WO2021260276A1

WO2021260276A1 - Methods and materials for determining parkinson's disease or a risk thereof

Info

Publication number: WO2021260276A1
Application number: PCT/FI2021/050499
Authority: WO
Inventors: Per Saris; Kari MURROS; Timo Takala; Vy Anh HUYNH
Original assignee: Helsingin Yliopisto
Priority date: 2020-06-26
Filing date: 2021-06-28
Publication date: 2021-12-30

Abstract

The present invention is directed to a method for determining or confirming Parkinson's disease or determining a risk of Parkinson's disease of a subject. The method comprises detecting the presence of Desulfovibrio species in a feces sample of a subject and optionally quantifying the amount of a detected Desulfovibrio species in said feces sample. The invention also provides a kit and a primer pair for use in said method. The present invention further provides an antibiotic for use in the treatment of Parkinson's disease or for use in decreasing the risk of Parkinson's disease in a subject, wherein the presence of a Desulfovibrio species is detected in a fecal sample taken from said subject and wherein said detected Desulfovibrio species is tested to be susceptible to said antibiotic. Another embodiment provided by the invention is a method for detecting the presence of one or more Desulfovibrio species in a biological sample utilizing a nucleic acid amplification reaction comprising an oligonucleotide primer pair amplifying a target sequence in periplasmic (FeFe) hydrogenase large subunit gene hydA of Desulfovibrio species.

Description

METHODS AND MATERIALS FOR DETERMINING PARKINSON’S DISEASE OR A RISK THEREOF

FIELD

[0001] The invention relates to methods for conducting nucleic acid amplification reactions, especially a polymerase chain reaction (PCR), and also to bacterial culture methods.

BACKGROUND

[0002] Parkinson’s disease (PD) is a complex neurodegenerative disease that involves the early loss of nerve cells in the substantia nigra, a part in the midbrain, resulting in movement disorder (Kalia & Lang, 2015). According to a research of Dorsey et al. (2018), 6.1 million people were diagnosed with PD in 2016 worldwide and the burden seems to have been increasing rapidly over time.

[0003] Although PD has been known for a long time and intensive studies on this subject have been carried out, the cause of the disease is still unidentified. Further, no prcclinical/prodromal stage diagnosis of PD is currently possible and biomarkers are generally lacking. Only years (even decades) after the onset of the disease, when the first motor symptoms arise, a clinical diagnosis is possible and still difficult. The failure of finding a strong biomarker mostly lies in the drastic heterogeneity of PD itself (Yilmaz et al, J. Neural Transmission 2019, 126:803-813). Genetic studies have revealed several mutations that enhance the risk of the disease in the population (Cheon, Chan, Chan, & Kim, 2012). For instance, the gene SCNA which encodes the a-synuclein protein was found to be related to the monogenic form of the disease (Polymeropoulos et al., 1997) or mutation in the GBA gene which encodes b-glucocerebrosidase is a genetic risk factor of PD (Sidransky & Lopez, 2012). However, genetics cannot be the only cause of the disease, since most of the cases (90%) are sporadic, not familial (Klein & Westenberger, 2012). Therefore, it is believed that the disease results from an interplay of genetic and environmental elements (Kalia & Lang, 2015).

[0004] As reviewed by Jackson et al. (2019), diet is a potential environmental factor that can affect the development and progression of PD via the alteration of the gut microbiota. Specifically, there is a rise of short chain fatty acid producing bacteria and a reduction of Gram-negative bacteria when having the Mediterranean diet, which is related to a lower risk of PD; while the evidence showed the contrary with the Western diet, which has a high risk of PD. Previously, the abnormally high levels of iron in the substantia nigra of patients with PD suggests that iron may contribute to the pathogenesis of the disease (Friedman, Friedman & Bauminger, 2007; Galazka-Friedman, Friedman & Bauminger, 2009). Interestingly, excess iron from human neurodegenerative tissues has been detected in the form of biogenic magnetite (Dobson, 2001; Kirschvink, Kobayashi-Kirschvink, & Woodford, 1992). Magnetite is a mineral with chemical formula Fe₃C>₄ and possesses magnetic properties.

[0005] Desulfovibrio ( DSV) is a genus of Gram-negative, anaerobic and sulfate- reducing bacteria. They are commonly found in soil, water, and sewage (Belila et ah, 2013; Dianou et ah, 1998; Korneeva, Pimenov, Krek, Tourova, & Bryukhanov, 2015). Besides being able to carry out the reduction of sulfate, they can also reduce Fe(III) which leads to the accumulation of magnetite (Lovley, Roden, Phillips, & Woodward, 1993). Desulfovibrio magneticus is uniquely classified as a magnetotactic bacterium with the ability to produce intracellular magnetite particles (Sakaguchi, Arakaki, & Matsunaga, 2002; Sakaguchi, Burgess, & Matsunaga, 1993).

[0006] Some DSV species have been isolated from human body and are associated with several infections and diseases. Specifically, Desulfovibrio desulfuricans and Desulfovibrio fairfieldensis can cause bacteremia (Goldstein, Citron, Peraino, & Cross, 2003; Hagiwara et al, 2014; Urata et al, 2008), and Desulfovibrio vulgaris has been isolated from an intra-abdominal abscess (Johnson & Finegold, 1987). Loubinoux and Bronowicki (2002) also evidenced the relation between Desulfovibrio species and inflammatory bowel disease with Desulfovibrio piger being the most prevalent one. Recently, the quantity of Desulfovibrio spp. were found to be larger in less sociable people (Johnson, 2020). This research was in accordance with other study showing the abundance of DSV spp. in children with autism (Finegold et al, 2010), which suggests that DSV spp. may be involved in the pathophysiology of autism (Finegold, 2011). To our knowledge, DSV species have not been shown to be associated with neurodegenerative diseases such as Alzheimer’s disease or PD.

[0007] There is thus still a need in the present field of technology to identify the causes of PD and for means to detect those individuals suffering from PD or with a higher risk of the disease (i.e. a disposition for developing PD). SUMMARY OF THE INVENTION

[0008] In the present invention, the inventors designed oligonucleotide primers for amplifying and detecting a [FeFe] hydrogenase gene of Desulfovibrio ( DSV) species, which encodes a periplasmic enzyme probably needed for the efficient accumulation of magnetite, and surprisingly found that the DSV bacteria are significantly more frequently present in feces of Parkinson patients compared to healthy controls. The inventors have thus discovered novel association between Desulfovibrio spp. and Parkinson’s disease which can be used for determination of PD or a risk thereof. The present invention further provides a bacterial cultivation based assay for a quick detection of hydrogen sulfide producing DSV bacteria with potential [FeFe] hydrogenase activity from a feces sample.

[0009] The invention is defined by the features of the independent claims. Some specific embodiments are defined in the dependent claims.

[0010] According to a first aspect of the present invention, there is provided a method for determining or confirming Parkinson’s disease or determining a risk of Parkinson’s disease of a subject, the method comprising detecting the presence of Desulfovibrio species in a feces sample of a subject and optionally quantifying the amount of a detected Desulfovibrio species in said feces sample.

[0011] According to a second aspect of the present invention, there is provided a kit for detecting the presence of a [FeFe] hydrogenase gene of Desulfovibrio species in a feces sample of a subject, the kit comprising an oligonucleotide primer pair amplifying a target sequence in a [FeFe] hydrogenase gene of Desulfovibrio species.

