WO2021234378A1 - Polynucleotide synthesis - Google Patents

Abstract

The invention relates to the production of oligonucleotides and polynucleotides at large scale. In particular, the invention relates to synthesizing polynucleotides from impure nucleotide monomers using a selective or high-fidelity polymerase, thereby avoiding the need for purification of the nucleotides prior to their use. In one aspect, the invention provides an in vitro method of synthesizing DNA from dNTPs using a DNA polymerase, from a reaction mixture comprising dNTPs and one or more impurities from the enzymatic conversion of rNTPs to dNTPs. The synthesized DNA finds particular utility in nucleic acid sequencing, molecular cloning, medical diagnostics, nucleic acid vaccines, self-replicating systems, the assembly of a DNA nanostructure, and biosensors. A kit for synthesizing DNA from impure dNTPs, a method of making dNTPs for use as a reaction mixture for the synthesis of nucleic acid, and a mixture of dNTPs are also provided.

Description

POLYNUCLEOTIDE SYNTHESIS

Field of the Invention

This invention relates to methods, reagents and compositions for producing nucleic acid polymers, uses of those reagents and compositions, methods of making nucleic acid compositions, and kits comprising those reagents or compositions. In particular, the invention provides an in vitro method of polymerising nucleotides from an impure mixture, to form a nucleic acid polymer for a technological application.

Background of the Invention

Nucleotides are the monomeric building blocks of nucleic acid oligomers and polymers, such as DNA and RNA. They find many uses, both in molecular biology applications and more broadly across the life sciences and related disciplines, and are commercially produced at high purity (typically ³98% pure) for these applications. Nucleotides such as deoxyribonucleotide triphosphates (dNTPs) and ribonucleotide triphosphates (rNTPs) can be commercially produced by chemical methods requiring toxic solvents, from which the dNTP yield is approximately 40-80% depending on the chemical process used and the different dNTP components. Alternatively, dNTPs can be enzymatically synthesized without the need for toxic solvents. One enzymatic method is conversion from dNMPs, using enzymes such as adenylate kinase (AMP kinase) and pyruvate kinase (PK) (Whitesides 1985; Bao & Ryu, 2007). Another such method is enzymatic synthesis by conversion from rNTPs using ribonucleotide reductase (“RNR”) to catalyse the formation of deoxyribonucleotides from ribonucleotides by removing the 2'-hydroxyl group of the ribose ring of nucleoside diphosphates (Fairman et al, 2011). The RNR enzyme and its use in dNTP synthesis are also described in Jong et al, 1998 (Journal of Biomedical Science volume 5, pages 62-68), WO-A-2011/123021 and WO-A-2004/057010.

Although some thermophilic DNA polymerases may be able to incorporate dNDPs in some high temperature polymerase reactions (see Burke & Luptak, PNAS January 30, 2018 115 (5) 980-985), and although DNA polymerases that can incorporate rNTPs are known (for example as described by EP-A-0823479), dNTPs are the usual substrate for DNA synthesis.

Polynucleotide synthesis is fundamental to a wide range of biological, medical, diagnostic and engineering technologies. These technologies typically utilise one or more of DNA synthesis, DNA sequencing, cloning (genetic engineering), biosensing, immunology, vaccinology, and self-replicating systems.

One exemplary area where polynucleotide synthesis is used at a large scale is in the design and manufacture of artificial nucleic acid structures for technological uses, often referred to as “nucleic acid nanotechnology”. These nucleic acid structures are typically on the nanometre scale and are referred to as nucleic acid nanostructures, or DNA origami. Nucleotides are the building block of nucleic acid nanostructures. These nanoscale structures of nucleic acids, most often DNA, can act as structural and functional components in synthetic biology. For example, DNA nanostructures can serve as scaffolds for the formation of more complex structures. DNA nanostructures have also been studied as a means to increase the efficiency of chemical reactions, binding several enzymes together to form nanoreactors.

Several techniques have been developed to design nucleic acid nanostructures able to withstand hostile environments, such as those present in a chemical or bio-reactor. Marth et al 2017 (ACS Nano 2017, 11, 5, 5003-5010) “ Precision Templated Botom-Up Multiprotein Nanoassembly through Defined Click Chemistry Linkage to DNA ” describes an approach that allows attachment of single-stranded DNA (ssDNA) to a defined residue in a protein of interest (POI) to provide optimal and well-defined multicomponent assemblies. The authors describe that this approach allows any potential protein to be simply engineered to attach single- stranded DNA or related biomolecules, creating conjugates for designed and highly precise multiprotein nanoscale assembly with tailored functionality.

DNA nanoreactors have been built in several shapes and forms, mostly incorporating a cascade of glucose oxidase (GOx) and horseradish peroxidase (HRP) enzymes, with different levels of catalytic enhancement. Such studies have focused primarily on optimising the proximity of enzymes in cascades. Co-localising enzymes with different techniques has led to up to a 33-fold increase in catalytic efficiency (You et al. 2012). Fu et al 2012 (J. Am. Chem. Soc. 2012, 134, 12, 5516-5519) “Interenzyme substrate diffusion for an enzyme cascade organized on spatially addressable DNA nanostructures ” describes spatially addressable DNA nanostructures that facilitate the self-assembly of heterogeneous elements with precisely controlled patterns. Discrete glucose oxidase (GOx) / horseradish peroxidase (HRP) enzyme pairs were organised on specific DNA origami tiles with controlled interenzyme spacing and position.

There remains a need to improve and optimise nucleic acid nanostructure production in a scalable, economical and efficient manner suitable for commercial applications. More broadly, there remains an overarching need for efficiently-produced and cost-effective materials for polynucleotide synthesis, for use in the many technologies in which polynucleotide synthesis is utilised.

Summary of the Invention

The present inventors have explored strategies for producing oligonucleotides and polynucleotides at large scale. In doing so, the inventors identified a serious problem because the cost of producing or procuring nucleotide monomers is prohibitive, in particular (but not only) at the large scale needed for the industrial production of polynucleotide nanostructures. The inventors have solved this problem by the unexpected realisation that synthesizing polynucleotides from impure nucleotide monomers, typically using a selective or high-fidelity polymerase, reduces the cost of nucleotides very significantly (typically > 100-fold) by avoiding the need for expensive purification (typically by HPLC) of the nucleotides prior to their use. Using impure dNTPs also decreases the production time by eliminating the purification step and provides higher amounts of nucleotides by mitigating losses in purification. This surprising finding has broad and significant applications across all technologies that involve DNA synthesis.

The invention generally relates to the provision of an impure dNTP source for DNA synthesis. This impure dNTP source will typically comprise a mixture of dNTP precursors and dNTPs, usually a mixture of rNTPs and dNTPs, for the purpose of synthesizing DNA for commercial, medical, diagnostic, technological or industrial purposes. Particular advantages arise when the DNA is required to be synthesized in large amounts, for example as is required when building DNA nanostructures or in other bio-engineering applications. In such large-scale applications, hundreds of grams or kilograms of dNTPS can be required. Other applications such as diagnostics will use much less in any one reaction (e.g., pg of dNTPs in a single polymerase chain reaction (PCR)), but many thousands of reactions take place every day so the combined scale is also very large. For example, worldwide demand for millions of Covid- 19 RT-qPCR tests each day in early 2020 requires a significant multi-gram scale availability of dNTPs. The savings and efficiencies made possible by the present invention across the diagnostics industry are therefore significant.

A first aspect of the invention provides an in vitro method of synthesizing DNA from dNTPs using a DNA polymerase, from a reaction mixture comprising dNTPs and one or more impurities from the enzymatic conversion of rNTPs to dNTPs.

The dNTPs typically form between 1% and 99.9% of the total NTPs in the reaction mixture, for example between 10% and 99% of the total NTPs, between 20% and 95% of the total NTPs, less than 95% of the total NTPs, less than 90% of the total NTPs, less than 80% of the total NTPs, or between 40% and 80% of the total NTPs. In some embodiments, the dNTPs form between 90% and 99% of the total NTPs in the reaction mixture. In some embodiments, the dNTPs form less than 98.5% of the total NTPs in the reaction mixture.

In some embodiments, 1, 2, 3 or 4 of the dNTPs in the reaction mixture are the product of the enzymatic conversion of precursors to dNTPs. In some embodiments, 1, 2, or 3 of dATP, dGTP and dCTP are the product of enzymatic conversion. The conversion reaction is typically incomplete, such that some precursors remain in the reaction mixture. Typically, the dNTPs provided as the reaction mixture for DNA synthesis are the direct product of the enzymatic conversion that have not been further processed or purified. In some embodiments, the dNTPs have not been processed or purified to remove non-dNTP contaminants. The usual purification step is by HPLC, so typically 1 , 2, 3, or 4 of the dNTPs have been prepared by a process that does not involve a HPLC purification step. Typical contaminants that may be present include rNTPs, nucleotide monophosphates or diphosphates (e.g. rNMPs, rNDPs, dNMPs, dNDPs), nucleotide tetraphosphates and pyrophosphates that may interfere with DNA synthesis, trace amounts of other enzymes (nucleases, proteases) or DNA from the enzymatic conversion of rNTPs to dNTPs.

The enzymatic production of dNTPs is known in the art, for example as described in US6087132 (Vasiloiu) and FR2779446A1 (Baillon et al.).

Different enzymatic conversion reactions can be used to generate the dNTPs, and each dNTP can be generated by a different reaction. In some embodiments, dNTPs are generated from rNTPs. In some embodiments, dNTPs are generated from monophosphate or diphosphate precursors. In some embodiments the enzymatic conversion reaction provides a mix of all four nucleotides, while in other embodiments any subset of the four nucleotides (dATP, dGTP, dCTP, dTTP) can be provided. For example, unpurified dCTP and rCTP without ATP, GTP, TTP. In some embodiments, an ‘effector’ nucleotide is present that is required to change the substrate specificity of enzymes used to synthesise dNTPs, in this case for dCTP synthesis ATP needs to be present.

The conversion of rNTPs to dNTPs is typically carried out by a ribonucleotide reductase enzyme (RNR) and/or nucleotide kinases. In some embodiments, 1, 2, or 3 of dATP, dGTP and dCTP are the product of enzymatic conversion by ribonucleotide reductase and/or nucleotide kinases. The enzymatic conversion of rNTPs to dNTPs is typically incomplete and less than 100% conversion occurs. In some embodiments, at least 2%, at least 5%, at least 10%, at least 20%, at least 40%, at least 60% or at least 90% of the rNTPs are converted to dNTPs. In some embodiments, between 0.1% and 10% of the rNTPs, are not converted and remain in the mixture.

Typically, dTTP is converted by thymidylate kinase from a dTMP (deoxythymidine monophosphate) or dTDP (deoxythymidine diphosphate) precursor, while dTMP is converted by thymidylate synthase from a rUTP (thymidine monophosphate) precursor.

The DNA synthesis reaction mixture may therefore also comprise monophosphate or diphosphate precursors. This is a typical embodiment for dTTP, because dTMP or dTDP can remain after incomplete phosphorylation of these precursors in the production of dTTP. In some embodiments, the dTTP forms between 90% and 99% of the total dTPs in the reaction mixture, or between 20% and 95%, or less than 99%, or less than 90%. The DNA synthesis reaction mixture typically comprises one or more other non-dNTP agents or contaminants.

One example of a non-dNTP agent is a ribonucleotide reductase. Other contaminants can include one or more of dNMPs, rNTPs, rNDPs, rNMPs. Other contaminants can include dNDPs (undesired, as can be incorporated by polymerases during DNA synthesis but at a slower rate than dNTPs, e.g., Burke et al 2018 in PNAS), deoxyribonucleotide tetraphosphate (a PCR inhibitor), pyrophosphate (a PCR inhibitor, at high concentrations can drive the reverse reaction of DNA synthesis where a polymerase excises nucleotides to form dNTPs), dideoxynucleotide triphosphate (ddNTP, a DNA synthesis inhibitor, which after incorporation into a DNA strand cannot be further extended by lacking a 3’-OH), trace contaminants such as metal ions that might affect enzyme activity or DNA stability, and/or trace macromolecules such as DNA, protease and nuclease from RNR reaction might cause off-target amplification or sample degradation.

In some embodiments, at least 1%, at least 5%, at least 10%, at least 20%, between 20% and 40%, or at least 50% of the dNTPs in the reaction mixture are polymerised into DNA.

The DNA polymerase used in the method of DNA synthesis may be a DNA-dependent DNA polymerase or an RNA-dependent DNA polymerase.

Typically, the DNA polymerase is a high fidelity polymerase or a selective polymerase.

The fidelity of a DNA polymerase refers to its ability to replicate a template accurately. A critical aspect of this is the ability of the DNA polymerase to read a template strand, select the appropriate nucleoside triphosphate and insert the correct nucleotide at the 3' primer terminus, such that canonical Watson-Crick base pairing is maintained. The rate of misincorporation (incorporating the incorrect nucleotide) is known as the polymerase's "error rate". In addition to effective discrimination for correct over incorrect nucleotide incorporation, some DNA polymerases possess a 3'®5' exonuclease activity. This activity, also termed "proofreading", is used to excise incorrectly incorporated mononucleotides that are then replaced with the correct nucleotide. High-fidelity PCR utilizes DNA polymerases with low misincorporation rates, typically that couple low misincorporation rates with proofreading activity to give faithful replication of the DNA target of interest.

A “High fidelity polymerase” is a polymerase that can discriminate between rNTPs and dNTPs to a degree sufficient to enable the particular application, as discussed in detail herein. In some embodiments, the high-fidelity polymerase has an error rate of less than 1 in 7500 base pairs incorporated. Selecting the appropriate high-fidelity polymerase for the application will be apparent to the skilled person based on the detailed discussion provided herein. In some embodiments, the polymerase has an error rate of less than 1 in 7500 and a preference of at least 100,000 fold for dNTP over rNTP. In certain embodiments, the DNA polymerase is a strand-displacing DNA polymerase, a F29 polymerase, a Bacillus stearothermophilus DNA polymerase or a large (Klenow) fragment of DNA polymerase I. In some embodiments, the DNA polymerase is a Taq ( Thermus aquaticus ) DNA polymerase.

The selectivity of a polymerase is its ability to incorporate a dNTP in preference to an rNTP.

Some DNA polymerases can discriminate between dNTPs and rNTPs. Polymerases that can discriminate between dNTPs and rNTPs and/or have a higher selectivity for them may advantageously be used according to the invention. The inventors have found that it is possible to by-pass the purification step and streamline the production of dNTPs and their use as substrates for DNA synthesis. For example, the NTP mixture comprising dNTPs and rNTPs can be produced and directly used as the reaction mixture for a rolling circle amplification reaction.

Importantly, whether or not a polymerase with high fidelity or selectivity is required for the amplification of nucleic acid from impure dNTPs will depend on the details of the application. For example, during qPCR to detect a pathogen, the outcome of the test typically depends on the incorporation of a fluorescent group (either a small-molecule dye or fluorescently modified primer) in the accumulating nucleic acid, and this function may be largely unaffected by whether that nucleic acid contains rNTP or dNTP. In contrast, during the use of unpurified RCA product as a vaccine, the incorporation of rNTP or dNTP may alter the immune response generated by the RCA product.

