WO2021227129A1 - Universal high-throughput sequencing adapter and application thereof - Google Patents

Abstract

Provided are a universal high-throughput sequencing adapter and an application thereof. The universal high-throughput sequencing adapter comprises a double-stranded complementary region and a single-stranded free arm. The sequencing adapter can be compatible with multiple sequencing platforms, such as Ion Torrent and Illumina platforms; the sequencing adapter is suitable for clinical testing and is cost-saving, and can further be applied to the authenticity interpretation of low-frequency mutations.

Description

A universal high-throughput sequencing adapter and its application

Cross-references to related applications

This application claims the priority of the Chinese patent application with the application number 202010407833.5 and the title "A universal high-throughput sequencing adapter and its application" submitted to the Chinese Patent Office on May 14, 2020, the entire content of which is incorporated by reference In this application.

Technical field

The invention relates to the field of gene sequencing, in particular to a universal high-throughput sequencing adapter and its application in the process of sequencing database construction.

Background technique

With the development of gene sequencing technology, high-throughput sequencing technology (High-Throughput Sequencing) has become more and more widely used in clinical practice, such as neonatal screening for high-risk diseases, diagnosis of genetic diseases, detection of gene carrying, and genetic Drug testing is used in many aspects such as individualized drug dosage, selection and drug response. High-throughput sequencing technology (High-Throughput Sequencing), also known as Next Generation Sequencing Technology (NGS), is relative to the traditional Sanger Sequencing technology. The principle of Sanger sequencing is to extend a synthetic short oligonucleotide primer by DNA polymerase, hybridize with a single-stranded DNA template to synthesize new DNA fragments, and separate different fragments by polyacrylamide electrophoresis to read DNA sequences. Since the advent of Sanger sequencing, it has been considered the gold standard for DNA sequencing due to its long read length and high data accuracy. It is also the gold standard for the verification of next-generation sequencing results. However, the throughput of Sanger sequencing data is low, and it is time-consuming and labor-intensive to detect more genes and more loci at the same time.

NGS sequencing usually uses massively parallel sequencing (MPS), which can realize simultaneous sequencing of multiple samples and multiple sites, greatly improving sequencing throughput. At present, high-throughput sequencing technology has been proven to have high accuracy and sensitivity in clinical genetic testing. However, it is affected by various noises and errors in the library construction process and sequencing process, causing low-frequency mutations in the sequencing results. It is difficult to distinguish its authenticity. For example, due to data pollution introduced by index hopping, compared to bridge amplification, in the Exclusion Amplification (ExAmp) mode, the proportion of label hopping can be as high as 2% (illumina.Effects of index misassignment on multiplexing) and downstream[Z]Analysis).

At present, the most widely used NGS sequencing platforms are Ion Torrent and Illumina. However, due to the different principles of sequencing technology, different platforms use different technical procedures for library construction, which makes the library not universal, that is, libraries suitable for the Ion Torrent platform cannot be used on the Illumina platform. Generate sequencing data and vice versa. This has greatly restricted the clinical application, so it is necessary to find a universal library and apply different sequencing platforms.

Library construction is an important part of NGS sequencing, and sequencing adapter research is the focus of library research. At present, the design of sequencing adapters mainly includes two directions. One is to try to improve the shape of the adapter, such as Y-shaped or U-shaped adapters. In order to reduce or avoid the appearance of adapter dimers and increase the amount of available sequencing data; the other is to add specific molecular tags to the adapter structure to identify errors in the library construction process. However, in the current existing technology, sequencing libraries prepared through the above two research directions can still only be used for fixed sequencing platforms, and cannot be used in mainstream sequencing platforms such as Ion Torrent and Illumina at the same time. The Ion Torrent platform and the Illumina platform have different sequencing principles and different methods for constructing sequencing templates. The Ion Torrent platform uses emulsion PCR to construct the sequencing template; the Illumina platform uses bridge amplification or exclusive amplification to construct the sequencing template. . According to the template construction method, Ion Torrent generally uses straight link heads; Illumina generally uses Y-links for library construction. In view of the fact that the above-mentioned current conventional high-throughput sequencing adapters are all single applicable adapters, the Ion Torrent and Illumina dual platforms cannot be applied.

In view of this, the present invention is proposed.

Summary of the invention

The technical problem to be solved by the present invention is to overcome the disadvantages that the high-throughput sequencing adapter in the prior art cannot realize the compatibility of different sequencing platforms, and the applicability is not strong.

Therefore, the first objective of the present invention is to seek a universal high-throughput sequencing adapter suitable for multiple sequencing platforms;

The second objective of the present invention is to seek a method for preparing a universal high-throughput sequencing adapter suitable for multiple sequencing platforms;

The third objective of the present invention is to seek the application of a universal high-throughput sequencing adapter;

The fourth objective of the present invention is to seek a method for detecting low-frequency gene mutations.

In order to achieve the above objective, the present invention provides the following technical solutions:

The present invention provides a single link head, which is characterized in that the single link heads are connected in sequence

1) Free arm,

2) Double-stranded complementary region, where,

The free arm includes a library amplification primer binding region and a carrier binding region;

The double-stranded complementary region contains two or more sequencing primer binding regions of the sequencing platform.

In some embodiments, the double-stranded complementary region further includes a tag sequence.

Preferably, the tag sequence is located at one end of the double-stranded complementary region away from the free arm.

In some embodiments, the tag sequence consists of 6-12 random bases.

In some embodiments, the length of the free arm of the single link head is 30-56 bp, and the length of the double-stranded complementary region is 40-58 bp.

In some specific embodiments,

The free arm can be composed of the following sequence:

5’-NNNNNNNNNNNNNNNACCGAGATCTACACTCTTTCCCTACACGAC-3’;

The double-stranded complementary region may be composed of the following sequence:

5’-GCTCTTCCGATNNNNNNNNNNNNCCTCTCTATGGGCAGTCGGTGATXXXXXX-3’;

Wherein, the "XXXXXX" represents a tag sequence composed of 6-12 random bases;

The "N" represents any base of A, T, C, G, or NA (no base).

In some embodiments, the free arm further includes a tag sequence, and the tag sequence is consistent with the double-stranded complementary region tag sequence.

In some specific embodiments,

The free arm can be composed of the following sequence:

5’-ACGTCTGAACTCCAGTCACXXXXXXATCTCGTATGNNNNNNNNNNNNNNN-3’,

The "XXXXXX" represents a tag sequence composed of 6-12 random bases;

The "N" represents any base of A, T, C, G, or NA (no base).

