WO2021262744A1

WO2021262744A1 - Kits and methods for isothermally amplifying ribonucleic acid of severe acute respiratory virus cov2

Info

Publication number: WO2021262744A1
Application number: PCT/US2021/038523
Authority: WO
Inventors: Erin K. HEINIGER
Original assignee: University Of Washington
Priority date: 2020-06-26
Filing date: 2021-06-22
Publication date: 2021-12-30

Abstract

Kits and methods are described for isothermally amplifying ribonucleic acid (RNA) of severe acute respiratory virus CoV2 (SARS-CoV2). In an embodiment, the kit comprises a reverse extension primer and a reverse bumper primer complementary to a SARS-CoV2 RNA molecule; and a forward extension primer and a forward bumper primer complementary to cDNA of the SARS-CoV2 RNA molecule. In an embodiment, the kits and methods for suitable for performing isothermal nucleic acid amplification reactions, such as isothermal strand displacement amplification reactions.

Description

KITS AND METHODS FOR ISOTHERMAUUY AMPUIFYING RIBONUCFEIC ACID

OF SEVERE ACUTE RESPIRATORY VIRUS COV2

CROSS-REFERENCE TO RELATED APPLICATION The present application claims the benefit of co-pending U.S. Provisional Patent

Application No. 63/044,983, filed on June 26, 2020, the content of which is incorporated herein by reference in its entirety.

STATEMENT OF GOVERNMENT LICENSE RIGHTS This invention was made with government support under Grant No. R61 AI147354, awarded by the National Institutes of Health. The government has certain rights in the invention.

BACKGROUND Testing of samples for severe acute respiratory virus CoV2 (SARS-CoV2) is important in containing and studying this virus. Many existing assays lack adequate accuracy and specificity. Additionally, many such assays are not compatible with isothermal nucleic acid amplification. Accordingly, there is presently a need for accurate and specific assays for isothermal amplification of samples from individuals having or thought to have SARS CoV2.

SUMMARY

This summary is provided to introduce a selection of concepts in a simplified form that are further described below in the Detailed Description. This summary is not intended to identify key features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter.

In an aspect, the present disclosure provides a kit for isothermally amplifying RNA of SARS-CoV2. In an embodiment, the kit comprises a reverse extension primer and a reverse bumper primer complementary to a SARS-CoV2 RNA molecule; and a forward extension primer and a forward bumper primer complementary to cDNA of the SARS- CoV2 RNA molecule.

In another aspect, the present disclosure provides methods for isothermally amplifying RNA of SARS -Co V2. In an embodiment, the methods include use of the kits of the present disclosure. In an embodiment, the method comprises contacting a sample having or suspected of having SARS-CoV2 RNA with the forward extension primer, the reverse extension; the forward bumper primer; and the reverse bumper primer of a kit according to any embodiment of the present disclosure; and isothermally amplifying any SARS-CoV2 RNA in the sample.

DESCRIPTION OF THE DRAWINGS

The foregoing aspects and many of the attendant advantages of the claimed subject matter will become more readily appreciated as the same become better understood by reference to the following detailed description, when taken in conjunction with the accompanying drawings, wherein:

FIGURE 1 is an image of a gel containing amplicons of a sample containing SARS- CoV2 RNA amplified using a kit, according to an embodiment of the present disclosure;

FIGURE 2 is an image of a gel containing amplicons of a sample containing SARS- CoV2 RNA amplified using a kit, according to an embodiment of the present disclosure;

FIGURE 3 is an image of a gel containing amplicons of a sample containing Human DNA amplified using a kit, according to an embodiment of the present disclosure;

FIGURE 4 illustrates average fluorescence over time for n=3 reactions using (real time) RT- isothermal strand displacement amplification (iSDA) amplification of the COVID N gene with an AP593 Pleiades hybridization probe, according to embodiments of the present disclosure, at a variety of RNA concentrations, demonstrating a limit of detection (LOD) for this assay of approximately 2000 copies;

FIGURES 5A and 5B illustrate amplification of human POP7 gene using iSDA amplification with either the NEB intercalating dye (green FAM channel, 5A) or Syto82 (orange HEX channel, 5B), where the assays contain at least 200 copies of human genomic DNA lift off before 30 minutes for both dye conditions and lift off after 30 minutes occurs in the NTC condition, and all curves are an average of n=2; and

FIGURE 6 illustrates RT iSDA amplification of SARS CoV2 ORFlab gene using a kit according to an embodiment of the present disclosure, where fluorescence was generated using a hybridization probe. DETAILED DESCRIPTION

Generally, the present disclosure provides methods and kits for the isothermal amplification and detection, such as without denaturation, of double stranded nucleic acid targets for polymerase strand displacement amplification (iSDA). The methods and compositions disclosed are highly specific for nucleic acid targets with high sensitivity, specificity, and speed that allow detection of clinically relevant target levels. The methods and compositions can easily be used to amplify or detect nucleic acid targets in biological samples.

