WO2011123021A1

WO2011123021A1 - Method for determining the amount of dntp

Info

Publication number: WO2011123021A1
Application number: PCT/SE2011/050315
Authority: WO
Inventors: Fredrik Tholander; Britt-Marie SJÖBERG
Original assignee: Fredrik Tholander; Sjoeberg Britt-Marie
Priority date: 2010-03-31
Filing date: 2011-03-22
Publication date: 2011-10-06

Abstract

The present invention is directed to ribonucleotide reductases (RNR) and methods for the determination of the enzymatic activity thereof and for determination of the amount of dNTP(s) in a sample. The methods of the invention are based on a PCR reaction wherein the PCR mixture comprises the necessary deoxyribonucleotides except the deoxyribonucleotide potentially formed by the RNR. By determining the amount of DNA formed in the PCR reaction, one may determine either the enzymatic activity of the RNR or the amount of dNTP formed by an RNR.

Description

METHOD FOR DETERMINING THE AMOUNT OF dNTP

Technical field of invention

The present invention is concerned with ribonucleotide reductases (RNR) and methods for the determination of the enzymatic activity thereof and for determination of the amount of dNTP(s) in a sample. The invention is of particular importance for the development of drugs targeted to RNR.

Background of invention

The enzyme RNR supplies the building blocks for DNA synthesis (deoxyribonucleotides) and is therefore essential for cell proliferation and life. Due to its fundamental biological role the enzyme is present in all free living organisms as well as several viruses. The enzyme has been extensively studied and its fundamental role in the synthesis of deoxyribonucleotides for DNA synthesis is well described.

RNR catalyzes the reduction of ribonucleotides, i.e. NDPs or NTPs, into the corresponding deoxyribonucleotides, i.e. dNDP or dNTP. When NDPs are the substrates, the dNDPs produced by the action of RNR have to be phosporylated so that the corresponding dNTPs are produced before they can be used as a substrates for DNA synthesis, as only dNTPs can act as building blocks for DNA. The RNR enzyme can reduce all four ribonucleotide substrates and exhibits a sophisticated allosteric regulation to produce dNTPs/dNDPs in amounts balanced for the cellular need. This activity constitutes the only path for de novo synthesis of deoxyribonucleotides [ 1 ; 2] . An alternative source of deoxyribonucleotides for DNA synthesis is supplied via the so-called salvage pathway; basically deoxyribonucleotides derived from degraded cells. However, this pathway is not sufficient to support DNA replication associated with cell division. Hence, RNR is an absolute prerequisite for cell proliferation and life.

Specifically, RNR catalyzes the reduction of the 2'-hydroxide of ribonucleotides into the 2'- hydrogen of deoxyribonucleotides. This reaction is based on radical chemistry and different RNR subtypes have evolved different strategies for radical generation, which all depend on different cofactors [3; 4] .

The specific cofactor dependence of different RNR enzymes has led to a classification of RNR into three main classes, class I-III. RNR enzymes belonging to class I use a diiron-oxygen cluster, class II a deoxyadenosyl-cobalamin cofactor, and class III needs a specific activase with a 4Fe-4S iron-sulfur cluster and the S-adenosyl methionine cofactor for radical generation. In addition, some RNR enzymes use ribonucleoside diphosphates (NDPs, i.e. ADP, CDP, GDP and UDP and other ribonucleoside triphosphates (NTPs, i.e. ATP, CTP, GTP and UTP) as substrates. While all class I enzymes use NDPs as substrates, some class II enzymes use NDPs and other class II enzymes use NTPs, and the class III enzymes use only NTPs [3; 4] . The products of the RNR reaction are the corresponding deoxyribonucleotides, i.e. dNDPs (dADP, dCDP, dGDP and dUDP) or dNTPs (dATP, dCTP, dGTP and dUTP). In the cell, when dUTP is produced, it is transformed into dTTP via thymidylate synthetase before incorporation into DNA. Consequently, cellular dNTP pools contains dCTP, dTTP, dATP and dGTP.

To assure high-fidelity replication and repair of the genetic material the intracellular concentrations of the building blocks of DNA must be kept at appropriate concentrations. The total amount of dNTPs in the cell is referred to as the dNTP pool. Different cellular growth states exhibit different requirement, for instance, dividing cells have a much higher amount of dNTP compared to resting cells which mainly need dNTPs for DNA repair. This balance of dNTP pools must be controlled by the cellular machinery of all organisms. In eukaryotes there is also an additional need to control the levels of dNTP pools required by the mitochondria, which have their own genome, their own DNA polymerase, and divide throughout the whole cell cycle. Mitochondrial (and chloroplastic) DNA synthesis is dependent on the dNTPs produced in the cytosol. RNR is the major factor that controls the de novo synthesis of deoxyribonucleotides (dNTPs or dNDPs, depending on the specific RNR). The enzyme exhibits a sophisticated allosteric regulation and synthesizes deoxyribonucleotides in amounts balanced for the cellular need. Other control mechanisms for the dNTP pool levels include e.g. regulation of RNR gene expression and reuse of deoxyribonucleotides derived from degraded cells in the extracellular media. In this so-called salvage pathway, various kinases and import systems are possible regulators. Importantly, only de novo synthesis catalyzed by RNR can provide sufficient levels of dNTPs to support DNA replication. For the mitochondria and cloroplasts, deoxyribonucleotides are imported from the cytosol and the action of various kinases controls the level of dNTP pools. It is well established that unbalanced dNTP pools, as well as pathologically increased dNTP pools, lead to increased mutational rates and is therefore deleterious to the cell. The most obvious consequence of this event is cancer but there are also a number of diseases that are caused by malfunction of the mitochondria, whose replication and function also depends on well balanced dNTP pools [ 1 ; 2; 5; 6] . Some intracellular pathogens are known to disrupt the balance in the dNTP pools. This is of course a strategy of the pathogen to provide building material for its own replication but might also be mutagenic to the host cell. In addition, drugs such as nucleoside analogues (used for treatment of e.g. HIV and cancer) may cause changes in the dNTP pools. Besides being mutagenic to the host this might also affect the mutational frequency of viruses, thus adding to the problem of drug resistance.

Determination of dNTP pools constitutes a potential diagnostic tool for cancers that are associated with changes in cellular dNTP pools. The study of dNTP pools is also of interest in preclinical studies of the effects of drugs on DNA metabolism . Thus, the study of dNTP pool fluctuations throughout the cell cycle under various conditions constitutes a versatile field of research with many different applications ranging from basic biological research to applied clinical studies. The complexity and low throughput of available methods for studies of dNTP pools is an obstacle hampering research in this area. The study of dNTP pools is generally difficult since these compounds are chemically very similar to their corresponding NTPs and commonly present in lower amounts, thus separation between these two groups of compounds is not straightforward. In the study of dNTP pools, dNTPs first need to be extracted from the cells; a few methods which are very similar exist for this purpose [7; 8; 9; 10; 11 ; 12; 13] . The general procedure for the extraction of dNTPs from samples can be outlined as follows:

1. Cell harvest. Cells not in tissue are collected by e.g. filtration or centrifugation. Cells grown on solid surface are collected with a cell scraper.

2. Cell lysis. Resuspend collected cells, or homogenize tissue, in lysis buffer. The lysis buffer contains chemicals that achieve cell lysis by various means, e.g. ethanol, tri-carboxylic acid, boiling water, acetonitrile, detergents, sodium dodeecylsulphate (SDS). Lysis by mechanical means are also possible, e.g. ultra sonication or pressure disruption.

3. Removal of cell debris. Macromolecules etc are removed by e.g. centrifugation leading to sedimentation of macromolecules while the dNTPs of interest are left in solution.

3a. Enrichment of dNTPs. dNTPs may be extracted from the sample by two-phase separation techniques, e.g. by trioctylamine/Freon (22 : 78 v/v) extraction. The extracted dNTPs may be concentrated by evaporation of the remaining solvent and subsequently dissolved in water.

4. Analysis of dNTP contents by various methods. Subsequent studies of the amount of each dNTP, both in relative and absolute terms, are traditionally performed according to two basic principles; HPLC analysis or a DNA polymerase elongation assay (Fig. 1A). In the former, each dNTP is separated and quantified using an HPLC system [ 14] while the latter relies on DNA polymerase-incorporation of radiolabeled dNTPs into DNA [15]. Quantification using the HPLC method relies on the use of an internal standard or by comparison with an external standard curve. There are also methods that rely on HPLC coupled to masspectrometry, LC-MS/MS. All HPLC-based methods are rather slow processes that require sophisticated equipment and specialized know-how on how to use the equipment. In addition, quantification of a single sample generally takes up to an hour and samples cannot be run in parallel.

The DNA polymerase assay involves incorporation of radiolabeled dNTPs (which is both hazardous and expensive) into a DNA template. Subsequent quantification of radiolabeled DNA requires an additional purification/separation step (with respect to the initial extraction of dNTP from the cells) in which the formed high molecular weight DNA is separated from the remaining radioactive dNTPs of the sample. This purification step normally relies on DNA blotting, precipitation or similar. The actual quantification relies on measurements of radiolabeled DNA, which is related to the amount of radiolabeled dNTP. Since RNR is present throughout all free-living organisms, as well as several viruses, it has a great pharmaceutical potential in a variety of fields, e.g. as a drug target in anticancer therapy, as an antimicrobial drug target in both humans as well as animals, as an antiparasite drug target and as a target in plant pathogens.

Currently there are only a handful of drugs targeting RNR on the market and all are used in cancer therapies. However, these drugs are associated with severe side-effects due to low specificities and the drugs generally affect an array of enzymes with similar chemical properties as RNR. The low specificity of current approved drugs stems from the fact that all are substrate analogues or radical scavengers (exploring the fact that the reaction mechanism of RNR depends on radical formation) or iron chelators (exploring the fact that the class I RNRs harbor a diiron cluster), molecular properties that are not unique for mammalian RNR. Therefore, there is a need to identify novel lead compounds that explore other parts of chemical space.

Even though RNR has been under study for several decades there are some marked difficulties associated with studies of this enzyme, which has not been solved. One difficulty is

determination of its enzymatic activity. All present methods are very labour intense and time consuming and only a few samples can be analyzed per day. Commonly, standard procedures include chromatographic separation of product and substrate and radioactivity-based quantification [16; 17] . The difficulties associated with determination of the enzymatic activity of this enzyme have hampered drug development efforts in larger scale. Therefore there is an urgent need for an easy, robust and rapid method to assay RNR that can be used e.g. for high throughput screening (HTS).

Summary of invention

A subject of the present invention is to provide new methods for studying the activity of RNR enzymes. Such methods are e.g. useful in the development of drugs targeted to RNR.

In a first aspect the invention is directed to a method for determining the amount of a

deoxyribonucleotide potentially formed by an RNR comprising

a) providing a sample potentially comprising a deoxyribonucleotide formed by an RNR in vivo or in vitro

b) mixing said sample potentially comprising said deoxyribonucleotide with reagents necessary for a PCR, comprising the necessary deoxyribonucleotides except the

deoxyribonucleotide potentially formed in vivo or in vitro by the RNR, and a DNA polymerase,

c) performing a PCR,

d) determining the amount of DNA formed, whereby the amount of DNA formed is proportional to the amount of limiting dNTP and thus indicative of the amount of said potentially formed deoxyribonucletide

wherein step b) is preceded by the step a") of incubating the deoxyribonucleotide potentially formed in step a) with an NDPK in case said RNR uses NDP as substrate. The invention is also directed to a method for determining the enzymatic activity of an RNR comprising

a') exposing an RNR to a ribonucleotide whereby the corresponding deoxyribonucleotide is formed to a degree potentially approaching zero, depending on the enzymatic activity of said RNR,

b) mixing the potentially formed deoxyribonucleotide of step a') with reagents necessary for a PCR, said reagents comprising the necessary deoxyribonucieotides except the

deoxyribonucleotide potentially formed by the RNR in step a), and a DNA polymerase, c) performing a PCR,

d) determining the amount of DNA formed, whereby the amount of DNA formed is proportional to the amount of limiting dNTP and thus indicative of the enzymatic activity of said RNR

wherein step b) is preceded by the step a") of incubating the deoxyribonucleotide potentially formed in step a') with an NDPK in case said RNR uses NDP as substrate.

The invention is also directed to a method for determining the amount of a dNTP in a dNTP pool comprising the steps of

a'") extracting dNTPs from a prokaryotic or eukaryotic cell, a tissue or an organism a'"") providing four different PCR mixtures, each comprising three dNTPs and a DNA polymerase, each PCR mixture lacking one different dNTP

b) mixing the extracted dNTP of step a'") with each of the four PCR mixtures of step a'"") so that each PCR mixture comprises three dNTPs in excess and the fourth only being provided via the cell extract of step a'") and consequently being present in limiting amount

c) performing four separate PCRs

d) determining the amount of DNA formed in each of the four PCRs of step c), whereby the amount of DNA formed is proportional to the amount of limiting dNTP and thus indicative of the amount of the limiting dNTP in each of the four PCRs. In order to study the effect of a substance on RNR one may subject said RNR to a substance potentially affecting its enzymatic activity before or simultaneously with performing the first step in the above methods.

The invention is also directed to the use of a PCR reaction for determining the amount of a deoxyribonucleotide in a sample and the use of a PCR reaction for determining the enzymatic activity of an RNR.

