WO2021228839A1 - Détection de polynucléotides par des nucléases cas - Google Patents

Détection de polynucléotides par des nucléases cas Download PDF

Info

Publication number
WO2021228839A1
WO2021228839A1 PCT/EP2021/062457 EP2021062457W WO2021228839A1 WO 2021228839 A1 WO2021228839 A1 WO 2021228839A1 EP 2021062457 W EP2021062457 W EP 2021062457W WO 2021228839 A1 WO2021228839 A1 WO 2021228839A1
Authority
WO
WIPO (PCT)
Prior art keywords
rna
sample
reporter
detecting
crrna
Prior art date
Application number
PCT/EP2021/062457
Other languages
English (en)
Inventor
Nina PAPAVASILIOU
Riccardo PECORI
Beatrice CASATI
Johan ZEELEN
Original Assignee
Deutsches Krebsforschungszentrum
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from EP20190953.8A external-priority patent/EP3954783A1/fr
Application filed by Deutsches Krebsforschungszentrum filed Critical Deutsches Krebsforschungszentrum
Publication of WO2021228839A1 publication Critical patent/WO2021228839A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means

Definitions

  • the present invention relates to a method for detecting an RNA virus in a sample, comprising the steps of a) releasing viral RNA from said sample; b) amplifying at least parts of the viral RNA comprised in said sample; c) contacting the amplified viral RNA of step a) with a type VI Cas nuclease, a crRNA, and a reporter RNA; and d) detecting cleavage of said reporter RNA, thereby detecting said RNA virus, and to methods and uses related thereto.
  • the present invention also relates to a method for detecting a target RNA and/or a target DNA in a sample of a subject, the method comprising the steps of a) contacting said sample with a Type V Cas nuclease, a Type V crRNA targeting said target DNA, a type VI Cas nuclease, a Type VI crRNA targeting said target RNA, a reporter RNA and a reporter DNA; and b) detecting cleavage of said reporter RNA, thereby detecting said target RNA; and/or detecting cleavage of said reporter DNA, thereby detecting said target DNA, and to methods uses and means related thereto.
  • SARS-like coronavirus SARS-CoV-2 also known as 2019-nCoV
  • 2019-nCoV the virus causing coronavirus disease 2019
  • RT-PCR tests can identify subjects who are currently infected with SARS-CoV-2; however, such tests require specific equipment, which may not be available in less developed countries.
  • CRISPR Clustered, Regularly Interspaced Short Palindromic Repeats
  • Cas CRISPR-associated nuclease which can be programmed by short guideRNAs (gRNAs) to induce double-strand breaks at specific, sequence-complementary DNA loci.
  • gRNAs short guideRNAs
  • CRISPR system have also been used in molecular detection of specific sequences, single-nucleotide variants, and pathogens (cf. e.g. Zhou et al. (2018), J Cell Mol Med 22:5807).
  • CRISPR-Cas9 system from Streptococcus pyogenes
  • CRISPR Cas type VI systems are unusual in that the nuclease is an RNase.
  • type VI Cas nucleases once activated by a ssRNA sequence complementary to their crRNA spacer, type VI Cas nucleases have unspecific RNase activity. This property was used by Kellner et al. (2019), Nature Protocols 14:2986 to establish an assay system testing for the presence of specific polynucleotide with fluorescence and lateral flow readouts.
  • saliva was proposed as a suitable sample material for SARS-CoV-2 detection (Wyllie et al. (2020), medRxiv 2020.04.16.20067835; doi.org/10.1101/2020.04.16.20067835).
  • the present invention relates to a method for detecting an RNA virus in a sample, comprising the steps of a) releasing viral RNA from said sample; b) amplifying at least parts of the viral RNA comprised in said sample; c) contacting the amplified viral RNA of step b) with a Type VI Cas nuclease, a crRNA, and a reporter RNA; and d) detecting cleavage of said reporter RNA, thereby detecting said RNA virus.
  • the method of the present invention is an in vitro method. Moreover, it may comprise steps in addition to those explicitly mentioned above. For example, further steps may relate, e.g., to providing a sample for step a), or contacting the viral RNA with further reagents in steps b), c) and/or d). Moreover, one or more of said steps may be aided or performed by automated equipment, however, preferably specialized equipment is not necessary to perform the method in its entirety.
  • standard conditions if not otherwise noted, relates to IUPAC standard ambient temperature and pressure (SATP) conditions, i.e. preferably, a temperature of 25°C and an absolute pressure of 100 kPa; also, preferably, standard conditions include a pH of 7.
  • SATP standard ambient temperature and pressure
  • standard conditions include a pH of 7.
  • the term “about” relates to the indicated value with the commonly accepted technical precision in the relevant field, preferably relates to the indicated value ⁇ 20%, more preferably ⁇ 10%, most preferably ⁇ 5%.
  • the term “essentially” indicates that deviations having influence on the indicated result or use are absent, i.e.
  • composition defined using the phrase “consisting essentially of’ encompasses any known acceptable additive, excipient, diluent, carrier, and the like.
  • a composition consisting essentially of a set of components will comprise less than 5% by weight, more preferably less than 3% by weight, even more preferably less than 1% by weight, most preferably less than 0.1% by weight of non-specified component(s).
  • fragment of a biological macromolecule, preferably of a polynucleotide or polypeptide, is used herein in a wide sense relating to any sub-part, preferably subdomain, of the respective biological macromolecule comprising the indicated sequence, structure and/or function.
  • the term includes sub-parts generated by actual fragmentation of a biological macromolecule, but also sub-parts derived from the respective biological macromolecule in an abstract manner, e.g. in silico.
  • RNA virus is known to the skilled person to relate to any virus having RNA as a genome.
  • the virus is a human and/or animal pathogenic virus, more preferably a human pathogenic virus.
  • the RNA virus is a virus having single-stranded RNA as a genome, preferably is a coronavirus or an influenza virus. More preferably, the RNA virus is a coronavirus as specified herein below.
  • viral RNA preferably is the RNA a viral particle carries as a genome, or a fragment thereof.
  • viral RNA preferably may also comprise free, i.e. non-capsid bound, viral RNA produced by an infected cell.
  • coronavirus is understood by the skilled person to relate to a group of viruses from the order Nidovirales, having a positive-sense single-stranded RNA genome with a size of approx. 25 to 35 kilobases.
  • the coronavirus is a beta-coronavirus, more preferably a severe acute respiratory syndrome coronavirus (SARS-CoV)-2, SARS-CoV-1, or Middle East respiratory syndrome coronavirus (MERS-CoV).
  • SARS-CoV severe acute respiratory syndrome coronavirus
  • SARS-CoV-1 SARS-CoV-1
  • MERS-CoV Middle East respiratory syndrome coronavirus
  • the coronavirus is SARS-CoV-2.
  • the terms "SARS-CoV-2" and "severe acute respiratory syndrome coronavirus 2" relate to the virus identified in Genbank entry NCBI:txid2697049.
  • coronavirus infection Symptoms and diseases caused by coronavirus infection and in particular SARS-CoV-2 infection are known to the skilled person.
  • the coronavirus is HCoV-NL63, HCoV-229E, HCoV-OC43, and HCoV-HKUl, all of which are known to the skilled person.
  • the RNA virus is selected from the list consisting of SARS- CoV-2, an influenza virus, HCoV-NL63, HCoV-229E, HCoV-OC43, and HCoV-HKUl.
  • SARS-CoV-2 an influenza virus
  • HCoV-NL63 a virus that virus
  • HCoV-229E a virus that virus
  • HCoV-OC43 a virus that virus
  • HCoV-HKUl HCoV-HKUl.
  • two RNA viruses are, in a preferred embodiment, SARS-CoV-2 and an influenza virus.
  • sample refers to a sample of biological origin, preferably a sample from a subject.
  • the sample is a sample of separated cells or a sample from a tissue or an organ.
  • Tissue or organ samples may be obtained from any tissue or organ by, e.g., biopsy.
  • Separated cells may be obtained from the body fluids, such as lymph, blood, plasma, serum, liquor and other, or from the tissues or organs by separating techniques such as centrifugation or cell sorting.
  • the sample is a tissue or body fluid sample which is known or suspected to comprise an RNA virus.
  • the sample is a sample of a body fluid, preferably saliva, sputum, blood, plasma, serum, lacrimal fluid, nasal discharge, urine, or stool sample.
  • Preferred samples are from saliva, sputum, nasal discharge, and nasal swabs; most preferably, the sample is a saliva or sputum sample.
  • the sample can be obtained from the subject by routine techniques which are well known to the person skilled in the art, e.g., venous or arterial puncture, nasal swabs, or open biopsy including aspiration of tissue or cellular material from a subject.
  • the sample is a sample of gurgle liquid.
  • the sample is a liquid sample obtained by providing to the subject a gurgling medium and the subject gurgling with the gurgling medium, which after gurgling is referred to as "gurgling sample”.
  • the gurgling medium is an aqueous liquid, more preferably a sterile aqueous liquid.
  • the gurgling liquid is saline (NaCl 0.9% (w/v)) or PBS.
  • the volume of gurgling medium is of from 1 ml to 20 ml, more preferably of from 2 ml to 8 ml.
  • said gurgling is performed for at least 10 s, more preferably at least 30 s, most preferably at least 60 s.
  • said gargling is performed for of from 10 s to 5 min, more preferably of from 30 s to 2 min, most preferably of from 45 s to 2 min.
  • the gurgling is performed for of from 2 s to 120 s, more preferably of from 5 s to 60 s.
  • the subject from which the gurgling sample is derived from is instructed to collect all liquid remaining in mouth and/or throat after gurgling 2-3 times and to add it to the gurgling sample
  • Preferably, of from 1 m ⁇ to 100 m ⁇ of the gurgling sample is used in the subsequent analysis, more preferably of from 2 m ⁇ to 50 m ⁇ .
  • releasing is, in principle, understood by the skilled person.
  • the term preferably relates to making viral RNA accessible at least partially to the reagents used in step b), preferably to the enzyme or enzymes contacted with the viral RNA in step b).
  • releasing comprises disassembling and/or denaturing viral capsid polypeptides and, if present, a viral membrane.
  • a surfactant such as Triton X, or a non-ionic surfactant such as Oleth-8.