The in vitro method of synthesizing DNA can employ any method of synthesizing DNA. Suitable techniques include rolling circle amplification, strand displacement amplification, or polymerase chain reaction, or variations of these approaches to DNA amplification. It is possible to amplify nucleic acid by performing reverse transcription to produce DNA from an RNA template, or to use two polymerases where one produces RNA from DNA and the other produces DNA from RNA to produce an exponential amplification. The template molecule for any of these techniques can be natural or synthetic nucleic acids, such as DNA or RNA.

The DNA that is synthesized according to the method can be used in any suitable technique that requires DNA synthesis. This includes, but is not limited to, nucleic acid sequencing, molecular cloning, diagnostics, medical diagnostics, veterinary diagnostics, nucleic acid vaccines, self-replicating systems, the assembly of a DNA nanostructure, in a biosensor, or in protein or metabolic engineering.

A biosensor for pathogen detection may involve quantitative polymerase chain reaction (qPCR) or quantitative loop-mediated isothermal amplification (qLAMP) amplifying nucleic acid of a pathogen. Cloning may involve PCR of plasmid DNA, genomic DNA, cellular RNA, or nucleic acids produced by solid-phase synthesis for controlling gene expression. Sequencing may involve PCR of an environmental or human sample to obtain enough nucleic acid for sequencing. Protein or metabolic engineering may involve deliberately mutating regions of a protein during PCR by introducing new sequences in the primers used to amplify DNA.

A nucleic acid produced by rolling circle amplification (RCA) can be used for DNA sequencing. Such RCA amplified nucleic acids made from impure dNTPs according to the invention can also be used in other applications including for sensing, cloning, for use as a vaccine. The enzymatic synthesis of nucleic acid by RCA is known in the art, for example as described in WO1994005797A1, W02000015779A2, US5714320A, W02002057487A2,

W02005030983A2, W02006119066A2, W02010086626A1, US9125845,

W02015079042A1, W02012017210A1, WO2016132129A1 , WO2016034849A1.

When the DNA that is synthesized is in turn used in the assembly of nucleic acid nanostructures, then the method may comprise the step of attaching one or more functional molecules to the nanostructure. At least one functional molecule can be a protein, for example an enzyme. In another embodiment, the nucleic acid nanostructure may comprise or consist of nucleic acid origami, nucleic acid bricks, nucleic acid crystal or nucleic acid hydrogel, or a hybrid thereof. The nucleic acid nanostructure may comprise a single functional molecule, between 1 and about 100,000 functional molecules, between about 1 and about 50,000 functional molecules, between about 1 and about 25,000 molecules, or between about 1 and about 10,000 molecules.

The nanostructure may be modified during or after its synthesis to comprise one or more functional molecules (e.g. enzymes) attached to the nanostructure. In some embodiments, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different functional molecules, e.g. enzymes forming a reaction pathway, are attached to the nanostructure.

The functional molecule may be attached to the nanostructure by a linker, which may be a flexible or rigid oligonucleotide linker, or which may be a chemical linker. A flexible oligonucleotide linker may be a single stranded DNA linker. A rigid oligonucleotide linker may be a double-stranded DNA linker. In certain embodiments the oligonucleotide linker may be at least ten nucleotides long or at least 20 nucleotides long. For example, the oligonucleotide linker may comprise 10 or more, 15 or more, or 20 or more nucleotides. In other embodiments, one or more functional molecules can be attached to the nanostructure by: non-specific affinity between nucleic acid and protein, optionally selected from charge, hydrophobicity and hydrogen-bonding; specific affinity between nucleic acid and protein, optionally an aptamer, antibody or DNA-protein recognition domain; a covalent bond between DNA and protein, optionally a chemical linker or enzymatic conjugation of DNA and proteins; or inclusion of any number and any length of single-stranded nucleic acid to which a DNA-enzyme conjugate hybridises at any distance from, location on, or orientation on the nanostructure.

In some embodiments 1 , 2, 3, 4, 5 or more species of functional molecule are provided on the nanostructure. Each species of functional molecule may be present in multiple copies, for example 10 or more, 50 or more or 100 or more of the same species of functional molecule. In some embodiments, the nanostructure comprises between about 1 and about 100,000 functional molecules, between about 1 and about 50,000 functional molecules, between 1 and about 25,000 molecules, or between about 1 and about 10,000 molecules.

In one embodiment, the nucleic acid amplification reaction can be used as a DNA sensor.

In another embodiment, the nucleic acid synthesis is part of a method of sequencing-by- synthesis.

The Examples below describe and test many applications for the dNTPs of the invention, including Rolling Circle Amplification (RCA) with impure dNTPs, Polymerase Chain Reaction (PCR) with impure dNTPs, Linear amplification (e.g. using a Bst polymerase) with impure dNTPs, RCA biosensor (e.g. with F29 polymerase) with impure dNTPs, RCA with different read-outs to confirm synthesis and purity (LC-MS), RCA with different dNTP sources, RCA at scale with impure dNTPs, Synthesis of DNA nanostructures with impure dNTPs, RCA for cell- free protein expression with impure dNTPs, PCR with DNA templates of different length and sequence with impure dNTPs, and qPCR of DNA templates with impure dNTPs.

The Examples further demonstrate the use of impure dNTPs for in vitro diagnostic tests with polymerases other than phi29 and nucleic acid amplification reactions other than RCA, thereby confirming that the utility is not limited to phi29 polymerase and/or RCA. In particular, the Examples demonstrate qPCR (e.g. with Taq polymerase) of DNA templates with pure vs. impure dNTPs at varying dNTP concentrations; qPCR of DNA templates with pure vs. impure dNTPs at varying template concentrations; qPCR of DNA templates with pure vs. three impure dNTPs batches; qPCR of DNA templates with pure vs. impure dNTPs after up to 20 freeze and thaw cycles of dNTPs; qPCR of DNA templates with pure vs. impure dNTPs after incubating dNTPs at 50°C up to 11 days; qPCR of Ebola DNA template with pure vs. impure dNTPs at varying template concentrations; and qLAMP of DNA templates with pure vs. different batches of impure dNTPs.

The Examples also demonstrate that diagnostic qPCR reactions with pure or impure dNTPs, were able to detect 10000 and 1000 copies of the DNA template, and that the qPCR method with impure dNTPs can be transferred to other methods such as qLAMP, while maintaining the same sensitivity. A second aspect of the invention provides DNA obtained or obtainable by the method of the first aspect.

A third aspect of the invention provides a kit for synthesizing DNA, comprising a reaction mixture comprising: an individual impure dNTP selected from dATP, dCTP, dTTP, and dGTP; or a pooled set of 2, 3 or 4 impure dNTPs; or a polymerase and impure dNTPs; or a polymerase, impure dNTPs, buffers and probes required for an amplification reaction.

The kit may also include instructions for use in the method of synthesis and optionally any downstream steps, such as use as a biosensor, use as a diagnostic or use in the assembly of a nanostructure.

In some embodiments of the kit wherein the DNA to be synthesised is a DNA nanostructure, the kit may also comprise one or more functional molecules for attachment to the nanostructure.

A fourth aspect of the invention provides a method of making dNTPs for use as a reaction mixture for the synthesis of nucleic acid, comprising: contacting rNTPs with a ribonuclease reductase under conditions in which the ribonuclease reductase is active and converts a proportion of the rNTPs into dNTPs, wherein less than 100% of the rNTPs are converted to dNTPs.

In some embodiments, less than 90% of the rNTPs are converted to dNTPs, or less than 60% of the rNTPs are converted to dNTPs.

In some embodiments, the method of the fourth aspect is for synthesis of the nucleic acids that can be self-assembled to form a nucleic acid nanostructure. In other embodiments, the method of the fourth aspect is for synthesis that is part of nucleic acid sequencing, molecular cloning, medical diagnostics, nucleic acid vaccines, self-replicating systems, or a biosensor.

A fifth aspect of the invention provides a mixture of dNTPs and rNTPs that is obtained or obtainable from the method of the fourth aspect.

A sixth aspect of the invention provides the use of the mixture of dNTPs and rNTPs according to the fifth aspect, in the synthesis of nucleic acid. In some embodiments the synthesized nucleic acid is made during nucleic acid sequencing, molecular cloning, medical diagnostics, nucleic acid vaccine generation, a self-replicating system, or as part of a biosensor. In other embodiments the synthesized nucleic acid is a nanostructure.

A seventh aspect of the invention provides a qPCR or qLAMP diagnostic assay wherein the DNA synthesis step of the assay is carried out by a method according to claim 1. In some embodiments, the assay diagnoses the presence or absence of a viral infection in a subject, typically a human subject.

Brief Description of the Drawings

Figure 1 shows a scheme for DNA synthesis using rolling circle amplification (RCA) from a circular template DNA produced by ligation of two shorter strands. The RCA product is a repeated sequence, which is cleaved into individual DNA molecules and run on a denaturing PAGE gel. DNA amplification is comparable with pure and impure dNTPs, while the yield of amplification can be estimated by comparison with a set of control product strands.

Figure 2 shows DNA amplification of a 1882bp gene fragment by PCR on agarose gel, comparing the reaction with pure and impure dNTPs, Q5 and Phusion polymerases, and various supplier buffers.

Figure 3 shows the results of PCR amplification of pure and impure dNTPs, with no substantial differences in read length or fidelity observed between pure and impure samples.

Figure 4 shows fluorescence signal traces of qPCRs with varying amounts of pure (Qiagen) and impure dNTPS (FN). Reactions supplied with impure dNTPs look similar in sensitivity. The more pure dNTPs were added to the reaction, the later a qPCR fluorescence signal was observed.

Figure 5 shows no visible differences in the sensitivity 10 - 1000 copies of a Covid DNA template independent of the used dNTPs (pure/impure). Only the reaction with pure dNTPs was able to detect 1 copy.

Figure 6 shows no visible differences between three different batches of impure dNTPs (FN I- III) and pure dNTPs (Qiagen) in regards to their performance in qPCRs. Negative controls did not result in any amplification signal.

Figure 7 shows the viability of dNTPs in qPCRs after up to 20 freeze and thaw cycles. Pure (Qiagen) and impure (FN) dNTPs were compared. No visible differences were observed between pure and impure dNTPs.

Figure 8 shows the viability of dNTP in qPCR after an incubation of up to 11 days at 50 °C. Pure (NEB) and impure (FN) dNTPs were compared. No visible differences were observed between pure and impure dNTPs.

Figure 9 shows the viability of dNTPs for an Ebola DNA template in qPCR. Pure (Qiagen) and impure (FN) dNTPs were compared. No visible differences were observed between pure and impure dNTPs.

Figure 10 shows the viability of impure dNTPs in qLAMP reactions. Pure and impure dNTPs produced only a positive signal when the corresponding template was present. There is a visible difference between batches of the impure dNTPs and pure dNTPs. The pure dNTPs produced an amplification signal in a shorter amount of time. Moreover, a follow up experiment shows that LAMP reactions supplied with pure and impure dNTPs are able to detect 1 to 10000 copies of a DNA template.

Detailed Description of the Invention

The inventors have investigated in vitro DNA amplification as a scalable method to produce DNA nanostructures suitable for enzyme immobilisation. In doing so, they have realised that the provision of dNTPs is a major cost and bottleneck to the development and exploitation of this technology, and prohibits the commercial application of this method. The inventors’ findings apply broadly to all technical areas involving DNA synthesis.

The inventors analysed an impure source of dNTPs that were synthesised by enzymatic conversion of bulk quantities of precursors to dNTPs. HPLC analysis indicated >90% purity and <99% purity in this impure dNTPs source, as opposed to >99% purity in typical ‘pure dNTPs’. In an exemplary tested dNTP set, comprising four separate dNTP preparations used in the Examples, the dATP was present at 98.1%, the dCTP at 95.9%, the dGTP present at 91.0% and the dTTP was present at 92.9%. In certain embodiments therefore, the dNTPs are (or each dNTP is) less than 98.5% pure. Despite this impure dNTP source, the Examples show that effective DNA synthesis was achieved when using it in various DNA synthesis procedures.

Without wishing to be bound by theory, the inventors consider that the impurity in the impure source of dNTPs comprises precursors (typically rNTPs and dNDPs) and/or the conversion enzyme (typically ribonucleotide reductase and/or nucleotide kinases). The invention is based in part on the realisation that the presence of the precursors (e.g. rNTPs) and/or RNR should not interfere with polymerase activity and that the use of such dNTP sources is effective for synthesising large amounts of DNA, for example as required in the field of nucleic acid nanostructures but also as needed in many other applications, when an appropriate DNA polymerase is used.

Some polymerases can incorporate rNTPs in DNA. Kinetic studies have shown that selectivity for insertion of dNTPs into DNA rather than rNTPs varies from 10-fold to >10⁶-fold, depending on the polymerase and the dNTP/rNTP pair examined. rNTP incorporation during DNA synthesis is potentially made more probable by the fact that the concentrations of rNTPs in vivo are higher than are the concentrations of dNTPs. Studies show that polymerases can incorporate rNTPs during DNA synthesis in vivo. Thus by choosing an appropriate polymerase that discriminates between dNTP and rNTP to a degree suitable for the application, an impure source of dNTPs including rNTPs and/or the ribonucleotide reductase enzyme may be used without compromising polymerase activity.

The Examples demonstrate the in vitro amplification of dNTPs present in a composition comprising other non-dNTP components. Therefore, the invention provides the polymerisation of nucleotides at the scale required for the production of a nucleic acid nanostructure, from a source of dNTPs that comprises impurities.

The invention therefore improves methods of producing industrial or commercial scale amounts of oligonucleotides and polynucleotides, for example in the production of nucleic acid nanostructures, by avoiding the need to purify dNTPs prior to their polymerisation. The purification step is typically expensive, commonly comprising HPLC purification. Removing the need for this step therefore dramatically reduces the cost and time taken to produce dNTPs. dNTPs

The invention relates to the provision of dNTP sources that are not perfectly pure, and may even comprise only a minority proportion of dNTPs within the composition.

The invention advantageously uses an impure, or unpurified source of dNTPs upon which the polymerase acts. The NTP source typically comprises the product of an enzymatic conversion of one or more precursors to dNTPs. Typically the precursors are ribonucleotides, but may also be mono- or di-phosphorylated deoxyribonucleotides. In one embodiment, the NTP source comprises the product of the enzymatic conversion of ribonucleotide triphosphates (rNTPs) to deoxyribonucleotide triphosphates (dNTPs) by a ribonucleotide reductase and nucleotide kinases. Bulk quantities of rNTPs are enzymatically converted to dNTPs, and as a result the “unpurified dNTPs” contain both rNTPs and dNTPs. Purification of the product of this reaction is not required prior to polymerisation.

There are two general strategies for synthesising dNTPs - chemical and enzymatic. Chemical methods are low-yielding. Within enzymatic, there are two general pathways: 1) reduction from rNDP to dNDP removing 2’-OH by ribonucleotide reductase (RNR), 2) phosphorylation from dNMP to dNTP adding phosphates by kinases. rNTPs are ~100x more abundant in cells, and thus appear to be the preferred precursor. To convert rNTPs to dNTPs both pathways are occurring simultaneously (phosphatases convert from rNTP -> rNDP, RNR from rNDP-> dNDP, kinases from dNDP->dNTP).