[0012] According to a third aspect of the present invention, there is provided a use of said kit for determining or confirming Parkinson’s disease or determining a risk of Parkinson’s disease of a subject. [0013] According to a fourth aspect of the present invention, there is provided a primer pair comprising

- a forward primer comprising at least 16 contiguous nucleotides of the following oligonucleotide:

5 ’-GAYGTSACCATHWKGGAAGA-3 ’ (SEQ ID NO: 1), wherein Y is thymine or cytosine, S is guanine or cytosine, H is adenine, cytosine or thymine, and W is adenine or thymine; and

- a reverse primer comprising at least 16 contiguous nucleotides of the following oligonucleotide: 5 ’-CAGGY CATRWMYTCGATGAA-3 ’ (SEQ ID NO:2), wherein Y is thymine or cytosine, R is guanine or adenine, W is adenine or thymine, and M is adenine or cytosine, wherein said primer pair amplifies a target sequence in a periplasmic [FeFe] hydrogenase large subunit gene hy IA of Desulfovibrio species. [0014] According to a fifth aspect of the present invention, there is provided a method for detecting the presence of one or more Desulfovibrio species in a biological sample, the method comprising the steps of: i) subjecting said sample or nucleic acids isolated therefrom to a nucleic acid amplification reaction comprising an oligonucleotide primer pair amplifying a target sequence in periplasmic [FeFe] hydrogenase large subunit gene hydA of Desulfovibrio species; ii) detecting the presence of an amplified target sequence in the reaction, wherein the presence of the target sequence is indicative of the presence of one or more Desulfovibrio species in the sample

[0015] According to a sixth aspect of the present invention, there is provided an antibiotic for use in the treatment of Parkinson’s disease or for use in decreasing the risk of Parkinson’s disease in a subject, wherein the presence of a Desulfovibrio species is detected in a fecal sample taken from said subject and wherein said detected Desulfovibrio species is tested to be susceptible to said antibiotic.

BRIEF DESCRIPTION OF THE DRAWINGS [0016] Figure 1. Agarose gel electrophoresis of PCR products obtained with the three positive Desulfovibrio ( DSV) control strains and five pairs of primers. Fane 1 : 100 bp DNA ladder marker; lane 2: negative control; lanes 3-7, D. desulfuricans MB; lanes 8-12, D. vulgaris, lanes 13-17, D. magneticus RS-1. The order of primer pairs specific to species (16S rDNA) from left to right was D. desulfuricans MB, D. vulgaris, D. magneticus RS-1, D. piger, and D. fairfieldensis, respectively. The vertical arrows indicate the PCR products that were specifically amplified from the positive control strains.

[0017] Figure 2 shows the distribution of DSV quantity in feces of PD patients and healthy individuals. The DSV amount of volunteers in each group is arranged from the highest to the lowest. Black bars indicate males and white bars indicate females.

[0018] Figure 3 illustrates results of qPCR quantification of DSV in feces of PD patients and healthy individuals. Values are the mean of each group and error bars indicate the standard deviation.

[0019] Figure 4 shows results of inoculation of PD (left tube) and healthy (right tube) feces in semi-solid Postgate medium. The samples were incubated anaerobically at 37°C for 3 days. The growth of DSV is indicated by the formation of FeS, which can easily be seen as a black precipitate in the tube on the left.

[0020] Figure 5 discloses a multiple sequence alignment of different Desulfovibrio hydA genes (SEQ ID NOS:22-29). Three pairs of primers targeting DSV hydA gene were designed from the regions indicated by grey frames. For Pair 1 (producing an amplicon of about 680 bp), forward Fe-primer was determined from the region corresponding to positions 448-467 ofD. magneticus hydA gene of SEQ ID NO:25 and reverse Fe-primer was designed from the region corresponding to positions 1114-1133 of D. magneticus hydA gene; For pair 2 (producing an amplicon of about 450 bp), forward primer was from the region corresponding to positions 682-701 of D. magneticus hydA gene and reverse primer from the region corresponding to positions 1114-1133 of D. magneticus hydA gene; and pair 3 (producing an amplicon of about 250 bp), forward primer from the region corresponding to positions 448-467 of D. magneticus hydA gene and reverse primer from the region corresponding to positions 682-701 of D. magneticus hydA gene. [0021] Figure 6 shows the results of antibiotic susceptibility test performed to a D. desulfuricans strain isolated from a feces sample of a PD patient. The underlined antibiotics had clear inhibitory effect against the isolate. EMBODIMENTS

[0022] As used herein, the term “PCR reaction”, "amplifying" or "amplification" refers generally to cycling polymerase-mediated exponential amplification of nucleic acids employing primers that hybridize to complementary strands, as described for example in Innis et al, PCR Protocols: A Guide to Methods and Applications, Academic Press (1990). An amplification product contains a sequence having sequence identity with a target sequence or its complement and can be detected, for example, by gel electrophoresis, an intercalating dye or a detection probe having specificity for a region of the target sequence or its complement. [0023] In the present context, the term “target sequence” refers to a nucleic acid segment preferably present in a periplasmic [FeFe] hydrogenase gene of Desulfovibrio species whose detection, quantitation, qualitative detection, or a combination thereof, is intended. For example, the target sequence can be in a periplasmic [FeFe] hydrogenase large subunit gene hyclA of Desulfovibrio species. Preferred target sequences (5 '->3') are disclosed, e.g., in Figure 5 (SEQ ID NO:22-29), wherein only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. Purification or isolation of a template molecule, if needed, for initiation of the amplification reaction can be conducted by methods known to those in the art. For example, isolation of the template can be achieved by using a commercially available purification kit or the like.

[0024] As used herein, the term “oligonucleotide”, or alternatively "primer" or “probe” refers to any polymer of two or more of nucleotides, nucleosides, nucleobases or related compounds used as a reagent in the DNA amplification methods. The oligonucleotide may be DNA and/or RNA and/or analogs thereof. Specific oligonucleotides of the present invention are described in more detail below. As used herein, an oligonucleotide can be virtually any length, limited only by its specific function in the DNA amplification reaction. Oligonucleotides of a defined sequence and chemical structure may be produced by techniques known to those of ordinary skill in the art, such as by chemical or biochemical synthesis, and by in vitro or in vivo expression from recombinant nucleic acid molecules, e.g., bacterial or viral vectors. Oligonucleotides may be modified in any way, as long as a given modification is compatible with the desired function of a given oligonucleotide. One of ordinary skill in the art can easily determine whether a given modification is suitable or desired for any given oligonucleotide of the present invention. Modifications include, but are not limited to base modifications, sugar modifications or backbone modification such as addition of 5’ tails. While design and sequence of oligonucleotides for the present invention depend on their function as described below, several variables must generally be taken into account. Among the most critical are: length, G/C content, melting temperature (Tm), Gibb free energy (G), specificity, self-complementarity and complementarity with other oligonucleotides in the system, polypyrimidine (T, C) or polypurine (A, G) stretches, and the 3'-end sequence. Controlling for these and other variables is a standard and well-known aspect of oligonucleotide design, and various computer programs are readily available to screen large numbers of potential oligonucleotides for optimal ones.

[0025] In the present invention, the inventors designed methods and materials which can be used for successful and specific detection of the presence of Desulfovibrio (DSV) species in human feces. The present invention provides at least the following ways to enumerate the amount of SC bacteria in human feces: 1) Indirect detection of DSV bacteria by measuring DNA levels of DSV species using a novel PCR method (Figure 2), 2) a color- based culture assay to detect the formation of iron sulfide in form of a black precipitate (Figure 4), or 3) a combination of the methods of 1) and 2). The present invention also provides kits and PCR primers for the performance of these methods.

