WO2021254009A1

WO2021254009A1 - Method for detecting trace nucleic acids in various mixed nucleic acids

Info

Publication number: WO2021254009A1
Application number: PCT/CN2021/091723
Authority: WO
Inventors: 李凯; 廖端芳; 肖莉; 张安迪; 邢春根
Original assignee: 李凯
Priority date: 2020-06-17
Filing date: 2021-04-30
Publication date: 2021-12-23
Also published as: CN111876472A; CN111876472B

Abstract

Disclosed in the present invention is a method for detecting trace nucleic acids by means of nucleic acid cyclization and selective nucleic acid disruption. The method comprises performing a cyclization treatment on a to-be-detected gene fragment and selectively performing a disruption treatment on a specific circular gene fragment. Different nucleic acid molecules respectively exhibit a circular state and a linear state by means of cyclization and a selective disruption treatment so as to be distinguished, and the technology can be used for identifying specific genotype nucleic acid molecules.

Description

Methods for detecting trace amounts of nucleic acids in a variety of mixed nucleic acids

Technical field

The patent of the present invention relates to the field of biomedicine, in particular to a nucleic acid analysis technology, in particular to the use of endonuclease to selectively break specific circular nucleic acids to achieve amplification and enrichment of unbroken nucleic acid molecules Technology.

Background technique

Nucleic acid analysis and enrichment are of great significance in the analysis of gene mutations. Polymerase chain reaction PCR, ligase chain reaction LCR and rolling circle amplification RCA have the effect of selective amplification of nucleic acids in specific regions, and can also be used for whole genome amplification. However, the analysis of somatic mutations is due to most cases, especially somatic mutations in biological specimens such as blood, urine, sputum, complex specimens of mixed hosts and parasitic microorganisms, and environmental testing such as water and air specific mutation pathogens Due to the large proportion of nucleic acid components that do not need to be analyzed, or the content of mutant nucleic acids is much lower than that of wild genes, the nucleic acid molecules of different genotypes can be selectively distinguished and the enrichment content is low or the content is extremely low. The mutant gene fragment has a certain practical value.

A variety of biotechnologies can be used for the enrichment of specific genotypes, such as a mutation-sensitive molecular switch composed of exonuclease-resistant sulfur-modified primers and high-fidelity DNA polymerase (1), designed for blue and white colonies with stop codons Enrichment technology (2), an enrichment system (3) composed of a combination of suicide gene and homicide gene, and digestion and amplification technology (4-6) coupled with thermostable restriction endonuclease and polymerase (4-6), both can be used Enrichment of mutant nucleic acids with specific properties under certain conditions. However, nucleic acid enrichment technology with higher enrichment efficiency and wider application range is still a practical technology to be developed in the field of biotechnology.

In view of the shortcomings or shortcomings of the specific genotype enrichment methods, including the limited types of high-temperature restriction endonucleases, the dephosphorylation treatment, and the limitation of the flux of the colony spot technology and the relatively time-consuming, etc., in order to solve the above-mentioned problems of the present invention From here.

Summary of the invention

The technical problem to be solved by the present invention is to provide a nucleic acid analysis technique for detecting trace nucleic acids from a variety of mixed nucleic acids, so as to achieve the purpose of high efficiency and distinguishing both hereditary mutations and epimutations.

In order to solve the above technical problems, the technical solution provided by the present invention is: a method for detecting trace nucleic acids from a variety of mixed nucleic acids, which includes the following steps:

(1) Carry out the circularization of linear nucleic acid molecules on the sample to be tested containing a variety of mixed nucleic acids,

(2) Use a nuclease with endonuclease function to selectively break the circularized nucleic acid, so that the nucleic acid target that does not need to be enriched in the sample to be tested changes from a circular nucleic acid to a linear nucleic acid.

(3) Detect and identify the nucleic acid molecules obtained in step (2), and detect whether the remaining form is linear nucleic acid or circular nucleic acid.

Preferably, when the nucleic acid target to be identified and enriched is a large number of unknowns with different lengths, before step (1), first fill in the end of the linear nucleic acid molecule in the sample to be tested to fill in A, and then use the nucleic acid The ligase links the linker to form a circularized nucleic acid.

Preferably, when the nucleic acid to be identified and enriched is a known and determined number of targets, before step (1), first use primers with restriction enzyme sites at the 5'end for amplification, and then use the corresponding The endonuclease processes the amplified product and nucleic acid ligase to form circular nucleic acid.

