WO2021238556A1 - Method for detecting target nucleic acid on basis of crispr technology - Google Patents

Abstract

Provided in the present invention is a method for detecting a target nucleic acid on the basis of CRISPR technology, and specifically, provided are a method, a system and a kit for detecting the target nucleic acid on the basis of CRISPR technology. The detection method comprises adding a gRNA, a Cas protein and a single-stranded nucleic acid detector into a reaction system containing the target nucleic acid, wherein the single-stranded nucleic acid detector can be single-stranded DNA, single-stranded RNA or a single-stranded DNA-RNA hybrid.

Description

Method for detecting target nucleic acid based on CRISPR technology Technical field

The present invention relates to the field of nucleic acid detection, relates to a method for target nucleic acid detection based on CRISPR technology, and in particular to a method, system and kit for target nucleic acid detection based on CRISPR technology.

Background technique

Nucleic acid detection methods have important applications, such as pathogen detection and genetic disease detection. In terms of pathogen detection, since each pathogen microorganism has its unique characteristic nucleic acid molecular sequence, nucleic acid molecular detection for specific species can be developed, also known as nucleic acid diagnostics (NADs, nucleic acid diagnostics). Microbial contamination detection, human pathogenic bacteria infection and other fields are of great significance. Another aspect is the detection of single nucleotide polymorphisms (SNPs) in humans or other species. Understanding the relationship between genetic variation and biological functions at the genome level provides a new perspective for modern molecular biology. Among them, SNPs are closely related to biological functions, evolution, and diseases. Therefore, the development of SNPs detection and analysis techniques especially important.

The current established specific nucleic acid molecule detection usually needs to be divided into two steps, the first step is the amplification of the target nucleic acid, and the second step is the target nucleic acid detection. Existing detection technologies include restriction endonuclease methods, Southern, Northern, dot blot, fluorescent PCR detection technology, LAMP loop-mediated isothermal amplification technology, recombinase polymerase amplification technology (RPA) and other methods. After 2012, CRISPR gene editing technology emerged. Zhang Feng's team developed a new nucleic acid diagnostic technology (SHERLOCK technology) with Cas13 as the core based on RPA technology. Doudna's team developed a Cas12 enzyme-based new nucleic acid diagnostic technology (SHERLOCK technology). Diagnostic technology (DETECTR technology), Dr. Wang Jin from Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, etc. also developed a new nucleic acid detection technology based on Cas12 (HOLMES technology). Nucleic acid detection technology based on CRISPR technology is playing an increasingly important role.

Although there are many existing nucleic acid detection technologies, how to detect more quickly, simply, cheaply, and accurately is still an important direction for improving detection technologies. Therefore, the development of new detection systems and detection methods is still of great significance in the field of nucleic acid detection.

Summary of the invention

The present invention provides a method, system and kit for detecting target nucleic acid based on CRISPR technology.

In one aspect, the present invention provides a method for detecting a target nucleic acid in a sample, the method comprising contacting the sample with a type V or type VI CRISPR/CAS effector protein, gRNA (guide RNA) and a single-stranded nucleic acid detector, and The gRNA includes a region that binds to the CRISPR/CAS effector protein and a targeting sequence that hybridizes to the target nucleic acid; detects the detectable signal generated by the CRISPR/CAS effector protein cleavage of the single-stranded nucleic acid detector, thereby detecting the target nucleic acid.

On the other hand, the present invention also provides a system or composition for detecting a target nucleic acid in a sample. The system or composition includes a V-type or VI-type CRISPR/CAS effector protein, gRNA (guide RNA), and single-stranded nucleic acid. In a nucleic acid detector, the gRNA includes a region that binds to the CRISPR/CAS effector protein and a targeting sequence that hybridizes to a target nucleic acid.

On the other hand, the present invention also provides a kit for detecting target nucleic acid in a sample. The kit includes a V-type or VI-type CRISPR/CAS effector protein, gRNA (guide RNA) and a single-stranded nucleic acid detector, The gRNA includes a region that binds to the CRISPR/CAS effector protein and a targeting sequence that hybridizes to a target nucleic acid.

On the other hand, the present invention also provides the application of the above-mentioned system or kit in the detection of target nucleic acid in a sample.

On the other hand, the present invention also provides the application of V-type or VI-type CRISPR/CAS effector protein in detecting target nucleic acid in a sample.

In the application as described above, the V-type or VI-type CRISPR/CAS effector protein can cut the single-stranded nucleic acid detector in the system after binding or hybridizing with the target nucleic acid in the sample.

On the other hand, the present invention also provides the application of Type V or Type VI CRISPR/CAS effector protein in preparing reagents for detecting target nucleic acids in samples.

Further, the type V CRISPR/CAS effector protein is selected from Cas12, Cas14 family proteins or mutants thereof, and the type VI CRISPR/CAS effector protein includes Cas13 family proteins or mutants thereof.

In one embodiment, the Cas protein is preferably the Cas12 family, including but not limited to one or more of Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, and Cas12j.

In one embodiment, the Cas12a is selected from one or more of FnCas12a, AsCas12a, LbCas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a, or Lb4Cas12a; the Cas12a is preferably LbCas12a, and the amino acid sequence is as SEQ ID No. 5, or pass the amino acid sequence shown in SEQ ID No. 5 or its active fragments through one or more (such as 2, 3, 4, 5, 6, 7, 8, etc., 9 or 10) A derivative protein formed by the substitution, deletion or addition of amino acid residues and having basically the same function.

In other embodiments, the amino acid sequence of Cas12b is shown in SEQ ID No. 6, or the amino acid sequence shown in SEQ ID No. 6 or its active fragments are passed through one or more (e.g., 2 or 3) , 4, 5, 6, 7, 8, 9 or 10) amino acid residue substitutions, deletions or additions, and have basically the same function of the derivative protein.

In one embodiment, the Cas13 family protein includes Cas13a and Cas13b. Preferably, the Cas13a is selected from Lshcas13a, and its amino acid sequence is shown in SEQ ID No. 7, or the amino acid sequence shown in SEQ ID No. 7 Or its active fragments are formed by substitution, deletion or addition of one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues , And a derivative protein with basically the same function.

In a preferred embodiment, the amino acid sequence of the Cas12i protein is selected from the following group:

(1) The protein shown in SEQ ID NO: 2;

(2) Pass the amino acid sequence shown in SEQ ID NO: 2 or its active fragments through one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 ) Derivative proteins formed by substitution, deletion or addition of amino acid residues and having basically the same functions.

The amino acid sequence of the Cas12j protein is selected from the following group:

(1) The protein shown in SEQ ID NO: 4;

(2) Pass the amino acid sequence shown in SEQ ID NO: 4 or its active fragments through one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 ) Derivative proteins formed by substitution, deletion or addition of amino acid residues and having basically the same functions.

In one embodiment, the Cas protein mutant includes amino acid substitutions, deletions or substitutions, and the mutant at least retains its trans-cleavage activity. Preferably, the mutant has Cis and trans cleavage activity.

In the present invention, the target nucleic acid includes ribonucleotides or deoxyribonucleotides, including single-stranded nucleic acid and double-stranded nucleic acid, such as single-stranded DNA, double-stranded DNA, single-stranded RNA, and double-stranded RNA.

In the present invention, the single-stranded nucleic acid detector includes single-stranded DNA, single-stranded RNA, or single-stranded DNA-RNA hybrids. In other embodiments, the single-stranded nucleic acid detector includes single-stranded DNA, single-stranded RNA, or a mixture of any two or three of single-stranded DNA-RNA hybrids, for example, single-stranded DNA and single-stranded RNA. Composition, single-stranded DNA and single-stranded DNA-RNA hybrid composition, single-stranded RNA and single-stranded DNA-RNA composition.

In a preferred embodiment, the single-stranded nucleic acid detector is a single-stranded oligonucleotide detector.

The single-stranded nucleic acid detector does not hybridize to the gRNA.

In a specific embodiment, the Cas protein is Cas12i, the target nucleic acid is single-stranded nucleic acid and/or double-stranded nucleic acid, preferably, single-stranded DNA and/or double-stranded DNA, and the single-stranded nucleic acid detector is selected From single-stranded DNA, and/or single-stranded RNA, and/or single-stranded DNA-RNA hybrids.

In a specific embodiment, the Cas protein is Cas12j, the target nucleic acid is single-stranded nucleic acid and/or double-stranded nucleic acid, preferably, single-stranded DNA and/or double-stranded DNA, and the single-stranded nucleic acid detector is selected From single-stranded DNA, and/or single-stranded RNA, and/or single-stranded DNA-RNA hybrids.

In a specific embodiment, the Cas protein is Cas12a (or, referred to as cpf1), and the target nucleic acid is a single-stranded nucleic acid and/or a double-stranded nucleic acid, preferably, a single-stranded DNA and/or a double-stranded DNA, The single-stranded nucleic acid detector is selected from single-stranded DNA, and/or single-stranded RNA, and/or single-stranded DNA-RNA hybrids.

In a specific embodiment, the Cas protein is Cas12b (or C2c1), and the target nucleic acid is a single-stranded nucleic acid and/or a double-stranded nucleic acid, preferably, a single-stranded DNA and/or a double-stranded DNA, The single-stranded nucleic acid detector is selected from single-stranded DNA, and/or single-stranded RNA, and/or single-stranded DNA-RNA hybrids.

In a specific embodiment, the Cas protein is Cas13a, and the target nucleic acid is RNA. Preferably, the single-stranded nucleic acid detector is selected from single-stranded DNA, and/or single-stranded RNA, and/or single-stranded DNA -RNA hybrids.