Ribonucleotide reductase converts rNDP to dNTP, while kinases and phosphatases add or remove the phosphates to convert rNDP -> rNTP or vice versa. dTTP is not synthesised by RNR, instead being synthesised from rUTP by thymidylate synthase and kinase enzymes. The impure dNTP sources used in the Examples were typically produced in a method involving conversion from precursors using ribonucleotide reductase (RNR), also known as ribonucleotide diphosphate reductase (rNDP), to catalyse the formation of deoxyribonucleotides from ribonucleotides by removing the 2'-hydroxyl group of the ribose ring of nucleoside diphosphates (Fairman et al, 2011). This reduction produces deoxyribonucleotides (Loeb, 2004). These deoxyribonucleoside diphosphates (dNDPs) thereby provide the dNTP precursors needed for the synthesis of DNA.

Human RNR contains regulatory hRRM1 and catalytic hRRM2 subunits. The substrates for RNR are ADP, GDP, CDP and UDP. RNR enzymes are known to exist in three classes, that differ in their catalytic mechanism: Class I RNR; Class II RNR; and Class III RNR.

RNR biology is well-known, for example as reviewed by Hofer A, et al “DNA building blocks: keeping control of manufacture”. Crit Rev Biochem Mol Biol. 2012;47(1):50-63.

In some embodiments, therefore, dATP, dCTP and/or dGTP, are manufactured from their corresponding ribonucleotide triphosphates in a single step employing ribonucleotide reductase and nucleotide kinases. In some embodiments, the RNR is human. In some embodiments, the RNR is bacterial, optionally obtained from Lactobacillus leichmannii (DSM 20076). dTTP is not synthesised by RNR, instead being synthesised by kinase / phosphatase reactions. Typically, dTTP is converted by thymidylate kinase from a dTMP (deoxythymidine monophosphate) or dTDP (deoxythymidine diphosphate) precursor, while dTMP is converted by thymidylate synthase from a rUTP (thymidine monophosphate) precursor. dTTP can also be made by chemical phosphorylation of thymidine. If the dTTP is produced chemically, then purification, e.g. HPLC purification, of the chemical reaction mix is not required according to the invention.

In some embodiments, a complete set of dNTPs can be produced in a single mixture comprising the necessary precursors and enzymes. Typically the enzymes will comprise RNR and nucleotide kinase activities. In some embodiments, a single multifunctional protein comprises both RNR and thymidylate kinase activities. For example, the microorganism Lactobacillus leichmannii has three nucleoside deoxyribosyl transferases, V1, V2 and V3 that are multifunctional and possess transferase, kinase, reductase, deaminase and polymerase activities. These enzymes and their use on the production of dNTPs are described, for example, in US 6,087,132.

In some embodiments, 2 or 3 dNTPs may be made in a single reaction, for example dATP and dCTP; dATP and dGTP; dCTP and dGTP; or dCTP and dGTP and dATP. In some embodiments, each dNTP is prepared separately and added into the reaction mixture for DNA synthesis as required. Each dNTP can therefore be prepared by a different method.

1, 2, 3 or all 4 of the dNTP sources may be impure according to the invention. In some embodiments, 1 , 2, or 3 dNTP sources may be purified according to the current usual standard, e.g. using HPLC purification. Even using only one impure dNTP source in a DNA synthesis reaction will provide notable cost and efficiency savings.

The invention relates in particular to the provision of dNTPs that have been enzymatically converted, e.g. from rNTPs. After the enzymatic reaction, multiple steps of purification may or may not be employed, including but not limited to alcohol precipitation (which could involve isopropanol precipitation) to remove DNA and proteins from the enzymatic reaction, and high performance liquid chromatography (HPLC) purification to reach >99% or >99.9% purity of dNTPs.

Purification is expensive and can be avoided by the realisation in this invention that impure dNTPs can be used by a polymerase with appropriate selectivity for a given application.

Typical HPLC-purified dNTPs for PCR are >99% or 99% pure, with <1% dNDP, <1% deoxyribonucleotide tetraphosphate, <0.1% rNMP, with other trace contaminants including inorganic contaminants such as pyrophosphate and metal ions or macromolecules including DNA and enzymes. The typical technique for determining purity is HPLC.

In contrast, the dNTPs of the invention can comprise contaminants including nucleosidic contaminants (e.g. deaminated/methylated dNTPs or dNTPs with a different base moiety), NTPs, and other deoxynucleoside phosphates such as dNMP, dNDP, or their tetra- and polyphosphates), inorganic species (such as chloride, acetate, or pyrophosphate as well as contaminants potentially present in raw materials e.g. heavy metals), or macromolecular contaminants (e.g. nucleic acids such as DNA or RNA, as well as traces of enzymatic activities such as DNases, RNases, Proteases, and DNA nicking activities).

The dNTPs are dATP, dCTP, dGTP, dTTP. The mixture may comprise all four dNTPs, only one dNTP, or any 1 , 2, or 3 dNTPs. Typically all four dNTPs are present when used in DNA synthesis by a polymerase. The composition can easily be controlled by controlling the NTPs present prior to contact with ribonucleotide reductase.

The impure dNTPs of the invention may contain 1 , 2, 3, 4, 5, 6, 7, 8 or more, or all of the following: rNTPs, rNDPs; rNMPs; dNMPs; dNDPs (undesired, as slower than dNTPs but can be incorporated by polymerases during DNA synthesis); ddNTPs (a DNA synthesis inhibitor, which after incorporation into a DNA strand cannot be further extended by lacking a 3’-OH); deoxyribonucleotide tetraphosphate (a PCR inhibitor); pyrophosphate (a PCR inhibitor, at high concentrations can drive the reverse reaction of DNA synthesis where a polymerase excises nucleotides to form dNTPs); trace contaminants such as metal ions that might affect enzyme activity or DNA stability; and/or trace macromolecules such as DNA, protease and nuclease from RNR reaction might cause off-target amplification or sample degradation.

The dNTPs are provided in amounts suitable for the purpose. For industrial and commercial purposes, typical amounts needed per day or per production run can be in the grams, tens or grams, hundreds of grams or even higher depending on the scale. In some embodiments, for example the production of nanostructures, industrial application requires litres, tens of litres or even hundreds of litres of dNTPs at the millimolar concentration range, for example 100mM (wherein one litre would contain around 50 grams of dNTP).

DNA synthesis reactions typically use 0.1 - 10mM dNTPs. Lab scale volumes are typically 10- 1000pL. Industrial scales from 1-100L thus use 0.1-1000g dNTPs.

Polymerases

DNA polymerases are diverse, with selectivity for dNTP over rNTP varying from 10² to 10⁶ (Wang et al., 2012, JBC). Selecting the correct polymerase for a given application can allow rNTPs to remain in the impure dNTP mix because the polymerase selectivity will ensure correct incorporation. Therefore, expensive HPLC purification is not required.

The invention relates at least in part to the use of polymerase fidelity to avoid getting rNTPs in product DNA.

In some embodiments the polymerase is a strand-displacing polymerase, for example F29 polymerase or Bst polymerase. In some embodiments, the fidelity or selectivity of the polymerase is at least the same as F29 polymerase or Bst polymerase.

The fidelity of a polymerase can be tested according to known methods, for example in Kunkel, T.A. and Tindall, K.R. (1988) Biochemistry, 27, 6008-6013. The Kunkel method uses portions of the lacZa gene in M13 bacteriophage to correlate host bacterial colony colour changes with errors in DNA synthesis. Barnes ((1992) Gene, 112, 29-35) built upon this assay and utilized PCR to copy the entire lacZ gene and portions of two drug resistance genes with subsequent ligation, cloning, transformation and blue/white colony colour determination. In both assays, errors incorporated in the lacZ gene cause a disruption in b-galactosidase activity leading to a white colony phenotype. With these lacZ-based experimental approaches, the percentage of white colonies must be converted to the number of errors per base incorporated. As a more direct read-out of fidelity, Sanger sequencing of individual cloned PCR products can also score DNA polymerase fidelity and offers the advantage that all mutations will be detected. Using this method, the entire mutational spectrum of a polymerase can be determined and there is no need to correct for nonphenotypic changes.

Fidelity is often assessed by comparison to standard Taq DNA polymerase. In some embodiments of the invention, a high-fidelity DNA polymerase is a polymerase that has a fidelity the same or better than Taq DNA polymerase (i..e. has an error rate that is the same or less than Taq polymerase). In some embodiments, the high-fidelity DNA polymerase is Taq DNA polymerase.

In some embodiments, the high-fidelity DNA polymerase has an error rate that is at least 2* less than Taq polymerase.

In some embodiments, the high-fidelity DNA polymerase has an error rate that is at least 10* less than Taq polymerase.

In some embodiments, the high-fidelity DNA polymerase has an error rate that is at least 20* less than Taq polymerase.

In some embodiments, the high-fidelity DNA polymerase has an error rate that is at least 50* less than Taq polymerase.

In some embodiments, the high-fidelity DNA polymerase has an error rate that is at least 100* less than Taq polymerase. For example, Q5® High-Fidelity DNA Polymerase (New England Biolabs) has a fidelity that is up to around 280x that of Taq polymerase. In another example, the Phusion® High-Fidelity DNA Polymerase* (New England Biolabs) has a fidelity that is around 39-50x that of Taq polymerase (i.e. an error rate that is 39^c-50* less).

Taq is commonly tested side by side with other polymerases in fidelity measurements. For example, using the blue/white method and correcting for non-phenotypic changes and error propagation during PCR, an error value for Taq may be around 2.7*10⁴ ±0.8*10⁴, or 1 per 3,700 bases.

In some embodiments the high-fidelity polymerase has an error rate of less than 1 per 3700 bases.

In some embodiments the high-fidelity polymerase has an error rate of less than 1 per 7500 bases. In some embodiments the high-fidelity polymerase has an error rate of less than 1 per 10,000 bases. In some embodiments the high-fidelity polymerase has an error rate of less than 1 per 15,000 bases. In some embodiments the high-fidelity polymerase has an error rate of less than 1 per 20,000 bases. In some embodiments the high-fidelity polymerase has an error rate of less than 1 per 50,000 bases.

In some embodiments the high-fidelity polymerase has an error rate of less than 2^c10⁴. In some embodiments, the high-fidelity polymerase has an error rate of less than 1*10⁵. In some embodiments, the high-fidelity polymerase has an error rate of less than 1*10⁶.

In some embodiments, the high-fidelity polymerase has a proofreading function (i.e. 3’->5’ exonuclease activity). In some embodiments, the DNA polymerase does not have a proofreading function.

The selectivity of a polymerase can be tested according to known methods, for example in Wang et al., 2012, JBC. This method measures the pre-steady state kinetics of NTP incorporation by incubating a polymerase with a fluorescent DNA primer and complementary template, then adding a polymerase substrate (e.g., dNTP, rNTP, ddNTP, etc.) and subsequently quenching the reaction by the addition of denaturing agents that will denature the polymerase and the primer/template duplex. Analysing the sample by electrophoresis will reveal differences in migration of the fluorescent DNA if a dNTP has been incorporated in the primer sequence, and by comparing samples quenched at different time points, the rate of incorporation can be measured. The selectivity of a polymerase for dNTP rather than rNTP is then calculated as the rate of dNTP incorporation divided by the rate of rNTP incorporation.

In some embodiments, the polymerase has at least a ten-fold selectivity for incorporation of dNTPs over rNTPs. Typically, the selectivity is at least a 1000-fold preference for dNTPs, for example at least a 10,000 fold preference for dNTPs. In certain embodiments, the polymerase has at least a 100,000 fold preference for dNTPs over rNTPs. In further embodiments, the polymerase has a 500,000 fold preference for dNTPs over rNTPs, for example at least a 1 million-fold preference. In some embodiments, the polymerase has an approximate 2 million fold preference for dNTPs over rNTPs.

In some embodiments, the DNA polymerase has an error rate of less than 1 per 7500 bases and at least a 100,000 fold preference for dNTPs over rNTPs.

In some embodiments, the DNA polymerase has an error rate of less than 1 per 15,000 bases and at least a 500,000 fold preference for dNTPs over rNTPs.

In some embodiments, the DNA polymerase has an error rate of less than 1 per 100,000 bases and at least a 500,000 fold preference for dNTPs over rNTPs. In some embodiments, the DNA polymerase has an error rate of less than 1 per 1 million bases and at least a 500,000 fold preference for dNTPs over rNTPs.

In some embodiments, the DNA polymerase has an error rate of 2x10 ⁶ or less and at least a 2 million fold preference for dNTPs over rNTPs.

In some embodiments, the polymerase is a F29 polymerase. F29 polymerase has 2 million fold preference for dNTPs over rNTPs due to its Tyr254 residue, which can discriminate against the hydroxyl group of an incoming ribonucleotide. These experiments involved deliberate mixing of polymerase with pure dTTP or rUTP (Salas, 1999). The intrinsic 3’ exonuclease activity of F29 polymerase can excise ribonucleotides from the 3'-termini in primer-template

DNA. This is important because the balance between excision and extension determines proof-reading efficiency. F29 DNA polymerase has an error frequency of between l xl0 ⁶- 10 ⁷ (Esteban et al J Biol Chem. 1993 Feb 5;268(4):2719-26). This error rate is comparable to that of Pfu (7 x 10 ⁷) and other proofreading DNA polymerases and is significantly lower than that of Taq DNA polymerase (2 ^c 10 ⁴).

In other embodiments, the polymerase is a Bst polymerase. This is a strand-displacing polymerase like F29 polymerase that finds utility in a number of applications according to the invention, including strand displacement amplification (SDA), nicking endonuclease mediated DNA amplification (NEMDA), loop-mediated isothermal amplification (LAMP) and rolling circle amplification (RCA). An example is the Bst 2.0 DNA Polymerase available from New England Biolabs, which has an error rate of 62 (±5)^c10^_6. Another example is the Bst 3.0 DNA Polymerase available from New England Biolabs, which has an error rate of 70±23^c10^-6.

Human DNA polymerase l can discriminate against ribonucleotides (Suo, 2010) and can be used in some embodiments of the invention.

Other high-fidelity DNA polymerases are known and can be commercially obtained. Examples include AccuPrime™ Taq DNA Polymerase High Fidelity (Invitrogen™; Hercules, CA, USA), KOD FX Neo (Toyobo; Osaka, Japan), Platinum® Pfx DNA Polymerase (Invitrogen™; Hercules, CA, USA) and Q5® High-Fidelity DNA Polymerase (New England Biolabs; Ipswich, MA, USA).

In some embodiments the DNA polymerase is a Taq DNA polymerase, for example the QIAGEN HotStarTaq DNA polymerase (available from QIAGEN GmbH, Hilden, Germany) as used in a number of the Examples below as part of the QIAGEN OneStep RT-PCR kit.

Synthesis methods

A diverse set of DNA synthesis methods exist and can be used according to the invention. PCR is the most common technique for synthesis, cloning, sequencing and testing including diagnostic testing. Other techniques are also well-known, such as isothermal amplification methods including loop-mediated isothermal amplification of DNA (LAMP) and RCA. The Examples describe a variety of these techniques.

Synthesis techniques currently typically use HPLC-purified dNTPs. By working at a much larger scale, the inventors have realised that at large scale dNTP cost becomes a limiting factor.

One synthesis method is the polymerase chain reaction (PCR), which is ubiquitous in molecular biology and is very well-known to the skilled person. In brief, PCR uses a template nucleic acid, oligonucleotide primers that bind to the template, dNTPs and a polymerase, in a reaction buffer. Multiple cycles of denaturation, annealing and extension lead to exponential amplification of the target (template) nucleic acid.