  • releasing comprises contacting sample with the aforesaid surfactant Triton X-100 at a concentration of from 0.05% (w/v) to 5% (w/v), preferably of from 0.1% (w/v) to 1% (w/v), more preferably of from 0.15% (w/v) to 0.5% (w/v), most preferably of about 0.2% (w/v).
  • releasing comprises contacting sample with Oleth-8 at a concentration of from 0.10% (w/v) to about 0.40% (w/v), preferably of from about 0.15% (w/v) to about 0.35% (w/v), more preferably of from about 0.20% (w/v) to about 0.30% (w/v), still more preferably about 0.25% (w/v), most preferably 0.25% (w/v).
  • the sample may be heated during the release step, e.g. to at least 90°C for about 5 min.
  • the sample is maintained at the same temperature as in the other steps during release, i.e.
  • the release step may be comprised in amplification step b).
  • the viral RNA released is used for the following steps as it is obtained by the aforesaid steps or a combination thereof.
  • releasing does not comprise a nucleic acid extraction step.
  • steps a) and b) are performed in the same reaction tube.
  • At least the reaction mixture of step c), preferably the reaction mixtures of steps b) and c), more preferably the reaction mixtures of steps a) to c), comprise at least one RNase inhibitor, preferably an Inhibitor of RNAses A, B, and C, particularly a murine RNase inhibitor, more preferably an inhibitor of RNases A, B, C, 1, and Tl, such as the commercially available SUPERaseTM RNase inhibitor.
  • extraction comprises contacting the sample with a DNA extraction buffer comprising at least one detergent, preferably as specified elsewhere herein.
  • extraction comprises contacting the sample with a commercially available DNA extraction buffer, preferably as described herein in the Examples.
  • extraction comprises, preferably consists of, heating the sample to a temperature of from 65°C to 100°C, preferably of from 80°C to 100°, more preferably of from 90°C to 100°C, most preferably about 95°C, for a time of from 1 min to 30 min, preferably of from 2 min to 15 min, more preferably of from 3 min to 10 min, even more preferably for about 5 min, most preferably for 5 min.
  • extraction comprises, preferably consists of, heating the sample to a temperature of about 95°C for about 5 min, preferably a temperature of 95°C for 5 min.
  • an RNase inhibitor preferably as specified herein above, is added prior to the heating step, preferably at a concentration of from 1 U/mI to 20 U/mI, more preferably of from 2 U/mI to 10 U/mI, still more preferably of from 3 U/mI to 5 U/mI, most preferably about 4 U/mI.
  • amplifying is used herein in its commonly accepted meaning, i.e. relating to a procedure causing the amount of at least a part of the viral RNA to increase compared to the amount after release of viral RNA from the sample.
  • Methods for amplifying RNA are, in principle, known in the art. Preferred are isothermal methods; thus, preferably, amplifying viral RNA is accomplished via an RNA-dependent RNA polymerase (EC 2.7.7.48), preferably using appropriate primers. More preferably, the viral RNA is amplified by a reverse-transcriptase recombinase polymerase amplification (RT-RPA) reaction.
  • RT-RPA reverse-transcriptase recombinase polymerase amplification
  • amplifying further comprises a second amplification step by a T7 RNA polymerase transcription reaction producing amplified viral RNA.
  • RT-RPA and T7 RNA polymerase protocols are known in the art.
  • Appropriate primers are known e.g. from Zhang et al. (2020), cited herein above.
  • Orfla-RPA-Forward 5’- GAAATTAATACGACTCACTATAGGGCGAAGTTGTAGGAGACATTATACTTAAACC -3’; SEQ ID NO:3) and Orfla-RPA-Reverse (5’-
  • N-RPA- Forward_vl 5’- gaaattaatacgactcactatagggT AATC AGAC AAGGAACTGATT AC AAAC ATTG-3 ’ ; SEQ ID NO:8) and N-RPA-Reverse_vl (5’- GACTTCCATGCCAATGCGCGACATTCCGAAGA-3', SEQ ID NO: 9) or primers N-RPA-Forward_v2 (5’- gaaattaatacgactcactataggg ACT AATC AGAC AAGGAACTGATT AC AAAC AT -3 ’ ; SEQ ID NO: 10) and N-RPA-Reverse_v2 (5’- CACGTTCCCGAAGGTGTGACTTCCATGCCAAT -3', SEQ ID NO: 11) are used; and in case E shall be targeted
  • the amplifying comprises contacting the sample with an RPA reaction mixture, more preferably an RT-RPA reaction mixture.
  • RPA reaction mixtures have been described (cf. e.g. US 2008/0076160, US 2011/0065106) and are commercially available, e.g. as TABAS03KIT from TwistDx Ltd, UK (Liu et al. (2021), Food Chemistry: 127608, (doi.org/10.1016/j.foodchem.2020.127608).
  • the RPA reaction mixture is used at from 1.5 fold to 5fold, more preferably at twofold, the concentration described by Kellner et al.
  • the concentration of components in the RPA mixture i.e.
  • 2xRPA preferably are at least 40 mM for RecA, 0.2 pM for RecF, 0.25 pM for RecO, 1 pM for RecR, 2 to 20 pM for SSB, 10 units for DNA polymerase V, 10 units for DNA polymerase, 1 pM for RuvA, lpM for RuvB, 1 pM for RuvC, and/or 20 nM for RecG; and are at least 40 nM for PriA, 40 nM for PriB, 0.2 pM for DnaT, 0.2 pM for DnaB, 0.4 pM for DnaC, 0.4 pM for DnaG, 4 pM for beta-Clamp, 1 pM for DNAX Clam loader, 1 pM for Polymerase core complex, 10 units for DNA polymerase I, and/or 4 units for DNA ligase, if present.
  • the amplifying comprises contacting said sample and/or said viral RNA with a reverse transcriptase, i.e. preferably comprises a step of reverse transcription.
  • the reverse transcriptase is preferably selected from M-MuLV reverse transcriptase, ProtoScript IITM reverse transcriptase, and Superscript IIITM reverse transcriptase, more preferably is M- MuLV reverse transcriptase.
  • the reverse transcription step is performed in the absence of added RNase H.
  • the incubation time for the amplifying step is of from 15 min to 60 min, preferably of from 30 min to 50 min, more preferably about 45 min, most preferably is 45 min, preferably under the conditions described herein above and/or in the Examples.
  • Type VI Cas nuclease also known as C2c2 Type or CasRx Cas nuclease, relates to a Cas nuclease targeting RNA, which, once being activated by a ssRNA sequence being complementary to its crRNA spacer, has unspecific RNase activity and cleaves any RNA in its vicinity.
  • the type VI Cas nuclease is a Casl3a nuclease, a Casl3b nuclease, a Casl3c nuclease, or a Casl3d nuclease, more preferably is a Casl3a nuclease.
  • a type VI Cas nuclease can be isolated e.g. from Leptotrichia wadeii, Leptotrichia buccalis, Leptotrichia shahii, Ruminococcus flavefaciens, Bergeyella zoohelcum, Prevotella buccae, or Listeria seeligeri.
  • step c) is performed at a temperature of 20°C to 37°C, more preferably at a temperature of about 25°C
  • the type VI Cas nuclease is Casl3a from Leptotrichia buccalis.
  • the type VI Cas nuclease is Casl3b from Capnocytophaga canimorsus Cc5 (CcaCasl3b).
  • type VI Cas nucleases and expression plasmids for their production are publicly available.
  • the type VI Cas nuclease is produced as a His 6 -Sumo-Cas nuclease fusion polypeptide and, more preferably, is purified by at least one of His 6 -Affmity purification, Sumo affinity purification, and size exclusion chromatography purification.
  • the type VI Cas nuclease is produced as a His 6 -Sumo-Cas nuclease fusion polypeptide and its purification comprises His 6 -Affmity chromatography, Sumo affinity chromatography, and size exclusion chromatography, preferably in the given order.
  • the concentration of the Type VI Cas nuclease in the reaction mixture in step c) is of from 20 to 150 nM, preferably of from 50 nM to 100 nM, more preferably is about 90 nM.
  • crRNA is used herein in relation to a combined crispr RNA (crRNA) of a type VI CRISPR/Cas system.
  • the crRNA comprises at least 20, preferably at least 25, more preferably comprises 28 nucleotides complementary to the target sequence.
  • the term "complementary”, if not otherwise noted, relates to at least 90%, more preferably at least 95%, still more preferably 99% complementarity. Most preferably complementarity relates to 100% complementarity over the aforementioned number of nucleotides.
  • Means and methods for designing crRNAs are known in the art.
  • Preferred crRNase are those disclosed in Zhang et al. (2020), ibd.
  • the crRNA comprises the sequence of S-crRNA (5’- GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGCAGCACCAGCUGUCCA ACCUGAAGAAG-3’, SEQ ID NO: 5), and in case the Orfla shall be targeted, the crRNA comprises the sequence of Orfla-crRNA (5’-
  • the crRNA comprises the sequence of N-crRNA (5’-
  • the crRNA comprises the sequence of E-crRNA (5’-
  • the crRNA comprises the sequence of crRNA HV69-70 (5 - GAUUUAGACUACCCCAAAAACGAAGGGGACUAAACUUGGUCCCAGAGACAUGU AUAGC AUGGA-3 ' (SEQ ID NO: 30), and/or the sequence of crRNA delHV69-70 (5’- GAUUUAGACUACCCCAAAAACGAAGGGGACUAAACCCAUUGGUCCCAGAGAUA GCAUGGAACC-3', SEQ ID NO:31).
  • the concentration of the crRNA in the reaction mixture is of from 20 to 150 nM, preferably of from 50 nM to 100 nM, more preferably is about
  • reporter RNA in principle, relates to any polynucleotide comprising at least one pair of ribonucleotides connected via a covalent bond cleavable by a Cas RNase activity, the cleavage of which can be determined.
  • the reporter RNA comprises at least a first label, preferably attached towards one of the ends of said reporter RNA, the term “towards the end” relating to an attachment within 10 nucleotides from an end, preferably within 5 nucleotides from an end, more preferably at the terminal nucleotide.
  • the term "attached”, as used herein, includes any type of attachment, covalent or non-covalent, which is sufficiently stable to allow detection of the association of the label and the reporter RNA or fragment thereof.
  • the label or labels preferably is/are linked to the reporter RNA by non-covalent bonds and the two molecules have a dissociation constant of at most 10 6 mo 1/1, more preferably of at most 10 7 mol/1, most preferably at most 10 8 mol/1.
  • the reporter RNA and the label or labels are covalently connected. More preferably, the reporter RNA comprises a first and a second label, wherein the first label is attached towards the 5' end of the reporter RNA and the second label is attached towards the 3' end of the reporter RNA.
  • a dye is the first label and a quencher is the second label; appropriate dye/quencher pairs are known in the art. More preferably, at least one of said first and second labels is an affinity label, i.e. a label with affinity for a binding partner; in such case, detecting cleavage of said reporter RNA preferably comprises binding of said affinity label to a solid surface. Suitable affinity pairs are known in the art, e.g. the streptavidin/biotin affinity pair. Thus, one of the first and second labels may e.g. be biotin. Also, preferably, the second label is a second affinity label non-identical to the first affinity label and/or is a detectable label, in particular a dye.