The above methods allow a rapid and easy determination of the enzymatic activity of an RNR or the amount of deoxyribonucieotides formed by an RNR enzyme (Fig. IB) . Thus the method is particularly advantageous compared to currently available methods as it is rapid to perform and is suitable for the analysis of many samples in parallel. Brief description of drawings

Figure 1A. Overview of currently available methods for determination of the amount of dNTPs in dNTP pools and the new method of the present invention (to the right). For all methods dNTPs are extracted from the cells to be investigated. Subsequently, the amounts of dNTP in the cellular extracts are determined by various methods. The method of the present invention simply involves four parallel PCRs, each with one dNTP missing, to determine the amount of dNTPs via quantification of DNA formed in the PCR. In contrast to the old methods, the new method does not require an additional separation step of deoxyribonucleotides, and is suitable for 96-well plates.

Figure IB. Outline of method for determining enzymatic activity of RNR.

An enzymatic reaction with RNR and a substrate nucleotide is performed. If the RNR of choice uses (//phosphate nuclotides as substrate, the enzyme nucleoside diphosphate kinase (NDPK) is added after the RNR reaction to convert the formed dNDPs into dNTP. A POLYMERASE CHAIN REACTION (PCR) with one dNTP missing (the one corresponding to the substrate used in the RNR reaction) is performed and formed DNA is quantified. The amount of formed DNA is related to the amount of dNTP formed in the RNR reaction. In this example reaction dCTP is supplied via the RNR reaction and the remaining dNTPs supplied in the PCR reaction mixture.

Figure 2A. The figure demonstrates the method of PCR-based detection of dNTPs. As indicated in the figure, within a set of 7 PCR runs, for each limiting deoxyribonucleotide increasing amounts of one dNTP (dCTP, dUTP, dATP, dGTP or dTTP) was added to different samples, and the remaining three dNTPs at a constant concentration of ΙΟΟμΜ. For, dCTP and dGTP, PCR product formation is visible down to 0.5μΜ, for dATP and dTTP to 2μΜ, and for dUTP to 8μΜ ; at zero concentration of dNTP no PCR product is detected. The template used in the PCR had a GC- content of approximately 35%, which reflects the level of detection for the different nucleotides. DNA (ca. 180 bp) from the PCR was separated on an ethidium bromide-containing (O^g/ml) agarose gel (2%) for 35 min at 100 Volts. Photographic visualization of DNA was achieved upon UV-excitation of ethidium bromide-stained DNA.

Figure 2B. Fluorescence of SYBR green-stained DNA from PCRs with limiting amount of dCTP, dGTP, dATP, dUTP and dTTP. Fluorescence was recorded on a Polarstar Omega plate reader (BMG Labtech GmbH) with excitation set to 485nm and emission monitored at 520nm. For each sample to be measured, a 10μΙ aliquot from the PCRs was mixed with 190μΙ SYBR green (diluted to 2xworking solution from the purchased stock solution of lO.OOOxworking solution) dissolved in TAE buffer (40mM Tris-Acetate and 2mM EDTA at pH 9). FI is fluorescence intensity.

Figure 3. Comparison of PCRs containing 1, 2, 4, 6, 12 and 15 μΜ of either dCTP or dCDP in which NDPK were used to catalyze conversion of dCDPs into dCTPs. The three remaining dNTPs of each PCR were present at ΙΟΟμΜ . Top panel, DNA (ca. 180 bp) from the PCR separated on an ethidium bromide-containing

agarose gel (2%) for 35 min at 100 Volts. Photographic visualization of DNA was achieved upon UV-excitation of ethidium bromide-stained DNA. Lower panel, fluorescence recorded on an Polarstar Omega plate reader (B G Labtech GmbH) with excitation set to 485nm and emission monitored at 520nm. For each sample to be measured, a ΙΟμΙ aliquot from the PCRs were mixed with 190μΙ SYBR green (diluted to 2xworking solution from the purchased stock solution of lO.OOOxworking solution) dissolved in TAE buffer (40mM Tris-Acetate and 2mM EDTA at pH 9). FI is fluorescence intensity.

Figure 4. Demonstration of PCR-based detection of RNR activity for different RNR enzymes using either di- or tri-phosphate ribonucleosides (NDPs/NTPs) as substrates.

A. The figure demonstrates PCR-based detection of dNTP formed by an RNR that utilizes ribonucleoside diphosphates as substrate; Class I RNR from E. coli which consists of the two subunits NrdA and NrdB. 0.6μΜ NrdB and 0.05, 0.1 or 0.2 μ NrdA was incubated with 500 μΜ CDP for 20, 30, or 45 minutes to form dCDP. NDPK was subsequently added and incubation performed to form dCTP prior to the PCR. Reference reaction mixtures with identical constituents as in the test samples but with inactivated enzymes (at the highest concentration used in the test samples) and known amounts of substrate and product corresponding to 20% substrate conversion were also prepared. A 5μΙ aliquot from each sample was used for PCR in a total volume of 25μΙ. Top panel, PCR products were visualized by ethidium bromide staining after separation of DNA by agarose gel electrophoresis. Lower panel, 10μΙ aliquots from each RNR reaction was mixed with 190μΙ SYBR green and fluorescence recorded.

B. The figure demonstrates PCR-based detection of dNTP formed by an RNR that utilizes ribonucleoside triphosphates as substrate; Class II RNR from P. aeruginosa which consists of the two subunits NrdJa and NrdJb. 2, 4 or 6μΙ NrdJa and NrdJb was incubated with Im CTP for 90 minutes to form dCTP. Reference samples were prepared as described in A. A 5μΙ aliquot from each sample was used for PCR in a total volume of 25μΙ.

Top panel, PCR products were visualized by ethidium bromide staining after separation of DNA by agarose gel electrophoresis. Lower panel, 10μΙ aliquots from each RNR reaction mixture was mixed with 190μΙ SYBR green and fluorescence recorded.

C. The figure demonstrates PCR-based detection of dNTP formed by an RNR that utilizes ribonucleoside diphosphates as substrate; Class I RNR from P. aeruginosa which consists of the two subunits NrdA and NrdB. Ι .ΟμΜ NrdB and 0.5, 1.0 or 2.0 μΜ NrdA was incubated with 500 μΜ CDP for 60 minutes to form dCDP. NDPK was subsequently added and incubation performed to form dCTP prior to the PCR. Reference samples were prepared as described in A. A 2.5μΙ aliquot from each sample was used for PCR in a total volume of 25μΙ. 10μΙ aliquots from each RNR reaction mixture was mixed with 190μΙ SYBR green and fluorescence recorded.

FI is fluorescence intensity.

Figure 5. Activity measurement in 96-well format suitable for HTS.

A. The figure depicts the relative fluorescence intensity data (%) corresponding to the amount of DNA formed in the PCR and recorded from a 96-well plate. The data in the figure is relative to the maximum response (well 12H, 100%) with the minimum value set to zero (well IB, 0%) The effect of 80 compounds (columns 2-11) on the RNR activity was tested using the novel method. The RNR, NDPK, and PCR reactions and subsequent detection were performed as described in materials and methods, section "Screen in multiwell format of the effect of many compounds on RNR reactions". The RNR reactions was set up in a 96-well plate with negative (3.5m hydroxyurea, well 1A-1D) and positive (no inhibitor, well 1E-1H) controls in column 1 and controls with 50uM and 25uM dCDP in wells 12A-C and 12D-F, respectively. Before addition of SYBR green 50ng and 250ng DNA was added to well 12G and 12H, respectively.

B. The same data set as in panel A is presented in serial format.

C. Positive (no hydroxyurea, HU) and negative control (3.5mM HU) samples used to calculate the Z-factor of the method, a common measure for the robustness of an HTS assay. The Z- factor of the given data is 0.82. FI is fluorescence intensity.

Definitions

In the present application the following abbreviations are used :

NDPK (nucleoside diphosphate kinase)

Tris (tris(hydroxymethyl)aminomethane)

HEPES (4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid )

DTT (2S,3S)-l,4-dimercaptobutane-2,3-diol

TCEP (tris(2-carboxyethyl)phosphine)

SYBR green (N',N'-dimethyl-N-[4-[(E)-(3-methyl-l,3-benzothiazol-2-ylidene)methyl]-l- phenylquinolin-l-ium-2-yl]-N-propylpropane-l,3-diamine).

GC content refers to the percentage of bases in a DNA molecule which are either guanine or cytosine.

AT content refers to the percentage of bases in a DNA molecule which are either adenine or thymine.

By "RNR" is in the present context meant an RNR (ribonucleotide reductase) enzyme of any class (e.g. I, II or III), unless it is clear from the context that a specific class of RNR enzyme is intended.

By "RNR reaction" is in the present context meant the chemical reaction in which

deoxyribonucleotides are (potentially) formed from ribonucleotides by the catalytic action of RNR.

"RNR reaction mixture" refers to a reaction mixture comprising RNR, ribonucleotides, and other reagents wherein deoxyribonucleotides are potentially formed by the catalytic action of RNR. "Deoxyribonucleotide" refers to a dNTP (dCTP, dUTP, dTTP, dATP, dGTP) or a dNDP (dCDP, dUDP, dTDP, dADP, dGDP) . Ribonucleotide refers to a NTP (CTP, UTP, ATP, GTP) or a NDP (CDP, UDP, ADP, GDP). By cellular "dNTP pool" is in the present context meant the total amount of dNTPs, i.e. the individual amount of dCTP, dTTP, dATP and dGTP when taken together, in a cell. A cellular dNTP pool may also comprise dUTP even though not always explicitly mentioned.

By "organism" is in the present context meant any eukaryotic organism, such as a mammal, bird, insect, plant, fungus and other unicellular eukaryotes, as well as prokaryotic organisms, such as bacteria, archaea and viruses. By "DNA template" is in the present context meant a deoxyribonucleic acid sequence used as the template to be copied in a PCR.

By "PCR" is meant a (DNA) Polymerase Chain Reaction, in the present context often abbreviated with PCR. PCR is a well-known molecular biology method familiar to any person skilled in the art of molecular biology and who knows how to select reagents, reaction conditions etc. A description of the PCR reaction may e.g. be found in [18; 19].

"Enzyme activity" or "enzymatic activity" in the present context refers to how active the RNR enzyme is in converting the enzyme's substrate into product. The enzyme activity or enzymatic activity may be affected by substances (both endogenous and exogenous) inhibiting or enhancing the activity of the enzyme. Enzyme activity is commonly given as the amount of enzyme that converts a specified amount of substrate to product per time unit. (The SI unit of enzyme activity is defined as the amount of enzyme that will convert 1 mol of substrate to product in 1 second, but for RNR the unit is usually the amount of enzyme that will convert one nmole of substrate to product in 1 min).

Detailed description of invention

The present inventors have developed an easy and fast method for quantifying the amount of any specific deoxyribonucleotide (dNTP) in a sample via a PCR (polymerase chain reaction). This method is useful both for the determination of the enzymatic activity of an RNR as well as for the determination of the amount of dNTP in a sample, such as a cell extract. These

determinations are important in many aspects, which will become apparent in the below. The method is particularly advantageous compared to currently available methods as it is rapid to perform and is suitable for the analysis of many samples in parallel. In short the invention relates to the use of PCR for determining the amount of a deoxyribonucleotide in a sample as well as to the use of PCR for determining the enzymatic activity of an RNR of a

deoxyribonucleotide in a sample and/or the use of PCR for determining the amount of a dNTP in a dNTP pool. The determination of the amount of a dNTP in a sample may be used for various purposes that will be explained in detail below. One example is the determination of the enzymatic activity of an RNR. The determination of the enzymatic activity of an RNR may in turn be used for determining the effect of a substance on the enzymatic activity of an RNR, e.g. for screening for RNR inhibitors or stimulators. In another non-limiting example, the method may be used to determine the amount of different dNTPs in a sample (regardless of the origin of the dNTPs), such as for the determination of the different amounts of dNTPs in a cellular dNTP-pool.

The present invention relates to a method for determining the amount of a deoxyribonucleotide potentially formed by an RNR comprising

b) mixing said sample potentially comprising said deoxyribonucleotide with reagents necessary for a PCR, comprising the necessary deoxyribonucleotides in excess except the deoxyribonucleotide potentially formed in vivo or in vitro by the RNR, and a DNA polymerase,

c) performing a PCR,

d) determining the amount of DNA formed, whereby the amount of DNA formed is

proportional to the amount of limiting dNTP and thus indicative of the amount of said potentially formed deoxyribonucletide

wherein step b) is preceded by the step a") of incubating the deoxyribonucleotide potentially formed in step a) with an NDPK in case said RNR uses NDP as substrate.

The RNR may be any type or class that utilizes a ribonucleotide as substrate. The

deoxyribonucleotide may be formed by the RNR in vivo or in vitro.

The method allows simple determination of the amount of a deoxyribonucleotide in a sample. This in turn allows simple assessment of the enzymatic activity of RNR as will become evident in the below. The method is also well suited for use in high-throughput screening of chemical libraries in the search for novel RNR inhibitors or substances stimulating the enzymatic activity of an RNR. The method is also useful for detecting and/or determining the amount of deoxyribonucleotides in samples, e.g. for the analysis of different dNTP pools in various stages of the cell cycle, where methods are usually very laborious and time consuming (taking days) [7; 8; 9; 10; 11 ; 12; 13].

