CN103131779A

CN103131779A - Enzyme digestion enriched PCR method used in noninvasive detection of epidermal growth factor receptor T790M mutation

Info

Publication number: CN103131779A
Application number: CN 201310058245
Authority: CN
Inventors: 何臣
Original assignee: SHENZHEN BAOAN DISTRICT PEOPLE'S HOSPITAL
Current assignee: SHENZHEN BAOAN DISTRICT PEOPLE'S HOSPITAL
Priority date: 2013-02-25
Filing date: 2013-02-25
Publication date: 2013-06-05

Abstract

The invention relates to an enzyme digestion enriched PCR method used in noninvasive detection of epidermal growth factor receptor T790M mutation, and belongs to the field of molecular biology. The invention aims at solving a clinical application bottleneck problem of NSCLC patient EGFR gene T790M mutation detection. According to the nucleotide differences between EGFR gene T790M mutant and wild-type sequences, proper PCR primers are designed, and are introduced into specific restriction endonuclease site during a PCR amplification process, and the EGFR gene T790M mutation enzyme digestion enriched PCR method is established. The method provided by the invention is mainly advantages in that: time required by the detection method is greatly shorter than that of common sequencing technologies; target sequence PCR amplification is carried out by using an enzyme digestion enriching method, and is used in detection, such that the interference caused by a large amount of wild-type sequence in the product to the detection result is avoided; the detection method steps are simple; a second-round PCR product is analyzed through mutant gene fragment specific restriction endonuclease digestion, such that mutant gene sequence can be accurately detected, and detection accuracy can be greatly improved; sampling is convenient, patient pain is low, and dynamic detection can be carried out.

Description

A kind of enzyme without wound detection EGF-R ELISA T790M sudden change is cut enrichment PCR method

Affiliated technical field

The invention belongs to biology field, relate to medical science and biotechnology, what be specifically related to is to cut enrichment PCR method without the enzyme of wound detection EGF-R ELISA T790M sudden change.

Background technology

Nonsmall-cell lung cancer (non small cell lung cancer, NSCLC) be a kind of common malignant tumour, sickness rate is the trend that raises year by year in the world, has become the one of the main reasons of cancer-related disease death in China and even worldwide.NSCLC is all insensitive to conventional chemicotherapy, before increases although second and third chemotherapeutics take platinum class and Japanese yew class as representative has been proved to be curative effect in generation, and for most of end-stage patients, overall existence benefits and is little.In recent years, along with constantly illustrating NSCLC cellular abnormality signal transduction pathway, EGF-R ELISA take Gefitinib as representative (epidermal growth factor receptor, the EGFR) effect of tyrosine kinase inhibitor in improving advanced NSCLC patient curative effect and quality of life obtained the abundant affirmation of multicenter, international clinical study.Yet, the overall efficient of treated with gefitinib is only 10%～30%, and further molecule genetics research confirms: NSCLC(exons 19 disappearances and the exon 2 1L858R sudden change of Gefitinib to having the sudden change of EGFR kinases provincial characteristics) the patient's EGFR of being better than gene evident in efficacy NSCLC patient that is wild-type (after existing the patient of EGFR gene extron 19 disappearances and exon 2 1L858R sudden change to accept treated with gefitinib, objective remission rate is brought up to 65%-94%).Regrettably, even if the patient has the EGFR transgenation, along with the prolongation for the treatment of time finally all inevitably produces the Gefitinib acquired resistance and causes progression of disease; And the Gefitinib price is very expensive, the patient takes month needs 10000 yuan of left and right, and non-essential treated with gefitinib also might produce severe side effect as the lethality interstitial pneumonia in addition.Therefore set up the major issue of earnestly hoping clinically solution that becomes that special, the simple and easy to do methods for clinical diagnosis of a kind of sensitivity is predicted treated with gefitinib NSCLC patient acquired resistance exactly.