Preferably, when the nucleic acid to be enriched is a known number of targets, before step (1), a primer with a LoxP site at the 5'end is used for amplification, and then the recombination function of cre recombinase is used to form Circularized nucleic acid.

Preferably, in step (1), the linear nucleic acid molecule is circularized with a nuclease capable of connecting linear nucleic acids into a circle. More preferably, the nuclease is a nucleic acid ligase.

Preferably, in step (2), the nuclease with endonuclease function is a natural endonuclease; in another preferred technical solution of the present invention, the nuclease with endonuclease function is a genetic engineering endonuclease. Dicer.

Preferably, in step (3), the method for identifying whether the remaining form of the nucleic acid molecule to be tested is linear or circular, including electrophoresis, exonuclease exonuclease, PCR amplification, rolling circle amplification, and flying Mass spectrometry, high pressure liquid phase method, high resolution dissolution curve.

As a preferred solution of the present invention, rolling circle amplification is performed on the sample to be tested after selective destruction. The rolling circle amplification adopts one-way rolling circle amplification or two-way rolling circle amplification. Preferably, random primers or specific primers are used for rolling circle amplification.

The exonuclease exonuclease method uses exonuclease V to digest linear nucleic acids. Preferably, exonuclease V digested specimens are amplified by PCR.

The method of the present invention can be used for qualitative and quantitative analysis of nucleic acid.

Nucleic acid loops use nucleases that have the ability to connect nucleic acid molecules. Currently the most widely used in biotechnology is T4 nucleic acid ligase. The high-temperature-resistant nucleic acid ligase itself has been used for nucleic acid analysis in the ligase chain reaction. But for T4DNA ligase that is not resistant to high temperatures, it is mainly used for subcloning, ligation of sequencing adapters in library preparation, etc. When the linker adopts a hairpin structure, the double-stranded linear nucleic acid molecule forms a single loop structure after being connected to the linker. This looping method by connecting linkers can be used for gene mutation analysis at the omics level.

In addition to the omics level analysis of gene mutation analysis, the combined mutation analysis of hotspot mutations also has a wide range of applications. For the amplified product of a specific known site, by introducing a restriction enzyme cleavage site at the end of primer 5, the amplified product is digested with restriction enzyme, and both ends of the amplified product are formed after restriction enzyme digestion At the end that can be ligated, nucleic acid ligase can make it form a double-stranded circular nucleic acid molecule.

Because the gene recombinase cre is highly efficient and easy to use, for the preparation of multi-hotspot combinatorial libraries, you can add sequencing sequence and LoxP sites to the 5 ends of sequence-specific primers to ensure that the two ends of the PCR amplified product The LoxP sites are in the same direction, so after the addition of cre enzyme, the two LoxP sites undergo gene recombination to form a circular structure.

In the research and development of blue and white colony enrichment mutations, the inventors used restriction enzyme digestion of PCR amplified products and further dephosphorylated the digested products, which substantially improved the enrichment of mutant fragments by blue and white colony technology. (6). In view of the limited types of heat-resistant restriction endonucleases and the limitations of dephosphorylation treatment and colony plaque technology in terms of throughput and relatively time-consuming limitations, the technology of the present invention adopts a brand-new technical solution, and the nucleic acid fragment to be tested is first circularized. , And then selectively destroy a specific type of circular nucleic acid to distinguish whether the existence form of the test molecule is circular or linear. This difference can be confirmed by (1) directly by the migration speed of nucleic acid electrophoresis; (2) can be further processed by exonuclease V digestion of linear nucleic acid to retain circular nucleic acid to relatively enrich circular nucleic acid molecules; (3) can be used for extranucleic acid The product of Dicer V is amplified by PCR for enrichment; (4) or the product after the broken circle is directly subjected to rolling circle amplification to achieve the absolute copy number amplification and enrichment of the genotype that remains in the ring structure after the broken circle. set.

Compared with the existing high-throughput sequencing library preparation technology, the present invention has the advantages of a wide application range, which can be used for both the enrichment of genetic mutations and the discrimination of methylation mutations, and the advantages of being used for further enrichment after discrimination. It has certain practical value in many fields such as biomedicine and environmental monitoring.

Nucleic acid amplification can have a variety of techniques, among which rolling circle amplification and PCR amplification have been widely used.

