WO2021242051A1 - Nouvelle souche leuconostoc sp. et procédé de bioconversion de la paeoniflorine l'utilisant - Google Patents

Nouvelle souche leuconostoc sp. et procédé de bioconversion de la paeoniflorine l'utilisant Download PDF

Info

Publication number
WO2021242051A1
WO2021242051A1 PCT/KR2021/006692 KR2021006692W WO2021242051A1 WO 2021242051 A1 WO2021242051 A1 WO 2021242051A1 KR 2021006692 W KR2021006692 W KR 2021006692W WO 2021242051 A1 WO2021242051 A1 WO 2021242051A1
Authority
WO
WIPO (PCT)
Prior art keywords
paeoniflorin
strain
extract
peony
present
Prior art date
Application number
PCT/KR2021/006692
Other languages
English (en)
Korean (ko)
Inventor
김창진
이종민
김춘식
박동진
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Publication of WO2021242051A1 publication Critical patent/WO2021242051A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/44—Preparation of O-glycosides, e.g. glucosides
    • C12P19/46—Preparation of O-glycosides, e.g. glucosides having an oxygen atom of the saccharide radical bound to a cyclohexyl radical, e.g. kasugamycin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Definitions

  • the present invention relates to a novel Leukonostok sp. strain and a bioconversion method of paoniflorin using the same, and more particularly, to a method for converting paoniflorin into ⁇ -gentiobiosyl paeoniflorin. It relates to a Leuconostoc sp. LN180020 strain showing bioconversion ability and a bioconversion method of paoniflorin using the same.
  • Paeoniflorin is a glycoside (Tetrahedron 25(9):1825-38) extracted from the root of Paeonia lactiflora Pall.
  • paoniflorin it has been reported that it suppresses ovarian androgen production.
  • it inhibits the inflammatory response of the peripheral nerves and brain, thereby selectively inhibiting the brain neuroprotective action against stroke and the activation of microglia by selectively inhibiting the activation of microglia.
  • metabolic syndrome such as antidiabetic and antiobesity, as well as reports that it weakens the tolerance.
  • paoniflorin has a limitation that it is not sufficient to exhibit a physiologically effective effect.
  • the present inventors repeated intensive research to develop a new transformant with improved physiological activity of paoniflorin, an indicator material of peony, by metabolizing or improving the peony extract.
  • the genus Leuconostoc sp. isolated from kimchi. the peony extract is fermented with LN180020 (KCTC 13719BP)
  • paoniflorin is converted to ⁇ -gentiobiosyl paeoniflorin
  • the ⁇ -gentiobiosyl paeoniflorin is converted to paeoniflorin It was found that it exhibits improved physiological activity compared to , and completed the present invention.
  • It is therefore an object of the present invention is to provide a flow in the Pocono stock (Leuconostoc sp.) LN180020 strain deposited as accession number KCTC13719BP.
  • Another object of the present invention is to provide a bioconversion composition for converting paeoniflorin containing the strain or its culture solution into ⁇ -gentiobiosyl paeoniflorin.
  • Another object of the present invention is to provide a bioconversion composition for converting paeoniflorin consisting of the strain or its culture solution into ⁇ -gentiobiosyl paeoniflorin.
  • Another object of the present invention is to provide a bioconversion composition for converting paeoniflorin essentially consisting of the strain or its culture medium into ⁇ -gentiobiosyl paeoniflorin. .
  • Another object of the present invention comprises the steps of (a) inoculating the strain or its culture solution to a composition comprising paeoniflorin; And (b) providing a method for converting paeoniflorin into ⁇ -gentiobiosyl paeoniflorin, comprising the step of culturing and fermenting the product obtained in step (a) will do
  • Another object of the present invention is to provide a fermented product of peony produced according to the method of inoculating and fermenting the powder, extract or extract of the peony ( Paeonia lactiflora ) with the strain or its culture medium.
  • Another object of the present invention is to provide the use of the strain or a culture medium thereof for producing a bioconversion agent that converts paeoniflorin into ⁇ -gentiobiosyl paeoniflorin .
  • the present invention provides a stock flow in Kono (Leuconostoc sp.) LN180020 strain deposited as accession number KCTC13719BP.
