WO2021241981A1 - 암의 예방 또는 치료용 조성물 - Google Patents

암의 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2021241981A1
WO2021241981A1 PCT/KR2021/006493 KR2021006493W WO2021241981A1 WO 2021241981 A1 WO2021241981 A1 WO 2021241981A1 KR 2021006493 W KR2021006493 W KR 2021006493W WO 2021241981 A1 WO2021241981 A1 WO 2021241981A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
znf667
acta2
head
rna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2021/006493
Other languages
English (en)
French (fr)
Inventor
정재호
신민규
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Academic Cooperation Foundation of Yonsei University
Original Assignee
Industry Academic Cooperation Foundation of Yonsei University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry Academic Cooperation Foundation of Yonsei University filed Critical Industry Academic Cooperation Foundation of Yonsei University
Publication of WO2021241981A1 publication Critical patent/WO2021241981A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7105Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents

Definitions

  • An object of the present invention is to provide a composition capable of preventing or treating gastric cancer among cancers, or inhibiting invasiveness or metastasis of gastric cancer cells.
  • Cancer is a cell mass composed of undifferentiated cells that proliferate indefinitely while ignoring the necessary condition in the tissue, unlike normal cells, which can proliferate and suppress regularly and in a controlled manner according to individual needs.
  • Such unrestricted proliferation of cancer cells infiltrates into surrounding tissues and, in more severe cases, metastasizes to other organs of the body, causing severe pain and eventually death.
  • Cancer is broadly classified into blood cancer and solid cancer, and occurs in almost all parts of the body, such as stomach cancer, pancreatic cancer, breast cancer, oral cancer, liver cancer, uterine cancer, esophageal cancer, and skin cancer.
  • therapeutic agents are being used for the treatment of specific cancers, surgery, radiation therapy, and anticancer drug treatment using chemotherapeutic agents that inhibit cell proliferation are the main methods up to now.
  • chemotherapeutic agents since it is not a targeted therapy, the biggest problem with existing chemotherapeutic agents is the side effects and drug resistance due to cytotoxicity, which is a major factor that ultimately causes the treatment to fail despite the initial successful response to the anticancer agent. Therefore, in order to overcome the limitations of these chemotherapeutic agents, there is a continuous need to develop targeted therapeutics with a clear anticancer mechanism.
  • Gastric cancer is the third leading cause of cancer-related death and ranks fourth among the most common cancers.
  • personalized pharmaceuticals clinically and biologically close molecular analysis is required.
  • understanding of biological complexity has been improved through omics studies of gastric cancer at the whole genome level, and in particular, prognosis using biomarkers and responsiveness to adjuvant chemotherapy through analysis of mRNA gene expression data.
  • Great advances have been made in forecasting.
  • Molecular profiling at different levels in gastric cancer is expected to lead to the development of personalized treatment strategies.
  • lncRNA long non-coding RNA
  • the lncRNA acts as an important substance in the path of cancer, and is related to the development and progression of cancer.
  • the lncRNA is a transcript of 200 or more nucleotides without protein-coding potential. They have a higher number of constituent nucleotides than the protein-coding gene, are restricted to specific cell/tissue types to a greater extent than mRNA, and are promising as cancer-type specific therapeutic targets.
  • RNA-targeting Nucleic acid-based (RNA-targeting) therapeutics have shown clinical success in several diseases and preclinical success in some cancers by targeting lncRNA. However, there have been no reports of lncRNA targets in gastric cancer, and sufficient studies have not been conducted on their clinical relevance and biological functions.
  • One object of the present invention is to provide a composition capable of preventing or treating cancer.
  • Another object of the present invention is to provide a composition capable of inhibiting the invasiveness or metastasis of cancer.
  • Another object of the present invention is to provide a composition that can overcome resistance to anticancer drugs.
  • ZNF667-AS1 ZNF667 Antisense RNA 1 (Head To Head)
  • RP11-572C15.6 FENDRR (FOXF1 Adjacent Non-Coding Developmental Regulatory RNA)
  • ACTA2-AS1 ACTA2 Antisense RNA 1
  • a pharmaceutical composition for preventing or treating cancer comprising an expression inhibitor specific to at least one of them as an active ingredient.
  • ZNF667-AS1, RP11-572C15.6, FENDRR and comprising an expression inhibitor specific to at least one of ACTA2-AS1 as an active ingredient, a pharmaceutical composition for inhibiting invasiveness or metastasis of cancer it's about
  • a pharmaceutical composition for overcoming resistance of resistant cancer comprising an expression inhibitor specific to at least one of ZNF667-AS1, RP11-572C15.6, FENDRR and ACTA2-AS1 as an active ingredient it's about
  • ZNF667-AS1, RP11-572C15.6, FENDRR, and containing an expression inhibitor specific for at least one of ACTA2-AS1 as an active ingredient, resistant or metastatic cancer prevention or treatment It relates to a pharmaceutical composition.
  • each of the ZNF667-AS1, RP11-572C15.6, FENDRR and ACTA2-AS1 is a long non-coding RNA gene (lncRNA), and the ZNF667-AS1 may be represented by SEQ ID NO: 1
  • the RP11-572C15.6 may be represented by SEQ ID NO: 2
  • the FENDRR may be represented by SEQ ID NO: 3
  • the ACTA2-AS1 may be represented by SEQ ID NO: 4, but is not limited thereto.
  • the ZNF667-AS1, RP11-572C15, FENDRR or ACTA2-AS1 specific expression inhibitor is an antisense nucleotide complementary to the gene, short interfering RNA (siRNA), short hairpin RNA (short RNA) It is preferable that at least one selected from the group consisting of hairpin RNA; shRNA) and ribozyme.
  • the "antisense nucleotide” binds (hybridizes) to the complementary base sequence of DNA, immature-mRNA, or mature mRNA as defined in Watson-Crick base pairing to disrupt the flow of genetic information from DNA to protein.
  • the nature of antisense nucleotides specific to a target sequence makes them exceptionally versatile. Since antisense nucleotides are long chains of monomeric units, they can be readily synthesized for the target RNA sequence. Many recent studies have demonstrated the usefulness of antisense nucleotides as biochemical means for studying target proteins (Rothenberg et al., J. Natl. Cancer Inst., 81:1539-1544, 1999).
  • antisense nucleotides Due to recent advances in oligonucleotide chemistry and nucleotide synthesis with improved cell line adsorption, target binding affinity and nuclease resistance, the use of antisense nucleotides can be considered as a new type of inhibitor.
  • the "siRNA” and “shRNA” are nucleic acid molecules capable of mediating RNA interference or gene silencing, and because they can inhibit the expression of a target gene, an efficient gene knockdown method or gene therapy used in a way shRNA is a single-stranded oligonucleotide that forms a hairpin structure by bonding between complementary sequences. In vivo, the shRNA is cut by a dicer and a small RNA fragment of 21 to 25 nucleotides in size. siRNA, which is a double-stranded oligonucleotide, and can specifically bind to mRNA having a complementary sequence to inhibit expression.
  • shRNA and siRNA to use may be determined by a person skilled in the art, and if the mRNA sequences targeted by them are the same, a similar expression reduction effect can be expected.
  • it specifically acts on ZNF667-AS1, RP11-572C15, FENDRR or ACTA2-AS1 to cut ZNF667-AS1, RP11-572C15, FENDRR or ACTA2-AS1 LncRNA molecules to interfere with RNA (RNAi, RNA interference) By inducing the phenomenon, it is possible to inhibit the ZNF667-AS1, RP11-572C15, FENDRR or ACTA2-AS1.
  • siRNA can be synthesized chemically or enzymatically.
  • the method for preparing siRNA is not particularly limited, and methods known in the art may be used. For example, a method for synthesizing siRNA directly chemically, a method for synthesizing siRNA using in vitro transcription, a method for cleaving long double-stranded RNA synthesized by in vitro transcription using an enzyme; Expression method through intracellular delivery of an shRNA expression plasmid or viral vector and expression method through intracellular delivery of a PCR (polymerase chain reaction)-induced siRNA expression cassette (cassette), but are not limited thereto.
  • a method for synthesizing siRNA directly chemically a method for synthesizing siRNA using in vitro transcription, a method for cleaving long double-stranded RNA synthesized by in vitro transcription using an enzyme
  • Expression method through intracellular delivery of an shRNA expression plasmid or viral vector and expression method through intracellular delivery of a PCR (polymerase chain reaction)-induced siRNA expression cassette (cassette), but are not limited thereto
  • the "ribozyme” refers to an RNA molecule having catalytic activity. Ribozymes having various activities are known, and the ribozymes of the gene include known or artificially generated ribozymes, and selectively ribozymes having target-specific RNA cleavage activity are prepared by known standard techniques. can be
  • the expression inhibitor is an expression inhibitor specific to the gene of ZNF667-AS1, and may be siRNA represented by SEQ ID NOs: 5 and 6, but is not limited thereto.
  • an expression inhibitor specific to at least one gene of ZNF667-AS1, RP11-572C15.6, FENDRR and ACTA2-AS1 can effectively inhibit the growth or proliferation of cancer cells, and furthermore, cancer cell invasiveness or Metastasis can also be effectively prevented or treated.
  • the term “cancer” refers to or refers to a physiological condition typically characterized by unregulated cell growth in mammals.
  • the cancer to be prevented or treated is gastric cancer, ovarian cancer, colorectal cancer, breast cancer, liver cancer, pancreatic cancer, cervical cancer, thyroid cancer, parathyroid cancer, non-small cell lung cancer, prostate cancer, Gallbladder cancer, biliary tract cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, blood cancer, bladder cancer, kidney cancer, melanoma, colon cancer, bone cancer, skin cancer, head cancer, uterine cancer, rectal cancer, brain tumor, perianal cancer, fallopian tube carcinoma, endometrial carcinoma, Vaginal cancer, vulvar carcinoma, esophageal cancer, small intestine cancer, endocrine adenocarcinoma, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, ureter cancer, renal cell carcinoma, renal pelvi
  • resistant cancer refers to a cancer that exhibits extremely low sensitivity to cancer treatment drugs, particularly anticancer drugs, and does not show improvement, alleviation, alleviation, or treatment symptoms by treatment such as chemotherapy. do.
  • the drug-resistant cancer for cancer treatment may have resistance to a specific anticancer agent from the beginning, and did not initially show resistance, but due to long-time drug treatment, it no longer exhibits sensitivity to the same therapeutic agent due to genetic mutation in cancer cells. may occur.
  • the "drug for cancer treatment” or “anticancer agent” is not particularly limited in its type, but may preferably be a drug for the treatment of gastric cancer.
  • Specific examples include nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, cediranib , restautinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, sorafenib, bevacizumab, cisplatin, cetuximab, viscumalbum, asparaginase, tretinoin, hydroxycarba amide, dasatinib, estramustine, gemtuzumab ozogamicin, ibritum
  • the term "overcoming resistance” refers to an action of increasing the sensitivity of cancer cells that have acquired resistance to a cancer treatment drug, particularly an anticancer drug, to a drug for treatment with a specific drug.
  • the increase in sensitivity is the degree to which the concentration exhibiting effects such as growth inhibition and apoptosis of cancer cells that have acquired resistance is equal to or higher than the concentration exhibiting effects such as growth inhibition on non-resistant cancer cells means to reach Synonyms with overcoming the tolerance include "resistance suppression”, “resistance release”, “resistance release” and "sensitivity enhancement” and the like.
  • the term “metastasis cancer” refers to a cancer that is caused by cancer cells moving from a primary organ to another organ and proliferating.
  • the spread of cancer to other parts of the body can be largely divided into growth of cancer tissue from the primary cancer and directly invading surrounding organs, and distant metastasis along blood vessels or lymphatic vessels to other organs far away.
  • it may mean that the cancer has metastasized to the stomach organs from other primary cancers, but is not limited thereto.
  • prevention may include, without limitation, any action that blocks cancer symptoms or suppresses or delays cancer symptoms using the pharmaceutical composition of the present invention.
  • treatment may include, without limitation, any action in which cancer symptoms are improved or beneficial by examining the pharmaceutical composition of the present invention.
  • the pharmaceutical composition of the present invention may be used not only in the form of an anticancer agent, but also in the form of an adjuvant for the anticancer agent.
  • the pharmaceutical composition of the present invention may be additionally administered in combination with other anticancer agents, thereby further enhancing the growth inhibitory effect on cancer cells.
  • the anticancer agent includes nitrogen mustard, imatinib, oxaliplatin, 5FU, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, Cediranib, restautinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab, viscumalbum, asparaginase, tretinoin, hydroxycarbamide , Dasatinib, estramustine, gemtuzumab ozogamicin, ibritumomab tuccetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtuzumab, procarba
  • the pharmaceutical composition may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or drinks, and the pharmaceutical composition may be characterized in that it is targeted to humans.
  • the pharmaceutical composition of the present invention is not limited thereto, but each can be formulated in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, fragrances, etc. for oral administration, and in the case of injections, buffers, preservatives, pain-freezing agents A topical agent, solubilizer, isotonic agent, stabilizer, etc.
  • the dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above.
  • a pharmaceutically acceptable carrier as described above.
  • it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have.
  • it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.
  • suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used.
  • it may further include a filler, an anti-agglomeration agent, a lubricant, a wetting agent, a flavoring agent, an emulsifier, a preservative, and the like.
  • the route of administration of the pharmaceutical composition according to the present invention is not limited thereto, but oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical , sublingual or rectal. Oral or parenteral administration is preferred.
  • parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.
  • the pharmaceutical composition of the present invention depends on several factors including the activity of the specific compound used, age, weight, general health, sex, formula, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated.
  • the dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, disease severity, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and 0.0001 to 50 mg/day kg or 0.001 to 50 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • the pharmaceutical composition according to the present invention may be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.
  • ZNF667-AS1 ZNF667 Antisense RNA 1 (Head To Head)
  • RP11-572C15.6 FENDRR (FOXF1 Adjacent Non-Coding Developmental Regulatory RNA)
  • ACTA2 Antisense RNA a method for preventing or treating cancer, comprising administering an effective amount of an expression inhibitor specific for at least one of -AS1 (ACTA2 Antisense RNA 1).
  • cancer comprising administering to an individual in need of administration an expression inhibitor specific for at least one of ZNF667-AS1, RP11-572C15.6, FENDRR and ACTA2-AS1 in an effective amount It relates to a method for inhibiting invasive or metastatic infiltration.
  • an anticancer agent comprising administering to an individual in need of administration, an expression inhibitor specific for at least one of ZNF667-AS1, RP11-572C15.6, FENDRR and ACTA2-AS1 in an effective amount It relates to a method of enhancing sensitivity to
  • the "individual” refers to an individual having cancer or suspected of having cancer, and refers to mammals including mice, livestock, etc. do.
  • composition according to the present invention when used, it is possible to effectively prevent, ameliorate or treat gastric cancer among cancers, as well as inhibit the invasiveness and metastasis of cancer cells, particularly gastric cancer cells.
  • composition of the present invention when used, it is possible to overcome resistance of resistant cancer by enhancing sensitivity to anticancer agents, and furthermore, to prevent or treat resistant cancer.
  • Each data is presented in matrix form, with rows representing individual genes and columns representing each tissue.
  • each cell represents the expression level of a gene in an individual tissue, and red and green represent the relative high and low expression levels represented by scale bars (log2 conversion scale).
  • Fig. 2 shows the prognostic relevance of LNC6 subtypes
  • Figure 2b shows a phylogenetic tree in the predictive model, and the patients were classified into subtypes with high predictability.
  • OS overall survival
  • RFS recurrence-free survival
  • RFS recurrence-free survival period
  • Fig. 4 relates to a subset of L6C anticancer drug resistance and epithelial phenotype
  • This analysis included AJCC stage II, III, or IV patients without primary metastasis.
  • CTX relapse-free survival
  • Figure 5a shows the responsiveness to pembrolizumab according to the LNC6 subtype, and
  • Figures 5b and 5c show the therapeutic responsiveness
  • the predictability of L6C subtypes and L6F subtypes is shown in those who show and those who show non-reactivity.
  • Figure 5d shows the normalized enrichment score (NES) of the up-regulated lncRNA in the L6E subtype in the treatment-responsive and non-responsive subjects.
  • CR means complete response
  • PR means partial response
  • SD stable disease
  • PD means progressive disease.
  • Figure 6 shows the cell type components in each LNC6 subtype
  • Figures 6a and 6b are the averaged xCell scores of TCGA cohort samples in each LNC6 subtype
  • Figure 6a shows the 5 cell type family components in each LNC6 subtype.
  • Figure 6b shows the components of 64 cell types in each LNC6 subtype.
  • FIG. 7 shows in vitro demonstration of the relationship between lncRNA and stem-like features
  • Figure 7b is the result of analyzing the ZNF667-AS1 knockdown efficiency by qRT-PCR after siRNA transformation in the EMT subtype gastric cancer cell line
  • Figure 7f shows the results of Western blot analysis using the EMT marker protein shown in the siRNA-transformed EMT subtype gastric cancer cell line
  • Figure 7g shows the MTS assay of oxaliplatin or 5FU in the siRNA-transformed EMT subtype gastric cancer cell line. shows the half maximal inhibitory concentration (IC 50 ) from
  • X-axis is LNC6 subtype
  • Y-axis is arranged in hierarchical clustering.
  • the 725 gastric developmental TFs identified at the level of mRNA abundance the 723 TFs whose expression levels were available in the TCGA cohort were shown. included in the analysis. TFs highly expressed in the early embryonic stage were classified into Group 1, and TFs highly expressed in the late embryonic stage or maturation stage were classified into Group 2, and the Y-axis was arranged from top to bottom according to the standard deviation in the TF groups and samples.
  • FIG. 11 shows specific gene mutations and copy number changes associated with the LNC6 subtype
  • FIG. 12 relates to the differential methylation of miRNA and protein expression and DNA in the TCGA STAD cohort
  • Figures 12a to 12c are multiple 2 to confirm the subtype-specific methylation of miRNA and protein expression and DNA in the TCGA data set -
  • Rho Spearman correlation coefficients
  • ZNF667-AS1 ZNF667 Antisense RNA 1 (Head To Head)
  • RP11-572C15.6 FENDRR (FOXF1 Adjacent Non-Coding Developmental Regulatory RNA)
  • ACTA2-AS1 ACTA2 Antisense RNA 1
  • a pharmaceutical composition for preventing or treating cancer comprising an expression inhibitor specific to at least one of them as an active ingredient.
  • ZNF667-AS1, RP11-572C15.6, FENDRR and comprising an expression inhibitor specific to at least one of ACTA2-AS1 as an active ingredient, a pharmaceutical composition for inhibiting invasiveness or metastasis of cancer it's about
  • a pharmaceutical composition for overcoming resistance of resistant cancer comprising an expression inhibitor specific to at least one of ZNF667-AS1, RP11-572C15.6, FENDRR and ACTA2-AS1 as an active ingredient it's about
  • ZNF667-AS1, RP11-572C15.6, FENDRR, and containing an expression inhibitor specific for at least one of ACTA2-AS1 as an active ingredient, resistant or metastatic cancer prevention or treatment It relates to a pharmaceutical composition.
  • each of the ZNF667-AS1, RP11-572C15.6, FENDRR and ACTA2-AS1 is a long non-coding RNA gene (lncRNA), and the ZNF667-AS1 may be represented by SEQ ID NO: 1
  • the RP11-572C15.6 may be represented by SEQ ID NO: 2
  • the FENDRR may be represented by SEQ ID NO: 3
  • the ACTA2-AS1 may be represented by SEQ ID NO: 4, but is not limited thereto.
  • a total of 12,727 lncRNA expression profiles and mRNA expression profiles were downloaded from the TCGA gastric adenocarcinoma (STAD) cohort consisting of 258 tumors, and then converted to a log2 base. Somatic mutations, copy-number alteration (CNA) and clinical data of TCGA STAD were downloaded from cBioPortal for Cancer Genomics. DNA methylation, miRNA expression and protein expression data from reverse phase protein array (RPPA) were downloaded from the UCSC Xena platform.
  • STAD gastric adenocarcinoma
  • Cluster analysis and visualization of lncRNA data were performed through Gene Cluster 3.0 and Java TreeView.
  • 258 TCGA STAD patients were classified into 6 clusters: 25 as L6A, 66 as L6B, 51 as L6C, 51 as L6D, 14 as L6E, and 51 as L6F.
  • multiple two-class t tests were performed on all possible combinations of the six subtypes.
  • five 2-sample t-tests were performed (L6A vs. L6B, L6A vs. L6C, L6A vs. L6D, L6A vs.
  • L6E, and L6A vs. L6A vs. L6A. L6F comparison) (P ⁇ 0.05).
  • lncRNAs with significant differences in expression in the 5 possible comparisons corresponded to the following 262 subtype-specific lncRNAs: 24 L6A, 67 L6B, 20 L6C, 55 L6D , 30 were classified as L6E, and 66 as L6F.
  • the lncRNA subtype signature was converted into an mRNA subtype signature by identifying the mRNA whose expression is specific to the LNC6 subtype, and the mRNA signature was independently verified using the mRNA expression data. applied to the cohort. Subtype-specific mRNA expression signatures were confirmed by multiple two-class t tests. For subtype L6A selection, five two-sample t-tests were performed (L6A vs. L6B, L6A vs. L6C, L6A vs. L6D, L6A vs. L6E, and L6A vs. L6F comparisons) (P ⁇ 0.001). .
  • the top 200 mRNAs were selected for each subtype according to the log ratio. Genes with significant differences in 4 comparisons were considered subtype-specific if the number of genes with significantly different expression in 5 possible comparisons was less than 200.
  • BCCP Bayesian compound covariate predictor
  • BCCP model was constructed based on lncRNA expression data in TCGA cohort for LNC6 subtype prediction in immunotherapy cohort and cancer cell line. Due to differences in the reference genome annotation version in the dataset, only 241 of the 262 subtype-specific lncRNAs were used.
  • lncRNA expression was analyzed from raw RNA sequencing data.
  • Pembrolizumab and 29 DNA-fingerprint GC cell lines were performed on 45 samples obtained from patients with metastatic GC who participated in Phase 2 clinical trials. Reads were aligned with the reference human genome GRCh38 according to the methods of the International Cancer Genome Consortium using STAR 2.6.0c.
  • Uniquely mapped reads for each non-coding RNA were calculated using the Rsubread package (ver. 1.34.0) with Gencode annotation (Release 22). Fragments per kilobase of transcript per million mapped reads (FPKM) values were calculated according to its definition using R ( https://www.r-project.org/).
  • TCGA subtypes and microsatellite instability (MSI) status were defined.
  • the BCCP model was applied to predict the benefits of different molecular subtypes and immunotherapy.
  • GIST gastrointestinal stromal tumor
  • ACRG Asian Cancer Research Group
  • ssGSEA Single-sample GSEA
  • GSEA Gene Set Enrichment Analysis
  • IPA Ingenuity Pathway Analysis
  • TCGA cohort transcripts by a gene signature-based method (xCell).
  • the 64 cell types were grouped into 5 cell type families, and the score of each cell type family was calculated as the sum of the cell type scores it contained.
  • Stem cell ability for each subtype was evaluated from the expression level of transcription factors that are expressed differently in the developmental stage of the mouse stomach.
  • 725 gastric developmental transcription factors identified at the mRNA abundance level 723 of the available expression level values in the TCGA cohort were used for analysis.
  • Each subtype cell cycle phase was evaluated from the expression level of S-phase abundant lncRNA identified by initial RNA capture sequencing.
  • lncRNA-mediated transcriptional network changes identified in LncRNA Modulator Atlas in Pan-cancer LncMAP
  • altered lncRNA-transcription factor gene triplets for each cancer type were identified by integrating paired lncRNA and gene expression profiles with genome-wide transcriptional regulation. Thereafter, only triplets containing immune-related genes obtained from the ImmPort project were used for analysis (17,572 triplets in STAD). The degree of immune regulation was defined as the number of triplets composed of each lncRNA.
  • CNA genes from TCGA cohort data were filtered by Q-value ( ⁇ 0.25) and frequency (>5%).
  • DNA methylation data were filtered to standard deviation >0.15, and if there was a significant difference in ⁇ -values in all five possible comparisons (P ⁇ 0.01), it was considered subtype specific, and a total of 38,476 subtype specific probes were identified.
  • L6A was 451, L6B 773, L6C 84, L6D 10, L6E 28,803, and L6F 8,355.
  • miRNA data were filtered for missing values ( ⁇ 20% of cohorts) and were considered subtype-specific if there was a significant difference (P ⁇ 0.05) in all five possible comparisons, and 143 subtype-specific miRNAs were identified: 17 L6A, 4 L6B, 0 L6C, 4 L6D, 8 L6E, and 110 L6F.
  • Proteins with a significant difference (P ⁇ 0.05) in all five possible comparisons were considered subtype-specific, resulting in a total of 40 subtype-specific proteins: 3 for L6A, 1 for L6B, 0 for L6C, 1 L6D, 10 L6E, and 25 L6F.
  • HM450 probes were annotated to lncRNA genes. Gene fusion cases were downloaded from the TCGA cohort, and data on gene fusion among 258 patients were available for 183 patients.
  • the gastric cancer cell line was cultured in RPMI-1640 medium containing 10% fetal bovine serum and penicillin/streptomycin (100ug/L each), wherein the culture was performed in a humidified incubator containing 5% CO 2 37 It was carried out under temperature conditions of °C.
  • ZNF667-AS1 knockdown by siRNA (Thermofisher Scientific) shown in Table 1 was performed using mirus transformation reagent (Mirus bio).
  • Cancer cells transformed with si-non-target or si-ZNF667-AS1 were inoculated into 96-well plates at an amount of 2X10 3 cells/well and cultured overnight before drug treatment, and 20uL CellTiter 96 AQueous One solution per well (MTS, Promega ) was maintained in the presence of drug for 72 h before addition. After incubating the plate for 3 hours, absorbance was measured at 490 nm using an ELISA reader (Bio tek).
  • a 24-well plate containing an 8-um-pore size chamber insert (Corning Costar) was used. did 2 X 10 5 cells in 200uL FBS-free culture medium were loaded into each filter insert (upper chamber), 700uL of culture medium containing 10% FBS was added to each lower chamber, and cultured at 37°C for 16 hours. did After harvesting, the bottom of the insert was fixed and dyed with crystal violet. The number of migrating or infiltrating cells was measured using an EVOS M7000 imaging system (Thermofisher Scientific).
  • the primary antibodies used were: ZNF667 (1:2000, Abcam, ab106432), N-Cadherin (1:1000, Cell signaling, 4061S), E-Cadherin (1:1000, Cell signaling, 14472S), Vimentin (1:1000, Cell signaling, 5741) and GAPDH (1:1000, Sigma, G9545). After washing 5 times with TBS-T, the blots were incubated with mustard radish hydrogen peroxide-conjugated secondary antibody and visualized with enhanced chemi-luminescence detection (ECL plus kit, Pierce).
  • lncRNA genes with unique expression for each subtype were identified: a total of 262 lncRNAs with distinct expression in the six subtypes corresponded to a total of 262 (Fig. 1b; Table 3).
  • LNC6 subtypes in the TCGA cohort represent sex, ethnicity, tumor location and stage of cancer, histological grade, and Loren subtype (Table 4).
  • the majority of L6A and L6E patients were male (84% and 100%).
  • the majority of L6A and L6D patients were from Western countries (96% and 92%).
  • Such ethnic differences were not found in the molecular subtypes of gastric cancer.
  • L6A patients had the highest proportion of the proximal part of the tumor (36%), whereas L6F patients had the lowest proportion (10%).
  • gastric cancer is usually diagnosed after advanced stage in Western countries, L6A subtype tumors showed a relatively low cancer stage.
  • L6C tumors also showed relatively low cancer stage, but L6E and L6F tumors showed high stage and histological grade.
  • the L6F subtype was rich in the diffuse subtype in the Loren classification.
  • the L6C probability corresponds to a positive predictive marker of response to immunotherapy
  • the L6F probability corresponds to a negative predictive marker of response to immunotherapy.
  • the deviation corresponds to 0 or 1, so that the predicted probability of the L6E subtype does not stratify immunotherapy responders and non-responders, although it is specifically upregulated in the L6E subtype.
  • L6F tumors are predicted to consist of stromal cells, that is, lymphoid epithelial cells, fibroblasts, chondrocytes, pericytes, and adipocytes, suggesting that the immune response is limited in L6F tumors (Fig. 6b). ).
  • L6F subtype showed the most significant association with clinical outcomes such as poor prognosis, early recurrence, and resistance to chemotherapy.
  • L6F-like gastric cancer cell lines were identified by applying BCCP predictors for L6F subtype to lncRNA expression data from 29 gastric cancer cell lines.
  • L6F probability showed a high correlation with epithelial-mesenchymal transition (EMT) subtype (Fig. 7a).
  • EMT epithelial-mesenchymal transition
  • L6A subtype was expressed through activation of metabolic pathways such as glycosylation, oxidative phosphorylation and fatty acid metabolism.
  • Hepatocyte nuclear factor-4 ⁇ (HNF4 ⁇ ) was predicted to be the most important upstream regulator of L6A.
  • the L6C subtype is associated with activation of the G2M checkpoint, E2F target, DNA repair, MYC target and MTORC1 signal, while the L6D subtype is associated with protein release and activation of KRAS signaling.
  • the L6E subtype is associated with the activation of an interferon response that maintains the activated immunity of the L6E subtype.
  • the L6F subtype is associated with activation of Wnt/ ⁇ -catenin signaling, TGF- ⁇ signaling, EMT, and angiogenesis.
  • TGF- ⁇ and Twist1 which are major regulators of EMT, are known as upstream regulators of the L6F subtype.
  • the molecular characteristics of the LNC6 subtype were further investigated using genomic and proteome data from TCGA data.
  • the L6B subtype was defined as a high copy number change, and only some genes were expressed differently among the LNC6 subtypes (Fig. 11a).
  • the L6C subtype is characterized by a high mutation burden, and many genes were mutated differently among the LNC6 subtypes (Fig. 11b).
  • the L6E subtype was characterized by a hypermethylation pattern (Fig. 12a), and the L6F subtype was characterized by the most distinct expression pattern of miRNAs and proteins (Figs. 12b and 12c) and a recurrent (15.4%) CLDN18-ARHGAP fusion.
  • the epigenetic background of subtype-specific lncRNAs and the identified epigenetic regulated lncRNAs were identified ( FIG. 13 ).
  • L6A and L6B subtypes were abundant in chromosomal instability (CIN) and microsatellite stability (MSS) subtypes.
  • the L6C subtype was abundant in the microsatellite instability (MSI) subtype, and the L6D subtype was mixed with a number of other molecular subtypes.
  • the L6E subtype corresponded to 100% Epstein-Barr virus (EBV) subtype, and the L6F subtype was abundant in the genetically stable (GS) subtype, the MP subtype and the EMT subtype.
  • An object of the present invention is to provide a composition capable of preventing or treating gastric cancer among cancers, or inhibiting invasiveness or metastasis of gastric cancer cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 암 중에서도 특히 위암을 예방 또는 치료하거나, 위암 세포의 침윤성 또는 전이성을 억제할 수 있으며, 항암제에 대한 감수성을 증진시킬 수 있는 조성물을 제공하고자 한다.