The present invention also provides a Y-type high-throughput sequencing adapter, characterized in that the sequencing adapter includes a first single strand and a second single strand;

The first single strand and the second single strand respectively include:

1) Free arm,

2) Double-stranded complementary region, where,

The free arm includes a library amplification primer binding region and a carrier binding region;

The double-stranded complementary region contains two or more sequencing primer binding regions of the sequencing platform.

In some embodiments, the free arm sequences of the first single strand and the second single strand are not complementary, and the first single strand and the second single strand may be annealed to form a Y-shaped structure double strand.

In some embodiments, the double-stranded complementary region includes a tag sequence, and the tag sequence is located at one end of the double-stranded complementary region away from the free arm.

In some embodiments, the sequencing platform includes, but is not limited to, Illumina, Ion Torrent, PacBio, Roche, Helicos, and ABI platforms; preferably, the sequencing platform is Ion Torrent and Illumina platforms.

In some embodiments, the second single-stranded free arm further includes a tag sequence.

In some preferred embodiments, the tag sequence in the free arm is the same as the tag sequence in the double-stranded complementary region; more preferably, the tag sequence in the free arm is close to the end of the double-stranded complementary region.

In some embodiments, the length of the double-stranded complementary region of the first single strand and the second single strand is 40-58 bp; the length of the free arm of the first single strand is 30-45 bp, and the length of the free arm of the second single strand is 30-45 bp. The length is 35-56bp; the tag sequence is composed of random bases of 6-12bp.

In some embodiments, the 3'end of the free arm of the first or second single strand is modified for stability;

Preferably, thio modification is carried out;

More preferably, the phosphodiester bond between the last 3 bases at the 3'end is replaced by phosphorothioate.

In some embodiments, the first single-stranded sequence is as follows:

Free arm sequence:

5’-NNNNNNNNNNNNNNNACCGAGATCTACACTCTTTCCCTACACGAC-3’;

Double-stranded complementary region sequence:

The "XXXXXX" represents a tag sequence composed of 6-12 random bases;

5’-GCTCTTCCGATNNNNNNNNNNCCTGCGTGTCTCCGACTCAGCTAXXXXXX-3’

The "N" represents any base of A, T, C, G, or NA (no base).

In some preferred embodiments, the first single strand is connected by a free arm and a double-strand complementary region in a 5'-3' direction sequentially.

In some embodiments, the second single-stranded sequence is as follows:

Free arm sequence:

5’-ACGTCTGAACTCCAGTCACXXXXXXATCTCGTATGNNNNNNNNNNNNNNN-3’;

Double-stranded complementary region sequence:

5’-XXXXXXTAGCTGAGTCGGAGACACGCAGGNNNNNNNNNNATCGGAAGAGC-3’;

The "XXXXXX" represents a tag sequence composed of 6-12 random bases;

The "N" represents any base of A, T, C, G, or NA (no base).

In some preferred embodiments, the second single-stranded double-stranded complementary region and the free arm are connected in a 5'-3' direction sequentially.

The present invention also provides a high-throughput sequencing adapter set, characterized in that the sequencing adapter set includes the above-mentioned high-throughput sequencing adapter.

In some embodiments, the high-throughput sequencing adapter set further includes another Y-type high-throughput sequencing adapter as follows: the Y-type high-throughput sequencing adapter includes third and fourth single strands;

The sequence of the other Y-type high-throughput sequencing adaptor is similar to the sequence of the above-mentioned Y-type high-throughput sequencing adaptor, except that the sequence of the double-stranded complementary region is different;

Wherein, the sequence of the double-strand complementary region of the third single-strand is as follows:

5’-GCTCTTCCGATNNNNNNNNNNNNCCTCTCTATGGGCAGTCGGTGATXXXXXX-3’;

The sequence of the double-strand complementary region of the fourth single-stranded is complementary to the sequence of the third single-stranded double-strand complementary region;

The "XXXXXX" represents a tag sequence composed of 6-12 random bases;

The "N" represents any base of A, T, C, G, or NA (no base).

In some preferred embodiments, the connection sequence between the free arms of the third and fourth single strands and the double-strand complementary region sequence is the same as that of the first and second single strands.

In some preferred embodiments, the single-stranded sequences of the Y-type high-throughput sequencing adapter are as follows:

The first single-stranded sequence (SEQ ID NO.1):

5’-ACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCCTGCGTGTCTCCGACTCAGCTAXXXXXX-3’;

The second single-stranded sequence (SEQ ID NO.2):

5’-XXXXXXTAGCTGAGTCGGAGACACGCAGGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATG-3’;

The third single-stranded sequence (SEQ ID NO.3):

5’-ACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCCTCTCTATGGGCAGTCGGTGATXXXXXX-3’

The fourth single-stranded sequence (SEQ ID NO.4):

5’-XXXXXXATCACCGACTGCCCATAGAGAGGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATG-3’.

In some other preferred embodiments, the single-stranded sequences of the Y-type high-throughput sequencing adapter are as follows:

The first single-stranded sequence (SEQ ID NO.5):

5’-CAAAGAGCGAGGACACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATTCTCCATCCA CCTGCGTGTCTCCGACTCAGCTAXXXXXX-3’;

The second single-stranded sequence (SEQ ID NO.6):

5’-XXXXXXTAGCTGAGTCGGAGACACGCAGGTGGATGGAGAATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATGGTCCTCGCTCTTTG-3’;

The third single-stranded sequence (SEQ ID NO.7):

5’-CAAAGAGCGAGGACACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCCGCTTTCGC CCTCTCTATGGGCAGTCGGTGATXXXXXX-3’

The fourth single-stranded sequence (SEQ ID NO. 8):

5’-XXXXXXATCACCGACTGCCCATAGAGAGGGCGAAAGCGGAGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATG GTCCTCGCTCTTTG-3’.

In view of the problem of sequence listing generation, SEQ ID NO.1-8 in the sequence listing does not contain "XXXXXX".

The present invention also provides a composition, characterized in that the composition comprises the above-mentioned high-throughput sequencing linker or linker set.

The present invention also provides a complex, which is characterized in that the complex is connected to the above-mentioned high-throughput sequencing adapter or adapter set.

The present invention also provides a kit, characterized in that the composition comprises the above-mentioned high-throughput sequencing adapter or adapter set.

In some embodiments, the kit is a high-throughput sequencing library building kit or a gene sequence enrichment kit.

The present invention also provides a method for preparing the above-mentioned high-throughput sequencing adapter, which is characterized in that it comprises the following steps:

S1 synthesizes the first strand and the second strand single-stranded sequence respectively;

S2 specifically anneals the two single-stranded sequences of S1 to obtain the high-throughput sequencing adapter.

The present invention also provides a method for constructing a sequencing library, which is characterized in that:

S1 prepares the target fragment of the sample to be tested;

S2 connects the aforementioned high-throughput sequencing adapter or adapter set to the target fragment of S1 to obtain a ligation product;

S3 amplifies the S1 ligation product, and obtains the sequencing library of the sample to be tested after purification.