  • the present invention provides a bioconversion composition for converting paeoniflorin containing the strain or its culture solution into ⁇ -gentiobiosyl paeoniflorin to provide.
  • the present invention provides a bioconversion composition for converting paeoniflorin consisting of the strain or its culture solution into ⁇ -gentiobiosyl paeoniflorin.
  • the present invention provides a composition for bioconversion that converts paeoniflorin essentially consisting of the strain or its culture solution into ⁇ -gentiobiosyl paeoniflorin.
  • the present invention comprises the steps of (a) inoculating the strain or its culture solution into a composition containing paeoniflorin; And (b) providing a method for converting paeoniflorin into ⁇ -gentiobiosyl paeoniflorin, comprising the step of culturing and fermenting the product obtained in step (a) do.
  • the present invention provides a fermented product of peony prepared according to a method of inoculating the powder, extract or extract of the peony ( Paeonia lactiflora ) with the strain or its culture solution and fermenting it.
  • the present invention provides a bioconversion agent for converting paeoniflorin into ⁇ -gentiobiosyl paeoniflorin.
  • the strain or culture solution thereof provides the use of
  • the present invention provides a leuconostoc genus ( Leuconostoc sp.) LN180020 strain deposited with accession number KCTC13719BP.
  • the leuconostok genus LN180020 strain is characterized in that it exhibits bioconversion ability of paeoniflorin.
  • the Leukonostok genus LN180020 strain is characterized in that it exhibits bioconversion ability to convert paeoniflorin to ⁇ -gentiobiosyl paeoniflorin .
  • the leuconostok genus LN180020 strain is characterized in that it comprises the 16S rRNA sequence of SEQ ID NO: 1.
  • the Leukonostok genus LN180020 strain is not limited in its source, but may be isolated from fermented food, for example, kimchi, soybean paste, red pepper paste, soy sauce, cheese, salted fish, etc. and, preferably, it may be separated from kimchi.
  • the present inventors isolated microorganisms from kimchi purely and evaluated their fermentability of peony extract in order to search for microorganisms exhibiting bioconversion ability capable of improving the physiological activity of paoniflorin.
  • the peony extract inoculated with the Leukonostok sp. strain specifically decreased paoniflorin, and more specifically, paoniflorin was ⁇ -gentiobiosil paoni It was confirmed that the conversion to Florin.
  • Leuconostoc citreum KM20 and 99.38% Leuconostoc citreum It was confirmed that it has a homology of 99.34% with EFEL 2700, and the new strain was named Leuconostoc sp. LN180020 and deposited with the Korea Research Institute of Bioscience and Biotechnology on November 20, 2018 (Accession No. KCTC13719BP) ).
  • the fermented product of the peony extract fermented with the identified new strain, Leuconostoc sp. LN180020 exhibits significantly improved anti-diabetic and anti-obesity effects compared to the peony extract. Confirmed. In addition, it was confirmed that the ⁇ -gentiobiosil paoniflorin produced by bioconversion of paoniflorin by the Leuconostoc sp. LN180020 strain exhibits a significantly improved antiobesity effect compared to paoniflorin. .
  • the novel strain provided in the present invention can be very usefully used for preparing a fermented product of a peony extract with improved physiological activity, or for bioconverting paoniflorin into ⁇ -gentiobiosil paoniflorin. have.
  • the present invention also provides a culture of the leuconostock genus LN180020.
  • the term 'cultivation' refers to all actions performed to grow microorganisms in an appropriately artificially controlled environmental condition, and in the present invention, it is a concept including 'fermentation'.
  • the cells of the 'Leuconostok genus LN180020' include not only live cells obtained from the culture medium, but also any processed form of lactic acid bacteria known to those skilled in the art, for example, cell lysate, dried material, frozen material, etc. It is not limited thereto.
  • the term 'culture' or 'culture solution' is meant to include 'fermented material', and the culture solution itself cultured in a liquid medium, a filtrate obtained by filtering or centrifuging the culture solution to remove the strain (centrifuged supernatant), etc. Includes artifacts derived from the culture medium itself.
  • the present invention also provides a bioconversion composition for converting leuconostok genus LN180020 strain or paoniflorin containing a culture medium thereof into ⁇ -gentiobiosyl paoniflorin.
