WO2021230609A1 - Modèle de simulation d'organe in vivo de maladie de fabry et son procédé de fabrication - Google Patents

Modèle de simulation d'organe in vivo de maladie de fabry et son procédé de fabrication Download PDF

Info

Publication number
WO2021230609A1
WO2021230609A1 PCT/KR2021/005855 KR2021005855W WO2021230609A1 WO 2021230609 A1 WO2021230609 A1 WO 2021230609A1 KR 2021005855 W KR2021005855 W KR 2021005855W WO 2021230609 A1 WO2021230609 A1 WO 2021230609A1
Authority
WO
WIPO (PCT)
Prior art keywords
gla
fabry disease
stem cells
kidney
gene
Prior art date
Application number
PCT/KR2021/005855
Other languages
English (en)
Korean (ko)
Inventor
김용균
김진원
서은정
남선아
Original Assignee
가톨릭대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 가톨릭대학교 산학협력단 filed Critical 가톨릭대학교 산학협력단
Publication of WO2021230609A1 publication Critical patent/WO2021230609A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0684—Cells of the urinary tract or kidneys
    • C12N5/0686—Kidney cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00—Coculture with; Conditioned medium produced by
    • C12N2502/45—Artificially induced pluripotent stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2503/00—Use of cells in diagnostics
    • C12N2503/02—Drug screening