In particular embodiments, the present disclosure provides kits and methods for amplifying ribonucleic acid (RNA) of severe acute respiratory virus CoV2 (SARS-CoV2). In an embodiment, the kits and methods of the present disclosure are suitable for isothermally amplifying RNA of SARS-CoV2, such as through iSDA reactions.

In certain embodiments, iSDA reactions can achieve >10⁹-fold amplification of the target sequence in <20 minutes at 49 °C, which makes it one of the fastest existing isothermal DNA amplification methods. iSDA initiates at sites where DNA base pairs spontaneously open or transiently convert into Hoogsteen pairs, i.e. "breathe", and proceeds to exponential amplification by repeated nicking, extension, and displacement of single strands.

As used herein, the term “isothermal strand displacement amplification” (“iSDA”) refers to primer extension using a primer that comprises a 5’ sequence segment non complementary to a target nucleic acid sequence, wherein said tail may further comprise a nicking enzyme specific sequence and a 3 ’ sequence segment complementary to the target nucleic acid sequence.

As used herein, the terms “oligonucleotide,” “nucleic acid,” and “polynucleotide” are used interchangeably herein. These terms refer to a compound comprising nucleic acid, nucleotide, or its polymer in either single- or double-stranded form, e.g., DNA, RNA, analogs of natural nucleotides, and hybrids thereof. The terms encompass polymers containing modified or non- naturally-occurring nucleotides, or to any other type of polymer capable of stable base-pairing to DNA or RNA including, but not limited to, peptide nucleic acids as described in Nielsen et ah, Science, 254: 1497-1500 (1991), bicyclo DNA oligomers as described in Bolli et ah, Nucleic Acids Res., 24:4660-4667 (1996), and related structures. Unless otherwise limited, the terms encompass known analogs of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally-occurring nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, and peptide-nucleic acids (PNAs).

As used herein, the term “Nicking Enzyme (or nicking endonuclease)” describes an enzyme that cuts one strand of a double-stranded DNA at a specifically recognized nucleotide sequence known as a nicking site. Such enzymes hydrolyse (cut) only one strand of the DNA duplex, to produce DNA molecules that are “nicked”, rather than cleaved. These nicking enzymes include N.Alw I, Nb.BbvCl, NLBbvCl, Nb.BsmI, NLBsmAI, NtBspQI, Nb.BsrDI, NtBstNBI, Nb.BstsCI, NtCviPII, Nb.BpulOI, NLBpulOI and Nt.Bst9I, which are commercially available from www.neb.com, www.fermentas.com and www.sibenzyme.com, respectively. The New England Biolabs REBASE website (rebase.neb.com/cgi- bin/azlist?nick) lists 917 nicking enzymes. Designing of artificial nicking endonucleases on the basis of restriction endonucleases was reviewed by Zheleznaya et ah, Biochemistry (Mosc). 74: 1457-66 (2009), incorporated by reference. “Nicking Enzyme” also includes engineered enzymes that cut one strand of a double stranded DNA for example zinc finger nucleases.

In certain embodiment, the kits and methods described herein utilize primer oligonucleotides that allow primer extension without denaturation of nucleic acid targets. In one embodiment modified bases are used to limit primer self-association.

KITS

In an aspect, the present disclosure provides a kit for isothermally amplifying RNA of SARS-CoV2. In an embodiment, the kit comprises a reverse extension primer and a reverse bumper primer at least partially complementary to a SARS-CoV2 RNA molecule; and a forward extension primer and a forward bumper primer at least partially complementary to cDNA of the SARS-CoV2 RNA molecule. Such primers are discussed further herein with respect to the examples of the present disclosure.

As discussed, such primers are suitable for amplifying RNA molecules of or associated with SARS-CoV2. Such RNA molecules can include those transcribed from one or more SARS-CoV2 genes including but not limited to the CoV2-N gene, and CoV2- ORFlab. In an embodiment, the kits are suitable for performing the methods of the present disclosure as shown in the Examples and FIGURES described further herein. As above, the primers of the present disclosure are suitable or otherwise configured to amplify a SARS CoV2 gene, such as through iSDA reactions. Accordingly, in an embodiment, the extension primers include a nicking enzyme occupation sequence, a nicking enzyme recognition and cleavage sequence, and a target hybridization sequence. In an embodiment, the nicking enzyme occupation sequence is configured to reversibly couple with a nicking enzyme, thereby placing the nicking enzyme in a position to break or nick a portion of the nucleic acid molecule, such as including the nicking enzyme recognition sequence. In an embodiment, the nicking enzyme occupation sequence is not complementary with the SARS CoV2 nucleic acid molecule. In an embodiment, the nicking enzyme recognition occupation sequence has a length in a range of about 10 nucleotides to about 25 nucleotides. In an embodiment, the particular sequence of the nicking enzyme occupation sequence does not affect occupation or coupling to the nicking enzyme occupation sequence and, accordingly, the nicking enzyme occupation sequence can be essentially any nucleic acid sequence having a length suitable for coupling to a nicking enzyme.