Many other synthesis methods are known in the art and can be used according to the invention, with some of these described below.

Rolling circle amplification (RCA) may be used to amplify DNA.

In one embodiment the DNA primers and template are not recycled, but amplified with RCA. In another embodiment, the DNA primers and template are recycled through multiple amplification reactions.

Rolling Circle Amplification of DNA is known in the art. For example, rapid amplification of plasmid and phage DNA using F29 DNA polymerase and multiply-primed Rolling Circle Amplification is described in Genome Res. 2001 11: 1095-1099. One embodiment of the invention uses the dNTPs of the invention in a method of using rolling circle amplification to amplify DNA, for example vector DNA such as M13 or plasmid DNA from single colonies or plaques, using random primers and F29 DNA polymerase. Circular DNA templates can thus be amplified 10,000-fold in a few hours. Rolling circle synthesis of oligonucleotides using F29 polymerase can thus be employed according to the invention (see also e,g, US5714320A).

Single stranded DNAs can be produced by cleavage of the RCA product. This could be achieved through the repetition of nucleic acid sequences in the RCA product that act as recognition sites for endonuclease enzymes added after RCA, as described by Ducani et al 2013 in Nature Methods. DNA molecules that encode a small, high-speed self-hydrolyzing deoxyribozyme (DNAzyme) can be used as templates for rolling circle amplification (RCA) to produce single-stranded DNAs (ssDNAs) of single- and multiple-unit lengths. Notably, the self cleaving activity can be triggered after RCA by the addition of metal ions that bind to the DNAzyme. Including self-cleaving deoxyribozymes in RCA products can generate large amounts of ssDNAs with defined sequence and length as well as precise termini. This method can be used efficiently to generate ssDNA size markers by using deoxyribozyme reaction conditions that permit partial processing. This is described by Gu and Breaker (Biotechniques 54:337-343 June 2013).

The use of F29 polymerase and RCA for cell-free amplification and cloning of plasmid DNA is described by Takahashi 2009. RCA for DNA sequencing or cloning is known (e,g, Dean 2001). RCA with strand-displacing polymerases (e.g., Bst polymerase) is described by Hafner 2001. RCA can be used for DNA or RNA quantitative sensing (e.g. Wang 2004, Veigas 2017). RCA can be used for cell-free protein expression templates (e,g, Kumar 2009). Cell-free cloning of DNA can be achieved using RCA and comprising primers that are either random or defined sequences (see e.g. W02006119066A2).

In some embodiments, RCA is used for autonomous self-replicating systems (eg. Sakatani 2015, Libicher 2020). In some embodiments, RCA is used to synthesise large quantities of concatemeric DNA (e.g. Waddington 2018). Non-specific amplification in RCA can be reduced using primer design and modifications (see e.g. W02002057487A2). Reverse transcription rolling circle amplification (RT-RCA) can be used to make full length cDNA (e.g. W02005030983A2). RCA using DNAzymes to cleave concatenated products is known (e.g. Breaker, 2013). The optimised use of primer sequence for RCA and teIN cleavage is described in W02012017210A1.

RCA or in vivo production using protein enzymes to cleave concatenated products is known (Ducani, 2013). RCA (e.g. using F29 polymerase) can be used for the production of linear dsDNA closed at both ends by hairpin loops. This may also use thermostable pyrophosphatase to cleave the pyrophosphate that accumulates during DNA synthesis, as at high concentrations pyrophosphate can cause polymerases to perform the reverse reaction of DNA polymerisation by combining pyrophosphate and DNA to produce dNTPs (see e.g. W02010086626A1).

An in vitro cell free process for production of DNAs comprising at least one hairpin, corresponding DNA products, oligonucleotides and RCA method are described in WO2016132129A1. The dNTPs of the invention can be used in an apparatus for controlling PCR or RCA reactions, for example for controlling temperature or reagent concentration, such as described in WO2014135859A1.

The Examples show that both PCR and RCA work effectively with impure dNTPs. Particularly surprisingly, impure dNTPs do not cause lower yield in RCA. Depending on the application, even in PCR inhibition may be irrelevant. For example, during cloning only one molecule of a plasmid is needed to replicate inside a cell to produce a viable bacterial colony, so if a PCR yields 10⁸ molecules or is inhibited to produce 100* less and only 10⁶ molecules then the process is still effective. Isothermal amplification methods can be used according to the invention. A review of isothermal amplification technologies is provided by Gill and Ghaemi (Nucleosides, Nucleotides, and Nucleic Acids, 27:224-243, 2008). Isothermal techniques include transcription mediated amplification (TMA) or self-sustained sequence replication (3SR), nucleic acid sequence-based amplification (NASBA), signal mediated amplification of RNA technology (SMART), strand displacement amplification (SDA), rolling circle amplification (RCA), loop-mediated isothermal amplification of DNA (LAMP), isothermal multiple displacement amplification (IMDA), helicase-dependent amplification (HDA), single primer isothermal amplification (SPIA), and circular helicase dependent amplification (cHDA). These techniques are sometimes used in molecular diagnosis.

Isothermal amplification technologies differ in their requirements for sample volume, specimen preparation, and methods of amplification and detection. The simplicity and isothermal nature of these methods offer great potential for the development of hand-held DNA diagnostic devices that could be used to detect pathogens at point-of-care or in the field. The pathogen may be a bacterial or virus, for example a coronavirus such as SARS-Cov-2. Another example of a viral pathogen is an ebolavirus.

A method of isothermal amplification and multimerization may use the dNTPs of the invention. Hafner et al (BioTechniques 30:852-867 April 2001) demonstrated the isothermal in vitro amplification and multimerization of several different linear DNA targets using only two primers and the strongly strand-displacing exonuclease-negative Bst DNA polymerase.

Another embodiment of the invention uses the dNTPs in linear nicking endonuclease-mediated strand-displacement DNA amplification. The nicking of one strand of a DNA target by the endonuclease produces a primer for the polymerase to initiate synthesis. As the polymerization proceeds, the down-stream strand is displaced into a single-stranded form while the nicking site is also regenerated. The combined continuous repetitive action of nicking by the endonuclease and strand-displacement synthesis by the polymerase results in linear amplification of one strand of the DNA molecule. Joneja and Huang (Analytical Chemistry 414, 2011 , 48-69) demonstrate that DNA templates up to 5000 nucleotides can be linearly amplified using a nicking endonuclease with 7-bp recognition sequence and Sequenase version 2.0 in the presence of single-stranded DNA binding proteins. Joneja, 2011 describes nicking endonuclease mediated DNA amplification (NEMDA), with optimisation of conditions, amplifying 3 strands in one-pot and amplifying strands up to 5000nt in length.

Another synthesis method uses the dNTPs of the invention in a rapid in vitro production of single-stranded DNA, as described for example by Minev et al Nucleic Acids Research, 2019, Vol. 47, No. 22). A rapid, high-yielding and user-friendly method for in vitro production of high- purity ssDNA with lengths up to at least seven kilobases uses the Polymerase chain reaction (PCR) with a forward primer bearing a methanol-responsive polymer that generates a tagged amplicon, that enables selective precipitation of the modified strand under denaturing conditions. ssDNA is recoverable in -40-50 min (time after PCR) with >70% yield with respect to the input PCR amplicon, or up to 70 pmol per 100 mI PCR reaction. The recovered ssDNA, for example, can be used for CRISPR/Cas9 homology directed repair in human cells, DNA- origami folding and fluorescent in-situ hybridization.

Applications

The dNTPs of the invention are useful in a very wide range of applications. Essentially, they could be used in any application that involves DNA synthesis.

There is an increasing demand for DNA, in particular ssDNA of lengths >200 nucleotides, in applications such as synthetic biology, biological imaging and bionanotechnology. The present invention supports this increasing demand.

The impure dNTPs of the invention find uses in many applications. In one embodiment, the impure dNTP source is used in nucleic acid synthesis. In another embodiment, the dNTP source is used in nucleic acid sequencing. In another embodiment, the dNTP source is used in molecular cloning (genetic engineering). In another embodiment, the dNTP source is used in testing, for example medical diagnostics. In another embodiment, the dNTP source is used in a nucleic acid vaccine. In another embodiment, the dNTP source is used in a self-replicating system. In another embodiment, the dNTP source is used in a nucleic acid nanostructure. In another embodiment, the dNTP source is used in a nucleic acid nanostructure that is used as an immobilisation platform for one or more enzymes.

The Examples below describe and test many applications for DNA synthesis using the dNTPs of the invention, including Rolling Circle Amplification (RCA) with impure dNTPs, Polymerase Chain Reaction (PCR) with impure dNTPs, Nicking Endonuclease Mediated DNA Amplification (NEMDA, e.g. using a Bst polymerase) with impure dNTPs, RCA biosensor (e.g. with F29 polymerase) with impure dNTPs, RCA with different read-outs to confirm synthesis and purity (LC-MS), RCA with different dNTP sources, RCA at scale with impure dNTPs, Synthesis of DNA nanostructures with impure dNTPs, RCA for cell-free protein expression with impure dNTPs, PCR with DNA templates of different length and sequence with impure dNTPs, and qPCR of DNA templates with impure dNTPs.

Example 1 demonstrates that impure dNTPs can be used in RCA for the purposes of DNA synthesis, sequencing, cloning, testing and for crude DNA vaccines with minor adjustments to current protocols. For example, the pyrophosphatase enzyme commonly added to DNA amplification reactions to limit the accumulation of pyrophosphate which drives the reverse reaction where polymerases excise nucleotides from DNA - in particular this would be useful if the impure dNTPs contain traces of pyrophosphate. The inventors have observed that the yield of DNA amplification scales linearly with volume up to 1 L RCA reactions. Various mechanisms may be used to cleave the RCA product into individual DNA strands - endonucleases (Ducani 2013), DNAzymes (Gu 2013) and preteleomerases (W02010-A-086626) are common strategies, and none should be affected by the use of impure dNTPs in the prior step of DNA amplification.

Similarly, various strand-displacing polymerases may be used (for example, Bst polymerase), provided that the contaminants in impure dNTPs do not prevent the application.

Example 2 indicates that impure dNTPs can be used in PCR for the purposes of DNA synthesis, sequencing, cloning and quantitative DNA sensing with minor adjustments to current protocols.

For example, modifications to the polymerase extension time, the number of PCR cycles, or the concentration of dNTPs could be made to optimise the PCR with impure dNTPs so that the amount of DNA amplified is equivalent to using pure dNTPs. Furthermore, there are abundant variations of PCR known in the art, involving the use of fluorescent dyes or probes to detect DNA in quantitative PCR, the use of multiple sets of primers in nested PCR, the incorporation of novel sequences in a PCR product, amplification with droplets for digital PCR, and so on, all of which may be unaffected by the use of impure dNTPs in PCR.

In various embodiments, the DNA synthesized according to the invention can be used for CRISPR/Cas9 homology directed repair in human cells, DNA-origami folding and fluorescent in-situ hybridization. As discussed herein, applications of the dNTPs of the invention include at least:

1. DNA synthesis

2. DNA sequencing

3. Cloning (genetic engineering)

4. Testing (medical diagnostics)

5. Vaccines

6. Self-replicating systems

7. Use of DNA to fold nanostructures

8. Use of DNA nanostructures as an immobilisation platform for enzymes In one embodiment, the synthesised DNA is incorporated into a nucleic acid nanostructure onto which functional molecules such as enzymes can be immobilised. In some embodiments, a single copy of an enzyme is immobilised on the nanostructure. In some embodiments, multiple copies of one enzyme type (species) can be attached to a DNA nanostructure.

The synthesis of DNA using the impure dNTP source of the invention is not limited to the production of DNA nanostructures, and can advantageously be used in any application requiring DNA synthesis.

In certain embodiments, the application may be sequencing-by-synthesis, DNA sensing, molecular cloning, medical diagnostics, nucleic acid vaccines, self-replicating systems, the assembly of a DNA nanostructure, in a biosensor, or in protein or metabolic engineering.

The DNA amplification reaction can be used as a sensor to detect the presence of the DNA template at low concentrations which is being replicated or transcribed by the polymerase. For example, the impure dNTPs can be used in rtPCR tests for pathogenic agents (such as bacteria or virus such as COVID-19, or ebola), which involves reverse-transcription of bacterial or viral (e.g. COVID-19) RNA to DNA, then PCR amplification of that DNA, and fluorescent detection of the DNA with an intercalating dye.

Therapeutics

Unprocessed RCA product can be used as a vaccine generating an immune response (see e.g. US9125845). In this example it is suggested but not shown that modified NTPs (a broad range including natural and synthetic NTPs, and also rNTPs) might be used during DNA synthesis so that they are included in the RCA product, and may or may not confer resistance to nuclease activity.

Diagnostics

The dNTPs of the invention may be used in a diagnostic assay or test. This may be to detect a biomarker in a subject, typically a human subject, or to determine the presence of a pathogen. The pathogen may in some embodiments be bacterial or viral. In some embodiments the diagnostic test may be for Coronavirus infection, for example the disease COVID-19 caused by the SARS-COV2 virus. Such diagnostic assays typically involve PCR or RCA.

The pathogen to be detected may in some embodiments be a virus such as a Coronavirus or other virus such as cytomegalovirus (CMV), adenovirus (AdV), Epstein-Barr virus (EBV), herpesvirus such as human herpes virus 6 (HHV6), influenza virus, and BK virus. In some embodiments the viral infection is caused by a Coronavirus or other respiratory tract viral infection, optionally wherein the infection is COVID-19.

The pathogen may in some embodiments be an ebolavirus. In other embodiments the pathogen may be an influenza virus, or a lentivirus such as HIV.

Quantitative polymerase chain reaction (qPCR) is widely used for diagnostics, also reverse transcription quantitative polymerase chain reaction (RT-qPCR) as is known in the art. Although RT-qPCR methods are used as the gold standard for detection of RNA genomes (e.g., viral RNA) or mRNA (e.g., cancer mRNA) because of their high sensitivity and specificity, there are still some caveats in the availability of reagents, instruments, and trained personnel.

Alternative diagnostic techniques such as quantitative rolling circle amplification (qRCA) also exist and can be used according to the invention.

Pathogens can be detected, for example in a diagnostic test, wherein the dNTP source comprises the dNTPs of the invention. RT-qPCR is the standard technique used to detect pathogenic nucleic acid form a host sample. Other techniques can also be used, including a diagnostic test comprising RCA. For example, rapid and sensitive detection of Severe Acute Respiratory Syndrome Coronavirus by Rolling Circle Amplification is described by Wang et al (Journal of Clinical Microbiology, May 2005, p. 2339-2344). The main advantage of diagnostic RCA is that it can be performed under isothermal conditions with minimal reagents and avoids the generation of false-positive results, a problem that is frequently encountered in PCR-based assays. Furthermore, the RCA technology provides a faster, more sensitive, and economical option to currently available PCR-based methods.

In some embodiments, the dNTPs of the Invention are used in a Reverse Transcription Loop- Mediated Isothermal Amplification (RT-LAMP). This may be a diagnostic assay, for example to detect the presence of a virus in a patient sample. In some embodiments the virus may be e coronavirus such as SARS-CoV-2 (see e.g. Park et a/ The Journal of Molecular Diagnostics 2020 https://doi.Org/10.1016/i.jmoldx.2020.03.006).