In the present invention, the detectable signal is realized in the following ways: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, colloidal phase change/dispersion, electrochemical detection, and semiconductor-based detection Detection.

In some embodiments, the method of the present invention further includes the step of measuring the detectable signal produced by the CRISPR/CAS effector protein (Cas protein). The Cas protein can stimulate the cleavage activity of the single-stranded nucleic acid after recognizing the target nucleic acid or hybridizing with the target nucleic acid, thereby cutting the single-stranded nucleic acid detector to generate a detectable signal.

In the present invention, the detectable signal may be any signal generated when the single-stranded nucleic acid detector is cleaved. For example, detection based on gold nanoparticles, fluorescence polarization, colloidal phase transition/dispersion, electrochemical detection, semiconductor-based sensing. The detectable signal can be read out by any suitable means, including but not limited to: measurement of detectable fluorescent signal, gel electrophoresis detection (by detecting the change of bands on the gel), color based on vision or sensor The presence or absence of detection, or the difference in color (for example, based on gold nanoparticles) and the difference in electrical signals.

In a preferred embodiment, the detectable signal is realized in the following manner: different reporter groups are set at the 5'end and 3'end of the single-stranded nucleic acid detector, and when the single-stranded nucleic acid detector is cleaved Afterwards, it can show a detectable report signal; for example, a single-stranded nucleic acid detector is provided with a fluorescent group and a quenching group at both ends, and when the single-stranded nucleic acid detector is cleaved, it can show a detectable Fluorescence signal.

In one embodiment, the fluorescent group is selected from one or more of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED460; the quenching group is selected From one or more of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

In other embodiments, the detectable signal can also be realized in the following manner: the 5'end and 3'end of the single-stranded nucleic acid detector are respectively provided with different labeling molecules, and the reaction signal is detected by colloidal gold detection. .

In one embodiment, the target nucleic acid includes DNA, RNA, and is preferably a single-stranded nucleic acid or a double-stranded nucleic acid or a nucleic acid modification.

In one embodiment, the target nucleic acid is derived from samples such as viruses, bacteria, microorganisms, soil, water sources, human bodies, animals, and plants. Preferably, the target nucleic acid is a product enriched or amplified by methods such as PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM and the like.

In one embodiment, the method further includes the step of obtaining the target nucleic acid from the sample.

In one embodiment, the target nucleic acid is a viral nucleic acid, a bacterial nucleic acid, a specific nucleic acid related to a disease, such as a specific mutation site or SNP site or a nucleic acid that is different from a control; preferably, the virus is a plant Virus or animal virus, for example, papilloma virus, hepatic DNA virus, herpes virus, adenovirus, pox virus, parvovirus, coronavirus; preferably, the virus is a coronavirus, preferably SARS, SARS-CoV2 (COVID -19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, Mers-Cov.

In some embodiments, the target nucleic acid is derived from a cell, for example, from a cell lysate.

In some embodiments, the measurement of the detectable signal may be quantitative, and in other embodiments, the measurement of the detectable signal may be qualitative.

Preferably, the single-stranded nucleic acid detector generates a first detectable signal before being cleaved by the Cas protein, and generates a second detectable signal different from the first detectable signal after being cleaved.

In other embodiments, the single-stranded nucleic acid detector includes one or more modifications, such as base modification, backbone modification, sugar modification, etc., to provide nucleic acids with new or enhanced features (such as improved stability). Examples of suitable modifications include modified nucleic acid backbones and non-natural nucleoside linkages. Nucleic acids with modified backbones include those that retain phosphorus atoms in the backbone and those that do not have phosphorus atoms in the backbone. Suitable modified oligonucleotide backbones containing phosphorus atoms include phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, methyl and other alkyl groups. Phosphonate. In some embodiments, the single-stranded nucleic acid detector contains one or more phosphorothioate and/or heteroatom nucleoside bonds. In other embodiments, the single-stranded nucleic acid detector can be a nucleic acid mimic; in some embodiments, the nucleic acid mimic is peptide nucleic acid (PNA), and another type of nucleic acid mimic is based on The heterocyclic base on the morpholine ring is connected to the morpholinyl unit (morpholinyl nucleic acid). Other nucleic acid mimics also include cyclohexenyl nucleic acid (CENA), and ribose or deoxyribose chains.

In another aspect, the present invention provides a method for detecting whether there is a characteristic sequence to be detected in a target nucleic acid based on CRISPR technology, the method comprising:

(1) Provide target nucleic acid, gRNA, Cas protein and single-stranded nucleic acid detector;

(2) The gRNA can target the characteristic sequence to be detected, the Cas protein recognizes the characteristic sequence to be detected under the action of the gRNA, and the Cas protein stimulates the single sequence after recognizing the characteristic sequence to be detected. Strand nucleic acid cleavage activity;

(3) The Cas protein cleaves the single-stranded nucleic acid detector by the single-stranded nucleic acid cleavage activity, and the single-stranded nucleic acid detector is cleaved by the Cas protein compared to before the single-stranded nucleic acid detector is cleaved by the Cas protein Make a detectable difference;

(4) Test whether the detectable difference described in step (3) can be detected; if the detectable difference described in step (3) can be detected, it reflects that the target nucleic acid contains the characteristic sequence to be detected; or, If the detectable difference described in step (3) cannot be detected, it reflects that the target nucleic acid does not contain the characteristic sequence to be detected.

In one embodiment, the steps (3) and (4) can be implemented in the following manner: different reporter groups are set at the 5'end and 3'end of the single-stranded nucleic acid detector, when the single-stranded nucleic acid detector After the nucleic acid detector is cut, it can show a detectable report signal. The presence or absence of the report signal reflects whether the target nucleic acid contains the characteristic sequence to be detected; if the report signal can be detected, it reflects that the target nucleic acid contains the characteristic to be detected. Sequence; or, if the reporter signal cannot be detected, it reflects that the target nucleic acid does not contain the characteristic sequence to be detected. For example, a single-stranded nucleic acid detector is provided with a fluorescent group and a quenching group at both ends. When the single-stranded nucleic acid detector is cleaved, it can show a detectable fluorescent signal. The presence or absence of the fluorescent signal reflects the target Whether the nucleic acid contains the characteristic sequence to be detected; if the fluorescent signal can be detected, it reflects that the target nucleic acid contains the characteristic sequence to be detected; or, if the fluorescent signal cannot be detected, it reflects that the target nucleic acid does not contain the characteristic sequence to be detected.

In one embodiment, the fluorescent group is selected from one or more of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED460; the quenching group is selected From one or more of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

In one embodiment, the steps (3) and (4) can also be implemented in other ways: the 5'end and 3'end of the single-stranded nucleic acid detector are respectively provided with different labeling molecules, and the detection is performed by colloidal gold. The method of detecting the colloidal gold test results of the single-stranded nucleic acid detector before being cleaved by the Cas protein and after being cleaved by the Cas protein to reflect whether the target nucleic acid contains the characteristic sequence to be detected; the single-stranded nucleic acid detector is cleaved by the Cas protein Before cutting and after being cut by Cas protein, different color development results will be shown on the detection line and quality control line of colloidal gold.

On the other hand, the present invention also provides a system for detecting whether there is a characteristic sequence to be detected in a target nucleic acid based on the CRISPR technology. The system includes: gRNA, Cas protein and a single-stranded nucleic acid detector.

On the other hand, the present invention also provides a CRISPR technology-based kit for detecting whether there is a characteristic sequence to be detected in a target nucleic acid, the kit comprising: gRNA, Cas protein and a single-stranded nucleic acid detector.

Further, the kit also includes primers for amplifying the target nucleic acid.

On the other hand, the present invention also provides the use of the above-mentioned system or the above-mentioned kit in diagnosing whether there is a characteristic sequence to be detected in the sample to be tested.

Further, the use includes obtaining a target nucleic acid from a sample to be tested, and further detecting whether there is a characteristic sequence to be detected in the target nucleic acid.

Preferably, it can be amplified by nucleic acid sequencing-based amplification (NASBA), recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), strand displacement amplification (SDA), helicase-dependent amplification Increase (HDA), or Nickase Amplification Reaction (NEAR), PCR, Multiple Displacement Amplification (MDA), Rolling Circle Amplification (RCA), Ligase Chain Reaction (LCR), or Derivative Amplification Method (RAM) Obtain the target nucleic acid from the sample to be tested.

In a preferred embodiment, the characteristic sequence to be detected is a virus-specific sequence, a bacterial-specific sequence, a disease-related characteristic sequence, a specific mutation site or a SNP site; preferably, the virus is a plant Virus or animal virus; preferably, the virus is a coronavirus, preferably SARS, SARS-CoV2 (COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, Mers-Cov. If the above-mentioned characteristic sequence to be detected is present in the target nucleic acid, it can reflect that the sample from which the target nucleic acid is derived is a certain virus, bacteria, or is infected with a certain virus, bacteria, or disease, or has a specific mutation site or SNP Site.

The Cas protein is preferably a V-type or VI-type CRISPR/CAS effector protein, for example, selected from Cas12, Cas13, Cas14 family proteins or mutants thereof.

In one embodiment, the Cas12a is selected from one or more of FnCas12a, AsCas12a, LbCas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a or Lb4Cas12a; the Cas12a is preferably LbCas12a, and the amino acid sequence is as shown in SEQ ID No. 5, or pass the amino acid sequence shown in SEQ ID No. 5 or its active fragment through one or more (such as 2, 3, 4, 5, 6, 7, 8 , 9 or 10) amino acid residue substitutions, deletions or additions, and have basically the same function of the derivative protein.