Rolling circle amplification is an in vitro application technology of natural rolling circle replication. As a nucleic acid amplification technology in addition to PCR amplification technology, it has high efficiency and is widely used in the field of whole gene amplification. The main purpose of rolling circle amplification is not mutation enrichment. The invention combines nucleic acid ring formation and ring destruction, which expands the application range for rolling circle amplification. Loop formation and selective destruction are the core of the present invention, which can distinguish nucleic acid molecules of specific genotypes, and provide a template that has been enriched and distinguished for PCR amplification and rolling circle amplification. In the present invention, ring formation is a non-selective process, and ring breaking is a selective process. Turning a circular nucleic acid into a linear nucleic acid only needs to make one or more nicks on the nucleic acid circle. Unlike exonucleases, endonucleases can cut nucleic acids at the non-end of the nucleic acid. One option for breaking the ring is through the use of restriction endonucleases, such as MseI and NciI. Another option for the selective implementation of ring breaking is to use endonucleases that have no sequence specificity, such as cas9, Agonaute, T7E1, UDG, etc. The selectivity of these enzymes is determined by selective guide RNA fragments. It is determined by the small fragments of guiding DNA and the uracil residues that convert the unmethylated cytosine C on the circular nucleic acid. The sample after selective destruction can preferably be amplified by rolling circle.

PCR amplification is the most widely used in the field of nucleic acid amplification. After the looping and breaking of the present invention, the specimen to be tested is distinguished between linear nucleic acid and circular nucleic acid by exonuclease, such as exonuclease V (endonuclease V), which degrades linear nucleic acid and retains circular nucleic acid. The sample to be tested after the linear nucleic acid is degraded can preferably be amplified by PCR.

The present invention directly uses electrophoresis to distinguish circular and linear nucleic acids for the specimens to be analyzed with a higher copy number by coupling ring-breaking. For the specimens and targets with low copy number to be enriched, through selective destruction processing, only those target nucleic acid molecules that still retain the ring after the destruction can be obtained in the amplification stage after the destruction A lot of amplification products. So as to achieve the further amplification of the selective enrichment of specific molecules. The invention has certain application value in the analysis of animal and plant gene mutations and epigenetic mutations, and has certain application value in the monitoring of mutations of pathogenic microorganisms.

The invented technology adopts a brand-new technical scheme. First, the nucleic acid fragment to be tested is circularized, and then a specific type of circular nucleic acid is selectively destroyed, so as to distinguish whether the existence form of the molecule to be tested is circular or linear. This difference can be confirmed directly by the migration speed of nucleic acid electrophoresis; it can also be further processed by digesting linear nucleic acid and exonuclease V that retains circular nucleic acid to relatively enrich circular nucleic acid molecules; or by rolling circle amplification for circular nucleic acid The genotype corresponding to the molecule is amplified and enriched in absolute copy number.

Compared with the existing high-throughput sequencing library preparation technology, the patent of the present invention has the advantages of high enrichment efficiency and wide application range. It can be used for the enrichment of genetic mutations and methylation mutations. Many fields such as biomedicine and environmental monitoring have practical value.

Description of the drawings

The present invention will be further described below in conjunction with the drawings and embodiments:

Figure 1A is a schematic diagram of the detection method of the present invention and its downstream application flow. The cyclization and selective decyclization in the dashed box on the left side of FIG. 1 are the technical core of the present invention. This technology can achieve the different states of the nucleic acid molecules of the test specimen into circular and linear states. The downstream applications on the right show multiple application scenarios for distinguishing circular and linear nucleic acid molecules. The other techniques can be flight mass spectrometry, high pressure liquid phase, high resolution dissolution curve, etc.

Fig. 1B is a schematic diagram of another process of the detection method of the present invention. It shows that in the analysis of free nucleic acids in the blood, the linear molecules of specific genotypes can be enriched by the combined application of looping/breaking and rolling circle amplification, and the products after rolling circle amplification can be sequenced and analyzed in one step.

Figure 2A: Ring-forming and ring-breaking recognition of methylated and non-methylated synthetic templates.

Figure 2B shows the results of rolling circle amplification of methylated and unmethylated synthetic fragments after ring formation and destruction.

Fig. 3A shows the ring formation of the artificial methylated and non-methylated templates containing the three-terminal protruding A tail of Example 2.