Description

암의 예방 또는 치료용 조성물
본 발명은 암 중에서도 특히 위암을 예방 또는 치료하거나, 위암 세포의 침윤성 또는 전이성을 억제할 수 있는 조성물을 제공하고자 한다.
암이란 개체의 필요에 따라 규칙적이고 절제 있는 증식과 억제를 할 수 있는 정상세포와 달리 조직 내에서 필요한 상태를 무시하고 무제한의 증식을 하는 미분화 세포로 구성된 세포덩어리로서 종양이라고도 한다. 이러한 무제한의 증식을 하는 암 세포는 주위의 조직으로 침투하고 더 심각한 경우는 신체의 다른 기관으로 전이가 되어 심각한 고통을 수반하고 결국 죽음을 초래하는 난치병이다.
암은 혈액암과 고형암으로 크게 분류되며, 위암, 췌장암, 유방암, 구강암, 간암, 자궁암, 식도암, 피부암 등 신체의 거의 모든 부위에서 발생하며, 이들의 치료방법으로 최근 글리벡 또는 허셉틴과 같은 소수의 표적치료제가 특정 암의 치료에 이용되고 있으나 현재까지는 수술이나 방사선 요법 및 세포증식을 억제하는 화학요법제를 이용한 항암제 치료가 주된 방법이다. 그러나 표적치료제가 아니기 때문에 기존 화학요법제의 가장 큰 문제는 세포독성으로 인한 부작용과 약제 내성으로써, 항암제에 의한 초기의 성공적인 반응에도 불구하고 결국에는 치료가 실패하게 되는 주요 요인이다. 따라서, 이러한 화학요법제의 한계를 극복하기 위해서는 항암작용 기전이 명확한 표적 치료제 개발이 지속적으로 필요하다.
위암은 암-관련 죽음의 3번째 원인에 해당하고, 가장 흔한 암 중에서도 4번째 순위를 차지한다. 개인 맞춤형 약제의 개발을 위하여 임상적으로 그리고 생물학적으로 면밀한 분자적 분석이 요구되고 있다. 지난 몇 년 동안, 전장 유전체 수준에서 위암에 대한 오믹스(omics) 연구를 통해 생물학적 복잡성에 대한 이해도를 높였고, 특히 mRNA 유전자 발현 데이터의 분석을 통해 바이오마커를 이용한 예후 및 보조 항암 화학 요법에 대한 반응성 예측에 큰 발전을 가져왔다. 위암에 있어서 다른 수준에서의 분자적 프로파일링은 개별 맞춤화된 치료 전략의 발전을 가져올 것으로 예측된다.
최근에는 긴 비암호화 RNA(long non-coding RNA; lncRNA)를 암의 예후 예측 및 치료를 위한 타겟으로 연구가 진행되고 있다. 상기 lncRNA는 암의 경로에 중요한 물질로 작용하며, 암으로의 발전 및 진행에 관련이 있다. 상기 lncRNA는 단백질-코딩 잠재력 없이 200개 이상의 뉴클레오티드로 이루어진 전사체이다. 이들은 단백질을 코딩하는 유전자보다 구성 뉴클레오티드의 수가 많으며, mRNA 보다 큰 정도로 특정 세포/조직 유형으로 제한되며, 암-유형 특이적 치료 타겟으로 전망되고 있다.
핵산 기반 (RNA-타겟팅) 치료제는 몇몇 질환에서 임상적 성공을 보였고, lncRNA를 타겟으로 하여 몇몇의 암에서도 임상 전 성공을 보였다. 하지만 위암에서는 lncRNA 타겟에 대하여 보고된 바가 없고, 이들의 임상적 연관성 및 생물학적 기능에 대하여 충분한 연구가 이루어지고 있지 않다.
본 발명의 일 목적은 암을 예방 또는 치료할 수 있는 조성물을 제공하고자 한다.
본 발명의 다른 목적은 암의 침윤성 또는 전이성을 억제할 수 있는 조성물을 제공하고자 한다.
본 발명의 또 다른 목적은 항암제에 대한 내성을 극복할 수 있는 조성물을 제공하고자 한다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
본 발명의 일 구현 예에 따르면, ZNF667-AS1(ZNF667 Antisense RNA 1 (Head To Head)), RP11-572C15.6, FENDRR(FOXF1 Adjacent Non-Coding Developmental Regulatory RNA) 및 ACTA2-AS1(ACTA2 Antisense RNA 1) 중 적어도 하나에 특이적인 발현 억제제를 유효 성분으로 포함하는, 암의 예방 또는 치료용 약학적 조성물에 관한 것이다.
본 발명의 다른 구현 예에 따르면, ZNF667-AS1, RP11-572C15.6, FENDRR 및 ACTA2-AS1 중 적어도 하나에 특이적인 발현 억제제를 유효 성분으로 포함하는, 암의 침윤성 또는 전이성 억제용 약학적 조성물에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, ZNF667-AS1, RP11-572C15.6, FENDRR 및 ACTA2-AS1 중 적어도 하나에 특이적인 발현 억제제를 유효 성분으로 포함하는, 내성암의 내성 극복용 약학적 조성물에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, ZNF667-AS1, RP11-572C15.6, FENDRR 및 ACTA2-AS1 중 적어도 하나에 특이적인 발현 억제제를 유효 성분으로 포함하는, 내성암 또는 전이암의 예방 또는 치료용 약학적 조성물에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, ZNF667-AS1, RP11-572C15.6, FENDRR 및 ACTA2-AS1 중 적어도 하나에 특이적인 발현 억제제를 유효 성분으로 포함하는, 항암제에 대한 감수성 증진용 약학적 조성물에 관한 것이다.
본 발명에서 상기 ZNF667-AS1, RP11-572C15.6, FENDRR 및 ACTA2-AS1 각각은 긴-비암호화 RNA 유전자(long non-coding RNA; lncRNA)로, 상기 ZNF667-AS1는 서열번호 1로 표시될 수 있고, 상기 RP11-572C15.6는 서열번호 2로 표시될 수 있으며, 상기 FENDRR은 서열번호 3으로 표시될 수 있고, 상기 ACTA2-AS1은 서열번호 4로 표시될 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 상기 ZNF667-AS1, RP11-572C15, FENDRR 또는 ACTA2-AS1에 특이적인 발현 억제제는 상기 유전자에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA(short interfering RNA; siRNA), 짧은 헤어핀 RNA(short hairpin RNA; shRNA) 및 리보자임(ribozyme)으로 구성된 군으로부터 선택된 어느 하나 이상인 것이 바람직하다.
본 발명에서 상기 "안티센스 뉴클레오티드"는 왓슨-크릭 염기쌍에 정의된 바에 따라, DNA, 미성숙-mRNA 또는 성숙된 mRNA의 상보적 염기서열에 결합(혼성화)하여 DNA에서 단백질로서 유전정보의 흐름을 방해하는 것이다. 표적 서열에 특이성이 있는 안티센스 뉴클레오티드의 성질은 그것들을 예외적으로 다기능이 되도록 한다. 안티센스 뉴클레오티드는 모노머 단위의 긴 사슬이기 때문에 이들은 표적 RNA 서열에 대해 쉽게 합성될 수 있다. 최근 많은 연구들은 표적 단백질을 연구하기 위한 생화학적 수단으로 안티센스 뉴클레오티드의 유용성을 증명하였다(Rothenberg et al., J. Natl. Cancer Inst., 81:1539-1544, 1999). 올리고뉴클레오티드 화학 및 향상된 세포주흡착, 표적결합 친화도 및 뉴클레아제 내성을 나타내는 뉴클레오티드 합성 분야에서 최근 많은 진보가 있었으므로 안티센스 뉴클레오티드의 사용은 새로운 형태의 억제제로 고려될 수 있다.
본 발명에서 상기 "siRNA" 및 "shRNA"는 RNA 방해 또는 유전자 사일런싱 (silencing)을 매개할 수 있는 핵산 분자로서, 표적 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 녹다운 (knockdown) 방법 또는 유전자 치료 방법으로 사용된다. shRNA는 단일 가닥의 올리고 뉴클레오티드 내에서 상보적인 서열간의 결합에 의해 헤어핀 (hairpin) 구조를 형성한 것이고, 생체 내에서 상기 shRNA는 다이서 (dicer)에 의해 절단되면서 21 내지 25 뉴클레오티드 크기의 작은 RNA 조각으로 이중 가닥의 올리고 뉴클레오티드인 siRNA가 되며, 상보적인 서열을 갖는 mRNA에 특이적으로 결합하여 발현을 억제할 수 있다. 따라서 shRNA 및 siRNA 중 어느 수단을 이용할지는 당업자의 선택에 의해 결정될 수 있으며 이들이 표적으로 하는 mRNA 서열이 동일한 경우라면 유사한 발현 감소 효과를 기대할 수 있다. 본 발명의 목적상 ZNF667-AS1, RP11-572C15, FENDRR 또는 ACTA2-AS1에 특이적으로 작용하여 ZNF667-AS1, RP11-572C15, FENDRR 또는 ACTA2-AS1 LncRNA 분자를 절단하여 RNA 간섭 (RNAi, RNA interference) 현상을 유도함으로써, 상기 ZNF667-AS1, RP11-572C15, FENDRR 또는 ACTA2-AS1을 억제할 수 있다. siRNA는 화학적으로 또는 효소학적으로 합성될 수 있다. siRNA의 제조방법으로는 특별히 한정되지 않으며, 당업계에 공지된 방법을 사용할 수 있다. 예를 들면, siRNA를 직접 화학적으로 합성하는 방법, 시험관 내 (in vitro) 전사를 이용한 siRNA의 합성법, 시험관 내 (in vitro) 전사에 의해 합성된 긴 이중 가닥 RNA를 효소를 이용하여 절단하는 방법, shRNA 발현 플라스미드나 바이러스성 벡터의 세포 내 전달을 통한 발현법 및 PCR (polymerase chain reaction) 유도 siRNA 발현 카세트 (cassette)의 세포 내 전달을 통한 발현법 등이 있으나 이에 한정되는 것은 아니다.
본 발명에서 상기 "리보자임(ribozyme)"은 촉매 활성을 갖는 RNA 분자를 말한다. 다양한 활성을 갖는 리보자임이 공지되어 있으며, 상기 유전자의 리보자임은 공지된 또는 인공적으로 생성된 리보자임을 포함하며, 선택적으로 표적 특이적 RNA 절단 활성을 갖는 리보자임이 공지의 표준 기법에 의해 제조될 수 있다.
본 발명의 일 예시에서 상기 발현 억제제는 ZNF667-AS1의 유전자에 특이적인 발현 억제제로, 서열번호 5 및 6으로 표시되는 siRNA일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서는 ZNF667-AS1, RP11-572C15.6, FENDRR 및 ACTA2-AS1 중 적어도 하나의 유전자에 특이적인 발현 억제제는 암 세포의 성장 또는 증식을 효과적으로 억제할 수 있고, 더 나아가서는 암 세포의 침윤성 또는 전이성 또한 효과적으로 예방 또는 치료할 수 있다.
본 발명에서 상기 "암"은 포유류에서 전형적으로 조절되지 않는 세포 성장으로 특징 지어진 생리적 상태를 나타내거나 가리킨다. 본 발명에서 상기 예방 또는 치료의 대상이 되는 암은 그 발생 부위에 따라 암은 위암, 난소암, 대장암, 유방암, 간암, 췌장암, 자궁경부암, 갑상선암, 부갑상선암, 비소세포성폐암, 전립선암, 담낭암, 담도암, 비호지킨 림프종, 호지킨 림프종, 혈액암, 방광암, 신장암, 흑색종, 결장암, 골암, 피부암, 두부암, 자궁암, 직장암, 뇌종양, 항문부근암, 나팔관암종, 자궁내막암종, 질암, 음문암종, 식도암, 소장암, 내분비선암, 부신암, 연조직 육종, 요도암, 음경암, 수뇨관암, 신장세포 암종, 신장골반 암종, 중추신경계(CNS central nervoussystem) 종양, 1차 CNS 림프종, 척수 종양, 뇌간 신경교종 또는 뇌하수체 선종일 수 있으나, 바람직하게는 위암일 수 있다.
본 발명에서 상기 "내성암"은 암 치료용 약물, 특히 항암제 치료에 대하여 극히 낮은 감수성을 나타내어, 항암요법 등의 치료법에 의하여 암의 증세가 호전, 완화, 경감 또는 치료증상을 나타내지 않는 암을 의미한다. 상기 암 치료용 약물 내성암은 특정한 항암제에 대하여 처음부터 내성을 가질 수도 있고, 최초에는 내성을 나타내지 않았으나, 긴 시간의 약물 치료로 인하여 암세포 내의 유전자 변이 등에 의하여 동일한 치료제에 대해 더 이상 감수성을 나타내지 않게 되어 발생할 수도 있다.
본 발명에서 상기 "암 치료용 약물" 또는 "항암제"는 그 종류를 특별히 한정하지는 않으나, 바람직하게는 위암의 치료용 약물일 수 있다. 구체적인 예를 들면, 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 소라페닙, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 데시타빈, 카페시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴, 보리노스텟, 엔티노스텟, 5FU 및 카르무스틴로 이루어진 군에서 선택된 1종 이상일 수 있으며, 바람직하게는 옥살리플라틴 또는 5FU일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 상기 "내성 극복"이란, 특정 약물로 암 치료용 약물, 특히 항암제에 대한 내성을 획득한 암 세포의 치료용 약물에 대한 감수성을 증가시키는 작용을 의미한다. 상기 감수성의 증가는 내성이 없는 암 세포에 대해 성장 억제 등의 효과를 보이는 농도와 비교하여, 내성을 획득한 암세포의 성장 억제 및 세포 사멸 등의 효과를 보이는 농도가 동등하거나 그 이상으로 상승시키는 정도에 이르는 것을 의미한다. 상기 내성 극복과 동의어로서 "내성 억제", "내성 해제", "저항성 해제" 및 "감수성 증강" 등이 있다.
본 발명에서 상기 "전이암"이란, 암 세포가 원발 장기를 떠나 다른 장기로 이동하여 증식되어 발생된 암을 의미한다. 암이 신체 다른 부분으로 퍼지는 것은 크게 원발암에서 암 조직이 성장하여 직접적으로 주위 장기를 침습하는 것과 멀리 있는 다른 장기로 혈관이나 림프관을 따라 원격 전이를 하는 것으로 구분할 수 있다. 바람직하게는 다른 원발암에서 암이 위의 장기로 전이된 것을 의미할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, "예방"은 본 발명의 약학적 조성물을 이용하여 암 증상을 차단하거나, 암 증상의 억제 또는 지연시키는 모든 행위라면 제한없이 포함할 수 있다.
본 발명에서, "치료"는 본 발명의 약학적 조성물을 조사하여 암 증상이 호전되거나 이롭게 되는 모든 행위라면 제한없이 포함할 수 있다.
본 발명의 약학적 조성물은 항암제 형태뿐만 아니라 상기 항암제의 보조제의 형태로도 사용될 수도 있다.
본 발명의 약학적 조성물은 다른 항암제와도 추가로 병용 투여할 수 있으며, 이를 통해서 암 세포에 대한 성장 억제 효과를 더욱 증강시킬 수 있다.
여기서 상기 항암제로는 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 5FU, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴 및 카르무스틴으로 이루어진 군에서 선택된 1종 이상을 사용할 수 있으나, 이에 제한되는 것은 아니다.
본 발명에 있어서, 상기 약학적 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학적 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다.
본 발명의 약학적 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 본 발명의 약학적 조성물은 약제적으로 허용 가능한 담체를 포함할 수 있다. 약제학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 약학적 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형할 수 있다.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
본 발명에 따른 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투여가 바람직하다.
본 발명에서, "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 본 발명의 약학적 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.
본 발명의 약학적 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여시간, 투여경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학적 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약무형태, 투여경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1일 0.0001 내지 50mg/kg 또는 0.001 내지 50mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 의약 조성물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형될 수 있다.