[0026] The present invention is based on the discovery that Desulfovibrio bacteria ( DSV) and particularly their ability to influence production of magnetite in human gut can be related to pathogenesis of PD. Without wishing to be bound by a theory, the inventors postulate the following: DSV possess a periplasmic enzyme [FeFe] hydrogenase that can reduce Fe(III) to Fe(II). DSV also produce FFS, which reacts with Fe(III) to form Fe(II). Fe(II) reacts with ferrihydrite in ferritin protein to abiotically form magnetite. The produced magnetite can then be absorbed into the intestinal epithelial cells as part of nanoparticles by endocytosis. From there, the magnetic nanoparticles can enter the blood circulation, cross the blood-brain-barrier endocytically and are then engulfed by brain microglial cells. In the brain, the magnetic nanoparticles are possibly able to induce alpha-synuclein aggregation, and dopaminergic cells may be especially sensitive to alpha-synuclein aggregation resulting in cell death and loss of dopaminergic cells. In addition, magnetic nanoparticles may accumulate in the brain and create oxidative stress (OS), which damages the membrane of the brain endothelial cells by production of reactive oxygen species (ROS). In the intestine the DSV may negatively affect the brain via the vagus nerve, by the magnetic nanoparticles and hydrogen sulfide, which both can enter the alpha-synuclein containing entero-endocrine cells and cause alpha-synuclein oligomerization and aggregation (an essential part in the pathophysiology of PD). Due to the prion protein nature of alpha-synuclein aggregates, the aggregation of this protein can spread via the vagus nerve to the brain and reach the dopaminergic cells, which may be most sensitive to alpha-synuclein aggregation. Therefore, determination of DSV bacteria in patient feces can serve as a biomarker for PD and a risk thereof.

[0027] Accordingly, the present invention is directed to a method for determining or confirming Parkinson’s disease or determining a risk of Parkinson’s disease of a subject, the method comprising detecting the presence of Desulfovibrio species in a feces sample of a subject and optionally quantifying the amount of a detected Desulfovibrio species in said feces sample.

[0028] In a preferred embodiment, said detecting comprises the steps of: i) subjecting said feces sample or nucleic acids isolated therefrom to a nucleic acid amplification reaction comprising an oligonucleotide primer pair amplifying a target sequence in a [FeFe] hydrogenase gene of Desulfovibrio species; and ii) detecting the presence of an amplified target sequence in the reaction, wherein the presence of the amplified target sequence is indicative of the presence of a [FeFe] hydrogenase in the sample.

[0029] In a more preferred embodiment, said [FeFe] hydrogenase gene is periplasmic [FeFe] hydrogenase large subunit gene hydA of Desulfovibrio species.

[0030] In another preferred embodiment, said primer pair comprises primers recognizing and binding to the sequence of said periplasmic [FeFe] hydrogenase large subunit gene hydA. A person skilled in the art is aware that target sequences naturally vary in related species as shown in Figure 5. This variation can be taken into account, e.g., by designing degenerate primers (i.e. a mix of similar but not identical primers) suitable to amplify the target sequences from one or more Desulfovibrio species.

[0031] In another preferred embodiment, one of said primers comprises at least 16 contiguous nucleotides of the following oligonucleotide:

5 ’-GAYGTSACCATHWKGGAAGA-3 ’ (SEQ ID NO: 1), wherein Y is thymine or cytosine, S is guanine or cytosine, H is adenine, cytosine or thymine, and W is adenine or thymine.

[0032] In another preferred embodiment, one of said primers comprises at least 16 contiguous nucleotides of the following oligonucleotide: 5 ’-CAGGY CATRWMYTCGATGAA-3 ’ (SEQ ID NO:2), wherein Y is thymine or cytosine, R is guanine or adenine, W is adenine or thymine, and M is adenine or cytosine

[0033] In preferred embodiments of the invention, each primer of said primer pair is less than 25 nucleotides long, and more preferably, less than 30 nucleotides long. Each of the present primers can also be defined as comprising or consisting of at least 16, 17, 18, 19 or 20 contiguous nucleotides present in a primer sequence of SEQ ID NO: 1 or 2. Each of the present primers can further be defined as having at least 50 %, 60 %, 70 %, 80 %, 85 %, 90 % or 95 % sequence identity to a primer sequence of SEQ ID NO: 1 or 2. Two well- known examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1997) Nucleic Acids Res 25(17):3389-3402 and Altschul et al. (1990) J. Mol Biol 215(3)-403-410, respectively.

[0034] In another preferred embodiment, Desulfovibrio species detectable by the said method are selected from the group consisting of: D. ferrophilus, D. alaskensis, D. vulgaris, D. magneticus, D. carbinolicus, D. piger, D. fairfieldensis, and D. desulfuricans.

[0035] In an alternative preferred embodiment, said detecting comprises the steps of: i) inoculating said feces sample into or on a culture medium comprising a metal sulfate and a ferric or ferrous iron source such as a ferric or ferrous iron salt; and ii) incubating the inoculated culture medium under anaerobic conditions, wherein the formation of a brown or black color or precipitate due to the production of ferrous sulfide indicates the production of hydrogen sulfide in the sample. In said alternative embodiment, the culture medium can be liquid medium, solid medium, or a semi-solid medium. Culture media comprising essential nutritional ingredients for the growth of bacteria are well-known in the art. In an embodiment, the culture medium of the present invention comprises at least peptone and/or yeast extract to support the growth of bacteria, preferably the medium comprises the ingredients of Postgate medium (DSMZ 63). Said metal sulfate preferably comprises Na₂SC>₄ and/or MgS0₄ and said ferric or ferrous iron salt is preferably FeS0₄.

[0036] In another preferred embodiment, said detecting comprises the steps of: i) inoculating a first aliquot of said feces sample into or on a culture medium comprising a metal sulfate and a ferric or ferrous iron source such as a ferric or ferrous iron salt; ii) incubating the inoculated culture medium under anaerobic conditions, wherein the formation of a brown or black color or precipitate due to the production of ferrous sulfide indicates the production of hydrogen sulfide in the sample; iii) subjecting a second aliquot of said feces sample or nucleic acids isolated therefrom to a nucleic acid amplification reaction comprising an oligonucleotide primer pair amplifying a target sequence in a [FeFe] hydrogenase gene of Desulfovibrio species; and iv) detecting the presence of an amplified target sequence in the reaction, wherein the presence of the amplified target sequence confirms the presence of a [FeFe] hydrogenase gene in the sample.

[0037] In preferred embodiments of the invention, the detection of the presence of Desulfovibrio species in said fecal sample is followed by quantifying the amount of the detected Desulfovibrio species in said fecal sample. It is also clear to a person skilled in the art that the detection and quantification steps of the present method can be performed simultaneously or in combination, for example, by quantitative polymerase chain reaction (qPCR), also known as real-time polymerase chain reaction providing means to measure the presence and amount of a reaction product as the amplification reaction progresses.

[0038] In further preferred embodiments of the invention, the detection of the presence of Desulfovibrio species in said fecal sample is followed with the subsequent steps of: i) optionally quantifying the amount of the detected Desulfovibrio species in said fecal sample; ii) isolating the Desulfovibrio species detected in the feces sample and culturing said Desulfovibrio species; and iii) testing antibiotic susceptibility of said Desulfovibrio species. In a more preferred embodiment, the method further comprises the subsequent steps of iv) treating the donor of said feces sample with an antibiotic which is effective against the Desulfovibrio species; and v) optionally subjecting said donor to fecal transplantation (examples of fecal transplantation treatments are disclosed in WO2019075344). Accordingly, the present invention is further directed to an antibiotic for use in the treatment of Parkinson’s disease or for use in decreasing the risk of Parkinson’s disease in a subject, wherein the presence of a Desulfovibrio species is detected in a fecal sample taken from said subject and wherein said detected Desulfovibrio species is tested to be susceptible to said antibiotic, i.e. said subject is a carrier of bacteria of Desulfovibrio species and the subject is prescribed an antibiotic that has been tested to be effective against the detected Desulfovibrio species. The present method can also be used for monitoring such treatment with an antibiotic.