NSCLC is complicated to the molecular mechanism of Gefitinib acquired resistance, what obtain at present generally admitting is T790M sudden change and the amplification of c-MET proto-oncogene of EGFR gene extron 20, and wherein approximately the patient's treated with gefitinib acquired resistance more than 50% is relevant with tumour cell EGFR gene T790M sudden change; And the evaluation of c-MET gene amplification need be carried out fluorescence in situ hybridization, and technical requirements is high, and complex operation is expensive, requires high to detecting sample.Further also proof of research: the curative effect that the EGFR gene T790M sudden change before the NSCLC patient treatment and patient accept after treated with gefitinib is remarkable negative correlation, therefore suddenlys change by detecting EGFR gene T790M that what predict exactly treated with gefitinib NSCLC patient acquired resistance is practicable laboratory diagnosis method in clinical practice.

The detection sample of at present NSCLC patient EGFR gene T790M sudden change comes from bronchofiberscope more, through skin lung fine needle aspiration biopsy sample or diagnosis of pleural effusion sample, thereby, the detection of EGFR gene T790M sudden change only is confined to carry out through bronchofiberscope, through skin lung fine needle aspiration biopsy or have in the some patients were of hydrothorax, and cancerous lung tissue is obviously heterogeneous, and can a small amount of sample of fine needle aspiration biopsy represent that the genetics variation of whole tumor tissues still remains further to be studied to confirm.Therefore, in the urgent need to carry out EGFR gene T790M sudden change diagnosis by sampling method more convenient, that patient compliance is good.

Research has been found that: noumenal tumour usually has a small amount of cancer cells to come off from primary tumo(u)r in the formation and development process to enter blood circulation, cause the free nucleic acid content of blood of cancer patients to be significantly higher than healthy population, and the free nucleic acid of peripheral blood have identical heritable variation with the genomic dna of primary tumo(u)r.But the free nucleic acid in peripheral blood may only have very small amount of mutator gene, and contains a large amount of wild type genes, and a large amount of wild type genes that wherein mix can hinder detecting of mutator gene, needs extremely sensitive special detection in Gene Mutation technology.Reported at present that the method that is applied to EGFR gene T790M sudden change detection has pcr amplification product direct sequencing, Taqman probe, PCR-SSCP, amplification retardance sudden change detection system etc., aforesaid method cuts both ways, clinically fail to carry out the major cause that the EGFR sudden change detects and be to be difficult to accomplish that the method for sampling is convenient, the easy sensitivity of method is special and need not the special aspects such as plant and instrument and take into account simultaneously.Therefore, if free mutant nucleic acid in effective enrichment peripheral blood just can solve the clinical application bottleneck problem that NSCLC patient EGFR gene T790M sudden change detects.

Mutant enzyme is cut enrichment PCR method by adopting wild-type and mutant specific restriction enzyme, selective removal wild-type sequence segment, the amplification mutant nucleotide sequence, detect the hit sensitivity of target tumor nucleic acid of blood thereby greatly improved, can reach 0.1%[15 to the limit of detection of mutant target gene]; According to this principle, the present invention is according to the difference of EGFR gene T790M mutant and wild-type sequence base, import specific restriction enzyme cut the site in the pcr amplification process by designing suitable PCR primer, set up EGFR gene T790M mutant enzyme and cut enrichment PCR method.

Summary of the invention

One of purpose of the present invention is to be provided for to cut enrichment PCR method without creating the enzyme that detects EGFR gene T790M sudden change, and for achieving the above object, the applicant adopts technical scheme as follows:

1, take patient's peripheral blood sample, separated plasma/serum extracts free nucleic acid;

2, using free nucleic acid uses primer ex20-S1 and ex20-AS1 to carry out first round pcr amplification as amplification template:

A. by observing the difference of EGFR gene T790M mutant and wild-type sequence base:

EGFR gene T790M wild-type sequence:

5’-actgacgtgcctctccctccctccaggaagcctacgtgatggccagcgtggacaaccccc acgtgtgccgcctgctgggcatctgcctcacctccaccgtgcagctcatca cgcagctcatgcccttcg-3’

EGFR gene T790M mutant sequence:

5’-actgacgtgcctctccctccctccaggaagcctacgtgatggccagcgtggacaacccccacgtgtgccgcctgctgggcatctgcctcacctccaccgtgcagctcatca tgcagctcatgcccttcg-3’

Both difference be tract " CgcaGctcatgcccttcg-3 ' " and " TgcaGctcatgcccttcg-3 ' " first base site; therefore; one of ex20-AS1 primer 3 ' penultimate base site design by the base mismatch (as Green Marker as shown in) of T to G, thereby in the EGF-R ELISA wild-type sequence first round pcr amplification product importing BstUI restriction enzyme site (CGCG gene order).