Definitions

  • the present invention relates to a disease model using kidney organoids and a method for constructing the same, and to a human stem cell-derived kidney organoid implementing Fabry disease and a method for implementing Fabry disease.
  • Fabry disease is a rare X-linked genetic disorder that causes defects in the glycosphingolipid metabolic pathway as a result of the absence or lack of activity of the lysosomal enzyme ⁇ -galactosidase A ( ⁇ -Gal A) am.
  • ⁇ -Gal A deficiency results in the accumulation of globotriaosylceramide (Gb3) and related neutral glycosphingolipids in the ribosome, impairing cell morphology and function.
  • Gb3 globotriaosylceramide
  • Fabry disease is a multisystem disease with life-threatening complications such as stroke, heart failure, cardiac arrhythmias and end stage renal disease (ESRD), which shortens life expectancy.
  • Renal involvement is frequent in renal variants of classical male Fabry disease as well as non-classical female Fabry disease, which often begins with microalbuminuria or proteinuria at the age of 20 to 30 years.
  • the progressive deterioration of renal function leads to ESRD at 4-5 years, which is known to be the leading cause of death in untreated Fabry disease patients.
  • Renal Fabry disease results from the accumulation of Gb3 in renal cells such as podocytes, glomerular endothelial cells, glomerular stromal cells, tubular epithelial cells and vascular endothelial cells.
  • Recombinant enzyme replacement therapy (ERT) with agalsidase- ⁇ and agalsidase- ⁇ clears cellular deposits of Gb3 and ameliorates disease burden, respectively.
  • ERT is potentially limited by the re-accumulation of Gb3 in podocytes after dose adjustment during the follow-up period and the formation of neutralizing anti-drug antibodies after injection, which reduces the efficacy of ERT by increased cellular Gb3 deposition and progressively lead to adverse clinical consequences of renal function, such as loss.
  • Gene therapy may be a potential treatment alternative for Fabry disease.
  • Success in gene therapy with rAAV for the treatment of congenital blindness, hemophilia B and lipoprotein lipase deficiency enhances gene therapy for Fabry disease.
  • rAAV2/8-hAGA-mediated ⁇ -Gal A gene therapy has been reported to have improved efficiency compared to ERT in a Fabry disease mouse model.
  • the present inventors generated GLA-knockout human induced pluripotent stem cells (iPSCs) and differentiated kidney organoids through CRISPR/Cas9 mediated gene editing, and developed renal Fabry disease in kidney organoids differentiated from GLA-knockout human iPSCs. , and also demonstrated the efficacy of ERT in GLA-knockout human iPSC-derived kidney organoids, thereby demonstrating that it is an efficient and useful model of human renal Fabry disease, thereby completing the present invention.
  • iPSCs human induced pluripotent stem cells
  • Another object of the present invention is to provide a kidney organoid differentiated from stem cells in which the GLA gene is knocked out as an in vivo organ mimic model of Fabry disease.
  • Another object of the present invention is to provide a screening method for a therapeutic agent for Fabry disease.
  • the present invention comprises the steps of knocking out the galactosidase alpha (GLA) gene in stem cells; And it provides a method for producing a long-term mimic model of Fabry disease, comprising the step of differentiating the GLA gene knockout stem cells into kidney organoids.
  • GLA galactosidase alpha
  • the present invention provides a kidney organoid differentiated from stem cells in which a galactosidase alpha (GLA) gene is knocked out, wherein the kidney organoid is an in vivo organ mimic model of Fabry disease.
  • GLA galactosidase alpha
  • the present invention comprises the steps of treating a candidate substance for the treatment of Fabry disease on the renal organoid of the present invention; confirming the degree of accumulation of Gb3 (globotriaosylceramide) in kidney organoids treated with the candidate substance; and selecting a substance that reduces the accumulation of Gb3 as compared to the untreated group as a Fabry disease therapeutic agent.
  • Gb3 globotriaosylceramide
  • the knockout may be performed using the CRISPR-Cas9 gene editing system, but is not limited thereto.
  • the knockout may be a deletion of the nucleotide sequence (CCTACCATG) of SEQ ID NO: 1 in the GLA gene, but is not limited thereto.
  • the stem cell may be an induced pluripotent stem cell (iPSC), but is not limited thereto.
  • iPSC induced pluripotent stem cell
  • the present invention relates to a disease model using a kidney organoid and a method for constructing the same, which can be used as an effective in vivo organ mimic model in the development of a new treatment for Fabry disease by implementing Fabry disease with a renal organoid derived from human stem cells. It is expected that it will be possible
  • 1A shows a human GLA-specific gRNA sequence.
  • 1B shows the GLA gene deletion site of clone #5 and clone #9.