The present invention also provides a method for detecting low-frequency gene mutations, and is characterized in that it comprises the following steps:

S1 prepares the above-mentioned high-throughput sequencing adapters or adapter sets, for the same sample, the tag sequences are the same;

S2 performs target fragment amplification on the sample to be tested and digests the primers;

S3 connects the digested product of S2 to the mid-to-high-throughput sequencing adapter or adapter set of S1 to obtain a ligation product, amplify the ligation product, and obtain a sequencing library after purification;

S4 sequence the sequencing library of S3, correct the sequencing data according to the tag sequence of the high-throughput sequencing adapter, and perform mutation analysis based on the corrected sequencing data.

In some embodiments, the mutation analysis in step S4 is: based on the fact that a specific mutation appears in both the sense strand and the antisense strand of the same read, it is determined as a true low-frequency mutation.

In some preferred embodiments, the sample to be tested is genomic DNA.

The present invention also provides the following applications of the above-mentioned high-throughput sequencing adapter, adapter set, composition, complex or kit:

a. Application in the construction of sequencing libraries or in the preparation of sequencing library products;

b. Application in high-throughput sequencing or in the preparation of high-throughput sequencing products;

c. Application in gene low-frequency mutation detection or in the preparation of gene low-frequency mutation detection products;

d. Application in in vitro diagnostics or in the preparation of in vitro diagnostic products;

e. In the application of target gene or amplification enrichment.

The beneficial technical effects of the present invention:

1) Using the universal high-throughput sequencing adapter of the present invention or its kit to construct a library can be performed on the mainstream sequencing platform Ion Torrent and all types of Illumina sequencing platforms to generate sequencing data. The library construction kit and method are not restricted by the existing sequencing platform. Meet the increasingly diverse clinical needs. For a specific detection requirement, it is only necessary to develop a library building kit to generate sequencing data on all types of Ion Torrent and Illumina sequencing platforms, which also saves the development cost and cycle of application companies.

2) The universal high-throughput sequencing adapter provided by the present invention includes paired double-stranded complementary regions and unpaired single-stranded free arms. The distal end of the paired double-stranded part contains the tag sequence, and the non-free ends of the two free arms contain the tag sequence. The base composition of the tag sequence carried by the same sample is consistent. According to the consistency of the tag sequence, it can be judged whether there is cross-contamination during the library construction process. After using some models of the Illumina sequencing platform for sequencing, the analysis of sequencing data can determine whether there is index hopping based on whether the base composition of the tag sequence of the same read is consistent.

3) The universal high-throughput sequencing adapter provided by the present invention includes paired double-stranded complementary regions and unpaired single-stranded free arms. The distal end of the paired double-stranded part contains a tag sequence, and the base composition of the tag sequence should be the same for the sense strand and antisense strand of the same read. A specific mutation must be in the sense strand of the same read, and the antisense strand can be judged as a true mutation. If a certain read only has mutations in the sense strand or the antisense strand, it can be judged as an error in the library construction or sequencing process, and the mutation cannot be included in the subsequent analysis process to avoid false positives.

4) The tag sequence contained in the universal high-throughput sequencing adapter provided by the present invention only uses a segment of tag sequence, and must exist in both the sense strand and the antisense strand through specific mutations; the base composition of the tag sequence of the sample should be in the read segment The base composition of the tag sequence is the same. When the tag sequence of a sample is not the same as the tag sequence in the read segment, it can indicate that the read segment does not belong to this sample, that is, a tag skip situation has occurred. The design of the present invention can effectively overcome the inherent label jumping problem of the sequencing part of the platform, and can realize the authenticity interpretation of low-frequency mutations.

5) The universal high-throughput sequencing adapter provided by the present invention includes paired double-stranded complementary regions and unpaired single-stranded free arms. Exemplarily, the universal high-throughput sequencing adapter includes a PN adapter and an AN adapter; the PN adapter double-strand complementary region consists of 40 to 58 bases; the AN adapter double-strand complementary region consists of 40 to 58 bases; the PN adapter or The 5'free arm of the AN linker is composed of 30 to 45 bases; the 3'free arm of the PN linker or the AN adaptor is composed of 35 to 56 bases; the tag sequence is composed of 6 to 12 bases, so as to achieve at least 114048 bases. Universal high-throughput sequencing adapter.

Description of the drawings

In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings that need to be used in the specific embodiments or the description of the prior art. Obviously, the appendix in the following description The drawings are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative work.

Figure 1. Schematic diagram of the structure of the universal high-throughput sequencing adapter shown in Example 1;

Figure 2. The quality control map of the universal high-throughput library 2100 in Example 2, including the quality control map of the universal high-throughput sequencing adapter library 2100 (sample R19054232);

Figure 3. The quality control map of the universal high-throughput library 2100 in Example 2, including the quality control map of the universal high-throughput sequencing adapter library 2100 (sample R20005128);

Figure 4. Technical circuit diagram in embodiment 4.

Detailed ways

The technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative work shall fall within the protection scope of the present invention.

The following terms or definitions are only provided to help understand the present invention. These definitions should not be construed as having a scope less than that understood by those skilled in the art.

Unless otherwise defined below, the meanings of all technical and scientific terms used in the specific embodiments of the present invention are intended to be the same as those commonly understood by those skilled in the art. Although it is believed that the following terms are well understood by those skilled in the art, the following definitions are still set forth to better explain the present invention.

As used in the present invention, the terms "including", "including", "having", "containing" or "involving" are inclusive or open-ended, and do not exclude other unlisted elements or method steps . The term "consisting of" is considered a preferred embodiment of the term "comprising". If in the following a certain group is defined as comprising at least a certain number of embodiments, this should also be understood as revealing a group preferably consisting of only these embodiments.

The indefinite or definite article used when referring to a noun in the singular form such as "a" or "an", "the" includes the plural form of the noun.

The terms "approximately" and "generally" in the present invention represent the accuracy range that can be understood by those skilled in the art and can still guarantee the technical effect of discussing the feature. The term usually indicates a deviation of ±10% from the indicated value, preferably ±5%.

In addition, the terms first, second, third, (a), (b), (c) and the like in the specification and claims are used to distinguish similar elements, and are not necessary for the order of description or time. It should be understood that the terms so applied are interchangeable under appropriate circumstances, and the embodiments described in the present invention can be implemented in other orders than described or exemplified in the present invention.