In some embodiments, the LAMP assay is a diagnostic quantitative loop-mediated isothermal amplification (qLAMP) assay.

RCA-based diagnostics of other diseases are possible, by detecting biomarkers, for example a genetic biomarker for cancer. In one embodiment, the dNTPs of the invention are used in a quantitative real-time monitoring of RCA amplification of cancer biomarkers (see e.g. Veigas et al Biosensors and Bioelectronics DOI: http://dx.doi.Org/10.1016/j.bios.2017.01.052).

The dNTPs of the invention may be used in cell-free protein synthesis using multiply-primed rolling circle amplification products. Multiply-primed rolling circle amplification (e.g. with cp29 DNA polymerase) is known as a simple way to generate large amounts of DNA. The products of this amplification method can have interruptions in both strands and branched structures, but Kumar and Chernaya (BioTechniques 47:637-639 July 2009) tested whether RCA- generated DNA can serve as the template for in vitro transcription. They found that RCA DNA- generated transcripts work in coupled in vitro translation with nearly the same efficiency (per nanogram of DNA) as those obtained from purified plasmid. This can provide a convenient, single-tube format for template amplification, transcription, and translation. The dNTPs of the invention can be used in this single-tube system.

Nucleic Acid Nanostructures

Some aspects of the invention relate to the production of a nucleic acid nanostructure. These nanostructures are typically made by nanoscale folding of nucleic acid such as DNA to create non-arbitrary two- or three-dimensional shape at the nanoscale. It is possible to create a nanostructure from 1 nucleic acid molecule folded on itself via intramolecular hybridisation. It is also possible to create a nanostructure using many hundreds or thousands of nucleic acid molecules, with the largest published discrete DNA nanostructure containing -28,000 nucleic acid molecules. When the nucleic acid nanostructure is composed of one or a few long (>1000nt), single-stranded nucleic acid(s) and many short (<200nt), single-stranded oligos, these structures are also known as DNA origami in the art (see e.g. Rothemund, Nature volume 440, pages 297-302 (2006)). The specificity of the interactions between complementary base pairs make nucleic acids such as DNA a useful construction material, through design of its base sequences.

The synthesis of nucleic acid nanostructures of controlled size and shape and comprised of a plurality of oligonucleotides is known in the art, for example as described in WO-A- 2014018675. In some embodiments, so-called “DNA bricks” are used, wherein structures are formed at least in part, by the self-assembly of single-stranded oligonucleotides. The location of each oligonucleotide in the resultant structure is known and so the structures may be modified with specificity. The molar amounts of oligonucleotides that are used will depend on the frequency of each oligonucleotide in the structures desired and the amount of structures desired. In some embodiments, the oligonucleotides may be present in equimolar concentrations. In some embodiments, each oligonucleotide may be present at a concentration of about 200 nM.

The nucleic acid nanostructure may also comprise or consist of a DNA hydrogel. DNA hydrogels are known in the art, for example in US20080167454A1. In certain embodiments, DNA building blocks are used to create a set of simple shapes. Trimers are disclosed that may associate together to form DNA assemblies of different shapes. For example, two trimers may be associated together to form a DNA assembly with a “dumbbell· shape. “Dendrimer-like DNA” (DL-DNA) is a DNA assembly. A “honeycomb¹ structure is a repeating pattern of generally hexagonal structures formed by the association of trimers (see FIG. 1 D and FIG. 4A (right hand portion) of US20080167454A1 for an example of a honeycomb structure). The DNA assembly may also be in the form of a generally linear assembly of trimers.

In some embodiments, DNA hydrogels are photo cross-linked to have a predetermined geometric pattern. This is described, for example, in WO-A-2010/017264. DNA hydrogels including other particles are described in US20100324124A1, where hydrogels are provided as delivery vehicles and the use of enzymes as a possible agent delivered on the hydrogel. DNA hydrogels can be enhanced according to the invention, to increase the functionality of attached molecules. For example, WO-A-2010/017264 describes nucleic acid molecules that form a three-dimensional structure that can function as a macroscopic scaffold. According to the present invention, such a 3D-structure can be used to enhance enzyme activity to stability of one or more functional molecules disposed on the nanostructure.

DNA origami is also described, for example, in US8501923B2. This describes a design concept wherein a scaffold is comprised of a helical single-stranded polynucleotide strand of at least 1500 nucleotides. This also describes the use of immobilised enzymes in multistep cascades, and refers to a micro- or nano-factory comprising a series of two or more enzymes arranged in a specific order to facilitate the generation of a desired product. For example, carotenoid biosynthesis requires the use of various enzymes that typically are present throughout the cytoplasm of an organism. Thus, the production efficiency is limited by the diffusion of a first by-product to the location of a second enzyme to convert the by-product to a second product and the like. In certain embodiments, the present invention provides optimised or improved micro- or nano-factories by improving the activity and/or stability of individual enzymes within a micro- or nano-factory through the effect of local pH and/or crowding.

In certain embodiments, the nanostructure is self-assembling. Self-assembled DNA nanostructures enable nanometre-precise patterning that can be used to create programmable molecular machines and arrays of functional materials.

At least a portion of the nucleic acid nanostructure may include a stability enhancement. For example click nucleic acid ligation (as in Gerard et al. 2012 ACS Nano) or by inducing UV photoproducts can provide stability enhancement for portions of the nanostructure, for example as described by WO2019234122A1.

The nanostructure of the invention can be designed to comprise one or more nanocaged enzymes. DNA nanocaged enzymes are known, for example as described by US20180016569A1. The concept of a simple and robust strategy for the DNA nanocaged is templated encapsulation of metabolic enzymes with high assembly yield and controlled packaging stoichiometry.

Stable nanoscale nucleic acid assemblies are also described in WO-A-2017189870 and can be used and modified according to the present invention.

In some embodiments, the nanostructure of the present invention uses a finite fully addressable nucleic acid nanostructure. Such nanostructures are sometimes known as nanocarriers. WO2012-A-151537 describes such nanocarriers for the delivery of pharmaceuticals, whereas the present invention modifies this technology to immobilise and modify one or more functional molecules.

Nanostructures can be assembled by a number of techniques known in the art, including annealing, isothermal folding, or the slow removal of denaturing agents.

Nanostructures can be stabilised by bonds formed between nucleotides. These bonds can be formed by enzymatic ligation, chemical ligation, photo-ligation, non-specific cross-linking, or other techniques apparent to the skilled person.

The nanostructure can be 1-dimensional, 2-dimensional or 3-dimensional. 1 D, 2D and 3D nanostructures are known in the art.

In certain embodiments, the nanostructure can be periodic, aperiodic or fractal.

In some embodiments, the surface of the nanostructure to which the one or more functional molecules are attached, is flat or curved, jagged or smooth, flexible or rigid, hydrophilic or hydrophobic, thick or thin, open to solvent or confined within the nanostructure.

The nucleic acid nanostructure may act as an immobilisation platform for functional molecules(s) attached to it.

Some aspects of the invention provide one or more functional molecules attached to a nucleic acid nanostructure produced according to the methods of the invention. In some embodiments, a single enzyme species is enhanced using a nucleic acid nanostructure. This may involve attaching multiple copies of the enzyme to the nanostructure, or attaching an individual enzyme molecule.

The functional molecule will typically be an enzyme but may alternatively be any chemical catalyst or biocatalyst. When the functional molecule is an enzyme, any appropriate enzyme can be used. Suitable enzymes can include, for example: enzymes comprising natural and unnatural amino acids, chemical modifications or post-translational modifications; natural enzymes; wild-type enzymes; recombinant enzymes; enzymes produced by directed evolution, de novo design or the genetic fusion of peptide or protein domains; peptide catalysts; nucleic acid enzymes (e.g. ribozymes or DNA enzymes); hybrid catalysts; monomeric, dimeric or multimeric enzymes; enzymes produced in vivo or in vitro for example by solid-phase synthesis. Alternatively, the functional molecule may not be a catalyst but may modify a reaction or biomolecule, for example, a functional molecule is positioned on the DNA nanostructure to act as a crowding agent to colocalised enzymes (e.g., bovine serum albumin (BSA) or polyethylene glycol (PEG)), or to stabilise the DNA or enzyme from denaturing (e.g., a coating like spermine or chitosan), or to provide a simple assay confirming the immobilisation of functional molecules on the DNA nanostructure (e.g., a fluorescently modified DNA strand, fluorescent protein or nanoparticle such as a quantum dot or gold nanoparticle).

When one type of functional molecule is attached, the nanostructure will perform the function of the attached molecule. Multiple individual molecules will typically be attached, so that there is a plurality of that single molecule attached on the nanostructure. A nanostructure comprising a functional molecule that is able to carry out, for example catalyse, a reaction may be referred to as a nanoreactor.

In some embodiments, two or more different functional molecules are attached to the nanostructure. These may each be present once, or may each be present multiple times. In these embodiments, the nanostructure will be able to perform the functions of all of the attached molecules. When the attached molecules form a reaction pathway, the nanostructure will then be able to catalyse that pathway. This multi-functional nanostructure is a nanoreactor, and may conveniently be referred to as a complex nanoreactor. Each reaction step of a sequence of reaction steps may be catalysed by an enzyme and optionally one or more cofactors. Cofactors may be co-located on the DNA scaffold, or may be provided elsewhere in the reaction environment.

A complex nanoreactor typically has three or more biocatalyst species, four or more biocatalyst species, five or more biocatalyst species, for example six or more biocatalyst species. A plurality of biocatalyst species may jointly catalyse a single reaction step.

In certain embodiments, the invention provides an array (or microarray) of dozens, or hundreds, of (a) single functional molecules or (b) nanoreactors.

An array is thus typically composed of a DNA nanostructure and at least two sets of enzymes binding to it, wherein a set of enzymes catalyses a given reaction pathway. The set of enzymes are typically repeated, but different sets of enzymes can be disposed upon the nanostructure.

A typical complex nanoreactor may therefore comprise a plurality of biocatalysts co-located in a predetermined arrangement on a DNA nanostructure. The interaction of each biocatalyst with the DNA nanostructure is arranged so that the activity of the biocatalyst is optimised, typically improved.

An array may comprise at least 2, for example 3, 4, 5 or more of the same set of enzymes. The distance or distances between any two, three, four, five or more repeated sets of enzymes within the array can represent an ordered pattern. The ordered pattern may be, for example, a geometric pattern or a predetermined pattern.

An array may comprise at least 2, for example 3, 4, 5 or more different sets of enzymes, thereby allowing multiple different reaction pathways to be catalysed by the same array. The distance or distances between any two, three, four, five or more distinct sets of enzymes within the array can represent an ordered pattern. The ordered pattern may be, for example, a geometric pattern or a predetermined pattern.

The number of enzyme sets (or nanoreactors) in an array may be very high, for example at least 10 nanoreactors, at least 100 nanoreactors, at least 1000 nanoreactors, at least 10000 nanoreactors, at least 100000 nanoreactors or at least 1 million nanoreactors.

Typically, the DNA microarray structure optimises enzyme placement according to the optimal performance, defined as the best compromise of the design features (such as reaction rate, ease of recycling, stability, unit cost, microarray active lifetime, and so on) depending on the specific synthetic pathway in consideration.

In some embodiments, a DNA nanostructure is made by a simple origami sheet (such as that of Tikhomirov etal. 2017) but other choices are also possible, for example a honeycomb lattice made by joining side-by-side several hexagonal nanoreactors (for example as described by Linko etal. 2015).

In one embodiment of the invention, a micrometer-size DNA structure containing 5, 10, 15, 20 or more functional molecules (e.g. enzymes), or containing 5, 10, 15, 20 or more nanoreactors (complex or not), is provided. In one embodiment of the invention, a micrometer-size DNA structure containing around 100 or more functional molecules (e.g. enzymes), or around 100 nanoreactors or more, is provided.

The functional molecules can be immobilised using a tether, for example an oligonucleotide linker. A functional molecule may be tethered to the DNA scaffold covalently or non-covalently. Binding chemistries for the tether may include chemical linkers, templated protein conjugation or other protein-DNA conjugation strategies, binding of biotinylated proteins to avidin or streptavidin or neutravidin, and/or click chemistry. A combination of binding chemistries may be used for different functional molecules.

Another typical tether is an enzymatic protein domain that recognises and binds to a specific nucleic acid sequence (either covalently or non-covalently). This is described, for example, in US20160340395. This describes the genetic fusion to a polypeptide of an enzymatic protein domain that recognises and chemically conjugates to a specific ssDNA sequence or DNA nanostructure. Enzyme attachment

Enzymes can be attached to the nucleic acid nanostructure using any suitable technique. Typically, the enzyme will be immobilised onto the nanostructure.

Enzyme immobilisation is known in the art for example as described in WO-A- 1995010605, WO- A- 1991014773 and CA2099376A1. WO-A- 1995010605 describes enzyme stabilisation using polyelectrolyte additives in bulk solution; WO-A-1991014773 describes enzyme stabilisation using polyelectrolyte additives and drying; and CA2099376A1 describes stabilization of proteins by cationic biopolymers.

Enzymes can be bound to DNA by connecting a particular residue on the enzyme to a particular DNA strand on the nanostructure. The residue to bind can be chosen according to constraints, such that it doesn’t inactivate the enzyme (e.g. if the residue blocks the reagent from reaching the enzyme binding site). In certain embodiments, non-specific conjugation to surface residues is used.

To ensure precise, selective, high-yield, cost-effective, reliable binding of several different enzymes to the DNA, binding can utilise a number of binding chemistries, including templated protein conjugation (see Trads et.al. 2017) or other protein-DNA conjugation strategies (such as Yan et.al.2018), binding of biotinylated proteins to avidin/streptavidin/neutravidin (as in Linko et.al. 2015), click chemistry (see Khatwani et.al 2012), or others. Multiple chemistries can be combined to efficiently build the same microarray.

Multiple copies of a single functional molecule may be attached to the nanostructure. These may be attached in an identical fashion, or different copies of a single functional molecule may be attached differently, for example with different linkers, different conjugation chemistry and/or at different distances from the nanostructure. This can provide, for example, improved activity for a single type of functional molecule when the nanostructure is placed under different bulk environmental conditions.

When different functional molecules are attached to the nanostructure, each type of functional molecule may be attached identically, or may be attached differently as discussed above. Typically, each copy of the same functional molecule (e.g. each Enzyme “A” in a given multi- step pathway, and each Enzyme “B” in that pathway) will be attached using the same attachment to create the same local environment for that molecule.

The typical stages of producing and testing a nanostructure are set out in the following passages.

1. Designing the nanostructure

The design of nucleic acid nanostructures is known in the art. In certain embodiments, the nucleic acid (e.g. DNA) nanostructure is typically first sketched by hand. Software tools can then be used to help visualise and design the crossover junctions between DNA strands (e.g., the “caDNAno” software available at https://cadnano.org). This can output a set of DNA strands in an output file such as a .csv file. This design process is well-described and known in the art.

The design of the nanostructure can then checked using other software tools, for example the “cando” software available at https://cando-dna-origami.org/, or the well-known “oxDNA” software available at https://dna.phvsics.ox.ac.uk/index.php/Main Page, or using other simulation tools. Any way of designing the DNA nanostructures can be utilised according to the present invention. This can involve using many short oligonucleotides, a few long oligonucleotides, or a single strand that folds upon itself.