The flow of a method of the invention can be outlined in the following way : in the first step, a sample potentially comprising a deoxyribonucleotide produced by an RNR in vivo or in vitro is provided or alternatively, as will be apparent later, is allowed to potentially be formed. This step can either be performed in vitro by e.g. incubating an RNR enzyme with its substrate, a ribonucleotide (i.e. NTP or NDP depending on the specific RNR used), whereupon the corresponding deoxyribonucleotide dNTP or dNDP is formed, or the dNTP may be produced in vivo by a eukaryotic or prokaryotic cell, a tissue or an organism, or by a viral RNR contained in a cell, and isolated by standard techniques known to the person skilled in the art and which basically involves physical collection of the cells to be investigated (e.g. by filtering off the cells of a bacterial growth suspension), lysis of the collected cells (e.g. by chemical means), removal of cell debris (e.g. by protein precipitation followed by centrifugation), and extraction of nucleotides (e.g. by means of TCA/Freon extraction). To detect product formation, the dNTP potentially formed by the RNR (i.e. the dNTP present in a sample in an amount from zero and above) is used in a PCR where a complete set of PCR reagents, except the dNTP under study, is added and the PCR performed. The amount of double stranded DNA formed in the reaction is related to the amount of the limiting dNTP present in the reaction, that is, the dNTP (or dNDP) formed in vivo or in vitro by the RNR. The outline of the method is presented in Fig. IB.

As the amount of deoxyribonucleotides produced by an RNR may differ depending on the enzymatic activity of the RNR (or the effect of an inhibitor or activator), the amount being anything from zero and up, it is in the present context often referred to deoxyribonucleotides "potentially formed" or that a sample "potentially comprises a deoxyribonucleotide" as in fact no deoxyribonucleotides actually may have been produced by the RNR. (And similarly, a cellular sample may in principle be devoid of deoxynucleotide content, regardless of its enzymatic origin.)

If a dNDP is formed by the RNR in an in vitro reaction, an extra step of phosphorylating this dNDP to form dNTP has to be performed, prior to product detection by the PCR. This is achieved by the addition of an NDPK (a commercially available enzyme) to the sample potentially comprising the dNDP formed prior to step b) in a method of the invention of mixing said potentially produced deoxyribonucleotide with reagents necessary for a PCR.

NDPK transfers phosphate groups between nucleoside triphosphates and nucleoside diphosphates, e.g. from ATP (present in excess in the enzymatic reaction mixture) to the dNDP thus yielding the corresponding dNTP. Typically, NDPK may be added to give a concentration of 0.02-0.1 units of enzyme per μΙ and the reaction mixture incubated for an additional time period of >0.5 hours, which results in conversion of dNDP to dNTP (Fig. 3).

If the formation of deoxyribonucleotides rather takes place in a eukaryotic or prokaryotic cell or tissues of multicellular organisms and the RNR uses NDPs as substrate, the cells will produce the corresponding dNTP from the dNDPs formed by the RNR by the action of various endogenous enzymes.

When the dNTP in a method of the invention is formed by an RNR in vitro, RNR is incubated with its substrate NDP or NTP according to standard methods described in the literature [16] . As a non-limiting example, a typical reaction mixture for forming dCDP with class I RNR from E. coli may contain 0.05-2 mM CDP, 0.05-0.2 μΜ NrdA, 0.1- 1 μΜ NrdB, 5mM ATP, lOm

magnesiumacetate (or other source of magnesium(II) ions), 30m DTT (or other reducing agent), and a 30mM Tris-buffer (or other buffering agent), at pH 7.5. If another dNDP is to be formed, the CDP in the above may be replaced by ADP, UDP or GDP. Different incubation times may be chosen to produce the amount of product that is needed . If the reaction is not run until the substrate is depleted it can be stopped by, e.g. boiling or addition of acid. This may be appropriate if one wishes to study the linear phase of the reaction in order to estimate initial reaction velocities. After the reactions with NDP-substrates have been quenched, or substrate is depleted, NDPK is added (final concentration 10-200mU/VI) to catalyze formation of dNTP. Alternatively, the dNTP or dNDP may have been produced in vivo and purified from the cell, tissue or organism in which it was produced. The dNTPs or dNDPs may be extracted from any type of cell, prokaryotic or eukaryotic, including unicellular and multicellular organisms, as well as other biological samples potentially containing dNTPs or dNDPs, e.g. blood plasma, blood serum and urine [7; 8; 9; 10; 11 ; 12; 13]. The general procedure for the extraction of dNTPs from samples can be outlined as follows. This procedure is only provided as an example and other methods may be used as well :

2. Cell lysis. Resuspend collected cells, or homogenize tissue, in lysis buffer. The lysis buffer contains chemicals that achive cell lysis by variuos means, e.g. ethanol, tri-carboxylic acid, per- cloric acid, boiling water, acetonitril, detergents, SDS. Lysis by mechanical means is also possible, e.g. ultra sonication or pressure disruption.

3. Removal of cell debris. acromolecules etc are removed by e.g. centrifugation leading to sedimentation of macromolecules while the dNTPs of interest are left in solution.

3a. Alternative enrichment of dNTPs. dNTPs may be extracted from the sample by two-phase separation techniques, e.g. by trioctylamine/Freon (22 :78 v/v) extraction. The extracted dNTPs may be concentrated by evaporation of the remaining solvent and subsequently dissolved in an a small volume of water. Alternatively, dNTPs may also be recovered from the sample by chromatography, e.g. ion exchange chromatography.

4. Analysis of dNTP content of the sample by PCR. Aliquots from step 3. or 3a. are added to four separate PCR mixtures, each lacking one out of four dNTP.

If the sample to be analyzed does not contain cells as the main source of dNTPs, e.g. blood plasma or urine, sample processing starts at step 3, optionally after sample concentration, e.g. by means of evaporation.

In a typical experiment to analyze the dNTP pools in a sample cells (approximately 10⁹) of a suspension are rapidly harvested by filtration on a AAWP nitrocellulose filter (0.8 pm, Millipore) and immediately immersed in 500-1000 μΙ of icecold 0.5-1 M trichloroacetic acid, 10-30 mM gCI₂ in an Eppendorf tube [14] . The tubes are incubated with frequent vortexing at 4°C for 20- 60 min and then centrifuged [7] . The supernatant is extracted and neutralized twice by 400- 1000 μΙ of a mixture of trioctylamine/Freon (22 : 78 v/v) [9] . Aliquots of the sample are used directly in the PCR mixture, or if needed evaporated to dryness in a Speedvac and dissolved in a small volume of water prior to addition of an aliquot to the PCR mixture.

The amount of product (i .e. dNTP) formation is analyzed via a PCR with three dNTPs in excess contained in the reaction mixture and the limiting fourth dNTP supplied via the enzymatic conversion of a ribonucleotide into a deoxyribonucleotide (formed in vivo or in vitro as explained above). Alternatively, if a radio-labelled ribonucleotide was used in the RNR reaction, all four dNTP may be contained in the PCR, as disclosed elsewhere herein. A typical mixture for PCR comprises a DNA template, a DNA primer pair specific to the DNA template, three different deoxyribonucleotides (three out of dCTP, dTTP (alternatively dUTP may be used), dATP and dGTP), a suitable buffer for a PCR reaction, a DNA polymerase. A complete set of PCR reagents except one limiting deoxyribonucleotide, e.g. dCTP, is added to the reaction mixture (step b)) and the PCR is performed (step c)). In a typical experiment a single PCR sample of 20-100 μΙ contains: 2-10 pg/μΙ of DNA template; 0.5 μΙ of each primer of a DNA primer pair specific for the DNA template; three different deoxyribonucleotides (three out of dCTP, dTTP/dUTP, dATP and dGTP), i.e. all the deoxyribonucleotides necessary for the PCR reaction except the dNTP provided via the sample under study, at a concentration of 50-200 μ ; 1.5-2.5mM MgCI₂

(doesn't have to be added to the reaction if it is contained in the previous enzymatic reaction) ; 0.01-0.04 Units/μΙ DNA polymerase (e.g. Taq polymerase, Pfu polymerase Pfx polymerase, KOD polymerase). Preferably, the polymerase should not have so-called proof-reading activity if dUTP is to be used in the PCR mixture since uracil is sometimes associated with stalling of such enzymes. PCR-reaction buffer at 1-time dilution (according manufacturer's instructions); and an aliquot from the RNR reaction mixture (for instance one 5 :th to one 10 :th of the total PCR volume) to provide the remaining fourth dNTP, or the radiolabeled dNTP, if radio-labelled ribonucleotide was used in the RNR reaction, as disclosed elsewhere herein. If the dNTP provided in the sample under study is radio-labelled, all four dNTPs necessary for the PCR reaction may be provided in the PCR mixture. To perform a reference reaction, increasing amounts of the limiting dNTP to give various final concentrations in separate reactions can be added instead of the aliquot from the RNR reaction mixture. The total volume of the PCR and its reagents can be proportionally up- or down-scaled. The reaction mixture is subsequently subjected to thermo cycling in a PCR machine using parameters appropriate for the specific DNA template and primer pairs. Possible cycling parameters may for instance be: 3 minutes at 94°C followed by 30-40 cycles of: 45 seconds at 94 °C, 30-50 seconds at 50-60°C, and 15-60 seconds at 72°C. When the limiting dNTP is present at high concentrations, longer elongation times may be necessary to avoid product saturation in the PCR {i.e. when the plateau phase of the PCR is reached). Increased concentration of DNA polymerase can also be used to compensate for this phenomenon.

The DNA sequence used as a template for the PCR may in principle be of any DNA sequence, but for optimal sensitivity the template should have a low content of the dNTP to be analyzed. The template length also affects the sensitivity of the method. For templates with similar GC content, a shorter template gives a better sensitivity with respect to DNA formed in the PCR whereas a longer template allows a lower concentration of primers to be used which reduces the background reading . Thus, appropriate templates must be selected considering the balance between GC-content and length and an example of a typical template for analysis of the dCTP or dGTP content of a sample can be e.g . 100-200 base pairs with a GC content of about 15-35%. Accordingly, for analysis of dATP or dTTP with similar sensitivities the AT content of the template should be the same. Longer template, e.g. up to 1000 base pairs, with the same GC/AT content can be used if reduced sensitivity is accepted . To compare all four dNTPs using a single template the GC content should preferably be 50% to achieve equal sensitivity for all four deoxyribonucleotides and the template length can be adjusted to obtain appropriate sensitivity. The template used for the PCR may otherwise preferably have a GC content of about 5-35%. Furthermore, factors such as e.g. type, origin, and commercial source of the polymerase used for the PCR can also affect the sensitivity of the method and different polymerases may require different reaction conditions.

For the PCRs performed in the method of the present invention any of dTTP and dUTP may be used, even if not always explicitly mentioned.

The primers used for the PCR should be specific to the DNA template and preferably not produce by-products or primer-dimers. The three deoxyribonucleotides except the deoxyribonucleotide formed by the RNR are preferably present in excess during the PCR reaction in the methods of the invention.

The PCR is a well established method and a standard procedure of any molecular biology laboratory [ 18] . In the PCR a template DNA is copied many times by means of the repeated action of a thermo stable DNA polymerase acting during repeated temperature cycling of the reaction mixture. The DNA template molecule to be copied is included in low amounts in the reaction together with two short DNA sequences called primers (which are complementary to two different sequences in the DNA template), dNTPs, and additional reagents necessary for the reaction to proceed. During the reaction the primers bind to the DNA template and the DNA polymerase makes a copy of the DNA template by polymerizing dNTPs to the primers according to the complementary sequence in the DNA template. This takes place at the optimal working temperature of the DNA polymerase. A subsequent rise in temperature followed by a temperature reduction will cause the DNA polymerase to leave the DNA and the DNA double strands to separate into single strands and (when the temperature is reduced) new primer molecules to bind (anneal) to the DNA template molecules, or newly copied DNA, which will then be copied by DNA polymerase as in the first step. By repeated cycling, this process will lead to multifold copies of the original DNA template.

The present invention allows for a variety of methods to be used for quantification of the DNA formed in the PCR, for instance fluorescence-based and radioactivity-based (e.g. by various scintillation counting approaches) measurements. For fluorescence-based detection methods a DNA-binding dye that exhibits changes in fluorescence intensity upon DNA binding may for instance be used. If radioactivity-based detection is to be performed, radio-labelled nucleotides (e.g . tritium-, carbon-14- or Phosphorus-32-labeled ribonucleotides or deoxyribonucleotides) must be included at some stage in the reaction mixtures and in a way to allow its incorporation into DNA during the PCR. One example is to use a radio-labelled substrate for RNR in the RNR reaction mixture; the resulting labelled deoxyribonucleotide product will be subsequently incorporated into DNA via the downstream reactions. Another possibility is to use a radio- labelled dNTP as one of the three dNTPs provided in excess (i.e. the ones not formed by RNR) in the PCR mixture. In both ways this will lead to radio-labelled DNA with the limiting dNTP controlling the amount of DNA formed . In the first example (the use of a radio-labelled RNR substrate), the PCR may optionally be performed with all four deoxyribonucleotides in the PCR mixture.