Fig. 3B shows the rolling circle amplification after the destruction of the artificial methylated and unmethylated templates containing the three-terminal protruding A tail in Example 2.

Fig. 4 shows the loop-forming and breaking-recognition of the EGFR18 base deletion mutation in Example 3.

Fig. 5A is an electrophoresis diagram of rolling circle amplification in Example 4.

Fig. 5B is a sequence diagram of PCR amplification products of the mutant mixed specimen of Example 4.

Fig. 6A is an electrophoresis diagram of rolling circle amplification in Example 5.

FIG. 6B is a sequence diagram of PCR amplification products of the mutant mixed specimen of Example 5. FIG.

detailed description

In order to make the above-mentioned objects, features and advantages of the present invention more obvious and understandable, the specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings. In the following description, many specific details are explained in order to fully understand the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without departing from the connotation of the present invention. Therefore, the present invention is not limited by the specific embodiments disclosed below.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments, and are not intended to limit the present invention. The term "and/or" as used herein includes any and all combinations of one or more related listed items. The specific embodiments of the present invention will be described below in conjunction with the accompanying drawings.

Example 1: Artificial synthesis of 53-base-length methylated template and non-methylated template for loop-breaking recognition and rolling circle amplification

The 1.53bp methylated and unmethylated fragments are synthesized by Sangong Chemical, and their 5'phosphorylation is modified. The sequence of the synthesized fragment is as follows: Four primers are synthesized in the methylated region of Septin9, and the 5 end is phosphorylated, and /imedc/ is marked as A Base modification

1. Non-methylated template

1a: GATGGGAT C ATTTCGGACGTATCATGTCGGACCCCGCGGTCAACGCGCAGCTG (SEQ ID No. 1)

2b: AcgtCCGAAATGATCCCATCCAGCTGCGCGTTGACCGCGGGGTCCGACATGAT (SEQ ID No. 2)

2. Methylation template

3c:

GATGGGATCATTTCGGA/i5MedC/gtatcatgtcggaccc/i5MedC/G/i5MedC/GGTCAA/i5MedC/G/i5MedC/GCAGCTG(SEQ ID No.3)

4d:

a/i5MedC/gtCCGAAATGATCCCATCCAGCTG/i5MedC/G/i5MedC/GTTGAC/i5MedC/G/i5MedC/GGGGTCCGACATGAT(SEQ ID No.4)

The artificial template is characterized by flanking sticky ends containing more than 20 bases at both ends. The purpose of this design is to improve the efficiency of ligase loop formation and to test the feasibility of looping/breaking. Methylated and unmethylated fragments were dissolved in deionized water with a final concentration of 100μm. Take 2ul of methylated template, 2ul of unmethylated template, and a portion containing one-thousandth methylated template and one thousandth. The mixed template of 999 non-methylated templates is used for ligation reaction, and the reaction system is as follows:

Reaction conditions: 25°C, 2h; then 70°C, 20min, to inactivate T4 DNA ligase.

2. Add 1μl AciI restriction endonuclease to digest the ligation product, 37°C, 2h, 70°C, 20min to inactivate the AciI endonuclease.

3. The digested products were identified by gel electrophoresis, the electrophoresis conditions were 100V, 30min, 2% agarose gel. The results of electrophoresis are shown in Figure 2A.

Figure 2A: Ring-forming and ring-breaking recognition of methylated and non-methylated synthetic templates. Lane 1 from left to right is the nucleic acid size marker, and the smallest band is 100 bases. In increments of 100, the brightest band is 500 bases. Lanes 2, 3 are the products after the methylation membrane plate is connected and the products after AciI digestion; Lanes 4 and 5 are the products after the unmethylated template is connected and the products after AciI digestion; Lanes 6, 7 are the products containing thousands of points The mixed template of one of the methylated fragments is the product after ligation and AciI digestion. The synthesized fragment is 53 bases, and under the action of ligase, a single-copy to multi-copy circular structure with 53 as the basic unit is formed. Circular nucleic acids migrate slower than linear nucleic acids under the conditions of electrophoresis in this experiment. After AciI digestion, the methylated ring structure is not affected, and the unmethylated ring structure is degraded into a linear structure with 53 bases, 106 bases, and 159 bases. These linear fragments migrate faster under the electrophoretic field than the correspondingly sized circular structures. Through the coupling of ring formation and destruction, the methylated and unmethylated nucleic acid fragments are distinguished.