[0039] In preferred embodiments, the amount of Desulfovibrio species detected in the fecal sample is compared with a cutoff value provided by nucleic acid amplification and/or bacterial culture assays performed to a number of subjects from healthy population and PD patients, wherein a value above the cutoff is an indication that the subject has PD or a predisposition for developing PD. In further preferred embodiments, an antibiotic treatment according to the present invention is recommended for the subject, when PD or the predisposition for developing PD is detected in the subject. In preferred embodiments, the present invention can also be used for determining severity of PD in a subject, wherein the amount of of Desulfovibrio species detected in the fecal sample correlates to the severity of PD (preferably assessed by Hoehn-Yahr classification, see Table 3).

[0040] The present invention also provides a kit for detecting the presence of a [FeFe] hydrogenase gene of Desulfovibrio species in a feces sample of a subject, the kit comprising an oligonucleotide primer pair amplifying a target sequence in a [FeFe] hydrogenase gene of Desulfovibrio species. [0041] In a preferred embodiment, said [FeFe] hydrogenase gene detected by the kit is periplasmic [FeFe] hydrogenase large subunit gene hydA of Desulfovibrio species. More preferably, said primer pair comprises primers recognizing and binding to the sequence of said periplasmic [FeFe] hydrogenase large subunit gene hydA.

[0042] In another preferred embodiment, one of said primers in the kit comprises at least 16 contiguous nucleotides of the following oligonucleotide: 5’- GAYGTSACCATHWKGGAAGA-3’ (SEQ ID NO: 1), wherein Y is thymine or cytosine, S is guanine or cytosine, H is adenine, cytosine or thymine, and W is adenine or thymine. In another preferred embodiment, one of said primers in the kit comprises at least 16 contiguous nucleotides of the following oligonucleotide: 5’-CAGGYCATRWMYTCGATGAA-3’ (SEQ ID NO:2), wherein Y is thymine or cytosine, R is guanine or adenine, W is adenine or thymine, and M is adenine or cytosine. [0043] In another preferred embodiment, the kit comprises components selected from the group consisting of: a polymerase, nucleotides, probes, and buffers comprising salts, detergents and/or other additives such as preservatives.

[0044] In preferred embodiments, the kit comprises a culture medium for anaerobic bacterial culture, said culture medium comprising a metal sulfate and a ferric or ferrous iron source such as a ferric or ferrous iron salt. More preferably, said culture medium is a Postgate medium (DSMZ medium 63).

[0045] The present invention is also directed to a use of said kit for determining or confirming Parkinson’s disease or determining a risk of Parkinson’s disease of a subject. [0046] The present invention also provides a primer pair comprising a forward primer comprising at least 16 contiguous nucleotides of the following oligonucleotide: 5’- GAYGTSACCATHWKGGAAGA-3’ (SEQ ID NO: 1), wherein Y is thymine or cytosine, S is guanine or cytosine, H is adenine, cytosine or thymine, and W is adenine or thymine; and a reverse primer comprising at least 16 contiguous nucleotides of the following oligonucleotide: 5 ’-CAGGY CATRWMYTCGATGAA-3 ’ (SEQ ID NO:2), wherein Y is thymine or cytosine, R is guanine or adenine, W is adenine or thymine, and M is adenine or cytosine, wherein said primer pair amplifies a target sequence in a periplasmic [FeFe] hydrogenase large subunit gene hycIA of Desulfovibrio species.

[0047] In a preferred embodiment, said forward primer of the primer pair comprises the sequence 5’-GACGTGACCATCTGGGAAGA-3’ (SEQ ID NOG); and said reverse primer of the primer pair comprises the sequence 5’- CAGGCCATGAATTCGATGAA -3’ (SEQ ID NO:4).

[0048] The present invention is also directed to a method for detecting the presence of one or more Desulfovibrio species in a biological sample, the method comprising the steps of: i) subjecting said sample or nucleic acids isolated therefrom to a nucleic acid amplification reaction comprising an oligonucleotide primer pair amplifying a target sequence in periplasmic [FeFe] hydrogenase large subunit gene hycIA of Desulfovibrio species; and ii) detecting the presence of an amplified target sequence in the reaction, wherein the presence of the target sequence is indicative of the presence of one or more Desulfovibrio species in the sample. Preferably, Desulfovibrio species detected by the said method are selected from the group consisting of: D. ferrophilus, D. alaskensis, D. vulgaris, D. magneticus, D. carbinolicus, D. piger, D. fairfieldensis, and D. desulfuricans.

[0049] In a preferred embodiment, one of the primers in the primer pair comprises at least 16 contiguous nucleotides of the following oligonucleotide: 5’- GAYGTSACCATHWKGGAAGA-3’ (SEQ ID NO: 1), wherein Y is thymine or cytosine, S is guanine or cytosine, H is adenine, cytosine or thymine, and W is adenine or thymine. In another preferred embodiment, one of the primers in the primer pair comprises at least 16 contiguous nucleotides of the following oligonucleotide: 5’-

CAGGYCATRWMYTCGATGAA-3’ (SEQ ID NO:2), wherein Y is thymine or cytosine, R is guanine or adenine, W is adenine or thymine, and M is adenine or cytosine.

[0050] Reference throughout this specification to one embodiment or an embodiment means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment. Where reference is made to a numerical value using a term such as, for example, about or substantially, the exact numerical value is also disclosed.

[0051] While the forgoing examples are illustrative of the principles of the present invention in one or more particular applications, it will be apparent to those of ordinary skill in the art that numerous modifications in form, usage and details of implementation can be made without the exercise of inventive faculty, and without departing from the principles and concepts of the invention. Accordingly, it is not intended that the invention be limited, except as by the claims set forth below.

[0052] The verbs “to comprise” and “to include” are used in this document as open limitations that neither exclude nor require the existence of also un-recited features. The features recited in depending claims are mutually freely combinable unless otherwise explicitly stated. Furthermore, it is to be understood that the use of "a" or "an", that is, a singular form, throughout this document does not exclude a plurality. EXPERIMENTAF SECTION

Materials and methods

Sample collection

The permission for this research was granted by the Ethics Committee of Helsinki with the reference numbers HUS/975/2019 and HUS/2248/2019 (amendment accepted 27.5.2020). Some (n = 6) of the Parkinson's patients gave a permission to isolate DSV from their feces. The sample collection was initiated in February 2019 and continued until the end of November 2019. Feces samples of 20 PD patients from Terveystalo, Helsinki, Finland and 20 healthy individuals were collected by MD Kari Murros for this study. The PD patients were diagnosed based on the UK Parkinson’s Disease Society Brain Bank Clinical Diagnostic Criteria (Hughes, Daniel, Kilford, & Fees, 1992) and the Movement Disorder Society Clinical Diagnostic Criteria for Parkinson's disease (Postuma et al, 2015). The control group had similar sex and age (over 50 years old) to the patients and did not have any symptoms of PD. The donors were instructed to collect morning feces samples into provided collection tubes. Each sample was given a distinct code. There was no restriction on diet or medication prior to sampling. The feces samples were refrigerated and transported ice cold to the University laboratory within 8 hours. Once received, the samples were divided into smaller aliquots to prevent repeated freeze-thaw cycles during experiments and then stored at -75 °C until further processing.

Bacterial strains and culture conditions

Three collection strains, D. desulfuricans MB (DSM 6949), D. vulgaris (DSM 644) and D. magneticus RS-1 (DSM 13731), were obtained from the Feibniz Institute DSMZ- German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany. Fiquid Postgate medium (DSMZ medium 63) for bacterial culture was made anoxic by sparging with nitrogen gas for one hour while being heated at 80 °C and then autoclaved. Solid medium was prepared by an addition of 15 g agar per liter of liquid medium prior to degassing and autoclaving. Distribution of the medium into Hungate-type tubes or plates and bacterial inoculation were performed in an anaerobic workstation (Don Whitley Scientific, West Yorkshire, UK). The bacteria were cultured anaerobically at 37 °C. The anaerobic condition inside the anaerobic jar was created using the Microbiology Anaerocult® A (Merck KGaA, Darmstadt, Germany) and indicated by Anaerotest® strip (Merck KgaA). The formation of a black precipitate (ferrous sulfide) demonstrated bacterial growth after two to seven days.