In other embodiments, the amino acid sequence of Cas12b is shown in SEQ ID No. 6, or the amino acid sequence shown in SEQ ID No. 6 or its active fragments are passed through one or more (e.g., 2 or 3) , 4, 5, 6, 7, 8, 9 or 10) amino acid residue substitutions, deletions or additions, and have basically the same function of the derivative protein.

In one embodiment, the Cas13 family protein includes Cas13a and Cas13b. Preferably, the Cas13a is selected from Lshcas13a, the amino acid sequence of which is shown in SEQ ID No. 7 or the amino acid sequence shown in SEQ ID No. 7 or The active fragment is formed by substitution, deletion or addition of one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues, And has a derivative protein with basically the same function.

In a preferred embodiment, the amino acid sequence of the Cas12i protein is selected from the following group:

(1) The protein shown in SEQ ID NO: 2;

(2) Pass the amino acid sequence shown in SEQ ID NO: 2 or its active fragments through one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 ) Derivative proteins formed by substitution, deletion or addition of amino acid residues and having basically the same functions.

The amino acid sequence of the Cas12j protein is selected from the following group:

(1) The protein shown in SEQ ID NO: 4;

(2) Pass the amino acid sequence shown in SEQ ID NO: 4 or its active fragments through one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 ) Derivative proteins formed by substitution, deletion or addition of amino acid residues and having basically the same functions.

In one embodiment, the Cas protein mutant includes amino acid substitutions, deletions or substitutions, and the mutant at least retains its trans-cleavage activity. Preferably, the mutant has Cis and trans cleavage activity.

In one embodiment, the Cas protein is selected from type V or type VI CRISPR/CAS effector protein.

In the present invention, the gRNA includes a sequence that targets the characteristic sequence to be detected (a targeting sequence) and a sequence that recognizes the Cas protein (a direct repeat sequence or a part thereof).

In the present invention, the targeting sequence includes 10-40 bp; preferably, 12-25 bp; preferably, 15-23 bp; preferably, 16-18 bp.

In the present invention, the gRNA has a matching degree of at least 50% with the characteristic sequence to be detected, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%.

In one embodiment, when the characteristic sequence contains one or more characteristic sites (such as specific mutation sites or SNPs), the characteristic sites completely match the gRNA.

In one embodiment, the detection method may include one or more gRNAs with different targeting sequences, which target different characteristic sequences.

In one embodiment, the identifying the characteristic sequence to be detected includes combining and/or cutting the characteristic sequence to be detected.

In one embodiment, the molar ratio of the Cas protein to gRNA is (0.8-1.2):1.

In one embodiment, the final concentration of the Cas protein is 20-200 nM, preferably 30-100 nM, more preferably 40-80 nM, more preferably 50 nM.

In one embodiment, the final concentration of the amount of gRNA is 20-200 nM, preferably, 30-100 nM, more preferably, 40-80 nM, more preferably, 50 nM.

In one embodiment, the final concentration of the amount of the target nucleic acid is 5-100 nM, preferably, 10-50 nM.

In one embodiment, the dosage of the single-stranded nucleic acid detector has a final concentration of 100-1000 nM, preferably, 150-800 nM, preferably, 200-800 nM, preferably, 200-500 nM, preferably, 200-300 nM.

In one embodiment, the single-stranded nucleic acid detector has 2-300 nucleotides, preferably, 3-200 nucleotides, preferably, 3-100 nucleotides, preferably, has 3-30 nuclei. The nucleotides are preferably 4-20 nucleotides, more preferably 5-15 nucleotides.

In one embodiment, the single-stranded nucleic acid detector is a single-stranded DNA molecule, a single-stranded RNA molecule, or a single-stranded DNA-RNA hybrid.

In one embodiment, the method can be used for the quantitative detection of the characteristic sequence to be detected.

The term "hybridization" or "complementary" or "substantially complementary" means that a nucleic acid (e.g., RNA, DNA) contains a nucleotide sequence that enables it to bind non-covalently, that is, in a sequence-specific, anti-parallel manner ( That is, the nucleic acid specifically binds to the complementary nucleic acid) to form base pairs and/or G/U base pairs with another nucleic acid, "annealing" or "hybridizing". Hybridization requires that the two nucleic acids contain complementary sequences, although there may be mismatches between the bases. Suitable conditions for hybridization between two nucleic acids depend on the length and degree of complementarity of the nucleic acids, which are variables well known in the art. Typically, the length of a hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nuclear Nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).

It should be understood that the sequence of a polynucleotide does not need to be 100% complementary to the sequence of its target nucleic acid in order to specifically hybridize. The polynucleotide may comprise 60% or higher, 65% or higher, 70% or higher, 75% or higher, 80% or higher, 85% or higher, 90% or higher, 95% or higher Higher, 98% or higher, 99% or higher, 99.5% or higher, or the sequence complementarity of the target region in the target nucleic acid sequence hybridized with it is 100%.

The present invention found that V-type or VI-type CRISPR/CAS protein (including Cas12i, Cas12j, Cas12a, Cas12b, Cas13a) once activated by detecting target nucleic acid can cleave non-targeted single-stranded DNA (ssDNA), single-stranded RNA (ssRNA) or single-stranded DNA-RNA hybrid. Therefore, when the target nucleic acid is present in the sample, the single-stranded nucleic acid detector (including single-stranded DNA, single-stranded RNA, or single-stranded DNA-RNA hybrid) can be used to detect the single-stranded nucleic acid by using the CRISPR/CAS protein The detection signal displayed by the device is used for detection.

General definition:

Unless otherwise defined, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

The term "amino acid" refers to a carboxylic acid containing an amino group. Various proteins in organisms are composed of 20 basic amino acids.

The terms "polynucleotide", "nucleotide sequence", "nucleic acid sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or a hybrid thereof, which may be double-stranded or single-stranded.

The term "oligonucleotide" refers to a sequence containing 3-100 nucleotides, preferably, 3-30 nucleotides, preferably 4-20 nucleotides, more preferably 5-15 nucleosides acid.

The term "homology" or "identity" is used to refer to the sequence matching between two polypeptides or between two nucleic acids. When a certain position in the two sequences to be compared is occupied by the same base or amino acid monomer subunit (for example, a certain position in each of the two DNA molecules is occupied by adenine, or two A certain position in each of the polypeptides is occupied by lysine), then each molecule is the same at that position. Between two sequences. Generally, the comparison is made when two sequences are aligned to produce maximum identity. Such an alignment can be used. For example, the identity of the amino acid sequence can be determined by conventional methods, see, for example, Smith and Waterman, 1981, Adv. Appl. Math. 2:482 Pearson & Lipman, 1988, Proc. Natl. Acad. Sci. USA 85:2444, Thompson et al., 1994, Nucleic Acids Res 22:467380, etc. The teachings are determined by computerized operating algorithms (GAP, BESTFIT, FASTA, and TFASTA, Genetics Computer Group in the Wisconsin Genetics software package). The BLAST algorithm available from the National Center for Biotechnology Information (NCBI www.ncbi.nlm.nih.gov/) can also be used, and the default parameters are used to determine.

As used herein, the "CRISPR" refers to clustered regularly interspaced short palindromic repeats (Clustered regularly interspaced short palindromic repeats), which are derived from the immune system of microorganisms.

As used herein, "biotin" is also called vitamin H, which is a small molecule vitamin with a molecular weight of 244 Da. "Avidin (avidin)", also known as avidin, is a basic glycoprotein that has 4 binding sites with extremely high affinity to biotin. The commonly used avidin is streptavidin. The extremely strong affinity of biotin and avidin can be used to amplify or enhance the detection signal in the detection system. For example, biotin is easy to covalently bond with proteins (such as antibodies, etc.), and the avidin molecule bound to the enzyme reacts with the biotin molecule bound to the specific antibody, which not only plays a multi-stage amplification effect, but also because When the enzyme encounters the corresponding substrate, the catalysis will show color to achieve the purpose of detecting unknown antigen (or antibody) molecules.

Feature sequence

As used herein, the "characteristic sequence" or "characteristic sequence to be detected" or "characteristic sequence to be detected" can be used interchangeably, and both refer to a nucleic acid sequence that characterizes the specificity or certain unique characteristics of an organism. Hybridization with the gRNA guide sequence promotes the formation of CRISPR complexes. The said characteristic sequence is a DNA polynucleotide, and its quantity can include the part complementary to the gRNA guide sequence, or it can be equal to or slightly less than the part complementary to the gRNA guide sequence. In certain embodiments, the organisms include animals, plants, and microorganisms. The microorganisms include bacteria, fungi, yeasts, protozoa, parasites or viruses. For example, the characteristic sequence may be a nucleic acid sequence that characterizes the characteristics of the virus (if the virus is an RNA sequence, it also includes a DNA sequence formed by reverse transcription); for example, the characteristic sequence may be a sequence containing specific mutation sites For example, gene mutation sites that induce tumors in animal cells, or certain gene mutation sites that change plant traits in plants (such as specific mutation sites that confer herbicide resistance to the ALS protein).