  • the second label is a fluorescein, preferably 6- carboxyfluorescein or fluorescein; antibodies specifically recognizing fluoresceins are available, thus said label may be detected optically or via an immunological detection method.
  • the second label is a chemical group specifically detected by antibodies conjugated to gold particles, as Exemplified in the lateral flow assay described herein in the Examples.
  • the reporter RNA has the sequence of the lateral-flow-reporter described by Zhang et al.
  • the reporter RNA has the sequence of the lateral-flow-reporter described by Kellner et al.
  • the reporter RNA in particular the reporter RNA having SEQ ID NO: 7, is present in the assay at an amount of up to 100 pmol, more preferably up to 50 pmol, still more preferably up to 20 pmol, most preferably up to 10 pmol, per assay mixture.
  • the reporter RNA in particular the reporter RNA having SEQ ID NO:7, is present in the assay at an amount of from about 10 pmol to 100 pmol, more preferably of from about 10 pmol to 50 pmol, still more preferably of from about 10 pmol to 20 pmol, most preferably of about 10 pmol, per assay mixture.
  • the nucleotide sequence of the reporter RNA is of minor importance, since the activity to be detected is non specific RNase activity caused by the presence of an RNA hybridizing to the crRNA.
  • the term "detecting cleavage of a reporter RNA” relates to assessing to which extent the reporter RNA was cleaved, wherein said extent may be any fraction of from 0% to 100% of the reporter RNA present in the assay mixture. Suitable methods include all methods enabling establishing whether at least one covalent backbone bond was cleaved by an RNase activity in reporter molecules.
  • the reporter RNA may e.g. be a mixed DNA/RNA oligonucleotide comprising ribonucleotides near the center of the molecule, such that cleavage by an RNase produces smaller fragments, which can be detected.
  • the reporter RNA comprises two labels
  • RNase activity on such a reporter RNA causes the first label to become separated from the second label, which separation can be detected.
  • said detection comprises separation of the first from the second label, e.g. by diffusion.
  • the reporter RNA comprises a dye and a quencher
  • increased radiation emission by the dye may be detected.
  • detection of cleavage may be performed by lateral flow diffusion, in particular as described by Zhang et al (2020), ibd., and herein in the Examples.
  • the ratio of signal band intensity to control band intensity is determined in such case.
  • detecting cleavage of reporter RNA is detecting presence of an RNA hybridizing to the crRNA, i.e. viral RNA and/or amplified viral RNA. More preferably, detecting increased cleavage of reporter RNA compared to a negative control is detecting presence of an RNA hybridizing to the crRNA, i.e. viral RNA and/or amplified viral RNA, and therefore is detecting an RNA virus. Detection of cleavage of reporter RNA may be qualitative, semiquantitative, or quantitative; preferably, detection of cleavage of reporter RNA is qualitative or semiquantitative.
  • the incubation time in the detecting cleavage of a reporter RNA i.e. preferably incubation time in which cleavage of the reporter time occurs, is of from 5 min to 30 min, preferably of from 7 min to 15 min, more preferably about 10 min, most preferably is 10 min, preferably under the conditions as described herein above and/or in the Examples.
  • RNA viruses in particular coronaviruses
  • the method can be performed using only two temperatures, namely the temperature of boiling water, and ambient temperature, e.g. standard temperature, or the body temperature of a mammal. This is particularly advantageous for applications in less developed countries, in which technical instrumentation may be scarce.
  • the complete method can be performed at the latter temperature.
  • release of the viral RNA and its amplification can be performed in the same test tube, further simplifying the method.
  • the present invention also relates to a method for detecting a target RNA and/or a target DNA in a sample of a subject, the method comprising the steps of a) contacting said sample with a Type V Cas nuclease, a Type V crRNA targeting said target DNA, a type VI Cas nuclease, a Type VI crRNA targeting said target RNA, a reporter RNA and a reporter DNA; and b) detecting cleavage of said reporter RNA, thereby detecting said target RNA; and/or detecting cleavage of said reporter DNA, thereby detecting said target DNA.
  • target RNA preferably relates to a polyribonucleotide of interest, suspected or known to be present in a sample.
  • the target RNA comprises at least 20, more preferably at least 25, even more preferably at least 28 nucleotides.
  • the target RNA may be said RNA as such, or may be a fragment thereof having the aforesaid length.
  • the term "at least a fragment” may relate to a subportion of an polynucleotide, but also to the full-length polynucleotide; preferably, said fragment comprises at least one nucleic acid sequence allowing specific detection of said target RNA, more preferably a specific nucleic acid sequence, even more preferably a nucleic acid sequence of at least 20 nucleotide, more preferably at least 25 nucleotides, even more preferably at least 28 nucleotides which is known or expected to be unique in said sample.
  • the target RNA does not consist of low-complexity sequences, such as short repeat sequences.
  • the target RNA may, in principle, be any type of RNA, such as double-stranded or single-stranded RNA, or linear or circular RNA.
  • the target RNA is an RNA being of diagnostic or therapeutic interest.
  • the target RNA is at least a fragment of a genome of an RNA virus or viroid, preferably of an RNA virus.
  • the target RNA is at least a fragment of an RNA of a pathogen, e.g. an RNA encoded by a pathogen as specified herein below, such as an RNA expressed from a promoter and/or one or more gene(s) of a virus, a bacterium, or a eukaryotic pathogen.
  • the target RNA is at least a fragment of an endogenous RNA, i.e. an RNA expressed by cells of the subject, preferably cells known or suspected to be comprised in the sample.
  • Endogenous RNAs are known to the skilled person and include in particular mRNAs, miRNAs, tRNAs, ribosomal RNAs (rRNAs), snRNAs, snoRNAs, and siRNAs; preferably, the endogenous RNA is an mRNA.
  • the target RNA may also be allele-specific, i.e. indicative of a specific allele of a gene.
  • the target RNA may be cell-type-specific, e.g.
  • target RNA in case at least a fragment of an RNA, e.g. mRNA, expressed only by (a) certain type(s) of cell(s) is used as target RNA.
  • the target RNA may be at least a fragment of a cell-type specific RNA, e.g. a cancer- specific RNA, such as an mRNA of a cancer-specific marker.
  • specificity may also be achieved by a specific combination of sample and target RNA, such as testing for melanocyte markers in a blood sample, e.g. in screening for circulating melanoma cells.
  • target DNA preferably relates to a polydeoxyribonucleotide of interest, suspected or known to be present in a sample or producible therefrom.
  • the target DNA may, preferably, be any type of DNA, such as double-stranded or single-stranded DNA, or linear or circular DNA; preferably, the target DNA comprises at least 20, more preferably at least 21, even more preferably at least 24 nucleotides.
  • the target DNA is at least a fragment of a DNA of a cell or virus, e.g. of a genomic DNA, an organellar DNA, a plasmid, and the like. More preferably, the target DNA is a reverse transcript of an RNA, preferably an RNA as specified herein above.
  • the target DNA is at least a fragment of a a reverse transcript of an RNA comprised in said sample, the term "RNA comprised in said sample” including any and all RNA molecules comprised in the sample, including an RNA optionally added to the sample before, during, or after extraction (spiking).
  • the RNA comprised in the sample is an RNA according to the specification of the target RNA herein above.
  • the target DNA is a reverse transcript of an endogenous RNA as specified herein above, more preferably of an mRNA, preferably of a housekeeping gene of the subject.
  • the target DNA is a control DNA, in particular a control for sample extraction, sample reverse transcription, and/or absence of RNases.
  • pathogen is understood by the skilled person and includes, preferably, any and all organisms, viruses, and viroids causing disease in a non-identical organism.
  • the pathogen preferably is a bacteriophage, a plant pathogen, a pathogen of livestock, laboratory, or companion animal, more preferably of a mammal, most preferably of a human.
  • Type V Cas nuclease also known as C2cl Type or Cpfl Cas nuclease, relates to a Cas nuclease targeting DNA, preferably ssDNA, which, once being activated by a DNA sequence being complementary to its Type V crRNA spacer, has unspecific DNase activity and cleaves any DNA, preferably ssDNA, in its vicinity.
  • the type V Cas nuclease is a Cas 12a nuclease, more preferably is Cas 12a from Lachnospiraceae bacterium ND2006 (LbCasl2a)(Chen et al. (2016), Science 360(6387):436).
  • a type V Cas nuclease can also be isolated e.g. from Francisella novicida, Acidaminococcus sp., other Lachnospiraceae sp., Alicyclobacillus acidoterrestris, Acidaminococcus sp. BV3L6, or Prevotella sp.
  • step a) is performed at a temperature of 20°C to 42°C, more preferably at a temperature of about 25°C
  • the type V Cas nuclease is LbCasl2a.
  • type V Cas nucleases and expression plasmids for their production are publicly available.
  • the type V Cas nuclease is produced as a His 6 -Sumo-Cas nuclease fusion polypeptide and, more preferably, is purified by at least one of His 6 - Affinity purification, Sumo affinity purification, and size exclusion chromatography purification. More preferably, the type V Cas nuclease is produced as a His 6 -Sumo-Cas nuclease fusion polypeptide and its purification comprises His 6 - Affmity chromatography, Sumo affinity chromatography, and size exclusion chromatography, preferably in the given order.
  • crRNA relates to a combined crispr RNA (crRNA) of a type VI CRISPR/Cas system, i.e. a Type VI crRNA.
  • Type V crRNA is used herein in relation to a combined crispr RNA (crRNA) of a type V CRISPR/Cas system.
  • a Type V crRNA preferably comprises a protospacer adjacent motif (PAM) sequence.
  • PAM protospacer adjacent motif