본 발명의 또 다른 구현 예에 따르면, 투여가 필요한 개체에게, ZNF667-AS1(ZNF667 Antisense RNA 1 (Head To Head)), RP11-572C15.6, FENDRR(FOXF1 Adjacent Non-Coding Developmental Regulatory RNA) 및 ACTA2-AS1(ACTA2 Antisense RNA 1) 중 적어도 하나에 특이적인 발현 억제제를 유효량으로 투여하는 단계를 포함하는, 암의 예방 또는 치료 방법에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 투여가 필요한 개체에게, ZNF667-AS1, RP11-572C15.6, FENDRR 및 ACTA2-AS1 중 적어도 하나에 특이적인 발현 억제제를 유효량으로 투여하는 단계를 포함하는, 암의 침윤성 또는 전이성 억제 방법에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 투여가 필요한 개체에게, ZNF667-AS1, RP11-572C15.6, FENDRR 및 ACTA2-AS1 중 적어도 하나에 특이적인 발현 억제제를 유효량으로 투여하는 단계를 포함하는, 내성암의 내성 극복 방법에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 투여가 필요한 개체에게, ZNF667-AS1, RP11-572C15.6, FENDRR 및 ACTA2-AS1 중 적어도 하나에 특이적인 발현 억제제를 유효량으로 투여하는 단계를 포함하는, 내성암 또는 전이암의 예방 또는 치료 방법에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, 투여가 필요한 개체에게, ZNF667-AS1, RP11-572C15.6, FENDRR 및 ACTA2-AS1 중 적어도 하나에 특이적인 발현 억제제를 유효량으로 투여하는 단계를 포함하는, 항암제에 대한 감수성 증진 방법에 관한 것이다.
본 발명에서 상기 "개체"는 암이 발병하였거나 발병이 의심되는 개체로서, 인간을 포함한 쥐, 가축 등을 포함하는 포유동물을 의미하나, 본 발명에서 제공하는 유효 물질로 치료 가능한 개체는 제한 없이 포함된다.
본 발명의 각 방법에서, 상기 발현 억제제 및 암의 정의, 투여 경로, 방법 및 용량 등에 관한 내용은 앞선 조성물에서 기재된 바와 중복되어 이하 명세서의 과도한 복잡을 피하고자 그 기재를 생략한다.
본 발명에 따른 조성물을 이용하는 경우, 암 중에서도 특히 위암을 효과적으로 예방, 개선 또는 치료할 수 있을 뿐만 아니라, 암 세포, 특히는 위암 세포의 침윤성 및 전이성을 또한 억제할 수 있다. 또한, 본 발명의 조성물을 이용하는 경우 항암제에 대한 감수성을 증진시켜 내성암의 내성 극복, 더 나아가서는 내성암을 예방 또는 치료할 수 있다.
도 1은 TCGA 코호트(n = 258)에서 STAD 조직으로부터 얻어진 lncRNA 데이터의 계측적 클러스터링 및 구분되는 발현 분석한 결과를 나타낸 것으로, 도 1a는 계측적 클러스터링 분석을 위하여, 적어도 7개의 조직에서 조직 별 중앙 값에 대하여 적어도 0.5 차이(log2 값)를 보이는 유전자(1,001 lncRNAs)가 선별된 결과를 보이는 것이고, 도 1b는 TCGA 코호트에서 LNC6 아형에 대하여 특이적인 lncRNA 발현 시그니처를 나타낸 것이다. 각 데이터는 매트릭스 형태로 나타내었으며, 행은 개별 유전자를 나타내고, 열은 각 조직을 나타낸다. 각 매트릭스 데이터에서 각각의 셀은 개별 조직에서 유전자의 발현 수준을 나타내며, 적색과 녹색은 스케일 바(log2 전환 스케일)로 나타내어지는 상대적 높고 낮은 발현 수준을 나타낸다.
도 2는 LNC6 아형의 예후 관련도를 나타낸 것으로, 도 2a는 TCGA 코호트(n = 258)에서 LNC6 아형에 특이적인 mRNA 발현 시그니처로, TCGA 데이터 세트에서 아형 특이적인 mRNA를 규명하기 위하여 다중 2-시료 t-테스트를 수행하였다. 도 2b는 예측 모델에서 계통도를 나타낸 것으로, 환자를 큰 예측 가능성이 있는 아형으로 분류하였다. 도 2c는 실험 코호트(n = 1,933)에서 환자의 총 생존 기간(overall survival; OS)과 무재발 생존 기간(recurrence-free survival; RFS)의 카플란-마이어 플롯(Kaplan-Meier plots)을 나타낸 것이다.
도 3은 한국 코호트(n=180)에서 LNC6 아형과 보조 항암 화학 요법 사이 상관 관계를 나타낸 것으로, 각 LNC6 아형 별 보조 항암 화학 요법(CTX)를 받은 환자와 받지 않은 환자 사이 무재발 생존 기간(RFS)의 카플란-마이어 플롯을 나타낸 것이며, 이때 대상 환자로는 한국인 코호트에서 원발 전이가 없는 AJCC 암기 II, III 또는 IV 환자를 대상으로 하였다.
도 4는 L6C의 항암제 내성과 상피 표현형의 서브세트에 관한 것으로, 도 4a는 한국인 코호트(n = 180)에서 LNC6 아형과 중간엽/상피 아형(MP/EP) 사이 코드표를 나타낸 것이다. 본 분석에는 원발 전이가 없는 AJCC 암기 II, III 또는 IV 환자를 대상으로 하였다. 도 4b는 보조 항암 화학 요법(CTX)를 받은 EP 아형 환자와 받지 않은 EP 아형 환자(n = 122) 사이 무재발 생존 기간(RFS)의 카플란-마이어 플롯을 나타낸 것으로, EP 아형 환자에 있어서 보조 항암 화학 요법과 L6C 아형 사이 상호 관계를 분석하였다.
도 5는 면역 요법에 대한 치료 반응성과 LNC6 아형(n=45) 사이의 상호 관계를 나타낸 것으로, 도 5a는 LNC6 아형에 따른 펨브롤리주맙에 대한 반응성을 나타낸 것이고, 도 5b 및 5c는 치료 반응성을 보이는 자와 비-반응성을 보이는 자에서 L6C 아형과 L6F 아형의 예측 가능성을 나타낸 것이다. 도 5d는 치료 반응성을 보이는 자와 비-반응성을 보이는 자에서 L6E 아형에서 상향 조절된 lncRNA의 정규화된 풍부도(Normalized enrichment score; NES)를 나타낸 것이다. 여기서, CR은 완전 관해(complete response), PR은 부분적 반응성(partial response), SD는 안정한 질환(stable disease), PD는 진행중인 질환(progressive disease)를 의미한다.
도 6은 각 LNC6 아형에서 세포 유형 구성요소를 나타낸 것으로, 도 6a 및 6b는 각 LNC6 아형에서 TCGA 코호트 시료의 xCell 스코어를 평균화한 것으로, 도 6a는 각 LNC6 아형에서 5개의 세포 유형 패밀리 구성요소를 나타낸 것이고, 도 6b는 각 LNC6 아형에서 64개의 세포 유형의 구성요소를 나타낸 것이다.
도 7은 lncRNA 및 줄기 유사 특징 사이 관계의 생체 외 입증을 나타낸 것으로, 도 7a는 위암 세포주(n=29) 사이의 상피 중간엽 전이 아형(epithelial-to-mesenchymal transition (EMT) subtype)과 관련된 L6F 아형의 예측된 가능성을 나타낸 것이고, 도 7b는 EMT 아형 위암 세포주에서 siRNA 형질 전환 후 qRT-PCR로 ZNF667-AS1 넉다운 효율을 분석한 결과이며, 도 7c 내지 7e는 세포 이동 및 침윤 어쎄이로부터 이동된 및 침윤된 세포의 대표 이미지를 나타낸 것으로, 통계적 바 그래프는 3번의 독립된 실험에서 평균화 결과를 나타낸다(t-test, **P < 0.05; n = 3). 도 7f는 siRNA 형질 전환된 EMT 아형의 위암 세포주에서 나타낸 EMT 마커 단백질을 사용하여 웨스턴 블럿 분석을 수행한 결과를 나타낸 것이고, 도 7g는 siRNA 형질 전환된 EMT 아형의 위암 세포주에서 옥살리플라틴 또는 5FU의 MTS 어쎄이로부터 반 최고치 억제 농도(half maximal inhibitory concentration, IC50)를 나타낸 것이다.
도 8은 TCGA 코호트(n=258)에서 특징(hallmark) 유전자 세트의 유전자 세트 풍부 분석을 나타낸 것으로, 분석 전 Z 스코어에 의해 시료에서 유전자 발현 값을 정규화하였고, 순위 정규화 방법에 의해 ssGSEAProjection를 적용하였으며, X 축은 LNC6 아형, Y 축은 계층적 클러스터링으로 배열하였다.
도 9는 TCGA 코호트(n=258)에서 위 발달 전사 인자의 발현 패턴을 나타낸 것으로, mRNA 풍부의 수준에서 규명된 725개의 위 발달 TF에 있어서, TCGA 코호트에서 발현 수준이 이용 가능한 723개의 TF를 본 분석에 포함시켰다. 초기 배아 단계에서 높게 발현된 TF를 그룹 1, 후기 배아 단계 또는 성숙 단계에서 높게 발현되는 TF를 그룹 2로 구분하였고, Y 축은 TF 그룹 및 시료에서 표준 편차에 따라 상부에서 하부로 정렬하였다.
도 10은 TCGA 코호트(n=258)에서 S-기의 lncRNA의 발현 패턴을 나타낸 것으로, 일시적으로 발현된 S-기 풍부 lncRNA에서, TCGA 코호트 시료에서 표준 편차가 0.3 보다 큰 85개의 lncRNA를 나타내었다.
도 11은 LNC6 아형과 관련된 특이적 유전자 돌연변이 및 복제 수 변화를 나타낸 것으로, 도 11a는 TCGA 코호트(n = 256)에서 특이적으로 돌연변이된 유전자를 나타낸 것이며, 바는 돌연변이의 수를 나타낸 것으로, MutSigCV에 의해 확인된 특이적으로 돌연변이된 유전자는 q 값으로 필터링되고, 빈도에 의해 순위를 매겼다(왼쪽). 돌연변이 색은 돌연변이의 부류를 나타내고, 카이 자승 검증(chi-square)으로 아형 특이적 유전자 돌연변이를 확인하였다. 도 11b는 TCGA 코호트(n=257)에서 복제 수 돌연변이를 나타낸 것으로, 바는 복제수가 변화된 게놈의 부분을 나타낸 것이며, 특이적으로 복제 수가 변화된 유전자는 q 값에 의해 필터링되고, 빈도에 의해 순위를 매겼다(왼쪽). 카이 자승 검증으로 아형 특이적 복제수 변화를 확인하였다.
도 12는 TCGA STAD 코호트에서 miRNA 및 단백질의 발현과 DNA의 구분되는 메틸화에 관한 것으로, 도 12a 내지 12c는 TCGA 데이터 세트에서 miRNA 및 단백질의 발현과 DNA의 아형-특이적 메틸화를 확인하기 위하여 다중 2-시료 t-테스트를 수행하였다. 데이터는 매트릭스 형식으로 나타내었고, 행은 각 유전자를 나타내며, 열은 각 조직을 나타낸다. 보다 상세하게, 도 12a는 TCGA 코호트(n=217)에서 LNC6 아형에 특이적인 DNA 메틸화 시그니처를 나타낸 것으로, 표준 편차가 0.15 미만인 경우 무시하였다. 도 12b는 TCGA 코호트(n=218)에서 LNC6 아형 특이적인 miRNA 발현 시그니처를 나타낸 것으로, miRNA의 결측 값이 코호트의 20% 보다 큰 경우 이를 무시하였다. TCGA 코호트(n=224)에서 LNC6 아형에 특이적인 단백질 발현(RPPA) 시그니처를 나타낸 것이다.
도 13은 TCGA 코호트(n=228)에서 LNC6 아형-특이적 lncRNA 유전자의 메틸화 패턴을 나타낸 것으로, 262개의 LNC6 아형 특이적 lncRNA 유전자에서, HM450 프로브에 주석을 단 184개의 유전자를 나타내었다. 각 lncRNA와 프로브 쌍에서 메틸화 변화 및 유전자 발현 사이의 스피어만 상관 계수(Spearman correlation coefficients; Rho)를 왼쪽에 나타내었다. 동일한 유전자 프로모터에 다중 프로브를 주석을 달았다면, lncRNA를 위해 가장 큰 절대적인 계수의 프로브를 선별하였다.
본 발명의 일 구현 예에 따르면, ZNF667-AS1(ZNF667 Antisense RNA 1 (Head To Head)), RP11-572C15.6, FENDRR(FOXF1 Adjacent Non-Coding Developmental Regulatory RNA) 및 ACTA2-AS1(ACTA2 Antisense RNA 1) 중 적어도 하나에 특이적인 발현 억제제를 유효 성분으로 포함하는, 암의 예방 또는 치료용 약학적 조성물에 관한 것이다.
본 발명의 다른 구현 예에 따르면, ZNF667-AS1, RP11-572C15.6, FENDRR 및 ACTA2-AS1 중 적어도 하나에 특이적인 발현 억제제를 유효 성분으로 포함하는, 암의 침윤성 또는 전이성 억제용 약학적 조성물에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, ZNF667-AS1, RP11-572C15.6, FENDRR 및 ACTA2-AS1 중 적어도 하나에 특이적인 발현 억제제를 유효 성분으로 포함하는, 내성암의 내성 극복용 약학적 조성물에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, ZNF667-AS1, RP11-572C15.6, FENDRR 및 ACTA2-AS1 중 적어도 하나에 특이적인 발현 억제제를 유효 성분으로 포함하는, 내성암 또는 전이암의 예방 또는 치료용 약학적 조성물에 관한 것이다.
본 발명의 또 다른 구현 예에 따르면, ZNF667-AS1, RP11-572C15.6, FENDRR 및 ACTA2-AS1 중 적어도 하나에 특이적인 발현 억제제를 유효 성분으로 포함하는, 항암제에 대한 감수성 증진용 약학적 조성물에 관한 것이다.
본 발명에서 상기 ZNF667-AS1, RP11-572C15.6, FENDRR 및 ACTA2-AS1 각각은 긴-비암호화 RNA 유전자(long non-coding RNA; lncRNA)로, 상기 ZNF667-AS1는 서열번호 1로 표시될 수 있고, 상기 RP11-572C15.6는 서열번호 2로 표시될 수 있으며, 상기 FENDRR은 서열번호 3으로 표시될 수 있고, 상기 ACTA2-AS1은 서열번호 4로 표시될 수 있으나, 이에 제한되는 것은 아니다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예
TCGA 위암 코호트의 게놈 및 임상적 데이터
258개의 종양으로 이루어진 TCGA 위선암(stomach adenocarcinoma; STAD) 코호트로부터 총 12,727 lncRNA의 발현 프로파일과 mRNA 발현 프로파일을 다운받은 뒤, log2 베이스로 전환시켰다. TCGA STAD의 체세포 돌연변이, 복제 수 변화(copy-number alteration; CNA) 및 임상적 데이터는 cBioPortal for Cancer Genomics로부터 다운받았다. 역상 단백질 어레이(reverse phase protein array; RPPA)로부터 DNA 메틸화, miRNA 발현 및 단백질 발현 데이터는 UCSC Xena 플랫폼으로부터 다운받았다.
아형-특이적 lncRNA의 아형 분류 및 동정
Gene Cluster 3.0 및 Java TreeView를 통하여 클러스터 분석 및 lncRNA 데이터의 시각화를 수행하였다. 계층적 클러스터링 결과, 258 TCGA STAD 환자를 6개의 클러스터로 분류하였다: 25명은 L6A로, 66명은 L6B로, 51명은 L6C로, 51명은 L6D로, 14명은 L6E로, 그리고 51명은 L6F로 분류하였다. 그 후, 아형-특이적 lncRNA를 확인하기 위하여, 6개 아형의 가능한 모든 조합에 대해 다중 2-클래스 t 테스트(multiple two-class t tests)를 수행하였다. 아형 L6A의 선별을 위하여 5번의 2-시료 t-테스트(2-sample t-tests)를 수행하였다(L6A vs. L6B, L6A vs. L6C, L6A vs. L6D, L6A vs. L6E, and L6A vs. L6F 비교) (P<0.05). 5개의 가능한 비교에 있어서 발현에 유의적 차이가 있는 lncRNA는 다음의 262개의 아형-특이적 lncRNA에 해당한다: 24개는 L6A로, 67개는 L6B로, 20개는 L6C로, 55개는 L6D로, 30개는 L6E로, 그리고 66개는 L6F로 분류되었다.
LNC6 아형의 예측 모델
lncRNA 발현 데이터는 대규모 코호트 데이터세트 중 TCGA 코호트에서만 이용 가능하므로, 그 발현이 LNC6 아형에 특이적인 mRNA를 규명함으로써 lncRNA 아형 시그니처를 mRNA 아형 시그니처로 전환하였고, mRNA 발현 데이터를 이용하여 mRNA 시그니처를 독립 검증 코호트에 적용하였다. 아형-특이적 mRNA 발현 시그니처를 다중 2-클래스 t 테스트에 의해 확인하였다. 아형 L6A 선별을 위하여, 5개의 2-시료 t-테스트를 수행하였다(L6A vs. L6B, L6A vs. L6C, L6A vs. L6D, L6A vs. L6E, and L6A vs. L6F comparisons) (P<0.001). 로그 비율에 따라 각 아형에 대하여 상위 200 mRNA를 선별하였다. 5개의 가능한 비교에 있어서 유의적 차이가 있는 발현을 보이는 유전자의 수가 200개 미만인 경우, 4개의 비교에서 유의적 차이가 있는 유전자를 아형-특이적인 것으로 간주하였다. 아형 예측 모델을 제작하기 위하여, Bayesian compound covariate predictor (BCCP) 알고리즘을 사용하여 이전에 개발된 모델을 사용하였다. 간단히는 총 1,200개 유전자 시그니처(각 아형별 200개 유전자를 포함함)에 대한 유전자 발현 데이터를 사용하여 아형에 속하는 각 조직 시료의 베이즈 확률(Bayesian probability)을 측정하였다. 실험 코호트에서 시료를 베이즈 확률 스코어에 따라 6개 아형 중 하나로 분류하였다. 예측을 위해 BRB-Array Tools (National Institutes of Health)을 사용하였다. 면역 치료 코호트 및 암 세포주에서 LNC6 아형 예측을 위하여 TCGA 코호트에서 lncRNA 발현 데이터에 근거하여 BCCP 모델을 제작하였다. 데이터세트 내 레퍼런스 게놈 주석 버전(reference genome annotation version)의 차이로 인하여, 262 아형-특이적 lncRNA 중 241개만 사용하였다.
실험 코호트의 게놈 및 임상적 데이터
미국 국립생물공학 정보센터(NCBI; accession numbers GSE13861, GSE26942, GSE26253, GSE29272, GSE66229, GSE14209, GSE84437, GSE15459)의 유전자 발현 옴니버스 데이터베이스(Gene Expression Omnibus database)로부터 1,933 환자를 포함하는 7개 독립 GC 코호트에서의 mRNA 발현 및 생존데이터를 획득하였다. 한국 코호트의 267명 환자에서 155명은 표준 보조 항암 화학 요법(5-FU 또는 5-FU와 시스플라틴/옥살리플라틴, 독소루비신 또는 파클리탁셀의 조합)을 받았다. 이들 중, 미국 암연합회(American Joint Commission on Cancer (AJCC), 6th edition) II기, III기 또는 IV기 질환으로 원발 전이가 없는 환자 180명을 보조 항암 화학 요법의 이점을 평가하기 위한 분석 서브세트에 포함시켰다. 190명의 환자 중 132명의 환자가 보조 항암 화학 요법을 받았다.