The term "nucleic acid" or "nucleic acid sequence" in the present invention refers to any molecule comprising ribonucleic acid, deoxyribonucleic acid or its analogue unit, preferably a polymeric molecule. The nucleic acid can be single-stranded or double-stranded. The single-stranded nucleic acid may be a nucleic acid of one strand of denatured double-stranded DNA. Alternatively, the single-stranded nucleic acid may be a single-stranded nucleic acid that is not derived from any double-stranded DNA.

The term "complementary" as used herein refers to the hydrogen bond base pairing between the nucleotide bases G, A, T, C, and U, so that when two given polynucleotides or polynucleotide sequences anneal to each other At this time, A paired with T, G paired with C in DNA, G paired with C, and A paired with U in RNA.

Other terms are defined in the description of various aspects of the invention.

The "sequencing adapter" in the present invention refers to a double-stranded nucleotide sequence connected to the two ends of the target fragment to be sequenced. The double-stranded oligonucleotide sequence can be double-stranded completely complementary or partially double-stranded. Complementarity, such as a "Y-type" linker formed because the terminal partial sequence is not complementary. The sequencing linker of the present invention is preferably such a "Y-type" linker. In addition, the composition of the nucleotide sequence of the sequencing adapter is related to the applicable sequencing platform. For example, the composition can include library amplification primer sequence, sample tag sequence, sequencing primer sequence, etc.; and the sequence length of the sequencing adapter is also related to the sequencing platform. It can be selected in the art. For example, in some embodiments of the present invention, the length of the linker can be specifically: 3'free arm sequence is 35-56 bp, 5'free arm sequence is 30-45 bp, double-stranded complementary region sequence The length is 40～58bp.

Exemplarily, Fig. 1 is a preferred universal high-throughput sequencing "Y-type" linker of the present invention, which includes a PN linker and an AN linker, which can be respectively located at either end of the target sequence. Both the PN linker and the AN linker comprise a double-stranded complementary region, a single-stranded 5'free arm and a single-stranded 3'free arm. In some embodiments, the PN linker of the universal high-throughput sequencing linker and the double-stranded complementary region of the AN linker both include a tag sequence, and the tag sequence is composed of 6 to 12 bases. In some preferred embodiments, the non-free end of the AN adaptor single-stranded 3'free arm of the high-throughput sequencing adaptor also contains the same base composition as the tag sequence, and the PN adaptor of the above-mentioned universal high-throughput sequencing adaptor is single-stranded The non-free end of the 3'free arm contains the same base composition as the tag sequence. In some embodiments, in order to enhance the stability of the linker and prevent hydrolysis, the 3'end of the 3'-free arm of the universal high-throughput sequencing linker AN linker and PN linker is thio modified; preferably, the last 3 bases The phosphodiester bond between is replaced by phosphorothioate. Exemplarily, the double-stranded complementary ends of the universal high-throughput sequencing linker AN linker and PN linker can be connected to the original gene fragment through a ligation reaction by a ligase. The 5'free arm of the AN adaptor and the 3'free arm of the PN adaptor are non-complementary paired single strands and cannot be connected to the original gene fragments, thereby ensuring the efficiency of connecting the universal high-throughput sequencing adaptor to the DNA fragments.

The "PN linker" and "AN linker" mentioned in the specification of the present invention respectively refer to a partial double-stranded structural fragment (Y-type structure) containing a double-stranded complementary region and a single-stranded 3'/5' free arm, which is in the library When constructing, they are connected to one end of the target sequence respectively, and the nucleotide sequences of the two are preferably different.

The "free arm" in the present invention refers to the region where the bases in the linker sequence are not complementary paired, such as the unpaired region of the PN linker or AN linker of the present invention. Therefore, even if it is not clear that the sequence between the free arms is not complementary, this The field should also understand that the two sequences are not complementary and can form a Y-shaped structure in some cases. In addition, in some embodiments, the free arm of the present invention includes a library amplification primer region; in other embodiments, the 3'free arm of the present invention also includes a tag sequence.

The "double-stranded complementary region" in the present invention refers to the double-stranded complementary region contained in the sequencing adapter. This region usually contains sequencing primer sequences. The double-stranded complementary region of the present invention contains at least two sequencing platforms for sequencing. Primer sequence.

The "tag sequence" in the present invention refers to a nucleotide sequence with a base length of 6 to 12 bp, which is used to identify different library samples.

The "non-free end" in the present invention refers to the end where the double-stranded complementary region of the PN linker or the AN linker is connected to the 3'or 5'free arm of the single strand.

The "free end" in the present invention refers to the 3'end of the single-stranded 3'free arm or the 5'end of the single-stranded 5'free arm of the PN linker or the AN linker.

The "high-throughput sequencing platform" in the present invention refers to sequencing platforms such as Ion Torrent, Illumina, Roche454, and ABI. Although the sequencing platforms are preferably Ion Torrent and Illumina in the present invention, they are not limited. It is clear in the art that, based on the inventive concept of the present invention, primer sequences can be selected for any two or more platforms, and they can be constructed in the linker sequence to prepare the compatible high-throughput sequencing linker of the present invention. In addition, for sequencers under different sequencing platforms, considering that the sequencing principles of sequencers under the same type of sequencing platform are basically the same, the method of the present invention is applicable to all models under the same platform, for example, in the Ion Torrent sequencing platform. All models, including but not limited to Ion GeneStudio ^TM S5 Plus, PGM, Proton, etc.; all models in the Illumina sequencing platform, including but not limited to Miseq DX, MiniSeq, NextSeq, etc., are suitable for the present invention.

The "low-frequency mutation" in the present invention refers to mutations where the frequency of gene mutation is less than 5%, including less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, etc. Various mutations.

The present invention is further described by the accompanying drawings and the following examples. The accompanying drawings and examples are only to illustrate specific embodiments of the present invention and should not be construed as limiting the scope of the present invention in any way. Unless otherwise specified, the experimental methods disclosed in the present invention all adopt conventional techniques in this technical field. The universal high-throughput sequencing adapter is completed by Shenggong Bioengineering (Shanghai) Co., Ltd., and the reagents and raw materials used in the examples can be obtained from the market. Purchased.

Example 1 Design and preparation of high-throughput sequencing adapters

According to the structure shown in Figure 1, two sets of universal high-throughput sequencing adapters AN1/PN1 and AN2/PN2 were designed. Among them, AN1/PN1 is a set of universal high-throughput sequencing adapters with shorter sequences, and AN2/PN2 is another set of universal high-throughput sequencing adapters with longer sequences.

The specific preparation method is as follows:

Prepare the sequencing linker shown in the following sequence 1-4, annealing sequence 1 and 2 to form AN1 linker, and annealing sequence 3 and 4 to form AN2 linker.