In some embodiments, the virus includes a double-stranded RNA virus, a positive sense RNA virus, a negative sense RNA virus, a retrovirus, or a combination thereof, or the virus infection is caused by a Coronaviridae virus, a picornavirus ( Picornaviridae virus, Caliciviridae virus, Flaviviridae virus, Togaviridae virus, Filoviridae, Paramyxoviridae, Pneumoviridae ( Pneumoviridae, Rhabdoviridae, Arenaviridae, Bunyaviridae, Orthomyxoviridae or Delta virus, or the virus infection is caused by Coronavirus , SARS, Poliovirus, Rhinovirus, Hepatitis A, Norwalkvirus, Yellow fever virus, West Nile virus ), Hepatitis C virus, Dengue fever virus, Zika virus, Rubella virus, Ross River virus, Sindbis virus ), Chikungunya virus, Borna disease virus, Ebola virus, new coronavirus (2019-nCoV), Marburg virus, measles Measles virus, Mumps virus, Nipah virus, Hendra virus, Newcastle disease virus, Human respiratory syncyvirus , Rabies virus, Lassa virus, Hantavirus, Crimean-Congo hemorrhagic fever virus, Influenza enza) or Hepatitis D virus (Hepatitis D virus).

In certain exemplary embodiments, the virus may be a plant virus selected from the group consisting of tobacco mosaic virus (TMV), tomato spotted wilt virus (TSWV), cucumber mosaic virus (CMV), potato Y virus (PVY), RT Virus Cauliflower Mosaic Virus (CaMV), Plum Pox Virus (PPV), Brome Mosaic Virus (BMV), Potato Virus X (PVX), Citrus Decay Virus (CTV), Barley Yellow Dwarf Virus (BYDV), Potato Roll Leaf Virus (PLRV), Tomato Cluster Stunt Virus (TBSV), Rice Bulb Virus (RTSV), Rice Yellow Mottle Virus (RYMV), Rice Off-White Virus (RHBV), Maize Reyadofina Virus (MRFV), Maize Dwarf Flower Leaf Virus (MDMV), Sugarcane Mosaic Virus (SCMV), Sweet Potato Feather Mottle Virus (SPFMV), Sweet Potato Settling Vein Nematode Virus (SPSVV), Grape Fan Leaf Virus (GFLV), Grape Virus A (GVA), Grape Virus B (GVB), Grape Spot Virus (GFkV), Grape Leaf Roll Virus Related Viruses-1, -2 and -3, (GLRaV-1, -2 and -3), Arabis Mosaic Virus (ArMV), or Larch Stem pitting related virus (RSPaV).

In some embodiments, examples of bacteria include, but are not limited to, one or more of the following (or a combination thereof): Actinobacillus species, Actinobacillus species, Actinobacillus species, Actinobacillus species ( Actinomyces) species (e.g. Actinomyces israelii and Actinomyces naeslundii), Aeromonas species (e.g. Aeromonas hydrophila, Aeromonas veronii biovar soobria (Aeromonas sobria) and Aeromonas los califorans oxidative), Anaplasma, Anaplasma, Anaplasma, Anaphagocytosis, Anaplasma Actinobacillus actinomycetemcomitans, Bacillus species (e.g. Bacillus anthracis, Bacillus cereus, Bacillus subtilis, Bacillus thuringiensis and Bacillus stearothermophilus), Bacteriodes, Enterobacter (Enterobacter) species (e.g. Enterobacter, Enterobacter) Enterobacter cloacae and E. coli, including opportunistic E. coli, such as enterotoxigenic E. coli, enteroinvasive E. coli, enteropathogenic E. coli, enterohemorrhagic E. coli, enteroaggregative E. coli and uropathogenic E. coli, Enterococcus Species (e.g. Enterococcus faecalis and Enterococcus faecium), Ehrlichia species (e.g. Ehrlichia chafeensia and Ehrlichia canis), Epidermophyton floccosum, Erysipelothrix rhusiopathiae, Eubacteria (Francisbacterium) species, Francisbacterium Bacteria nucleatum, Gardnerella vaginaalis, Gemella morbillorum, Haemophilus species (e.g. Haemophilus influenzae, Haemophilusducreyi, Haemophilusaegyptius, Haemophilus parainfluenza, Haemophilus parahaemolyticus and Haemophilus (Heoberobacter parahaemolyticus), such as Heobophilus (Heylacterobacter) cinaedi and Helicobacter fennelliae), Kingella kingii, Klebsiella species, Lactobacillus species, Listeria monocytogenes, Leptospira interrogans, Legionella pneumostophila, Leptospira interrogans, Peptospira interrogans, Peptospira pneumostophila, Leptospira interrogans, Peptospira interrogans, Peptospira species , Microsporum canis, Moraxella catarrhalis, Morganell species, Mobiluncus species, Micrococcus species, Mycobacterium species (e.g. Mycobacterium leprae, Mycobacterium tuberculosis, Mycobacterium paratuberculosis) , Mycobacterium intracellulare, Mycobacterium avium, Mycobacterium bovis, and Mycobacterium marinum), Mycoplasma species (e.g. Mycoplasma pneumoniae, Mycoplasma homominis, and Mycoplasma genitalium), Nocardia species (e.g. Nocardia and Nocardia asteroides, Nocardia asteroides, Nocardia brasiliensis), Neisseria species (e.g. N eisseria gonorrhoeae and Neisseria meningitidis), Pasteurella multocida, Pityrosporum orbiculare (Malassezia furfur), Providencia species (e.g. Providencia alcalifaciens, Providencia rettquifaciens, Providencia rettquifaciens, Providencia stuartiibacterium), Providencia stuartiibacterium Pseudomonas , Rickettsia sp., Salmonella species (e.g. Salmonella enterica, Salmonella typhi, Salmonella para typhi, Salmonella enteritidis, Salmonella cholerasuis and Salmonella typhimurium (e.g. Serratia) marquises and Serratia liquices) ), Shigella species (e.g. Shigella dysenteriae, Shigella flexneri, Shigella boydii and Shigella sonnei), Staphylococcus species, Streptococcus species (e.g. Streptococcus pneumoniae (e.g. Streptococcus pneumoniae, Streptococcus pneumoniae, Streptococcus pneumoniae, Streptococcus pneumoniae, Streptococcus pneumoniae, Streptococcus pneumoniae, Streptococcus pneumoniae Toxin-resistant serotype 14 Streptococcus pneumoniae, rifampicin-resistant serotype 18C Streptococcus pneumoniae, tetracycline-resistant serotype 19F Streptococcus pneumoniae, penicillin-resistant serotype 19F Streptococcus pneumoniae, and trimethoprim Serotype 23F Streptococcus pneumoniae, Chloramphenicol-resistant serotype 4 Streptococcus pneumoniae, Spectinomycin-resistant serotype 6B Streptococcus pneumoniae, Streptomycin-resistant serotype 9V Streptococcus pneumoniae, Optokin Resistant serotype 14 Streptococcus pneumoniae, rifampicin-resistant serotype 18C Streptococcus pneumoniae, penicillin-resistant serotype 19F Streptococcus pneumoniae, or trimethoprim-resistant serotype 23F Streptococcus pneumonia), Yersin Yersinia species (e.g. Yersinia enterocolitica, Yersinia pestis, and Yersinia pseudotuberculosis) and Xanthomo nas maltophilia and so on.

Target nucleic acid

As used herein, the "target nucleic acid" refers to a polynucleotide molecule extracted from a biological sample (sample to be tested). The biological sample is any solid or fluid sample obtained, excreted or secreted from any organism, including but not limited to single-celled organisms, such as bacteria, yeast, protozoa and amoeba, etc., multi-cellular organisms (such as plants or animals, Includes samples from healthy or apparently healthy human subjects or human patients affected by conditions or diseases to be diagnosed or investigated, such as pathogenic microorganisms such as pathogenic bacteria or viral infections). For example, a biological sample can be from, for example, blood, plasma, serum, urine, stool, sputum, mucus, lymphatic fluid, synovial fluid, bile, ascites, pleural effusion, seroma, saliva, cerebrospinal fluid, aqueous or vitreous fluid, Or any biological fluid obtained from body secretions, exudates, exudates (e.g., fluid obtained from an abscess or any other site of infection or inflammation) or from joints (e.g., normal joints or joints affected by diseases, such as Rheumatoid arthritis, osteoarthritis, gout, or septic arthritis), or a swab on the surface of the skin or mucous membrane. The sample can also be a sample obtained from any organ or tissue (including a biopsy or autopsy specimen, such as a tumor biopsy) or can contain cells (primary cells or cultured cells) or cultured by any cell, tissue or organ base. Exemplary samples include, but are not limited to, cells, cell lysates, blood smears, cytocentrifugation preparations, cytology smears, body fluids (e.g., blood, plasma, serum, saliva, sputum, urine, bronchoalveolar lavage, semen, etc. ), tissue biopsy (e.g. tumor biopsy), fine needle aspirate and/or tissue section (e.g. cryostat tissue section and/or paraffin-embedded tissue section).

In other embodiments, the biological sample may be plant cells, calluses, tissues or organs (such as roots, stems, leaves, flowers, seeds, fruits) and the like.

In the present invention, the target nucleic acid also includes a DNA molecule formed by reverse transcription of RNA. Further, the target nucleic acid can be amplified by techniques known in the art, and the amplification technique is isothermally amplified. Technology and non-isothermal amplification technology, isothermal amplification can be based on nucleic acid sequencing amplification (NASBA), recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), strand displacement amplification (SDA) ), helicase dependent amplification (HDA), or nickase amplification reaction (NEAR). In certain exemplary embodiments, non-isothermal amplification methods may be used, including but not limited to PCR, multiple displacement amplification (MDA), rolling circle amplification (RCA), ligase chain reaction (LCR), or derivative Material amplification method (RAM).