In an embodiment, the nicking enzyme recognition site is of a size and has a sequence suitable or otherwise configured to selectively bind with a nicking enzyme. In an embodiment, the nicking enzyme has a sequence configured to be nicked or cleaved by the nicking enzyme, such as a sequence according to SEQ ID NO. 41.

In an embodiment, the target hybridization sequence has a sequence configured to couple with, such as through Watson-Crick base pairing, a target sequence of the SARS CoV2 gene. As discussed further herein, such SARS CoV2 genes include, but are not limited to, the N region of the CoV2 genomic RNA molecule (such as according to accession number MT044257, version MT044257.1, nucleotides 266 through 21555 and/or SEQ ID NO. 25) or ORFlab region of the CoV2 genomic RNA molecule (such as according to accession number MT044257, version MT044257.1, nucleotides 28274 through 29533 and/or SEQ ID NO. 26). In an embodiment, the target hybridization sequence is suitable or otherwise configured to bind with a target sequence of a control gene, such as a human POP7 gene (such as according to accession number GCF_000001405.39 and/or SEQ ID NO. 27)

In an embodiment, the kits of the present disclosure include primers suitable or otherwise configured to amplify a SARS-CoV2 RNA molecule is all or a portion of the N region of the CoV2 genomic RNA molecule, such as according to accession number MT044257, version MT044257.1, nucleotides 266 through 21555 and/or SEQ ID NO. 25. In an embodiment, the forward extension primer comprises a nucleic acid sequence CCTTCATTCTTGTCAGGCCTCAGCGATGAAACTCAAGCC (SEQ ID NO.l); the reverse extension primer comprises a nucleic acid sequence

CCGTCACATCATTCACATCCTCAGCCACTGCTCATGGATT (SEQ ID NO.3); the forward bumper primer comprises a nucleic acid sequence ACATTCCCACCAACAG (SEQ ID NO. 2); and the reverse bumper primer comprises a nucleic acid sequence TGGTCTGCATGAGTTTAG (SEQ ID NO. 4). In an embodiment, the forward extension primer comprises a nucleic acid sequence

CAAAATAACGTAACCGGACCTCAGCACTCAAGCCTTACCGCA (SEQ ID NO. 30); the reverse extension primer comprises a nucleic acid sequence

CAAAATAACGAAAGCGAACCTCAGCCAGCAGGAAGAAGAGTCACA (SEQ ID NO. 29); the forward bumper primer comprises a nucleic acid sequence CTGAATAAGCATATTGACGCATAC (SEQ ID NO.34); and the reverse bumper primer comprises a nucleic acid sequence AATTGTTTGGAGAAATCATCCA (SEQ ID NO. 28).

In an embodiment, the kits of the present disclosure are suitable to amplify a SARS- CoV2 RNA molecule including all or a portion of the ORF lab region of the CoV2 genomic RNA molecule, such as according to accession number MT044257, version MT044257.1, nucleotides 28274 through 29533 and/or SEQ ID NO. 26. In an embodiment, the forward extension primer comprises a nucleic acid sequence

CCTTCATTCTTGTCCGTTCACCTCAGCTGTTT (SEQ ID NO. 6); the reverse extension primer comprises a nucleic acid sequence

CCGTCACATCAATCACATCCTCAGCAAAGACCGTTAAGTGTA (SEQ ID NO.7); the forward bumper primer comprises a nucleic acid sequence

TACCAACCACCACAAAC (SEQ ID NO. 8); and the reverse bumper primer comprises a nucleic acid sequence GTCTTGGACAGTAAACTAC (SEQ ID NO. 9). In an embodiment, the forward extension primer comprises a nucleic acid sequence CCTTCATTCTTGTCCGTTCACCTCAGCTGTTT (SEQ ID NO. 6); the reverse extension primer comprising a nucleic acid sequence CCGTCACATCAATCACATCCTCAGCACCCTCAACTTTACCA (SEQ ID NO. 10); the forward bumper primer comprises a nucleic acid sequence

