WO2021224475A1 - Traitement et diagnostic du cancer impliquant un arn linc - Google Patents

Traitement et diagnostic du cancer impliquant un arn linc Download PDF

Info

Publication number
WO2021224475A1
WO2021224475A1 PCT/EP2021/062196 EP2021062196W WO2021224475A1 WO 2021224475 A1 WO2021224475 A1 WO 2021224475A1 EP 2021062196 W EP2021062196 W EP 2021062196W WO 2021224475 A1 WO2021224475 A1 WO 2021224475A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
polynucleotide
sequence
cancer
rna
Prior art date
Application number
PCT/EP2021/062196
Other languages
English (en)
Inventor
Chandrasekhar KANDURI
Santhilal SUBHASH
Original Assignee
Xandrax Ab
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xandrax Ab filed Critical Xandrax Ab
Publication of WO2021224475A1 publication Critical patent/WO2021224475A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents

Definitions

  • This invention relates to long intervening non-coding RNA and their role in cancer treatment and diagnosis.
  • Protein-coding genes are small islands in the vast genetic information carefully replicated from generation to generation. Whereas protein coding genes have been the subject of intense research since the 1960s, non-coding DNA is only beginning to be understood. Non coding DNA may be transcribed into RNA just like protein coding DNA but forming non coding RNA instead of mRNA.
  • Non-coding RNA transcripts are long intervening non-coding RNA (lincRNA), which are located between two protein coding genes, which are non-coding transcripts with a length of more than 200 base pairs.
  • the transcription level of lincRNAs if often well below that of mRNA.
  • lincRNAs The role and properties of lincRNAs is only beginning to be elucidated. It is thought that lincRNAs may have a role in regulating expression of protein-coding genes.
  • a polynucleotide that is able to bind to and inhibit an RNA transcript that comprises a sequence segment of at least 30 nucleotides selected from SEQ ID NO 3 or one of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7 or SEQ ID NO 64, or a sequence that has at least 80% identity to those sequences.
  • the polynucleotide provides for a novel treatment of cancer.
  • the RNA transcript comprises a sequence segment of at least 30 nucleotides selected from SEQ ID NO 2.
  • the RNA transcript preferably comprises or consists of SEQ ID NO 2.
  • the RNA transcript comprises a sequence segment of at least 30 nucleotides selected from SEQ ID NO 3, or a sequence that has at least 80% identity to SEQ ID NO 3.
  • the RNA transcript preferably comprises or consists of SEQ ID NO 3, or a sequence that has at least 80% identity to SEQ ID NO 3.
  • nucleotide according to the first aspect of the invention for use in the treatment of a disease, in particular cancer.
  • a pharmaceutical composition comprising a polynucleotide according to the first aspect of the invention.
  • a method of treatment comprising administering to a patient a polynucleotide according to the first aspect of the invention to patient, preferably a cancer patient.
  • a polynucleotide that detects an RNA transcript selected from SEQ ID NO 3, SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7 and SEQ ID NO 64, or a sequence that has at least 80% identity to those sequences for use in diagnosis of a disease, in particular diagnosis of cancer.
  • a method for diagnosis, in particular diagnosis of cancer comprising detecting the amount of an RNA transcript comprising one of the sequences selected from SEQ ID NO 3, SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 4, SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO 7 and SEQ ID NO 64 or a sequence that has at least 80% identity to those sequences, in a sample from a patient.
  • Fig. 1 shows status of Sp-lincRNA transcripts in germ cells, preimplantation stage embryos, the human body map tissues, TCGA tumors compared with the corresponding healthy samples or TCGA tumors compared with GTEx health samples.
  • Z-score in the plots is derived from the normalized TPM expression values. The log fold change is calculated by comparing the expression of tumors with the health samples expression.
  • Fig. 2a and 2b shows relative expression of Sp-lincRNA transcripts LINC01518, AP001476.1 and P4HA3 in HeLa and HEK cell lines.
  • Fig. 3 shows percentage of relative expression levels of LINC01518, AP001476.1 and P4HA3 Sp- lincRNAs that are downregulated using two different siRNAs and control siRNAs in HeLa cells.
  • Fig. 4 shows results from an MTT assay showing the percentage of proliferative cells for HeLa cells transfected with siRNAs for LINC01518, AP001476.1 and P4HA3 Sp-lincRNAs compared to the respective control siRNA samples.