DNA extraction

DNA from the feces samples was extracted using the Stool DNA Isolation Kit (Norgen Biotek, Ontario, Canada). The bacterial DNA of D. desulfuricans MB (DSM 6949), D. vulgaris (DSM 644) and D. magneticus RS-1 (DSM 13731) as positive controls were isolated using the MagAttract HMW DNA Kit (Qiagen GmbH, Hilden, Germany).

Primers and PCR conditions

A pair of universal primers targeting bacterial 16S rDNA was used to validate the success of DNA isolation from feces samples. Primers for detecting D. magneticus and periplasmic [FeFe] hydrogenase gene were designed by multiple sequence alignment of the 16S rDNA genes and the periplasmic [FeFe] hydrogenase large subunit genes ( hydA ) of different Desulfovibrio spp., respectively. The primer specificity was checked using the Primer-BLAST on NCBI database (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). The 16S rDNA primer sequences used for specific detection of Desulfovibrio genus and the species including D. desulfuricans, D. fairfieldensis, D. piger, and D. vulgaris were obtained from previous studies (Chakraborty et al, 2011; Fite et al, 2004; Loubinoux et al, 2002). All the primers used in this study are listed in Table 1.

Conventional PCR amplification was carried out in 50 mΐ volume consisting of 1 x Phusion Green HF buffer (Thermo Fisher Scientific, Vilnius, Lithuania), 0.2 mM dNTP mix (Thermo Fisher Scientific), 0.5 mM of each primer, 1 U of Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific) and approximately 170 ng of total DNA extracted from feces samples or 20 ng of bacterial genomic DNA. Reaction mixture comprised of water instead of DNA was used as a negative control. The PCR condition was set as follows: 98 °C for 30 secs followed by 30 cycles of denaturing at 98 °C for 10 secs, annealing at 55 °C for 10 secs and elongation at 72 °C for 20 secs, continuing with 72 °C for 5 min and final 4 °C for 15 min.

The PCR products were separated in 1.5% (w/v) agarose gel containing 0.1 pg ml ¹ ethidium bromide and visualized under UV light. The size marker used was 100 bp GeneRuler DNA ladder (Thermo Fisher Scientific). The PCR products were then purified using SanPrep Column PCR Product Purification kit (BBI Life Sciences, Shanghai, China) and sent to the Institute of Biotechnology (University of Helsinki, Finland) for sequencing, followed by comparison to the NCBI GenBank database for analysis.

Cloning of 16S rDNA and hydA PCR products Vector pHelixl (Roche Diagnostics GmbH, Mannheim, Germany) was amplified with the primers AmpF and OriF to obtain a part containing only the ampicillin resistance gene and the origin of replication ( amp^R-ori ). The amplicon was purified using SanPrep Column PCR Product Purification kit (BBI Life Sciences) and checked by gel electrophoresis in 0.9% (w/v) agarose gel containing 0.1 pg ml ¹ ethidium bromide. The size marker used in plasmid gels was 1 kb GeneRuler DNA ladder (Thermo Fisher Scientific).

The purified amplification products of 16S rDNA fragments from the five DSV species and the hydA fragment from D. desulfuricans MB, after being verified by sequencing, underwent kinase treatment. Twenty mΐ reaction comprised of 1 x T4 DNA Ligase buffer (Thermo Fisher Scientific), with additional 0.5 mM ATP, 5% PEG 4000 solution (Thermo Fisher Scientific), 10 U of T4 Polynucleotide Kinase (Thermo Fisher Scientific), water, and 52-230 ng of the 16S rDNA or hydA inserts. The reaction was incubated at 37 °C for 30 min and terminated by incubating at 75 °C for 10 min. The inserts were then ligated to the ampR-ori fragment as follows. Forty mΐ ligation reactions contained lx T4 DNA Ligase buffer (Thermo Fisher Scientific), 5% PEG 4000 solution (Thermo Fisher Scientific), 5 U of T4 DNA Ligase (Thermo Fisher Scientific), water, vector, and inserts, whose amounts were calculated so that the molar ratio between vector and insert was 1 :3 with total mass of 280-495 ng. The reactions were incubated overnight at room temperature, after which they were purified by SanPrep Column PCR Product Purification kit (BBI Life Sciences) and eluted in 25 mΐ of sterile Milli-Q water. Ten mΐ of the ligation mixtures were introduced into competent E. coli XLl-Blue cells (Agilent Technologies, Santa Clara, CA, USA) by electroporation with pulse 2.5 kV, 200 W and 25 pFD (Zabarovsky & Winberg, 1990). The transformed cells were then added into 1 ml SOC medium and incubated at 37 °C for one hour. LB medium containing ampicillin 100 pg ml-1 was used for selection and subculturing. For screening the right clones from obtained transformant colonies, a quick DNA extraction method was used. Colonies were picked into 4 ml of LB+ampicillin broth and incubated at 37 °C with shaking. Next day, 200 pi of the cultures were mixed with 100 mΐ chloroform and 100 mΐ phenol. The mixtures were vortexed for one minute to break the cells, and centrifuged for five minutes to separate the aqueous DNA-containing phase from the solvent phase and cell debris.

Twenty mΐ of the upper phase was loaded into 0.9% (w/v) agarose gel containing 0.1 pg ml ¹ ethidium bromide, and the genetic material was separated by electrophoresis and visualized under UV light. Based on the screening results, plasmids were isolated from putative right clones using the SanPrep Column Plasmid Mini-preps kit (BBI Life Sciences, Shanghai, China), and confirmed by PCR with corresponding insert primers.

Statistical analysis Independent samples T-test was performed using IBM SPSS Statistics 20 software to analyze the results.

Bacterial isolation from feces

An approximate 0.4 g of fresh or frozen feces (stored less than 8 months) of DSV- and hydA- positive patients was added to 5 ml of semi- so lid Postgate medium which contained 1.5 g agar l ¹ (Jain, 1995). Once the blackening of the medium was detected after 3-7 days at 37 °C, the culture was streaked on Postgate agar and the plates were incubated for 4-10 days at 37 °C. Black colonies were visually inspected with phase contrast microscopy, and continuously picked onto new Postgate plates until a pure isolate with cells having the shape of curved rod was obtained. All the procedures and bacterial cultivations were performed in anaerobic workstation (Don Whitley Scientific) at 37 °C. DNA of the isolates was extracted with the MagAttract HMW DNA Kit (Qiagen GmbH), from which the 16S rDNA fragment for species identification was amplified with the universal primers pA and pE’. The PCR products were purified and sent to the Institute of Biotechnology (University of Helsinki, Finland) for sequencing. The sequences were compared to the NCBI GenBank database to identify the isolates. All the isolates were cryopreserved at - 75 °C in liquid Postgate medium containing 17% glycerol (VWR Chemicals, Leuven, Belgium).

Antibiotic susceptibility testing

The tests were performed by a pour plate method, wherein 100 mΐ of three-day cultured isolate was added to 20 ml of warm Postgate agar medium. The mixture was then poured into plate and antibiotic disks were subsequently placed on the agar plates. The plates were cultured anaerobically at 37 °C as defined above.