2. Nucleic Acid Synthesis

The nucleic acid sequences can then be synthesised according to the present invention, using the dNTPs of the invention. For example, DNA can also be produced by in vitro amplification of DNA using template DNA, polymerase enzymes and impure dNTPs.

Oligonucleotides (e.g. <200nt) are also available for commercial sale (such as from Integrated DNA Technologies, Inc. Coralville, Iowa 52241 USA). Oligos are typically made using solid- phase synthesis. Circular ssDNA bacteriophage genome (e.g. 7249nt) is typically used for DNA origami and is commercially available (for example from Tilibit nanosystems GmbH, DE- 85748 Garching, Germany) and is typically produced in vivo.

3. Nanostructure assembly

Nanostructure assembly techniques are known in the art. In one embodiment, DNA strands are mixed in 40mM tris, 20mM acetic acid, 1mM EDTA, 12.5mM MgCI2. The DNA strands can be various concentrations. The magnesium can be optimised, typically 2-20mM is suitable to enable self-assembly but prevent aggregation of DNA. An example of a mixing reaction is provided in the Table below:

The DNA is typically heated to 95^°C to eliminate native secondary structure then cooled slowly to encourage self-assembly of the nanostructure. The rate of cooling is typically optimised for every nanostructure and can take between 1 minute to 1 week. It is also possible to design nanostructures that assemble without annealing, so annealing is not essential. It is also possible to anneal by the slow removal of a chemical denaturing agent, for example, by dialysis. An example of an annealing protocol is provide in the table below:

The assembly of the DNA nanostructures can then be confirmed. This can be achieved via agarose gels and atomic force microscopy, though other techniques are possible (e.g., automated electrophoresis or electron microscopy).

An exemplary agarose gel protocol is to use 0.9 % Agarose (Life Technologies) dissolved in 0.5x TAE from ultrapure deionised water. Microwave to dissolve. After agarose is dissolved and cooled down, add 5 pL SybrSAFE DNA stain per 100 mL and cast agarose gel using BIORAD agarose gel kit. 2 pL 100 nM DNA samples added to 16 pL H2O and 2 pL loading dye, before loading 5 pL 10 nM origami on the gel. Gel run in 0.5x TAE running buffer, 120 V, 40 minutes, at 4 degrees, before imaging with with UV light on Azure c150.

An exemplary protocol for atomic force microscopy is to image samples in fluid on Bruker multimode 8 using MSLN-E tip on mica surface in peak force tapping mode. Variable sample volume but typically between 1-5 pL added to the mica surface for sample adhesion, before adding up to 100 pL 1X TAE, 12.5 mM MgCL. Typically between 0.5 to 3 pm area imaged with 100-150 pN force and 1.5-3 Hertz.

The DNA nanostructures are then purified from any excess strands used during assembly via size-exclusion chromatography, though other techniques are possible (e.g., size-exclusion filtration). In one embodiment, samples are typically purified with an AKTA pure 25 L at 4^°C through a Superdex 200 Increase 10/300 GL column using 1X TAE, 12.5 mM MgCh at a flow rate of 0.5 mL/min. Typically between 50-500 pl_ samples injected.

The concentration of DNA nanostructures can be measured via absorbance at 260 nm.

4. Immobilisation

The nanostructures can then be mixed with the functional molecules.

In one embodiment, DNA nanostructures and enzymes are mixed with 1 :1 stoichiometry in a buffer system, typically containing 10mM MgCh. In the experiments performed by the inventors, DNA nanostructures and enzymes are used at a final concentration of 1nM.

Various ratios of DNA to enzyme may be used to optimise immobilisation or enhancement of enzyme function. Various annealing protocols may be used to optimise immobilisation of enzymes.

5. Assay

The activity of the functional molecule can be assayed using suitable known techniques.

In one embodiment, the enzyme is assayed using an appropriate range of buffers to ensure the stability and activity of the enzyme and DNA during the reaction.

In some embodiments, assays of enzyme activity use a plate-reader (e.g. absorbance, fluorescence, luminescence). However, other assays and apparatus may be used. It is also possible to assay enzyme activity using chromatography or mass-spectrometry, which would provide the same information (though more directly) about the production or consumption of metabolites.

The disclosure is illustrated by the following non-limiting Examples. It is understood that the Examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, sequence accession numbers, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term “and/or” includes any and all combinations of one or more of the associated listed items. As used herein, the singular forms “a”, “an”, and “the” are intended to include the plural forms as well as the singular forms, unless the context clearly indicates otherwise. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open- ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one having ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and the present disclosure and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

In describing the invention, it will be understood that a number of techniques and steps are disclosed. Each of these has individual benefit and each can also be used in conjunction with one or more, or in some cases all, of the other disclosed techniques. Accordingly, for the sake of clarity, this description refrains from repeating every possible combination of the individual steps in an unnecessary fashion. Nevertheless, the specification and claims should be read with the understanding that such combinations are entirely within the scope of the invention and the claims.

Examples

Summary

Nucleic acid amplification reactions typically employ >99% HPLC-purified deoxyribonucleotide triphosphates (dNTPs). HPLC purification is the largest component of the cost of commercially available dNTPs. However, this purification may be unnecessary if the polymerase enzyme can itself discriminate between the various nucleotide substrates in the sample (for example, between dNTPs and any rNTPs remaining from enzymatic synthesis of dNTPs). Alternatively, the contaminants in the dNTP stock that may affect polymerase activity (e.g., deoxyribonucleotide tetraphosphates or pyrophosphates) may not have a significant effect on the desired application. The Examples describe and demonstrate effective methods of DNA replication by rolling circle amplification (RCA) and polymerase chain reaction (PCR) using unpurified dNTPs. qPCR and qLAMP diagnostic assays are also exemplified.

Example 1: Rolling circle amplification (RCA)

Overview

Two DNA amplification reactions were run in parallel using pure and impure dNTPs. This involved 4 steps:

1. Preparation of a circular DNA template by ligation of 5’-phosphate modified template DNA strand into a circle using a complementary ‘splint DNA’ and ligase enzyme.

2. Rolling circle amplification using F29 polymerase to form many concatenated DNA copies of the reverse complement of the template.

3. Nicking of the RCA product using a sequence-specific nuclease to form a DNA sequence of arbitrary sequence and length.

4. Running a denaturing PAGE gel to separate the DNA by length and observe the formation of the product strand.

Materials and Methods:

Ligation: 5 pl_ 10x T4 DNA ligase buffer (NEB, M0202), 25 mI_ 10 mM 5’-phosphate modified ssDNA template oligo, 0.5 mI_ 100 mM ssDNA ligation oligo were mixed with 19 pL ultrapure H2O. Samples were annealed by incubating at 95°C for 2 minutes and cooling to 20°C at a rate of -2°C per minute. After annealing, 1.5 mI_ 10c T4 DNA ligase buffer (NEB, M0202), 1 pL 10 U/pL T4 DNA ligase (NEB, M0202L) and 12 pL ultrapure H2O were added to initiate ligation to circularise the template oligo. Samples were incubated at 20°C for 30 minutes.

Rolling circle amplification (RCA): 1 mI_ of the ligation product was diluted by adding 19.25 mI_ ultrapure H₂0, 0.25 pL 20 mg/ml_ BSA, 10 mM dNTPs, 0.5 pL 1M DTT and 0.5 pL 10 U/pL F29 polymerase (NEB, M0269). dNTPs were obtained as ‘pure’ dNTPs from NEB (>99% dNTPs, purified by HPLC) or as ‘impure’ dNTPs from Larova GmbH, Lobstedter Str. 8007749 Jena, Germany (>90% purity dNTPs, verified by HPLC). Samples were incubated at 30°C for 2 hours.

Nicking RCA product: 5 pL of the RCA product was diluted by adding 19.7 pL ultrapure H2O, 2.3 pL 10x NEB buffer 3.1, and 2 pL 100 mM nicking strand. Samples were annealed by incubating at 95°C for 2 minutes and cooling to 20°C at a rate of -2°C per minute. Finally, 1 pL 10 U/pL Nt-BspGI was added and the sample incubated at 1.5 hours at 50°C. Denaturing PAGE: 20% denaturing PAGE gels were cast by mixing 6.7 ml_ 40% 29:1 Acrylamide: Bis-Acrylamide (Fisher BioReagents, 10001313), 1.43 ml_ 10x TAE, 4.2 g urea, 2.5 ml_ formamide and heating to fully dissolve. 100 mI_ 10% ammonium persulfate (APS) and 10 mI_ tetramethylethylenediamine (TEMED, BIORAD, 1610800) was added to initiate polymerisation of the gel. Gels were cast with a BIORAD Mini-PROTEAN Gel Kit, run with a BIORAD PowerPac Basic Power Supply and observed a gel illumination unit from azure biosystems (c150, Dublin, California, United States). A 5 mI_ sample was diluted in 7.5 mI_ formamide and 2.5 mI_ gel loading dye (R0611 , ThermoFisher), then heated to 95°C for 2 minutes. 10 pL of this sample was loaded on a denaturing PAGE gel, which was run at 220 V for 20 minutes at 50°C in 1x TAE running buffer before staining the gel with SybrGold.

DNA sequences:

RCA template strand (5’-3’):

/5Phos/TTGTGAGAGAACGCTCTTCACCAGGCTTAGACAACGATTCGGGAGGGTG

CACTT ACCGGTTT CT CTT CGAGAAACT GGCACTGCTCT AATCCGAAAGC

- Ligation strand (5’-3’): GTT CT CT CACAAGCTTTCGGATT AG A

- Nicking strand (5’-3’): T G AAG AGCGTT CT CT CACAA

The results are shown in Figure 1. The unnicked product of rolling circle amplification is a long, concatenated DNA aggregate that does not migrate through the PAGE gel. This nicking strand is a short oligo that migrates further through the PAGE gel. The desired product strand amplified in this reaction migrates to an intermediate distance through the gel. Surprisingly, no difference in DNA amplification by RCA was observed between the pure and impure sources of dNTPs, with the product band present with both sources of dNTPs and an absence of off- target amplification.

This indicates that impure dNTPs can be used in RCA for the purposes of DNA synthesis, sequencing, cloning, testing and for crude DNA vaccines with minor adjustments to current protocols.

For example, the pyrophosphatase enzyme commonly added to DNA amplification reactions to limit the accumulation of pyrophosphate which drives the reverse reaction where polymerases excise nucleotides from DNA - in particular this would be useful if the impure dNTPs contain traces of pyrophosphate. The inventors have observed that the yield of DNA amplification scales linearly with volume up to 1 L RCA reactions. Various mechanisms may be used to cleave the RCA product into individual DNA strands - endonucleases (Ducani 2013), DNAzymes (Gu 2013) and preteleomerases (W02010-A-086626) are common strategies, and none should be affected by the use of impure dNTPs in the prior step of DNA amplification.

Similarly, various strand-displacing polymerases may be used (for example, Bst polymerase), provided that the contaminants in impure dNTPs do not prevent the application. Various DNA templates of different length and sequence may be used (for example, a dsDNA plasmid can be nicked by an endonuclease to create a site for a strand-displacing polymerase to begin RCA, or a ssDNA viral genome like M13 bacteriophage may be primed by the addition of short oligos to initiate RCA). Various cleavage mechanisms may be used (as described in the Introduction). Finally, various methods of DNA detection may be used to measure amplification, as known in the art.

Example 2: Polymerase chain reaction (PCR)

Materials and Methods

Reagents used for the PCR were obtained from New England Biolabs, Ipswich, Massachusetts, United States, besides the impure dNTPs. The impure dNTPs were obtained from Larova GmbH, Lobstedter Str. 8007749 Jena, Germany, and were the product of enzymatic synthesis of dNTPs lacking a final step of HPLC purification. The DNA template for the PCR was a non-purified product of a GoldenGate assembly (10 pl_ 2 nM DNA). The polymerases were: Phusion® High-Fidelity DNA Polymerase and Q5 High-Fidelity DNA Polymerase.

50 mI_ PCRs were pipetted according to the following schemes and 2 mI_ 2 nM of the GoldenGate assembly were added to each reaction:

The following PCR protocol was used:

After the PCR 5 pl_ of the sample were mixed with 3 pl_ 6x Loading dye (R0611 , Thermo Fisher, Waltham, Massachusetts, United States) and applied on a SybrSafe (Thermo Fisher) prestained 0.7 % (w/v) agarose gel. The agarose gel was run for 45 minutes at 110 V in 1x TAE buffer (Thermo Fisher). After the gel separated the DNA it was visualized on a gel illumination unit from azure biosystems (c150, Dublin, California, United States). The remaining 45 mI_ of the PCR were purified with the NEB Monarch PCR & DNA Cleanup Kit (5 ug). DNA was eluted in 15 pL nuclease free water. The concentration of the DNA solution was determined with a DS-11 Spectrophotometer (DeNovix, Wilmington, Delaware, United States). Purified samples were sent for sequence verification to Eurofins (Ebersberg, Germany). DNA sequences were analysed using SnapGene® software (from GSL Biotech; available at snaggene.com), using the sequence alignment tool to compare the amplified samples with the original DNA template and create the images in Figure 3.

DNA Sequences:

- Forward Primer (5’-3’): GGTTCACCACGCGGGAA

- Reverse Primer (5’-3’): CAAAGGGCG AAAAACCGT CT AT CAG GoldenGate Construct (Assembled) (5’-3’):

CATCGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTT CACCACGCGGGAAACGGTCTGATAAGAGACACCGGCATACTCTGCGACATCGT AT AACGTT ACT GGTTT CACATT C ACCACCCT G AATT G ACT CT CTTCCGGGCGCT A TCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCGGGATCTCGAC GCT CT CCCTT ATGCGACTCCTGCT ATCAGCACACAATTGCCCATT AT ACGCGCGT AT AATGGACT ATT GT GTGCT GAT AATT AGGAAGCAGCCCAGT AGT AGGTT GAGG CCGTTGAGCACCGCCGCCGCAAGGAATGGTGCATGCAAGGAGATGGCGCCCAA CAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCA TGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAG GCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGG CGT AG AGG ATCG AG ATCG AT CT CG ATCCCGCG AAATT AAT ACG ACT CACT AT AG GGG AATT GT G AGCGG AT AACAATTCCCCT CT AG AAAT AATTTT GTTT AACTTT AAG AAGGAGAT AT ACAT AT GCACCCCGAGACTCTT GTT AAGGTT AAGGACGCCGAGG ACCAATTGGGTGCACGT GT CGGGT ACATCGAGTTGGACCTT AATTCGGGAAAGA TCCT CG AGT CGTT CCGTCCT G AGG AGCGTTT CCCAAT GAT GT CAACTTT CAAGG TT CTTTT GT GT GGTGCCGT ATT GT CT CGT GT CGACGCAGGGCAAGAGCAACTCG GGCGTCGTATCCACT ACAGTCAAAAT G ACTT AGTT G AGT ACAGTCCTGTT ACT G A GAAGCACTT GACT GACGGT AT GACT GTCCGT GAGCTCT GTTCCGCCGCT AT CAC GATGTCGGACAATACGGCCGCAAATCTCTTGCTCACGACAATCGGTGGTCCAAA GGAGTT AACTGCATT CCTTCACAAT ATGGGT GACCACGT AACACGTTT AGACCGT TGGGAGCCAGAGTT AAAT GAGGCAAT CCCAAAT GACGAGCGT GACACT ACAAT G CCAGCAGCCATGGCCACT ACGTT ACGT AAGCTTTT AACAGGGGAGTTGCTT ACG CTT GCATCCCGTCAACAATT AAT CGACT GGATGGAAGCT GACAAGGT AGCTGGG CCATT ATTGCGTT CCGCCTT ACCTGCCGGATGGTT CATCGCCGACAAGAGTGGA GCTGGAGAGCGT GGTTCT CGTGGT ATCATCGCCGCT CTCGGT CCT GACGGGAA

GCCT AGT CGT ATCGTT GTCAT CT ACACGACTGGTT CGCAAGCAACT ATGGACGA

GCGT AATCGTCAAAT CGCAG AGATCGG AGCCT CACTT AT CAAGC ACTGGT CAGG

TCATCACCATCACCATCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGC

TGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTC

T AAACGGGT CTT GAGGGGTTTTTTGCT GAAAGGAGGAACT AT ATCAGCACACAAT

TGCCCATTATACGCGCGTATAATGGACTATTGTGTGCTGATATATCCGGATTGGC

GAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTA

CGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCT

TTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATC

GGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAA

AACTT GATT AGGGT GATGGTT CACGT AGTGGGCCAT CGCCCT GAT AGACGGTTT

TT CGCCCTTT G ACGTTGG AGT CCACGTT CTTT AAT AGT GG ACT CTT GTT CCAAAC

TGGAACAACACTC

Results and interpretation

Eight DNA amplification reactions were run in parallel using pure and impure dNTPs. The results are shown in Figure 2. For both polymerases and all PCR buffers, the expected product band is present with both sources of dNTPs and there is an absence of off-target amplification. This amplification yield with impure dNTPs was between 20-65% less than with pure dNTPs, which is surprising as this indicates only a slight decrease in the rate of the exponential amplification reaction. All samples were sequenced and no substantial differences in read length or fidelity were observed between samples (Figure 3).