4. Dilute the above-mentioned enzyme digestion product by 1000 times and carry out rolling circle amplification. The amplification kit was purchased from Xinhai Gene Corporation (lot number A3702), and the system is as follows:

Reaction procedure: 95°C, 3min; 25°C, 5min; adding BSA and phi29, 30°C, 14h.

5. Take 5ul of rolling circle amplification product for electrophoresis identification, electrophoresis conditions are 100V, 30min, 0.8% concentration agarose gel. The results of electrophoresis are shown in Figure 3B.

Figure 2B: Rolling circle amplification results of methylated and non-methylated synthetic fragments after ring formation and destruction. Lane 1 is the nucleic acid size reference marker, the smallest band is 100 bases, and the brightest band is 500 bases. Lanes 2, 3, and 4 are the products after rolling circle amplification of methylated specimens, unmethylated specimens, and mixed specimens containing 1/1000 methylated fragments, respectively. Compared with unmethylated specimens, methylated specimens have significantly more amplified products. The amplified product of the mixed specimen (lane 4) was also significantly more than that of the unmethylated specimen (lane 3). The results show that rolling circle amplification differentiates the linear and circular specimens from ring formation and destruction, and performs differentiated amplification, so that the restriction endonuclease digestion step for selective destruction is transformed into specific genotypes. Amplification of the copy number of nucleic acid molecules.

Example 2: Artificial synthesis of 34-base long methylated template and non-methylated template after looping/breaking of rolling circle amplification enrichment

Take 2μl of methylated template, 2μl of unmethylated template, and a mixed template containing 1/1000 methylated template and 999/1000 unmethylated template, and connect them with hairpin adapters reaction. The template sequence is as follows:

Four primers, 5 end phosphorylation, /imedc/ marked as methylation modification

Full A1: Cacgtc/i5medc/gcgccgggcatacattatacgaagtta(SEQ ID No.5)

Full A 2: Aac ttc gta taa tgt atg ccc ggc g/i5medc/g gac gtg a (SEQ ID No. 6)

Non-A 3: Cac gtc cgc gcc ggg cat aca tta tac gaa gtt a (SEQ ID No. 7)

Non-A 4: Aac ttc gta taa tgt atg ccc ggc gcg gac gtg a (SEQ ID No. 8)

The hairpin linker sequence is as follows: P-aaa aaa aaa aag/i5medc/a/i5medc/a/i5medc/i5medc/gta/i5medc/t/i5medc/a/i5medc/t/i5medc/i5medc/gagttggatg/i5medc/ tgg atg gtt ttt ttt ttt t (SEQ ID No. 9). After confirming that the gel electrophoresis can observe the changes in ring formation and destruction, this set of templates and hairpin adapters were synthesized to simulate the actual situation of gene detection of free nucleic acids in the blood.

1. The connection reaction system is as follows:

Reaction conditions: 25°C, 2h; then 70°C, 20min, to inactivate T4 DNA ligase.

3. The digested products were identified by gel electrophoresis, the electrophoresis conditions were 100V, 30min, 2% agarose gel. The results of electrophoresis are shown in Figure 3A.

Figure 3A: The first lane on the left is the 100-base DNA size marker, and the two brightest bands are 500 and 1000 bases, respectively. Lanes 2, 5, and 7 are the mixture of short template and linker; after ligase linking, the linear template and two linkers are connected to form a circular structure, which is located near the size of the 100 base reference substance (lanes 3, 6, 9); the middle band is After the hairpin-shaped product connected to the template and a linker, after digestion with the restriction enzyme AciI, only the ring molecule formed by the methylated template still maintains the ring structure (lane 4). The loop structure formed by the unmethylated short template and the linker becomes linear again after AciI digestion, and two small fragments with a difference of 14 bases in molecular size overlap the same gel band. The smallest band still visible after ligase ligation and AciI digestion is the excess linker molecule. The above results indicate that the process of ring formation and destruction can distinguish between methylated and unmethylated nucleic acid molecules.

Reaction procedure: 95°C, 3min; 25°C, 5min; adding BSA and phi29, 30°C, 14h.

5. Take 5ul of rolling circle amplification product for electrophoresis identification, the electrophoresis conditions are 100V, 30min, 0.8% concentration agarose gel. The results of electrophoresis are shown in Figure 3B.