  • Fig. 5 shows a line graph showing the cell cycle profiles of HeLa cells transfected with Sp-lincRNA inhibiting siRNA and control siRNA.
  • Fig. 6 show bar graphs representing the percentage of Annexin V positive cells after 48 hrs and 72 hrs of HeLa cells transfected with siRNA inhibiting three different Sp-lincRNAs and control siRNA samples. For each gene, the p value is calculated using two different siRNA transfected samples. * indicates p value ⁇ 0.05, ** indicates p value ⁇ 0.01 and *** indicates p value ⁇ 0.001. Data from plots are represented as mean ⁇ SD.
  • Figs. 7-8 shows wound healing assay with HeLa cells and A549 cells where SEQ ID NO 3 and 4 is inhibited using siRNA.
  • SEQ ID NO 2 to SEQ ID 5" refers to SEQ ID NO 2, 3, 4, and 5.
  • Any sequence herein also comprises a substantially similar sequence, such a sequence preferably has at least 80%, more preferably 90%, more preferably 95%, more preferably 98% and most preferably 99% sequence similarity to the described sequences. Sequence similarity can be analysed using for example BLAST2 sequences, using standard settings. Hence sequences that are at least 80 % identical, more preferably 90%, more preferably 95%, more preferably 98% and most preferably 99% identical to any of SEQ ID NO 1-7 are also comprised herein. Such sequences preferably have substantially the same properties as the sequences described herein.
  • the substantially similar sequence may for example have the same biological function as of SEQ ID NO 1-SEQ ID NO 7.
  • the function of one of SEQ ID NO 1-7 may be to target a protein coding mRNA.
  • sequence variations may be for example polymorphisms in the human population in the sp- lincRNA sequences.
  • point mutations, leading to the replacement of one base with another, deletions or insertions are examples of such polymorphisms.
  • SEQ ID NO 1 to 7 also comprises sequences with 5, more preferably 4, more preferably 3, more preferably 2 and most preferably 1 base substitution or base deletions, or base insertions.
  • the sequence may have 2, more preferably 1, substitutions, insertions or deletions.
  • the polynucleotide described herein is able to bind to and inhibit one of the sp- lincRNAS (sperm-specific lincRNAs) described herein, shown in Table la below (SEQ ID NO 1- 7).
  • Table la also show examples of polynucleotides (siRNAs) that are able to bind and inhibit the sp-lincRNAs.
  • SEQ ID NO 1 to SEQ ID 7 are provided as DNA-type sequences in the sequence listing because they are typically cloned from DNA. However, being RNA molecules, they have Us instead of Ts.
  • SEQ ID NO 64 is a variant of SEQ ID NO 5.
  • SEQ ID NO 64 has additional 57 nucleotides in the 3' end, but is otherwise identical to SEQ ID NO 5. All embodiments relating to SEQ ID NO 5 also applies to SEQ ID NO 64.
  • SEQ ID NO 65 is exon 2 of SEQ ID NO 64 which contains the additional 57 nucleotides.
  • splice variants For some of the sp-lincRNAs, there is alternative splicing. For example, for LINC01518 there are at least two different splice variants. The splice variants share at least one sequence stretch (preferably an exon). By targeting such a shared sequence stretch (exon) more than one splice variant may be targeted for knockdown. Alternatively, splice form that only has a certain exon may be targeted, which may increase specificity.
  • the polynucleotide is able to bind and inhibit a RNA transcript which comprises a part of one of SEQ ID NO 1 to SEQ ID NO 7, which part preferably is at least a section of at least 16 consecutive nucleotides, more preferably at least 20 nucleotides, more preferably at least BO nucleotides, more preferably at least 50, even more preferably 100 and most preferably at least 200 nucleotides from SEQ ID NO 1 to SEQ ID NO 7.
  • the RNA transcript comprises or consists of one of SEQ ID NO 1 to SEQ ID NO 7.
  • the polynucleotide is able to bind to and inhibit an RNA transcript that comprises a target sequence for one of the siRNAs mentioned herein (SEQ ID NO 8- SEQ ID NO 47), in particular target sequences for the siRNAs with sequences SEQ ID NO 8 to 23, in particular SEQ ID NO 12 to 23.
  • the RNA transcript comprises one of the target sequences for the siRNA of SEQ ID NO 8 to SEQ ID NO 47.