This indicates that impure dNTPs can be used in PCR for the purposes of DNA synthesis, sequencing, cloning and quantitative DNA sensing with minor adjustments to current protocols.

For example, modifications to the polymerase extension time, the number of PCR cycles, or the concentration of dNTPs could be made to optimise the PCR with impure dNTPs so that the amount of DNA amplified is equivalent to using pure dNTPs. Furthermore, there are abundant variations of PCR known in the art, involving the use of fluorescent dyes or probes to detect DNA in quantitative PCR, the use of multiple sets of primers in nested PCR, the incorporation of novel sequences in a PCR product, amplification with droplets for digital PCR, and so on, all of which may be unaffected by the use of impure dNTPs in PCR. Example 3: Nicking endonuclease mediated DNA amplification (NEMDA),

This is a similar reaction to RCA in Example 1, but only the single step of mixing and amplification. There are no ligation steps before or nicking steps after amplification. Other strand-displacing polymerases such as Bst polymerase can be used instead of F29 polymerase.

Data generated similar to Example 1 using native or denaturing PAGE.

Example 4: RCA biosensor (F29 polymerase)

Similar reaction to RCA in Example 1 , except the final nicking step is excluded. The experiment uses samples in which the concentration of the template DNA is varied. This determines the lower concentration limit of template DNA that can be detected. As the RCA reaction is a linear amplification, the amount of template DNA determines the amount of RCA product formed.

DNA amplification can be detected on an agarose gel and with fluorescence a qPCR machine via DNA binding dye that binds to the amplified DNA in real time. If an agarose gel, then the protocol from Example 2 can be used. If a qPCR machine, then use an Agilent AriaMX qPCR with a pre-made qPCR kit (except for dNTPs to test pure vs. impure), e.g., TaqPath.

Example 5: RCA with different read-outs to confirm synthesis and purity (LC-MS). Repetition of Example 1 , with a set of different DNA sequences. This experiment uses LC-MS to confirm the mass of the synthesized oligo, to determine if any rNTPs have been incorporated as a result of using the impure dNTPs. Data generated include a chromatogram measuring the absorbance of DNA at 260nm during elution from the chromatographic column and a deconvoluted mass spectra showing the predicted and measured masses of DNA oligos synthesized with impure dNTPs. An example LC-MS protocol may be:

LC-MS with a XevoG2-XSQ ToF instrument (Waters). 50 pL 10 mM samples were buffer exchanged into H2O using MicroBio-Spin 6 columns (BIORAD) before LC-MS analysis in negative ionisation mode. An ACQUITY UPLCH-Class plus system was used for RP-LC with an ACQUITY UPLC BEH130 A1.7 pm C18 (2.1 *75 mm). Buffer A: 75mM triethylammonium acetate (TEAA) pH 7.0 buffer in H2O. Buffer B: 75 mM TEAA pH 7.0 buffer in MeCN. Flow rate: 0.2 mL.min ¹. Column temperature: 70°C. Leucine enkephalin was used as the reference for the LockSpray correction. The raw continuum data was deconvoluted to produce zero charge mass spectra using ProMass HR for MassLynx (Novatia) software. Samples may also be analysed directly by MS without prior LC separation.

Example 6: RCA with different dNTP sources

Repeat of Example 1 with different dNTP sources, confirming that the process is not limited by a particular supply or source of impure dNTPs. Enzymatic synthesis from rNTPs can use a different RNR enzyme. Data generated on a PAGE gel.

Example 7: DNA synthesis at scale with impure dNTPs.

Scale up of RCA of linear amplification.

Similar method to RCA in Example 1, except scaling up the volume from pl_ to L.

Slight variations to the method, in particular, the concentrations of reagents may be optimized and typically more dilute except for dNTPs, and the cleavage strategy may be modified so that the addition of the ‘nicking strand’ is not necessary.

Data generated on a PAGE gel.

Example 8: DNA synthesis of DNA nanostructures with pure vs. impure dNTPs.

RCA linear amplification applied to the amplification of DNA nanostructures. Similar method to RCA in Example 1 , except increasing the number of templates added in the same reaction mix. Up to 200 strands amplified simultaneously with pure dNTPs has been carried out.

Slight variations to the method, in particular, optimizing the nicking step and post-nicking purification to remove all complementary DNA so that the product strands are free to hybridise in a DNA nanostructure.

Example 9: RCA for cell-free protein expression with pure vs. impure dNTPs.

Similar reaction to RCA in Example 1 , except without the final nicking step, and adding a different template which encodes for a gene.

A different final step uses the amplified DNA as a template for cell-free protein expression.

This has been regularly achieved with PCR, but RCA may be easier to scale up as it is an isothermal reaction. Both techniques are faster than conventional microbiology to clone plasmids.

Data are a measure of GFP fluorescence as it is expressed from the RCA product synthesised with either pure or impure dNTPs, and also an SDS-PAGE gel of the protein showing its molecular weight as evidence of correct expression.

See NEB cell-free expression protocol

(https://international.neb.com/protocols/2019/12/02/nebexpress-cell-free-e-coli-protein- synthesis-sds-page-protocol) for more detail:

NEBExpress Cell-free E.coli Protein Synthesis SDS-PAGE Protocol

In vitro protein synthesis reactions produced by the NEBExpress™ Cell-free E coli Protein Synthesis System can be directly loaded onto an SDS-PAGE gel without the need for acetone or TCA precipitation.

1. Combine 2 pl_ of a NEBExpress™ Cell-free E. coli Protein Synthesis System reaction with 6 pL of SDS-PAGE Blue Loading Buffer (NEB #B7703), and 10 pL H₂0. Also prepare a negative control sample.

2. Incubate at 100°C for 3-5 minutes.

3. Load 3 pL of the Unstained Protein Standard (NEB #P7717) into the first lane.

4. After a quick microcentrifuge spin, load samples directly on to the gel. To ensure uniform mobility, load an equal volume of SDS-PAGE Blue Loading Buffer into any unused wells.

5. Run the gel according to the manufacturer’s recommendations.

6. Stain with Coomassie Blue or another stain as directed or proceed to Western Blot. After staining, the target protein is typically observed as a unique band, absent in the negative control reaction. However, sometimes the target has the same apparent molecular weight as an endogenous protein. In this case, the target protein will enhance or “darken” the co migrating band.

Example 10: PCR with DNA templates of different length and sequence with pure vs. impure dNTPs.

Similar to Example 2, testing the limits of impure dNTPs a diverse set of DNA sequences. This tests the effect of contaminants inhibiting polymerase activity when amplifying longer sequences, where the contaminant effect may be more pronounced.

Data may include agarose gels as in Example 2.

Example 11 : qPCR of DNA templates with pure vs. impure dNTPs.

Diagnostics are possible using impure dNTPs. This reduces the cost and increases the supply of kits. Given the PCR results reported above, medical diagnostics like qPCR are provided.

COVID-19 RT-qPCR is an exemplary diagnostic test.

Example 12: qPCR of DNA templates with pure vs. impure dNTPs at varying dNTP concentrations

The QIAGEN OneStep RT-PCR Kit (QIAGEN GmbH, Hilden, Germany) was used. dNTPs were either from the Qiagen kit (pure) or FabricNano batches (impure) at a stock concentration of 10 mM. qTOWER³84 from Analytik Jena (Jena, Germany) was used. As readout the Optical Cartridge Type “Color module 1 (470 nm/520 nm), FAM” (Gain 3) was used for detection as the qPCR probe was labeled with fluorescein. All reactions were performed in triplicates the values were averaged and the error bars represent the standard deviation.

The protocol for the qPCR was the following:

A typical qPCR reaction was between 20 and 50 ul and contained the following components:

All DNA was synthesised by IDT (Integrated DNA Technologies, Iowa, USA) The primers and probes were either a ready to go solution from IDT (2019-nCoV RUO Kit) or mixed to a final concentration of 6.7 uM primers and 1.7 uM probe.

Sequences (5’-3’):

Results and interpretation

The results are shown in Figure 4. qPCR reactions with varying amounts of dNTPs (pure and impure) were run in parallel. An increase in fluorescence can be detected when the PCR is amplifying the template DNA. A fluorescent probe, which is quenched when annealed to the template strand is partially displaced and cleaved upon DNA synthesis of the polymerase. In the reactions with the pure dNTPs (Qiagen), the more dNTPs are added the later the fluorescence signal increases indicating a dNTP concentration dependency of the PCR. In the reaction with the impure dNTPs this dependency cannot be observed, as all conditions produce about the same fluorescent signal trace.

Example 13: qPCR of DNA templates with pure vs. impure dNTPs at varying template concentrations

The QIAGEN OneStep RT-PCR Kit (QIAGEN GmbH, Hilden, Germany) was used. dNTPs were either from the Qiagen kit or FabricNano batches at a stock concentration of 10 mM. qTOWER³ 84 from Analytik Jena (Jena, Germany) was used. As readout the Optical Cartridge Type “Color module 1 (470 nm/520 nm), FAM” (Gain 3) was used for detection as the qPCR probe was labeled with fluorescein. All reactions were performed in triplicates the values were averaged and the error bars represent the standard deviation.

The protocol for the qPCR was the following:

A typical qPCR reaction was between 20 and 50 ul and contained the following components:

All DNA was synthesised by IDT (Integrated DNA Technologies, Iowa, USA). The primers and probes were either a ready to go solution from IDT (2019-nCoV RUO Kit) or mixed to a final concentration of 6.7 uM primers and 1.7 uM probe.

Sequences (5’-3’):

Results and interpretation

The results are shown in Figure 5. qPCR reactions with varying amounts of template DNA were run with pure and impure dNTPs in parallel. An increase in fluorescence can be detected when the PCR is amplifying the template DNA. A fluorescent probe, which is quenched when annealed to the template strand is partially displaced and cleaved upon DNA synthesis of the polymerase. In the reactions with the pure dNTPS (Qiagen), template copy numbers from 1 to 1000 could be detected. In the reaction with the impure dNTPs a positive fluorescent signal could be detected from reactions with 10 to 1000 copy numbers of the template. Hence, the qPCR with pure dNTPs is more sensitive under the tested conditions. Example 14: qPCR of DNA templates with pure vs. three impure dNTPs batches

The QIAGEN OneStep RT-PCR Kit (QIAGEN GmbH, Hilden, Germany) was used. dNTPs were either from the Qiagen kit (pure), FabricNano batches (impure) at a stock concentration of 10 mM. Each batch was labelled dNTPs I (FN), dNTPs II (FN), dNTPs III (FN). AriaMx Real time PCR System from Agilent (Santa Clara, CA, United States) was used for all experiments. As readout the Optical Cartridge Type “SYBR/FAM” was used for detection as the qPCR probe was labeled with fluorescein. All reactions were performed in triplicates the values were averaged and the error bars represent the standard deviation.

The protocol for the PCR was the following:

A typical qPCR reaction was between 20 and 50 ul and contained the following components:

Different DNA templates were used: positive control: 2019-nCoV_N, negative control: Hs_RPP30. All DNA was synthesised by IDT (integrated DNA Technologies, Iowa, USA). The primers and probes were either a ready to go solution from IDT (2019-nCoV RUO Kit) or mixed to a final concentration of 6.7 uM primers and 1.7 uM probe.

Sequences (5’-3’):

Results and interpretation

The results are shown in Figure 6. qPCR reactions with varying batches of impure dNTPs and one batch of pure dNTPs were run in parallel to investigate batch to batch variability of impure dNTPs. Three different batches of impure dNTPs were labelled dNTPs I (FN), dNTPs II (FN), dNTPs III (FN). An increase in fluorescence can be detected when the PCR is amplifying the template DNA. A fluorescent probe, which is quenched when annealed to the template strand is partially displaced and cleaved upon DNA synthesis of the polymerase. There was no difference observed between the reactions with different batches of impure dNTPs. Similar to the pure dNTPs all reactions with a positive template, primers and dNTPs produced a fluorescent signal after cycle 25.

Example 15: qPCR of DNA templates with pure vs. impure dNTPs after up to 20 freeze and thaw cycles of dNTPs The QIAGEN OneStep RT-PCR Kit (QIAGEN GmbH, Hilden, Germany) was used. dNTPs were either from the Qiagen kit (pure), FabricNano batches (impure) at a stock concentration of 10 mM. AriaMx Real-time PCR System from Agilent (Santa Clara, CA, United States) was used for all experiments. As readout the Optical Cartridge Type “SYBR/FAM” was used for detection as the qPCR probe was labeled with fluorescein. The protocol for the PCR was the following:

A typical qPCR reaction was between 20 and 50 ul and contained the following components:

Different DNA templates were used: positive control: 2019-nCoV_N, negative control: Hs_RPP30. All DNA was synthesised by IDT (Integrated DNA Technologies, Iowa, USA) The primers and probes were either a ready to go solution from IDT (2019-nCoV RUO Kit) or mixed to a final concentration of 6.7 uM primers and 1.7 uM probe. To assay the freezing and thawing stability of dNTPs, 4.8 ul of 10 mM dNTPs were aliquoted and frozen at -80 °C for 3 minutes. Next, aliquots were thawed at room temperature for 2 minutes. Then, 1 aliquot was taken after each thawing cycle and the remainder was frozen again. This was repeated until 20 cycles were completed. Sequences (5’-3’):

Results and interpretation

The results are shown in Figure 7. qPCR reactions with pure and impure dNTPs were run in parallel to investigate freeze and thaw stability of the dNTPs. Before the reactions were run dNTPs were frozen and thawed up to 20 times. An increase in fluorescence can be detected when the PCR is amplifying the template DNA. A fluorescent probe, which is quenched when annealed to the template strand is partially displaced and cleaved upon DNA synthesis of the polymerase. All reactions with a positive template, primers and dNTPs produced a fluorescent signal after cycle 25. There was no difference observed between the reactions, independent of their purity and freeze/thaw cycle. This result shows the same resistance against freezing and thawing of dNTPs.