The determination in step d) of DNA formed by the PCR in step c) in a method of the invention may be based on any method for DNA detection. Non-limiting examples of suitable methods include direct fluorescence measurements using e.g. a fluorescent DNA-binding molecule which exhibits an intensity change in fluorescence upon binding to DNA, or can be analyzed e.g . by separation of DNA on an agarose gel followed by DNA staining with a DNA-binding fluorescent molecule, or by direct measurements of absorbance at 260 nm if nucleotides and primers are first separated from the DNA, e.g . by means of filtration or precipitation, or by radioactivity- based detection if radio labelled nucleotides are used in the assay and removed prior to detection, or by scintillation proximity assay (SPA) if radio labelled nucleotides are used and suitable DNA-binding beads are used, e.g . streptavidin-coated beads for binding of biotin- conjugated DNA (easily obtained by the use of biotin-conjugated primers or nucleotides in the PCR) , or by antibody-based detection if an DNA-specific antibody is prepared. Examples of DNA-binding dyes that could be used for the quantification of DNA products of the PCR include, but is not limited to (generic name or acronym given) 7-AAD, Acridine Orange, BEBO, BOBO-3, Chromomycin A3, CY dyes, DAPI, DRAQ5, Ethidium Bromide, Hoechst 33258, Hoechst 33342, LC Green, LDS 751, Mithramycin, POPO-3, PO-PRO-3, Propidium Iodide (PI), SYTO-dyes, SYTO- 13, SYTO- 16, SYTO-60, SYTO-62, SYTO-64, SYTO-82, SYTO-9, SYTOX Blue, SYTOX Green, SYTOX Orange, Thiazole Orange, TO-PRO, TO-PRO- 1, TO-PRO-3, TOTO-dyes, TOTO-1, TOTO-3, TOTO-3, YO-PRO- 1, or YOYO- 1. dNTPs covalently labelled with a fluorescent dye could also be used to achieve detection of the amount of DNA formed in the PCR. In this approach it would also be possible to combine differently labelled dNTPs to achieve detection by means of FRET (Forster resonance energy transfer or fluorescence resonance energy transfer) or quenched fluorescence. The various modes of detection makes the method very flexible, e.g. different modes of detection may be chosen to expand or improve the dynamic range u nder certain experimental conditions or to select different wavelengths for detection, the latter being particularly valuable to avoid i nterference with test su bstances with fluorescent properties.

When detection and quantification of the DNA formed in the PCR is to be done by radioactivity measurements (e.g . sci ntillation counting) radio-labelled nucleotides must be included at some stage in the reaction mixtures and in a way to allow its incorporation into DNA during the PCR. One example is to use a radio-labelled substrate for RNR in the RNR reaction mixture, the resulting labelled deoxyri bonucleotide product will be subsequently incorporated into DNA via the downstream reactions. Another possibility is to use a radio-labelled dNTP as one of the three d NTPs provided i n excess (i .e. the ones not formed by RNR) in the PCR mixtu re. In both ways this will lead to radio-labelled DNA with the limiting dNTP controlling the amount of DNA formed . When a radio-labelled RNR substrate is used in the RNR reaction, the amount of radio-labelled nucleotide incorporated into DNA (and hence the amount of radio-labelled DNA formed) in the PCR will be directly related to the amount of deoxyribonucleotide formed by the RNR. Under such conditions, it is possible to use un-labelled and equal concentrations of all four dNTPs in the PCR because the only source of radio-labelled dNTP will be provided by the action of RNR. This in turn may allow for changes in PCR cycling conditions (e.g. elongation time and the number of cycles). In the case a radio-labelled RNR substrate is used in the RNR reaction, in method step b) in all the methods provided herein, the PCR mixture therefore can comprise all four dNTPs (i.e. dATP, dCTP, dGTP and dTTP/dUTP). The invention is therefore also directed to a method for determining the amount of a deoxyribonucleotide or for determining the enzymatic activity of an RNR wherein said deoxyribonucleotide potentially formed in step a) or a'), respectively, is radio-labelled and wherein step b) optionally all four deoxyribonucleotides are present. SPA (scintillation proximity assay) is a scintillation technology well known to the person skilled in the art. SPA is performed in aqueous solution and thereby requires the radio-labelled molecule and the scintillant to be in close proximity in order for the emitted β-particles to excite the scintillant to emit light. This is achieved by scintillant-impregnated beads which are coated with appropriate receptors for the radio-ligand to be detected. Thereby, the scintillant and the radio-labelled ligand can be brought sufficiently close for a scintillation event to occur.

In the methods disclosed herein wherein step d) may be performed by radioactivity

measurements using scintillation proximity assay. If SPA is to be used for quantification of the amount of DNA formed in the PCR, a method to bind the DNA to the SPA bead must be utilized. Because streptavidin-coated SPA beads are commercially available, an example of a convenient method is to utilize biotin-labeled primers in the PCR. This assures straightforward detection of the amount of DNA formed in the PCR.

Alternatively, if a non-labelled ribonucleotide substrate is used in the RNR reaction, the PCR is set up as described with three dNTPs in excess. In this case, one of the three dNTPs supplied in the PCR mixture must be radio-labelled. Furthermore, a method to bind the DNA to the SPA bead must be utilized.

For determination of the individual concentrations of dNTPs in cellular dNTP pools, SPA may also be utilized. In this case, the PCR is performed with three dNTPs in excess (in order to detect the fourth limiting one), but with one of the three dNTPs appropriately radio-labelled. Also here, binding to the SPA beads may be achieved by using biotinylated primers in the PCR.

Accumulation of PCR products may also be monitored in real time during the actual PCR if the PCR is set up in a quantitative real-time PCR instrument. In such a set-up any DNA-binding dye or probe (short DNA sequence specific for the PCR product under study and labelled to allow photometric detection based on different principles) suitable for real-time PCR may be used, e.g. SYBR green or other DNA-binding dyes (for examples, see above), FRET-based hydrolysis probes such as Taqman, FRET-based molecular beacon probes, scorpion primers based on fluorescence quenching, FRET-based hybridization probes (relying on two DNA primers labelled in a way that FRET is achieved when the primers are bound in close proximity), eclipse probes which are quenched when not bound to DNA, labelled primers which are quenched when not part of a double stranded DNA product (as in e.g. amplifluor assays using labelled so-called uniprimers), LUX primers, or sunrise primers, etc. (The names given above for probes and primers used for quantification in real time PCR applications are commonly used in the scientific literature or by manufacturers of qPCR products).

The amount of DNA formed, reflecting the amount of the limiting deoxyribonucletide, is determined by a simple comparison with a standard curve of DNA derived from a set of PCRs with known amounts of a limiting deoxyribonucleotide (Fig. 2). The standard curve should express the increase in a measured signal (which is related to DNA concentration) with respect to increasing amounts of dNTP used in the PCR. For instance, after performing the RNR reaction and subsequent PCR an aliquot of ΙΟμΙ is taken from the sample and mixed with 190μΙ of SYBR green (lxworking solution, according to the manufacturers instructions). The fluorescence intensity of the sample is then read in a fluorometer set to excitation at 485nm and emission at 520nm. From the standard curve (constructed using a series of samples, with identical constituents as the unknown samples but with known amounts of dNTP, which are mixed with SYBR green in the same way as the unknown samples), the concentration of dNTP that corresponds to the reading of the unknown sample can be deduced. The amount of DNA formed in the reaction is related to the amount of the deoxyribonucleotide that is present in limiting amounts in the sample(s) under investigation, that is, the amount of in vivo or in vitro formed deoxyribonucleotide. Thus, the experimental reaction mixture contains ail chemicals (except the one deoxyribonucleotide under study) recommended for a standard PCR and follows the general guidelines for such assays. All the dNTPs except the one under study are present in excess, while the dNTP under study is present in limiting amounts. Therefore, the amount of PCR product formed is proportional to the amount of the limiting dNTP. Alternatively, if a radio- labelled ribonucleotide is used in the RNR reaction all four dNTPs may be present in the PCR mixture as disclosed elsewhere herein. To obtain the specific activity of RNR (in units per mg, i.e. nmoles formed dNTP per min per mg protein) the amount of formed dNTP is divided by the time RNR was incubated with the substrate and the amount of protein in the sample (amount of dNTP formed/[incubation time*amount RNR] ; i.e. RNR activity). For highly purified protein samples this gives a precise measure of the activity of RNR. For samples containing a lot of contaminants, such as a cellular extract, the total protein content of the sample is instead considered and the activity gives a general measure of the specific activity of RNR in the total protein content of the extract. The steps of preparing the PCR mixture, performing the PCR and analysing the amount of DNA formed are performed as described above in the below methods of the invention. The method of the present invention is particularly useful for determining the enzymatic activity of an RNR enzyme. In that case, the deoxyribonucleotide provided in step a) of the method described above for determining the amount of a deoxyribonucleotide potentially formed by an RNR, is provided in a step a') by exposing an RNR to a ribonucleotide whereby the

corresponding deoxyribonucleotide is formed to a degree potentially approaching zero, depending on the enzymatic activity of said RNR. In such a method, the sample potentially comprising a deoxyribonucleotide of step a) of the method for determining the amount of a deoxyribonucleotide potentially formed by an RNR, is provided by performing step a'). Such a method for determining the enzymatic activity of an RNR consequently comprises the steps of a') exposing an RNR to a ribonucleotide whereby the corresponding deoxyribonucleotide is formed to a degree potentially approaching zero, depending on the enzymatic activity of said RNR,

b) mixing the potentially formed deoxyribonucleotide of step a') with reagents necessary for a PCR, said reagents comprising the necessary deoxyribonucleotides except the deoxyribonucleotide potentially formed by the RNR in step a'), and a DNA polymerase, c) performing a PCR,

d) determining the amount of DNA formed, whereby the amount of DNA formed is

proportional to the amount of limiting dNTP and thus indicative of the enzymatic activity of said RNR

Step a') in the method for determining the enzymatic activity of an RNR may take place in vitro in a test tube and the like, but may just as well take place naturally in a cell, tissue or organism and the potentially produced deoxyribonucleotide subsequently extracted as described elsewhere in this text before the remaining method steps b)-d) of the method are performed separately for each dNTP in the extract (dATP, dGTP, dCTP, and in this case dTTP).

The organism that potentially produces the deoxyribonucleotides whose amounts are to be determined may be any prokaryotic or eukaryotic organism, such as a unicellular or multicellular organism that has an RNR enzyme, including cells that contain an RNR encoded by a virus that has infected the cell.

When the method is used for determining the enzymatic activity of an RNR one utilizes that the enzymatic activity of the RNR is reflected in the amount of deoxyribonucleotides produced . If the enzymatic activity is low, little or no deoxyribonucleotides will be produced, while on the other hand, if the enzymatic activity is high, a higher amount will be produced. The amount of PCR product formed is proportional to the amount of the limiting deoxyribonucleotides (as all other deoxyribonucleotides are added in excess) which therefore in turn reflects the enzymatic activity of the RNR given as units per mg (i.e. nmoles of dNTP formed per min per mg protein). It is of great interest in many areas of research to be able to study the enzymatic activity of an RNR enzyme, e.g. in drug development projects that target RNR, and studies of the regulation of RNR and its relation to development of cancer. Also, being able to determine the enzymatic activity of an RNR is particularly useful for identifying the effect of a given substance, such as a potential inhibitor, on an RNR enzyme, or a substance potentially stimulating RNR activity. ATP is e.g. known to stimulate the activity of some RNR enzymes. Such a substance potentially affects the enzymatic activity of the RNR, which in turn is reflected in the amount of deoxyribonucleotides produced. In such a method for identifying the effect (inhibiting or stimulating) of a given substance on the enzymatic activity of an RNR, said RNR is subjected to a substance potentially affecting its enzymatic activity and thereafter, or simultaneously, incubated with a ribonucleotide, whereby the corresponding deoxyribonucleotide is formed to a degree potentially approaching zero depending on the enzymatic activity of said RNR. This step may also take place in a cell (prokaryotic or eukaryotic) by exposing a prokaryotic or eukaryotic cell, a tissue or an organism to the substance potentially affecting the RNR (or another enzyme involved in the cellular deoxyribonucleotide metabolism as further explained below) and thereafter extracting the potentially produced deoxyribonucleotides. The organism may e.g. be a pathogen (bacterium, parasite, etc.), a virus-infected mammal or plant or a tumor/cancer or genetically modified cell line. After the potential formation of the deoxyribonucleotides the PCR and analysis of the amount of DNA formed is performed according to steps b)-d) in the method for determining the amount of a deoyribonucleotide potentially formed by an RNR or the method for determining the enzymatic activity of an RNR described above, possibly with the extra phosphorylation step (step a"). Such a method for identifying the effect of a given substance on the enzymatic activity of an RNR consequently comprises the steps of

a"") subjecting an RNR to a substance potentially affecting its enzymatic activity,

a') exposing the mixture of a"") to a ribonucleotide whereby the corresponding deoxyribonucleotide is formed to a degree potentially approaching zero, depending on the effect of said substance on the RNR,

b) mixing the potentially formed deoxyribonucleotide of step a') with reagents necessary for a PCR, said reagents comprising the necessary deoxyribonucleotides except the deoxyribonucleotide potentially formed by the RNR in step b), and a DNA polymerase, c) performing a PCR,

d) determining the amount of DNA formed, whereby the amount of DNA formed is

proportional to the amount of limiting dNTP and thus indicative of enzymatic activity of said RNR having been subjected to the substance potentially affecting its enzymatic activity.

wherein steps a"") and a') can be performed sequentially or simultaneously and wherein step b) is preceded by the step a") of incubating the deoxyribonucleotide potentially formed in step a') with an NDPK in case said RNR uses NDP as substrate. This method thus corresponds to the method for determining the amount of a deoyribonucleotide potentially formed by an RNR or a method for determining the enzymatic activity of an RNR further comprising the step of subjecting said RNR to a substance potentially affecting its enzymatic activity wherein said further step can be performed before step a) or a'), respectively, or simultaneously with step a) or a'), respectively.