면역치료 코호트 및 GC 세포주에서의 lncRNA 발현 분석
로우 RNA 시퀀싱 데이터로부터 lncRNA 발현을 분석하였다. 펨브롤리주맙 및 29 DNA-핑거프린트 GC 세포주의 임상 2기에 참여한 전이성 GC 환자로부터 얻어진 45개의 시료에 대하여 수행하였다. STAR 2.6.0c를 이용하여 국제암유전체 협력단(International Cancer Genome Consortium)의 방법에 따라 리드를 레퍼런스 인간 게놈 GRCh38와 얼라인하였다. Gencode 주석(Release 22)과 함께 Rsubread 패키지(ver. 1.34.0)를 사용하여 각 비코딩 RNA에 대한 유니크 맵 리드(uniquely mapped read)를 계산하였다. R (https://www.r-project.org/)을 이용하여 그것의 정의에 따라 FPKM(Fragments per kilobase of transcript per million mapped reads) 값을 계산하였다.
다른 분자 아형의 예측
TCGA 아형 및 미세부수체 불안정성(microsatellite instability; MSI) 상태를 정의하였다. 다른 분자 아형 및 면역 치료의 이점을 예측하기 위하여 BCCP 모델을 적용하였다. 환자를 해당 분자 아형으로 분류하기 위하여 위장관 기질 종양(gastrointestinal stromal tumor; GIST) 및 아시아 암 연구 그룹(Asian Cancer Research Group; ACRG) 유전자 발현 시그니처를 적용하였다.
통계적 분석
각 아형 별 총 생존 기간(overall survival; OS) 및 무재발 생존 기간(recurrence-free survival; RFS) 사이의 상관 관계를 분석하기 위하여 카플란-마이어 플롯(Kaplan-Meier plots) 및 로그 순위법(log-rank tests)을 사용하였다. 두 아형(EP∩L6C vs EP-L6C) 사이의 상호 관계 정도와, 보조 항암 화학 요법의 이점을 평가하기 위하여, 콕스 비례 위험 모델(Cox proportional hazards model)을 적용하였다. 모델은 세가지 공변량으로, 성별, 나이 및 미국 암연합회(AJCC) 암의 병기를 포함하였다. 모든 통계적 분석은 R 언어 환경(http://www.r-project.org)에서 수행하였다.
생물 정보학 분석
TCGA 코호트 및 면역 치료 코호트에서 GenePattern과 함께 Single-sample GSEA (ssGSEA), Gene Set Enrichment Analysis (GSEA)의 연장(extension)을 수행하였다. 간단히는, 시료 및 유전자 세트의 각 페어링의 분리된 풍부 점수(enrichment scores)를 계산하였고, 이는 유전자 세트에서 유전자가 시료 내에서 대등하게 상향- 또는 하향-조절되었는 지 정도를 나타낸다. 발현 값은, 시료에 걸쳐 유전자 당 Z-정규화를 수행하였고, 그 후 시료 당 Z 값에 의해 순위를 매겼다. TCGA 코호트 분석을 위하여 "hallmark" 유전자 세트를 사용하였다. 얻어진 풍부 점수는 Z 스코어에 의해 시료에 걸쳐 정규화되었다(NES - normalized enrichment score).
표준 경로(canonical pathways)와 각 아형의 상류 조절자(upstream regulators)를 규명하기 위하여 Ingenuity Pathway Analysis (IPA)을 사용하였다. IPA는 적정한 수의 유전자가 요구되므로, 5개의 가능한 비교에서 발현 상 유의적 차이(P<0.05)를 보이는 mRNA를 분석에 사용하였다. 절대적 로그 비율이 1 초과인 mRNAs만을 L6F의 분석에 사용하였다. 유전자의 결과적 수는 다음과 같았다: L6A는 1,576개, L6B는 404개, L6C는 427개, L6D는 1,756개, L6F는 2,391개에 해당하였다. 아형별 시료와 TCGA 코호트에서 시료 나머지 사이에서의 유전자의 발현 로그 비율을 분석하였다.
다른 상물학적 특성 분석
64개의 면역 및 기질 세포 타입을 포함하는 세포 이질성(cellular heterogeneity)은 유전자 시그니처-기반 방법(xCell)에 의한 TCGA 코호트 전사체로부터 추론되었다. 64개의 세포형은 5개의 세포형 패밀리로 그룹핑하였고, 각 세포형 패밀리의 스코어는 포함하는 세포형 스코어의 총체로 계산되었다. 각 아형 별 줄기세포능은 마우스 위 발달 단계에서 다르게 발현되는 전사 인자의 발현 수준으로부터 평가되었다. mRNA 풍부 수준에서 규명된 725개의 위 발달 전사인자 중 TCGA 코호트에서 발현 수준 값이 이용 가능한 723개를 분석에 사용하였다. 각 아형 별 세포 주기의 단계는 초기 RNA 캡쳐 시퀀싱에 의해 규명된 S-단계 풍부 lncRNA의 발현 정도로부터 평가하였다. 1,145개의 일시적으로 발현되는 S-단계 풍부 lncRNA 중, TCGA 코호트 시료에 걸쳐 표준 편차가 0.3 초과인 경우 분석에 사용하였다. 위암에서 면역 조절에 관여하는 lncRNA를 확인하기 위하여, LncRNA Modulator Atlas in Pan-cancer (LncMAP)에서 규명된 lncRNA-중재 전사 네트워크 변화들을 평가하였다. 간단히는, 게놈-와이드 전사 조절(genome-wide transcriptional regulation)로 페어링된 lncRNA 및 유전자 발현 프로파일을 통합함으로써 각 암 유형별 변화된 lncRNA-전사 인자 유전자 트리플렛(triplets)을 확인하였다. 이후, ImmPort 프로젝트로부터 얻어진 면역-관련 유전자를 포함한 트리플렛만을 분석에 사용하였다(STAD에서 17,572 트리플렛). 면역 조절의 정도는 각 lncRNA가 구성하는 트리플렛의 수로 정의하였다.
다른 게놈 분석
TCGA 코호트 데이터(395 프로파일 시료)로부터 Q-value (<0.1)에 의해 돌연변이된 유전자를 거른 뒤 상위 29 유전자를 TCGA 코호트로부터 돌연변이 빈도로 플롯팅하였다(n=258). TCGA 코호트 데이터로부터 CNA 유전자를 Q-값 (<0.25) 및 빈도(>5%)로 필터링 하였다. TCGA 코호트로부터 CNA 빈도로 상위 25개 유전자를 플로팅하였다(n=258). DNA 메틸화 데이터는 표준 편차 >0.15로 필터링하였고, 모든 5개의 가능한 비교에서 β-값에 유의적 차이가 있는 경우(P<0.01), 아형 특이적인 것으로 간주하였고, 총 38,476개의 아형 특이적 프로브를 확인하였다: L6A는 451개, L6B는 773개, L6C는 84개, L6D는 10개, L6E는 28,803개, 그리고 L6F는 8,355개에 해당한다. miRNA 데이터는 결측 값(코호트의 <20%)으로 필터링하였고, 모든 5개의 가능한 비교에서 유의적 차이를 보이는 경우(P<0.05) 아형 특이적인 것으로 간주하였고, 143개의 아형 특이적 miRNA를 확인하였다: L6A는 17개, L6B는 4개, L6C는 0개, L6D는 4개, L6E는 8개, L6F는 110개에 해당하였다. 모든 5개의 가능한 비교에서 유의적 차이(P<0.05)가 있는 단백질은 아형 특이적인 것으로 간주하였고, 총 40개의 아형 특이적 단백질을 얻었다: L6A는 3개, L6B는 1개, L6C는 0개, L6D는 1개, L6E는 10개, L6F는 25개에 해당하였다. lncRNA 유전자의 후성 조절의 분석을 위하여, HM450 프로브를 lncRNA 유전자에 주석으로 달았다. TCGA 코호트에서 유전자 융합 경우를 다운로드 하였고, 258명의 환자 중 유전자 융합이 발생한 데이터는 183명의 환자에게서 이용이 가능하였다.
세포 배양 및 형질 전환
위암 세포주를 10% 소태아 혈청이 첨가되었고, 페니실린/스트렙토마이신(100ug/L each)을 포함하는 RPMI-1640 배지에서 배양하였고, 이때 배양은 5% CO2를 포함하는 가습화된 배양기 내에서 37℃의 온도 조건 하에서 수행되었다. 표 1에 나타낸 siRNA (Thermofisher Scientific)에 의한 ZNF667-AS1 넉다운은 mirus 형질 전환 시약(Mirus bio)을 사용하여 수행되었다.
서열(5'->3')
센스 가닥(Sense) GCUCCUAGCAACCAACAUUTT(서열번호 5)
안티센스 가닥(Antisense) AAUGUUGGUUGCUAGGAGCTG(서열번호 6)
정량적 실시간 RT-PCR
암 세포에 대하여 TRI 시약을 이용해 총 RNA를 추출하였다. M-MLV 역전사효소(Enzynomics)를 사용하여 cDNA를 합성하였다. SYBR Green PCR 마스터 믹스 (Thermofisher Scientific) 및 하기 표 2의 프라이머를 이용하여 Eco 실시간 PCR 시스템(Illumina) 상에서 실시간 qPCR에 의해 유전자 발현을 측정하였다. GAPDH에 대하여 상대적 유전자 발현량을 정규화 하였다.
유전자 정방향 프라이머(Forward Primer) 역방향 프라이머(Reverse Primer)
FENDRR AGAGTGCTTCCACTGCCCTA (서열번호 7) CCCATTTGCAAAGGCTACAT (서열번호 8)
MAGI2-AS3 TGGGTCTGTGCAGAGTTGAG (서열번호 9) GCTGGTTATGGCCAATGAGT (서열번호 10)
ACTA2-AS1 GTGGTTCTGGTTTGCCTGAT (서열번호 11) CTGGCCCTGTAACACCAGAT (서열번호 12)
ZNF667-AS1 GGACACTGTGCAGGATGATG (서열번호 13) GGCAAGAATGCTGTGTCTCA (서열번호 14)
RP11-572C15.6 TCATCCCTCTTCCTTGATGG (서열번호 15) ATTGGCAACTTTGGGCTATG (서열번호 16)
세포 생존율 어쎄이
si-비 타겟 또는 si-ZNF667-AS1로 형질 전환된 암 세포를 96-웰 플레이트에 2X103 세포/웰의 양으로 접종하여 약물 처리 전 밤새 배양하고, 웰당 20uL CellTiter 96 AQueous One 용액(MTS, Promega)을 첨가하기 전에 72 시간 동안 약물의 존재 하에서 유지하였다. 플레이트를 3시간 동안 배양한 뒤 ELISA 리더(Bio tek)를 이용하여 490 nm에서 흡광도를 측정하였다.
세포 이동능 및 침윤능 어쎄이
si-비 타겟 또는 si-ZNF667-AS1로 형질 전환된 암 세포의 이동능 및 침윤능을 평가하기 위하여, 8-um-기공 사이즈의 챔버 인저트(Corning Costar)를 포함하는 24-웰 플레이트를 사용하였다. 200uL FBS-프리 배양 배지 내 2 X 105 세포를 각 필터 인저트(상부 챔버)에 로딩하고, 각 하부 챔버에 10% FBS를 포함하는 배양 배지 700uL를 추가한 뒤, 37℃에서 16 시간 동안 배양하였다. 수확 후 인저트의 바닥을 고정시킨 뒤 크리스탈 바이올렛으로 염색하였다. EVOS M7000 이미징 시스템(Thermofisher Scientific)을 이용하여 이동 또는 침윤한 세포의 수를 측정하였다.
면역 블롯
프로테아제 억제제 칵테일 및 포스파타제 억제제(Roche)로 보충된 RIPA 버퍼에서 세포를 용혈시켰다. BCA 단백질 어쎄이 키트(Thermofisher Scientific)를 이용하여 총 단백질 농도를 측정하였다. SDS-PAGE를 이용하여 단백질 10ug을 분리한 뒤 PVDF 막(Millipore) 상에서 이동시키고 1차 항체를 이용하여 4℃에서 밤새 배양하였다. 사용된 1차 항체는 다음과 같다: ZNF667 (1:2000, Abcam, ab106432), N-Cadherin (1:1000, Cell signaling, 4061S), E-Cadherin (1:1000, Cell signaling, 14472S), Vimentin (1:1000, Cell signaling, 5741) 및 GAPDH (1:1000, Sigma, G9545). TBS-T로 5회 세척하고, 블롯을 겨자무과산화수소-컨쥬게이트된 2차 항체로 배양한 뒤 향상된 케미-루미네센스(chemi-luminescence) 검출(ECL plus kit, Pierce)로 시각화 하였다.
위암에서 lncRNA의 영향을 확인하기 위한 시스템적 접근
총 게놈 수준에서 무편파적 접근으로 위암에서 lncRNA의 영향을 확인하기 위하여, 비지도 클러스터링(unsupervised clustering)을 수행하였다. TCGA 코호트에서 lncRNA 발현의 계층적 클러스터링 분석을 통해 6개의 클러스터로 구분하였고, L6A, L6B, L6C, L6D, L6E, 및 L6F로 명명하였다(도 1a). 다음으로, 각 아형 별로 발현이 독특한 lncRNA 유전자를 규명하였다: 6개의 아형에서 구분되는 발현을 보이는 lncRNA는 총 262개에 해당하였다(도 1b; 표 3).
ENSEMBL ID 유전자 명
(Gencode v19)
아형 비율 (subtype/others)
ENSG00000269900.2 RMRP L6A 2.01
ENSG00000242125.2 SNHG3 L6A 1.37
ENSG00000271824.1 AC009014.3 L6A 1.16
ENSG00000126005.11 MMP24-AS1 L6A 0.97
ENSG00000233621.1 RP11-422J8.1 L6A 0.89
ENSG00000229953.1 RP11-284F21.7 L6A 0.88
ENSG00000260704.1 LINC00543 L6A 0.79
ENSG00000175701.6 LINC00116 L6A 0.77
ENSG00000258940.2 RP11-407N17.5 L6A 0.64
ENSG00000226330.1 RP11-739N20.2 L6A 0.61
ENSG00000268516.1 CTD-3138B18.5 L6A -0.26
ENSG00000272645.1 RP11-504P24.8 L6A -0.31
ENSG00000269958.1 RP11-73M18.8 L6A -0.49
ENSG00000267449.1 RP11-264B14.2 L6A -0.54
ENSG00000188206.5 HNRNPU-AS1 L6A -0.58
ENSG00000257621.3 RP11-349A22.5 L6A -0.61
ENSG00000273014.1 RP11-225B17.2 L6A -0.77
ENSG00000229152.1 ANKRD10-IT1 L6A -0.91
ENSG00000259865.1 RP11-488L18.10 L6A -0.96
ENSG00000268205.1 CTC-444N24.11 L6A -0.99
ENSG00000245532.4 NEAT1 L6A -1.14
ENSG00000267207.1 RP11-264B14.1 L6A -1.30
ENSG00000251562.3 MALAT1 L6A -1.39
ENSG00000264940.2 SNORD3C L6A -1.50
ENSG00000130600.11 H19 L6B 2.24
ENSG00000260032.1 LINC00657 L6B 1.58
ENSG00000269972.1 RP3-430N8.10 L6B 1.27
ENSG00000234678.1 RP11-465N4.4 L6B 1.24
ENSG00000269987.1 RP3-430N8.11 L6B 1.19
ENSG00000253352.4 TUG1 L6B 1.15
ENSG00000232803.1 RP11-93B14.5 L6B 1.07
ENSG00000254635.1 WAC-AS1 L6B 1.00
ENSG00000234771.2 RP11-395P17.3 L6B 0.97
ENSG00000270580.1 RP11-1186N24.5 L6B 0.86
ENSG00000234072.1 AC074117.10 L6B 0.84
ENSG00000260766.1 RP11-226L15.5 L6B 0.81
ENSG00000228989.1 AC133528.2 L6B 0.77
ENSG00000206195.6 AP000525.9 L6B 0.74
ENSG00000238035.4 AC138035.2 L6B 0.74
ENSG00000247228.2 RP11-296I10.3 L6B 0.73
ENSG00000267100.1 ILF3-AS1 L6B 0.73
ENSG00000253738.1 GS1-251I9.4 L6B 0.73
ENSG00000226696.1 LENG8-AS1 L6B 0.73
ENSG00000225484.2 RP11-773D16.1 L6B 0.69
ENSG00000188185.7 LINC00265 L6B 0.69
ENSG00000272993.1 RP11-196G18.24 L6B 0.69
ENSG00000231826.1 AC016735.2 L6B 0.66
ENSG00000269990.1 CTD-3074O7.12 L6B 0.66
ENSG00000240731.1 RP5-890O3.9 L6B 0.65
ENSG00000231074.4 HCG18 L6B 0.65
ENSG00000273071.1 RP11-337C18.10 L6B 0.65
ENSG00000177337.3 DLGAP1-AS1 L6B 0.63
ENSG00000261455.1 LINC01003 L6B 0.61
ENSG00000226752.3 PSMD5-AS1 L6B 0.59
ENSG00000259943.1 RP1-39G22.7 L6B 0.58
ENSG00000255503.1 RP11-113K21.4 L6B 0.58
ENSG00000228315.7 GUSBP11 L6B 0.58
ENSG00000240618.1 RP11-206L10.5 L6B 0.57