Example 16: qPCRof DNA templates with pure vs. impure dNTPs after incubating dNTPs at 50°C up to 11 days

The QIAGEN OneStep RT-PCR Kit (QIAGEN GmbH, Hilden, Germany) was used. dNTPs were either from FabricNano batches (impure) or from NEB (New England Biolabs, Ipswich, Massachusetts, United States) (pure) at a stock concentration of 10 mM. AriaMx Real-time PCR System from Agilent (Santa Clara, CA, United States) was used for all experiments. As readout the Optical Cartridge Type “SYBR/FAM” was used for detection as the qPCR probe was labeled with fluorescein. All reactions were performed in triplicates the values were averaged and the error bars represent the standard deviation. The protocol for the PCR was the following:

A typical qPCR reaction was between 20 and 50 ul and contained the following components:

Different DNA templates were used: positive control: 2019-nCoV_N, negative control: Hs_RPP30. All DNA was synthesised by IDT (Integrated DNA Technologies, Iowa, USA). The primers and probes were either a ready to go solution from IDT (2019-nCoV RUO Kit) or mixed to a final concentration of 6.7 uM primers and 1.7 uM probe.

To assess the stability of dNTPs 50 ul aliquots were incubated at 50 °C up to 11 days. At certain days (0, 1, 2, 3, 4, 7, 9, 11 days) one aliquot was removed from the incubation and stored at -20 °C until further analysis.

Sequences (5’-3’):

Results and interpretation

The results are shown in Figure 8. qPCR reactions with varying batches of impure dNTPs and one batch of pure dNTPs were run in parallel to investigate the stability of dNTPs after incubating them at 50 °C. Before the reactions were run, dNTPs were incubated at 50 °C for up to 11 days. An increase in fluorescence can be detected when the PCR is amplifying the template DNA. A fluorescent probe, which is quenched when annealed to the template strand is partially displaced and cleaved upon DNA synthesis of the polymerase. All reactions with a positive template, primers and dNTPs produced a fluorescent signal after cycle 25. There was no difference observed between the reactions, independent of their purity and incubation time at 50 °C. This result shows the possibility to ship and store dNTPs at 50 C or lower for longer periods of time. Example 17: qPCR of Ebola DNA template with pure vs. impure dNTPs at varying template concentrations

The QIAGEN OneStep RT-PCR Kit (QIAGEN GmbH, Hilden, Germany) was used. dNTPs were either from the Qiagen kit (pure), FabricNano batches (impure) at a stock concentration of 10 mM. AriaMx Real-time PCR System from Agilent (Santa Clara, CA, United States) was used for all experiments. As readout the Optical Cartridge Type “SYBR/FAM” was used for detection as the qPCR probe was labeled with fluorescein. All reactions were performed in triplicates the values were averaged and the error bars represent the standard deviation.

The protocol for the PCR was the following:

A typical qPCR reaction was between 20 and 50 ul and contained the following components:

Different DNA templates were used: positive control: EBOV2, negative control: Hs_RPP30. Ail

DNA was synthesised by IDT (Integrated DNA Technologies, iowa, USA). The primers and probes were mixed to a final concentration of 6.7 uM primers and 1.7 uM probe.

Sequences (5’-3’):

Results and interpretation

The results are shown in Figure 9. qPCR reactions with impure and pure dNTPs were run in parallel to investigate if the method with impure dNTPs can be transferred to other template DNA (here: Ebola) than Covid. An increase in fluorescence can be detected when the PCR is amplifying the template DNA. A fluorescent probe, which is quenched when annealed to the template strand is partially displaced and cleaved upon DNA synthesis of the polymerase. Both reactions, with pure and impure dNTPs, were able to detect 10000 and 1000 copies of the DNA template. The increase in fluorescence was for both reactions (pure/impure) similar for the same copy number of the template. This result indicates that the qPCR method with impure dNTPs can be transferred to other DNA targets.

Example 18: qLAMP of DNA templates with pure vs. different batches of impure dNTPs Reagents from NEB (New England Biolabs, Ipswich, Massachusetts, United States) were used. dNTPs were used either from FabricNano batches (impure) or from NEB (pure) at a stock concentration of 10 mM. AriaMx Real-time PCR System from Agilent (Santa Clara, CA, United States) was used for all experiments. As readout the Optical Cartridge Type “SYBR/FAM” was used for detection. All reactions were performed in triplicates the values were averaged and the error bars represent the standard deviation.

The protocol for the LAMP was the following:

A typical LAMP reaction was between 20 and 50 ul and contained the following components:

For the detection limit determination, varying amounts of DNA templates were added to the LAMP reaction (1, 10, 100, 1000, 10000 copies). Different DNA templates were used: positive control: 2019-nCoV_N, negative control: Hs_RPP30. All DNA was synthesised by IDT (Integrated DNA Technologies, Iowa, USA). The LAMP primers were mixed to a 10x master mix solution with the following final concentrations: 16 uM GeneN-A-FIP/GeneN-A-BIP, 4 uM GeneN-A-LF/GeneN-A-LB amd 2 uM GeneN-A-F3/GeneN-A-B3.

Sequences (5’-3’):

Results and interpretation

The results are shown in Figure 10. qLAMP reactions with varying batches of impure and one batch of pure dNTPs were run in parallel to investigate if the qPCR with impure dNTPs can be transferred to other DNA amplification methods. An increase in fluorescence can be detected when the LAMP is amplifying the template DNA. A fluorescent dye attaches to double stranded DNA. An increase in DNA production results in an increase of the fluorescent signal. LAMP reactions with different batches of impure dNTPs produce at different times an increase in the fluorescent signal. For the pure dNTPs a fluorescent signal was observed after ca. 12 minutes, for impure dNTP batch 1 after ca. 14 minutes, batch 2 after ca. 16 minutes, batch 3 after ca. 13 minutes. This result shows that in principle LAMP reactions work with impure dNTPs, however, pure dNTPs result in a faster reaction.

Both reactions, with pure and impure dNTPs, were able to detect between 10 and 10000 copies of the DNA template. This results indicates that the qPCR method with impure dNTPs can be transferred to other methods such as qLAMP, while maintaining the same sensitivity.

Selected references

Bao, J., & Ryu, D. D (2007) Total biosynthesis of deoxynudeoside triphosphates using deoxynucleoside monophosphate kinases for PCR application. Biotechnology and bioengineering , 98(1), 1-11.

Burke et a/ 2018 (Proceedings of the National Academy of Sciences, 115(5), 980-985.), “DNA synthesis from diphosphate substrates by DNA polymerases”

Ducani et ai 2013 (Nature methods, 10(7), 847.) Enzymatic production of monoclonal stoichiometric'singie-stranded DNA oligonucleotides. Joneja, A., & Huang, X. (2011). Linear nicking endonuclease-mediated strand-displacement DNA amplification. Analytical biochemistry. 414(1), 58-89

Gerrard et al. 2012 {Acs Nano, 6(10), 9221-9228.) A new modular approach to nanoassembly: stable and addressable DNA nanoconstructs via orthogonal click chemistries. Fairman, J. W., Wijerathna, S. R., Ahmad, M. F., Xu, H., Nakano, R., Jha, S., ... & Nordlund, P. (2011). Structural basis for allosteric regulation of human ribonucleotide reductase by nucleotide-induced oligomerization. Nature structural & molecular biology, 18(3), 316.

Fu 2012, “Interenzyme substrate diffusion for an enzyme cascade organized on spatially addressable DNA nanostructures”

Kearney et al (Advanced Materials 28(27) February 2016) “DNA Origami: Folded DNA- Nanodevices That Can Direct and Interpret Cell Behavior”

Ladner, W. E., & Whitesides, G. M. (1985). Enzymic synthesis of deoxyATP using DNA as starting material. The Journal of Organic Chemistty, 50(7), 1076-1079. Liu 2016, “A Three-Enzyme Pathway with an Optimised Geometric Arrangement to Facilitate Substrate Transfer”

Marth 2017 “Precision Templated Bottom-Up Multiprotein Nanoassembly through Defined Click Chemistry Linkage to DNA”

Rosier 2019 “A DNA-based synthetic apoptosome” Song 2018 “Self-assembly of a magnetic DNA hydrogel as a new biomaterial for enzyme encapsulation with enhanced activity and stability”

Tikhomirov, G., Petersen, P., & Qian, L. (2017). Fractal assembly of micrometre-scale DNA origami arrays with arbitrary patterns. Nature, 552(7683), 67-71.

Wang et al 2012 (Journal of Biological Chemistry, 287(34), 28215-28226 ) “Structural factors that determine selectivity of a high fidelity DNA polymerase for deoxy-, dideoxy-, and ribonucleotides”.

Zhang 2016, “Proximity does not contribute to activity enhancement in the glucose oxidase- horseradish peroxidase cascade”

Zhang 2017, “Increasing Enzyme Cascade Throughput by pH-Engineering the Microenvironment of Individual Enzymes”

Zhao 2016, “Nanocaged enzymes with enhanced catalytic activity and increased stability against protease digestion”

Claims

CLAIMS:

1. An in vitro method of synthesizing DNA from dNTPs using a DNA polymerase, from a reaction mixture comprising dNTPs and one or more impurities from the enzymatic conversion of rNTPs to dNTPs.

2. An in vitro method according to claim 1, wherein the dNTPs form between 1% and 99.9% of the total NTPs in the reaction mixture, between 10% and 99% of the total NTPs, between 20% and 95% of the total NTPs, less than 95% of the total NTPs, less than 90% of the total NTPs, less than 80% of the total NTPs, or between 40% and 80% of the total NTPs; typically wherein the dNTPs form between 90% and 99% of the total NTPs in the reaction mixture or between 90 and 98.5% of the total NTPs in the reaction mixture.

3. An in vitro method according to claim 1 or claim 2, wherein 1 , 2, 3 or 4 of the dNTPs in the reaction mixture are the product of the enzymatic conversion to dNTPs, optionally wherein: the dNTPs are the direct product of the enzymatic conversion; and/or the dNTPs are not purified to remove non-dNTP contaminants, optionally by HPLC; and/or the conversion is carried out by a ribonucleotide reductase and/or thymidylate synthase and/or nucleotide kinase.

4. An in vitro method according to claim 3, wherein the enzymatic conversion is incomplete, optionally wherein at least 2%, at least 5%, at least 10%, at least 20%, at least 40% or at least 60% of the rNTPs, or between 0.1% and 10% of the rNTPs, are not converted and remain in the mixture.

5. An in vitro method according to any preceding claim, wherein the reaction mixture comprises one or more other non-dNTP agents.

6. An in vitro method according to claim 5, wherein a non-dNTP agent is a ribonucleotide reductase or nucleotide kinase.

7. An in vitro method according to claim 5, wherein a non-dNTP agent is a ribonucleotide monophosphate (rNMP), ribonucleotide diphosphate (rNDP), ribonucleotide triphosphate (rNTP), deoxyribonucleotide monophosphate (dNMP), deoxyribonucleotide diphosphate (dNDP), deoxynucleotide tetraphosphate, dideoxynucleotide triphosphate (ddNTP), pyrophosphate or other inorganic contaminant.

8. An in vitro method according to any preceding claim, wherein at least 1%, at least 5%, at least 10%, at least 20%, between 20% and 40%, or at least 50% of the dNTPs in the reaction mixture are polymerised into DNA.

9. An in vitro method according to any preceding claim, wherein the DNA polymerase is a high fidelity polymerase or a selective polymerase, optionally wherein: the polymerase has an error rate of less than 1 per 7500 bases; and/or the polymerase has a selectivity of at least 10,000 fold preference for dNTPs over rNTPs, or at least a 1,000,000 fold preference for dNTPs over rNTPs.

10. An in vitro method according to any preceding claim, wherein the DNA polymerase is a strand-displacing DNA polymerase, a F29 polymerase, a Bacillus stearothermophilus DNA polymerase or a large (Klenow) fragment of DNA polymerase I, or a Taq polymerase.

11. An in vitro method according to any preceding claim, wherein the method comprises: rolling circle amplification, strand displacement amplification, or polymerase chain reaction; and/or wherein the template is DNA or RNA.

12. An in vitro method according to any preceding claim, wherein the DNA that is synthesized is used in: (i) nucleic acid sequencing; (iii) molecular cloning; (iv) medical diagnostics; (v) a nucleic acid vaccine; (vi) a self-replicating system; (vii) the assembly of a DNA nanostructure; or (viii) a biosensor.

13. An in vitro method according to claim 12(vii), comprising the step of attaching one or more functional molecules to the nanostructure.

14. An in vitro method according to claim 13, wherein at least one functional molecule is a protein, optionally an enzyme.

15. An in vitro method according to any of claims 12 to 14, wherein the nucleic acid nanostructure comprises or consists of nucleic acid origami, nucleic acid bricks, nucleic acid crystal or nucleic acid hydrogel, or a hybrid thereof.

16. An in vitro method according to any of claims 12 to 15, wherein the nucleic acid nanostructure comprises a single functional molecule, between 1 and about 100,000 functional molecules, between about 1 and about 50,000 functional molecules, between about 1 and about 25,000 molecules, or between about 1 and about 10,000 molecules.

17. An in vitro method according to any of claims 1 to 16, wherein the nucleic acid amplification reaction is used as a DNA sensor.

18. An in vitro method according to any of claims 1 to 11 , wherein the nucleic acid synthesis is part of a method of sequencing-by-synthesis.

19. DNA obtained or obtainable by the method of any of claims 1 to 16.

20. A kit for synthesizing DNA, comprising a reaction mixture comprising: an individual impure dNTP selected from dATP, dCTP, dTTP, and dGTP;or a pooled set of 2, 3 or 4 impure dNTPs; or a polymerase and impure dNTPs; or a polymerase, impure dNTPs, buffers and probes required for an amplification reaction.

21. A kit according to claim 20, wherein the DNA to be synthesised is a DNA nanostructure, optionally wherein the kit also comprises one or more functional molecules for attachment to the nanostructure.

22. A method of making dNTPs for use as a reaction mixture for the synthesis of nucleic acid, optionally for synthesis of the nucleic acids that can be self-assembled to form a nucleic acid nanostructure, comprising: contacting rNTPs with a ribonuclease reductase and/or nucleotide kinase under conditions in which the ribonuclease reductase and/or nucleotide kinase are active and convert a proportion of the rNTPs into dNTPs, wherein less than 100% of the rNTPs are converted to dNTPs, optionally wherein less than 80% of the rNTPs are converted to dNTPs, or wherein less than 60% of the rNTPs are converted to dNTPs.

23. A mixture of dNTPs and rNTPs that is obtained or obtainable from the method of claim 22.

24. Use of the mixture of dNTPs and rNTPs according to claim 23, in the synthesis of nucleic acid or a nucleic acid nanostructure.

25. A qPCR or qLAMP diagnostic assay wherein the DNA synthesis step is carried out by a method according to any of claims 1 to 10.

26. A qPCR or qLAMP diagnostic assay according to claim 25, wherein the assay diagnoses the presence or absence of a viral infection in a subject.