TACCAACCACCACAAAC (SEQ ID NO. 8); and the reverse bumper primer comprises a nucleic acid sequence CCGTTAAGTGTAGTTGT (SEQ ID NO. 11). In an embodiment, the kits of the present disclosure further include one or more control primers configured to amplify a gene or other nucleic acid molecule likely present in a sample, such as a human-derived sample, but not directly associated with SARS CoV2 itself or a SARS CoV2 infection. By amplifying such sample-associated genes or other nucleic acid molecules, the kits are suitable to provide evidence that the tested sample includes human or other sample-derived nucleic acid material. Accordingly, in an embodiment, the kit includes control primers suitable or otherwise configured to amplify a human POP7 gene, such as according to accession number GCF_000001405.39 and/or SEQ ID NO. 27.

In an embodiment, the control primers are suitable to amplify a target nucleic acid molecule through isothermal nucleic acid amplification reactions, such as according to the same or similar reaction conditions as the amplification reaction conditions as for the SARS CoV2 nucleic acid molecule. In an embodiment, the control primers comprise: a control forward extension primer comprising a nucleic acid sequence CCTTCATTCTTGTCCGACAAAGTGCTGAGGT (SEQ ID NO. 13); a control reverse extension primer comprising a nucleic acid sequence

CCGTCACATCAATCACATCCTCAGCGGGAAAGGGACGC (SEQ ID NO. 14); a control forward bumper primer comprising a nucleic acid sequence GCCTCGACCTTCCA (SEQ ID NO. 15); and a control reverse bumper primer comprising a nucleic acid sequence CCATGCTGTGTGCC (SEQ ID NO. 16). In an embodiment, the control primers comprise: a control forward extension primer comprising a nucleic acid sequence CCTTCATTCTTGTCCGACAAAGTGCTGAGGT (SEQ ID NO. 13); a control reverse extension primer comprising a nucleic acid sequence

CCGTCACATCAATCACATCCTCAGCGGGAAAGGGACGC (SEQ ID NO. 14); a control forward bumper primer comprising a nucleic acid sequence GCTCCAGTGATCCT (SEQ ID NO. 18); and a control reverse bumper primer comprising a nucleic acid sequence CCATGCTGTGTGCC (SEQ ID NO. 16). In an embodiment, the control primers comprise: a control forward extension primer comprising a nucleic acid sequence CCTTCATTCTTGTCCGACCTCAGCGCTATGTTGCCCAG (SEQ ID NO. 20); a control reverse extension primer comprising a nucleic acid sequence CCGTCACATCAATCACATGTAACCTCAGCACTTT (SEQ ID NO. 21); a control forward bumper primer comprising a nucleic acid sequence AGACAGGGTCTTGCT (SEQ ID NO. 22); and a control reverse bumper primer comprising a nucleic acid sequence GGGCAGTGGCTCAC (SEQ ID NO. 23). In an embodiment, the control primers comprise: a control forward extension primer comprising a nucleic acid sequence CGTGCATGCTTGTGCGAGTGCTGAGGTTACAGGCGT (SEQ ID NO. 32); a control reverse extension primer comprising a nucleic acid sequence CTGACTCTGCTTGCGCTGCCTCAGCCATGCTGTGTGCCCT (SEQ ID NO. 33); a control forward bumper primer comprising a nucleic acid sequence ATCCTCCCGCCTCGACCT (SEQ ID NO. 34); and a control reverse bumper primer comprising a nucleic acid sequence GGGCTCTCGGTTTTCT (SEQ ID NO. 35).

In an embodiment, the present disclosure provides a kit including one or more nucleic acid molecules at least 75% identical to the nucleic acid sequences of SEQ ID NOS. 1-4, 6-11, 13-16, 18, 20-23, and 28-35. As used herein “at least 75% identical” means that the nucleic acid differs in its full length nucleic acid sequence by 25% or less (including any nucleic acid substitutions, deletions, additions, or insertions) from the nucleic acid defined by SEQ ID NOS: 1-4, 6-11, 13-16, 18, 20-23, and 28-35.

In various preferred embodiment, the primer nucleic acid molecules comprise or consist of nucleic acid sequence at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to nucleic acid sequence according to any one of SEQ ID NOS: 1- 4, 6-11, 13-16, 18, 20-23, and 31-39. In a further embodiment the primer nucleic acid molecules comprise or consist of an amino acid sequence according to any one of SEQ ID NOS: 1-4, 6-11, 13-16, 18, 20-23, and 28-35.

In an embodiment, one or more of the primers of the present disclosure are lyophilized or otherwise dried. In an embodiment, one or more the primers of the present disclosure are disposed in a solvent, such as an aqueous solvent or buffer.