ENSG00000273000.1 KB-1572G7.2 L6B 0.56
ENSG00000270346.1 RP1-90J20.12 L6B 0.53
ENSG00000225210.5 AL589743.1 L6B 0.52
ENSG00000244306.5 CTD-2314B22.3 L6B 0.51
ENSG00000230724.5 LINC01001 L6B 0.50
ENSG00000261716.1 RP11-196G18.22 L6B 0.43
ENSG00000270157.1 RP5-894A10.6 L6B 0.43
ENSG00000229539.1 RP11-119B16.2 L6B 0.42
ENSG00000232640.1 RP1-266L20.2 L6B 0.42
ENSG00000246067.3 RAB30-AS1 L6B 0.41
ENSG00000273179.1 RP11-20I20.4 L6B 0.41
ENSG00000229043.2 AC091729.9 L6B 0.39
ENSG00000235477.2 RP11-122G18.5 L6B 0.37
ENSG00000225791.2 TRAM2-AS1 L6B 0.34
ENSG00000260233.2 SSSCA1-AS1 L6B 0.32
ENSG00000237094.7 RP4-669L17.10 L6B 0.32
ENSG00000272872.1 LL22NC03-N14H11.1 L6B 0.31
ENSG00000233013.4 FAM157B L6B 0.31
ENSG00000245849.2 RAD51-AS1 L6B 0.31
ENSG00000270015.1 RP11-540B6.6 L6B 0.29
ENSG00000235919.3 ASH1L-AS1 L6B 0.28
ENSG00000227719.1 AC006042.6 L6B 0.27
ENSG00000247400.3 DNAJC3-AS1 L6B 0.27
ENSG00000215394.4 BMS1P18 L6B 0.25
ENSG00000230177.1 RP5-1112D6.4 L6B 0.25
ENSG00000249592.1 RP11-440L14.1 L6B 0.24
ENSG00000179523.4 EIF3J-AS1 L6B 0.23
ENSG00000271975.1 RP11-383J24.6 L6B 0.21
ENSG00000261172.1 RP11-356C4.5 L6B 0.19
ENSG00000247137.4 RP11-727A23.5 L6B 0.18
ENSG00000236859.2 AC018737.1 L6B 0.16
ENSG00000260276.1 RP11-77H9.2 L6B 0.16
ENSG00000206573.4 SETD5-AS1 L6B 0.15
ENSG00000263934.2 SNORD3A L6C 1.59
ENSG00000236081.1 AC074389.9 L6C 1.30
ENSG00000250920.1 RP11-297P16.4 L6C 1.25
ENSG00000260552.1 RP11-49I11.1 L6C 0.82
ENSG00000257084.1 U47924.27 L6C 0.81
ENSG00000240990.5 HOXA11-AS L6C 0.67
ENSG00000256940.1 RP11-783K16.5 L6C 0.63
ENSG00000243766.3 HOTTIP L6C 0.48
ENSG00000245694.4 CRNDE L6C 0.47
ENSG00000204528.3 PSORS1C3 L6C 0.39
ENSG00000228630.1 HOTAIR L6C 0.36
ENSG00000247095.2 MIR210HG L6C 0.26
ENSG00000269867.1 CTD-2583A14.8 L6C 0.11
ENSG00000273142.1 RP11-458F8.4 L6C -0.01
ENSG00000267394.1 CTB-175E5.7 L6C -0.19
ENSG00000267776.1 AC006116.24 L6C -0.31
ENSG00000236933.1 RP11-439A17.7 L6C -0.36
ENSG00000245060.2 LINC00847 L6C -0.44
ENSG00000249456.1 RP11-298J20.4 L6C -0.47
ENSG00000238039.1 AF011889.2 L6C -0.49
ENSG00000232593.2 RP11-258C19.5 L6D 0.45
ENSG00000237250.3 RP11-193H5.1 L6D 0.24
ENSG00000230555.2 RP11-517P14.2 L6D -0.12
ENSG00000214719.7 AC005562.1 L6D -0.12
ENSG00000261801.1 LOXL1-AS1 L6D -0.15
ENSG00000233903.2 Z83851.4 L6D -0.16
ENSG00000230513.1 THAP7-AS1 L6D -0.18
ENSG00000235314.1 LINC00957 L6D -0.18
ENSG00000223813.2 AC007255.8 L6D -0.20
ENSG00000273145.1 CITF22-92A6.1 L6D -0.21
ENSG00000268087.1 CTC-429P9.2 L6D -0.22
ENSG00000267322.1 SCARNA17 L6D -0.26
ENSG00000224914.2 LINC00863 L6D -0.26
ENSG00000267904.1 CTC-429P9.5 L6D -0.27
ENSG00000196810.4 CTBP1-AS2 L6D -0.27
ENSG00000259806.2 CTD-2196E14.4 L6D -0.28
ENSG00000270017.1 CTD-2576F9.2 L6D -0.29
ENSG00000263327.2 TAPT1-AS1 L6D -0.35
ENSG00000245937.3 CTC-228N24.3 L6D -0.36
ENSG00000175772.10 AC112229.7 L6D -0.37
ENSG00000271359.1 RP11-84C13.1 L6D -0.41
ENSG00000269481.1 CTD-2521M24.6 L6D -0.47
ENSG00000273015.1 LINC00938 L6D -0.49
ENSG00000272667.1 RP11-395A13.2 L6D -0.50
ENSG00000272447.1 RP11-182L21.6 L6D -0.53
ENSG00000267080.1 ASB16-AS1 L6D -0.57
ENSG00000253982.1 CTD-2336O2.1 L6D -0.57
ENSG00000239569.2 KMT2E-AS1 L6D -0.59
ENSG00000236618.2 PITPNA-AS1 L6D -0.60
ENSG00000163597.10 SNHG16 L6D -0.60
ENSG00000254911.2 SCARNA9 L6D -0.61
ENSG00000270081.1 RP5-935K16.1 L6D -0.64
ENSG00000226137.3 BAIAP2-AS1 L6D -0.66
ENSG00000233368.2 RP11-277L2.3 L6D -0.68
ENSG00000264575.1 LINC00526 L6D -0.68
ENSG00000265479.1 DTX2P1-UPK3BP1-PMS2P11 L6D -0.69
ENSG00000265091.1 RP11-835E18.5 L6D -0.69
ENSG00000257167.2 TMPO-AS1 L6D -0.72
ENSG00000204054.7 LINC00963 L6D -0.72
ENSG00000236537.1 RP11-732M18.3 L6D -0.73
ENSG00000270103.2 RNU11 L6D -0.73
ENSG00000270170.1 NCBP2-AS2 L6D -0.73
ENSG00000232533.1 AC093673.5 L6D -0.74
ENSG00000262477.1 AC021224.1 L6D -0.75
ENSG00000233223.2 AC113189.5 L6D -0.75
ENSG00000255198.3 SNHG9 L6D -0.77
ENSG00000214783.5 POLR2J4 L6D -0.79
ENSG00000270726.1 AJ271736.10 L6D -0.81
ENSG00000229874.2 RP11-312O7.2 L6D -0.88
ENSG00000273432.1 RP5-1165K10.2 L6D -0.95
ENSG00000261512.2 RP11-46D6.1 L6D -1.01
ENSG00000270066.2 SCARNA2 L6D -1.39
ENSG00000272933.1 RP11-47A8.5 L6D -1.62
ENSG00000258486.2 RN7SL1 L6D -2.31
ENSG00000259001.2 RPPH1 L6D -2.48
ENSG00000250742.1 RP11-834C11.4 L6E 2.93
ENSG00000256039.1 RP11-291B21.2 L6E 1.04
ENSG00000235576.1 AC092580.4 L6E 0.96
ENSG00000253838.1 RP11-44K6.2 L6E 0.90
ENSG00000261520.1 DLGAP1-AS5 L6E 0.82
ENSG00000132832.5 RP11-445H22.3 L6E 0.74
ENSG00000261971.2 RP11-473M20.7 L6E 0.64
ENSG00000227619.1 RP11-492E3.2 L6E 0.57
ENSG00000273290.1 CTC-297N7.8 L6E 0.56
ENSG00000258521.1 RP11-638I2.9 L6E 0.55
ENSG00000239213.1 RP11-85F14.5 L6E 0.52
ENSG00000259834.1 RP11-284N8.3 L6E 0.46
ENSG00000229950.1 TFAP2A-AS1 L6E 0.46
ENSG00000267745.1 RP11-686D22.8 L6E 0.44
ENSG00000262222.1 RP11-876N24.4 L6E 0.32
ENSG00000206028.1 CTA-373H7.7 L6E 0.29
ENSG00000254287.1 RP11-44K6.4 L6E 0.27
ENSG00000225783.2 MIAT L6E 0.26
ENSG00000263013.1 RP11-876N24.5 L6E 0.25
ENSG00000203362.2 RP3-337H4.8 L6E 0.22
ENSG00000267074.1 RP11-1094M14.5 L6E 0.21
ENSG00000249746.1 RP11-254I22.3 L6E 0.16
ENSG00000261270.1 RP11-325K4.3 L6E 0.07
ENSG00000235437.3 RP11-357C3.3 L6E -0.79
ENSG00000272620.1 AFAP1-AS1 L6E -0.86
ENSG00000268913.1 AC026806.2 L6E -0.95
ENSG00000238142.1 RP11-108M9.4 L6E -1.02
ENSG00000261123.1 RP11-304L19.3 L6E -1.29
ENSG00000259933.2 RP11-304L19.1 L6E -1.37
ENSG00000272763.1 RP11-357H14.17 L6E -1.43
ENSG00000272761.1 RP11-572C15.6 L6F 2.02
ENSG00000269936.2 MIR145 L6F 1.72
ENSG00000203706.4 SERTAD4-AS1 L6F 1.17
ENSG00000268388.1 FENDRR L6F 1.07
ENSG00000255248.2 RP11-166D19.1 L6F 1.04
ENSG00000249669.3 MIR143HG L6F 0.92
ENSG00000237125.4 HAND2-AS1 L6F 0.77
ENSG00000224958.1 PGM5-AS1 L6F 0.76
ENSG00000267047.1 RP11-589P10.7 L6F 0.74
ENSG00000166770.6 ZNF667-AS1 L6F 0.66
ENSG00000261625.1 RP11-554A11.4 L6F 0.60
ENSG00000253864.1 AC131025.8 L6F 0.59
ENSG00000250734.2 RP11-404E16.1 L6F 0.58
ENSG00000234638.1 AC053503.6 L6F 0.47
ENSG00000180139.10 ACTA2-AS1 L6F 0.46
ENSG00000235501.1 RP4-639F20.1 L6F 0.44
ENSG00000269186.1 LINC01082 L6F 0.43
ENSG00000230148.4 HOXB-AS1 L6F 0.42
ENSG00000230630.1 DNM3OS L6F 0.39
ENSG00000272755.1 RP11-326G21.1 L6F 0.37
ENSG00000228221.1 LINC00578 L6F 0.37
ENSG00000225986.1 RP3-340N1.5 L6F 0.33
ENSG00000262879.1 RP11-156P1.3 L6F 0.32
ENSG00000259248.1 USP3-AS1 L6F 0.27
ENSG00000234456.3 MAGI2-AS3 L6F 0.27
ENSG00000258441.1 LINC00641 L6F 0.26
ENSG00000261534.1 RP11-244O19.1 L6F 0.26
ENSG00000269044.1 CTC-429P9.3 L6F 0.24
ENSG00000255455.2 RP11-890B15.3 L6F 0.23
ENSG00000267532.2 MIR497HG L6F 0.21
ENSG00000250360.1 CTD-2089N3.1 L6F 0.21
ENSG00000267082.1 CTC-510F12.2 L6F 0.18
ENSG00000224739.2 AC016735.1 L6F -0.18
ENSG00000260711.1 RP11-747H7.3 L6F -0.18
ENSG00000234286.1 AC006026.13 L6F -0.20
ENSG00000238164.2 RP3-395M20.8 L6F -0.21
ENSG00000267751.1 AC009005.2 L6F -0.22
ENSG00000269609.1 RP11-18I14.10 L6F -0.22
ENSG00000260196.1 RP1-239B22.5 L6F -0.22
ENSG00000235823.1 LINC00263 L6F -0.23
ENSG00000253716.1 RP13-582O9.5 L6F -0.26
ENSG00000231770.1 TMEM44-AS1 L6F -0.27
ENSG00000214293.4 RSBN1L-AS1 L6F -0.29
ENSG00000225138.3 CTD-2228K2.7 L6F -0.32
ENSG00000234155.1 RP11-30P6.6 L6F -0.34
ENSG00000251603.1 RP11-164P12.4 L6F -0.34
ENSG00000254837.1 AP001372.2 L6F -0.40
ENSG00000227036.2 LINC00511 L6F -0.43
ENSG00000234608.3 MAPKAPK5-AS1 L6F -0.44
ENSG00000175061.13 C17orf76-AS1 L6F -0.45
ENSG00000177410.8 ZFAS1 L6F -0.51
ENSG00000233834.2 AC005083.1 L6F -0.52
ENSG00000268006.1 PTOV1-AS1 L6F -0.52
ENSG00000247271.2 ZBED5-AS1 L6F -0.55
ENSG00000232677.2 LINC00665 L6F -0.61
ENSG00000196696.8 PDXDC2P L6F -0.64
ENSG00000232445.1 RP11-132A1.4 L6F -0.67
ENSG00000232956.4 SNHG15 L6F -0.71
ENSG00000261183.1 RP11-532F12.5 L6F -0.77
ENSG00000272141.1 RP11-465B22.8 L6F -0.78
ENSG00000196756.7 SNHG17 L6F -0.82
ENSG00000226950.2 DANCR L6F -0.82
ENSG00000261373.1 VPS9D1-AS1 L6F -0.91
ENSG00000224259.1 RP11-48O20.4 L6F -1.05
ENSG00000203499.6 FAM83H-AS1 L6F -1.26
ENSG00000259187.1 CTD-2008A1.1 L6F -1.55
LNC6의 인구학적 및 임상학적 연관성
TCGA 코호트에서 LNC6 아형은 성별, 민족, 종양 위치 및 암의 병기, 조직학적 등급 및 로렌 아형을 나타낸다(표 4). L6A 및 L6E 환자 대부분이 남성이었다(84% 및 100%). L6A 및 L6D 환자의 대부분은 서양 국가 환자이었다(96% and 92%). 민족에서의 그러한 차이는 위암의 분자적 아형에서는 발견할 수 없었다. L6A 환자가 종양의 근위부의 가장 높은 비율을 보였고 (36%), 반면 L6F 환자가 가장 낮은 비율을 보였다(10%). 흥미롭게도, 일반적으로 위암은 서양 국가에서 병기가 진행된 후 진단이 되지만, L6A 아형 종양은 상대적으로 낮은 암의 병기를 보였다. L6C 종양 또한 상대적으로 낮은 암의 병기를 보였으나, L6E 및 L6F 종양은 높은 병기와 조직학적 등급을 보였다. 마지막으로, L6F 아형은 로렌 분류에서 미만성 아형이 풍부하였다.
LNC6 L6A L6B L6C L6D L6E L6F n
나이, 평균 (SD) 66.2 (10.3) 66.2 (9.7) 68.5 (10.0) 68.9 (9.9) 62.6 (12.3) 60.2 (10.5) 258
남성 21/25
(84%)
45/66
(68%)
24/51
(47%)
26/51
(51%)
14/14
(100%)
29/51
(57%)
258
서양 기원(Western origin) 24/25
(96%)
47/66
(71%)
29/51
(57%)
47/51
(92%)
9/14
(64%)
37/51