  • the strain of the present invention or its culture medium is preferably included in the composition of the present invention in an amount of 10 to 20 parts by weight, but is not limited thereto.
  • the culture solution preferably includes diluting the culture stock solution culturing the strain of the present invention and the culture supernatant from which the strain is removed, and more preferably, including diluting it 0.5 to 500 times.
  • composition of the culture solution additionally include all the components known to act synergistically on the growth of Leukonostok sp.
  • the present invention also comprises the steps of (a) inoculating a composition comprising a paeoniflorin (paeoniflorin) Leukono stock genus LN180020 strain or a culture solution thereof; And (b) providing a method for converting paeoniflorin into ⁇ -gentiobiosyl paeoniflorin, comprising the step of culturing and fermenting the product obtained in step (a) do.
  • the composition containing paoniflorin may be an extract of the raw material containing paoniflorin, and preferably, it may be a powder, extract or extract of a peony ( Paeonia lactiflora ) or a peony ( Paeonia ) plant. In order to facilitate the culture, preferably, the composition containing paoniflorin may be in a liquid state.
  • the 'peony' refers to the root of a plant having the scientific name Paeonia lactiflora , preferably the root of Paeonia lactiflora used as a medicine.
  • the peony as a medicine is also called Paeoniae Radix or Peony root, and more specifically, it refers to the root of the peony Paeonia lactiflora Pallas or other closely related plants (Peony and Paeoniaceae) used as medicinal parts.
  • the peony extract may be extracted by a solvent extraction method known in the art.
  • the extraction solvent is not limited thereto, but water, a lower alcohol having 1 (C1) to 6 (C6) carbon atoms, an organic solvent, or a mixture thereof may be used.
  • the lower alcohol having 1 (C1) to 6 (C6) carbon atoms is not limited thereto, but may be methanol, ethanol, alcohol, propanol, isopropanol, butanol, pentanol, or hexanol
  • the organic solvent is not limited thereto, acetone, ethyl acetate, n-nucleic acid, diethyl ether, acetone, or benzene.
  • extraction may be performed with water or an alcohol having 1 to 6 carbon atoms or a mixed solvent thereof, and more preferably water, ethanol or alcohol.
  • a small amount of water eg, in the form of 95% ethanol or 99% ethanol may be added to alcohol to reflect physicochemical properties such as hygroscopicity.
  • the extraction temperature and time are not particularly limited as long as the purpose of extraction of the active ingredient is achieved, but may be extracted at 30° C. to 121° C. for 10 minutes to 12 hours. In order to facilitate extraction of the active ingredient during extraction, it may be extracted by pressing. Meanwhile, the extraction may be performed by supercritical extraction or subcritical extraction using an appropriate solvent such as carbon dioxide.
  • the amount of the strain to be inoculated in step (a) is 1 to 5% (v/v) of the strain of 1 x 10 8 to 1 x 10 11 added to the composition itself or the medium containing the composition or the pre-cultured strain culture medium. can be added.
  • the culture of step (b) after inoculation of the leuconostok genus LN180020 strain or its culture solution according to the present invention may be by a lactic acid bacteria culture method known in the art.
  • the fermentation may be performed by a method of culturing for at least 10 hours at a condition of 10 to 45° C. and pH 3 to 9, but is not limited thereto.
  • the culture medium a medium composed of a carbon source, a nitrogen source, vitamins and minerals, or a whey medium using a dairy component, a skim milk medium, etc.
  • a carbon source in the medium for culture production of the present invention is at least one selected from the group consisting of glucose, sucrose, maltose, fructose, lactose, xylose, galactose, arabinose, and combinations thereof, Preferably, it is at least one selected from the group consisting of sucrose, fructose, glucose, galactose, arabinose and lactose, and more preferably glucose.