  • Figure 1c shows the expression levels of GLA protein of clone #5 and clone #9 in GLA-knockout human iPSC as a result of Western blot.
  • 1D shows the expression levels of GLA protein of clone #5 and clone #9 in GLA-knockout human iPSC-derived kidney organoids as a result of Western blot.
  • Figure 2a shows the result of confirming the structure of the GLA-knockout human iPSC-derived kidney organoid under a bright field microscope.
  • Figure 2b shows the results of confirming the structure of the GLA-knockout human iPSC-derived kidney organoids by PAS staining.
  • Figure 2c shows the result of confirming the structure of the GLA-knockout human iPSC-derived kidney organoid with an electron microscope.
  • LDL proximal tubule
  • NPHS1 podocytes
  • ERT enzyme replacement therapy
  • the present invention comprises the steps of knocking out the galactosidase alpha (GLA) gene in stem cells; And it provides a method of manufacturing an in vivo long-term mimic model of Fabry disease, comprising the step of differentiating the GLA gene knockout stem cells into kidney organoids.
  • GLA galactosidase alpha
  • kidney organoid differentiated from stem cells in which the GLA gene is knocked out wherein the kidney organoid is an in vivo organ mimic model of Fabry disease.
  • Fabry disease is one of lysosomal storage disorders caused by a deficiency of an enzyme called alpha-galactosidase A ( ⁇ -Gal A).
  • Fabry's disease is inherited as an X-linked recessive trait and occurs mainly in males and relatively mild symptoms in females. Symptoms usually begin in childhood or adolescence and progress slowly during adulthood. And it occurs at a rate of 1 in 40,000 males, and is known to occur at a rate of 1 in 117,000 in the total population.
  • Deficiency of ⁇ -Gal A causes accumulation of Gb3 (globotriaosylceramide) in lysosomes, which leads to serious complications of peripheral neuropathy, skin, kidney disease, cardiomyopathy, and stroke.
  • Gb3 globotriaosylceramide
  • GLA galactosidase alpha gene
  • ⁇ -Gal A alpha-galactosidase A
  • the knockout may be using a CRISPR-Cas9 gene editing system.
  • CRISPR-Cas9 or "CRISPR-Cas9 gene editing system” used in the present invention is a genome editing method called CRISPR (Clustered regularly interspaced short palindromic repeat, CRISPR) gene scissors, which is specific for a specific nucleotide sequence. It is composed of RNA (gRNA) that binds to , and Cas9 protein, which acts as a scissors to cut a specific nucleotide sequence. Using this CRISPR/Cas9 system, knock-out that can inhibit the function of a specific gene is possible by introducing plasmid DNA into a cell or animal.
  • CRISPR Clustered regularly interspaced short palindromic repeat
  • knock-out refers to partial, substantial, or complete deletion, silencing, inactivation or down-regulation of a gene.
  • gRNA guide RNA
  • guide RNA refers to a small RNA of about 45 to 70 nucleotides having nucleotide sequence information that is a template for a modification reaction when editing RNA.
  • the 5' side region of gRNA is in the order complementary to the part of the mRNA to be edited, and is bound to the mRNA through this region, and in the 3' side region, there is a nucleotide sequence complementary to the order of the final mRNA after editing, and the sequence information is Accordingly, RNA modification reactions such as insertion or deletion of uridine bases occur.
  • the knockout may be a deletion of the nucleotide sequence (CCTACCATG) of SEQ ID NO: 1 in the GLA gene.
  • the stem cells may be induced pluripotent stem cells (iPSCs).
  • iPSCs induced pluripotent stem cells
  • stem cell as used in the present invention is a cell that is the basis of cells or tissues constituting an individual, and its characteristic is that it can self-renew by dividing repeatedly, and depending on the environment, It refers to a cell having a multidifferentiation ability capable of differentiating into a cell having a function. It occurs in all tissues during the development of the fetus and is found in some tissues where cells are actively replaced, such as bone marrow and epithelial tissue, even in adulthood. Stem cells are totipotent stem cells, which are formed when a fertilized egg begins dividing, and pluripotent stem cells in the blastocyst, which are formed by continuing division of these cells, depending on the type of differentiated cell.
  • the pluripotent stem cells are cells that can differentiate only into cells specific to the tissues and organs that contain these cells, and not only the growth and development of each tissue and organ in the fetal, neonatal and adult stages, but also homeostasis of adult tissues. It is involved in maintenance and inducing regeneration in the event of tissue damage. These tissue-specific pluripotent cells are collectively referred to as adult stem cells.
  • induced pluripotent stem cell refers to an embryonic stem cell that returns to the cell stage prior to differentiation by injecting a cell differentiation-related gene into a somatic cell that has been differentiated as a dedifferentiated stem cell.