B. utilize primer ex20-S1 and ex20-AS1 to obtain first round pcr amplification product sequence:

EGFR gene T790M wild-type:

5’-actgacgtgcctctccctccctccaggaagcctacgtgatggccagcgtggacaacccccacgtgtgccgcctgctgggcatctgcctcacctccaccgtgcagctcatca cgcggctcatgcccttcg-3’

EGFR gene T790M mutant:

5’-actgacgtgcctctccctccctccaggaagcctacgtgatggccagcgtggacaacccccacgtgtgccgcctgctgggcatctgcctcacctccaccgtgcagctcatca tgcggctcatgcccttcg-3’

3, restriction enzyme 1 selective enzyme restriction enrichment first round PCR product, this endonuclease capable selective enzyme restriction is removed wild type gene fragment in first round PCR product, thereby reaches the purpose of enrichment mutant gene sequence;

4, using first round PCR product accepts enzyme after the BstUI enzyme is cut and cuts product and use primer ex20-S2 and ex20-AS2 to carry out second as amplification template to take turns pcr amplification:

C. by contrasting the difference of EGFR gene T790M mutant and wild-type sequence first round PCR product base:

First round pcr amplification product sequence

EGFR gene T790M wild-type:

5’-actgacgtgcctctccctccctccaggaagcctacgtgatggccagcgtggacaacccccacgtgtgccgcctgctgggcatctgcctcacctccaccgtgcagctcat

cccttcg-3’

EGFR gene T790M mutant:

cccttcg-3’

can find the sudden change due to EGFR gene T790M, newly produced a Hin1 II restriction enzyme site (CATG gene order) in EGFR gene T790M mutant, shown in square frame, therefore there is the potential possibility of utilizing Hin1 II restriction enzyme digestion to come specific detection EGFR gene T790M sudden change whether to exist, yet 3 ' 11 base places reciprocal at first round pcr amplification product, EGFR gene T790M mutant or all there is a Hin1 II restriction enzyme site in the wild-type product no matter, shown in square frame, thereby disturbed greatly the judgement of result, therefore, we one of ex20-AS2 primer 3 ' the 7th base site design reciprocal by the base mismatch of G to C, thereby selective removal 3 ' 11 the base Hin1 of place II restriction enzyme sites reciprocal of first round pcr amplification product, and then can make and use Hin1 II restriction enzyme specific enzymes and cut second and take turns mutant gene fragment in the PCR product, reach specific detection mutant gene sequence and become possibility.

That uses D. that primer ex20-S2 and ex20-AS2 amplification obtains second takes turns the pcr amplification product sequence and is:

EGFR gene T790M wild-type:

5’-actgacgtgcctctccctccctccaggaagcctacgtgatggccagcgtggacaacccccacgtgtgccgcctgctgggcatctgcctcacctccaccgtgcagctcat cacgcggctgatgcccttcg-3’

EGFR gene T790M mutant:

5’-actgacgtgcctctccctccctccaggaagcctacgtgatggccagcgtggacaacccccacgtgtgccgcctgctgggcatctgcctcacctccaccgtgcagctcat catgcggctgatgcccttcg-3’

5,5.. restriction enzyme 2 specific enzymess are cut second and are taken turns the PCR product, and this endonuclease capable specific enzymes is cut second and taken turns mutant gene fragment in the PCR product, reaches the purpose of specific detection mutant gene sequence;

6, enzyme is cut the capable native polyacrylamide gel electrophoresis-Yin of product and dye analysis;

7, EGFR gene T790M mutant and wild type gene sequence second are taken turns the PCR product and be rendered as respectively the 103bp(mutant after restriction enzyme digestion and electrophoresis) and the 120bp(wild-type) size enzyme cut the product fragment, therefore, whether can differentiate clearly that according to the appearance of 103bp size electrophoresis product whether EGFR gene T790M suddenlys change.