Results

Detection of Desulfovibrio spp. and hydA by conventional PCR

In order to discover if there is any relation between the presence of Desulfovibrio spp. in human intestinal tract and PD, we performed conventional PCR to specifically detect them from feces samples derived from patients and healthy individuals. All PCR products from control strains as well as feces samples giving proper bands in gel electrophoresis were verified by sequencing. First, the specificity of the primers was checked by using the DNA extracted from positive control strains as PCR template. As a result, the primers specific to D. desulfuricans MB, D. magneticus RS-1, and D. vulgaris showed high specificity, as they amplified fragments of expected sizes only from the corresponding bacteria (Fig. 1). Because there were no control strains available for D. fairfieldensis or D. piger, the specificity of those primers was determined from fragments amplified from feces. By sequencing, it was confirmed that those primers were specific, as they only amplified 16S rDNA fragments of D. fairfieldensis or D. piger. The primers to detect Desulfovibrio genus and D. desulfuricans strain Essex 6 also amplified fragments of correct sizes from the feces samples, but by sequencing the amplicons were later confirmed not to be Desulfovibrio DNA (data not shown). Thus, as those primers were not specific, they were excluded from subsequent experiments. In total, sixteen PD patients and eight healthy individuals were positive with DSV (Table 2). Some samples from healthy volunteers were detected with more than one species of DSV. Regarding the patients, D. desulfuricans, D. fairfieldensis, and D. piger were found, whereas for the healthy group, all five examined species were detected (Table 3). However, the detected D. magneticus could also be D. carbinolicus, as based on the sequencing result, the primers for D. magneticus RS-1 also amplify the 16S rDNA of D. carbinolicus. The most common species in the feces of PD patients was D. desulfuricans (n=10). For the healthy group, D. desulfuricans and D. fairfieldensis were the most common species. Each of them was found four times, but for once, they were both detected in the same sample. Statistical analysis revealed a significant difference in the presence of DSF between PD and healthy group (p<0.05, n=20) suggesting that DSV is associated with

PD.

As the primers for detecting the genus were not usable, to detect more DSV species, and to assess their putative ability to produce magnetite, three Fe-primer pairs targeting DSV- specific hydA gene were designed and tested (Fig. 5). Sequencing of the obtained test- PCR products showed that Fe-primer pair 1 specifically amplified DSV-hydA fragments of correct size and were selected for further experiments. As a result, all 20 patients and 13 healthy people were found positive with hydA (Table 2). Comparing to the results from strain/species-specific primers, additional four patients and five healthy people were detected with the Fe-primers. A significant difference between the two groups was found (p<0.05, n=20) indicating that [FeFe] hydrogenase gene is also associated with PD.

Cloning of 16S rDNA and hydA fragments For the qPCR standard curve, the 16S rDNA and hydA PCR products from control strains or, in case of D. fairfieldensis and D. piger, from feces were cloned in plasmid vector. The precise lengths of the amplicons are shown in Table 1. Approximately 20 to 30 transformant colonies were obtained on the selection plates from each cloning. Colonies were screened for the right transformants by DNA extraction. By comparing with the plain vector, the plasmids containing inserts could be distinguished and the right transformants were selected. Plasmids were isolated from putative right clones, and confirmed by PCR (data not shown) verifying successful clonings.

Quantification of DSV in the feces of patients and healthy individuals

While DSV was found to be more prevalent in the PD group, we also detected these bacteria in several healthy people. To assess whether there is a difference in the DSV quantity between healthy people and PD patients, quantitative real-time PCR was carried out to determine the bacterial amount in the DSV- and hydA -positive feces samples from both groups. Standard curves were made in every run from serial dilutions of the plasmids with known copy numbers. The results revealed that the patients had a significantly higher amount of DSV in their feces than healthy people (p<0.05, n=20). Specifically, the average amount of DSV for the patient group was 5.8x10⁶ bacteria g ¹ feces (standard deviation l.OxlO⁷ bacteria g ¹ feces), while for the healthy group, it was 1.9xl0⁵ bacteria g ¹ feces (standard deviation 4.8^c10⁵ bacteria g ¹ feces). Although most patients had a relatively low amount of DSV, the quantity could reach up to 3.3 xlO⁷ bacteria g ¹ feces while in the healthy group, the maximum was about 1.9^c10⁶ bacteria g¹ feces. The results are shown in Table 3, and Figs. 2 and 3. An additional statistical test was done to analyze whether there is a difference in the amount of DSV between male (n=12) and female patients (n=8). A p-value of 0.036 supported the hypothesis and male patients actually had more DSV than female. As an evidence, five patients having the highest DSV counts were males (Table 3, Fig. 2). We could not find the same relation in the healthy group. However, healthy volunteers with the highest top-three amount of DSV were also men.

In addition, we wanted to determine if the high amount of DSV in the patients correlates with the severity of the disease. Based on Hoehn-Yahr classification (Hoehn & Yahr, 1967), 11 cases were more severe among 20 patients. Interestingly, all seven cases having the DSV amount higher than any of the healthy individuals were in this category. Furthermore, the patients in a more severe stage of PD (n=l 1) had a significantly higher amount of DSV comparing to other patients (n=9) (p<0.05). This suggests that high amount of DSV correlates with the disease severity.

Isolation of Desulfovibrio from feces of patients In order to further confirm the presence of Desulfovibrio in the PCR-positive patients’ feces, we aimed to isolate them from the samples by bacterial enrichment and continuous subculturing. The isolates were identified by 16S rDNA sequencing and comparison to the NCBI GenBank database. Some patients’ feces could easily be distinguished from the healthy group feces as the feces cultures in semi-solid Postgate medium turned black due to the production of FeS (Fig. 4). Altogether, we successfully isolated D. desulfuricans from two samples, D. fairfieldensis from three samples, D. legalii from one sample and an unidentified Desulfovibrio species from one sample. The isolation of D. desulfuricans and D. fairfieldensis was in accordance with the molecular detection by the species- specific primers. Interestingly, D. legalii was isolated from the patient negative for DSV with the used DSV strain/species specific primers, but positive with Fe-primers. Besides D. legalii, we found another DSV species which was also detected with only Fe-primers. The species had a high identity (approximately 95%) to D. intestinalis and D. simplex.

Antibiotic susceptibility testing of detected Desulfovibrio species

The D. desulfuricans strain isolated from a feces sample of a PD patient was clearly susceptible to at least ceftazidime, tetracycline, penicillin, cephalothin, chloramphenicol, kanamycin and streptomycin (Figure 6). Based on the results, penicillin was chosen to treat the PD patient. The measured amount of D. desulfuricans in the gut of the patient before antibiotic treatment was 5.3 x 10⁶ bacteria/g feces, during the antibiotic treatment it was 1.4 x 10⁶ bacteria/feces and two weeks after the treatment 1.8 x 10⁶ bacteria/feces, thus showing the effect of the antibiotic.

Table 1. Primers used in the detection of Desulfovibrio spp. and hydA by conventional PCR, i.e. SEQ ID NOS: 3-22.

Table 2. Summary of the detected Desulfovibrio spp. and hydA in the human feces by PCR.

Table 3. Summary of the PCR detection, quantification and isolation of Desulfovibrio spp. from patients and healthy individuals.

REFERENCES

Belila, A., Abbas, B., Fazaa, L, Saidi, N., Snoussi, M., Hassen, A., & Muyzer, G. (2013). Sulfur bacteria in wastewater stabilization ponds periodically affected by the ‘red-water’ phenomenon. Applied Microbiology and Biotechnology, 97(1), 379-394.

Chakraborty, R., Hazen, T. C., Joyner, D. C, Kiisel, K., Singer, M. E., Sitte, J., & Torok,

T. (2011). Use of immunomagnetic separation for the detection of Desulfovibrio vulgaris from environmental samples. Journal of Microbiological Methods, 86(2), 204-209.

Cheon, S.-M., Chan, L., Chan, D. K. Y., & Kim, J. W. (2012). Genetics of Parkinson’s disease-a clinical perspective. Journal of Movement Disorders, 5(2), 33.

Dianou, D., Lopes, J., Traore, A. S., Lino, A.-R., Moura, L, & Moura, J. G. (1998). Characterization of Desulfovibrio sp. isolated from some lowland paddy field soils of Burkina Faso. Soil Science and Plant Nutrition, 44(3), 459-465.