(73%)
258
근위부(Proximal location) 9/25
(36%)
14/66
(21%)
9/51
(18%)
8/43
(19%)
3/14
(21%)
5/51
(10%)
250
T3/4 7/25
(28%)
48/66
(73%)
38/50
(76%)
24/44
(55%)
13/14
(93%)
44/51
(86%)
250
N1-3 18/25
(72%)
42/66
(64%)
26/50
(52%)
31/41
(76%)
10/14
(71%)
35/50
(70%)
246
M1 0/25
(0%)
4/62
(6%)
1/48
(2%)
7/48
(15%)
1/12
(8%)
3/51
(6%)
246
AJCC 암기 III/IV 8/25
(32%)
30/66
(45%)
16/51
(31%)
21/51
(41%)
8/14
(57%)
31/51
(61%)
240
조직학적 등급 3 12/25
(48%)
34/64
(53%)
32/51
(63%)
31/51
(61%)
14/14
(100%)
43/48
(90%)
253
로렌 미만형(Lauren Diffuse type) 5/25
(20%)
7/66
(11%)
3/51
(6%)
11/51
(23%)
3/13
(23%)
34/49
(69%)
247
LNC6 아형의 진단적 중요성
TCGA 코호트에서 후속 조치 기간의 단축으로, 독립적 일반 GC 코호트(Total n = 1,933)에서 LNC6 아형의 진단적 관계를 평가하였다. 먼저, TCGA 코호트로부터 LNC6 아형 특이적 mRNA 유전자 발현 시그니처를 추출하였다(도 2a). 이후 예측 모델을 설계하기 위하여 BCCP 알고리즘을 시행하였고(도 2b), 각 시그니처의 강도를 평가하였다. TCGA 코호트에서 각 시그니처의 베이지안 확률의 ROC 분석 결과 AUC는 0.9143 내지 0.9845에 해당하였다. 이러한 로버스트 예측 모델(robust prediction model)을 일반 GC 코호트 데이터세트에 적용하였다. 이때 상기 데이터세트에서 mRNA 유전자 발현 및 생존 데이터는 이용 가능하다. 상기한 예측 모델로 환자를 계층화 하였을 때, OS와 RFS에서 비슷한 생존 패턴을 보였다 (도 2c). L6A 및 L6F 아형은 나쁜 예후와 상관 관계가 있고, 다음으로 L6B 및 L6D 아형이 상관 관계가 있었다. L6C 및 L6E 아형은 좋은 예후와 상관 관계가 있었다. 이를 통해 위암의 임상적 결과는 lncRNA 발현 패턴을 반영한 전사적 특징에 기인한 것을 알 수 있었다.
LNC6 아형 및 보조 항암 화학 요법
반 이상의 환자가 표준 보조 항암 화학 요법을 받은 코호트에서 LNC6 아형과 보조 항암 화학 요법으로 인한 임상적 이점 사이 상관 관계를 조사하였다(도 3). L6A (P=0.025), L6B (P=0.03), 및 L6D (P=0.057) 아형이 보조 항암 화학 요법에 대하여 이점을 보이는 반면, L6C 아형(P=0.51)의 경우 보조 항암 화학 요법에 대하여 이점이 없는 것을 볼 수 있었다. 상피 및 중간엽 표현형의 두가지 구분되는 분자적 아형은 보조 항암 화학과의 상호 작용을 입증하므로, 이러한 두가지 분자적 아형과 LNC6 아형 사이 관련성을 분석하였다. 상피 표현형(epithelial phenotype; EP)은 L6B 및 L6C에서 풍부한 반면, 중간엽 표현형(mesenchymal phenotype; MP)은 L6F에서 풍부하였다(도 4a). EP 아형 종양을 가진 환자는 보조 항암 화학 요법에서 이점을 가지는 주된 아형이므로, EP 아형의 서브세트 분석을 수행하였다. L6C 아형 환자의 경우 보조 항암 화학 요법에 어떠한 이점도 보이지 않은 반면(P=0.76), L6C 아형에 속하지 않는 환자는 보조 항암 화학 요법에 우수한 이점을 보였다(P<0.0001) (도 4b). 콕스 회귀 모델에 적용하는 상호 작용 실험을 수행하여 두 군 사이에서 보조 항암 화학 요법의 영향의 차이점을 평가하였고, 상호 작용은 유의성을 보였다(P=0.01 by likelihood ratio test). 화학 반응에 민감한 것으로 알려진 EP 아형 종양의 서브세트인 L6C 아형 종양은 보조 항암 화학 요법에 이점을 보이지 않았는바, lncRNA 발현 패턴은 EP 아형을 임상적 관련된 아형으로 추가로 세분할 수 있음을 알 수 있었다.
LNC6 아형 및 면역 치료
펨브롤리주맙으로 처리된 전이성 위암 환자의 코호트로부터 lncRNA 발현데이터를 이용하여 LNC6 아형과 면역 치료에 대한 임상적 이점 사이 상관 관계를 분석하였다. TCGA 코호트에서 아형 특이적 lncRNA의 발현 데이터에 기반하여 예측 모델을 설계하였다. L6C (46%) 및 L6E (100%) 아형은 면역 치료에 대한 치료 반응성이 좋았으나, 다른 아형의 경우 치료 반응성이 나빴다(≤25%) (도 5a). 임상적 반응은 L6C (P=0.012) 및 L6F (P=0.016) 아형의 예측되는 확률과 매우 높은 상관 관계를 보였다(도 5b-c). L6C 확률은 면역 치료에 대한 반응의 긍정적 예측 표지에 해당하는 반면, L6F 확률은 면역 치료에 대한 반응의 부정적 예측 표지에 해당한다. 아마도 트레이닝 시료(training samples)에서 L6E 아형의 적은 수로 인하여 편차가 0 또는 1에 해당하여, L6E 아형의 예측되는 확률이 면역 치료 반응자와 비반응자를 계층화하지 못하였더라도, L6E 아형에서 특이적으로 상향 조절된 lncRNA의 GSEA가 성공적으로 면역 치료 반응자와 비반응자를 계층화하였다(P=0.00021) (도 5d). 따라서, lncRNA 발현 패턴을 고려함으로써 위암에서 면역 치료 반응성의 예측 값을 더할 수 있다. LNC6 아형에서 종양 미세 환경의 기본적인 면역적 특징을 보다 잘 이해하기 위하여, 유전자 시그니처-기반 방법에 의해 전사체로부터 세포 서브세트를 열거하였다. L6E 종양에서 골수성 및 림프성 면역 세포가 풍부한 것으로 예측되었는 바, 이로부터 L6E 종양에서 활동적인 면역 반응이 있음을 알 수 있었다(도 6a). 반면에, L6F 종양은 기질 세포즉, 림프성 상피 세포, 섬유아세포, 연골 세포, 혈관 주위 세포 및 지방 세포로 이루어지는 것으로 예측되는 바, L6F 종양에서 면역 반응이 제한되어 있는 것을 알 수 있었다(도 6b).
위암 세포주에서 lncRNA에 의해 중재되는 줄기세포 유사 특징들
L6F 아형이 나쁜 예후, 조기 재발 및 항암 화학 요법에 대한 내성과 같은 임상적 결과와 가장 유의적 연관성을 보이므로, LNC6 아형 중 특정 lncRNA가 임상적 관련된 표현형에 연관이 있는 지 확인하였다. 먼저, L6F 아형에 대한 BCCP 예측자를 29개 위암 세포주로부터의 lncRNA 발현 데이터에 적용함으로써 L6F-유사 위암 세포주를 규명하였다. L6F 확률은 상피-중간엽 전이 아형(epithelial-mesenchymal transition (EMT) subtype)과 높은 상관 관계를 보였고(도 7a). qRT-PCR을 이용하여 RNA 시퀀싱 데이터로부터 얻어진 결과에 의해 선별된 L6F 아형에서 특이적으로 상향 조절된 5개의 lncRNA의 발현을 확인하였다. 하기 표 5에 나타낸 이들 lncRNA의 발현은 비-EMT 아형 세포주(n=3)에 비하여 EMT 아형 세포주(n=3)에서 평균 발현 수준이 높았다. 특히, ZNF667-AS1 (ENSG00000166770.6)는 시료의 소수에서 통계적으로 유의한 차이를 보였다. EMT 아형 세포주에서 siRNA를 이용하여 ZNF667-AS1를 넉다운한 결과, 세포의 침윤성 및 이동능을 감소시켰다(도 7b 및 7c-7e). 더욱이, ZNF667-AS1 사일런싱(silencing)에 의해 E-카데린(E-cadherin)의 발현이 증가되고, N-카데린(N-cadherin) 및 비멘틴(vimentin)의 발현이 감소되었는 바, 상기 EMT 아형 세포들이 중간엽 특성을 잃고, 상피적 특성을 얻은 것을 알 수 있었다(도 7f). 이로써, ZNF667-AS1가 위암 세포주의 EMT 표현형에 관련성이 높은 것을 알 수 있었다. 이를 통해 ZNF667-AS1를 사일런싱함으로써 EMT 위암 세포주의 옥살리플라틴 및 5-FU에 대한 감수성을 증가시킬 수 있음을 알 수 있었다(도 7f 및 7g).
아형 세포주 RP11-572C15.6 ZNF667-AS1 MAGI2-AS3 FENDRR ACTA2-AS1
EMT MKN1 -11.99 -8.29 -13.32 -9.90 -13.51
SNU1750 -12.87 -6.46 -9.94 -13.52 -14.29
SNU484 -15.06 -2.56 -11.80 -16.18 -12.94
non-EMT YCC3 -22.26 -10.62 -7.66 -12.98 -13.92
SNU719 -15.00 -11.07 -13.27 -13.81 -14.92
MKN74 -16.68 -11.42 -16.44 -15.40 -14.38
평균 배수 변화 4.67 5.27 0.77 0.86 0.83
P value (Student's t-test) 0.12 0.04 0.79 0.68 0.17
LNC6 아형의 생물학적 영향
LNC6 아형의 생물학적 특성을 규명하기 위하여, GSEA(Gene set enrichment analysis) 및 IPA(ingenuity pathway analysis)를 수행하였다(도 8, 표 6 및 7). L6A 아형은, 당화, 산화적 인산화 및 지방산 대사와 같은 대사 경로의 활성화를 통해 나타내었다. 간 세포 핵 인자(Hepatocyte nuclear factor-4α; HNF4α)가 가장 중요한 L6A의 상류 조절자인 것으로 예측되었다. L6C 아형은 G2M 체크포인트(checkpoint), E2F 타겟, DNA 수선(repair), MYC 타겟 및 MTORC1 신호의 활성화와 관련되어 있고, L6D 아형은 단백질 방출 및 KRAS 신호의 활성화와 관련되어 있다. L6E 아형은 L6E 아형의 활성화된 면역을 유지시키는 인터페론 반응의 활성화와 관련되어 있다. 가장 특징적으로, L6F 아형은 Wnt/β-카테닌(Wnt/β-catenin) 신호, TGF-β 신호, EMT, 및 혈관 신생의 활성화와 관련된다. 또한, EMT의 주 조절자에 해당하는 TGF-β 및 Twist1는 L6F 아형의 상류 조절자로 알려져 있다.
LNC6 아형의 줄기세포능을 평가하기 위하여, 마우스에서 위 발달 과정 중 다르게 발현되는 전사 인자의 발현 패턴을 확인하였다 (도 9). 초기 배아 단계에서 과발현되는 전사인자는 L6F 아형, 다음으로 L6B 아형에서 발현이 상향 조절되었는 바, 이를 통하여 이들 아형이 줄기세포능을 갖는 것을 알 수 있었다. 이를 통해 L6F 아형의 활성화된 생물학적 경로와 L6F 아형의 나쁜 예후 사이의 상관 관계를 알 수 있었다. 한편, 후기 배아 단계 또는 성숙 단계에서 과발현되는 전사인자는 LNC6 아형들 사이에서 다르게 발현되지 않았다. 또한, S-기에서 풍부 lncRNA의 발현 패턴을 조사한 결과, S-기 lncRNA는 L6D 및 L6F에서 그 발현이 하향 조절되었으나, L6B에서는 상향 조절된 것을 볼 수 있었다 (도 10). 이는 줄기세포의 휴지 특징(quiescent feature)과 EMT 시그니처와 증식 시그니처 사이의 음성 상관관계에 의한 것이다.
LNC6 Ingenuity Canonical Pathways -log(p-value) zScore Ratio
 L6A  Sumoylation Pathway 2.96 -1.94 15.6%
DNA Double-Strand Break Repair by Non-Homologous End Joining 2.89 NaN 35.7%
Stearate Biosynthesis I (Animals) 2.80 1.67 20.5%
EIF2 Signaling 2.50 -2.84 11.4%
Acyl-CoA Hydrolysis 2.27 0.00 33.3%
 L6B  Type I Diabetes Mellitus Signaling 4.07 -1.63 8.1%
Cytotoxic T Lymphocyte-mediated Apoptosis of Target Cells 3.81 -2.00 15.6%
Antigen Presentation Pathway 3.45 NaN 13.2%
CD28 Signaling in T Helper Cells 3.45 -2.00 6.7%
Nur77 Signaling in T Lymphocytes 3.41 NaN 10.2%
 L6C Regulation of Actin-based Motility by Rho 4.32 1.00 10.1%
RhoGDI Signaling 3.88 0.30 6.9%
Glucocorticoid Receptor Signaling 2.99 NaN 4.6%
Integrin Signaling 2.96 -0.30 5.4%
GP6 Signaling Pathway 2.96 -2.33 6.7%
 L6D  Protein Ubiquitination Pathway 5.43 NaN 15.5%
Estrogen Receptor Signaling 4.84 NaN 18.7%
Sirtuin Signaling Pathway 4.62 -1.33 14.4%
Cleavage and Polyadenylation of Pre-mRNA 4.00 NaN 50.0%
mTOR Signaling 3.86 0.00 14.9%
 L6E  MSP-RON Signaling Pathway 4.25 NaN 17.6%
Calcium Transport I 4.24 0.45 50.0%
Sperm Motility 3.76 -1.60 13.3%
Interferon Signaling 3.54 2.12 22.2%
Endothelin-1 Signaling 3.49 -1.09 11.1%
 L6F Axonal Guidance Signaling 10.60 NaN 20.1%
cAMP-mediated signaling 10.50 5.53 25.6%
Hepatic Fibrosis / Hepatic Stellate Cell Activation 9.48 NaN 26.3%
G-Protein Coupled Receptor Signaling 8.69 NaN 22.3%
Gαi Signaling 7.44 2.83 27.9%
LNC6 상류 조절자 p-value of overlap 예측 활성 상태 Activation z-score
 L6A HNF4A 8.92E-08 1.844
CD24 1.49E-06 억제 -4.126
CST5 1.21E-03 1.768
ESR1 1.41E-03 억제 -5.532
TCOF1 2.00E-03
 L6B SAFB 2.81E-05 1.673
interferon beta-1a 3.47E-05
Sod 1.45E-04 활성화 2
EBI3 2.28E-04 -0.685
CIITA 4.81E-04 -0.41
 L6C ERBB2 2.91E-05 -1.327
Rhox4b (includes others) 1.36E-04
Histone h3 2.59E-04
Ctbp 3.36E-04
MM-401 3.70E-04
 L6D HNF4A 3.68E-14 -1.604
mir-149 4.33E-04
miR-16-5p (and other miRNAs w/seed AGCAGCA) 7.60E-04 억제 -2.896
tunicamycin 1.27E-03 1.467
ONECUT1 1.44E-03
 L6E PHF1 1.87E-08 활성화 2.219
KAT6A 3.16E-08 억제 -3.231
CDX2 2.13E-07 억제 -2.762
COMMD3-BMI1 4.93E-07 활성화 2.891
STAT5A 8.44E-07 -1.145
L6F TGFB1 4.10E-29 활성화 7.428
ERBB2 1.20E-22 억제 -2.928
TGFB3 1.15E-20 활성화 4.795
beta-estradiol 2.69E-19 활성화 3.139
TWIST1 1.17E-18 활성화 4.508
LNC6 아형의 게놈 배경
TCGA 데이터로부터 게놈 및 프로테옴 데이터를 이용하여 LNC6 아형의 분자적 특성을 더욱 조사하였다. L6B 아형을 고복제수 변화로 정의하였고, 일부의 유전자만 LNC6 아형 사이에서 다르게 발현되었다(도 11a). L6C 아형은 높은 돌연변이 부하(high mutation burden)로 특징지어 지며, LNC6 아형 사이에서 많은 유전자가 다르게 돌연변이 되었다(도 11b). L6E 아형은 과메틸화 패턴에 의해 특징지어지며(도 12a), L6F 아형은 miRNA 및 단백질의 가장 구분되는 발현 패턴(도 12b 및 12c)과 재발성 (15.4%) CLDN18-ARHGAP 융합으로 특징지어 진다. 또한, 아형-특이적 lncRNA의 후생적 배경 및 규명된 후생적 조절된 lncRNAs에 대하여 확인하였다(도 13).
다른 분자적 아형의 유사도
위암의 다른 분자적 아형에 대한 LNC6의 유사도를 확인하였다(도 6). L6A 및 L6B 아형은 염색체 불안정성(chromosomal instability; CIN) 및 미세부수체 안정성(microsatellite stability; MSS) 아형에서 풍부하였다. L6C 아형은 미세부수체 불안정성(microsatellite instability; MSI) 아형에서 풍부하였고, L6D 아형은 다수의 다른 분자적 아형과 혼합되어 있었다. L6E 아형은 100% 엡스타인-바 바이러스(Epstein-Barr virus; EBV) 아형에 해당하였고, L6F 아형은 유전적으로 안정(genomically stable; GS)한 아형, MP 아형 및 EMT 아형에서 풍부하였다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
본 발명은 암 중에서도 특히 위암을 예방 또는 치료하거나, 위암 세포의 침윤성 또는 전이성을 억제할 수 있는 조성물을 제공하고자 한다.