Sequence 1:

5’-XXXXXXTAGCTGAGTCGGAGACACGCAGGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTA*T*G-3’; (3’ free arm chain)

Sequence 2:

5’-ACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCCTGCGTGTCTCCGACTCAGCTAXXXXXX-3’; (5’ free arm chain)

Sequence 3:

5’-XXXXXXTAGCTGAGTCGGAGACACGCAGGTGGATGGAGAATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATGGTCCTCGCTCTT*T*G-3’; (3’ free arm chain)

Sequence 4:

5’-CAAAGAGCGAGGACACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATTCTCCATCCA CCTGCGTGTCTCCGACTCAGCTAXXXXXX-3’; (5’ free arm chain)

Prepare the sequencing linker shown in the following sequence 5-8, annealing sequence 5 and 6 to form PN1, and sequence 7 and 8 to form PN2 linker.

Sequence 5:

5’-ACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCCTCTCTATGGGCAGTCGGTGATXXXXXX-3’

Sequence 6:

5’-XXXXXXATCACCGACTGCCCATAGAGAGGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTA*T*G-3’

Sequence 7:

5’-CAAAGAGCGAGGACACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCCGCTTTCGC CCTCTCTATGGGCAGTCGGTGATXXXXXX-3’

Sequence 8:

5’-XXXXXXATCACCGACTGCCCATAGAGAGGGCGAAAGCGGAGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATG GTCCTCGCTCTT*T*G-3’

Among them, the end of the double-strand complementary region of the AN linker contains a tag sequence, where the tag sequence is 6-12 random bases "X". The 3'free arm of the AN linker also contains a tag sequence of 6-12 random bases "X", and is connected to the non-free end of the 3'free arm of the AN linker. The end of the double-stranded complementary region of the PN linker contains a tag sequence, where the tag sequence is 6-12 random bases "X". The 3'free arm of the PN linker also contains a tag sequence of 6-12 random bases "X", and is connected to the non-free end of the 3'free arm of the PN linker. *Represents the thio modification site. Specifically, to enhance the stability of the linker and prevent hydrolysis, the universal high-throughput sequencing linker AN linker and the phosphodiester between the last 3 bases of the 3'end of the 3'free arm of the PN linker The bond is replaced by phosphorothioate.

Example 2 Preparation of a universal high-throughput sequencing library of aortic-related genes

The universal high-throughput sequencing adapters AN1/PN1 and AN2/PN2 prepared in Example 1 were used in the experiment, respectively.

Among them, the number of universal high-throughput sequencing adapters corresponds to the number of samples to be tested. For example, if the number of samples to be tested is 10, 10 sets of universal high-throughput sequencing adapter sets are prepared correspondingly, and each set of universal high-throughput sequencing adapter sets includes PN1 adapters and AN1 adapters. The base sequence composition of the tag sequence in the same group of PN1 adaptors and AN1 adaptors is the same, and the base sequence composition of the tag sequence in different adaptor groups is different.

Connect the target fragment to be tested with the above-mentioned sequencing adapter set to obtain a ligation product; wherein the gene fragments from the same sample source are connected to the same set of the universal high-throughput sequencing adapter set; the ligation product is amplified to obtain an amplified product, which is purified Then, a universal high-throughput sequencing library of the sample to be tested is obtained.

Specific steps are as follows:

1. DNA extraction and quality inspection

(1) Sample genomic DNA extraction: Take peripheral blood samples 1 and 2 (corresponding to R190542432 and R20005128 respectively) for genomic DNA extraction. The sample DNA was extracted in accordance with the operating instructions of the nucleic acid extraction reagent (DR181003-48) produced by Beijing Anzhiyin Biotechnology Co., Ltd.

(2) Use NanodropOne for DNA purity measurement, and Qubit 4.0 for double-stranded DNA concentration measurement. Dilute the DNA to 5ng/ul for use.

2. Library construction

The target regions to be examined are the entire coding region and the variable splicing region of the ACTA2, COL3A1, FBN1, MYH11, MYLK, SMAD3, TGFBR1, and TGFBR2 genes (20bp from exons to introns). The multiple PCR primer pool of the target detection area is based on the design of Ion Ampliseq Designer, synthesized and provided by Thermo Fisher.

(1) Target fragment amplification, the specific implementation is as follows:

Component	Reaction volume
Multiplex PCR master mix	2uL
Primer pool 1/2	5uL
Genomic DNA (5ng/uL)	2uL
Nuclease-free water	1uL
total capacity	10uL

Reaction conditions

(2) Digestion reaction, the specific implementation is as follows:

Mix the amplified products from primer pool 1 and primer pool 2 of the same sample to a volume of 20uL, and add 2uL digestion reaction premix. The reaction conditions are as follows:

temperature reflex		Reaction time
50℃	10min
55°C	10min
60℃	20min
10℃	Keep

(3) Use ligase to connect samples 1 and 2 to the universal high-throughput sequencing adapters AN1/PN1 and AN2/PN2, respectively. The ligase is Fast T4 DNA Ligase produced by Shanghai Yisheng Biotechnology Co., Ltd., and the ligation buffer is Shanghai Yi 5×Fast Ligation Buffer produced by Sheng Biotechnology Co., Ltd. The specific implementation is as follows:

Configure and connect the reaction solution according to the following table:

Component	Reaction volume
Ligase	2uL
Connection buffer	4uL
Universal high-throughput sequencing adapter PN adapter (10uM)	1uL
Universal high-throughput sequencing adapter AN adapter (10uM)	1uL
PCR product after digestion	22uL
total capacity	30uL

Reaction conditions

temperature reflex	Reaction time
22°C	30min
68°C	5min

72°C	5min
10℃	Keep

(4) Purification and amplification, the specific implementation is as follows:

Use Ampure magnetic beads to purify the ligated product, and perform PCR amplification on the purified product.

reaction system

Component	Reaction volume
PCR MIX	25uL
Upstream primer (5uM)	5uL
Downstream primer (5uM)	5uL
Ligation product after purification	20uL
total capacity	50uL

Reaction conditions

(5) Library purification and quantification, the specific implementation is as follows:

Use Ampure magnetic beads to purify the amplified library. After the purified library, use Agilent 2100 and QUBIT 4.0 for quality inspection and quantification of the library. The library 2100 quality inspection map is shown in Figure 2 and Figure 3, showing that the main peak of the library length fragment is around 400bp and the main peak of the library is a single sharp single peak. The result shows that the two ends of the original gene fragments have been connected to a universal high-throughput sequencing adapter. The library concentration is calculated according to the dilution factor. The library concentration higher than 1ng/uL can be used for subsequent experimental steps, and the library construction fails when the library concentration is lower than 1ng/uL.