Dobson, J. (2001). Nanoscale biogenic iron oxides and neurodegenerative disease. FEBS Letters, 496(1), 1-5.

Dorsey, E. R., Elbaz, A., Nichols, E., Abd-Allah, F., Abdelalim, A., Adsuar, J. C., & Murray, C. J. L. (2018). Global, regional, and national burden of Parkinson's disease, 1990-2016: a systematic analysis for the Global Burden of Disease Study 2016. The Lancet Neurology, 77(11), 939-953.

Edwards, U., Rogall, T., Blocker, H., Emde, M., & Bottger, E. C. (1989). Isolation and direct complete nucleotide determination of entire genes. Characterization of a gene coding for 16S ribosomal RNA. Nucleic Acids Research, 17(19), 7843-7853.

Finegold, S. M. (2011). Desulfovibrio species are potentially important in regressive autism. Medical Hypotheses, 77(2), 270-274.

Finegold, S. M., Dowd, S. E., Gontcharova, V., Liu, C., Henley, K. E., Wolcott, R. D., . . . & Green, J. A. (2010). Pyrosequencing study of fecal microflora of autistic and control children. Anaerobe, 16(4), 444-453.

Fite, A., Macfarlane, G., Cummings, J., Hopkins, M., Kong, S., Furrie, E., & Macfarlane,

S. (2004). Identification and quantitation of mucosal and faecal desulfo vibrios using real time polymerase chain reaction. Gut, 55(4), 523-529.

Friedman, A., Galazka-Friedman, J., & Bauminger, E. R. (2007). Iron as a trigger of neurodegeneration in Parkinson's disease. Handbook of Clinical Neurology, 83, 493-505.

Goldstein, E. J., Citron, D. M., Peraino, V. A., & Cross, S. A. (2003). Desulfovibrio desulfuricans bacteremia and review of human Desulfovibrio infections. Journal of Clinical Microbiology, 41(6), 2752-2754. Hagiwara, S., Yoshida, A., Omata, Y., Tsukada, Y., Takahashi, H., Kamewada, H., . . . & Nakano, M. (2014). Desulfovibrio desulfuricans bacteremia in a patient hospitalized with acute cerebral infarction: case report and review. Journal of Infection and Chemotherapy, 20(4), 274-277.

Hoehn, M. M., & Yahr, M. D. (1967). Parkinsonism: onset, progression, and mortality. Neurology, 17(5), 427-442.

Hughes, A. J., Daniel, S. E., Kilford, L., & Lees, A. J. (1992). Accuracy of clinical diagnosis of idiopathic Parkinson's disease: a clinico-pathological study of 100 cases. Journal of Neurology, Neurosurgery & Psychiatry, 55(3), 181-184.

Jackson, A., Forsyth, C. B., Shaikh, M., Voigt, R. M., Engen, P. A., Ramirez, V., & Keshavarzian, A. (2019). Diet in Parkinson's Disease: Critical Role for the Microbiome. Frontiers in Neurology, 10.

Jain, D. K. (1995). Evaluation of the semisolid Postgate's B medium for enumerating sulfate- reducing bacteria. Journal of Microbiological Methods, 22(1), 27-38.

Johnson, C. C., & Finegold, S. M. (1987). Uncommonly encountered, motile, anaerobic gram- negative bacilli associated with infection. Reviews of Infectious Diseases, 9(6), 1150- 1162.

Johnson, K. V.-A. (2020). Gut microbiome composition and diversity are related to human personality traits . Human Microbiome Journal, 15, 100069.

Kalia, L. V., & Lang, A. E. (2015). Parkinson's disease. Lancet (London, England), 386(9996), 896-912. https://doi.org/10.1016/S0140-6736(14)61393-3

Kirschvink, J. L., Kobayashi-Kirschvink, A., & Woodford, B. J. (1992). Magnetite biomineralization in the human brain. Proceedings of the National Academy of Sciences, §9(16), 7683-7687.

Klein, C., & Westenberger, A. (2012). Genetics of Parkinson’s disease. Cold Spring Harbor Perspectives in Medicine, 2(1), a008888.

Kobayashi, A., Yamamoto, N., & Kirschvink, J. (1997). Studies of inorganic crystals in biological tissue: magnetite in human tumor. Journal of the Japan Society of Powder and Powder Metallurgy, 44(3), 294-300.

Korneeva, V., Pimenov, N., Krek, A., Tourova, T., & Bryukhanov, A. (2015). Sulfate- reducing bacterial communities in the water column of the Gdansk Deep (Baltic Sea). Microbiology, 84(2), 268-277.

Loubinoux, J., Bronowicki, J.-P., Pereira, I. A., Mougenel, J.-L., & Le Faou, A. E. (2002). Sulfate-reducing bacteria in human feces and their association with inflammatory bowel diseases. FEMS Microbiology Ecology, 40(2), 107-112. Lovley, D. R., Roden, E. E., Phillips, E., & Woodward, J. (1993). Enzymatic iron and uranium reduction by sulfate-reducing bacteria. Marine Geology, 113(1-2), 41-53.

Polymeropoulos, M. H., Lavedan, C., Leroy, E., Ide, S. E., Dehejia, A., Dutra, A., . . . & Nussbaum R. L. (1997). Mutation in the a-synuclein gene identified in families with Parkinson's disease. Science, 276( 5321), 2045-2047.

Postuma, R. B., Berg, D., Stem, M., Poewe, W., Olanow, C. W., Oertel, W., . . . & Deuschl, G. (2015). MDS clinical diagnostic criteria for Parkinson's disease. Movement Disorders, 30(12), 1591-1601.

Sakaguchi, T., Arakaki, A., & Matsunaga, T. (2002). Desulfovibrio magneticus sp. nov., a novel sulfate-reducing bacterium that produces intracellular single-domain-sized magnetite particles. International Journal of Systematic and Evolutionary Microbiology, 52(1), 215- 221.

Sakaguchi, T., Burgess, J. G., & Matsunaga, T. (1993). Magnetite formation by a sulphate- reducing bacterium. Nature, 365(6441), 47.

Sidransky, E., & Lopez, G. (2012). The link between the GBA gene and parkinsonism. The Lancet Neurology, 7/(11), 986-998.

Urata, T., Kikuchi, M., Hino, T., Yoda, Y., Tamai, K., Kodaira, Y., & Hitomi, S. (2008). Bacteremia caused by Desulfovibrio fairfieldensis. Journal of Infection and Chemotherapy, 14(5), 368-370.

Zabarovsky, E. R., & Winberg, G. (1990). High efficiency electroporation of ligated DNA into bacteria. Nucleic Acids Research, 75(19), 5912.

Claims

1. Method for determining or confirming Parkinson’s disease or a risk thereof in a subject, the method comprising detecting the presence of Desulfovibrio species in a feces sample of a subject and optionally quantifying the amount of a detected Desulfovibrio species in said feces sample.

2. The method according to claim 1, wherein said detecting comprises the steps of: i) subjecting said feces sample or nucleic acids isolated therefrom to a nucleic acid amplification reaction comprising an oligonucleotide primer pair amplifying a target sequence in a [FeFe] hydrogenase gene of Desulfovibrio species; and ii) detecting the presence of an amplified target sequence in the reaction, wherein the presence of the amplified target sequence is indicative of the presence of a [FeFe] hydrogenase gene in the sample.

3. The method according to claim 2, wherein said [FeFe] hydrogenase gene is periplasmic [FeFe] hydrogenase large subunit gene hyclA of Desulfovibrio species.

4. The method according to claim 3, wherein said primer pair comprises primers recognizing and binding to the sequence of said periplasmic [FeFe] hydrogenase large subunit gene hydA.