Further, above-mentioned steps two described pcr amplification primer ex20-S1 and ex20-AS1 sequence are as follows,

The primer title	Primer sequence
		ex20-S1	5’-ACTGACGTGCCTCTCCCTCC-3’
ex20-AS1	5’-CGAAGGGCATGAGCC GC-3’

Further, described restriction enzyme 1 is restriction enzyme BstUI, and it is the CGCG gene order that enzyme is cut sequence.

Further, above-mentioned steps four described pcr amplification primer ex20-S2 and ex20-AS2 sequence are as follows:

The primer title	Primer sequence
		ex20-S2	5’-CCTCCAGGAAGCCTACGTGA-3’
ex20-AS2	5’-CGAAGGGCAT CAGCCGC-3’

。

Further, described restriction enzyme 2 is restriction enzyme Hin1 II, and it is the CATG gene order that enzyme is cut sequence.

Major advantage of the present invention is:

1, the needed time of detection method provided by the present invention well below sequencing technologies commonly used, meets clinical needs especially.

2, the present invention's method of adopting enzyme to cut enrichment carry out target sequence pcr amplification so that for detection of, avoided the interference that in the product, a large amount of wild-type sequences cause detected result.

3, detection method step of the present invention is simple, thereby many uncertain factors of existing in the complex operations process have been avoided, and use mutant gene fragments specific restriction analysis second to take turns the PCR product and reach accurate detection mutant gene sequence, thereby can greatly improve Detection accuracy.

4, detection method provided by the present invention can detect the EGFR gene T790M sudden change in the blood of cancer patients sample, thereby it is convenient to have a sampling, and patient's misery is little, advantage that can detection of dynamic.

Description of drawings

Fig. 1 is technical schematic diagram of the present invention.

Fig. 2 is KODAK2000R gel imaging system imaging results in embodiment 1.

Fig. 3 detects second of the sudden change positive or wild type gene sequence to take turns PCR product cloning direct Sequencing result in embodiment 1.

Fig. 4 be EGFR gene T790M mutant enzyme cut enrichment PCR method to the plasmid that will contain EGFR gene T790M mutant and wild-type by 1: 0,1:1,1:10,1:100,1:500,1:1000, the sample that the ratio of and1:2000 and 0: 1 is mixed carries out detected result.

Embodiment:

The main agents formula

1、0.5mol/L EDTA （PH：8.0）

Na2EDTA·2H2O 186.1g

Add tri-distilled water to 800ml, vigorous stirring on magnetic stirring apparatus, NaOH regulates pH value to 8.0, is settled to 1L, and the packing autoclaving is standby.

2、 TE（PH：8.0）

1M Tris.CL （PH：8.0） 10ml

0.5M EDTA（PH：8.0） 2ml

3、TAE（50×）

Tris alkali 242g

Glacial acetic acid 57.1ml

0.5M EDTA（PH：8.0） 100ml

Add tri-distilled water to 1000ml, vigorous stirring on magnetic stirring apparatus, the packing autoclaving is standby.

4、 TBE(5×)

Tris alkali 54g

Boric acid 27.5g

0.5M EDTA（PH：8.0） 20ul

5,2% agarose gel

Agarose 2g

TBE 100ml

Add EB 5ul encapsulating to be used for the evaluation of plasmid DNA and PCR product after the microwave-oven-heating dissolving

6,30% acrylamide glue

Acrylamide 29g

Bisacrylamide 1g

Add tri-distilled water to 60ml, be heated to 37 ℃ of dissolvings, add water distilled water and be settled to 100ml.The pH value of solution should be not more than 7.0, puts to be stored in 4 ℃ in brown bottle.

Use the polyacrylamide gel liquid formula of 12% fresh configuration:

7, developing solution

Anhydrous sodium carbonate 22.9g

Add tri-distilled water to 1000ml

Room temperature keeps in Dark Place.

Embodiment 1

Use EGFR gene T790M mutant enzyme provided by the invention cut enrichment PCR method to Patients with Non-small-cell Lung Gefitinib resistance after the detection of plasma specimen.