  • the targets sequences are as follows:
  • an exon that comprise one of the shorter target sequences shown in Table lb is targeted.
  • Preferred targeted exons are as follows:
  • each of the exon sequences of Table lc (SEQ ID NO 54-63 and SEQ ID NO 65) are preferred target sequences and are separate embodiments of the invention. Hence in various embodiments one of the RNA transcripts comprising or consisting of the exon sequences of table lc is targeted.
  • RNA transcript being inhibited comprises or consist of one of SEQ ID NO 1 to SEQ ID NO 7, in particular SEQ ID NO 2 or SEQ ID NO S.
  • the polynucleotide may preferably be able to hybridize to a part of SEQ ID NO 1 to SEQ ID NO 7 or other target sequence as described herein.
  • the hybridizing part may preferably have a length of at least 18 nucleotides, more preferably at least 18, 19, 20, 21, 22, 23, and most preferably at least 24 consecutive nucleotides selected from one of SEQ ID NO 1 to SEQ ID NO 7 or the other preferred target sequences.
  • the sp-lincRNA transcripts may be inhibited using any suitable technology that renders a RNA transcript (the "target transcript") inactive.
  • the target transcript can be made inactive by for example causing its degradation or sequestering it, changing its subcellular location or making it unable to bind to other molecules, for example by blocking hybridization.
  • Such technologies are often referred to as “knockdown” technologies.
  • a knock-down technology is a technology that utilizes a polynucleotide that is at least partially complementary to the target transcript, and that renders the target transcript non-functional, for example by causing the breakdown of the target transcript or by sequestering the transcript. As the skilled person knows, there are many different useful knockdown technologies.
  • polynucleotide sequence which is at least partially complementary (able to base pair using Watson-Crick base pairing) to the target sequence.
  • the length of the polynucleotide is chosen dependant on the technology used (for example RNAi or antisense) but should at least have a length such that it is specific for the target transcript (given the size of the human genome and the fact that the genetic code contains four information "bits": C, G, A and T/U).
  • a length of at least 16 to 18 polynucleotides is enough to provide specificity and stable binding.
  • RNA interference pathway for example by using siRNA or shRNA.
  • the RNAi pathway involves the binding of short complementary RNA molecules to the target transcript, together with endogenous proteins that inhibits the target transcript by for example catalysing the breakdown of the target transcript.
  • Another preferred method is the recruitment of RNAse
  • the polynucleotide used herein can contain the bases cytosine (C), guanine (G), adenine (A) thymidine (T), or uracil (U).
  • C cytosine
  • G guanine
  • A adenine
  • T thymidine
  • U uracil
  • a polynucleotide may comprise modified nucleotides, such as, for example, locked nucleic acids.
  • a locked nucleic acid is a nucleic acid modified by adding a methylene bridge between the 2' oxygen and the 4' carbon (KurreckJ, et al Nucleic Acids Res. 2002 May l;30(9):1911-8).
  • the polynucleotide may also be conjugated to other types of molecules, for example antibodies or other proteins, lipids, carbohydrates, polymers or other types of molecules. Such conjugation may be used to enhance or enable for example detection, purification, stability, drug delivery, targeting or binding specificity or another desirable property of the polynucleotide.
  • a conjugate is a dynamic poly conjugate (DPC) which comprises a membrane-disrupting polymer. Conjugation can be done using covalent or non- covalent bonding. Examples of non-covalent conjugation systems include the biotin- streptavidin system.
  • the polynucleotide is preferably complementary to the target sequence and able to form a duplex with the target sequence.
  • the polynucleotide used in knockdown is able to at least partially hybridize with the target transcript.
  • the duplex may be formed under what the skilled person refers to as stringent conditions or may be in more physiologically relevant conditions.
  • a complementary polynucleotide may be completely complementary or partially complementary for example by comprising G:U wobble or having one or more nucleotides that is not involved in Watson-Crick base pairing with the target sequence. It is preferred that the polynucleotide contains at most 3 mismatching nucleotides.
  • the polynucleotide may have an overhang that does not hybridize with the target sequence.
  • the polynucleotide can be manufactured by organic synthesis methods known in the art.
  • the polynucleotides can be produced by using a vector, for example a plasmid as is known in the art.
  • the plasmid can be used to produce the polynucleotide in vitro, and the polynucleotide can then be purified from the culture.