Of course a substance potentially affecting the enzymatic activity of an RNR enzyme may also be added before step a) or simultaneously with step a) in the method for determining the amount of a deoxyribonucleotide potentially formed by an RNR disclosed above in order to study the substance ^' s effect on the amount of deoxyribonucleotide formed.

The method for identifying the effect of a given substance on the enzymatic activity of an RNR consequently is similar to the method for determining the amount of deoxyribonucleotide potentially formed by an RNR or the method for determining the enzymatic activity of an RNR enzyme, but comprises the additional step subjecting the RNR to a substance potentially affecting its enzymatic activity wherein this further step may be performed before step a) or a'), respectively, or simultaneously with step a) or a'), respectively, in the latter method. The step of subjecting the RNR to a substance potentially affecting its enzymatic activity may be performed by subjecting a eukaryotic or prokaryotic cell, a virus, a tissue or an organism to the substance. Such an organism may e.g. be a mammal, a plant or a virus-infected organism.

Depending on the effect of the substance on the RNR, the enzymatic activity of the RNR will be unchanged, increased or decreased. This will be reflected in the amount of deoxyribonucleotides produced, which in turn will affect the amount of DNA produced in the PCR. Therefore, the amount of DNA formed in the PCR will reflect the enzymatic activity of the RNR enzyme after it has been subjected to the substance potentially affecting its enzymatic activity. A method for identifying the effect of a given substance on the enzymatic activity of an RNR is particularly useful for the screening of potential inhibitors or activators of RNR in the development of new drugs targeted to RNR and the testing of their effect in vitro or in vivo. Also, such a method may be used for characterization of RNR enzymes, stability tests, studies of allosteric effects etc. Since the enzyme is ubiquitous the use of this method facilitates the development of novel drugs and bioactive compounds within a variety of fields. The enzyme constitutes a target for cancer therapy, for novel antibiotics, pesticides, antiviral treatments, antifungal treatments, and antiparasite treatment. Particularly within the field of antibiotics there is a global need for novel drugs due to emerging drug resistant/multiresistant bacterial strains.

Instead of subjecting the RNR directly to a substance potentially affecting its activity, one may instead subject another enzyme involved in the cellular deoxyribonucleotide metabolism. The effect of the substance on this enzyme will then in turn be reflected by changed levels of dNTPs which may be studied by the method of the present invention. Thereby one may study the effect of substances potentially affecting RNR activity although these substances do not have a direct effect on the RNR enzyme. In such a method, a eukaryotic or prokaryotic cell, tissue or organism is subjected to a substance potentially affecting the activity of an enzyme involved in the cellular deoxyribonucleotlde metabolism, other than RNR. The method may of course also be performed in vitro in a test tube or the like comprising all necessary enzymes and substrates. The effect of the substance affecting an enzyme other than RNR involved in the cellular deoxyribonucleotlde metabolism can then be analyzed by determining the amount of deoxyribonucleotlde formed, as described above.

The present invention is also suitable for determining the amount of each separate dNTP in a dNTP pool. In such a case, dNTPs potentially produced in a prokaryotic or eukaryotic cell, a tissue or an organism are extracted from the cell, tissue or organism to produce a cell extract comprising the cellular dNTP pool by any of the available standard techniques for nucleotide (or nucleotide metabolite) extraction known to the skilled person (as described in more detail elsewhere in this text). The cell, tissue or organism may also have been subjected to a substance potentially affecting the activity of an RNR or another cellular enzyme involved in dNTP metabolism prior to dNTP extraction. The cell extract potentially comprises all four types of dNTPs (dATP, dGTP, dTTP and dCTP). The extract may also comprise dUTP . In order to determine the amount of each dNTP in the cell extract, four separate PCRs have to be performed, one for the determination of each dNTP. In each PCR mixture, three dNTPs are added in excess, while the fourth, whose amount is to be determined, is only provided via the cell extract, and therefore is present in limiting amounts, i.e. one of the four PCR mixtures misses dATP, another dCTP, yet another dTTP and the fourth misses dGTP. In such a method, one of the dNTPs may be radio-labelled if e.g. SPA is used for detection of the amount of PCR product formed. The amount of DNA produced will therefore reflect the amount of the limiting dNTP in each of the four separate PCRs. Basically this means that for determining the amount of all four dNTPs potentially present in a dNTP-pool, the method of claim 1 has to be performed four times with four separate PCR mixtures, each comprising one type of dNTP only provided via the cell extract and consequently present in limiting amounts. In other words a method of the invention for determining the amount of a dNTP in a dNTP pool comprises the steps of

b) mixing the extracted dNTP of step a'") with each of the four PCR mixtures of step a'"") so that each PCR mixture comprises three dNTPs in excess and the fourth only being provided via the cell extract of step a'") and consequently being present in limiting amount c) performing four separate PCRs

d) determining the amount of DNA formed in each of the four PCRs of step c), whereby the amount of DNA formed is proportional to the amount of limiting dNTP and thus indicative of the amount of the limiting dNTP in each of the four PCRs.

As a whole, the methods of the invention are very simple and do not require any particular equipment or chemicals, in one aspect, for example only a plate reader capable of reading fluorescence and a thermo cycling machine are required . In addition, the mode of detection is flexible and allows detection by various principles, for example measuring of fluorescence intensity or scintillation counting by various means. Unless radio-labelling is used, the methods disclosed herein are both safer and more environmentally friendly, as destruction and handling of standard chemicals are generally simpler than the handling of radioactive isotopes. The reagents used are also cheap and do not have to be used in large amounts. Additionally, the equipment necessary is cheap compared to the equipment used in other methods. Importantly, the assay involves short hands-on times and only a few pipetting steps. Typically, only 2-4 hr total assay time with only a few simple pipetting steps and very short hands-on time is required to complete the method for hundreds of samples. The method is therefore rapid and uncomplicated. Another advantage with the methods of the present invention is that they are well suited for multi-well format (for example screening in 96-well microplates) and robotics, which is advantageous if many samples are to be analysed simultaneously, e.g. in industrial applications. Since an inhibitor (or an RNR stimulating substance) easily can be included in the RNR reaction mixture, a very important application of the method is to use it for efficient studies of potential inhibitors and particularly to perform automated high throughput screening of compound libraries to identify novel RNR inhibitors. The latter approach has been virtually impossible using previously available activity assays, which can maximally process 30-40 samples over 1-2 days of intense laboratory work. The novel method in contrast can be easily adapted to robotics and multi-well format and can thereby rapidly provide results for thousands of samples.

Furthermore, reagents required to perform the present method may also be commercially packaged in a so-called kit. The kit may contain all reagents to perform the method or only selected key reagents which need to be complemented by standard chemicals. Such a kit may also include a description of how to perform the method.

A kit for the determination of the enzymatic activity of an RNR enzyme may, for instance, contain purified RNR enzyme; ribonucleotides for the RNR reaction; a buffer containing the necessary additives to run the RNR reaction (e.g. a source of magnesium(II) ions, DTT or TCEP as reducing agents, vitamin B12, S-adenosyl methionine, deoxyribonucleotide effector nucleotides, ATP, and a buffering agent) ; NDPK for formation of triphosphate nucleotides;

deoxynucleotides for the PCR; template for the PCR; primers for the PCR; DNA standards to use as controls, SYBR green (or other suitable DNA binding dye or DNA detection reagents and materials) ; additional reagents for PCR. The contents of the kit may be adapted for different needs or different kits may be constructed for different needs, e.g. a kit for high through-put screening of a certain number of compounds in the search for compounds affecting the activity of RNR, a kit with all necessary reagents except RNR, other kits containing only a subset of the reagents outlined above, a kit for determination of dNTP pools, or a kit with suitable PCR primers and templates intended for a certain RNR. EXPERIMENTAL SECTION

MATERIALS AND METHODS Material

Recombinant RNR was expressed and purified as described [20; 21; 22]. Determination of protein concentration was performed according to the method of Bradford with bovine serum albumin as standard [23] or by measuring the absorbance at 280 nm. For the PCR,

commercially available reaction mixtures were used (e.g. from Invitrogen or Fermentas). NDPK, SYBR green and other standard chemicals were purchased from Sigma Aldrich, Sweden.

6x DNA loading Dye ( 10 mM Tris-HCI (pH 7.6), 0.03% bromophenol blue, 0.03% xylene cyanol, 60% glycerol, 60 mM EDTA) were purchased from Fermentas, Sweden.

TAE buffer, lxworking solution contains 40mM Tris-Acetate and 2 mM EDTA.

DNA standard solutions were purchased from Fermentas.

PCR test reaction

Except for one dNTP, a standard PCR was prepared following the standard guidelines for such assays. Specifically, a number of test reactions were prepared with three deoxyribonucleotides (three out of dCTP, dTTP, dATP and dGTP) at a constant concentration (typically 50-200 μΜ) and increasing amounts (typically 0; 0.5; 1; 2; 4; 8; 16 μΜ) of the remaining

deoxyribonucleotide (dCTP, dUTP/dTTP, dATP, or dGTP). Other standard components of the reaction mixture typically contained : 2-10 pg/μΙ of DNA template; 0.25-1 μΜ of each primer of a DNA primer pair specific for the DNA template; 1.5-3 mM MgCI₂; 0.01-0.04 Units/μΙ Taq DNA polymerase and PCR-reaction buffer (at lxWorking dilution according to manufacturer's instructions) in a total volume of 25-100μΙ. Samples were subjected to thermo cycling as follows: 3 minutes at 94°C followed by 40 cycles of: 45 seconds at 94 °C, 50 seconds at 55 °C, and 60 seconds at 72. Analysis of DNA formed in the PCR.

PCR samples were analyzed by agarose gel electrophoresis and ethidium bromide staining or analyzed by fluorescence intensity measurement upon mixing with SYBR green. For gel analysis, a 6-10 μΙ aliquot of the PCR mixture was mixed with one 5^th of the volume of 6x DNA loading dye. Samples were then loaded into the wells of a 2% agarose gel (casted in IxTAE) containing 0.5 μg/ml ethidium bromide and subjected to electrophoretic separation at 100 Volts for approximately 35 minutes in a 0.5xTAE buffer bath. The separated ethidium bromide-stained DNA fragments were subsequently visualized by UV illumination and the fluorescent emission photographically documented .

For fluorescence intensity analysis a 10 μΙ aliquot from the PCR samples was mixed with 190 μΙ SYBR green ( lx working solution according manufacturer's instructions) dissolved in

IxTAE and incubated for approximately 5 minutes. (As for many fluorophores, light exposure of the SYBR green solution should be minimized to avoid extensive photobleaching.) Fluorescence intensity was recorded at 520nm ( lOnm bandwidth) with excitation set to 485 nm ( lOnm bandwidth) with the use of a suitable fluorometer (e.g. Polarstar Omega plate reader, BMG Labtech Gmbh).

As a control that the amount of DNA is within the linear range of the SYBR green response (SYBR green has a linear range for DNA concentrations ranging from approximately 2- 1000 pg/μΙ for a solution at lxworking concentration ; at higher working concentrations the linear range increases) a number of reference samples within this interval was used .

NDPK reaction to control the efficency of conversion of dN DP to dNTP.

Samples containing 10-200 mUnits/μΙ of NDPK, 2-4 mM ATP, 3-8 mM gCI₂ and different concentrations (5, 10, 20, 30, 60, 75 μΜ in separate samples) of dCDP in a total reaction volume of 25-30 μΙ were incubated for 30 minutes at 37°C whereafter the reactions were quenched by boiling for 3 minutes.

Subsequently, aliquots from the NDPK reaction mixtures were mixed with reagents for PCR to give the following final concentrations : 100-200 μΜ of the three dNTP not present in the NDPK reaction (dGTP, dATP and dTTP) ; 2- 10 pg/μΙ of DNA template; 0.5- 1 μΜ of each primer of a DNA primer pair specific for the DNA template; 0.02-0.05 Units/μΙ Taq DNA polymerase and PCR-reaction buffer (at lxWorking dilution according to manufacturer's instructions) in a total volume of 60 μΙ . Typically, 1 volume unit of NDPK reaction mixture was mixed with 4 volumes of PCR mixture.

PCR control samples were prepared with known final concentrations of dCTP (the limiting dNTP) of 1, 2, 4, 6, 12, 15 μΜ (i.e. the final dNTP concentration in the PCR samples that would result if NDPK converted all dNDP to dNTP) . All other reagents were as descri bed in the previous paragraphs.

All samples were subsequently subjected to PCR cycling and the DNA formed analyzed by fluorescence intensity measurement and gel analysis, as described in the sections PCR test reaction and Analysis of DNA formed in the PCR. To assess the efficiency of NDPK action, the amount of DNA formed in PCR control samples with known amounts of dCTP were compared with samples with NDPK-formed dCTP.