Figure 3B shows the rolling circle amplification after the ring is broken. A mixed sample containing one-thousandth of a methylated template yields visible amplification products (lane 2); pure methylated samples have the most amplification products (lane 4). There was almost no amplification product in the pure unmethylated template (lane 3).

Example 3: Identification of EGFR18 base deletion mutations.

1. Configuration of test template: prepare wild type, mutant type and 50% to 50% as test specimens. The template sequences are:

EGFR-exon19-wt:atctcacaattgccagttaacgtcttccttctctctctgtcatagGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCG TCGCTATCAAGGAATTAAGA GAAGCAACATCTCCGAAAGCCAACAAGGAAATCCTgtgtctggaccttctgtctggaccttccagtctggaccttccagtctggaccttccagtctggaccttcca ct ct in the figure (SEQ ct gtctggaccttcca gtctggaccttcca ctggacctcca)

EGFR-exon19-del18:

atctcacaattgccagttaacgtcttccttctctctctgtcatagGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAAT------------------CGAAAGCCAACAAGGAAATCCTCGATgtgagtttctgctttgctgtgtgggggtccatggctctctctgtgtggccggtccatggctctctctgtgtggggggtccatggctctctctgtgtggccdelection in the figure 11 (base in the figure is missing) ccatggctctgaacctcaggcccaccttct.

guide RNA transcription template:

GAATTCTAATACGACTCACTATAGCTTAATTCCTTGATAGCGAGTTTAAGAGCTATGCTGGAAACAGC (SEQ ID No. 12)

Use 5'primers with EcoRI restriction site to perform PCR reaction on the template to be tested. The primer sequences are:

Forward primer: ggaggaaTTC GGAGTGAGTACGGTGTGC CCCAGAAGGTGAGAAAGTT (SEQ ID No. 13) (the underline in the figure indicates the EcoRI restriction site);

Reverse primer: ggaggaaTTC GAGTTGGATGCTGGATGG agaaa ctc acat cgagg atttc (SEQ ID No. 14) (the underline in the figure is the EcoRI restriction site).

2. PCR reaction conditions are as follows:

The PCR reaction program is: 98°C, 30s; 98°C, 10s, 60°C, 15s, 72°C, 10s; 72°C, 3 minutes; the number of cycles is 35 times.

Take the purified PCR reaction product and digest it with restriction enzyme EcoRI. The digestion conditions are as follows:

Reaction conditions: 37℃, 1h

3. Treat the product after EcoRI digestion at 70°C for 20 minutes to inactivate EcoRI.

4. Pre-preparation of guide RNA: Use an in vitro transcription kit to transform the DNA template of guide RNA, and store it in aliquots at -80°C after purification. Carry out Cas9 nuclease in vitro digestion reaction: add 250ng guide RNA and 100ng Cas9 protein (Cas9 nuclease, S.pyogenes, NEB#M0386M) to the above digestion system, 37°C, 2 hours, then 70°C, 20 minutes, The Cas9 protein loses its activity.

5. Carry out gel electrophoresis on the DNA products after the above steps, the electrophoresis conditions are 100V, 30min, 2% agarose gel. The results of electrophoresis are shown in Figure 4.

Figure 4 shows the ring-forming and breaking recognition of EGFR18 base deletion mutations. Lane 1 is the nucleic acid size marker. Lanes 2, 5, and 8 are PCR products in a linear state. Lanes 3, 6, and 9 are the circular DNA linked by ligase, and the bands are lagging behind the linear DNA. Lanes 4, 7, and 10 are the products after cas9 digestion. The mutant products are not digested by cas9 (lane 4); wild products are digested by cas9 The circular DNA becomes linear (lane 7); the part of the circular DNA obtained from the wild mutant half of the template becomes linear, showing two nucleic acid bands (lane 10). Nucleic acid looping/breaking can distinguish EGFR18 base mutations from wild fragments.