  • the Type V crRNA comprises at least 20, preferably at least 21, more preferably comprises 24 nucleotides complementary to the target sequence. Means and methods for designing Type V crRNAs are known in the art.
  • the Type V crRNA comprises the sequence of SEQ ID NO:23.
  • reporter DNA preferably, relates to any DNA polynucleotide comprising at least one pair of deoxyribonucleotides connected via a covalent bond cleavable by a Casl2 DNase activity, the cleavage of which can be determined.
  • the reporter DNA comprises at least one label, preferably attached towards one of the ends of said reporter DNA, the terms “towards the end” and “attached” having, mutatis mutandis, the meaning as specified herein above in the context of the reporter RNA.
  • the label or labels preferably is/are linked to the reporter DNA by non-covalent bonds and the two molecules have a dissociation constant of at most 10 6 mol/1, more preferably of at most 10 7 mol/1, most preferably at most 10 8 mol/1.
  • the reporter DNA and the label or labels are covalently connected.
  • the terms first and second label are preferably used in connection with the reporter RNA as specified herein above; thus, in the context of the target DNA, the terms third and second label are preferably used.
  • the reporter DNA comprises a third and a fourth label, wherein the third label is attached towards the 5' end of the reporter DNA and the fourth label is attached towards the 3' end of the reporter DNA.
  • a dye is the third label and a quencher is the fourth label; appropriate dye/quencher pairs are known in the art. More preferably, at least one of said third and fourth labels is an affinity label, i.e. a label with affinity for a binding partner; in such case, detecting cleavage of said reporter DNA preferably comprises binding of said affinity label to a solid surface. Suitable affinity pairs are known in the art, e.g. the streptavidin/biotin affinity pair. Thus, one of the third and fourth labels may e.g. be biotin. Also, preferably, the fourth label is a fourth affinity label non-identical to the third affinity label and/or is a detectable label, in particular a dye.
  • the fourth label is a digoxigenin; antibodies specifically recognizing digoxigenin are available, thus said label may be detected optically or via an immunological detection method.
  • the fourth label is a chemical group specifically detected by antibodies conjugated to gold particles, as Exemplified in the lateral flow assay described herein in the Examples.
  • the reporter DNA has the sequence of SEQ ID NO: 18, which may be provided e.g. as reporter DNA according to any one of SEQ ID NOS: 19-22.
  • the first to fourth labels, as referred to herein are mutually non-identical. It may, however, also be envisaged that the reporter RNA and the reporter DNA have the same affinity label, e.g. fluorescein, e.g. in applications such as lateral flow detection.
  • the reporter RNA and/or reporter DNA may in principle be used for detection of any target RNA and/or target DNA.
  • the subject preferably is a plant, more preferably a crop plant. More preferably, the subject is a vertebrate, still more preferably a mammal, even more preferably a livestock, laboratory, or companion animal, most preferably is a human.
  • the method for detecting a target RNA and/or a target DNA preferably is an in vitro method. Moreover, it may comprise steps in addition to those specifically mentioned; e.g. a further step preferably preceding step a) may relate to extracting and/or purifying RNA and/or DNA from said sample; also, the method may be comprised in a method for detecting an RNA virus in a sample as specified elsewhere herein, in particular by using an RNA from the RNA virus as target RNA, and using e.g. a reverse transcript of a housekeeping mRNA of the subject as the target DNA.
  • the present invention preferably relates to a method for detecting an RNA virus in a sample, comprising the steps of i) releasing RNA from said sample; ii) amplifying at least parts of the RNA comprised in said sample via a DNA intermediate; iii) detecting a target RNA and a target DNA in the reaction mixture of step ii) according to the method for detecting a target RNA and/or a target DNA according to the present invention; and iv) thereby detecting said RNA virus.
  • the method for detecting a target RNA and/or a target DNA may comprise detecting a target RNA, detecting a target DNA, or detecting a target RNA and a target DNA, preferably comprises detecting a target RNA and a target DNA.
  • said method preferably is a method for detecting (i) two non-identical RNAs of interest or (ii) an RNA and a DNA of interest.
  • the method for detecting a target RNA and/or a target DNA is applicable in each case where detection of two non-identical RNAs or of an RNA and a DNA is desirable.
  • the target RNA and target DNA is a control polynucleotide, in particular a control for sample extraction, sample reverse transcription, and/or absence of RNases.
  • the target RNA or the target DNA is or is derived from a polynucleotide known to be present in the sample, more preferably is an RNA present in abundance in at least one cell type known to be present in the sample.
  • the target RNA or the target DNA is or is derived from an mRNA of a housekeeping gene of at least one cell type known to be present in the sample, more preferably of essentially all cell types suspected to be present in said sample.
  • the target RNA or the target DNA is or is derived from an mRNA of a general housekeeping gene of essentially all nucleated cells of said subject, such as RNaseP mRNA in a mammal, in particular a human.
  • the method for detecting a target RNA and/or a target DNA may comprise additional steps of extracting and/or purifying polynucleotides from the sample, preferably as specified herein above; the method may also comprise one or more steps of concentrating or diluting polynucleotides comprised in the sample.
  • the method for detecting a target RNA and/or a target DNA may be applied in the absence of an amplification step.
  • polynucleotides comprised in the sample are amplified.
  • Said amplification may be non-sequence specific, e.g. by using non-sequence specific primers such as oligo(dT) primers, preferably is sequence specific for at least one polynucleotide of interest.
  • amplification is effected as specified herein above.
  • amplification comprises at least one step of creating a DNA intermediate of at least one RNA of interest or fragment thereof, e.g. by reverse transcription.
  • this step is used for at least one RNA in case two non-identical RNAs shall be detected.
  • RNA may be produced from said DNA, e.g. by T7-transcription, preferably as specified herein above and/or in the Examples.
  • T7-transcription preferably as specified herein above and/or in the Examples.
  • it may be sufficient to amplify a fragment of a polynucleotide of interest such as to produce or amplify a target DNA and/or a target RNA.
  • the method for detecting a target RNA and/or a target DNA is a multiplex method in that it allows detection of a target RNA and a target DNA, i.e. of two polynucleotides of interest.
  • the method may, however, be further multiplexed:
  • the Type V crRNA and/or Type VI crRNA may be selected as to be specific for a generic group of target RNAs or target DNAs; as a non-limiting example, a crRNA may be selected to bind to a conserved nucleic acid sequence comprised in all SARS viruses; as will be understood, in such case, detecting cleavage of the reporter DNA or reporter RNA is indicative of at least one member of the generic group being present.
  • the reporter DNA and/or reporter RNA may be selected such as to be indicative of a generic group of polynucleotides.
  • step a) may comprise contacting said sample with a multitude of Type V crRNAs and/or Type VI crRNAs; in such case, detecting cleavage of said reporter RNA and/or of said reporter DNA would be indicative that a target of at least one of said Type V crRNAs and/or Type VI crRNAs was present in the sample.
  • the method may be used to test a sample for the presence of at least one member of a predefined set of viruses and for the presence of at least one member of a predefined set of bacteria, or to test a sample for the presence of at least one member of two predefined sets of viruses, e.g. SARS viruses and influenza viruses.
  • viruses e.g. SARS viruses and influenza viruses.
  • detecting cleavage has been specified herein above in the context of a reporter RNA; the same applies mutatis mutandis to reporter DNAs.
  • the present invention also relates to a type V Cas nuclease and/or a type VI Cas nuclease for use in diagnosing an infection with an RNA virus in a subject, preferably according to the method for detecting a target RNA and/or a target DNA or a method for detecting an RNA virus in a sample according to the present invention.
  • the present invention also relates to a method for diagnosing an infection with an RNA virus in a subject, comprising a) detecting an RNA virus in a sample of said subject by a method of the present invention; and b) in case an RNA virus is detected in step a), diagnosing an infection with an RNA virus in said subject.
  • the present invention further relates to a use of a type VI Cas nuclease, preferably a Cas 13a nuclease, a Casl3b nuclease, a Casl3c nuclease, or a Casl3d nuclease, for detecting an RNA virus, preferably according to the method for detecting an RNA virus described herein above.
  • a type VI Cas nuclease preferably a Cas 13a nuclease, a Casl3b nuclease, a Casl3c nuclease, or a Casl3d nuclease
  • the present invention also relates to a use of a type VI Cas nuclease, preferably a Casl3a nuclease, a Cas 13b nuclease, a Cas 13c nuclease, or a Cas 13d nuclease, for the manufacture of a diagnostic composition or device for the detection of an RNA Virus, preferably according to the method for detecting an RNA virus described herein above.
  • a type VI Cas nuclease preferably a Casl3a nuclease, a Cas 13b nuclease, a Cas 13c nuclease, or a Cas 13d nuclease
  • the present invention relates to a method for diagnosing an infection with an RNA virus in a subject, comprising a) detecting an RNA virus in a sample of said subject by the method for detecting an RNA virus described herein above; and b) in case an RNA virus is detected in step a), diagnosing an infection with an RNA virus in said subject.