  • yeast extract One selected from the group consisting of yeast extract, soytone, peptone, beef extract, tryptone, casitone and combinations thereof that can be used as the nitrogen source in the medium for culture production of the present invention above, preferably at least one selected from the group consisting of yeast extract, peptone, tryptone, and soytone, and more preferably yeast extract or soytone.
  • Culture and fermentation of lactic acid bacteria can be made according to the milk-containing medium and culture conditions known in the art. These procedures can be easily adjusted and used by those skilled in the art according to the selected strain. Various such methods are disclosed in various literatures (eg, James et al., Biochemical Engineering, Prentice-Hall International Editions). Depending on the cell growth method, suspension culture and adherent culture can be used, depending on the culture method, batch, fed-batch, and continuous culture methods.
  • paoniflorin is converted to ⁇ -gentiobiosyl paoniflorin, and as a result, paoniflorin is reduced.
  • the present invention also provides a fermented product of peony prepared according to the above method.
  • the fermented product of the peony may be a fermented product of a powder, extract, or extract of a peony ( Paeonia lactiflora ). It is characterized in that the content of oniflorin is low or absent, and the content of ⁇ -gentiobiosyl paoniflorin is increased.
  • the fermented product of the peony extract fermented by the LN180020 strain of the genus Leukonostok exhibits significantly improved antidiabetic and antiobesity effects compared to the peony extract, resulting in metabolic syndrome including diabetes and obesity. It can be very usefully utilized in the development of prophylactic or therapeutic agents.
  • the present invention provides the use of the strain or its culture medium for producing a bioconversion agent for converting paeoniflorin into ⁇ -gentiobiosyl paeoniflorin.
  • the term “comprising” is used in the same sense as “including” or “characterized by”, and in the composition or method according to the present invention, specifically Additional components or method steps that have not been excluded are not excluded.
  • the term “consisting of” means excluding additional elements, steps, or ingredients not specifically described.
  • the term “essentially consisting of” means that, in the scope of a composition or method, it may include substances or steps that do not substantially affect the basic properties thereof in addition to the substances or steps described.
  • the LN180020 strain of the leukonostok genus provided by the present invention has very excellent bioconversion ability to convert paoniflorin into ⁇ -gentiobiosyl paoniflorin with improved physiological activity, prevention of various diseases including diabetes, obesity, etc. Alternatively, it may be very usefully utilized in the development of therapeutic agents.
  • FIG. 1A and 1B are HPLC chromatograms showing the content of indicator substances and new useful substances in non-fermented peony extract (non-fermented, (FIG. 1A)) and lactic acid bacteria fermented product (fermented, (FIG. 1B)) of the peony extract. .
  • 3 is a result of evaluating the lipase inhibitory activity of a non-fermented peony extract (non-fermented), lactic acid bacteria fermented product (fermented) and a positive control group (olistat) of the peony extract.
  • Figure 4 is the result of confirming the glucose uptake rate (relative glucose uptake) into muscle cells of the lactic acid bacteria fermented product of the peony extract and the non-fermented peony extract.
  • LN180020 (KCTC 13719BP) in leuconostock.
  • FIG. 6 is a view showing the results of genomic sequence analysis of LN180020 in the leuconostok genus.
  • Figure 7 is a non-fermented peony extract (non-fermented) and lactic acid bacteria fermented product (fermented) of the peony extract, respectively, the peony indicator material before bioconversion (paeoniflorin, paeoniflorin) and the material after bioconversion to separate and purify the LC-MS is the result of performing
  • Example 1 Isolation of plant lactic acid bacteria from kimchi
  • kimchi source samples are gradually diluted with sterile water, spread on MRS (Man Rogosa and Sharpe) medium, and cultured at 28°C for 2 days.
  • MRS Man Rogosa and Sharpe
  • the strain isolated through 16s rRNA sequence analysis was identified and stored at -70°C using 20% glycerol.
  • the genus Lactobacillus Lactobacillus
  • the genus Petiococcus Pediococcus
  • the genus Weissella the genus Leuconostoc ( Leuconostoc )