5. The method according to claim 4, wherein one of said primers comprises at least 16 contiguous nucleotides of the following oligonucleotide: 5 ’-GAYGTSACCATHWKGGAAGA-3 ’ (SEQ ID NOT), wherein Y is thymine or cytosine, S is guanine or cytosine, H is adenine, cytosine or thymine, and W is adenine or thymine.

6. The method according to claim 4 or 5, wherein one of said primers comprises at least 16 contiguous nucleotides of the following oligonucleotide: 5 ’-CAGGY CATRWMYTCGATGAA-3 ’ (SEQ ID NO:2), wherein Y is thymine or cytosine, R is guanine or adenine, W is adenine or thymine, and M is adenine or cytosine.

7. The method according to any one of the claims 2-6, wherein Desulfovibrio species detectable by the said method are selected from the group consisting of: D. ferrophilus, D. alaskensis, D. vulgaris, D. magneticus, D. carbinolicus, D. piger, D. fairfieldensis, and D. desulfuricans.

8. The method according to claim 1, wherein said detecting comprises the steps of: i) inoculating said feces sample into or on a culture medium comprising a metal sulfate and a ferric or ferrous iron source such as a ferric or ferrous iron salt; and ii) incubating the inoculated culture medium under anaerobic conditions, wherein the formation of a brown or black color or precipitate due to the production of ferrous sulfide indicates the production of hydrogen sulfide in the sample.

9. The method according to claim 8, wherein said culture medium is a Postgate medium (DSMZ medium 63).

10. The method according to claim 8 or 9, wherein said detecting comprises the steps of: i) inoculating a first aliquot of said feces sample into or on a culture medium comprising a metal sulfate and a ferric or ferrous iron source such as a ferric or ferrous iron salt; ii) incubating the inoculated culture medium under anaerobic conditions, wherein the formation of a brown or black color or precipitate due to the production of ferrous sulfide indicates the production of hydrogen sulfide in the sample; iii) subjecting a second aliquot of said feces sample or nucleic acids isolated therefrom to a nucleic acid amplification reaction comprising an oligonucleotide primer pair amplifying a target sequence in a [FeFe] hydrogenase gene of Desulfovibrio species; and iv) detecting the presence of an amplified target sequence in the reaction, wherein the presence of the amplified target sequence further confirms the presence of a [FeFe] hydrogenase gene in the sample.

11. The method according to any one of claims 1-10, wherein the detection of the presence of Desulfovibrio species in said fecal sample is followed by quantifying the amount of the detected Desulfovibrio species in said fecal sample, preferably by quantitative polymerase chain reaction (qPCR).

12. The method according to any one of claims 1-11, wherein the detection of the presence of Desulfovibrio species in said fecal sample is followed with the following steps of: i) optionally quantifying the amount of the detected Desulfovibrio species in said fecal sample; ii) isolating the Desulfovibrio species detected in the feces sample and culturing said Desulfovibrio species; and iii) testing antibiotic susceptibility of said Desulfovibrio species.

13. The method according to claim 12 further comprising: iv) treating the donor of said feces sample with an antibiotic which is effective against the Desulfovibrio species; and v) optionally subjecting said donor to fecal transplantation.

14. The method according to any one of claims 1-13, wherein the amount of Desulfovibrio species detected in the fecal sample is compared with a cutoff value provided by nucleic acid amplification and/or bacterial culture assays performed to a number of subjects from healthy population and PD patients, wherein a value above the cutoff is an indication that the subject has PD or a risk for developing PD.

15. The method according to any one of claims 1-15 further comprising a step of determining severity of PD in a subject, wherein the amount of of Desulfovibrio species detected in the fecal sample correlates to the severity of PD.

16. A kit for detecting the presence of a [FeFe] hydrogenase gene of Desulfovibrio species in a feces sample of a subject, the kit comprising an oligonucleotide primer pair amplifying a target sequence in a [FeFe] hydrogenase gene of Desulfovibrio species.

17. The kit according to claim 16, wherein said [FeFe] hydrogenase gene is periplasmic [FeFe] hydrogenase large subunit gene hyclA of Desulfovibrio species.

18. The kit according to claim 17, wherein said primer pair comprises primers recognizing and binding to the sequence of said periplasmic [FeFe] hydrogenase large subunit gene hydA.

19. The kit according to claim 18, wherein one of said primers comprises at least 16 contiguous nucleotides of the following oligonucleotide:

20. The kit according to claim 18or 19, wherein one of said primers comprises at least 16 contiguous nucleotides of the following oligonucleotide:

5 ’-CAGGY CATRWMYTCGATGAA-3 ’ (SEQ ID NO:2), wherein Y is thymine or cytosine, R is guanine or adenine, W is adenine or thymine, and M is adenine or cytosine.

21. The kit according to any one of claims 16-20 comprising components selected from the group consisting of: a polymerase, nucleotides, probes, and buffers comprising salts, detergents and/or other additives such as preservatives.

22. The kit according to any one of claims 16-21 comprising a culture medium for anaerobic bacterial culture, said culture medium comprising a metal sulfate and an iron salt.

23. The kit according to claim 22, wherein said culture medium is a Postgate medium (DSMZ medium 63).

24. Use of kit according to any one of claims 16-23 for determining or confirming Parkinson’s disease or determining a risk of Parkinson’s disease of a subject.

25. A primer pair comprising a forward primer comprising at least 16 contiguous nucleotides of the following oligonucleotide:

5 ’-GAYGTSACCATHWKGGAAGA-3 ’ (SEQ ID NO: 1), wherein Y is thymine or cytosine, S is guanine or cytosine, H is adenine, cytosine or thymine, and W is adenine or thymine; and a reverse primer comprising at least 16 contiguous nucleotides of the following oligonucleotide: 5 ’-CAGGY CATRWMYTCGATGAA-3 ’ (SEQ ID NO:2), wherein Y is thymine or cytosine, R is guanine or adenine, W is adenine or thymine, and M is adenine or cytosine, wherein said primer pair amplifies a target sequence in a periplasmic [FeFe] hydrogenase large subunit gene hycIA of Desulfovibrio species.

26. The primer pair according to claim 25, wherein said forward primer comprises the sequence 5 ’-GACGTGACCATCTGGGAAGA-3 ’ (SEQ ID NOG); and wherein said reverse primer comprises the sequence 5’- CAGGCCATGAATTCGATGAA -3’ (SEQ ID NO:4).

27. Method for detecting the presence of one or more Desulfovibrio species in a biological sample, the method comprising the steps of: i) subjecting said sample or nucleic acids isolated therefrom to a nucleic acid amplification reaction comprising an oligonucleotide primer pair amplifying a target sequence in periplasmic [FeFe] hydrogenase large subunit gene hycIA of Desulfovibrio species; and ii) detecting the presence of an amplified target sequence in the reaction, wherein the presence of the target sequence is indicative of the presence of one or more Desulfovibrio species in the sample.

28. The method according to claim 27, wherein said primer pair comprises primers recognizing and binding to the sequence of said periplasmic [FeFe] hydrogenase large subunit gene hycIA.

29. The method according to claim 28, wherein one of said primers comprises at least 16 contiguous nucleotides of the following oligonucleotide:

30. The method according to claim 28 or 29, wherein one of said primers comprises at least 16 contiguous nucleotides of the following oligonucleotide:

31. The method according to any one of the claims 27-30, wherein Desulfovibrio species detectable by the said method are selected from the group consisting of: D. ferrophilus, D. alaskensis, D. vulgaris, D. magneticus, D. carbinolicus, D. piger, D. fairfieldensis, and D. desulfuricans.

32. The method according to any one of claims 27-31, wherein the biological sample is a feces sample.

33. An antibiotic for use in the treatment of Parkinson’s disease or for use in decreasing the risk of Parkinson’s disease in a subject, wherein the presence of a Desulfovibrio species is detected in a fecal sample taken from said subject and wherein said detected Desulfovibrio species is tested to be susceptible to said antibiotic.