RNR reaction for dNDP formation, activity assay for RNR catalyzed conversion of NDP to dN DP

A typical reaction mixture for forming dCDP with class I RNR (which consists of two separate subunits; NrdA a nd N rdB) from E. coli may contain, but is not limited to, 0.05-2 mM CDP, 0.05- 0.5 μΜ NrdA, 0.5-5 μΜ Nrd B, 2-5m M ATP, 10-30mM magnesiu m-acetate (or mag nesiu m chloride at the same concentration), 15-30mM DTT (or TCEP at the same concentration), in a 30m M Tris-buffer (or H EPES at the same concentration) at pH 7.5. A common total reaction volume was 25-200μΙ . If a nother dN DP is to be formed, the CDP in the above may be replaced by ADP, UDP or GDP. The NDP substrate was added last to the mixture and will start the reaction . The reactions were normally performed at 25-37°C. Different incubation times may be chosen to produce the amount of product that is needed for efficient detection . If the reaction is not run until the su bstrate is depleted it can be stopped by, e.g. boiling or addition of acid . This setup is appropriate if one wishes to study the linear phase of the reaction in order to estimate initial reaction velocities.

Conversion of RNR-formed dNDP to dNTP by NDPK

In reactions where the assayed RNR converts NDP to dNDP (such as class I E. coli RNR) the enzyme NDPK was added to catalyze formation of dNTP after completion of the RNR reaction. NDPK was added to give a final activity of 10-50 mll/μΙ and the reactions incubated for 0.5-4 hours at 37°C whereafter the reactions were quenched by boiling for 3 minutes. RNR reaction for dNTP formation, activity assay for RNR-catalyzed conversion of NTP to dNTP

A typical reaction mixture for forming dCTP with class II RNR from Pseudomonas aeruginosa may contain, but is not limited to, 50 mM HEPES (pH 7.5), 0.5-2 mM ATP, 2-5 ml MgCI₂ 10-30 mM DTT, 0.05-2 mM CTP, 5-50 μΜ 5'-deoxyadenosylcobalamin, and 0.5-4μΜ of RNR (for P. aeruginosa the class II RNR consists of two subunits denoted NrdJa and NrdJb). The total reaction volume was typically 25-200 μΙ. The NTP substrate was added last to the mixture in order to start the reaction. The reactions were typically performed at 25-37°C.

Different incubation times may be chosen to produce the amount of product that is needed for efficient detection. If the reaction is not run until the substrate is depleted it can be stopped by, e.g. boiling or addition of acid. This setup may be appropriate if one wishes to study the linear phase of the reaction in order to estimate initial reaction velocities. Due to the light sensitivity of deoxyadenosylcobalamin, light exposure of the reaction mixture was minimized.

Test of the effect of compounds on the RNR reaction.

The specific RNR reaction was performed as described in sections describing the RNR reactions with the addition that the compound whose effect was tested was included in the reaction mixture. To test the effect of hydroxyurea (a known inhibitor of RNR) increasing amounts of this compound was added to separate RNR reaction mixtures to give the following final

concentrations: 10000, 3300, 1100, 370, 120, 41, 13, 4.6, 1.5, 0.51 μΜ.

Analysis of the amount of dNTP or dNDP formed in RNR reactions, determination of enzyme activity.

To quantify the amount of dNTP formed in an RNR reaction (or RNR in conjunction with NDPK) a PCR with an aliquot from the RNR reaction and subsequent quantification of DNA were performed. The aliquot from the RNR reaction mixture was mixed with a PCR mixture containing all reagents as described in the section PCR test reaction, with the exception that the dNTP potentially formed by the RNR reaction (the dNTP to be quantified) was omitted. A typical set up involved the mixing of 1 volume unit from the RNR reaction mixture with 4 volume units from the PCR mixture. Some reagents needed for the PCR (e.g . magnesium(II) ions) are commonly included already in the RNR reaction mixture. In such cases the concentration of that substituent in the PCR mixture may have to be adjusted, or completely omitted, to reach a final concentration appropriate for PCR, see section PCR test reaction. To perform the actual quantification of DNA formed in the PCR the fluorescence intensity of a ΙΟμΙ aliquot mixed with 190μΙ of SYBR green solution was measured, as described in section Analysis of DNA formed in the PCR. The amount of DNA formed, which reflects the amount of the limiting deoxyribonucletide, was determined by a simple comparison with a standard curve of DNA derived from a set of PCRs with known amounts of a limiting deoxyribonucleotide (Fig. 2), set up as described in section PCR test reaction. The standard curve expresses the increase in fluorescence intensity (which is related to DNA concentration) with respect to increasing amounts of dNTP used in the PCR. For instance, after performing the RNR reaction the fluorescence intensity of the sample is read in a fluorometer. From the standard curve (constructed using the same amount of sample and SYBR green as for the unknown sample) the concentration of dNTP that corresponds to the reading of the unknown sample is determined. This value is scaled by a factor to account for the dilution associated with mixing of PCR and RNR reaction mixtures (e.g. multiplied by 5 if one volume RNR solution was mixed with 4 volumes of PCR solution). To obtain the specific activity, the obtained value of dNTP is divided by the time RNR was incubated with the substrate and by the amount of protein in the sample.

Screen in multiwell format of the effect of many compounds on RNR reactions.

The basic outline of the RNR reaction was as described in the previous sections. An RNR reaction using class I enzyme from P. aeruginosa was performed with 100 μΜ CDP in a total reaction volume of 30 μΙ in the wells of a 96-well PCR plate with the addition of test compounds to give concentrations of ΙΟΟμΜ. 80 different compounds from NCI's (National Cancer Institute) diversity set II were tested and thus mixed into the reaction mixtures of the wells of column 2- 11. In addition, 4 samples without test compound were set up in well E1 -H1 . These reaction mixtures contained the same amount of solvent (i.e. 1% DMSO) as resulted from mixing compounds into the other wells. Another 4 samples with 3.5 mM (final concentration) hydroxyurea (a known inhibitor of RNR), instead of test compound, and 1% DMSO was set up in wells Al-Dl.

Six samples, to serve as controls for the amount of product formed and for the efficiency of the NDPK reaction and PCR, was prepared and added to wells A12-F12; three with 50μΜ dCDP (A12-C12) and three with 25μΜ dCDP (D12-F12). Two wells (12G-12H) were left empty.

Reaction mixtures with RNR and test compounds were kept chilled ( 1-4°C) for at least 60 minutes (to account for possible slow binders) before final addition of substrate to start the reactions. After addition of substrate the plate was transferred to a heat block, or water bath, holding 25°C, incubated for 45 minutes and then boiled for 3 minutes to quench reactions. After boiling samples were allowed to cool off, NDPK added (ca 25 mUnits/μΙ, final concentration) and the plate subsequently transferred to a heat block holding 37°C and incubated for 2 hours and then boiled for 3 minutes.

After cooling the samples, 70 μΙ of PCR mixtures (prepared as described above) lacking dCTP was added to each well (except the empty wells 12G-12H) . Samples were subsequently subjected to PCR cycling as described above. After PCR cycling 10μΙ from each sample were transferred to the corresponding wells of a black 96-well microtitre plate. In a volume of 10μΙ known amounts of DNA was added to the empty wells of the microtitre plate; 50 ng to well 12G and 250 ng to well 12H. (These additions served to roughly mark the lower and upper limits of the assay under the conditions used.) 190 μΙ SYBR green solution was added to each well and the fluorescence intensity recorded as described above. In all steps care was taken to assure adequate mixing, to avoid dispersion and spill of samples, and to minimize sample evaporation, e.g. by means of appropriate sealing, mixing, and centrifugation.

Extraction of dNTPs

Cell (approximately 10⁹) are rapidly harvested by filtration on an AAWP nitrocellulose filter (0.8 pm, Millipore) and immediately immersed in a 700 μΙ of icecold 0.6 M trichloroacetic acid, 15 mM MgCI₂ in an Eppendorf tube. The tubes are incubated with frequent vortexing at 4°C for 30 min and then centrifuged. The supernatant is extracted and neutralized twice by 800 μΙ of a mixture of trioctylamine/Freon (22 : 78 v/v) [7; 9; 14] . Aliquots of the sample are used directly in the PCR mixture, or if needed evaporated to dryness in a Speedvac and dissolved in a small volume of water prior to addition of an aliquot to the PCR mixture.

PCR and DNA quantification are subsequently performed as described above with the exception that four PCRs are set up, each missing one out of the four dNTPs (dCTP, dGTP, dATP and dTTP), and that a template with a GC content of 50% was used. In addition, four sets of reference PCRs with increasing amounts of one limiting dNTP within each set are to be performed.

RESULTS AND DISCUSSION

PCR test reactions- To evaluate the sensitivity of the PCR part of the assay five series with 7 PCR samples with 200μΜ of three deoxyribonucleotides (dCTP, dGTP, dATP, or dTTP) in each was prepared; three without either dCTP, dGTP or dATP, and two without dTTP. Within each test set the fourth dNTP (i.e. either dCTP, dGTP, dATP, dTTP or dUTP) was present in limiting amounts (or absent) at the following concentrations: 0, 0.5, 1, 2, 4, 8 and 16 μΜ. Other components of the reaction mixture was: 5 pg/μΙ of DNA template, 0.5 μΜ of each primer of a DNA primer pair specific for the DNA template, 2 mM MgCI₂, 0.02 Units/μΙ Taq DNA polymerase and PCR-reaction buffer (at lxWorking dilution according to the manufacturer's instructions). The total reaction volume was 60 μΙ. The following DNA template, and downstream and upstream primers were used :

CCTAAATTACGAAGTTCACGTTCCACGCTTTGAGTTACTTCTTCTAATTGTCTTAAAGATACTGGCCTTTTT TCGCACGCTTTAATTAAGCCACGTAAAATCTTTTCTTTATTAAACTCTTCTCGTGTTCCTTCTTTTTTTACAA CGATAAGAGGTGACTCTTCCACTCTTTCAAAT (SEQ ID NO. 1), CCTAAATTACGAAGTTCACGTTCC

(SEQ ID NO. 2) and ATTTGAAAGAGTGGAAGAGTCACC (SEQ ID NO. 3), respectively. PCR cycling conditions were as follows : 3 minutes at 94°C followed by 40 cycles of: 45 seconds at 94 °C, 50 seconds at 55 °C, and 60 seconds at 72.

Notably, the range tested covers a physiologically relevant range of nucleotide concentrations for mammalian cells, where dNTP levels usually spans the range between 5 and 25μΜ . For bacterial cells, dNTP concentrations are considerably higher and vary e.g . between 90 μΜ (for dGTP) and 260 μΜ (for dTTP) in logarithmically growing E. co/i [8] , Qualitative gel analysis of PCRs - After PCR the DNA content of each PCR sample was analyzed by agarose gel electrophoresis and ethidium bromide staining (and also analyzed by fluorescence intensity measurement upon mixing with SYBR green; see below). For gel analysis, an 8 μΙ aliquot of the PCR mixture was mixed with 1.6 μΙ of 6x DNA loading dye. Samples were then loaded into the wells of a 2% agarose gel (casted in lxTAE) containing 0.5 μς/ιτιΙ ethidium bromide and subjected to electrophoretic separation at 100 Volts for approximately 30 minutes in a 0.5xTAE buffer bath. The separated ethidium bromide-stained DNA fragments were subsequently visualized by UV illumination and the fluorescent emission photographically documented. The result of the analysis is presented in Figure 2A, which shows how the intensity of a specific band of DNA of approximately 200-base pairs in length increases as the concentration of the limiting dNTP increases.

Quantitative analysis of PCRs- For fluorescence intensity analysis a 10 μΙ aliquot from the PCR samples was mixed with 190 μΙ SYBR green (lx working solution according manufacturer's instructions) dissolved in lxTAE and incubated for approximately 5 minutes. (Light exposure of the SYBR green solution was minimized to reduce photobleaching.) Flourescence intensity was recorded at 520 nm (10 nm bandwidth) with excitation set to 485 nm (10 nm bandwidth) with the use of a Polarstar Omega plate reader (BMG Labtech Gmbh) (Fig. 2B). A number of reference samples showed that the linear range of the SYBR green response is between ~2pg/VI and ~1000pg^l DNA when SYBR green was used at a lxworking solution (not shown, see below for further details of the assay). Notably, the linear range can be increased and decreased by increasing or decreasing, respectively, the concentration of SYBR green. Detection limits of the assay- Within the range tested, PCR product formation could be detected when the initial dNTP concentration of one of the dNTPs of the reaction mixture was as low as 0.5μΜ while the other three were at 200 μΜ, see Fig. 2. Detection of the DNA product by SYBR green fluorescence in a 96-well plate (Fig. 2B), or by electrophoretic separation of DNA on an agarose gel and staining of DNA with ethidium bromide (Fig. 2A), both give very similar results. (Both detection methods show that formation of DNA product is linear up to about 16 μΜ dCTP, and that the detection limit is approximately 0.5 μΜ dCTP and dGTP. For dATP and dTTP the detection limit is slightly higher; around 1-2 μΜ. For dUTP in turn, the level of detection is around 8 μΜ. Importantly, no PCR products could be detected when only three dNTPs were present in the PCR mixture. Similar experiments performed using other primers and templates, gave different detection limits (data not shown).