  • the genus Enterococcus Enterococcus 193 of 39 species (species) included canine strains were isolated.
  • Example 2 Preparation of lactic acid bacteria fermented product of peony extract
  • Example 3 Identification of lactic acid bacteria strains having paoniflorin metabolism
  • Paeoniflorin which is an extract of peony or one of the indicator components of the peony, is known for its obesity-related activity, but it was determined that the therapeutic activity for obesity was not sufficient. wanted to explore.
  • a peony extract was prepared by adding 10 times (w/v) water to 1 g of a dry weight of peony and extracting it at 121 degrees for 15 minutes, and each strain isolated in Example 1 was treated with 2 x 10 9 CFU /ml concentration was inoculated and cultured in a culture room at 28°C for 48 hours. After that, the culture (supernatant) was extracted with 50% ethanol, and the chromatogram change was analyzed under UV 235nm, 15-100% methanol gradient conditions through HPLC using TSK-GEL ODS-100V 5 ⁇ m column (4.6mm x 15cm). (see FIGS. 1A and 1B).
  • Example 4 Confirmation of cytotoxicity and anti-obesity effect of fermented products of Leuconostoc sp. LN180020 of peony extract
  • the lactic acid bacteria fermented product of the peony extract was treated at different concentrations (3 and 30 ⁇ g/ml) in mouse L6 myotube cells, and the MTT assay was performed 24 hours later. .
  • the lipase inhibitory activity was evaluated.
  • Lipase inhibitory activity was measured as follows. After dissolving 5mg/ml of lipase in 150ul of the reaction solution (100mM Tris-Hcl, pH 8.2), each experimental sample (lactic acid fermented peony extract, peony extract, and Orlistat) was mixed with a solution of 100uM, 5 min reaction. After that, 30ul of a solution of the substrate p-nitrophenyl palmitate (PNPP) or 4-nitrophenyl dodecanoate (PNPD) dissolved in 0.1% (W/V) in 5 mM sodium acetate (pH 5.0) solution was added, followed by reaction at 37°C for 12 hours. The results were measured with a spectrophotometer at a wavelength of 409 nm. Orlistat was used as a control, and peony extract and lactic acid bacteria fermented peony extract were used as experimental samples, respectively.
  • the reaction solution 100mM Tris-Hcl, pH 8.2
  • each experimental sample lactic acid fermente
  • Orlistat used as a positive control for lipase inhibitory activity showed inhibitory activity of 61.7% and 50.4%, respectively, on PNPP and PNPD substrates, and in samples after fermentation, 53.5% and 38.4%, respectively. showed inhibitory activity.
  • the inhibitory activity of PNPP and PNPD substrates was 40.1% and 21.8%, respectively, confirming that the lipase activity inhibitory effect was significantly increased in the extract after fermentation (Fig. 3). .
  • mouse L6 myoblasts were dispensed into a 24-well culture vessel at a cell count of 5x10 5 cells/ml, and then once every 2 days in a differentiation medium (low glucose (5 mM) ) DMEM, 2% Fetal Bovine Serum, 1% penicillin/streptomyc) were replaced and cultured.
  • a differentiation medium low glucose (5 mM)
  • DMEM low glucose
  • Fetal Bovine Serum 2%
  • penicillin/streptomyc 1% penicillin/streptomyc
  • the [ 14 C]2-deoxy-D-glucose-6-phosphate content in L6 myoblasts increased by about 55% to 80% compared to the untreated control group, It was confirmed that about 25-35% increase compared to the fermented peony extract treatment group. This indicates that when the peony extract is fermented using lactic acid bacteria, the antidiabetic activity can be increased by promoting glucose absorption into muscle cells compared to the non-fermented peony extract.
  • 100 nM of porcine insulin used as a positive control has an antidiabetic effect almost equivalent to 10 ⁇ M (3.57 ⁇ g/ml) of rosiglitazone, which is actually used as a diabetes treatment, but at a low concentration (3 ⁇ g/ml) [14 C]2-deoxy-D-glucose-6-phosphate content of the lactic acid bacteria-treated group of the peony extract of ml) was similar to that of the insulin 100 nM-treated group, and the high concentration (30 ⁇ g/ml) peony extract [14 C]2-deoxy-D-glucose-6-phosphate content of the lactic acid bacteria-treated group was significantly increased compared to the insulin 100 nM-treated group (FIG. 4).
  • Example 5 Leuconostoc genus ( Leuconostoc sp. ) Phylogenetic analysis of LN180020 lactic acid bacteria
  • the lactic acid bacteria of the Leuconostoc sp. LN180020 (KCTC 13719BP) of the present invention were additionally identified, and a new substance that showed an increase in anti-obesity activity was identified.