  • RNA virus infection means assessing whether a subject suffers from an RNA virus infection, or not. As will be understood by those skilled in the art, such an assessment is usually not intended to be correct for all (i.e. 100%) of the subjects to be identified. The term, however, requires that preferably a statistically significant portion of subjects can be identified (e.g. a cohort in a cohort study). Whether a portion is statistically significant can be determined without further ado by the person skilled in the art using various well known statistic evaluation tools, e.g., determination of confidence intervals, p-value determination, Student's t-test, Mann- Whitney test etc.
  • Preferred confidence intervals are at least 90%, at least 95%, at least 97%, at least 98% or at least 99 %.
  • the p-values are, preferably, 0.1, 0.05, 0.01, 0.005, or 0.0001. More preferably, at least 60%, at least 70%, at least 80% or at least 90% of the subjects of a population can be properly identified by the method of the present invention. Diagnosing according to the present invention may include applications of the method in monitoring, confirmation, and sub-classification of the RNA virus infection.
  • the present invention also relates to a type VI Cas nuclease for use in diagnosing an infection with an RNA virus in a subject, preferably according to the method for detecting an RNA virus described herein above.
  • the present invention also relates to a method for detecting a variant of a SARS-CoV virus in a sample, said method comprising the steps of a) releasing SARS-CoV RNA from said sample; b) amplifying at least parts of the SARS-CoV RNA comprised in said sample; c) contacting the amplified SARS-CoV RNA of step a) with a Type VI Cas nuclease, a reporter RNA, and (i) with a crRNA comprising the sequence of SEQ ID NO:30, and, spatially separated from (i), (ii) with a crRNA comprising the sequence of SEQ ID NO:31; and d) detecting cleavage of said reporter RNA in (i) and (ii), thereby detecting said RNA virus.
  • the aforesaid method preferably, is an in vitro method, and may comprise steps in addition to those specified above, in particular steps as specified herein above for the other methods.
  • the present invention relates to a polynucleotide comprising, preferably consisting of, the nucleic acid sequence of SEQ ID NO:30 or 31 or a sequence at least 90% identical thereto.
  • polynucleotide is known to the skilled person. As used herein, the term preferably includes nucleic acid molecules comprising or consisting of a nucleic acid sequence or nucleic acid sequences as specified herein.
  • the polynucleotide of the present invention shall be provided, preferably, either as an isolated polynucleotide (i.e. isolated from its natural context) or in genetically modified form.
  • the polynucleotide preferably, is DNA, including cDNA, or is RNA. The term encompasses single as well as double stranded polynucleotides.
  • the polynucleotide is a chimeric molecule, i.e., preferably, comprises at least one nucleic acid sequence, preferably of at least 5 bp, more preferably at least 10 bp, heterologous to the residual nucleic acid sequences.
  • comprised are also chemically modified polynucleotides including naturally occurring modified polynucleotides such as glycosylated or methylated polynucleotides or artificial modified one such as biotinylated polynucleotides.
  • polynucleotide preferably, includes variants of the specifically indicated polynucleotides.
  • polynucleotide relates to the specific polynucleotides indicated.
  • polynucleotide variants may be variants of a polynucleotide related to herein comprising a nucleic acid sequence characterized in that the sequence can be derived from the aforementioned specific nucleic acid sequence by at least one nucleotide substitution, addition and/or deletion, wherein the polynucleotide variant shall preferably have the activity of being a crRNA.
  • said polynucleotide has at least 90%, more preferably at least 95%, still more preferably at least 97%, even more preferably at least 98%, most preferably at least 99% identity with the sequence of SEQ ID NO:30 or 31.
  • the degree of identity (e.g. expressed as "%identity") between two biological sequences, preferably DNA, RNA, or amino acid sequences, can be determined by algorithms well known in the art.
  • the degree of identity is determined by comparing two optimally aligned sequences over a comparison window, where the fragment of sequence in the comparison window may comprise additions or deletions (e.g., gaps or overhangs) as compared to the sequence it is compared to for optimal alignment.
  • the percentage is calculated by determining, preferably over the whole length of the polynucleotide or polypeptide, the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
  • Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman (1981), by the homology alignment algorithm of Needleman and Wunsch (1970), by the search for similarity method of Pearson and Lipman (1988), by computerized implementations of these algorithms (GAP, BESTFIT, BLAST, PASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, WI), or by visual inspection. Given that two sequences have been identified for comparison, GAP and BESTFIT are preferably employed to determine their optimal alignment and, thus, the degree of identity. Preferably, the default values of 5.00 for gap weight and 0.30 for gap weight length are used.
  • the present invention relates to a kit comprising the polynucleotide of the present invention in a housing.
  • kit preferably refers to a collection of the aforementioned compound(s), means or reagents, which may or may not be packaged together.
  • the polynucleotide is comprised in a composition, preferably as a ready-to-use solution, in the kit.
  • the housing may be any kind of container and/or packaging deemed appropriate by the skilled person.
  • the components of the kit may be comprised by separate vials (i.e. as a kit of separate parts) or provided in a single vial.
  • the housing is adapted such that the components of the kit may be transported together as a unit.
  • the kit preferably, is to be used for practicing the methods referred to elsewhere herein.
  • the kit preferably contains instructions for carrying out said methods.
  • the instructions can be provided by a user's manual in paper or electronic form.
  • the kit comprises a diluent; appropriate diluents are known to the skilled person.
  • the kit further comprises at least one of a Type VI Cas nuclease and a reporter RNA.
  • a method for detecting an RNA virus in a sample comprising the steps of a) releasing viral RNA from said sample; b) amplifying at least parts of the viral RNA comprised in said sample; c) contacting the amplified viral RNA of step a) with a Type VI Cas nuclease, a crRNA, and a reporter RNA; and d) detecting cleavage of said reporter RNA, thereby detecting said RNA virus.
  • step a) comprises contacting said sample with a surfactant, preferably a non-ionic surfactant.
  • step a) comprises contacting said sample with said surfactant at a concentration of from 0.05% (w/v) to 5% (w/v).
  • steps b) to c), preferably all steps, are performed at a temperature of from 20°C to 45°C.
  • steps b) to c), preferably all steps, are performed at a temperature of 20°C to 37°C.
  • steps b) to c), preferably all steps, are performed at a temperature of about 25°C.
  • step a) comprises contacting the viral RNA with a primer and an RNA polymerase, preferably an RNA-dependent RNA polymerase.
  • step b) comprises amplifying said viral RNA by reverse-transcriptase recombinase polymerase amplification (RT-RPA), preferably comprising contacting said viral RNA with MuLV reverse transcriptase.
  • R-RPA reverse-transcriptase recombinase polymerase amplification
  • RNA virus is SARS-CoV-2, SARS-CoV-1, or MERS.
  • said reporter RNA comprises at least a first label, preferably attached towards one of the ends of said reporter RNA. 12. The method of any one of embodiments 1 to 11, wherein said reporter RNA comprises a first and a second label, wherein the first label is attached towards the 5' end of the reporter RNA and the second label is attached towards the 3' end of the reporter RNA.
  • detecting cleavage of said reporter RNA comprises detecting separation of the first label from the second label.
  • a type VI Cas nuclease preferably a Casl3a nuclease, a Casl3b nuclease, a Casl3c nuclease, or a Casl3d nuclease, for detecting an RNA virus, preferably according to the method of any one of embodiment s 1 to 18.
  • a type VI Cas nuclease for use in diagnosing an infection with an RNA virus in a subject preferably according to the method according to any one of embodiments 1 to 19.
  • RNA virus is a SARS- CoV-2, SARS-CoV-1, or MERS.
  • a method for diagnosing an infection with an RNA virus in a subject comprising a) detecting an RNA virus in a sample of said subject by the method of any one of embodiments 1 to 19; and b) in case an RNA virus is detected in step a), diagnosing an infection with an RNA virus in said subject.
  • a method for detecting a target RNA and/or a target DNA in a sample of a subject comprising the steps of a) contacting said sample with a Type V Cas nuclease, a Type V crRNA targeting said target DNA, a type VI Cas nuclease, a Type VI crRNA targeting said target RNA, a reporter RNA and a reporter DNA; and b) detecting cleavage of said reporter RNA, thereby detecting said target RNA; and/or detecting cleavage of said reporter DNA, thereby detecting said target DNA.
  • RNA is at least a fragment of a genome of an RNA virus, of a pathogen RNA, or of an endogenous RNA of said subject, preferably an mRNA.
  • RNA is at least a fragment of a genome of an RNA virus and wherein said target DNA is a reverse transcript of an endogenous transcript of said subject, preferably of a transcript of a housekeeping gene of said subject.
  • said reporter RNA comprises a first and a second label, wherein the first label is attached towards the 5' end of the reporter RNA and the second label is attached towards the 3' end of the reporter RNA.
  • detecting cleavage of said reporter RNA comprises detecting separation of the first label from the second label and/or wherein detecting cleavage of said reporter DNA comprises detecting separation of the second label from the fourth label.
  • any one of embodiments 23 to 38, wherein said type VI Cas nuclease is a Casl3a nuclease, a Cas 13b nuclease, a Casl3c nuclease, or a Cas 13d nuclease preferably is a Casl3a nuclease, more preferably a Casl3a nuclease from Leptotrichia wadeii (LwaCasl3a) or from Leptotrichia buccalis (LbuCasl3a) or from Capnocytophaga canimorsus Cc5 (CcaCasl3b).