It should be noted that the detection limit strongly depends on the GC content and the length of the DNA template used to detect the dNTP under study. In addition, for dUTP as limiting dNTP the Taq polymerase has a reduced efficiency compared to the other four dNTPs. Thus, the data clearly indicate that the method functions for detection of all 5 dNTPs and that the detection level can be modulated by appropriately choosing DNA templates and PCR cycling conditions. The observed upper limit of the linear range is related to the phenomenon of the plateau phase of the PCR, i.e. when PCR product concentration becomes very high the concentration of DNA polymerase will be the limiting factor of the PCR. This could be partly overcome by increasing the concentration of DNA polymerase in the reaction mixture or by increasing the time for elongation during PCR cycling (data not shown) . Since the method is flexible and allows various modes of quantification there is a possibility to tune the detection limits of the assay. For instance, if the linear range of the method is of concern one may adjust the volume of RNR reaction mixture added to the PCR mixture. Another possibility is to follow the approach to use a radioactive substrate for RNR and subsequently include all four dNTPs in the PCR mixture and to perform quantification of DNA by scintillation- based methods, as described elsewhere in this document. Both these options have the potential to modulate the linear range of the method .

Robustness towards erroneously incorporated nucleotides- To further test the robustness of the PCR, the ability of different dNDPs or NTPs to substitute for the limiting dNTP in the PCR was tested (data not shown). Independently of which of these compounds were added, no PCR product was detected. Thus, unspecific product formation due to incorporation of non-matching nucleotides, deoxyribonucleoside diphosphates or ribonucleoside triphosphates was ruled out. Even thoug h unspecific incorporation of erroneous deoxyribonucleotides or ribonucleotides may occur, the level of this activity is far below the background level of the assay and thereby have a neglectable effect on the amount of DNA formed. Similarly, unspecific formation of DNA side products in the PCR is neglectable.

Analysis of the physiological dNTP levels in mammalian and bacterial cells

Typical concentrations of dNTPs in S-phase mammalian cells are 13 μΜ dATP, 5 μΜ dGTP, 22 μΜ dCTP, and 23 μΜ dTTP. Figure 2 shows that these concentrations can be detected by the method described in this document. To test the ability of the method to determine cellular dNTP levels mouse fibroblasts are to be grown, harvested and cellular metabolites isolated [7; 9; 14] . Briefly, mouse fibroblasts, approximately 10⁶ cells, are immersed in 700 μΙ of ice cold 0.6 M trichloroacetic acid supplemented with 15 mM MgCI₂ in an Eppendorf tube. The tubes are incubated with frequent vortexing at 4°C for 30 min and then centrifuged . The su pernatant is extracted and neutralized twice by 800 μΙ of a mixture of trioctylamine/Freon (22 : 78 v/v) . Four 5 μΙ aliquots from the final extract are used to supply four PCRs, each lacking a single d NTP, with a limiting amount of the last dNTP. All other conditions for the PCR and su bsequent detection of DNA are as descri bed above.

Bacterial dNTP levels- Cellu lar dNTP levels in bacterial cells are considerably higher compared to mammalian cells and vary e.g. between 90 μΜ (for dGTP) and 260 μΜ (for dTTP) in logarithmically growi ng E. coli. To test the method for detection of dNTP levels of bacterial cells nucleotides are to be extracted from E. coli. in the logarithmic and stationary growth phases [9 ; 14; 27] . Cells are harvested by fi ltration on an AAWP nitrocel lulose filter (0.45 pm, Milli pore) and i mmediately im mersed in a 700 μΙ of icecold 0.6 M trichloroacetic acid, 15 mM MgCI₂ in a n Eppendorf tu be . The tubes are incu bated with frequent vortexing at 4°C for 30 min and then centrifuged. The supernatant is extracted and neutralized twice by 800 μΙ of a mixture of trioctylamine/Freon (22 : 78 v/v). Four separate aliquots from the final extract are used to supply four PCRs, each lacking a single dNTP, with a limiting amount of the last dNTP . All other conditions for the PCR and subsequent detection of DNA are as described above.

Efficiency of the NDPK assay

To assess the efficiency of NDPK catalyzed conversion of dNDP to dNTP samples containing 25 mUnits/μΙ of NDPK, 2 m ATP, 3.5 mM MgCI₂ and different concentrations ( 1, 2, 4, 6, 12, 15 μ in separate samples) of dCDP in 50 mM Tris pH 7.5 in total reaction volumes of 10 μΙ were incubated overnight at 37°C whereafter the reactions were quenched by boiling for 5 minutes.

Subsequently, reagents for PCR were added to give the following final concentrations: 200 μΜ of the three dNTP not present in the NDPK reaction (dGTP, dATP and dTTP); Spg/ Ι of DNA template; 0.5 μΜ of each primer of a DNA primer pair specific for the DNA template; 0.02 Units/μΙ Taq DNA polymerase and PCR-reaction buffer (at lxWorking dilution according to manufacturer's instructions) in a total volume of 25 μΙ.

PCR control samples were prepared with known final concentrations of dCTP (the limiting dNTP) of 1, 2, 4, 6, 12, and 15 μΜ (i.e. the final dNTP concentration in the PCR samples that would result if NDPK converted all dNDP to dNTP) in separate samples. All other reagents were as described in the previous section.

All samples were subsequently subjected to PCR cycling and the DNA formed analyzed by fluorescence intensity measurement and gel analysis, as described in the sections PCR test reaction and Analysis of DNA formed in the PCR. To assess the efficiency of NDPK action, the amount of DNA formed in PCR control samples with known amounts of dCTP were compared with samples with NDPK-formed dCTP (Fig. 3). As shown in Figure 3, the NDPK catalyzed conversion of dCDP to dCTP is highly efficient and results in very similar amounts of DNA as in PCRs where dCTP were added directly. Notably, the final equilibrium position for the inter- conversion between tri- and di-phosphates, that will be reached when the NDPK catalyzed reaction has gone to completion, is dictated by the amounts of starting material of the respective nucleotides. Under the given reaction conditions, the triphosphate donor (ATP) is present in excess, leading to nearly full conversion of dCDP into dCTP. Detection of RNR activity using the novel method for RNR enzymes using NDP as substrate.

To determine the enzymatic activity of an RNR enzyme, the amount of deoxyribonucleotide formed per unit of time by the enzyme must be determined. Thus, to quantify the amount of dNTP formed in an RNR reaction (or RNR reaction in conjunction with NDPK) a PCR with an aliquot from the RNR reaction mixture and subsequent quantification of DNA was performed.

The aliquot from the mixture was mixed with a PCR mixture containing all reagents as described in the section PCR test reaction, with the exception that the dNTP potentially formed by the RNR reaction (the dNTP to be quantified) is omitted. PCR cycling and subsequent quantification of DNA, which is related to the amount of deoxyribonucleotide formed in the RNR reaction, are performed as in sections PCR test reaction and Analysis of DNA formed in the PCR. RNR reactions with class I enzyme from E. coli (which consists of two separate subunits, NrdA and NrdB) was set up to contain 500 μΜ CDP and three different amounts of enzyme; three reactions with 0.05 μΜ NrdA and 0.6 μ NrdB, three with 0.1 μΜ NrdA and 0.6 μΜ NrdB, and three with 0.2 μ NrdA and 0.6 μΜ NrdB. The reaction mixture was prepared in 30 mM Tris- buffer at pH 7.5 and also contained 4 mM ATP, 15 mM magnesium-acetate, 30 mM DTT, and 15 mM TCEP. The total reaction volume was 50μΙ. All reagents were kept on ice during preparation of the reaction mixture. The CDP substrate was added last to start the reaction whereupon the samples were transferred to a 25°C water bath and incubated for 20, 30 or 45 minutes. At each time point three samples containing three different ratios of enzyme were quenched by boiling for 5 minutes and subsequently cooled on ice. To convert formed dCDP to dCTP, NDPK was added to give a final activity of 25 mU/μΙ and the reactions incubated overnight at 37°C, quenched by boiling and cooled.

RNR reactions with class I enzyme from P. aeruginosa (made up of two separate subunits, NrdA and NrdB) were also prepared. The reaction mixtures were prepared with three different amounts of enzyme; one with 0.5 μΜ NrdA and 1.0 μΜ NrdB, one with 1.0 μΜ NrdA and 1.0 μΜ NrdB, one with 2.0 μΜ NrdA and 1.0 μΜ NrdB. The reaction mixture was prepared in 30 mM Tris-buffer at pH 7.5 and also contained 0.5 mM ATP, 15 mM magnesium-acetate, 30 mM DTT, and 15 mM TCEP. The total reaction volume was 50μΙ. All reagents were kept on ice during preparation of the reaction mixture. The CDP substrate (500μΜ final concentration) was added last to start the reaction whereupon the samples were transferred to a 25°C water bath and incubated for 60 minutes and then quenched by boiling for 5 minutes and subsequently cooled on ice. To convert formed dCDP to dCTP, samples were supplemented with ATP to give a final concentration of 4mM, and NDPK was added to give a final activity of 25 mU/μΙ. The samples were subsequently incubated overnight at 37°C, quenched by boiling and cooled.

PCR-based quantification of RNR activity.

To quantify the amount of dCTP formed in the RNR reactions, aliquots from the RNR reaction mixtures were transferred to 20 μΙ of pre-made PCR mixtures to give final reaction volumes of 25 μΙ. For samples with class I RNR from E. coli 5 μΙ aliquots were transferred, and for samples with class I RNR from P. aeruginosa 2.5 μΙ aliquots along with of 2,5 μΙ of water. The constituents of the PCR mixtures were (final concentrations given) ; 5 pg/μΙ of DNA template; 0.5 μΜ of each primer of a DNA primer pair specific for the DNA template; 0.02 Units/μΙ Taq DNA polymerase; PCR-reaction buffer (at lxWorking dilution according to manufacturer's instructions) ; and 200 μΜ dGTP, dATP and dTTP (magnesium chloride was omitted since it was contained in the RNR reaction mixture) . The used DNA template, downstream and upstream primers had the following DNA sequences :

CCTAAATTACGAAGTTCACGTTCCACGCTTTGAGTTACTTCTTCTAATTGTCTTAAAGATACTGGCCTTTTT TCGCACGCTTTAATTAAGCCACGTAAAATCTTTTCTTTATTAAACTCTTCTCGTGTTCCTTC I I I I I I I ACAA CGATAAGAGGTGACTCTTCCACTCTTTCAAAT (SEQ ID NO. 1), CCTAAATTACGAAGTTCACGTTCC (SEQ ID NO. 2) and ATTTGAAAGAGTGGAAGAGTCACC (SEQ ID NO. 3), respectively. Samples were subjected to thermo cycling as follows: 3 minutes at 94°C followed by 40 cycles of: 45 seconds at 94 °C, 50 seconds at 55 °C, and 60 seconds at 72.

PCR reference reactions with identical reaction constituents (as in the test samples with RNR enzymes) except that these references contained fixed amounts of CTP and dCTP, which were added after inactivation of RNR and NDPK by boiling for 5 minutes. The reference samples were prepared to contain 100 μΜ dCTP and 400 μΜ CTP, under the assumption that NDPK phosphorylates 100% of the diphosphate nucleotides this corresponds to a substrate conversion of 20%.

To perform the actual quantification of DNA formed in the PCR the fluorescence intensity of a 10 μΙ aliquot mixed with 190 μΙ of SYBR green solution was measured, as described in section

Analysis of DNA formed in the PCR (Fig. 4A, C). The amount of DNA formed, which reflects the amount of the limiting deoxyribonucletide, was determined by comparison with a standard curve. For the given reaction conditions, the specific activity of class I RNR from E. coli was determined to 40 nmol-min^-mg^"1 and for class I RNR from P. aeruginosa to 10 nmol-min^-mg^" ¹. Qualitative analysis of the amount of DNA formed in RNR reactions with class I enzyme from E. coli was also performed with agarose gel electrophoresis (Fig. 4A). Fig. 4A shows that the novel method gives detectable signals at the given reaction conditions. The DNA produced (which is coupled to the amount of dCDP produced by the RNR enzyme) by the PCR is clearly visualized on the gel as bands of approximately 200 base pairs in length. Importantly, the intensity of the bands increases as the time of incubation increases and the band intensity also respond to the amount of enzyme present in the reaction mixture.

Detection of RNR activity using the novel methodology for RNR enzymes using NTP as substrate.

Since some RNR enzymes use NDP and some NTP as substrates the performance of the assay with an RNR that uses NTP as substrate was also tested. To this end, RNR reactions with class II RNR from P. aeruginosa (which consists of two separate subunits, NrdJa and NrdJb) were prepared in total reaction volumes of 50 μΙ. The reactions mixtures were prepared in 30 mM Tris buffer at pH 7.5 containing 1 mM of CTP substrate, 10 mM magnesium-acetate, 30 mM DTT, 15 mM TCEP, 400 μΜ ATP, 30 μΜ vitamin B₁₂ coenzyme (5'-deoxydenosylcobalamin), and enzyme in different amounts in different samples. One sample containing 2 μΜ NrdJa and 2 μΜ NrdJb, one with 4 μΜ NrdJa and 4μΜ NrdJb, and one with 6 μΜ NrdJa and 6 μΜ NrdJb were prepared . All regents were kept on ice during preparation of reaction mixtures. Upon addition of CTP, which was added last, reaction mixtures were transferred to a 25°C water bath, incubated for 90 min, quenched by boiling and cooled. Due to the light sensitivity of deoxyadenosylcobalamin, light exposure of the reaction mixture was minimized and all reaction steps were either performed under dimmed light or in the dark. To quantify the amount of dCTP formed in the RNR reaction, 5 μΙ from each sample was transferred to a 20 μΙ PCR mixture and further processed as described above. The constituents of the PCR mixtures were (final concentrations given); 5 pg/μΙ of DNA template; 0.5 μΜ of each primer of a DNA primer pair specific for the DNA template; 0.02 Units/μΙ Taq DNA polymerase; 0.5 mM MgCI₂ (adjusted to give a final 1.5 mM magnesium(II) ion concentration) ; PCR-reaction buffer (at lxWorking dilution according to manufacturer's instructions); and 200 μΜ dGTP, dATP and dTTP. The used DNA template, downstream and upstream primers as well as PCR cycling conditions were the same as given above.