Example 3 Sequencing analysis based on the Ion Torrent platform and the Illumina platform

In this embodiment, the Ion Torrent platform and the Illumina platform are used to perform sequencing verification on the above-mentioned high-throughput library, as follows:

1. The Ion GeneStudio ^TM S5 Plus sequencer on the Ion Torrent platform is sequenced on the computer. The specific implementation steps are as follows:

Dilute the library after purification and quality inspection, use Ion 520 ^TM & Ion 530 ^TM Kit–OT, and proceed according to the kit operating procedures. After template preparation on the IonTouch 2 instrument, the Ion GeneStudio ^TM S5 Plus gene sequencer is used for sequencing and data analysis.

2. The Miseq DX sequencer on the Illumina platform is used for online sequencing. The specific implementation steps are as follows:

After the above-mentioned purification and quality inspection, the library was diluted, and Miseq DX Reagent Kit v3 was used to proceed in accordance with the kit operating procedures. Sequencing and data analysis were performed on the Miseq DX gene sequencer.

The results of sequencing data are analyzed as follows, and the details are as follows:

For Ion GeneStudio ^TM S5 Plus platform:

1. Analyze the concentration of the general high-throughput sequencing library, and the fragment length distribution concentration of the library meets the subsequent requirements of sequencing;

2. Analyze the offline results of the Ion GeneStudio ^TM S5 Plus platform, which mainly include base number ≥Q20, number of reads, average read length, On Target, and Uniformity. See the table below for details:

3. The average read length of the above two samples is ≥200bp, indicating that all samples in the sample are read through, that is, the bases between the beginning and the end of the target fragment to be tested can be identified; Mean depth (average sequencing depth) is ≥500×, indicating that the test is to be tested The target fragments have been sequenced more than 500 times; On Target (target rate) are ≥95%, indicating that 95% of the measured base sequences can be compared to the target area to be tested; Uniformity (uniformity) is ≥90 %, indicating that the amplification efficiency of each read in the target area to be tested and the efficiency of connecting the universal high-throughput adapter are similar. The above parameters all indicate that the two ends of the target segment to be tested are successfully connected to the universal high-throughput sequencing adapter, and the sequencing is successful; it indicates that the library connected to the universal high-throughput sequencing adapter can be sequenced on the Ion GeneStudio ^TM S5 Plus gene sequencer.

For Miseq DX platform:

1. Analyze the results of Miseq DX platform decommissioning, mainly including data output, the number of Reads, and the percentage of Q30. See the table below.

2. The data output of the above two samples are both ≥0.5G, the Reads data are both ≥3M, and the proportion of Q30 is ≥75%, indicating that the two samples are successfully sequenced; indicating that the two samples are successfully connected to the universal high-throughput sequencing adapter at both ends of the target segment to be tested. And the library connected to the universal high-throughput sequencing adapter can be sequenced on the Miseq DX gene sequencer.

In summary, the use of the sequencing adapters prepared by the present invention to build a library can meet the sequencing requirements of the Ion GeneStudio ^TM S5 Plus platform and the Miseq DX platform at the same time, that is, meet the requirements of the two mainstream sequencing platforms of the Ion Torrent platform and the Illumina platform at the same time. The sequencing adapter of the present invention has the properties of a universal library-building adapter.

In addition, since all models in the Ion Torrent sequencing platform have the same sequencing principles and processes, ^{the library applicable to the Ion GeneStudio TM} S5Plus sequencer can be applied to other Ion Torrent platform sequencers, such as PGM, Proton, etc. In the same way, all models in the Illumina sequencing platform have the same sequencing principles and processes, and the library applicable to the Miseq DX gene sequencer can be applied to other types of sequencers on the Illumina platform, such as MiniSeq, NextSeq, etc. Therefore, it can be clarified that the library connected with the universal sequencing adapter of the present invention can be applied to all types of sequencers on the Ion Torrent platform and the Illumina platform.

Example 4 Judgment of the authenticity of low-frequency mutations

This embodiment further verifies the application of the sequencing adapter of the present invention in low-frequency detection, and specifically provides a detection method for judging the authenticity of low-frequency mutations, which can correct sequencing errors introduced by index hopping. The technical circuit diagram is shown in Figure 4, which specifically includes the following steps:

1. Sample dilution

(1) The sample is a commercial tumor SNV 5% gDNA standard (GW-OGTM005), which is serially diluted with commercial human genomic DNA (G304A) to a mutation frequency of 2.5%, 1.25%, and 0.5%, named as sample 1, sample 2. Sample 3, Sample 4.

(2) Use Qubit 4.0 to measure the concentration of double-stranded DNA. Dilute the DNA to 5ng/ul for use.

2. Library construction

The target area to be inspected is the designated hot spot area of EGFR(L858R/T790M/△E746_△A750)/PIK3CA(E545K)/KRAS(G12D/G13D/A146T)/NRAS(Q61K) gene. The multiple PCR primer pool of the target detection area uses Thermo Fisher's Ampliseq colon&lung panel. 3 replicates for each sample.

(1) Target fragment amplification, the specific implementation is as follows:

Component	Reaction volume
Multiplex PCR master mix	4uL
Primer pool	10uL
Genomic DNA (5ng/uL)	2uL
Nuclease-free water	4uL
total capacity	20uL

Reaction conditions

(2) Digestion reaction, the specific implementation is as follows:

Add 2uL of the digestion reaction premix to the above PCR product, and the reaction conditions are as follows:

temperature reflex		Reaction time
50℃	10min
55°C	10min
60℃	20min
10℃	Keep

(3) Connect the universal high-throughput sequencing adapter:

I. Preparation of universal high-throughput sequencing adapter set: The high-throughput sequencing adapter set adopts the PN1/AN1 and PN2/AN2 described in Example 1. Taking the PN2/AN2 test data as an example, 4 sets of adapter sets are prepared as follows: The sample sequence tags are ATCACG; CGATGT; TTAGGC; TGACCA. For specific preparation methods, refer to Example 1.

II. Connect the universal high-throughput sequencing adapter, the specific implementation is as follows:

reaction system

Component	Reaction volume
Ligase	2uL
Connection buffer	4uL
Universal high-throughput sequencing adapter P adapter (10uM)	1uL
Universal high-throughput sequencing adapter A adapter (10uM)	1uL
PCR product after digestion	22uL
total capacity	30uL

Reaction conditions

temperature reflex	Reaction time
22°C	30min
68°C	5min
72°C	5min
10℃	Keep

(4) Purification and amplification, the specific implementation is as follows:

Use Ampure magnetic beads to purify the ligated product, and perform PCR amplification on the purified product.

reaction system

Component	Reaction volume
PCR MIX	25uL
Upstream primer (5uM)	5uL
Downstream primer (5uM)	5uL
Ligation product after purification	20uL
total capacity	50uL

Reaction conditions

(5) Library purification and quantification, the specific implementation is as follows:

The amplified library was purified using Ampure magnetic beads, and the purified library was quantified using QUBIT 4.0.