In an embodiment, the kits of the present disclosure include one or more reagents suitable for performing a nucleic acid amplification reaction, such as an iSDA nucleic acid amplification reaction. In an embodiment, the kit comprises a polymerase enzyme. In an embodiment, the polymerase enzyme is a Warmstart Bst 2.0 polymerase enzyme. In an embodiment, the kit includes a reverse transcriptase enzyme. In an embodiment, the polymerase enzyme is a Warmstart Reverse Transcriptase enzyme. In an embodiment, the kit includes a nicking enzyme, such as a nicking enzyme configured to nick or break a nicking sequence of a nucleic acid molecule. In an embodiment, the nicking enzyme is a Nt.BbvCl nicking enzyme.

In an embodiment, the kit includes a detectable agent configured to specifically associate with reaction products of the reactions of the present disclosure, such as an amplicon of the reactions described herein, and to provide a detectable signal. In an embodiment, such detectable agents include fluorescent probes, such as a fluorescent probe configured to specifically associate with an amplicon and generate a fluorescent signal when illuminated with light of an appropriate wavelength.

METHODS

In another aspect, the present disclosure provides method of amplifying SARS- CoV2 RNA. In an embodiment, the method includes contacting a sample having or suspected of having SARS-CoV2 RNA with a forward extension primer, a reverse extension primer; a forward bumper primer; and a reverse bumper primer of a kit according to any of embodiment of the present disclosure. In an embodiment, the sample is a biological sample from a subject suspected of having SARS CoV2 or suspected having come in contact with another having or suspect of having SARS CoV2.

As used herein, a “sample” as used herein refers to a sample of any source which is suspected of containing a target sequence, such as a SARS CoV2 nucleic acid molecule. These samples can be tested by the methods described herein. A sample can be from a laboratory source or from a non-laboratory source. A sample may be suspended or dissolved in liquid materials such as buffers, extractants, solvents, and the like. Samples also include biological samples such as plant, animal and human tissue or fluids such as whole blood, blood fractions, serum, plasma, cerebrospinal fluid, lymph fluids, milk, urine, various external secretions of the respiratory, intestinal, and genitourinary tracts, tears, and saliva; and biological fluids such as cell extracts, cell culture supernatants, fixed tissue specimens, and fixed cell specimens. Samples include nasopharyngeal or throat swabs, stools, wound or rectal swabs. Biological samples may also include sections of tissues such as biopsy and autopsy samples or frozen sections taken for histological purposes. A biological sample is obtained from any animal including, e.g., a human. A biological sample may include human and animal pathogens that includes microbes or microorganisms such as a viruses including SARS CoV2. The practice of the methods described herein will employ, unless otherwise indicated, conventional techniques in organic chemistry, biochemistry, oligonucleotide synthesis and modification, bioconjugate chemistry, nucleic acid hybridization, molecular biology, microbiology, genetics, recombinant DNA, and related fields as are within the skill of the art. These techniques are fully explained in the literature. See, for example, Sambrook, Fritsch & Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition, Cold Spring Harbor Laboratory Press (1989); Ausubel, et ah, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons (1987, 1988, 1989, 1990, 1991, 1992, 1993, 1994, 1995, 1996); Gait(ed.), OLIGONUCLEOTIDE SYNTHESIS: A PRACTICAL APPROACH, IRL Press (1984); and Eckstein (ed ), OLIGONUCLEOTIDES AND ANALOGUES: A PRACTICAL APPROACH, IRL Press (1991).

In an embodiment, the method further includes isothermally amplifying any SARS- CoV2 RNA in the sample, such as to provide one or more amplicon nucleic acid molecules. In an embodiment, isothermally amplifying any SARS CoV2 RNA molecules includes maintaining the sample and the primers under conditions and for a time sufficient to amplify any SARS CoV2 nucleic acid molecules present in the sample. In an embodiment, isothermally amplifying any SARS CoV2 RNA comprises maintaining the sample at a temperature in a range of about 49°C to about 51°C. In an embodiment, isothermally amplifying any SARS CoV2 RNA comprises maintaining under conditions suitable to amplify any SARS CoV2 nucleic acid molecules present in the sample for a reaction time in a range of about 25 minutes to about 60 minutes.

EXAMPLES EXAMPLE 1 : COV2 N ASSAY

The present Example provides experimental results of an iSDA amplification of a sample including the SARS CoV2 N gene. The sample was contacted with the primers of Table 1 and processed as described below. As shown in FIGURE 1, these primers generate observable amplicons, such as the CoV2-N amplicon exemplified below, with numbers of target SARS CoV2 N gene nucleic acid molecules in the sample as low as 1E2 copies.