  • Primer sequence information Primer name Base sequence (5' ⁇ 3') (SEQ ID NO:) 27F-1492R_F AGAGTTTGATCCTGGCTCAG (2) 27F-1492R_R CGGTTACCTTGTTACGACTT (3)
  • the 16S rRNA nucleotide sequence of LN180020 in the leuconostock genus was confirmed through BigDye (R) Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems), and the previously known leuconostock genus sequence is in the NCBI database (https://www. ncbi.nlm.nih.gov/), EzTaxon-e server (https://www.eztaxon-e.ezcloud.net/) and LPSN (https://www.bacterio.net/nocardioides.html) databases. and sequence comparison analysis was performed using BioEdit v7.2.6.1, MEGA7 program.
  • the leuconostok genus LN180020 showed the highest 16S rRNA sequence homology with 99.86% with the leukonostok citreum ATCC 49370T, followed by the leuconostock holzapfelii ( L. holzapfelii ) BFE 7000 T and 99.78%; Leukono stock lactis ( L. lactis ) JCM 6123 T and leukonostok palmae ( L. palmae ) TMW 2.694 T and 98.92%; Leukonostok Kimchi ( L. kimchii ) IMSNU 11154 T and 98.49%; Leukonostok Gelidum subsp. L. gelidum subsp.
  • the genome size of LN180020 in the leuconostok genus was 1,906,090, and the G+C content was 39.1%. It contained 1,869 protein coding sequences, 12 rRNA genes, 69 tRNA genes, and 3 plasmids (Table 2).
  • the identified new strain Leuconostoc sp. LN180020 was deposited with the Korea Research Institute of Bioscience and Biotechnology on November 20, 2018 (Accession No. KCTC13719BP).
  • Example 6 Analysis of bioconversion components of fermented peony extract lactic acid bacteria
  • LC-MS Liquid chromatography mass spectrometry analysis for identifying the bioconverted material was performed by dissolving the supernatant in methanol and using a QTrap 3200 connected HPLC system (Luna C18 (2), 100X2 with Turbolon Spray source (AB SCIEX, Singapore)) .0mm, 3 ⁇ m; guard cartridge system, security guard #KJ 0-4282; Phenomenex, USA).
  • the column was maintained at 25°C with 100% methanol (A) and HPLC water (B) containing 0.04% trifluoroacetic acid at a flow rate of 1.0 mL/min, and the sample was sampled at 15% for the first 5 minutes.
  • the methanol concentration was sequentially increased from 15% to 100% from 5 minutes to 20 minutes, maintained at 100% methanol for 20 minutes to 25 minutes, and from 100% to 15% from 25 minutes to 35 minutes The methanol concentration was decreased until , and after that, it was measured while maintaining 15% methanol for 5 minutes (Table 3).
  • HPLC conditions HPLC retention time (min) A; MeOH (%) B; Water (%) 0-5 15 85 5-20 15-100 85-0 20-25 100 0 25-35 100-15 0-85 35-40 15 85
  • the indicator substance decreased near the retention time of the fermented peony extract at about 15 minutes (FIG. 1), and corresponds to a new useful component at about 14.2 minutes It was confirmed that the peak to be increased.
  • each corresponding peak was analyzed by thin layer chromatography using silica gel 60G F254 glass plate in the developing solvent methanol:chloroform (1.5:5).
  • the structure of the new useful ingredient in which the paoniflorin was converted was identified by Proton, Carbon, TOCSY, HSQC, and HMBC NMR, and the results are shown in FIG. 8 .
  • the material produced by bioconversion of paoniflorin was identified as ⁇ -gentiobiosyl paeoniflorin ( FIG. 8 ).
  • the LN180020 strain of the leukonostok genus provided by the present invention has very excellent bioconversion ability to convert paoniflorin into ⁇ -gentiobiosyl paoniflorin with improved physiological activity, prevention of various diseases including diabetes, obesity, etc. Alternatively, it can be very usefully used in the development of therapeutic agents, and thus has very high industrial applicability.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne une nouvelle souche Leuconostoc sp. et un procédé de bioconversion pour la paeoniflorine utilisant celle-ci et, plus spécifiquement, une souche Leuconostoc sp. LN180020 présentant une activité de bioconversion de la paeoniflorine en β-gentiobiosyl paeoniflorine, et un procédé de bioconversion pour la paeoniflorine l'utilisant.
PCT/KR2021/006692 2020-05-29 2021-05-28 Nouvelle souche leuconostoc sp. et procédé de bioconversion de la paeoniflorine l'utilisant WO2021242051A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0065498 2020-05-29
KR1020200065498A KR20210147774A (ko) 2020-05-29 2020-05-29 신규한 류코노스톡 속 균주 및 이를 이용한 패오니플로린의 생물전환방법