  • Cells that induce pluripotency such as The induced pluripotent stem cells may be of human origin, for example, human tissue, blood, etc., means that the source of the induced pluripotent stem cells is human, but is not limited thereto.
  • the term "organoid” is a 'mini-like organ' made to have minimal functions using stem cells. is characterized. Cells are transformed into a three-dimensional cell aggregate formed through self-renewal and self-organization from adult stem cells (ASCs), embryonic stem cells (ESCs), and induced pluripotent stem cells (iPSCs). It contains specific cells of the model organ by re-aggregating and recombination using a three-dimensional culture method. While overcoming the limitations of 2D cell line culture methods, existing efficient 2D culture-based biochemical and cell biological analysis techniques can be easily utilized. In addition, the physiologically active function of the human body can be similarly reproduced, and by constructing an organ analogue from the patient's tissue, disease modeling based on the patient's genetic information, drug screening through repeated tests, etc. can be performed.
  • living organ simulation model means simulating the physiological environment in which an actual human organ operates, and in the present invention, it may be a kidney organoid.
  • the present invention comprises the steps of treating a candidate substance for the treatment of Fabry disease to the renal organoid of the present invention; confirming the degree of accumulation of Gb3 (globotriaosylceramide) in kidney organoids treated with the candidate substance; and selecting a substance that reduces the accumulation of Gb3 as compared to the untreated group as a Fabry disease therapeutic agent.
  • Gb3 globotriaosylceramide
  • Enzyme replacement therapy is a treatment that supplements the deficient lysosomal enzyme by administering recombinant ⁇ -galactosidase A ( ⁇ -Gal A) to Fabry disease patients, and was approved in the United States in 2003.
  • ⁇ -Gal A ⁇ -galactosidase A
  • Commercially available recombinant ⁇ -Gal A used for enzyme replacement therapy includes Fabrazyme from Genzyme in the US and Replagal from Trans Karyotic Therapeutics, Inc. in Europe. have.
  • Isuabsys a domestic pharmaceutical company, also marketed Fabagal and is being used as a treatment.
  • Enzyme replacement therapy is known to have therapeutic effects on Fabry disease, such as lowering plasma and urine Gb3 concentrations, alleviating nerve pain, alleviating the occurrence of heart disease, and stabilizing kidney function.
  • enzyme replacement therapy is currently the most widely known treatment for Fabry disease, it has been reported that enzyme replacement therapy is limited or ineffective in Fabry disease with moderate or severe renal impairment. It is very important to evaluate the therapeutic effect in the course of enzymatic treatment.
  • a CRISPR/Cas9 All-in-one plasmid was constructed and a GLA mutant clone was generated.
  • All-in-one CRISPR/Cas9 carrying GFP and gRNA was purchased from Life Technologies (Cat. A21174, GeneArt CRISPR Nuclease Vector Kit).
  • Human GLA-specific gRNA sequences were provided by Invitrogen Life Technologies. The GLA gRNA sequence is as follows: TTGGCAAGGACGCCTACCAT (SEQ ID NO:2). Oligo annealing and subcloning with the Cas9 nuclease reporter vector was performed according to the instructions.
  • Cas9 nuclease reporter vector containing gRNA for GLA was transfected by electroporation into iPSCs (CMC11), and the cells were cultured for 7-10 days.
  • GFP-expressing cells were sorted by FACS, seeded as single cells in 96-well and cultured until pure clones. A total of six clones expressing GFP were obtained and analyzed by Sanger sequencing. Clones #5 and #9 were identified as deletion mutants and used for western analysis.
  • CMC11 iPSCs were obtained from the Catholic University of Korea (male donor). Cells with passage numbers between 30 and 60 were used.
  • GLA knockout human iPSCs were 24-well with mTeSR1 medium (Stem Cell Technologies) + 10 ⁇ M Y27632 (LC Laboratories) on glass plates (LabTek) coated with 3% GelTrex (Thermo Fisher Scientific). Plates were plated at a density of 5,000 cells/well (day -3).
  • kidney organoids were fixed at day 18 of differentiation. For fixation, an equal volume of PBS (Thermo Fisher Scientific) + 8% paraformaldehyde (Electron Microscopy Sciences) was added to the medium for 15 minutes, and then the samples were washed three times with PBS. The fixed organoid cultures were blocked in 5% donkey serum (Millipore) + 0.3% Triton-X-100/PBS, washed by incubating overnight in 3% bovine serum albumin (Sigma) + PBS with primary antibody, and Alexa Incubated with Fluor (Invitrogen) secondary antibody, washed, and stained or mounted with DAPI in Vectashield H1000.
  • PBS Thermo Fisher Scientific + 8% paraformaldehyde
  • the fixed organoid cultures were blocked in 5% donkey serum (Millipore) + 0.3% Triton-X-100/PBS, washed by incubating overnight in 3% bovine serum albumin (Sigma) + PBS with primary
  • the primary antibodies used in this experiment were: anti-LTL (Vector Labs FL-1321, 1:500 dilution), anti-NPHS1 (R&D AF4269, 1:500), and anti-Gb3 (TCI chemicals A2506, 1:500).