1, the free nucleic acid extraction of plasma specimen:

(1) collection of plasma specimen, processing and preservation:

1) gather patient's sample before feed after rising morning, after the routine disinfection patient skin, extract approximately 2.5ml of patient's ulnar vein blood with the 5ml disposable syringe, at once inject 5ml routine blood test pipe, send the laboratory to be for further processing sample rapidly;

2) low speed centrifuge in 3000rpm centrifugal 15 minutes after trim;

3) take out lightly test tube, draw upper plasma with 1ml single track adjustable pipette, be sub-packed in the 0.5ml centrifuge tube with 300ul, indicate numbering according to the sample registration;

4) preserve the standby or extracting DNA at once of above-mentioned plasma specimen in-80 ℃.In above standby sample preservation process, strictly note preservation condition, prevent multigelation.

(2) the plasma specimen dissociative DNA extracts:

Extract in a small amount test kit explanation slightly modified with reference to AxyPrep whole blood genome, detailed step is as follows:

1) add 500ul AP1 damping fluid in the 1.5ml micro-centrifuge tube;

2) add 300ul to thaw or fresh plasma, serum and hydrothorax supernatant, the vortex oscillator shook at a high speed 10 seconds, fully mixing;

3) add 100ul AP2 damping fluid, the vortex oscillator shook at a high speed 10 seconds, fully mixing;

4) under room temperature 12, centrifugal 10 minutes of 000rpm

5) carefully draw the 4th step gained supernatant and add (adsorption column AxyPrep places in the 2ml collection tube in advance) in adsorption column AxyPrep, attention can not spill reagent on lid or edge, cover lid, with

Centrifugal 1 minute of 6000rpm outwells the waste liquid in collection tube;

6) open gently adsorption column AxyPrep lid, add 800ul damping fluid W2, attention can not spill reagent on lid or edge, and cover lid with 12,000rpm centrifugal 1 minute, discards waste liquid;

7) open gently adsorption column AxyPrep lid, add 500ul damping fluid W2, attention can not spill reagent on lid or edge, and cover lid with 12,000rpm centrifugal 1 minute, discards waste liquid;

8) adsorption column AxyPrep is put back in the sky collection tube centrifugal 1 minute of 12,000rpm;

9) adsorption column AxyPrep is put back to the 1.5ml centrifuge tube, add 40ul damping fluid TE, placed 1 minute centrifugal 1 minute of 12,000rpm under room temperature;

2, EGFR gene T790M mutant enzyme is cut the enrichment pcr analysis:

(1) carry out first round pcr amplification:

1) the PCR reaction system is as follows:

2) PCR reaction conditions:

(2) first round PCR product B stUI enzyme is cut, is built reaction system by following condition:

Hatch 2 hours enzymes for 37 ℃ and cut first round PCR product, then hatch 20 minutes lower deactivation BstUI enzymes for 65 ℃.

(3) the preparation enzyme is cut the product nest-type PRC

1) the PCR reaction system is as follows:

2) PCR reaction conditions:

(4) carry out second and take turns PCR product Hin1 II enzyme and cut, build reaction system by following condition

Hatch 2 hours enzymes for 37 ℃ and cut second and take turns the PCR product, then hatch 20 minutes deactivation Hin1 II enzymes for 65 ℃.

(5) second take turns the analysis of PCR product native polyacrylamide gel electrophoresis:

1) join glue: press the preparation of dosage shown in agent prescription 12% polyacrylamide gel, polymerized at room temperature 30-60 minute, treat that polymerization is placed in the electrophoresis chamber that fills 1 * TBE electrophoretic buffer fully.

2) electrophoresis: get the 3ulPCR product, or DNA marker3ul, add 0.6ul6 * loading buffer mixing, add well, voltage 80V(8V/cm) when electrophoresis moves to desired location to marker dye, finish electrophoresis

3) silver dyes: the main method that provides with reference to " molecular cloning experiment guide " (third edition) is carried out

4) electrophoresis complete after, the gel that still sticks on sheet glass is inserted the vinyl disc that dyes for silver;

5) in distilled water, rinsing is removed electrophoretic buffer twice;

6) carry out gel in 10% ethanolic soln and fix 10 minutes, slightly concussion, absorb 10% ethanol and repeat once on shaking table;

7) absorb ethanolic soln, add 0.7% salpeter solution to just covering gel, slight concussion is 6 minutes on shaking table, absorbs salpeter solution and with twice of distilled water rinsing;

8) add 0.2% silver nitrate solution to just covering gel, the slight concussion 30 minutes on shaking table of room temperature lucifuge is with distilled water rinsing gel and dyeing dish three times;

9) add in the dyeing dish add the formaldehyde solution of 125ul in the 100ml developing solution after, when slight concussion dyeing is coiled to the solution yellowing under non-direct projection light, again change mentioned solution, continuation is slightly concussion under non-direct projection light, and the appearance of monitoring band and background, when signal to noise ratio reaches maximum, remove mentioned solution;

10) add 3% acetic acid solution, slightly shook 5 minutes;

11) remove 3% acetic acid solution, the ethanolic soln detergent gel twice with 10%, each 2 minutes;

12) KODAK2000R gel imaging system imaging analysis.