Publications (1)

Publication Number Publication Date
WO2021242051A1 true WO2021242051A1 (fr) 2021-12-02

Family

ID=78744763

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/006692 WO2021242051A1 (fr) 2020-05-29 2021-05-28 Nouvelle souche leuconostoc sp. et procédé de bioconversion de la paeoniflorine l'utilisant

Country Status (2)

Country Link
KR (1) KR20210147774A (fr)
WO (1) WO2021242051A1 (fr)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080064657A1 (en) * 2003-05-20 2008-03-13 Day Donal F Isomaltooligosaccharides from Leuconostoc as Neutraceuticals
KR101253875B1 (ko) * 2011-04-05 2013-05-22 가천대학교 산학협력단 진세노사이드의 생물전환능을 갖는 류코노스톡 메센테로이데스 와이엘비팔
KR20130068317A (ko) * 2011-12-15 2013-06-26 한국 한의학 연구원 소청룡탕 또는 소청룡탕 유산균 발효물을 포함하는 간독성 질환의 예방 및 치료용 약학적 조성물
KR20160006812A (ko) * 2014-07-09 2016-01-20 가천대학교 산학협력단 작약 추출물을 포함하는 당뇨 예방 및 치료용 조성물
KR102026934B1 (ko) * 2018-06-25 2019-09-30 충북대학교 산학협력단 재조합 목적단백질 고효율 생산을 위한 신규 류코노스톡 시트리움 efel 2701 균주 및 이의 용도
KR20200069249A (ko) * 2018-12-06 2020-06-16 한국생명공학연구원 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방, 개선 또는 치료용 조성물

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080064657A1 (en) * 2003-05-20 2008-03-13 Day Donal F Isomaltooligosaccharides from Leuconostoc as Neutraceuticals
KR101253875B1 (ko) * 2011-04-05 2013-05-22 가천대학교 산학협력단 진세노사이드의 생물전환능을 갖는 류코노스톡 메센테로이데스 와이엘비팔
KR20130068317A (ko) * 2011-12-15 2013-06-26 한국 한의학 연구원 소청룡탕 또는 소청룡탕 유산균 발효물을 포함하는 간독성 질환의 예방 및 치료용 약학적 조성물
KR20160006812A (ko) * 2014-07-09 2016-01-20 가천대학교 산학협력단 작약 추출물을 포함하는 당뇨 예방 및 치료용 조성물
KR102026934B1 (ko) * 2018-06-25 2019-09-30 충북대학교 산학협력단 재조합 목적단백질 고효율 생산을 위한 신규 류코노스톡 시트리움 efel 2701 균주 및 이의 용도
KR20200069249A (ko) * 2018-12-06 2020-06-16 한국생명공학연구원 작약 추출물의 유산균 발효물을 유효성분으로 포함하는 당뇨병의 예방, 개선 또는 치료용 조성물