  • Renal organoid in vitro samples were fixed overnight at 4°C in 0.1 M phosphate buffer containing 4% paraformaldehyde and 2.5% glutaraldehyde. After washing with 0.1 M phosphate buffer, the sample was fixed at 4° C. for 1 hour in the same buffer containing 1% osmium tetroxide. The samples were then dehydrated with a series of graded ethanol solutions, exchanged with acetone, and embedded in Epon 812.
  • Ultrathin sections (70-80 nm) were obtained by an Ultramicrotome (Leica Ultracut UCT, Germany). Ultrathin sections were double stained with uranyl acetate and lead citrate and examined with a transmission electron microscope (JEM 1010, Japan) at 60 kV.
  • Renal organoids were homogenized in boiling lysis buffer (1% sodium dodecyl sulfate [SDS], 1 mM sodium orthovanadate, and 10 mM Tris, pH 7.4) and a BCA protein assay kit (Pierce Biotechnology Inc., Rockford, IL, USA) was prepared. was used to measure the protein concentration. Equal amounts of proteins were separated on SDS-polyacrylamide gels. The gel was then transferred to a nitrocellulose membrane. For immunodetection, non-specific binding sites were blocked with PBS containing 0.1% Tween-20 and 5% skim milk, and then the blots were incubated overnight in the same solution as the primary antibody (anti-GLA, Invitrogen 1:1000).
  • the blots were washed and incubated with a secondary antibody conjugated to horseradish peroxidase (Peroxidase AffiniPure F(ab')2 Fragment Donkey Anti-Rat IgG, Jackson Immuno Research Lab.) and Western Blotting Luminol Reagent Kit (Santa Cruz Biotechnology). was used to visualize the blot.
  • kidney organoids were embedded in wax and cut transversely to a thickness of 4 ⁇ m using a microtome. After embedding, sections were processed for PAS staining. Sections were washed with distilled water, dehydrated with graded ethanol and xylene, mounted on Canada balsam, stained with PAS and examined by light microscopy.
  • Kidney organoids differentiated in Example 2 were observed with a bright field microscope (JSI-200, Samwon scientific).
  • the coding sequence (CDS) of GLA was targeted to generate GLA knockout iPSCs (CMC11).
  • CMC11 GLA knockout iPSCs
  • a GLA-specific single-guide RNA (sgRNA) was provided by a pre-designed synthetic gRNA online tool to introduce a deletion mutation in exon 1 of the GLA gene (see Fig. 1a).
  • iPSCs were transfected with an all-in-one vector expressing Cas9, sgRNA and GFP.
  • GFP-positive cells were isolated using FACS, and these cells were cultured in 96-well plates. Six clones expressing GFP were identified by Sanger sequencing analysis. Two out of six clones were identified with modifications in genetic lesions targeted by GLA-specific sgRNA mediated Crispr/Cas9.
  • Clones #5 and #9 showed deletions of 16 and 9 nucleotides in exon 1, resulting in out-of-frame and in-frame mutations, respectively (see FIG. 1B ).
  • the GLA protein of clone #5 was expected to produce a shorter amount than the normal GLA protein due to the initial appearance of the stop codon.
  • clone #5 As expected, in clone #5, no GLA protein was detected by the GLA antibody compared to the control GLA protein. On the other hand, clone #9 showed a lower level of GLA protein than the control (see FIGS. 1C and 1D ). According to the above results, the disappearance of the GLA protein in clone #5 was predicted to be due to an early stop codon, and clone #9 was selected because it was predicted that the amount of GLA protein was low due to low mRNA expression in clone #9.
  • the nucleotide sequence of the deletion site of clone #9 is as follows: CCTACCATG (SEQ ID NO: 1). Therefore, it was confirmed that the GLA knockout iPSC cell line was successfully generated using the CRISP/Cas9 genome editing system.
  • GLA-knockout human iPSC-derived kidney organoids was confirmed by bright field microscopy, electron microscopy and PAS staining.
  • wild-type human iPSCs (CMC11) and GLA-knockout human iPSCs (GLA9) were differentiated into kidney organoids on day 18 (see FIG. 2a ), and the differentiated GLA-knockout kidney organoids exhibited apoptotic cell death. It was confirmed that it was transformed into (see FIG. 2b).
  • Gb3 globotriaosylceramide
  • NPHS1 GLA-knockout human iPSC-derived kidney organoid podocytes
  • ERT enzyme replacement therapy
  • agalsidase- ⁇ and agalsidase- ⁇ are known to inhibit the accumulation of Gb3. Therefore, as a result of confirming whether GLA-knockout human iPSC-derived renal organoids can reproduce the therapeutic effect in Fabry disease, GLA- by enzyme replacement therapy (ERT) using recombinant human ⁇ -Gal A (rh ⁇ -GLA) It was found that the altered cellular structure of the knockout kidney organoid was restored (see Fig. 4 top), and the accumulation of Gb3 was reduced (see Fig. 4 bottom).
  • the human stem cell-derived kidney organoid according to the present invention is expected to be usefully used as an effective in vivo organ simulating model in the development of a new therapeutic agent for Fabry disease.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Urology & Nephrology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