Further, the detection method of the present invention further includes a step of amplifying the target nucleic acid; the detection system further includes a reagent for amplifying the target nucleic acid. The reagents for amplification include one or more of the following groups: DNA polymerase, strand displacement enzyme, helicase, recombinase, single-stranded binding protein, and the like.

Cas protein

The "Cas protein" as used herein refers to a CRISPR-associated protein, preferably from a type V or type VI CRISPR/CAS protein, once it binds to the characteristic sequence (target sequence) to be detected (that is, the Cas protein-gRNA-target sequence is formed). Meta-complex), it can induce its trans activity, that is, random cleavage of non-targeted single-stranded nucleotides (that is, the single-stranded nucleic acid detector described herein, preferably single-stranded DNA (ssDNA), single-stranded DNA-RNA hybrids, Single-stranded RNA). When the Cas protein is combined with the characteristic sequence, it can induce its trans activity by cutting the characteristic sequence or not; preferably, it induces its trans activity by cutting the characteristic sequence; more preferably, it induces its trans activity by cutting the single-stranded characteristic sequence. trans activity. The Cas protein recognizes the characteristic sequence by recognizing the PAM (protospacer advanced motif) adjacent to the characteristic sequence.

The Cas protein of the present invention is a protein with at least trans cleavage activity, preferably, the Cas protein is a protein with Cis and trans cleavage activity. The Cis activity refers to the activity of the Cas protein to recognize the PAM site and specifically cleave the target sequence under the action of gRNA.

The Cas protein of the present invention includes V-type and VI-type CRISPR/CAS effector proteins, including protein families such as Cas12, Cas13, and Cas14. Preferably, for example, Cas12 protein, such as Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j; preferably, the Cas protein is Cas12a, Cas12b, Cas12i, Cas12j. The Cas13 protein family includes Cas13a, Cas13b and so on.

In an embodiment, the Cas protein referred to herein, such as Cas12, also encompasses functional variants of Cas or homologs or orthologs thereof. A "functional variant" of a protein as used herein refers to a variant of such a protein that at least partially retains the activity of the protein. Functional variants may include mutants (which may be insertion, deletion or substitution mutants), including polymorphs and the like. Functional variants also include fusion products of such a protein with another nucleic acid, protein, polypeptide, or peptide that is not normally related. Functional variants can be naturally occurring or can be man-made. Advantageous embodiments may involve engineered or non-naturally occurring type V DNA targeting effector proteins.

In one embodiment, one or more nucleic acid molecules encoding Cas proteins, such as Cas12, or orthologs or homologs thereof can be codon optimized for expression in eukaryotic cells. Eukaryotes can be as described herein. The one or more nucleic acid molecules may be engineered or non-naturally occurring.

In one embodiment, the Cas12 protein or its orthologs or homologs may contain one or more mutations (and therefore the nucleic acid molecule encoding it may have one or more mutations. The mutations may be artificially introduced and may Including but not limited to one or more mutations in the catalytic domain.

In one embodiment, the Cas protein may be from: Ciliates, Listeria, Corynebacterium, Sartorella, Legionella, Treponema, Nemogen, Eubacterium, Streptococcus , Lactobacillus, Mycoplasma, Bacteroides, Flavivola, Flavobacterium, Azospirillum, Sphaerochaeta, Gluconacetobacter, Neisseria, Roche, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma , Campylobacter and Laurespirillum.

In one embodiment, the Cas protein is selected from proteins consisting of the following sequences:

(1) The protein shown in SEQ ID NO: 2 or SEQ ID NO: 4-7;

(2) List the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4-7 or its active fragments through one or more (such as 2, 3, 4, 5, 6, 7 , 8, 9, or 10) amino acid residue substitutions, deletions or additions, and have basically the same function of the derivative protein.

In one embodiment, the Cas protein further includes at least 50%, preferably 55%, preferably 60%, preferably 65%, preferably 70%, preferably 75%, preferably 80%, preferably 85%, preferably 90% of the above sequence. %, preferably 95%, a protein with sequence identity and trans activity.

The Cas protein can be obtained by recombinant expression vector technology, that is, the nucleic acid molecule encoding the protein is constructed on a suitable vector, and then transformed into a host cell, so that the encoding nucleic acid molecule is expressed in the cell, thereby obtaining the corresponding protein. The protein can be secreted by the cell, or the protein can be obtained by cracking the cell through conventional extraction techniques. The coding nucleic acid molecule may be integrated into the genome of the host cell for expression, or may not be integrated into the host cell for expression. The vector further includes regulatory elements that facilitate sequence integration or self-replication. The vector can be, for example, a plasmid, virus, cosmid, phage, etc., which are well known to those skilled in the art. Preferably, the expression vector in the present invention is a plasmid. The vector further includes one or more regulatory elements, selected from the group consisting of promoters, enhancers, ribosome binding sites for translation initiation, terminator, polyadenylic acid sequences, and selection marker genes.

The host cell can be a prokaryotic cell, such as Escherichia coli, Streptomyces, Agrobacterium; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a plant cell. Those of ordinary skill in the art know how to select appropriate vectors and host cells.

gRNA

As used herein, the "gRNA" is also called guide RNA or guide RNA, and has the meaning commonly understood by those skilled in the art. Generally speaking, guide RNAs can include direct repeats and guide sequences, or consist essentially of direct repeats and guide sequences (also called spacers in the context of endogenous CRISPR systems). (spacer)) composition. In different CRISPR systems, gRNA can include crRNA and tracrRNA, or only crRNA, depending on the Cas protein it depends on. crRNA and tracrRNA can be artificially modified and fused to form single guide RNA (sgRNA). In some cases, the targeting sequence is any that has sufficient complementarity with the target sequence (the characteristic sequence in the present invention) to hybridize with the target sequence and guide the specific binding of the CRISPR/Cas complex to the target sequence. The polynucleotide sequence usually has a sequence length of 12-25 nt. The same direct repeat sequence can be folded to form a specific structure (such as a stem-loop structure) for the Cas protein to recognize to form a complex. The targeting sequence does not need to be 100% complementary to the characteristic sequence (target sequence). The targeting sequence is not complementary to the single-stranded nucleic acid detector.

In certain embodiments, the degree of complementarity (match) between the targeting sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, At least 95%, or at least 99%. Determining the best alignment is within the abilities of those of ordinary skill in the art. For example, there are published and commercially available alignment algorithms and programs, such as but not limited to ClustalW, Smith-Waterman algorithm in matlab, Bowtie, Geneious, Biopython, and SeqMan.

The gRNA of the present invention may be natural, or artificially modified or designed and synthesized.

Single-stranded nucleic acid detector

The single-stranded nucleic acid detector of the present invention refers to a sequence containing 2-200 nucleotides, preferably, 2-150 nucleotides, preferably 3-100 nucleotides, preferably 3-30 nucleotides Nucleotides, preferably 4-20 nucleotides, more preferably 5-15 nucleotides. Preferably, it is a single-stranded DNA molecule, a single-stranded RNA molecule, or a single-stranded DNA-RNA hybrid.

The single-stranded nucleic acid detector is used in a detection method or system to report whether it contains a characteristic sequence. The two ends of the single-stranded nucleic acid detector include different reporter groups or labeling molecules. When it is in the initial state (that is, when it is not cut), it does not present a reporter signal. When the single-stranded nucleic acid detector is cleaved, it displays A detectable signal is displayed, that is, a detectable difference between after cutting and before cutting is shown. In the present invention, if the detectable difference can be detected, it reflects that the target nucleic acid contains the characteristic sequence to be detected; or, if the detectable difference cannot be detected, it reflects that the target nucleic acid does not contain the characteristic sequence to be detected. Sequence of features.

In one embodiment, the reporter group or labeling molecule includes a fluorescent group and a quenching group, and the fluorescent group is selected from FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red Or one or any of LC RED460; the quenching group is selected from one or any of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

In one embodiment, the single-stranded nucleic acid detector has a first molecule (such as FAM or FITC) connected to the 5'end and a second molecule (such as biotin) connected to the 3'end. The reaction system containing the single-stranded nucleic acid detector is matched with the flow bar to detect the characteristic sequence (preferably, the colloidal gold detection method). The flow bar is designed to have two capture lines, the sample contact end (colloidal gold) is provided with an antibody that binds the first molecule (ie, the first molecule antibody), and the first line (control line) contains the binding first molecule. An antibody of one molecule contains an antibody of a second molecule (ie, a second molecule of antibody, such as avidin) that binds to the second molecule at the second line (test line). When the reaction flows along the strip, the first molecule of antibody binds to the first molecule and carries the cleaved or uncut oligonucleotide to the capture line. The cleaved reporter will bind to the first molecule of antibody at the first capture line. The antibody, and the uncut reporter will bind the second molecule of antibody at the second capture line. The binding of the reporter group on each line will result in a strong readout/signal (e.g. color). As more reporters are cut, more signals will accumulate at the first capture line, and fewer signals will appear at the second line. In certain aspects, the present invention relates to the use of flow bars as described herein for the detection of nucleic acids. In certain aspects, the present invention relates to a method for detecting nucleic acid using a flow strip as defined herein, such as a (lateral) flow test or a (lateral) flow immunochromatographic assay. In some aspects, the molecules in the single-stranded nucleic acid detector can replace each other or change the position of the molecules. As long as the reporting principle is the same or similar to the present invention, the improved methods are also included in the present invention.

The detection method of the present invention can be used for the quantitative detection of the characteristic sequence to be detected. The quantitative detection index can be quantified according to the signal strength of the reporter group, for example, according to the luminescence intensity of the fluorescent group, or according to the width of the color band.