  • any one of embodiments 23 to 39, wherein said type V Cas nuclease is a Casl2a nuclease, preferably from Lachnospiraceae bacterium ND2006 Casl2a (LbCasl2a) or Acidaminococcus sp. BV3L6 (AsCasl2a) or a Casl2b nuclease, preferably from Alicy clobacillus acidiphilus (AaCasl2b).
  • Casl2a nuclease preferably from Lachnospiraceae bacterium ND2006 Casl2a (LbCasl2a) or Acidaminococcus sp. BV3L6 (AsCasl2a) or a Casl2b nuclease, preferably from Alicy clobacillus acidiphilus (AaCasl2b).
  • a method for detecting an RNA virus in a sample comprising the steps of i) releasing RNA from said sample; ii) amplifying at least parts of the RNA comprised in said sample via a DNA intermediate; iii) detecting a target RNA and a target DNA in the reaction mixture of step ii) according to the method according to any one of embodiments 23 to 40; and iv) thereby detecting said RNA virus.
  • target DNA is a reverse transcript of a transcript of said subject, preferably an endogenous transcript, more preferably of a transcript of a housekeeping gene of said subject, most preferably of an RNase P transcript.
  • step ii) comprises contacting the viral RNA with a primer and an RNA polymerase, preferably an RNA-dependent RNA polymerase.
  • step ii) comprises amplifying said viral RNA by reverse-transcriptase recombinase polymerase amplification (RT-RPA).
  • RNA virus is SARS-CoV- 2, SARS-CoV-1, or MERS.
  • a method for diagnosing an infection with an RNA virus in a subject comprising a) detecting an RNA virus in a sample of said subject by a method of any one of embodiments 23 to 47; and b) in case an RNA virus is detected in step a), diagnosing an infection with an RNA virus in said subject.
  • step b) or ii) comprises amplifying said viral RNA by reverse-transcriptase recombinase polymerase amplification (RT-RPA) and
  • step b) is performed for about 45 min.
  • step b) comprises contacting said viral RNA with M-MuLV reverse transcriptase.
  • heating comprises heating to at least 90°C for about 5 min.
  • step c) or iii) is performed for of from 7 min to 15 min, preferably about 10 min.
  • step c) contacting (i) a first aliquot of the amplified viral RNA of step a) with a Type VI Cas nuclease, a crRNA comprising the sequence of SEQ ID NO: 31, and a reporter RNA, and (ii) a second aliquot of the amplified viral RNA of step a) with a Type VI Cas nuclease, a crRNA comprising the sequence of SEQ ID NO:30, and a reporter RNA, wherein said contacting of (i) is performed spatially separated from the contacting of (ii).
  • a method for detecting a variant of a SARS-CoV virus in a sample comprising the steps of a) releasing SARS-CoV RNA from said sample; b) amplifying at least parts of the SARS-CoV RNA comprised in said sample; c) contacting the amplified SARS-CoV RNA of step a) with a Type VI Cas nuclease, a reporter RNA, and (i) with a crRNA comprising the sequence of SEQ ID NO:30, and, spatially separated from (i), (ii) with crRNA comprising the sequence of SEQ ID NO:31; and d) detecting cleavage of said reporter RNA in (i) and (ii), thereby detecting said RNA virus.
  • a polynucleotide comprising, preferably consisting of, the nucleic acid sequence of SEQ ID NO:30 or 31 or a sequence at least 90% identical thereto.
  • polynucleotide of embodiment 64 wherein said polynucleotide comprises, preferably consists of, the nucleic acid sequence of SEQ ID NO:30 or 31.
  • polynucleotide of embodiment 64 or 65 wherein said polynucleotide is a ribonucleotide, or is a polynucleotide encoding said nucleic acid sequence.
  • a kit comprising the polynucleotide according to any one of embodiments 64-66 in a housing.
  • kit of embodiment 67 wherein said kit further comprises at least one of a Type VI Cas nuclease and a reporter RNA.
  • Fig. 1 Schematic representation of the improved assay protocol.
  • Fig. 2 Results of a SHERLOCK assay targeting SARS-CoV-2 Orfla, modified according to the invention; 5 copies / m ⁇ of input can be detected.
  • Fig. 3 Results of a SHERLOCK assay targeting the SARS-CoV-2 S gene, modified according to the invention; 0.5 copies / m ⁇ of input can be detected.
  • Fig. 4 Comparison of Superase as RNase inhibitor to murine RNase inhibitor in a SHERLOCK assay; SUPERase reduces background and improves differentiation.
  • Fig. 5 Optimization of reporter RNA amount; down to 10 pmol can be used without loss of sensitivity.
  • Fig. 6 comparison of the results of prior art (qRT-PCR) testing for SARS-CoV-2 to the assay of the present invention; results are identical, except for samples close to the detection limit.
  • Fig. 7 Schematic representation of a Type VI/Type V Cas multiplex assay, exemplified as a fluorescence assay; dsDNA and RNA may be produced e.g. from RNA in a sample, e.g. by RPA as described in the Examples.
  • Target RNA activates Casl3, which in turn cleaves reporter RNA; target DNA activates Cas 12, which in turn cleaves reporter DNA; cleavage of the reporter separates the quencher from the respective fluorophore.
  • Fig. 8 Specificity of detection by Casl2 and Casl3: A) Fluorescence of TEX615 reporter RNA (SEQ ID NO:26) overtime after incubation with Cas 12, Cas 13, Casl2 crRNA, Casl3 crRNA, and reporter RNA ("multiplex") or with Cas 12, Casl2 crRNA, and reporter RNA ("Casl2") or with Cas 13, Casl3 crRNA, and reporter RNA (“Casl3”) or with Casl2 crRNA, Casl3 crRNA, and reporter RNA ("No Cas”); B) Fluorescence of FAM reporter DNA (SEQ ID NO: 19) over time after incubation with Cas 12, Cas 13, Casl2 crRNA, Casl3 crRNA, and reporter DNA ("multiplex") or with Cas 12, Casl2 crRNA, and reporter DNA (“Casl2”) or with Cas 13, Casl3 crRNA, and reporter DNA (“Cas 13”) or with Cas 12 crRNA, Cas 13 cr
  • Fig. 9 Expected result of lateral flow assays with HybriDetect 2T sticks: for RNA extraction and SARS-CoV2, + indicates the result being positive, i.e. successful RNA extraction and presence of SARS-CoV-2, respectively.
  • Fig. 10 Flow diagram of atypical testing procedure; approximate time required: sample taking ca. 5 min, RNA extraction ca 2 h (kit) or ca 5 min (heating); RT-RPA ca 25-45 min, T7- polymerase reaction and Cas 13 cleavage ca. 10-30 min, lateral flow detection ca. 2 min.
  • Fig. 11 Result of the lateral flow assay with detection of SARS-CoV-2 directly after lysing the sample by heat treatment with QuickExtract DNA Extraction solution and Luna Cell Ready Lysis Buffer; y-axis: ratio of the intensity of the signal band/intensity of the control band (band intensity ratio); NTC: no template control.
  • Fig. 12 A) Effect of RNase inhibitor addition before heat extraction of samples; B) Comparison of reverse transcriptase (RT) enzymes in the presence or absence of RNase H. M-MuLV showed the best sensitivity (5-2.5 cp/m ⁇ ) in comparison to ProtoScript II or Superscript III, while the addition of RNase H lead to an improvement for Superscript III only. For each copy number, the order of columns is as indicated in the Fig. from top to bottom.
  • Fig. 13 Comparison of different RPA reaction mix concentrations in detection of SARS-CoV- 2 on a false-negative sample (A) and on several samples close to the limit of detection (LOD, B).
  • Fig. 14 Optimization of reaction time (A) and crRNA concentration (B) for the Casl3 detection step.
  • Fig. 15 Comparison of purified RNA (A, B) and heat-treated (C, D) swab samples (A, C) or gurgle water (GW) samples (B, D) as sample material in ADESSO and qRT-PCT in a clinical context; x-axis: ct-value of samples as determined by qRT-PCR, Y-axis: band intensity ratio of said samples.
  • Fig. 16 Detection of SARS-CoV-2 variants; A) Schematic overview of mutations in the SARS- CoV-2 spike protein in mutants B.1.1.7 (UK variant) and B.1.351 (South Africa Variant); B) Positioning of crRNA HV69-70 and crRNA delHV69-70 in the spike protein sequences of SARS-CoV-2 Wuhan ("wildtype" strain) and the B.1.1.7 variant; C) Schematic representation of positioning of T7-primers in the three clinical samples of the B.1.351 variant.
  • step (a) lyse patient material directly to liberate RNA: add TritonX to 0.2% final & boil (5 min);
  • the sensitivity of the improved assay is at 5 copies of viral RNA/ pi if the Orfla gene is targeted, and is at 0.5 copies of viral RNA/ pi if the S gene is targeted. This compares to 100 and 10 copies, respectively, for the method of Zhang et al.
  • the non-ionic surfactant When releasing is achieved by the non-ionic surfactant Oleth-8, the non-ionic surfactant can be used as a formulation commercialized by Lucigen (QuickExtract DNA Extraction Solution cat# QE09050) or NEB (Luna® Cell Ready Lysis Module #E3032).
  • Lucigen QuickExtract DNA Extraction Solution cat# QE09050
  • NEB Liuna® Cell Ready Lysis Module #E3032
  • the amount of reporter RNA per assay can be reduced to 10 pmol without loss of sensitivity. This compares to 200 pmol according to Zhang et al. (2020).
  • Example 2.1 Comparison to gold standard in clinical samples
  • the improved assay was compared to results obtained by the present gold standard method (qRT-PCR) in clinical samples. The results were found to be identical, except for two samples close to the detection limit (Fig. 6).
  • RNAseP RNAs were detected at the same time.
  • Casl3 and its crRNA, specific for S detected the RNA produced by T7 polymerase from the amplicon produced during RPA amplification. Casl3 then was activated and cleaved an ssRNA reporter, with subsequent production of TEX615 fluorescent signal.
  • Casl2 and its crRNA, specific for RNAseP detected directly the dsDNA amplicon resulting from RPA amplification of RNasP mRNA. Upon recognition, Casl2 was activated and cleaved an ssDNA reporter, resulting in a FAM fluorescent signal.
  • the Type V crRNA had the sequence 5'-rUrArA rUrUrU rCrUrA rCrUrA rArGrU rGrUrA rGrArU rGrArC rCrUrG rCrGrA rGrCrGrA rGrCrGrA rGrGrU rUrCrU rGrA-3' (SEQ ID NO:23), the reporter DNA had the sequence 5'-6-FAM-TTATTATTATT-Iowa Black® FQ-3' (SEQ ID NO: 19).
  • the Type VI crRNA and the reporter RNA have been described herein above.
  • Example 4 Multiplex detection by lateral flow
  • RNAseP RNAs the presence of SARS-CoV2 virus (S gene) and human RNAseP RNAs are detected at the same time.
  • Casl3 and its crRNA, specific for S detect the RNA produced by T7 polymerase from the amplicon produced during RPA amplification.
  • Casl3 then gets activated and cleaves a ssRNA reporter containing FAM and Biotin, respectively, at the 5’ and 3’ ends.
  • Casl2 and its crRNA, specific for RNAseP can detect directly the dsDNA amplicon resulting from RPA amplification of RNase P mRNA.
  • the Type V crRNA was the same as in Example 3, the reporter DNA was 5'-6-FAM-TTATTATTATT- biotin-3' (SEQ ID NO:20) or 5'-6-FAM-TTATTATTATT-digoxigenin-3' (SEQ ID NO:21).
