherein the sequence encoding a region of an endogenous CSF1 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9, or a part thereof, of the endogenous CSF1 gene.
The method of claim 66, wherein the animal is a mouse, and the sequence encoding a region of an endogenous CSF1 comprises a portion of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and a portion of exon 8 of the mouse CSF1 gene.
A non-human animal comprising at least one cell comprising a nucleotide sequence encoding a human or chimeric CSF1 polypeptide, wherein the human or chimeric CSF1 polypeptide comprises at least 50 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human CSF1, wherein the animal expresses the human or chimeric CSF1 polypeptide.
The animal of claim 68, wherein the human or chimeric CSF1 polypeptide has at least 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, or 517 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a haman CSF1.
The animal of claim 68 or 69, wherein the human or chimeric CSF1 polypeptide comprises a sequence that is at least 90%, 95%, or 99%identical of SEQ ID NO: 10.
The animal of any one of claims 68-70, wherein the nucleotide sequence is operably linked to an endogenous CSF1 regulatory element of the animal.
The animal of any one of claims 68-71, wherein the nucleotide sequence is integrated to an endogenous CSF1 gene locus of the animal.
The animal of any one of claims 68-72, wherein the non-human animal comprises at least one cell comprising a nucleotide sequence encoding a chimeric CSF1 polypeptide, and the chimeric CSF1 polypeptide has at least one mouse CSF1 activity and/or at least one human CSF1 activity.
A method of making a genetically-modified non-human animal cell that expresses a human or chimeric CSF1, the method comprising:

replacing, at an endogenous mouse CSF1 gene locus, a nucleotide sequence encoding a region of endogenous CSF1 with a nucleotide sequence encoding a corresponding region of human CSF1, thereby generating a genetically-modified non-human animal cell that includes a nucleotide sequence that encodes the human or chimeric CSF1, wherein the cell expresses the human or chimeric CSF1.
The method of claim 74, wherein the animal is a mouse.
The method of claim 74 or 75, wherein the nucleotide sequence encoding the human or chimeric CSF1 is operably linked to an endogenous CSF1 regulatory region, e.g., promoter.
The animal of any one of claims 44-60 and 68-73, wherein the animal further comprises a sequence encoding an additional human or chimeric protein (e.g., colony stimulating factor 1 receptor (CSF1R) , programmed cell death protein 1 (PD-1) , programmed cell death 1 ligand 1 (PD-L1) , IL6, IL3, IL15, colony stimulating factor 2 (CSF2) , thyroid peroxidase (TPO) , or CD40) .
The animal of claim 77, wherein the additional human or chimeric protein is CSF1R.
The method of any one of claims 61-67, 74-76, wherein the animal further comprises a sequence encoding an additional human or chimeric protein (e.g., CSF1R, PD-1, PD-L1, IL6, IL3, IL15, CSF2, TPO, or CD40) .
The method of claim 79, wherein the additional human or chimeric protein is CSF1R.
A method of determining effectiveness of an CSF1/CSF1R pathway modulator for treating an immune disorder, comprising:

administering the CSF1/CSF1R pathway modulator to the animal of any one of claims 1-20, 30-35, 40, 41, 44-60, 68-73, 77, and 78, wherein the animal has an immune disorder; and

determining the effects of the CSF1/CSF1R pathway modulator.
The method of claim 81, wherein the CSF1/CSF1R pathway modulator is an anti-human CSF1 antibody.
The method of claim 81, wherein the CSF1/CSF1R pathway modulator is an anti-human CSF1R antibody.
The method of any one of claims 81-83, wherein the immune disorder is allergy, asthma, myocarditis, nephritis, hepatitis, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative Colitis, autoimmune liver disease, diabetes, pain or neurological disorders.
A method of determining effectiveness of an CSF1/CSF1R pathway modulator for reducing inflammation, comprising:

administering the CSF1/CSF1R pathway modulator to the animal of any one of claims 1-20, 30-35, 40, 41, 44-60, 68-73, 77, and 78, wherein the animal has an inflammation; and

determining the effects of the CSF1/CSF1R pathway modulator.
A method of determining effectiveness of an CSF1/CSF1R pathway modulator for treating cancer, comprising:

administering the CSF1/CSF1R pathway modulator to the animal of any one of claims 1-20, 30-35, 40, 41, 44-60, 68-73, 77, and 78, wherein the animal has a cancer; and

determining the effects of the CSF1/CSF1R pathway modulator.
The method of claim 86, wherein the cancer is breast cancer, ovarian cancer, endometrial cancer, melanoma, kidney cancer, lung cancer, or liver cancer.
A method of determining effectiveness of an CSF1/CSF1R pathway modulator for treating an infectious disease, comprising:

administering the CSF1/CSF1R pathway modulator to the animal of any one of claims 1-20, 30-35, 40, 41, 44-60, 68-73, 77, and 78, wherein the animal has an infectious disease; and

determining the effects of the CSF1/CSF1R pathway modulator.
A method of determining toxicity of an anti-CSF1R antibody or an anti-CSF1 antibody, the method comprising

administering the anti-CSF1R antibody or the anti-CSF1 antibody to the animal of any one of claims 1-20, 30-35, 40, 41, 44-60, 68-73, 77, and 78; and

determining weight change of the animal.
The method of claim 89, wherein the method further comprises performing a blood test (e.g., determining red blood cell count) .
A protein comprising an amino acid sequence, wherein the amino acid sequence is one of the following:

(a) an amino acid sequence set forth in SEQ ID NO: 1, 2, 10, 34, 35, or 43;

(b) an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 1, 2, 10, 34, 35, or 43;

(c) an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 1, 2, 10, 34, 35, or 43 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid; and

(d) an amino acid sequence that comprises a substitution, a deletion and/or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 1, 2, 10, 34, 35, or 43.
A nucleic acid comprising a nucleotide sequence, wherein the nucleotide sequence is one of the following:

(a) a sequence that encodes the protein of claim 91;

(b) SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 36, 37, 38, 39, 40, 41, or 42; or

(c) a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 36, 37, 38, 39, 40, 41, or 42.
A cell comprising the protein of claim 91 and/or the nucleic acid of claim 92.
An animal comprising the protein of claim 91 and/or the nucleic acid of claim 92.