Description of the drawings

Figure 1. Use single-stranded DNA as a single-stranded nucleic acid detector to verify the results of Cas12i.

Figure 2. Use single-stranded DNA as a single-stranded nucleic acid detector to verify the detection results of Cas12j.

Figure 3. Using different single-stranded DNA as a single-stranded nucleic acid detector to verify the results of Cas12i.

Figure 4. Using different single-stranded DNA as a single-stranded nucleic acid detector to verify the detection results of Cas12j.

Figure 5. Using single-stranded RNA as a single-stranded nucleic acid detector to verify the detection results of Cas12i and Cas12j.

Figure 6. The results of using colloidal gold test strips to detect the Cas12i cleavage single-stranded nucleic acid detector.

Figure 7. Use double-stranded DNA as the target nucleic acid and single-stranded RNA as the single-stranded nucleic acid detector to verify the detection results of Cas12i.

Figure 8. Use double-stranded DNA as the target nucleic acid and single-stranded RNA as the single-stranded nucleic acid detector to verify the detection results of Cas12j.

Figure 9. Use single-stranded DNA as the target nucleic acid and single-stranded RNA as the single-stranded nucleic acid detector to verify the detection results of Cas12a.

Figure 10. Use single-stranded DNA as the target nucleic acid and single-stranded RNA as the single-stranded nucleic acid detector to verify the detection results of Cas12b.

Figure 11. Use single-stranded DNA TGW6-i3g2-100bp-TTA1 (SEQ ID No. 8) as the target nucleic acid and 5'6-FAM-UUUUU-3'BHQ1 as the single-stranded nucleic acid detector to verify Cas12i, Cas12j, Cas12a and Cas12b test results.

Figure 12. Using single-stranded DNA TGW6-i3g2-100bp-TTA1 (SEQ ID No. 8) as the target nucleic acid, using 5'-/56-FAM/rA rA rA rA rA/3Bio/-3'(rA represents the base Adenine RNA) as a single-stranded nucleic acid detector to verify the detection results of Cas12i, Cas12j, Cas12a and Cas12b.

Figure 13. Using single-stranded DNA TGW6-i3g2-100bp-TTA1 (SEQ ID No. 8) as the target nucleic acid, using 5'-/56-FAM/rC rC rC rC rC/3Bio/-3'(rC represents the base Cytosine RNA)) as a single-stranded nucleic acid detector to verify the detection results of Cas12i, Cas12j, Cas12a and Cas12b.

Figure 14. Use single-stranded DNA TGW6-i3g2-100bp-TTA1 (SEQ ID No. 8) as the target nucleic acid, and FAM/TUTUT/3Bio/-3' (where T is DNA and U is RNA) as the single-stranded nucleic acid The detector verifies the detection results of Cas12i, Cas12j, Cas12a and Cas12b.

Figure 15. Use single-stranded DNA TGW6-i3g2-100bp-TTA1 (SEQ ID No. 8) as the target nucleic acid, and FAM/UTUTU/3Bio/-3' (where T is DNA and U is RNA) as the single-stranded nucleic acid The detector verifies the detection results of Cas12i, Cas12j, Cas12a and Cas12b.

Figure 16. Using single-stranded DNA TGW6-i3g2-100bp-TTA1 (SEQ ID No. 8) as the target nucleic acid, using FAM/A rA A rA A/3Bio/-3' (A represents DNA with adenine base, rA represents RNA whose base is adenine)) as a single-stranded nucleic acid detector to verify the detection results of Cas12i, Cas12j, Cas12a and Cas12b.

Figure 17. When using sgRNA1, sgRNA2, or sgRNA3 as gRNA, and verifying that the sample is ssDNA (single-stranded DNA) or ssRNA (single-stranded RNA), the bypass cleavage (trans cleavage) activity of Cas12i, the experimental results show that the sample is ssDNA Either ssRNA can detect the fluorescent signal.

Implementation

The present invention will be further explained below in conjunction with the embodiments. The following descriptions are only preferred embodiments of the present invention, and are not intended to limit the present invention in other forms. Anyone familiar with the profession may use the technical content disclosed above. Change to an equivalent embodiment with the same change. Any simple modification or equivalent change made to the following embodiments based on the technical essence of the present invention without departing from the content of the solution of the present invention shall fall within the protection scope of the present invention.

The technical solution of the present invention is based on the following principles to obtain the nucleic acid of the sample to be tested. For example, the target nucleic acid can be obtained by an amplification method, and the gRNA that can be paired with the target nucleic acid is used to guide the Cas protein to recognize and bind to the target nucleic acid; subsequently, the Cas protein Stimulate the cleavage activity of single-stranded DNA, single-stranded RNA or single-stranded DNA-RNA hybrid, thereby cutting the single-stranded nucleic acid detector in the system; the two ends of the single-stranded nucleic acid detector are respectively equipped with fluorescent groups and quenching groups, If the single-stranded nucleic acid detector is cleaved, fluorescence will be excited; in other embodiments, the two ends of the single-stranded nucleic acid detector may also be provided with labels that can be detected by colloidal gold.

Example 1. Using Cas12i to use single-stranded DNA as a single-stranded nucleic acid detector

PCR amplification of rice Os06g0623700 gene, primer design is as follows:

TGW6-i3g2-F3: CCAGACCGAGAGCAAATG (SEQ ID NO.18);

WSDT18-R: AGCTTCCCACCAGCACTAAC (SEQ ID NO.19);

The PCR product is purified and recovered as the target nucleic acid sequence, and the amplified target nucleic acid sequence is shown in SEQ ID No. 1;

Using Cas12i protein, its amino acid sequence is shown in SEQ ID No. 2;

Looking for the target sequence of gRNA for the above-mentioned target nucleic acid sequence, the designed gRNA sequence is shown in SEQ ID No. 3;

Single-stranded DNA is used as the Reporter (single-stranded nucleic acid detector), and its sequence is: 5'6-FAM-TTTTT-3'BHQ1, and the detection is carried out by means of a fluorescent report.

In this embodiment, the final concentration of Cas12i in the system is 50 nM, the final concentration of gRNA is 50 nM, the concentration of dsDNA (target nucleic acid) is 14.8 nM, and the final concentration of Reporter is 200 nM.

As shown in Figure 1, using single-stranded DNA as the Reporter, Cas12i can show cleavage activity against the Reporter. Compared with the control without target nucleic acid, it can quickly report fluorescence. In Figure 1, ① is the experimental result of adding target nucleic acid, ② is the control group without adding target nucleic acid.

Example 2: Using Cas12j to use single-stranded DNA as a single-stranded nucleic acid detector

Using the target nucleic acid, gRNA, and Reporter of Example 1, using the Cas12j protein, the amino acid sequence is shown in SEQ ID No. 4; the dosage and concentration of Cas12j, target nucleic acid, gRNA, and Reporter are 50 nM, 14.8 nM, 50 nM, and 200 nM, respectively.

The results are shown in Figure 2. Using single-stranded DNA as the Reporter, Cas12j can show cleavage activity against the Reporter. Compared with the control without target nucleic acid, it can quickly report fluorescence. In Figure 2, ① is the experimental result of adding target nucleic acid, ② is the control group without adding target nucleic acid.

Example 3. Using Cas12i and Cas12j to use different single-stranded DNA as single-stranded nucleic acid detectors

In this embodiment, single-stranded DNA is used as the target nucleic acid, and single-stranded DNA is used as the single-stranded nucleic acid detector.

Among them, the target nucleic acid single-stranded DNA sequence for Cas12i is TGW6-i3g2-100bp-TTA1 (SEQ ID No. 8); the gRNA sequence for Cas12i is DRi3-gOsTGW6-2 (SEQ ID No. 9).

The target nucleic acid single-stranded DNA sequence for Cas12j is Cas12j19-g3-ATG-R (SEQ ID No. 10); the gRNA sequence for Cas12j is DR12j19gOsTGW6-3 (SEQ ID No. 11).

The designed single-stranded DNA detector sequence is as follows (5’-3’):

Reporter-A: 5’6-FAM-AAAAA-3’BHQ1;

Reporter-T: 5’6-FAM-TTTTT-3’BHQ1;

Reporter-C: 5’6-FAM-CCCCC-3’BHQ1;

Reporter-FB: 5'6-FAM/TTATT/3'BHQ1.

In the system, the final concentration of Cas12i or Cas12j is 250nM, the final concentration of target nucleic acid is 25nM, the final concentration of gRNA is 25nM, and the final concentration of single-stranded DNA detector is 200nM.

As shown in Figure 3, using different single-stranded DNA as detectors, Cas12i can all show cleavage activity against Reporter, and can quickly report fluorescence compared with the control without target nucleic acid.

In Figure 3:

①、Cas12i+Reporter-A+target nucleic acid

②, Cas12i+Reporter-T+ target nucleic acid

③、Cas12i+Reporter-C+target nucleic acid

④ Cas12i+Reporter-FB+ target nucleic acid

⑤, Cas12i+H ₂ O control group

As shown in Figure 4, using different single-stranded DNA as detectors, Cas12j can all show cleavage activity against Reporter. Compared with the control without target nucleic acid, it can quickly report fluorescence.

In Figure 4:

①、Cas12j+Reporter-A+target nucleic acid

②、Cas12j+Reporter-T+target nucleic acid

③、Cas12j+Reporter-C+target nucleic acid

④ Cas12j+Reporter-FB+ target nucleic acid

⑤, Cas12j+H ₂ O control group

Example 4. Using Cas12i and Cas12j to use single-stranded RNA as a single-stranded nucleic acid detector

Single-stranded DNA (ssDNA) is used as the target nucleic acid, and single-stranded RNA is used as a single-stranded nucleic acid detector to verify the activity of Cas12i and Cas12j.