Table 1: CoV2-N gene primers

* The nicking enzyme occupation sequence is in bold, the nicking enzyme recognition and cleavage site is in italics, and the target hybridization sequence is underlined.

CoV2-N amplicon (SEQ ID NO: 5) ACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGA

AGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACT

GTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCA

ACAATCCATGAGCAGTGCTGACTCAACTCAGGCCTAAACTCATGCAGACCA

Table 2: N gene assay reaction components

Amplicons from COVID N gene RT-iSDA assays were generated according to the above protocol. Reactions were incubated at 50°C for 27 minutes before dilution in loading buffer (Ambion), incubated at 95 °C to melt hybridized DNA strands, and run on a 15% TBE-Urea denaturing gel at 70°C. The gel was run for 45 minutes at 160V, then stained for 15 minutes with 2X SYBR Gold and imaged using a BioRad Geldoc. See FIGURE 1. Starting copies of template were as noted. "MecA" amplicons are shown as positive controls, and run at longer lengths than the N gene amplicons. No template control (NTC) reactions show "primer dimer" amplicons that are not target dependent.

Amplicons are observed in the 70-100 bp range (mecA amplicons are shown as positive controls) and appear to be dose-dependent, as more amplicons are observed from the reactions with 1E5 or 1E4 starting copies of RNA than for the reaction with 1E2 starting copies (Figure 1). No amplicons are observed in the 10-copy reaction, though the limit of detection for iSDA reactions often falls between 10 and 100 copies per reaction. EXAMPLE 2: COV2-ORF1AB ASSAY

The present Example provides experimental results of an iSDA amplification of a sample including the SARS CoV2-ORFlAB gene. The sample was contacted with the primers in Table 2 and processed as described below. As shown in FIGURE 2, these primers generate observable amplicons, such as the CoV2-ORFlab amplicon exemplified below, with numbers of target CoV2-ORFlab gene nucleic acid molecules in the sample as low as 1E5 copies.

Table 3: CoV2-ORFlab primers

* The nicking enzyme occupation sequence is in bold, the nicking enzyme recognition and cleavage site is in italics, and the target hybridization sequence is underlined. CoV2-ORFlab amplicon (SEQ ID NO: 12)

TACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGC AGAGTGGTTTTAGAAAAATGGCATTCCCATCTGGTAAAGTTGAGGGTTGT ATGGTACAAGTAACTTGTGG TACAACTACA CTTAACGG

Table 4: ORFlab assay reagents and concentrations

The results of amplification experiments shown in FIGURE 2. No amplicons are seen in the case of assay ORFlvl. However, amplicons are observed from the 1E5 starting copy condition for ORFlv2 with RNA from both the ATCC and Twist Biosciences. As these bands do not appear in the no template control (NTC) reactions, we conclude that they are SARS-CoV2 RNA dependent.

Amplicons from COVID ORFlab gene RT-iSDA assays were generated according to the above protocol, and fluorescently observed using a hybridization probe(AP593, “LQ” chemistry, developed and provided by ELITech). Reactions were incubated at 50°C for 27 minutes before dilution in loading buffer (Ambion), incubated at 90°C to melt hybridized DNA strands, and run on a 15% TBE-Urea denaturing gel at 70°C. The gel was run for 45 minutes at 160V, then stained for 15 minutes with 2X SYBR Gold and imaged using a BioRad Geldoc. See FIGURE 2. Starting copies of template were as noted. "ATCC" and "Twist" indicate the source of the purified RNA template used. "MRSA mecA" amplicons are shown as positive controls, and run at different lengths than the ORFlab gene amplicons. No template control (NTC) reactions show "primer dimer" amplicons that are not target dependent.

Human POP7 gene primers Assays with the ORFlab described elsewhere in the present Example were also performed with primers suitable to amplify Human POP7 genes. Such primers are suitable to show that the sample contained human genetic material.

Version 1 amplicon - POP7 (SEQ ID NO: 17) GCCTCGACCTTCCAAAGTGCTGAGGTTACAGGCGTGAGCCACTGCCCG

GCCAGGTGCACCCTTTGTACAGGAAAAGGGGTAGGAAAGGCTTCGAGGTCCC TCTGAGCCCTCTGATCGCGTCCCTTTCCCACGCCAGGGCACACAGCATGG

Table 6: Human POP7 gene primers - Version 2

5 Version 2 amplicon - POP7 (SEQ ID NO: 19)

GGCTCCAGTGATCCTCCCGCCTCGACCTTCCAAAGTGCTGAGGTTACA

GGCGTGAGCCACTGCCCGGCCAGGTGCACCCTTTGTACAGGAAAAGGGGTAG

GAAAGGCTTCGAGGTCCCTCTGAGCCCTCTGATCGCGTCCCTTTCCCACGCCA

GGGCACACAGCATGG 0

Version 3 amplicon - POP7 (SEQ ID NO: 24)