The library concentration is calculated according to the dilution factor. The library concentration higher than 1ng/uL can be used for subsequent experimental steps, and the library construction fails when the library concentration is lower than 1ng/uL.

3. The Miseq DX sequencer on the Illumina platform for online sequencing, the specific implementation steps are as follows:

After the above-mentioned purification and quality inspection, the library was diluted, and Miseq DX Reagent Kit v3 was used to proceed in accordance with the kit operating procedures. Sequencing and data analysis were performed on the Miseq DX gene sequencer.

4. Sequencing data analysis mainly includes the following contents:

(1) Use tag sequences to identify data from the same sample source, and identify sequencing numbers with the same tag sequence as data from the same sample source;

(2) For the above-mentioned sequencing data classified into the same sample source, further use the sequencing tag sequence and the universal high-throughput sequencing adapter AN adapter double-stranded end tag sequence base sequence to form a consistent identification of sample cross-contamination and tag hopping (index hopping) introduction The sequencing error.

(3) For the above-mentioned sequencing data classified into the same sample source, further use the sense strand of the mutation site, and the antisense strand should contain the tag sequence composed of the same base, that is, the AN end and the PN end should contain the tag sequence composed of the same base .

The specific results are shown in the table below:

Sample 1 (expected mutation frequency 5%)

Gene	Mutation site	Mutation frequency	Number of forward reads	Number of negative reads
EGFR		L858R	5%	198	201
EFGR	T790M	5.5%	213	187

EGFR	ΔE746_A750	4.7%	217	168
PIK3CA	E545K	6.8%	204	196
KRAS	G12D	5.3%	199	200
KRAS	G13D	4.5%	184	216
KRAS	A146T	7%	214	186
NRAS	Q61K	4.3%	204	193

Sample 2 (Expected mutation frequency 2.5%)

Gene	Mutation site	Mutation frequency	Number of forward reads	Number of negative reads
EGFR	L858R	2.8%	207	191
EFGR	T790M	1.3%	212	187
EGFR	ΔE746_A750	2.1%	244	139
PIK3CA	E545K	3.8%	177	223
KRAS	G12D	2.5%	188	212
KRAS	G13D	2.2%	197	203
KRAS	A146T	4%	211	189
NRAS	Q61K	1.3%	199	197

Sample 3 (expected mutation frequency 1.25%)

Gene	Mutation site	Mutation frequency	Number of forward reads	Number of negative reads
EGFR	L858R	1.5%	216	180
EFGR	T790M	2.5%	245	152
EGFR	ΔE746_A750	1%	249	143
PIK3CA	E545K	2%	225	175
KRAS	G12D	1.3%	199	199

KRAS	G13D	1.8%	192	208
KRAS	A146T	1%	203	197
NRAS	Q61K	1.8%	194	204

Sample 4 (Expected mutation frequency 0.5%)

Gene	Mutation site	Mutation frequency	Number of forward reads	Number of negative reads
EGFR	L858R	1.5%	216	181
EFGR	T790M	0.5%	245	155
EGFR	ΔE746_A750	0.3%	227	154
PIK3CA	E545K	1%	218	182
KRAS	G12D	0.5%	182	218
KRAS	G13D	1.5%	200	200
KRAS	A146T	0.8%	205	195
NRAS	Q61K	0.5%	217	182

In the library construction process, a universal high-throughput sequencing adapter is used. After the sequencing is completed, the obtained sequencing data is analyzed. First, the tag sequence is used to identify the source data of the same sample, and the sample is divided into four mutation frequencies of sample 1, sample 2, sample 3, and sample 4. Then identify whether the double-stranded partial tag sequence of the read linker is the same as the sample tag sequence, and eliminate the index hopping problem. Then, the authenticity of the mutation site is further recognized by whether the positive read and negative read with the same tag sequence have the same mutation site. However, mutations in which only positive or negative reads exist, or mutations in which the tag sequence in the read is inconsistent with the sample tag are excluded, so as to realize the correct identification of low-frequency mutations.

5. The results show that by using the universal high-throughput sequencing adapter of the present invention for library building sequencing, low-frequency mutations with a frequency of less than 5% can be effectively detected, and low-frequency mutations with a mutation frequency of 0.5% can also be effectively detected, further reducing The detection limit of low-frequency mutations is improved.

The above description of the specific embodiments of the application does not limit the application, and those skilled in the art can make various changes or modifications according to the application, as long as they do not deviate from the spirit of the application, they shall fall within the scope of the appended claims of the application.

Claims (24)

1. A Y-type high-throughput sequencing adapter, characterized in that the sequencing adapter includes a first single strand and a second single strand;

   The first single strand and the second single strand respectively include:

   1) Free arm,

   2) Double-stranded complementary region, where,

   The free arm includes a library amplification primer binding region and a carrier binding region;

   The double-stranded complementary region contains two or more sequencing primer binding regions of the sequencing platform.
2. The high-throughput sequencing adapter of claim 1, wherein the free arm sequences of the first single strand and the second single strand are not complementary, and the first single strand and the second single strand can be annealed to form Y Double-stranded structure.
3. The high-throughput sequencing adapter according to any one of claims 1-2, wherein the double-stranded complementary region contains a tag sequence, and the tag sequence is located at the end of the double-stranded complementary region away from the free arm.
4. The high-throughput sequencing adapter according to any one of claims 1 to 3, wherein the sequencing platform includes but not limited to Illumina, Ion Torrent, PacBio, Roche, Helicos, and ABI platforms; preferably, the sequencing platform is Ion Torrent and Illumina platforms.
5. The high-throughput sequencing adapter of any one of claims 1 to 4, wherein the second single-stranded free arm further contains a tag sequence.
6. The high-throughput sequencing adapter of claim 5, wherein the tag sequence in the free arm is the same as the tag sequence in the double-stranded complementary region; preferably, the tag sequence in the free arm is close to the end of the double-stranded complementary region. .
7. The high-throughput sequencing adapter according to any one of claims 1-6, wherein the length of the double-strand complementary region of the first single-strand and the second single-strand is 40-58 bp; the free arm of the first single-strand The length is 30-45bp, the length of the second single-stranded free arm is 35-56bp; the tag sequence is composed of random bases of 6-12bp.
8. The high-throughput sequencing adaptor according to any one of claims 1-7, wherein the 3'end of the free arm of the first or second single strand is modified for stability; preferably, thiomodified; more preferably Yes, the phosphodiester bond between the last 3 bases at the 3'end is replaced by phosphorothioate.
9. The high-throughput sequencing adapter of any one of claims 1-8, wherein the first single-stranded sequence is as follows:

   Free arm sequence:

   5’-NNNNNNNNNNNNNNNACCGAGATCTACACTCTTTCCCTACACGAC-3’;

   Double-stranded complementary region sequence:

   The "XXXXXX" represents a tag sequence composed of 6-12 random bases;

   3’

   The "N" represents any base of A, T, C, G, or NA (no base).
10. The high-throughput sequencing adapter of claim 9, wherein the second single-stranded sequence is as follows:

    Free arm sequence:

    5’-ACGTCTGAACTCCAGTCACXXXXXXATCTCGTATGNNNNNNNNNNNNNNN-3’;

    Double-stranded complementary region sequence:

    5’-XXXXXXTAGCTGAGTCGGAGACACGCAGGNNNNNNNNNNATCGGAAGAGC-3’;

    The "XXXXXX" represents a tag sequence composed of 6-12 random bases;

    The "N" represents any base of A, T, C, G, or NA (no base).
11. A high-throughput sequencing adapter set, characterized in that the sequencing adapter set comprises the high-throughput sequencing adapter according to any one of claims 1-10.
12. The high-throughput sequencing adapter set of claim 11, wherein the high-throughput sequencing adapter set further comprises the following Y-type high-throughput sequencing adapters:

    The Y-type high-throughput sequencing adapter comprises a third and a fourth single strand, and its sequence is only different from the sequence of the high-throughput sequencing adapter of claims 1-10 only in the sequence of the double-strand complementary region;

    Wherein, the sequence of the double-strand complementary region of the third single-strand is as follows:

    5’-GCTCTTCCGATNNNNNNNNNNNNCCTCTCTATGGGCAGTCGGTGATXXXXXX-3’;

    The sequence of the double-strand complementary region of the fourth single-stranded is complementary to the sequence of the third single-stranded double-strand complementary region;

    The "XXXXXX" represents a tag sequence composed of 6-12 random bases;

    The "N" represents any base of A, T, C, G, or NA (no base).
13. The high-throughput sequencing adapter set of claim 12, wherein the single-stranded sequences of the Y-type high-throughput sequencing adapter are as follows:

    The first single-stranded sequence:

    5’-ACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCCTGCGTGTCTCCGACTCAGCTAXXXXXX-3’;

    The second single-stranded sequence:

    5’-XXXXXXTAGCTGAGTCGGAGACACGCAGGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATG-3’;

    The third single-stranded sequence:

    5’-ACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCCTCTCTATGGGCAGTCGGTGATXXXXXX-3’

    Fourth single-stranded sequence:

    5’-XXXXXXATCACCGACTGCCCATAGAGAGGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATG-3’.
14. The high-throughput sequencing adapter set of claim 12, wherein the single-stranded sequences of the Y-type high-throughput sequencing adapter are as follows:

    The first single-stranded sequence:

    5’-CAAAGAGCGAGGACACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATTCTCCATCCA CCTGCGTGTCTCCGACTCAGCTAXXXXXX-3’;

    The second single-stranded sequence:

    5’-XXXXXXTAGCTGAGTCGGAGACACGCAGGTGGATGGAGAATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATGGTCCTCGCTCTTTG-3’;

    The third single-stranded sequence:

    5’-CAAAGAGCGAGGACACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCCGCTTTCGC CCTCTCTATGGGCAGTCGGTGATXXXXXX-3’

    Fourth single-stranded sequence:

    5’-XXXXXXATCACCGACTGCCCATAGAGAGGGCGAAAGCGGAGATCGGAAGAGCACGTCTGAACTCCAGTCACXXXXXXATCTCGTATG GTCCTCGCTCTTTG-3’.
15. A composition, characterized in that the composition comprises the high-throughput sequencing adapter according to any one of claims 1-10, or the high-throughput sequencing adapter set according to any one of claims 11-14.
16. A complex, characterized in that the complex is connected to the high-throughput sequencing adapter according to any one of claims 1-10, or the high-throughput sequencing adapter set according to any one of claims 11-14.
17. A kit, characterized in that the composition comprises the high-throughput sequencing adapter according to any one of claims 1-10, or the high-throughput sequencing adapter set according to any one of claims 11-14.
18. The kit of claim 17, wherein the kit is a high-throughput sequencing library building kit or a gene sequence enrichment kit.
19. The preparation method of the high-throughput sequencing adapter according to any one of claims 1-10, characterized in that it comprises the following steps:

    S1 synthesizes the first strand and the second strand single-stranded sequence respectively;

    S2 specifically anneals the two single-stranded sequences of S1 to obtain the high-throughput sequencing adapter.
20. A method for constructing a sequencing library, which is characterized in that:

    S1 prepares the target fragment of the sample to be tested;

    S2 connect the high-throughput sequencing adapter of any one of claims 1-10 or the high-throughput sequencing adapter set of any one of claims 11-14 to the target fragment of S1 to obtain a ligation product;

    S3 amplifies the S1 ligation product, and obtains the sequencing library of the sample to be tested after purification.
21. A method for detecting low-frequency gene mutations, and is characterized in that it comprises the following steps:

    S1 prepares the high-throughput sequencing adapter according to any one of claims 1-10 or the high-throughput sequencing adapter set according to any one of claims 11-14, and the tag sequence is the same for the same sample;

    S2 performs target fragment amplification on the sample to be tested and digests the primers;

    S3 connects the digested product of S2 to the mid-to-high-throughput sequencing adapter or adapter set of S1 to obtain a ligation product, amplify the ligation product, and obtain a sequencing library after purification;

    S4 sequence the sequencing library of S3, correct the sequencing data according to the tag sequence of the high-throughput sequencing adapter, and perform mutation analysis based on the corrected sequencing data.
22. The method for detecting low-frequency gene mutations according to claim 21, and is characterized in that the mutation analysis in step S4 is: based on the fact that a specific mutation appears in both the sense strand and the anti-sense strand of the same read, it is determined as true low frequency. mutation.
23. The method for detecting low-frequency gene mutations according to any one of claims 21-22, wherein the sample to be tested is genomic DNA.
24. The high-throughput sequencing adapter according to any one of claims 1-10, the high-throughput sequencing adapter set according to any one of claims 11-14, the composition according to claim 15, the complex according to claim 16 or claims The following applications of the kit described in 17-18:

    a. Application in the construction of sequencing libraries or in the preparation of sequencing library products;

    b. Application in high-throughput sequencing or in the preparation of high-throughput sequencing products;

    c. Application in gene low-frequency mutation detection or in the preparation of gene low-frequency mutation detection products;

    d. Application in in vitro diagnostics or in the preparation of in vitro diagnostic products;

    e. In the application of target gene or amplification enrichment.

Images