  • Suitable hosts include E. coli, CHO cells, yeast, plant cells etc.
  • the polynucleotide can be produced in the subject, the target cell or target animal by introducing an expression vector into cells of the subject or animal as known in the art of gene therapy.
  • an expression vector is used is pLKO.l - TRC. This plasmid can be introduced into cells via direct transfection, or can be converted into lentiviral particles for subsequent transduction of a target cell line.
  • siRNA which depends on the above-mentioned RNAi pathway.
  • siRNA involves the administration of double stranded RNA (dsRNA) where one strand is complementary to the target transcript.
  • dsRNA double stranded RNA
  • the guide strand is incorporated into a protein complex called RISC.
  • RISC protein complex
  • the length of the siRNA duplex structure may be from 15 to SO base pairs, more preferably from 18 to 25, more preferably from 19 to 24 base pairs and most preferably from 19 to 21 base pairs.
  • the region of complementarity to the target transcript is preferably from 15 to 30 base pairs, more preferably from 18 to 25 more preferably from 19 to 24 base pairs and most preferably from 19 to 21 base pairs.
  • the duplex preferably has nucleotide overhangs at the 3'-ends.
  • the overhang is preferably from 1 to 4 nucleotides, preferably 2 nucleotides long.
  • the overhang nucleotide is preferably T most preferably TT (and not U or UU).
  • the overhangs may be deoxythymidine overhangs.
  • useful siRNA for activating the RNAi pathway.
  • useful rules include: 1) the guide strand of the siRNA duplex preferably binds to a sequence that begins with AA, 2) a C+G content of at most 30-50% is preferred, 3) stretches of > 4 T's or A's in the target sequence is to be avoided, 4) sequences that share homology with other parts of the human genome should be avoided. BLAST can be used to analyse this within seconds.
  • BLAST can be used to analyse this within seconds.
  • siRNA polynucleotides are listed in Table la where sense as well as antisense sequences of the duplex are listed and it is referred to the sequence listing for more information. In general, even SEQ ID Nos of SEQ ID NO 8-47 refer to sense strands and the following odd number refers to the corresponding antisense strand in the duplex.
  • suitable siRNAs duplexes for targeting LINC01518 are SEQ ID NO 8 in duplex with a suitable hybridization partner such as SEQ ID NO 9 and SEQ ID NO 10 in duplex with a suitable hybridization partner such as SEQ ID NO 11.
  • a suitable hybridization partner is a polynucleotide sequence that is capable of forming a stable duplex with its partner, by being at least partially complementary.
  • the sequences of SEQ ID NO 8-47 are preferably modified to have thymidine overhangs, which may be two thymidine bases.
  • the thymidine overhangs are preferably deoxythymidine overhangs.
  • shRNA short hairpin RNA
  • miRNA microRNA pathway
  • shRNA is formed by short stretches of RNA that folds back and at least partially base pairs with itself, thus forming a hairpin-like structure. The hairpin is cleaved once in the cell, resulting in a duplex molecule. One strand of the duplex molecule serves as the guide strand for the RISC complex.
  • shRNA can be obtained by transcription from DNA that is complementary to the desired shRNA molecule.
  • a useful vector is the abovementioned pLKO.l - TRC vector. Antisense oligonucleotides
  • RNAse H enzyme will degrade sp-linc RNA.
  • This pathway may be recruited by using, for example, so called gapmers.
  • Gapmers are DNA polynucleotides with short stretches of modified nucleic acids, for example locked nucleic acids (LNAs) at the ends. Gapmers with other types of modifications than LNA are discussed in Kasuya et al. Sci Rep. (2016) Jul 27;6:30377. Gapmers are useful because they increase the binding strength of the polynucleotide to the target sequence.
  • Gapmers have a central portion of unmodified nucleotides flanked by a number of modified nucleic acids, for example LNAs, on each side.
  • LNAs include in hybridization.
  • the number of unmodified nucleotides can be from 6 to 15, more preferably from 6 to 12, even more preferably from 7 to 10.
  • the number of LNAs on each side is preferably from 1 to 6 more preferably 2 to 4 and most preferably 3.
  • the number of central unmodified nucleotides is 10 and there are 3 LNAs on each side.
  • the gapmer may have a modified backbone to include phosphothioate, which enhances pharmacokinetics and pharmacodynamics of the nucleotide.