La présente invention concerne un organoïde rénal dérivé de cellules souches humaines dans lequel un gène de galactosidase alpha (GLA) est neutralisé, mettant en oeuvre la maladie de Fabry, et une méthode pour mettre en oeuvre la maladie de Fabry, et l'organoïde rénal de la présente invention devrait être utilisé comme modèle de simulation d'organe in vivo efficace dans le développement d'une nouvelle thérapie pour la maladie de Fabry.
PCT/KR2021/005855 2020-05-13 2021-05-11 Modèle de simulation d'organe in vivo de maladie de fabry et son procédé de fabrication WO2021230609A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0056875 2020-05-13
KR1020200056875A KR102253326B1 (ko) 2020-05-13 2020-05-13 파브리병의 생체 장기 모사 모델 및 이의 제조방법

Publications (1)

Publication Number Publication Date
WO2021230609A1 true WO2021230609A1 (fr) 2021-11-18

Family

ID=76158481

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/005855 WO2021230609A1 (fr) 2020-05-13 2021-05-11 Modèle de simulation d'organe in vivo de maladie de fabry et son procédé de fabrication

Country Status (2)

Country Link
KR (1) KR102253326B1 (fr)
WO (1) WO2021230609A1 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102571867B1 (ko) * 2021-12-13 2023-08-30 가톨릭대학교 산학협력단 고도 분화 신장 오가노이드 제조 방법
KR20230149381A (ko) * 2022-04-19 2023-10-27 가톨릭대학교 산학협력단 A4galt 유전자 편집을 통한 파브리병의 치료 방법

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101519452B1 (ko) * 2013-12-23 2015-05-12 한국과학기술원 파브리 병의 유도-만능 줄기세포 모델 및 이의 용도
KR20190069238A (ko) * 2017-12-11 2019-06-19 대한민국(관리부서 질병관리본부장) Keap1 넉아웃 배아줄기세포 및 이의 제조 방법