Claims (20)

  1. ZNF667-AS1(ZNF667 Antisense RNA 1 (Head To Head)), RP11-572C15.6, FENDRR(FOXF1 Adjacent Non-Coding Developmental Regulatory RNA) 및 ACTA2-AS1(ACTA2 Antisense RNA 1) 중 적어도 하나에 특이적인 발현 억제제를 유효 성분으로 포함하는, 암의 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서,
    상기 발현 억제제는 상기 유전자에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA(short interfering RNA; siRNA), 짧은 헤어핀 RNA(short hairpin RNA; shRNA) 및 리보자임(ribozyme)으로 구성된 군으로부터 선택된 어느 하나 이상인 것인, 약학적 조성물.
  3. 제1항에 있어서,
    상기 암은 위암, 난소암, 대장암, 유방암, 간암, 췌장암, 자궁경부암, 갑상선암, 부갑상선암, 비소세포성폐암, 전립선암, 담낭암, 담도암, 비호지킨 림프종, 호지킨 림프종, 혈액암, 방광암, 신장암, 흑색종, 결장암, 골암, 피부암, 두부암, 자궁암, 직장암, 뇌종양, 항문부근암, 나팔관암종, 자궁내막암종, 질암, 음문암종, 식도암, 소장암, 내분비선암, 부신암, 연조직 육종, 요도암, 음경암, 수뇨관암, 신장세포 암종, 신장골반 암종, 중추신경계(CNS central nervoussystem) 종양, 1차 CNS 림프종, 척수 종양, 뇌간 신경교종 또는 뇌하수체 선종인, 약학적 조성물.
  4. 제1항에 있어서,
    상기 발현 억제제는 서열번호 5 및 6으로 표시되는 것인, 약학적 조성물.
  5. ZNF667-AS1(ZNF667 Antisense RNA 1 (Head To Head)), RP11-572C15.6, FENDRR(FOXF1 Adjacent Non-Coding Developmental Regulatory RNA) 및 ACTA2-AS1(ACTA2 Antisense RNA 1) 중 적어도 하나에 특이적인 발현 억제제를 유효 성분으로 포함하는, 암의 침윤성 또는 전이성 억제용 약학적 조성물.
  6. 제5항에 있어서,
    상기 발현 억제제는 상기 유전자에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA(short interfering RNA; siRNA), 짧은 헤어핀 RNA(short hairpin RNA; shRNA) 및 리보자임(ribozyme)으로 구성된 군으로부터 선택된 어느 하나 이상인 것인, 약학적 조성물.
  7. 제5항에 있어서,
    상기 암은 위암, 난소암, 대장암, 유방암, 간암, 췌장암, 자궁경부암, 갑상선암, 부갑상선암, 비소세포성폐암, 전립선암, 담낭암, 담도암, 비호지킨 림프종, 호지킨 림프종, 혈액암, 방광암, 신장암, 흑색종, 결장암, 골암, 피부암, 두부암, 자궁암, 직장암, 뇌종양, 항문부근암, 나팔관암종, 자궁내막암종, 질암, 음문암종, 식도암, 소장암, 내분비선암, 부신암, 연조직 육종, 요도암, 음경암, 수뇨관암, 신장세포 암종, 신장골반 암종, 중추신경계(CNS central nervoussystem) 종양, 1차 CNS 림프종, 척수 종양, 뇌간 신경교종 또는 뇌하수체 선종인, 약학적 조성물.
  8. 제5항에 있어서,
    상기 발현 억제제는 서열번호 5 및 6으로 표시되는 것인, 약학적 조성물.
  9. ZNF667-AS1(ZNF667 Antisense RNA 1 (Head To Head)), RP11-572C15.6, FENDRR(FOXF1 Adjacent Non-Coding Developmental Regulatory RNA) 및 ACTA2-AS1(ACTA2 Antisense RNA 1) 중 적어도 하나에 특이적인 발현 억제제를 유효 성분으로 포함하는, 내성암의 내성 극복용 약학적 조성물.
  10. 제9항에 있어서,
    상기 발현 억제제는 상기 유전자에 상보적으로 결합하는 안티센스 뉴클레오티드, 작은 간섭 RNA(short interfering RNA; siRNA), 짧은 헤어핀 RNA(short hairpin RNA; shRNA) 및 리보자임(ribozyme)으로 구성된 군으로부터 선택된 어느 하나 이상인 것인, 약학적 조성물.
  11. 제9항에 있어서,
    상기 암은 위암, 난소암, 대장암, 유방암, 간암, 췌장암, 자궁경부암, 갑상선암, 부갑상선암, 비소세포성폐암, 전립선암, 담낭암, 담도암, 비호지킨 림프종, 호지킨 림프종, 혈액암, 방광암, 신장암, 흑색종, 결장암, 골암, 피부암, 두부암, 자궁암, 직장암, 뇌종양, 항문부근암, 나팔관암종, 자궁내막암종, 질암, 음문암종, 식도암, 소장암, 내분비선암, 부신암, 연조직 육종, 요도암, 음경암, 수뇨관암, 신장세포 암종, 신장골반 암종, 중추신경계(CNS central nervoussystem) 종양, 1차 CNS 림프종, 척수 종양, 뇌간 신경교종 또는 뇌하수체 선종인, 약학적 조성물.
  12. 제9항에 있어서,
    상기 발현 억제제는 서열번호 5 및 6으로 표시되는 것인, 약학적 조성물.
  13. 제9항에 있어서,
    상기 내성암은 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 소라페닙, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 데시타빈, 카페시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴, 보리노스텟, 엔티노스텟, 5FU 및 카르무스틴로 이루어진 군에서 선택된 1종 이상의 약물에 대한 내성을 가진 암인, 약학적 조성물.
  14. ZNF667-AS1(ZNF667 Antisense RNA 1 (Head To Head)), RP11-572C15.6, FENDRR(FOXF1 Adjacent Non-Coding Developmental Regulatory RNA) 및 ACTA2-AS1(ACTA2 Antisense RNA 1) 중 적어도 하나에 특이적인 발현 억제제를 유효 성분으로 포함하는, 내성암 또는 전이암의 예방 또는 치료용 약학적 조성물.
  15. ZNF667-AS1(ZNF667 Antisense RNA 1 (Head To Head)), RP11-572C15.6, FENDRR(FOXF1 Adjacent Non-Coding Developmental Regulatory RNA) 및 ACTA2-AS1(ACTA2 Antisense RNA 1) 중 적어도 하나에 특이적인 발현 억제제를 유효 성분으로 포함하는, 항암제에 대한 감수성 증진용 약학적 조성물.
  16. 투여가 필요한 개체에게, ZNF667-AS1(ZNF667 Antisense RNA 1 (Head To Head)), RP11-572C15.6, FENDRR(FOXF1 Adjacent Non-Coding Developmental Regulatory RNA) 및 ACTA2-AS1(ACTA2 Antisense RNA 1) 중 적어도 하나에 특이적인 발현 억제제를 유효량으로 투여하는 단계를 포함하는, 암의 예방 또는 치료 방법.
  17. 투여가 필요한 개체에게, ZNF667-AS1(ZNF667 Antisense RNA 1 (Head To Head)), RP11-572C15.6, FENDRR(FOXF1 Adjacent Non-Coding Developmental Regulatory RNA) 및 ACTA2-AS1(ACTA2 Antisense RNA 1) 중 적어도 하나에 특이적인 발현 억제제를 유효량으로 투여하는 단계를 포함하는, 암의 침윤성 또는 전이성 억제 방법.
  18. 투여가 필요한 개체에게, ZNF667-AS1(ZNF667 Antisense RNA 1 (Head To Head)), RP11-572C15.6, FENDRR(FOXF1 Adjacent Non-Coding Developmental Regulatory RNA) 및 ACTA2-AS1(ACTA2 Antisense RNA 1) 중 적어도 하나에 특이적인 발현 억제제를 유효량으로 투여하는 단계를 포함하는, 내성암의 내성 극복 방법.
  19. 투여가 필요한 개체에게, ZNF667-AS1(ZNF667 Antisense RNA 1 (Head To Head)), RP11-572C15.6, FENDRR(FOXF1 Adjacent Non-Coding Developmental Regulatory RNA) 및 ACTA2-AS1(ACTA2 Antisense RNA 1) 중 적어도 하나에 특이적인 발현 억제제를 유효량으로 투여하는 단계를 포함하는, 내성암 또는 전이암의 예방 또는 치료 방법.
  20. 투여가 필요한 개체에게, ZNF667-AS1(ZNF667 Antisense RNA 1 (Head To Head)), RP11-572C15.6, FENDRR(FOXF1 Adjacent Non-Coding Developmental Regulatory RNA) 및 ACTA2-AS1(ACTA2 Antisense RNA 1) 중 적어도 하나에 특이적인 발현 억제제를 유효량으로 투여하는 단계를 포함하는, 항암제에 대한 감수성 증진 방법.
PCT/KR2021/006493 2020-05-27 2021-05-25 암의 예방 또는 치료용 조성물 Ceased WO2021241981A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200063802A KR102482601B1 (ko) 2020-05-27 2020-05-27 암의 예방 또는 치료용 조성물
KR10-2020-0063802 2020-05-27