Also Published As

Publication number Publication date
KR20210147774A (ko) 2021-12-07

Similar Documents

Publication Publication Date Title
WO2017119795A1 (fr) Nouvelle souche gfc1 de lactobacillus casei, extrait de ginseng fermenté utilisant la souche, et son procédé de préparation
WO2020075949A1 (fr) Nouvelle souche de lactobacillus plantarum atg-k2, atg-k6 ou atg-k8 et composition de prévention ou de traitement de la vaginite comprenant celle-ci
WO2020040407A1 (fr) Nouvelle souche de cutibacterium avidum, et composition pour prévenir ou traiter la dermatite atopique, comprenant une souche ou un produit cultivé associé
WO2020040408A1 (fr) Nouvelle souche de cutibacterium granulosum, et composition comprenant une telle souche ou une culture de ladite souche pour prévenir ou traiter l'acné
WO2014007427A1 (fr) Procédé utilisant la conversion enzymatique et de fermentation de lactobacillus pour la préparation d'un liquide de ginseng rouge fermenté concentré ayant une teneur accrue en composé k, et produit contenant un liquide de ginseng rouge fermenté concentré préparé par ledit procédé de préparation en tant que principe actif
WO2012144790A1 (fr) Peptide cyclique provenant de nonomureaea sp., son procédé de production, et composition pharmaceutique pour la prévention ou le traitement d'une maladie liée aux mycobactéries le comprenant
WO2020027456A1 (fr) Nouvelle souche de ceriporia lacerata-k1 et composition comprenant une culture de cette dernière pour la prévention ou le traitement du diabète
WO2018004224A2 (fr) Nouveau microorganisme appartenant à la famille des sporichthyaceae et son utilisation
WO2021221398A1 (fr) Nouvelles bactéries d'acide lactique ayant un excellent effet d'amélioration de la fonction immunitaire, et composition alimentaire, composition alimentaire fonctionnelle pour la santé et probiotiques les comprenant
WO2020116962A1 (fr) Composition de prévention, d'amélioration, ou de traitement du diabète, comprenant le produit de fermentation de bactéries acide lactique d'extrait de paeonia lactiflora comme ingrédient actif
WO2023055188A1 (fr) Nouveaux probiotiques et utilisation associée
WO2014069874A1 (fr) Composition permettant d'éliminer des substances kératiniques de la peau comprenant des lactobacillus de thé vert
WO2022203302A1 (fr) Souche de lactobacillus fermentum ayant pour effet de prévenir ou d'améliorer une maladie buccale et son utilisation
WO2022050559A1 (fr) Procédé de préparation d'extrait de déinoxanthine fermenté et composition cosmétique comprenant un extrait de déinoxanthine fermenté
WO2020091312A1 (fr) Composition contenant des probiotiques en tant que principe actif pour prévenir ou traiter des lésions intestinales causées par la consommation d'alcool
WO2018164468A1 (fr) Souche de bacillus amyloliquefaciens gf423, et composition ayant des activités anti-oxydantes et anti-inflammatoires ou de prévention ou de traitement de l'hyperlipidémie, y compris un polypeptide produit par celle-ci
WO2021230581A1 (fr) Découverte d'une nouvelle akkermansia muciniphila ak32 et application correspondante pour la prévention ou le traitement d'une lésion intestinale
WO2023038419A1 (fr) Souche de protection de la santé intestinale lactobacillus paracasei eps da-bacs possédant des effets favorisant la croissance de lactobacillus bifidus et inhibant les bactéries intestinales nuisibles clostridium difficile, et son polysaccharide
WO2021071159A1 (fr) Composition antidiabétique, hypotenseuse ou antioxydante comprenant un fermentat de levure de rhynchosia nulubilis et son procédé de préparation
WO2012169842A2 (fr) Lactobacillus plantarum inédit isolé à partir de feuilles de camellia sinensis
WO2022039561A1 (fr) Composition pour le traitement ou la prévention d'une infection par clostridium difficile
WO2021242051A1 (fr) Nouvelle souche leuconostoc sp. et procédé de bioconversion de la paeoniflorine l'utilisant
WO2022035269A1 (fr) Souche de faecalibacterium prausnitzii et ses utilisations
WO2016072655A1 (fr) Composition pour améliorer, traiter ou prévenir la constipation comprenant un produit fermenté renfermant des bactéries lactiques de graines de cassia comme ingrédient efficace, et son procédé de préparation
WO2010137877A2 (fr) Cellule souche végétale dérivée du cambium de la famille des asteraceae et son procédé de mise en culture isolée

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21812979

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21812979

Country of ref document: EP

Kind code of ref document: A1