3, interpretation of result:

EGFR gene T790M mutant and wild type gene sequence second are taken turns the PCR product and be rendered as respectively the 120bp(wild-type after restriction enzyme digestion and electrophoresis) and the 103bp(mutant) size enzyme cut the product fragment, according to this result of determination, in the 6 increments bases that this enforcement detects, there is EGFR gene T790M sudden change in 4 routine samples.Test result as shown in Figure 2.

Further will detect second of the sudden change positive or wild type gene sequence and take turns PCR product cloning direct Sequencing, result fits like a glove, and test result as shown in Figure 3.

[0138Embodiment 2

Use EGFR gene T790M mutant enzyme in embodiment 1 cut enrichment PCR method to the plasmid that will contain EGFR gene T790M mutant and wild-type by 1: 0,1:1,1:10,1:100,1:500,1:1000, the sample that the ratio of and1:2000 and 0: 1 is mixed detects.Specific implementation method is with example 1, and result shows: enzyme is cut enrichment PCR method can detect a T790M mutant gene that is mingled in 1000 wild type genes, and result as shown in Figure 4.

Claims

1. the enzyme without wound detection EGF-R ELISA T790M sudden change is cut enrichment PCR method, it is characterized in that, operation steps is as follows:

1.. take patient's peripheral blood sample, separated plasma/serum extracts free nucleic acid;

2.. use free nucleic acid and use primer ex20-S1 and ex20-AS1 to carry out first round pcr amplification as amplification template;

3.. restriction enzyme 1 selective enzyme restriction is removed wild type gene fragment in first round PCR product, reaches enrichment T790M mutant gene product;

4.. use first round PCR product and accept enzyme after the BstUI enzyme is cut and cut product and use primer ex20-S2 and ex20-AS2 to carry out second as amplification template to take turns pcr amplification:

5.. restriction enzyme 2 specific enzymess are cut second and are taken turns T790M mutant gene fragment in the PCR product, reach the specific detection mutant gene;

6.. enzyme is cut the capable native polyacrylamide gel electrophoresis-Yin of product dye analysis, differentiate that whether EGFR gene T790M suddenlys change.

2. a kind of enzyme without wound detection EGF-R ELISA T790M sudden change as claimed in claim 1 is cut enrichment PCR method, it is characterized in that, described pcr amplification primer ex20-S1 and ex20-AS1 sequence are as follows:

Primer title: ex20-S1 sequence: 5 '-ACTGACGTGCCTCTCCCTCC-3 '

Primer title: ex20-AS1 sequence: 5 '-CGAAGGGCATGAGCCGC-3 '.

3. a kind of enzyme without wound detection EGF-R ELISA T790M sudden change as claimed in claim 1 is cut enrichment PCR method, it is characterized in that, described restriction enzyme 1 is restriction enzyme BstUI, and it is the CGCG gene order that enzyme is cut sequence.

4. a kind of enzyme without wound detection EGF-R ELISA T790M sudden change as claimed in claim 1 is cut enrichment PCR method, it is characterized in that, described pcr amplification primer ex20-S2 and ex20-AS2 sequence are as follows:

Primer title: ex20-S2 sequence: 5 '-CCTCCAGGAAGCCTACGTGA-3 '

Primer title: ex20-AS2 sequence: 5 '-CGAAGGGCATCAGCCGC-3 '.

5. a kind of enzyme without wound detection EGF-R ELISA T790M sudden change as claimed in claim 1 is cut enrichment PCR method, it is characterized in that, described restriction enzyme 2 is restriction enzyme Hin1 II, and it is the CATG gene order that enzyme is cut sequence.