PCR reference reactions with identical reaction constituents (as in the test samples with RNR enzymes) except that these references contained fixed amounts of CTP and dCTP, which were added after inactivation of RNR by boiling for 5 minutes. The reference samples were prepared to contain 100 μΜ dCTP and 900 μΜ CTP, corresponding to a substrate conversion of 10%.

Analysis of results was performed by agarose gel electrophoresis and SYBR green-based quantification of DNA as described above. Under the given reaction conditions, the specific activity, for 1 mM substrate, was determined to 3 nmol-min^-mg^"1 based on fluorescence intensity measurements (Fig. 4B). The DNA formed in the PCR, which reflects the amount of dCTP formed by the RNR enzyme, also gives detectable signals at the given reaction conditions as determined by qualitative gel analysis. Thus, the method is capable to detect

deoxyribonucleotide formation by both RNR enzymes that use NDPs as susbstrate as well as RNR enzymes that use NTPs as substrate.

Effects of inhibitors on the RNR reaction as assayed with the method of the invention

The ability of the method to analyze the effect of inhibitors on the RNR reaction was tested. RNR reactions with class I RNR from P. aeruginosa was prepared as describe above with the following exceptions: Substrate was present at a single concentration of 100 μΜ and the known RNR inhibitor hydroxyurea was added to yield final concentrations of 10000, 3300, 1100, 370, 120, 41, 13, 4.6, 1.5, 0.51 μΜ in separate samples. Formation of deoxyribonucleotides was subsequently analyzed by PCR-based detection followed by SYBR green-based quantification. Obtained data was analyzed and an IC50 value for inhibition of RNR by hydroxyurea was determined to 140±20 μΜ.

The method in HTS (high-throughput screening) format

To test the suitability of the assay for high-throughput screening applications a screen of the effect of many different compounds was performed in 96 well format.. Multiple RNR reactions using class I RNR from P. aeruginosawas set up as described in section "Screen in multiwell format of the effect of many compounds on RNR reactions". The recorded fluorescence intensity data for such an experiment is presented in Fig . 5A-B. As seen from the positive and negative control wells, inactive compounds are significantly separated from active compounds. A common measure for the robustness of an HTS assay is the Z-factor, which preferably should be between 0.5 and 1, the closer to 1 the better the HTS assay. The Z-factor is calculated according to the formula : 1- (3Sp+3s_n)/| C_p-C_n | ; were s_p and s_n are the standard deviation for the positive and negative controls, respectively; C_p and C_n are the mean values of the positive and negative controls, respectively. The Z-factor of the method was determined to 0.82 using data derived from 24 negative (3.5 mM HU) and 24 positive (no inhibitor) control samples (Fig. 5C). The Z-factor for the positive and negative controls of Fig. 5A-B is 0.79.

Conclusion

Together, these data show that the method can be used to easily detect dNTPs levels under various experimental conditions. For instance, RNR activity in multiple samples can be easily detected within 2-3 hr total assay time with only a few simple pipetting steps and very short hands-on time. Moreover, the method is sufficiently sensitive to allow studies of kinetic parameters of RNR. Since an inhibitor can be easily included in the RNR reaction mixture the most important application of the method is to use it for efficient studies of potential inhibitors and particularly to perform automated high throughput screening of compound libraries to identify novel RNR inhibitors. The latter approach has been virtually impossible using previously available activity assays, which can maximally process 30-40 samples over 1-2 days of intense laboratory work. The novel method in contrast can be easily adapted to robotics and multi-well format. Furthermore, the reagents necessary to perform the method, along with proper instructions, are well suited to be packaged as a kit.

REFERENCES

[ I] C.K. Mathews, DNA precursor metabolism and genomic stability. FASEB J 20 (2006) 1300- 1314.

[2] C.K. Mathews, and S. Song, Maintaining precursor pools for mitochondrial DNA replication. FASEB J 21 (2007) 2294-2303.

[3] P. Nordlund, and P. Reichard, Ribonucleotide reductases. Annu Rev Biochem 75 (2006) 681- 706.

[4] E. Torrents, M. Sahlin, and B.-M. Sjoberg, The ribonucleotide reductase family - Genetics and genomics, in : A.K. K., and V.N . Uversky, (Eds.), Molecular anatomy and physiology of proteins: Ribonucleotide reductase, Nova Science Publishers, 2008, pp. 17-77.

[5] A. Chabes, and L. Thelander, DNA building blocks at the foundation of better survival. Cell Cycle 2 (2003) 171-173.

[6] A. Bourdon, L. Minai, V. Serre, J. P. Jais, E. Sarzi, S. Aubert, D. Chretien, P. de Lonlay, V. Paquis-Flucklinger, H. Arakawa, Y. Nakamura, A. Munnich, and A. Rotig, Mutation of RRM2B, encoding p53-controlled ribonucleotide reductase (p53R2), causes severe mitochondrial DNA depletion. Nat Genet 39 (2007) 776-780.

[7] A. Chabes, B. Georgieva, V. Domkin, X. Zhao, R. Rothstein, and L. Thelander, Survival of DNA damage in yeast directly depends on increased dNTP levels allowed by relaxed feedback inhibition of ribonucleotide reductase. Cell 112 (2003) 391-401.

[8] M.H. Buckstein, J. He, and H. Rubin, Characterization of nucleotide pools as a function of physiological state in Escherichia coli. J Bacteriol 190 (2008) 718-726.

[9] J.X. Khym, An analytical system for rapid separation of tissue nucleotides at low pressures on conventional anion exchangers. Clin Chem 21 (1975) 1245-1252.

[10] A.B. Canelas, A. ten Pierick, C. Ras, R.M. Seifar, J.C. van Dam, W.M. van Gulik, and J.J. Heijnen, Quantitative evaluation of intracellular metabolite extraction techniques for yeast metabolomics. Anal Chem 81 (2009) 7379-7389.

[I I] M.R. Mashego, K. Rumbold, M. De Mey, E. Vandamme, W. Soetaert, and J.J. Heijnen, Microbial metabolomics: past, present and future methodologies. Biotechnol Lett 29 (2007) 1- 16.

[12] J.D. Rabinowitz, and E. Kimball, Acidic acetonitrile for cellular metabolome extraction from Escherichia coli. Anal Chem 79 (2007) 6167-6173.

[13] P. Chen, Z. Liu, S. Liu, Z. Xie, J. Aimiuwu, J. Pang, R. Klisovic, W. Blum, M. R. Grever, G.

Marcucci, and K.K. Chan, A LC-MS/MS method for the analysis of intracellular nucleoside triphosphate levels. Pharm Res 26 (2009) 1504-1515.

[14] A. Hofer, J .T. Ekanem, and L. Thelander, Allosteric regulation of Trypanosoma brucei ribonucleotide reductase studied in vitro and in vivo. J Biol Chem 273 ( 1998) 34098-34104.

[ 15] P. A. Sherman, and J . A. Fyfe, Enzymatic assay for deoxyribonucleoside triphosphates using synthetic oligonucleotides as template primers. Anal Biochem 180 ( 1989) 222-226.

[16] L. Thelander, B.-M. Sjoberg, and S. Eriksson, Ribonucleoside diphosphate reductase (Escherichia coli). Methods Enzymol 51 (1978) 227-237.

[ 17] B.-M. Sjoberg, and M. Sahlin, Thiols in redox mechanism of ribonucleotide reductase.

Methods Enzymol 348 (2002) 1-21. [ 18] M.F. Kramer, and D.M. Coen, Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr Protoc Cytom Appendix 3 (2006) Appendix 3K.

[19] 3. Sambrook, E.F. Fritsch, and T. Maniatis, Molecular Cloning : A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989.

[20] P. Larsson Birgander, S. Bug, A. Kasrayan, S.L. Dahlroth, M. Westman, E. Gordon, and B.- M. Sjoberg, Nucleotide-dependent formation of catalytically competent dimers from engineered monomeric ribonucleotide reductase protein Rl. J Biol Chem 280 (2005) 14997-15003.

[21] B.-M. Sjoberg, S. Hahne, M. Karlsson, H. Jornvall, M. Goransson, and B.E. Uhlin,

Overproduction and purification of the B2 subunit of ribonucleotide reductase from Escherichia coli. J Biol Chem 261 ( 1986) 5658-5662.

[22] E. Torrents, M. Westman, M. Sahlin, and B.-M. Sjoberg, Ribonucleotide reductase modularity: Atypical duplication of the ATP-cone domain in Pseudomonas aeruginosa. J Biol Chem 281 (2006) 25287-25296.

[23] M.M. Bradford, A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72 (1976) 248-254.

[24] A. Jordan, E. Torrents, C. Jeanthon, R. Eliasson, U. Hellman, C. Wernstedt, J. Barbe, I.

Gibert, and P. Reichard, B12-dependent ribonucleotide reductases from deeply rooted eubacteria are structurally related to the aerobic enzyme from Escherichia coli. Proc Natl Acad

Sci USA 94 ( 1997) 13487-13492.

[25] M. Fontecave, Ribonucleotide reductase from Pyrococcus furiosus. Methods Enzymol 334

(2001) 215-27.

[26] E. Torrents, A. Poplawski, and B.-M. Sjoberg, Two proteins mediate class II ribonucleotide reductase activity in Pseudomonas aeruginosa: expression and transcriptional analysis of the aerobic enzymes. J Biol Chem 280 (2005) 16571-16578.

[27] A. Platz, M . Karlsson, S. Hahne, S. Eriksson, and B.-M. Sjoberg, Alterations in intracellular deoxyribonucleotide levels of mutationally altered ribonucleotide reductases in Escherichia coli. J Bacteriol 164 ( 1985) 1194-1199.

Claims

1. Method for determining the amount of a deoxyribonucleotide potentially formed by an RNR comprising

b) mixing said sample potentially comprising said deoxyribonucleotide with reagents necessary for a PCR, comprising the necessary deoxyribonucleotides except the deoxyribonucleotide potentially formed in vivo or in vitro by the RNR, and a DNA polymerase,

c) performing a PCR,

2. Method for determining the enzymatic activity of an RNR comprising

b) mixing the potentially formed deoxyribonucleotide of step a') with reagents necessary fo a PCR, said reagents comprising the necessary deoxyribonucleotides except the

deoxyribonucleotide potentially formed by the RNR in step a'), and a DNA polymerase, c) performing a PCR,

3. Method according to claim 1 or 2 further comprising the step of subjecting said RNR to a substance potentially affecting its enzymatic activity wherein said further step can be performed before step a) or a'), respectively, or simultaneously with step a) or a'), respectively.

4. Method according to claim 3, wherein the step of subjecting said RNR to a substance potentially affecting its enzymatic activity is performed by subjecting a eukaryotic or prokaryoti cell, tissue or an organism to said substance potentially affecting the enzymatic activity of said RNR.

5. Method according to claim 1 or 2, wherein a eukaryotic or prokaryotic cell, tissue or an organism is subjected to a substance potentially affecting the activity of an enzyme involved in the cellular deoxyribonucleotide metabolism other than RNR.

6. Method according to claim 4 or 5, wherein the organism is a mammal.

7. A method according to any one of claims 1-6, wherein said deoxyribonucleotide potentially formed in step a) or a') is radio-labelled and wherein step b) optionally all four

deoxyribonucleotides are present.

8. Method for determining the amount of a dNTP in a dNTP pool comprising the steps of

c) performing four separate PCRs

9. Method according to any of the preceding claims, wherein step d) is performed by

fluorescence intensity measurements, radioactivity measurements, by separation of DNA on an agarose gel followed by DNA staining or by direct measurements of absorbance.

10. Method according to claim 9, wherein the direct fluorescence measurement is performed using a DNA-binding fluorescent dye which exhibits an intensity change upon binding to DNA.

11. Method according to claim 10, wherein the label is SYBR green, Pico green, Hoechts or ethidium bromide.

12. Method according to claim 11, wherein the DNA staining is made by ethidium bromide.

13. A method according to any one of claims 1-8, wherein step d) is performed by radioactivity measurements using scintillation proximity assay.

14. A method according to claim 13, wherein the primers for the PCR reaction are labelled with biotin.

15. Method according to any of the preceding claims wherein the RNR is of class I.

16. Method according to any of claims 1-14, wherein the RNR is of class II.

17. Method according to any of claims 1-14, wherein the RNR is of class III.

18. Method according to any of the preceding claims, wherein the template used for the PCR comprises a similar amount of all four nucleotides.

19. A method according to any one of claims 1-17, wherein the template used for the PCR has a GC content of about 5-35%.

20. Use of a PCR for determining the amount of a deoxyribonucleotide in a sample.

21. Use of a PCR for determining the enzymatic activity of an RNR.

22. Use of a PCR for determining the amount of a dNTP in a dNTP pool.