The final concentration of target nucleic acid ssDNA is 5nM, the final concentration of Cas12i and Cas12j is 50nM, the final concentration of gRNA is 50nM, and the concentration of Reporter-FQ-U is 200nM. It is verified that Cas12i and Cas12j are using single-stranded RNA as a single-stranded nucleic acid detector. test.

The sequence of Reporter-FQ-U is 5’6-FAM-UUUUU-3’BHQ1;

The gRNA for Cas12i is DRi3-gOsTGW6-2 (SEQ ID No. 9);

The gRNA for Cas12j is DR12j19-gOsTGW6-3 (SEQ ID No.11);

The target nucleic acid ssDNA for Cas12i is: Cas12i3-g2-ssDNA0 (SEQ ID No. 12):

The target nucleic acid ssDNA for Cas12j is: Cas12j19-g3-ssDNA0 (SEQ ID No. 13):

As shown in Figure 5, using single-stranded RNA as a detector, Cas12i and Cas12j can show cleavage activity against Reporter, and can quickly report fluorescence compared with the control without target nucleic acid.

In Figure 5, the results represented by the different lines are as follows:

①、Cas12i does not add Reporter-FQ-U control group

②、Cas12i+H ₂ O+Reporter-FQ-U (no target nucleic acid added)

③、Cas12i+Cas12i3-g2-ssDNA0+Reporter-FQ-U

④, Cas12j does not add Reporter-FQ-U control group

⑤、Cas12j+H ₂ O+Reporter-FQ-U (no target nucleic acid added)

⑥、Cas12j+Cas12j19-g3-ssDNA0+Reporter-FQ-U

Example 5: Detection of SARS-CoV-2 using lateral flow test strips

LAMP was used to amplify the orf1ab gene fragment of SARS-CoV-2, where the LAMP primers were designed as follows:

orf1ab-A-B3: agtctgaacaactggtgtaag (SEQ ID NO.20);

orf1ab-A-BIP: tcaacctgaagaagagcaagaactgattgtcctcactgcc (SEQ ID NO.21);

orf1ab-A-F3: tccagatgaggatgaagaaga (SEQ ID NO.22);

orf1ab-A-FIP: agagcagcagaagtggcacaggtgattgtgaagaagaagag (SEQ ID NO.23);

orf1ab-A-LB: acaaactgttggtcaacaagac (SEQ ID NO.24);

orf1ab-A-LF: ctcatattgagttgatggctca (SEQ ID NO.25);

Taking the LAMP product as the target nucleic acid, using the Cas12i protein of Example 1, gRNA: AGAGAAUGUGUGCAUAGUCACACCCAAGGUAAACCUUUGGAAUUUGG (SEQ ID NO.26); using the single-stranded nucleic acid detector 5'-/56-FAM/TTTTT/3Bio/-3' as the Reporter, It is detected by means of lateral flow test strips. The detection line of the test strip is marked with streptavidin that can bind to Bio, and the control line is marked with an antibody that can bind to a colloidal gold-labeled antibody, and the gold-labeled antibody can bind to FAM.

In the reaction system used: the final concentration of Cas12i is 50nM, the final concentration of gRNA is 50nM, the LAMP product is 1ul, and the reporter concentration is 500nM.

The results are shown in Fig. 6, using test strips to detect when Cas12i targets the target nucleic acid and cutting the Reporter, the coloring of the control line is more obvious than that of the control group.

The samples in the reaction system detected by the test strip in Figure 6 from left to right 1-2 are shown in the following table:

serial number	1	2
Cas12i	+	+
Target nucleic acid	-	+
Reporter	+	+

Example 6, Cas12i can use double-stranded target nucleic acid to cut single-stranded RNA

In this embodiment, double-stranded DNA (dsDNA) is used as the target nucleic acid, and single-stranded RNA is used as a single-stranded nucleic acid detector to verify the detection activity of Cas12i.

LAMP was used to amplify the orf1ab gene fragment of SARS-CoV-2, where the LAMP primers were designed as follows:

orf1ab-A-B3: agtctgaacaactggtgtaag (SEQ ID NO.27);

orf1ab-A-BIP: tcaacctgaagaagagcaagaactgattgtcctcactgcc (SEQ ID NO.28);

orf1ab-A-F3: tccagatgaggatgaagaaga (SEQ ID NO.29);

orf1ab-A-FIP: agagcagcagaagtggcacaggtgattgtgaagaagaagag (SEQ ID NO.30);

orf1ab-A-LB: acaaactgttggtcaacaagac (SEQ ID NO.31);

orf1ab-A-LF: ctcatattgagttgatggctca (SEQ ID NO.32);

With LAMP product as the target nucleic acid, the gRNA sequence is as follows:

AGAGAAUGUGUGCAUAGUCACACCCAAGGUAAACCUUUGGAAUUUGG(SEQ ID NO.33);

The sequence of Reporter-FQ-U is 5’6-FAM-UUUUU-3’BHQ1;

The final concentration of Cas12i is 50nM, the final concentration of gRNA is 50nM, and the final concentration of Reporter-FQ-U is 200nM; as shown in Figure 7, double-stranded DNA is used as the target nucleic acid, and Cas12i is used to quickly report fluorescence using single-stranded RNA. In Figure 7, ① is Cas12i+H ₂ O+Reporter-FQ-U, and ② is Cas12i+LAMP+Reporter-FQ-U.

Example 7. Cas12j can use double-stranded target nucleic acid to cut single-stranded RNA

Using the PCR product for OsTGW6, the final concentration of gRNA (shown in SEQ ID No.11) is 50nM, the concentration of Cas12j is 50nM, and the final concentration of gRNA is 50nM, Reporter-FB-U(5'6-FAM-UUUUU-3'BHQ1) At a final concentration of 200 nM, the detection activity of Cas12j was verified.

As shown in Figure 8, the use of double-stranded DNA as the target nucleic acid and the use of Cas12j to use single-stranded RNA can quickly report fluorescence. In Figure 8, ① is Cas12j+H ₂ O+Reporter-FB-U, and ② is Cas12j+target nucleic acid+Reporter-FB-U.

Example 8. The results of using other Cas proteins to cut different single-stranded nucleic acid detectors with different target nucleic acids

In the present invention, it is also verified that when Cas12i and Cas12j use different single-stranded nucleic acids or double-stranded nucleic acids as target nucleic acids, different single-stranded RNA detectors (for example, 5'-/56-FAM/rA rA rA rA rA/ 3Bio/-3'(rA represents RNA whose base is adenine), 5'-/56-FAM/rC rC rC rC/3Bio/-3'(rC represents RNA whose base is cytosine)), or Single-stranded DNA-RNA hybrid detector (for example, FAM/TUTUT/3Bio/-3' (where T is DNA and U is RNA), FAM/UTUTU/3Bio/-3' (where T is DNA, U Is RNA), FAM/A rA A rA A/3Bio/-3' (A means DNA with adenine base, rA means RNA with adenine base)), compared with the control group, Cas12i and Cas12j In the use of different single-stranded RNA detectors, or single-stranded DNA-RNA hybrid detectors, fluorescence can be reported quickly.

In addition, the present invention also verifies the effect of Cas12a, Cas12b, and Cas13a using different single-stranded nucleic acid detectors when targeting different target nucleic acids. Among them, the amino acid sequence of Cas12a is shown in SEQ ID No. 5, and Cas12b is shown in SEQ ID No. 5. The amino acid sequence is shown in SEQ ID No. 6, and the Cas13a amino acid sequence is shown in SEQ ID No. 7. The experimental design adopted is as follows:

The sequence of the above TGW6-i3g2-100bp-TTA1 is shown in SEQ ID No. 8;

The sequence of the above Cas12i3-g2-ssDNA0 is shown in SEQ ID No. 12;

The sequence of the above OsTGW6 is shown in SEQ ID No. 1;

The sequence of the aforementioned LbCas12a-TGW6-g1 is as follows (SEQ ID No. 14):

UAAUUUCUACUAAGUGUAGAUUUUCACCGACAGCAGCAUGA;

The sequence of the above AaCas12b-TGW6-g1 is as follows (SEQ ID No. 15):

The sequence of the above RNA (TGW6-100bp-TTA1) is as follows (SEQ ID No. 16):

The sequence of the above Cas13a-gRNA is as follows (SEQ ID No. 17):

The above-mentioned single-stranded RNA detector includes 5'-/56-FAM/UUUUU/3Bio/-3', 5'-/56-FAM/rArArArArA/3Bio/-3' (rA represents RNA whose base is adenine), 5'-/56-FAM/rCrCrCrC rC/3Bio/-3' (rC represents RNA whose base is cytosine);

The aforementioned single-stranded DNA-RNA hybrid detector includes FAM/TUTUT/3Bio/-3' (where T is DNA and U is RNA), FAM/UTUTU/3Bio/-3' (where T is DNA, U is RNA), FAM/A rA A rA A/3Bio/-3' (A represents DNA with adenine base, rA represents RNA with adenine base);

The aforementioned single-stranded DNA detectors include Reporter-A: 5'6-FAM-AAAAA-3'BHQ1; Reporter-T: 5'6-FAM-TTTTT-3'BHQ1; Reporter-C: 5'6-FAM-CCCCC -3'BHQ1; Reporter-FB: 5'6-FAM/TTATT/3'BHQ1.