Publications (1)

Publication Number Publication Date
WO2021241981A1 true WO2021241981A1 (ko) 2021-12-02

Family

ID=78744906

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/006493 Ceased WO2021241981A1 (ko) 2020-05-27 2021-05-25 암의 예방 또는 치료용 조성물

Country Status (2)

Country Link
KR (1) KR102482601B1 (ko)
WO (1) WO2021241981A1 (ko)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113999918A (zh) * 2021-12-31 2022-02-01 北京大学人民医院 结直肠癌远端转移特异性长链非编码rna标记物linc01871及其检测试剂盒
CN114886910A (zh) * 2022-06-21 2022-08-12 上海市同仁医院 Linc00938在神经细胞凋亡中的应用
CN115786513A (zh) * 2022-11-25 2023-03-14 徐州医科大学 Itga8在拉帕替尼耐药的her2阳性胃癌诊断、治疗中的应用

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024181737A1 (ko) * 2023-02-28 2024-09-06 아주대학교산학협력단 N6-메틸아데노신 제어 rp11-108m9.4를 이용한 재발성 간암 진단 또는 치료 용도

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107213161A (zh) * 2017-05-27 2017-09-29 西南交通大学 长链非编码rna rp11‑224o19.2抑制剂的用途
CN109988765A (zh) * 2019-03-29 2019-07-09 中国医科大学附属盛京医院 一种fendrr基因的靶向抑制剂及其用途

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019157345A1 (en) 2018-02-09 2019-08-15 The Broad Institute, Inc. Compositions and methods for characterizing bladder cancer

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107213161A (zh) * 2017-05-27 2017-09-29 西南交通大学 长链非编码rna rp11‑224o19.2抑制剂的用途
CN109988765A (zh) * 2019-03-29 2019-07-09 中国医科大学附属盛京医院 一种fendrr基因的靶向抑制剂及其用途

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DONG ZHIMING, LI SHENGMIAN, WU XUAN, NIU YUNFENG, LIANG XIAOLIANG, YANG LIU, GUO YANLI, SHEN SUPENG, LIANG JIA, GUO WEI: "Aberrant hypermethylation-mediated downregulation of antisense lncRNA ZNF667-AS1 and its sense gene ZNF667 correlate with progression and prognosis of esophageal squamous cell carcinoma", CELL DEATH & DISEASE, vol. 10, no. 12, 1 December 2019 (2019-12-01), pages 930, XP055871273, DOI: 10.1038/s41419-019-2171-3 *
ZHOU RU‑JIAN, LV HUI‑ZENG: "Knockdown of ACTA2‑AS1 promotes liver cancer cell proliferation, migration and invasion", MOLECULAR MEDICINE REPORTS, SPANDIDOS PUBLICATIONS, GR, GR , XP055871275, ISSN: 1791-2997, DOI: 10.3892/mmr.2019.9856 *
ZHU YUNHENG, ZHANG XIAOHUA, WANG LIFENG, ZHU XIUXIANG, XIA ZIYIN, XU LING, XU JUN: "FENDRR suppresses cervical cancer proliferation and invasion by targeting miR-15a/b-5p and regulating TUBA1A expression", CANCER CELL INTERNATIONAL, vol. 20, no. 1, 1 December 2020 (2020-12-01), XP055871274, DOI: 10.1186/s12935-020-01223-w *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113999918A (zh) * 2021-12-31 2022-02-01 北京大学人民医院 结直肠癌远端转移特异性长链非编码rna标记物linc01871及其检测试剂盒
CN114886910A (zh) * 2022-06-21 2022-08-12 上海市同仁医院 Linc00938在神经细胞凋亡中的应用
CN114886910B (zh) * 2022-06-21 2023-09-22 上海市同仁医院 Linc00938在神经细胞凋亡中的应用
CN115786513A (zh) * 2022-11-25 2023-03-14 徐州医科大学 Itga8在拉帕替尼耐药的her2阳性胃癌诊断、治疗中的应用
CN115786513B (zh) * 2022-11-25 2023-09-19 徐州医科大学 Itga8在拉帕替尼耐药的her2阳性胃癌诊断、治疗中的应用

Also Published As

Publication number Publication date
KR20210146682A (ko) 2021-12-06
KR102482601B1 (ko) 2022-12-29

Similar Documents

Publication Publication Date Title
Sullivan et al. Trisomy 21 consistently activates the interferon response
KR102487727B1 (ko) 암 예후 예측을 위한 조성물 및 이를 포함하는 키트
McAllan et al. Integrative genomic analyses in adipocytes implicate DNA methylation in human obesity and diabetes
KR102482601B1 (ko) 암의 예방 또는 치료용 조성물
Maierhofer et al. Epigenetic signatures of Werner syndrome occur early in life and are distinct from normal epigenetic aging processes
Wu et al. TGF-β1 induced proliferation, migration, and ECM accumulation through the SNHG11/miR-34b/LIF pathway in human pancreatic stellate cells
WO2018026190A1 (ko) 암 예후 예측용 바이오마커
CN102959090B (zh) 用于表征和鉴别遗传毒性化合物的基因表达分析
Lafferty et al. MicroRNA-eQTLs in the developing human neocortex link miR-4707-3p expression to brain size
Wang et al. RNA-seq analysis of blood of valproic acid-responsive and non-responsive pediatric patients with epilepsy
Culina et al. MicroRNA signatures of CD4+ T cell subsets in healthy and multiple sclerosis subjects determined by small RNA-sequencing
US20230250433A1 (en) Methods and compositions for treatment of apc-deficient cancer
WO2015111852A1 (ko) Nudt15 유전자 내의 단일염기다형성 마커를 포함하는 티오퓨린 유도 백혈구 감소증 발병 위험 예측용 조성물
WO2018105921A2 (ko) 지방간의 진단 또는 치료를 위한 류신 지퍼 단백질의 용도
Lujan et al. A CellAgeClock for expedited discovery of anti-ageing compounds
Xu et al. The expression pattern and regulatory mechanism of the G0/G1 switch gene 2 (G0S2) in the pathogenesis and treatment of AChR Myasthenia Gravis (MG)
Garcia-Manteiga et al. Identification of differential DNA methylation associated with multiple sclerosis: A family-based study
Tang et al. Bioinformatic analysis of differentially expressed genes and identification of key genes in EBV-transformed lymphoblasts
WO2019088348A1 (ko) Egfr 저해제 저항성 암 치료제
CN120536580B (zh) Dll3作为宫颈神经内分泌癌治疗靶点及其应用
EP4589022A1 (en) Compositions and methods relating to colorectal cancer
Long et al. The epigenetics of autoimmunity: An overview
US20250290150A1 (en) Methods and systems for characterization, diagnosis, and treatment of cancer
Deng Exploring Molecular Mechanisms and Biomarkers in Psoriasis: Insights from Omics Technologies and Single-Cell Analyses
Pekkarinen et al. Integrative DNA methylation analysis of pediatric brain tumors reveals tumor type-specific developmental trajectories and epigenetic signatures of malignancy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21812664

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21812664

Country of ref document: EP

Kind code of ref document: A1