Example 4: EGFR18 base deletion mutation analysis, cas9 digestion, containing one-thousandth mutation, rolling circle amplification first-generation sequencing

1. Prepare EGFR-19 exon wild-type (1pg), mutant (1pg), and 0.1% mutant PCR products as test specimens. The template sequence is:

EGFR-exon19-del18:

atctcacaattgccagttaacgtcttccttctctctctgtcatagGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAAT------------------CGAAAGCCAACAAGGAAATCCTCGATgtgagtttctgctttgctgtgtggccggtccatggctctgaacctcaggccggtccatggctctctctgtgtggccdelection of bases in the figure 11 (bp gt ct ctctgaacctcaggcccaccttct18)

guide RNA transcription template: GAATTCTAATACGACTCACTATAGCTTAATTCCTTGATAGCGAGTTTAAGAGCTATGCTGGAAACAGC (SEQ ID No. 12)

2. Use 5'primers with EcoRI restriction sites to perform PCR reaction on the template to be tested. The primer sequences are:

Reverse primer: ggaggaaTTC GAGTTGGATGCTGGATGG agaaa ctc acat cgagg atttc (SEQ ID No. 14) (the underline in the figure indicates the EcoRI restriction site).

The PCR reaction conditions are as follows:

3. Take the purified PCR reaction product and digest it with restriction enzyme EcoRI. The digestion conditions are as follows:

Reaction conditions: 37°C, 1 hour.

4. Treat the digested product of EcoRI at 80 degrees Celsius for 20 minutes to inactivate EcoRI.

5. Pre-preparation of guide RNA: Use an in vitro transcription kit to transform the DNA template of guide RNA, and store it in aliquots at -80°C after purification. Carry out Cas9 nuclease in vitro digestion reaction: add 250ng guide RNA and 100ng Cas9 protein (Cas9 nuclease, S.pyogenes, NEB#M0386M) to the above digestion system, 37°C, 2 hours, then 70°C, 20 minutes, The Cas9 protein loses its activity.

6. Dilute the above-mentioned enzyme digestion product by 1000 times, and carry out rolling circle amplification. The amplification kit was purchased from Xinhai Gene Corporation (batch number A3702). The system is as follows:

Reaction procedure: 95°C, 3min; 25°C, 5min; adding BSA and phi29, 30°C, 14h.

7. Take 5μl of rolling circle amplification products for electrophoresis identification, the electrophoresis conditions are 100V, 30min, 0.8% concentration agarose gel. The results of electrophoresis are shown in Figure 5A. It can be seen from Figure 5A that after rolling circle amplification, wild, mutant, and mixed specimens with a small amount of mutations can be clearly distinguished. The most amplified product mutant specimens (lane 2), mixed specimens have obvious amplified long fragment band products (lane 4), wild specimens only saw a very small amount of long fragment amplified products and a few ultra-long amplified products remained in the sample Inside the hole (lane 3).

The final PCR amplification product of the mixed sample containing one-thousandth mutation is sent to the company for first-generation sequencing. The sequencing result is shown in Figure 5B. Sequencing diagram: The first-generation sequencing result shows that the sample containing one-thousandth mutation template is the product of rolling circle amplification. Appears as a single peak of the mutant sequence. It shows that after the three steps of looping/breaking/rolling circle amplification, the mutant fragments are enriched.

Example 5: EGFRT790M 2369C>T hot spot mutation analysis

1. Prepare EGFR790 wild-type (1pg), mutant (1pg), and 0.1% mutant PCR products as test specimens. The template sequences are:

EGFR790-wt:

TCTCCCTCCCTCCAGGAAGCCTACGTGATGGCCAGCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCA C GCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATATTGGCTCCCAGTACCTGCTCAACTGGTG (the base line in the figure below is the base line with the base No. ID in the SEQ ID No.

EGFR790-mut:

TCTCCCTCCCTCCAGGAAGCCTACGTGATGGCCAGCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCATCTGCCTCACCTCCACCGTGCAGCTCATCA T GCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATATTGGCTCCCAGTACCTGCTCAACTGGTG is the base line in the figure with the base line No. in the SEQ ID No.

Forward primer: GGAG GAATTC GTTATCAGTTATCTCCACCGTGCAGCTCATCC (SEQ ID No. 17) (marked as EcoRI restriction site in the figure, C is the introduced mutation base); and

Reverse primer: GGAG GAATTC GTTATCAGTTATAGCCGAAGGGCATGAGCTCC (SEQ ID No. 18) (marked as EcoRI restriction site in the figure, C is the introduced mutation base).

The PCR reaction conditions are as follows:

The PCR reaction program is: pre-denaturation: 95°C, 3min; 95°C, 20s, 58°C, 20s, 72°C, 20s; 72°C, 3min; the number of cycles is 35 times.