AGACAGGGTCTTGCTATGTTGCCCAGGCTGATCTCAAACACCCGGGCT

CCAGTGATCCTCCCGCCTCGACCTTCCAAAGTGCTGAGGTTACAGGCGTGAGC

CACTGCCC 0 Table 8: Human POP7 iSDA assay reagents and concentrations

Amplicons from Human POP7 gene iSDA assays were generated according to the above protocol. Reactions were incubated at 50°C for 45 minutes before dilution in loading buffer (Ambion), incubated at 90°C to melt hybridized DNA strands, and run on a 15% TBE-Urea denaturing gel at 70°C. The gel was run for 45 minutes at 160V, then stained 5 for 15 minutes with 2X SYBR Gold and imaged using a BioRad Geldoc. See FIGURE 3. Dilutions of human genomic DNA template were as noted. "ATCC" and "Twist" indicate the source of the purified RNA template used. "MRSA mecA" amplicons are shown as positive controls, and run at different lengths than the ORFlab gene amplicons. No template control (NTC) reactions show "primer dimer" amplicons that are not target 0 dependent. There appear to be template -dependent amplicons in all three versions of the assay. Version 3 appears to have a lower limit of detection than the other two versions of the assay.

EXAMPLE 3: COV2 N-GENE RT-ISDA The present Example demonstrates RT-iSDA amplification of a sample using primer sets according to an embodiment of the present disclosure.

Table 9: SARS-CoV2 Primer Set for RT-iSDA

Table 10: SARS-CoV2 RT-iSDA assay reagents and concentrations

RT-iSDA reagents were mixed as in the table above. After addition of synthetic CoV2 RNA (Twist Biosciences Cat# 103925, Control 2), the reactions were incubated at 50°C for 50 minutes and fluorescence was measured using a BioRAD CFX96. The results, summarized and illustrated in FIGURE 4, show a limit of detection of approximately 2E3.

It is believed that this assay and the primers of Table 9 are suitable to provide, for example, the following amplicon (SEQ ID NO: 35):

CTGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGAGCCT AAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGA CAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTT

CTCCAAACAATT

As a control, the same samples were assayed for the Human POP7 gene using the primers in the following Table. Table 11 : Human POP7 primers

The primers of Table 11, when contacted with a sample containing a Human POP7 gene for a time and under conditions sufficient for an iSDA amplification reaction, are suitable to provide the following amplicon:

ATCCTCCCGCCTCGACCTTCCAAAGTGCTGAGGTTACAGGCGTGAGCC ACTGCCCGGCCAGGTGCACCCTTTGTACAGGAAAAGGGGTAGGAAAGGCTTC GAGGTCCCTCTGAGCCCTCTGATCGCGTCCCTTTCCCACGCCAGGGCACACAG CATGGCAGAAAACCGAGAGCCC

Table 12: Human POP7 assay reagents and concentrations

Reagents were mixed as in the table above. After addition of purified human DNA (Promega, Cat #G3041), the reactions were incubated at 50°C for 50 minutes and fluorescence was measured using a BioRAD CFX96. The results of these assays are illustrated in FIGURES 5A and 5B.

As used herein, the singular forms “a”, “an” and “the” include plural referents unless the context clearly dictates otherwise. “And” as used herein is interchangeably used with “or” unless expressly stated otherwise.

All embodiments of any aspect of the invention can be used in combination, unless the context clearly dictates otherwise.

While illustrative embodiments have been illustrated and described, it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention.

Claims

The embodiments of the invention in which an exclusive property or privilege is claimed are defined as follows:

1. A kit for isothermally amplifying ribonucleic acid (RNA) of severe acute respiratory virus CoV2 (SARS-CoV2), the kit comprising: a reverse extension primer and a reverse bumper primer complementary to a SARS- CoV2 RNA molecule; and a forward extension primer and a forward bumper primer complementary to cDNA of the SARS-CoV2 RNA molecule.

2. The kit of Claim 1, wherein the SARS-CoV2 RNA molecule is all or a portion of the N region of the CoV2 genomic RNA molecule set forth in SEQ ID NO. 25.

3. The kit of Claim 2, wherein the forward extension primer comprises a nucleic acid sequence set forth in SEQ ID NO. 1; wherein the reverse extension primer comprises a nucleic acid sequence set forth in SEQ ID NO .3; wherein the forward bumper primer comprises a nucleic acid sequence set forth in SEQ ID NO. 2; and wherein the reverse bumper primer comprises a nucleic acid sequence set forth in SEQ ID NO. 4.