  • the Type VI crRNA and the reporter RNA have been described herein above.
  • Example 5 Methods for Examples 6 to 10
  • a plasmid encoding the LwaCasl3 insert was transformed into Rosetta cells and purified according to established protocols with substantial modification. Single colonies were inoculated into 25 mL Terrific Broth (TB) (100 ug/mL AMP) and grown to an OD of 0.6 at 37°C degrees while shaking at 150 rpm. The suspension was chilled for 30 min at 4°C and subsequently induced with 0.5 mM IPTG and left shaking for an additional 16h at 21°C. Cells were harvested by centrifugation at 5 k rpm for 15 min at 4°C.
  • TB Terrific Broth
  • the pellet was resuspended in 4x (wt/vol) supplemented lysis buffer (12 cOmplete Ultra EDTA-free tablets, 600 mg of lysozyme and 6 uL of benzoase to lysis buffer (20 mM Tris pH 8.0, 500 mM NaCl, 1 mM DTT)) and lysed by sonication. Lysate was cleared by centrifugation at 10 k rpm for lh at 4°C. Supernatant was purified using a 1 mL HIS-Trap column (Cytiva) slurry and affinity chromatography was performed using the AKTA pure system with lysis buffer for washing steps and an imidazole gradient for elution.
  • the protein sample was incubated with SUMO protease (ThermoScientific) as per the manufacturer’s instructions at 4°C overnight to remove the affinity tags.
  • the sample was then re-applied to a 1 mL HIS-Trap column. Both the SUMO protease (which itself has a 6xHIS tag) and the cleaved affinity tag bind to the resin, while pure Casl3 eluted in the wash step.
  • a final size-exclusion chromatography step was performed using the AKTA pure system using 10 mM HEPES pH 7.0, 5 mM MgC12, 1 M NaCl and 2 mM DTT as gel filtration buffer on a Superdex 16/600 column.
  • Fully synthetic SARS-CoV-2 RNA was purchased from Twist Biosciences (MT007544.1 or MN908947.3). In order to test SHERLOCK sensitivity, serial dilutions were prepared in water or in saline, from the initial concentration of 10 6 cp/m ⁇ to 0.01 cp/pl.
  • the frozen samples were picked up and transported to our laboratory, where they were either stored at 4°C and a few days later analyzed or immediately analyzed.
  • Clinical samples were lysed for direct SHERLOCK or ADESSO assay as follows: 10m1 of sample were mixed with 10m1 of QuickExtract DNA Extraction solution (Lucigen, #QE09050), and incubated at 95°C for 5 min. Then the samples were mixed by vortexing and spun down for 15 seconds at lO.OOOg. Finally, 5,6 m ⁇ of sample (for RT-RPA 2X) were collected from the upper liquid phase, carefully avoiding to aspirate any precipitate, and used in the RT-RPA step. crRNA synthesis and purification
  • CRISPR-RNAs were either designed in our lab or synthesized by Integrated DNA Technologies (IDT). To produce the crRNAs in our lab we followed a previously published protocol (Kellner et al. (2019), Nature Protocols 14:2986). In short, the templates for the crRNAs were ordered as DNA oligonucleotides from Sigma-Aldrich with an appended T7 promoter sequence. These oligos were annealed with a T7-3G oligonucleotide, and used in an in vitro transcription (IVT) reaction (HiScribe T7 Quick High Yield RNA Synthesis Kit, NEB, #E2050S).
  • ITT in vitro transcription
  • the crRNAs were then purified using Agencourt RNAClean XP Kit (Beckman Coulter, #A63987). The correct size of the crRNAs was confirmed on a UREA gel and the concentration evaluated by nanodrop. Aliquots of lOng/mI of each crRNA were produced to avoid repeated freeze and thaw cycles and stored at -80°C.
  • RT-RPA Reverse Transcriptase Recombinase polymerase amplification
  • RT-RPA reactions were carried out with TwistAmp Basic (TwistDx, #TABAS03KIT) with the addition of M-MuLV Reverse Transcriptase (NEB, #M0253) and RNase Inhibitor, Murine (NEB, #M0314). Reactions were run at 42°C for 45 minutes in a heat block.
  • RT-RPA 2X two lyophilized pellets TwistAmp Basic are used to prepare the following master mix for 5 reactions: 59 m ⁇ of Rehydration Buffer (RB) are mixed with 2,5 m ⁇ of each primer (forward and reverse) at a concentration of 20mM, 1.5 m ⁇ of M-MuLV RetroTranscriptase (200U/pl - NEB, #M0253) and 1,5 m ⁇ of RNase Inhibitor, Murine (40U/pl - NEB, #M0314). The RB-primer-enzyme mix is used to rehydrate two pellets and finally 5m1 of MgOAc are added.
  • RB Rehydration Buffer
  • the reaction mix for Casl3 activity was prepared by combining 4.3 m ⁇ of nuclease-free water, 1 m ⁇ of cleavage buffer (400mM Tris pH 7.4), 1 m ⁇ of LwaCasl3a protein diluted in Storage Buffer (SB, Kellner et al 2019, loc.
  • the reaction mix for Casl3 activity was prepared by combining 8.6 pi of nuclease-free water, 2 m ⁇ of cleavage buffer (400mM Tris pH 7.4), 2 m ⁇ of LwaCasl3a protein diluted in Storage Buffer (SB) to a concentration of 126.6 pg/ml, 1 m ⁇ of crRNA (40ng/pl), 1 m ⁇ of fluorescent reporter (IDT, diluted in water to a final concentration of 4 mM), 1 m ⁇ of RNase inhibitor, Murine (NEB, #M0314), 0.8 m ⁇ of rNTP solution mix (25mM each, NEB, #N0466), 0.6 m ⁇ ofNxGen T7 RNA Polymerase (Lucigen, #30223-2) and 1 m ⁇ of MgC12 (120mM).
  • Example 6 A SHERLOCK-based assay for SARS-CoV2 detection in clinical samples We assessed the sensitivity of our test when combining the Casl3 detection with an RT-RPA pre-amplification step on SARS-CoV-2 genes S and Orfla. Indeed, we detected SARS-CoV-2 gene S at a concentration of lOaM (5 copies/m ⁇ ) and gene Orfla at a concentration of lOOaM (50 copies/m ⁇ ). This improvement is preferably due to the replacement of ProtoScript II Reverse Transcriptase with M-MuLV Reverse Transcriptase. We then used the set of primers and crRNA for S to conduct a blind test on 30 clinical samples.
  • Example 7 SARS-CoV2 direct detection from clinical samples
  • the RNA extraction step is the major time-consuming step for COVID-19 diagnosis ( Figure 10).
  • Different studies have already demonstrated that it is possible to omit this step (Smyrlaki et al. (2020), Nat Commun 11:4812; Bruce et al. (2020), PLoS Biol 18(10): e3000896; Arizti- Sanz et al., (2020) Nat Commun 11:5921; Joung etal. (2020), medRxiv 2020.05.04.20091231). Therefore, after demonstrating the high potential of SHERLOCK as a diagnostic test for COVID-19, we attempted to improve our protocol in order to avoid the RNA extraction step, making the test faster and cheaper.
  • Example 8 ADESSO: an optimized and highly sensitive SHERLOCK assay
  • SHERLOCK a series of steps in SHERLOCK, namely, 1) sample lysis, 2) RT-RPA and 3) Casl3 detection, to increase both sensitivity and speed of the test.
  • Casl3 activation via a fluorometer to also monitor the speed of the reaction in real time.
  • RNaseAlert was added to the samples following lysis and fluorescence was measured to evaluate the corresponding nuclease activity. Notably, addition of RNase inhibitors in the lysis buffer prior to heating was sufficient to inhibit RNase activity almost completely ( Figure 12A).
  • RT-RPA reverse transcriptase
  • M-MuLV shows the best sensitivity (5-2.5 cp/m ⁇ ) in comparison to ProtoScript II or Superscript III, while the addition of RNase H lead to an improvement for Superscript III only ( Figure 12B).
  • Example 9 Evaluation of ADESSO’ s performance on clinical samples in direct comparison to RT-qPCR.
  • RNA extracted from swabs was able to correctly identify most positive samples (91 out of 95), resulting in a sensitivity of 96%.
  • all the false negative samples have Ct values higher than 31, corresponding to lower viral loads ( ⁇ 100cp/pl) and therefore a lower probability of spreading the virus (Figure 15A).
  • RT-qPCR Tib Molbiol
  • Example 10 Evolution/ Adaptation of ADESSO for detection of SARS-CoV-2 variants: a flexible and powerful assay to rapidly identify specific variants or mutations.
  • SARS-CoV-2 Since the beginning of the pandemic, SARS-CoV-2 has evolved considerably. The first variants to appear carried a D614G mutation, which is now dominant and shared between all the existing variants. While several variants exist, here we focus on two variants of concern, SARS-CoV-2 B.l.1.7 (UK variant) and SARS-CoV-2 B.1.351 (South Africa (SA) variant). SARS-CoV-2 B.l.1.7, also known as 501Y.V1, seems to have an enhanced transmissibility and may be more virulent. It was first detected in England in late 2020 and, after becoming the dominant variant in the UK, it is now spreading quickly all over Europe and worldwide.
  • UK variant SARS-CoV-2 B.l.1.7
  • SA South Africa
  • B.l.1.7 contains eight mutations in the spike gene in addition to the mutation causing the D614G substitution, including deletions (e.g., AHV69-70) ( Figure 16A).
  • SARS-CoV-2 B.1.351 also known as 501Y.V2, was first detected in late 2020 in Eastern Cape, South Africa. This variant quickly became dominant locally and displaced other viral lineages in several regions, possibly as a result of increased transmissibility or immune escape.
  • B.1.351 contains nine mutations in the spike gene in addition to the mutation causing the D614G substitution, including clusters of mutations (e.g., mutations leading to D242-244 and R246I) ( Figure 16A). It is now essential to quickly identify individuals infected by SARS-CoV-2 variants.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne un procédé de détection d'un virus à ARN dans un échantillon, comprenant les étapes consistant à a) libérer l'ARN viral à partir dudit échantillon ; b) amplifier au moins des parties de l'ARN viral compris dans ledit échantillon ; c) mettre en contact l'ARN viral amplifié de l'étape a) avec une nucléase Cas de type VI, un ARNcr et un ARN rapporteur ; et d) détecter le clivage dudit ARN rapporteur, ce qui permet de détecter ledit virus ARN, ainsi que des procédés et des utilisations associés. La présente invention concerne également un procédé de détection d'un ARN cible et/ou d'un ADN cible dans un échantillon d'un sujet, le procédé comprenant les étapes consistant à a) mettre en contact ledit échantillon avec une nucléase Cas de type V, un ARNcr de type V ciblant ledit ADN cible, une nucléase Cas de type VI, un ARNcr de type VI ciblant ledit ARN cible, un ARN rapporteur et un ADN rapporteur ; et b) détecter le clivage dudit ARN rapporteur, ce qui permet de détecter ledit ARN cible ; et/ou détecter le clivage dudit ADN rapporteur, ce qui permet de détecter ledit ADN cible, ainsi que des procédés d'utilisation et des moyens associés.
PCT/EP2021/062457 2020-05-11 2021-05-11 Détection de polynucléotides par des nucléases cas WO2021228839A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP20173912.5 2020-05-11
EP20173912 2020-05-11
EP20190953.8 2020-08-13
EP20190953.8A EP3954783A1 (fr) 2020-08-13 2020-08-13 Détection de polynucléotides par nucléases cas