3. Purify the PCR reaction product and digest it with the restriction enzyme EcoRI. The digestion conditions are as follows:

Reaction conditions: 37°C, 1 hour

5. The above endonuclease digestion products are subjected to cyclization treatment; the cyclization reaction conditions are as follows:

Add ATP with a final concentration of 1mM and 0.4μl T4 DNA ligase at 25°C for 1 hour, followed by treatment at 70°C for 20 minutes to inactivate T4 DNA ligase.

6. The product after cyclization is digested with restriction enzyme NciI, and the digestion conditions are as follows:

Add 0.4ul NciI restriction endonuclease and treat it at 37°C, 1h, 70°C, 20 minutes to inactivate NciI.

7. Take 0.1ul of the digested product for rolling circle amplification, and the amplification conditions are as follows:

Reaction procedure: 95°C, 3 minutes; 25°C, 5 minutes; adding BSA and phi29, 30°C, 14 hours.

For electrophoresis of rolling circle amplification products, the electrophoresis conditions were 100V, 30 minutes, and 0.8% agarose gel. The results of gel electrophoresis are shown in Figure 6A: Lane 2 is a mixed template containing one-thousandth mutations, Lane 3 is a mutant template, and Lane 4 is a wild template. Wild template amplification products are the least. The first lane on the left is the kb DNA marker. After rolling circle amplification, there were significantly more rolling circle amplification products containing one-thousandth of the mutant mixed template (lane 2) and mutant template (lane 3) than the wild specimen (lane 4). The amount of product after rolling circle amplification was significantly different among the three specimens.

The rolling circle amplification products of the mixed sample containing one-thousandth mutations were subjected to first-generation sequencing, and the sequencing results are shown in Figure 6B.

Figure 6B: After sequencing, the rolling circle amplification product of the mixed sample containing 0.1% mutant template was confirmed to be derived from the mutant template and did not show a mixed set of peaks, indicating that the content of mutant molecules in the amplified product was enriched.

The basic principles, main features and advantages of the present invention have been shown and described above. Those skilled in the industry should understand that the present invention is not limited by the above examples. The above examples and descriptions only illustrate the principles of the present invention. The present invention will have various changes without departing from the spirit and scope of the present invention. And improvements, these changes and improvements all fall within the scope of the claimed invention. The scope of protection claimed by the present invention is defined by the appended claims and their equivalents.

Claims

The methods for detecting trace amounts of nucleic acids in a variety of mixed nucleic acids include the following steps:

(1) The linear nucleic acid molecules in the sample to be tested are circularized,

(2) Carry out selective destruction treatment on the circularized nucleic acid, so that the nucleic acid target that does not need to be enriched in the sample to be tested changes from circular nucleic acid to linear nucleic acid,

(3) Detect and identify the nucleic acid molecules obtained in step (2), and detect whether the remaining form is linear nucleic acid or circular nucleic acid.
The method for detecting trace amounts of nucleic acid according to claim 1, wherein when the nucleic acid target to be identified and enriched is a large number of unknowns with different lengths, before step (1), the sample to be tested Fill in the end of the linear nucleic acid molecule in A, and then link the linker with a nucleic acid ligase to form a circularized nucleic acid.
The method for detecting trace amounts of nucleic acid according to claim 1, wherein when the nucleic acid to be identified and enriched is a known and determined number of targets, before step (1), a 5'end band restriction is used. The primers of the sex endonuclease site are amplified, and then the amplified product is treated with the corresponding endonuclease, and then the nucleic acid ligase is used to form circularized nucleic acid.
The method for detecting trace amounts of nucleic acid according to claim 1, wherein when the nucleic acid to be enriched is a known number of targets, before step (1), a LoxP site at the 5'end is used The primers are amplified, and then the recombination function of cre recombinase is used to form circular nucleic acid.
The method for detecting trace amounts of nucleic acid according to claim 1, wherein in step (2), the nuclease with endonuclease function is a natural endonuclease or a genetically engineered endonuclease.
The method for detecting trace amounts of nucleic acid according to claim 1, wherein in step (3), the method of identifying whether the remaining form of the nucleic acid molecule to be tested is linear or circular, including electrophoresis, exonuclease Excision method, PCR amplification method, rolling circle amplification method, flight mass spectrometry, high pressure liquid method, high resolution melting curve.
The method for detecting trace amounts of nucleic acid according to claim 1, wherein the sample to be tested after selective destruction is subjected to rolling circle amplification.