Using Cas12a, single-stranded DNA Cas12i3-g2-ssDNA0 as the target nucleic acid, and LbCas12a-TGW6-g1 as the gRNA, select the single-stranded RNA detector 5'-/56-FAM/UUUUU/3Bio/-3'; as shown in Figure 9 As shown, compared with the control group, Cas12a can quickly report fluorescence for the single-stranded RNA detector; in Figure 9, ① is Cas12a+H ₂ O+Reporter, ② is Cas12a+target nucleic acid+Reporter.

Using Cas12b, single-stranded DNA Cas12i3-g2-ssDNA0 as the target nucleic acid, and AaCas12b-TGW6-g1 as the gRNA, select the single-stranded RNA detector 5'-/56-FAM/UUUUU/3Bio/-3'; as shown in Figure 10 As shown, compared with the control group, Cas12b can quickly report fluorescence for the single-stranded RNA detector; in Figure 10, ① is Cas12b+H ₂ O+Reporter, ② is Cas12b+target nucleic acid+Reporter.

As shown in Figure 11, the single-stranded DNA TGW6-i3g2-100bp-TTA1 (SEQ ID No. 8) is used as the target nucleic acid, and 5'6-FAM-UUUUU-3'BHQ1 is used as the single-stranded nucleic acid detector, ①Cas12i, ②Cas12j , ③Cas12a and ④Cas12b can report the fluorescence quickly, ⑤-⑧ is the blank control.

As shown in Figure 12, the single-stranded DNA TGW6-i3g2-100bp-TTA1 (SEQ ID No. 8) is used as the target nucleic acid, and 5'-/56-FAM/rA rA rA rA rA/3Bio/-3'(rA It means that the base is adenine RNA) as a single-stranded nucleic acid detector, ①Cas12i, ②Cas12j, ③Cas12a and ④Cas12b can quickly report fluorescence, and ⑤-⑧ is a blank control.

As shown in Figure 13, the single-stranded DNA TGW6-i3g2-100bp-TTA1 (SEQ ID No. 8) is used as the target nucleic acid, and 5'-/56-FAM/rC rC rC rC rC/3Bio/-3'(rC Represents the RNA whose base is cytosine)) as a single-stranded nucleic acid detector, ①Cas12i, ②Cas12j, ③Cas12a, and ④Cas12b can quickly report fluorescence, and ⑤-⑧ is a blank control.

As shown in Figure 14, the single-stranded DNA TGW6-i3g2-100bp-TTA1 (SEQ ID No. 8) is used as the target nucleic acid, and FAM/TUTUT/3Bio/-3' (where T is DNA and U is RNA) is used as the target nucleic acid. Single-stranded nucleic acid detectors, ①Cas12i, ②Cas12j, ③Cas12a and ④Cas12b can quickly report fluorescence, and ⑤-⑧ are blank controls.

As shown in Figure 15, single-stranded DNA TGW6-i3g2-100bp-TTA1 (SEQ ID No. 8) is used as the target nucleic acid, and FAM/UTUTU/3Bio/-3' (where T is DNA and U is RNA) is used as the target nucleic acid. Single-stranded nucleic acid detectors, ①Cas12i, ②Cas12j, ③Cas12a and ④Cas12b can quickly report fluorescence, and ⑤-⑧ are blank controls.

As shown in Figure 16, the single-stranded DNA TGW6-i3g2-100bp-TTA1 (SEQ ID No. 8) is used as the target nucleic acid, and FAM/A rA A rA A/3Bio/-3' (A represents the base is adenine ①Cas12i, ②Cas12j, ③Cas12a and ④Cas12b can quickly report fluorescence, and ⑤-⑧ is a blank control.

In addition, when Cas12a and Cas12b use other single-stranded nucleic acids or double-stranded nucleic acids as target nucleic acids, they can quickly report fluorescence for different single-stranded RNA detectors or single-stranded DNA-RNA hybrid detectors. When Cas13a uses RNA as the target nucleic acid, it can report fluorescence for different single-stranded DNA detectors or single-stranded DNA-RNA hybrid detectors.

Example 9. Cas12i performs nucleic acid detection when the target nucleic acid is RNA

The sequences of the gRNA and the sample to be tested used in this embodiment are shown in the following table, where the bold part in the gRNA is the guide sequence, which can hybridize with the sample to guide the binding of the Cas protein to the sample.

Add Cas12i (Cas12i in Example 1), gRNA, target nucleic acid ssDNA (single-stranded DNA) or ssRNA (single-stranded RNA) to the detection system, and a single-stranded nucleic acid detector Reporter (5'-FAM-TTCTT-3') BHQ); the final concentration of Cas12i is 100nM, the final concentration of gRNA is 50nM, and the substrate concentration: the final concentration of ssDNA is 250nM, the final concentration of ssRNA is 250nM, and the final concentration of Reporter is 500nM.

When sgRNA1 is selected for gRNA, the target nucleic acid is ssDNA-1 and ssRNA-1, and a control without target nucleic acid is set; when sgRNA2 is used for gRNA, ssDNA-2 and ssRNA-2 are used for target nucleic acid, and no target is set. Nucleic acid control: When sgRNA3 is selected for gRNA, ssDNA-3 and ssRNA-3 are selected for target nucleic acid, and a control without target nucleic acid is set.

The experimental results are shown in Figure 17. When sgRNA1, sgRNA2, or sgRNA3 are selected as gRNA, no matter whether the target nucleic acid is ssDNA or ssRNA, the fluorescent signal can be detected. This reflects that Cas12i can not only use DNA when performing trans-cutting or in vitro detection. As the target nucleic acid, RNA can also be used as the target nucleic acid.

All documents mentioned in the present invention are cited as references in this application, as if each document was individually cited as a reference. In addition, it should be understood that after reading the above teaching content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims (10)

1. A method for detecting target nucleic acid in a sample, the method comprising contacting the sample with a V-type Cas protein (CRISPR/CAS effector protein), gRNA (guide RNA) and a single-stranded nucleic acid detector, the gRNA comprising contacting the V The region where the type Cas protein binds and the targeting sequence that hybridizes with the target nucleic acid; detects the detectable signal generated by the V-type Cas protein cleavage of the single-stranded nucleic acid detector, thereby detecting the target nucleic acid; the single-stranded nucleic acid detector is selected from single-stranded DNA , Any one or any combination of single-stranded RNA or single-stranded DNA-RNA hybrids, the single-stranded nucleic acid detector does not hybridize with the gRNA;

   The V-type Cas protein is Cas12i and/or Cas12j;

   The Cas12i protein is selected from the following group:

   (1) The protein shown in SEQ ID NO: 2;

   (2) Pass the amino acid sequence shown in SEQ ID NO: 2 through one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues Derivative proteins that are formed by substitution, deletion or addition of, and have basically the same function;

   (3) A protein that has at least 85% sequence identity with the sequence shown in SEQ ID NO: 2 and has trans activity;

   The Cas12j protein is selected from the following group:

   (1) The protein shown in SEQ ID NO: 4;

   (2) Pass the amino acid sequence shown in SEQ ID NO: 4 through one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues Derivative proteins formed by substitution, deletion or addition of, and having basically the same function

   (3) A protein that has at least 85% sequence identity with the sequence shown in SEQ ID NO: 4 and has trans activity.
2. The method according to claim 1, wherein the detectable signal is detected in the following ways: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, colloidal phase change /Dispersion, electrochemical detection and semiconductor-based detection.
3. The method according to claim 1 or 2, wherein the target nucleic acid comprises ribonucleotides or deoxyribonucleotides; preferably, it comprises single-stranded nucleic acid, double-stranded nucleic acid, for example, single-stranded DNA, double-stranded nucleic acid, and double-stranded nucleic acid. Stranded DNA, single-stranded RNA.
4. The method according to any one of claims 1-3, wherein the 5'end and 3'end of the single-stranded nucleic acid detector are respectively provided with different reporter groups, and when the single-stranded nucleic acid detector is cut Later, a detectable report signal can be displayed; or, the 5'end and 3'end of the single-stranded nucleic acid detector are respectively provided with different labeling molecules, and the reaction signal is detected by means of colloidal gold detection.
5. The method according to claim 1, wherein the target nucleic acid is derived from viruses, bacteria, microorganisms, soil, water sources, human bodies, animals, and plants.
6. The method according to claim 1, wherein the target nucleic acid is a product enriched or amplified by PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM and other methods.
7. The method according to claim 1, wherein the target nucleic acid is a viral nucleic acid, a bacterial nucleic acid, a specific nucleic acid related to a disease, or a specific nucleic acid that is different from a control. Preferably, the specific nucleic acid related to a disease is a specific Mutation site or SNP site; preferably, the virus is a plant virus or an animal virus, for example, papilloma virus, liver DNA virus, herpes virus, adenovirus, pox virus, parvovirus, coronavirus; preferably, the virus The virus is a coronavirus, for example, SARS, SARS-CoV2 (COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, Mers-Cov.
8. The method according to claim 1, wherein the single-stranded nucleic acid detector further comprises a modification; the modification is selected from the group consisting of base modification, backbone modification, and sugar modification.
9. A system or composition or kit for detecting target nucleic acid in a sample, said system or composition comprising the V-type Cas protein, gRNA and single-stranded nucleic acid detector according to any one of claims 1-8 .
10. The use of the system or composition or kit of claim 9 in detecting a target nucleic acid in a sample, or in preparing a reagent for detecting a target nucleic acid in a sample.

Images