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101519452B1 (ko) * 2013-12-23 2015-05-12 한국과학기술원 파브리 병의 유도-만능 줄기세포 모델 및 이의 용도
KR20190069238A (ko) * 2017-12-11 2019-06-19 대한민국(관리부서 질병관리본부장) Keap1 넉아웃 배아줄기세포 및 이의 제조 방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
FREEDMAN BENJAMIN S.: "Modeling Kidney Disease with iPS Cells : Supplementary Issue: Stem Cell Biology", BIOMARKER INSIGHTS, LIBERTAS ACADEMICA LTD., NEW ZEALAND, vol. 10s1, 1 January 2015 (2015-01-01), New Zealand , pages BMI.S20054, XP055786593, ISSN: 1177-2719, DOI: 10.4137/BMI.S20054 *
MINORU TAKASATO, ER PEI X., CHIU HAN S., MAIER BARBARA, BAILLIE GREGORY J., FERGUSON CHARLES, PARTON ROBERT G., WOLVETANG ERNST J.: "Kidney organoids from human iPS cells contain multiple lineages and model human nephrogenesis", NATURE, NATURE PUBLISHING GROUP UK, LONDON, vol. 526, 22 October 2015 (2015-10-22), London, pages 564 - 568, XP055454802, ISSN: 0028-0836, DOI: 10.1038/nature15695 *
SONG, CHIEN, YARMISHYN, CHOU, YANG, WANG, LEU, YU, CHANG, CHIOU: "Generation of GLA-Knockout Human Embryonic Stem Cell Lines to Model Autophagic Dysfunction and Exosome Secretion in Fabry Disease-Associated Hypertrophic Cardiomyopathy", CELLS, vol. 8, no. 4, 8 April 2019 (2019-04-08), XP055867488, DOI: 10.3390/cells8040327 *

Also Published As

Publication number Publication date
KR102253326B1 (ko) 2021-05-18

Similar Documents

Publication Publication Date Title
US20240196872A1 (en) Double knockout (gt/cmah-ko) pigs, organs and tissues
Zhang et al. CRISPR/Cas9‐mediated sheep MSTN gene knockout and promote sSMSCs differentiation
WO2021230609A1 (fr) Modèle de simulation d'organe in vivo de maladie de fabry et son procédé de fabrication
Twigg et al. Oxidative damage to DNA in human spermatozoa does not preclude pronucleus formation at intracytoplasmic sperm injection.
EP0449948B1 (fr) Greffe de cellules genetiquement modifiees pour le traitement de maladies du systeme nerveux central
CN102329779B (zh) 通过mRNA诱导体细胞为多能干细胞的方法
US20050132426A1 (en) Long-term cell culture compositions and genetically modified animals derived therefrom
KR20080051191A (ko) 단리된 동종접합 간세포, 그로부터 유래된 분화 세포 및이들을 제조 및 사용하기 위한 물질 및 방법
JP2011015693A (ja) 移植可能なヒトニューロン幹細胞
US20040241838A1 (en) Stem cells
WO2004003182A2 (fr) Cellules souches homozygotes isolees, cellules differenciees derivees de ces cellules et materiaux et procedes d'obtention et d'utilisation correspondants
US20150258149A1 (en) Adult bone marrow cell transplantation to testes creation of transdifferentiated testes germ cells, leydig cells and sertoli cells
Park et al. Assisted reproductive techniques and genetic manipulation in the common marmoset
IL148457A (en) Method of isolating a mammalian primary cell of a desired type, a cell isolated by the method and a tissue isolated by the method
Ruvinsky Basics of gametic imprinting
Mobley Neural stem cells and adult neurogenesis
WO2001019182A1 (fr) Transfert nucleaire utilisant des cellules donneuses selectionnees
US20090170203A1 (en) Methods for female mammalian spermatogenesis and male mammalian oogenesis using synthetic nanobiology
WAGLEY et al. Culture of principal cells from the ram epididymis: a comparison of the morphology of principal cells in culture and in situ
KR101173116B1 (ko) 신규한 돼지 정조줄기세포 분리 및 배양 방법
Friedrich et al. Mouse genital ridges in organ culture: the effects of temperature on maturation and experimental induction of teratocarcinogenesis
MXPA02010075A (es) Celulas pluripotentes que comprenden nucleos alogenicos y mitocondria.
US20020197715A1 (en) Culture system for mouse tracheal epithelial cells
WO2023204463A1 (fr) Procédé de traitement de la maladie de fabry par édition du gène a4galt
US20120196769A1 (en) Methods of repairing tandemly repeated DNA sequences and extending cell life-span using nuclear transfer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21803098

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21803098

Country of ref document: EP

Kind code of ref document: A1