Publications (1)

Publication Number Publication Date
WO2021228839A1 true WO2021228839A1 (fr) 2021-11-18

Family

ID=75801618

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2021/062457 WO2021228839A1 (fr) 2020-05-11 2021-05-11 Détection de polynucléotides par des nucléases cas

Country Status (1)

Country Link
WO (1) WO2021228839A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080076160A1 (en) 2002-02-21 2008-03-27 Asm Scientific, Inc. Recombinase polymerase amplification
WO2020028729A1 (fr) * 2018-08-01 2020-02-06 Mammoth Biosciences, Inc. Compositions de nucléase programmable et leurs méthodes d'utilisation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080076160A1 (en) 2002-02-21 2008-03-27 Asm Scientific, Inc. Recombinase polymerase amplification
US20110065106A1 (en) 2002-02-21 2011-03-17 Twistdx, Inc. Recombinase polymerase amplification
WO2020028729A1 (fr) * 2018-08-01 2020-02-06 Mammoth Biosciences, Inc. Compositions de nucléase programmable et leurs méthodes d'utilisation

Non-Patent Citations (17)

* Cited by examiner, † Cited by third party
Title
"Statistics for Research", vol. Details are found in Dowdy and Wearden, 1983, JOHN WILEY & SONS
ABD EL WAHED AHMED ET AL: "A Portable Reverse Transcription Recombinase Polymerase Amplification Assay for Rapid Detection of Foot-and-Mouth Disease Virus", PLOS ONE, vol. 8, no. 8, August 2013 (2013-08-01), pages e71642, XP055816678, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3748043/pdf/pone.0071642.pdf> DOI: 10.1371/journal.pone.0071642 *
ARIZTI-SANZ ET AL., NAT COMMUN, vol. 11, 2020, pages 5921
BRUCE ET AL., PLOS BIOL, vol. 18, no. 10, 2020, pages e3000896
CAMERON MYHRVOLD ET AL: "Field-deployable viral diagnostics using CRISPR-Cas13", SCIENCE, vol. 360, no. 6387, 27 April 2018 (2018-04-27), US, pages 444 - 448, XP055718928, ISSN: 0036-8075, DOI: 10.1126/science.aas8836 *
CAMERON MYHRVOLD ET AL: "Supplementary Materials for Field-deployable viral diagnostics using CRISPR-Cas13", SCIENCE, 26 April 2018 (2018-04-26), XP055681013, Retrieved from the Internet <URL:https://science.sciencemag.org/content/sci/suppl/2018/04/25/360.6387.444.DC1/aas8836-Myhrvold-SM.pdf> [retrieved on 20200330], DOI: 10.1126/science.aas8836 *
CHEN ET AL., SCIENCE, vol. 360, no. 6387, 2018, pages 436
GOOTENBERG JONATHAN S. ET AL: "Nucleic acid detection with CRISPR-Cas13a/C2c2 - supplementary materials", SCIENCE, vol. 356, no. 6336, 13 April 2017 (2017-04-13), US, pages 438 - 442, XP055781069, ISSN: 0036-8075, Retrieved from the Internet <URL:https://science.sciencemag.org/content/sci/suppl/2017/04/12/science.aam9321.DC1/aam9321_Gootenberg_SM.pdf> DOI: 10.1126/science.aam9321 *
HUANG ET AL., BIOSENSORS AND BIOELECTRONICS, vol. 164, 2020, pages 112316
JONATHAN S. GOOTENBERG ET AL: "Nucleic acid detection with CRISPR-Cas13a/C2c2", SCIENCE, vol. 356, no. 6336, 13 April 2017 (2017-04-13), US, pages 438 - 442, XP055481345, ISSN: 0036-8075, DOI: 10.1126/science.aam9321 *
JOUNG ET AL., MEDRXIV, 4 May 2020 (2020-05-04), pages 20091231
JOUNG ET AL., POINT-OF-CARE TESTING FOR COVID-19 USING SHERLOCK DIAGNOSTICS, vol. 20200505, 2020, Retrieved from the Internet <URL:www.stopcovid.science/docs/STOPCovidWhitepaper.pdf>
KELLNER ET AL., NATURE PROTOCOLS, vol. 14, 2019, pages 2986
LIU ET AL., FOOD CHEMISTRY, 2021, pages 127608
WYLLIE ET AL., MEDRXIV, 16 April 2020 (2020-04-16), pages 20067835
ZHANG ET AL., SHERLOCK COVID-19 TESTING KIT INSTRUCTIONS, vol. 20200321, 2020, Retrieved from the Internet <URL:www.broadinstitute.org/files/publications/special/COVID-19detection(updated).pdf>
ZHOU ET AL., J CELL MOL MED, vol. 22, 2018, pages 5807

Similar Documents

Publication Publication Date Title
Kostyusheva et al. CRISPR-Cas systems for diagnosing infectious diseases
CN114058679B (zh) 一种crispr级联核酸检测系统及其检测方法与应用
JP2017200483A (ja) 核酸の配列特異的な精製及び多重分析のための方法及び組成物
CN104962607B (zh) 一种单一或多重目的基因片段恒温扩增的检测方法
JP2023513955A (ja) ウイルス配列を検出するための組成物、キット、及び方法
US11149320B1 (en) Assays for the detection of SARS-CoV-2
CN114391046A (zh) 一种检测非洲猪瘟病毒的方法和试剂盒
JP2012513216A (ja) Ｘｍｒｖの検出方法
US20210340636A1 (en) Assays for the Detection of SARS-CoV-2
JP2020092721A (ja) ターゲット核酸検出のための二重プローブアッセイ
CN115461476A (zh) 用于检测SARS-CoV-2新型冠状病毒的引物及其试剂盒、检测方法和应用
Qin et al. One-pot visual detection of African swine fever virus using CRISPR-Cas12a
KR101097560B1 (ko) 핵산 검출 방법
US20210340635A1 (en) Materials and methods for detecting coronavirus
JP2023518217A (ja) 標的核酸を検出するためのループプライマー及びループ・デ・ループ方法
Xia et al. Rapid detection of Banna virus by reverse transcription-loop-mediated isothermal amplification (RT-LAMP)
WO2023207909A1 (fr) Kit de détection d&#39;acides nucléiques fondé sur la protéine crispr et son utilisation
EP3954783A1 (fr) Détection de polynucléotides par nucléases cas
Xu et al. Direct detection of Corynebacterium striatum, Corynebacterium propinquum, and Corynebacterium simulans in sputum samples by high-resolution melt curve analysis
CN106471135B (zh) 肠道病毒和双埃柯病毒的分子检测
EP3438280B1 (fr) Procédé de détection d&#39;hémoplasme
WO2021228839A1 (fr) Détection de polynucléotides par des nucléases cas
CN115838834A (zh) 一种基于RT-RAA和CRISPR/Cas12a的人鼻病毒A型和C型检测体系
US20230031670A1 (en) Method and kit for detection of polynucleotide
US20240209462A1 (en) A method for detection of target nucleic acid using isothermal amplification

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21723768

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21723768

Country of ref document: EP

Kind code of ref document: A1