  • gapmers which are antisense molecules containing locked nucleic acids are described in Kurreck J, et al Nucleic Acids Res. 2002 May l;30(9):1911-8. Gapmers are available from Exiqon A/S.
  • a polynucleotide can be analysed for ability to bind to and inhibit the sp-lincRNA transcripts by methods known in the art within days.
  • a simple way to confirm binding of the polynucleotide to the target sequence is to allow the polynucleotide to bind to the target sequence in vitro.
  • One suitable method which is time and cost efficient is to test the candidate polynucleotide on cultured cells known to express a sp-lincRNA target transcript.
  • the expression of the target transcript can be analysed using any suitable method, including RT-qPCR, northern blot, in situ hybridization or hybridization microarrays.
  • a particularly suitable method is RT-qPCR.
  • the polynucleotide is administered to the cultured cells and expression of the target transcript is compared to non-treated or mock treated cells.
  • Administration to cultured cells can be carried with for example liposomes and/or electroporation as is known in the art.
  • One useful transfection reagent for this purpose is Lipofecatamine from ThermoFisher.
  • Suitably transient transfection is used.
  • a suitable time point for measuring inhibition is 48 hours post transfection.
  • the degree of inhibition can be measured as the decrease of the presence of one of the sp line RNA transcript.
  • the degree of inhibition is usually expressed in terms of the formula
  • Expression of the target transcript may inhibited by at least 20%, 30%, 40%, 50%, 60%, 70%, 85%, 90%, 95% or most preferably at least 99%.
  • Knockdown efficiency can also be measured by measuring a parameter that is affected by sp-linc RNA such as, for example, proliferation, senescence, migration, colony formation, cell cycle, apoptosis, or signalling trough FGFR2, FGFR3 PI3K/AKT or Ras/MAPK or protein expression.
  • a parameter that is affected by sp-linc RNA such as, for example, proliferation, senescence, migration, colony formation, cell cycle, apoptosis, or signalling trough FGFR2, FGFR3 PI3K/AKT or Ras/MAPK or protein expression.
  • the polynucleotides may be administered to animals and the effect can be measured as is known in the art.
  • the effect of tumour formation or tumour growth can be measured by using a mouse tumour model, for example a subcutaneous mouse tumour model.
  • tumour cell line is used in mice that allow the growth of such tumour cells.
  • the polynucleotides being tested can be administered and formulated as described herein and as is known to the person skilled in the art.
  • siRNA molecules can be administered to animals using liposomes with high efficiency (Eguchi et al, J Hepatol. 2016 Mar;64(3):699- 707).
  • the polynucleotides are preferably administered to the patient in the form of a pharmaceutical composition.
  • a pharmaceutical composition comprises an effective amount of the polynucleotide and a pharmaceutically acceptable carrier, which typically is an aqueous or non-aqueous solution comprising a variety of different pharmacologically acceptable compounds.
  • the formulation is made to suit the mode of administration. There is a wide variety of possible formulations. The formulation may be adapted to increase the uptake or stability of the polynucleotide or to improve the pharmacokinetics or pharmacodynamics of the polynucleotide, or to enhance other desirable properties of the formulation.
  • siRNA molecules can be administered to animals using liposomes with high efficiency (Eguchi et at, J Hepatol. 2016 Mar;64(3):699- 707).
  • Administration of gapmers to animals is described in for example Kasuya et al. Sci Rep. (2016) Jul 27;6:30377.
  • Formulations of the gapmer drug mipomersen is described in US7407943.
  • Various methods can be used to facilitate uptake of polynucleotides by cells.
  • Such methods include liposomes, bacteria, the use of PEGylation, cyclodextrin polymer nanoparticles (CDP) or cholesterol.
  • CDP cyclodextrin polymer nanoparticles
  • Formulation for parenteral administration such as for example intraarticular, intravenous, intradermal, intraperitoneal, intratumoural or subcutaneous administration include aqueous and non-aqueous injection solutions.
  • Formulations for injection may be in unit dosage forms, for example ampules or in multidosage forms.
  • the formulation may be provided in a dry form that is to be reconstituted by adding water or other liquid before use.
  • the formulation can be for administration topically, systemically or locally.
  • the formulation can also be provided as an aerosol.