4. The kit of Claim 2, wherein the forward extension primer comprises a nucleic acid sequence set forth in SEQ ID NO. 30; wherein the reverse extension primer comprises a nucleic acid sequence set forth in SEQ ID NO. 29; wherein the forward bumper primer comprises a nucleic acid sequence set forth in SEQ ID NO. 31; and wherein the reverse bumper primer comprises a nucleic acid sequence SEQ ID NO.

28.

5. The kit of Claim 1, wherein the SARS-CoV2 RNA molecule is all or a portion of the ORFlab region of the CoV2 genomic RNA molecule set forth in SEQ ID NO. 26.

6. The kit of Claim 5, wherein the forward extension primer comprises a nucleic acid sequence set forth in SEQ ID NO. 6; wherein the reverse extension primer comprises a nucleic acid sequence SEQ ID

NO.7; wherein the forward bumper primer comprises a nucleic acid sequence SEQ ID NO. 8; and wherein the reverse bumper primer comprises a nucleic acid sequence SEQ ID

NO. 9.

7. The kit of Claim 5, wherein the forward extension primer comprises a nucleic acid sequence set forth in SEQ ID NO. 6; wherein the reverse extension primer comprising a nucleic acid sequence set forth in SEQ ID NO. 10; wherein the forward bumper primer comprises a nucleic acid sequence SEQ ID NO. 8; and wherein the reverse bumper primer comprises a nucleic acid sequence SEQ ID NO. 11.

8. The kit of Claim 1, wherein the forward extension primer comprises a nicking enzyme occupation sequence, a nicking enzyme recognition and cleavage site, and a target hybridization site.

9. The kit of Claim 1, wherein the reverse extension primer comprises a nicking enzyme occupation sequence, a nicking enzyme recognition and cleavage site, and a target hybridization site.

10. The kit of any of Claims 1-9, further comprising control primers configured to amplify all or a portion of a human POP7 gene set forth in SEQ ID NO. 27.

11. The kit of Claim 10, wherein the control primers comprise: a control forward extension primer comprising a nucleic acid sequence set forth in SEQ ID NO. 13 a control reverse extension primer comprising a nucleic acid sequence SEQ ID NO. 14; a control forward bumper primer comprising a nucleic acid sequence set forth in SEQ ID NO. 15; and a control reverse bumper primer comprising a nucleic acid sequence SEQ ID NO. 16.

12. The kit of Claim 10, wherein the control primers comprise: a control forward extension primer comprising a nucleic acid sequence set forth in SEQ ID NO. 13; a control reverse extension primer comprising a nucleic acid sequence set forth in SEQ ID NO. 14; a control forward bumper primer comprising a nucleic acid sequence set forth in SEQ ID NO. 18; and a control reverse bumper primer comprising a nucleic acid sequence set forth in SEQ ID NO. 16.

13. The kit of Claim 10, wherein the control primers comprise: a control forward extension primer comprising a nucleic acid sequence set forth in SEQ ID NO. 20; a control reverse extension primer comprising a nucleic acid sequence set forth in SEQ ID NO. 21; a control forward bumper primer comprising a nucleic acid sequence set forth in SEQ ID NO. 22; and a control reverse bumper primer comprising a nucleic acid sequence set forth in SEQ ID NO. 23.

14. The kit of Claim 10, wherein the control primers comprise: a control forward extension primer comprising a nucleic acid sequence set forth in SEQ ID NO. 32; a control reverse extension primer comprising a nucleic acid sequence set forth in SEQ ID NO. 33; a control forward bumper primer comprising a nucleic acid sequence set forth in SEQ ID NO. 34; and a control reverse bumper primer comprising a nucleic acid sequence set forth in SEQ ID NO. 35.

15. The kit according to any of Claims 1-14, further comprising a polymerase enzyme.

16. The kit according to any of Claims 1-15, further comprising a reverse transcriptase enzyme.

17. The kit according to any of Claims 1-16, further comprising a nicking enzyme.

18. A method of amplifying SARS-CoV2 RNA, the method comprising: contacting a sample having or suspected of having SARS-CoV2 RNA with the forward extension primer, the reverse extension; the forward bumper primer; and the reverse bumper primer of a kit according to any of Claims 1-18; and isothermally amplifying any SARS-CoV2 RNA in the sample.

19. The method of Claim 18, wherein isothermally amplifying any SARS CoV2 RNA comprises: maintaining the sample at a reaction temperature in a range of about 49°C to about

5 loC.

20. The method of Claim 18, wherein isothermally amplifying any SARS CoV2

RNA comprises: maintaining the sample at a reaction temperature for a reaction time in a range of about 25 minutes to about 60 minutes