  • the formulations may contain nuclease inhibitors, antioxidants, buffers, antibiotics, salts, solutes that renders the formulation isotonic, lipids, carriers, diluents emulsifiers, chelating agents, excipients, fillers, drying agents, antioxidants, binding agents, solubilizers, stabilizers, antimicrobial agents, preservatives and the like.
  • nucleic acids are well known in the art.
  • the polynucleotide may be administered to the subject in any suitable manner.
  • Nucleic acids can be administered by a number of routes including but not limited to oral, intravenous, intratumour, intraperitoneal, intramuscular, transdermal, subcutaneous, topical, sublingual, or rectal means. Suitable modes of administration include injection or infusion.
  • the polynucleotide is administered by injection into a tumour of the subject.
  • an effective amount of the polynucleotide is administered to the subject.
  • An effective amount is an amount that is able to treat one or more symptoms of a disease, halt or reverse the progression of a disease.
  • the subject may be a subject in need of treatment.
  • the subject is preferably a human.
  • Administration may be carried out at a single time point or repeatedly over a time period or from an implanted slow-release matrix.
  • Other delivery systems include bolus injections, time-release, delayed release, sustained release or controlled release systems.
  • Dosage and administration regimens may be determined by methods known in the art, for example with testing in appropriate in vitro or in vivo models, such as animal models to analyse efficacy, pharmacokinetics, pharmacodynamics, excretion, tissue uptake and the like by methods known in the art.
  • a suitable way of finding a suitable dose is starting with a low amount and gradually increasing the amount.
  • Dosing amounts and formulations used for the approved drugs mipomersen and fomivirsen and givosiran may serve as guidance.
  • the disease being treated is cancer.
  • cancer Non-limiting examples of cancer that are treated include: breast cancer, prostate cancer, colon cancer, lung cancer, brain tumours, skin cancer, head- and neck cancer, liver cancer, pancreatic cancer, stomach cancer, renal caner, testicular cancer, ovarian cancer, leukemias and lymphomas.
  • the polynucleotide may also be used as a research tool.
  • the role of an sp-lincRNA transcript (one of SEQ ID NO 1-7 or 64) may be investigated.
  • the role of an sp-lincRNA transcript may be investigated through administration of the polynucleotide to cells in culture or to animals.
  • the polynucleotide may be administered to cells or animals as described herein.
  • transgenic animals or cells that produce the inhibitory polynucleotides may be generated.
  • transgenic mice may be generated by methods known in the art.
  • Cell lines stably expressing the polynucleotides may be generated. Any suitable phenotype or characteristic may be investigated.
  • sp-lincRNAs in cancer may be investigated. This may be done by studying cell proliferation, senescence, migration, invasion, metabolism, cell cycle progression, apoptosis, drug sensitivity or morphology.
  • animal models for example tumour growth, tumour invasion, metastasis, apoptosis, drug sensitivity, treatment, may be investigated.
  • Detection of one of the sp-lincRNAs may be used for diagnosis.
  • a high level of an sp-lincRNA in a patient indicates that the patient has cancer, or may be in the risk of developing cancer.
  • the level of an sp-lincRNA transcript can be determined in a sample from a patient, preferably a sample from a tumour.
  • the sample may be a tissue sample, for example taken after surgical removal of a tumour or by needle biopsy.
  • the sample may also be a blood sample containing circulating tumour cells (CTCs), ascites fluid, blood, plasma, or similar.
  • CTCs circulating tumour cells
  • the level of an sp-lincRNA transcript can be determined by methods known in the art such as RT-qPCR, northern blot, in situ hybridization, hybridization microarrays, etc. It is referred to Ausubel FM et a I, Current Protocols in Molecular Biology (Wiley) for details.
  • the sample may be isolated from the patient. Diagnosis may be carried out in vitro.
  • the level of an sp-linc RNA transcript in a sample can be compared to a sample from healthy tissue or to a normal value for healthy tissue, for example a value for a reference group of patients.
  • the expression levels of the reference group are ranked according to expression level and a threshold expression level is determined as the expression level of a predetermined percentile of the reference group.
  • the threshold may be determined as the expression level of the 80thpercentile, where expression levels over the 80thpercentile are considered to be high expression. Any suitable cut-off may be used.
  • the number of patients in the reference group is preferably at least 100, more preferably at least 1000.
  • a method for diagnosis may involve the steps of isolating a sample from a patient and then determining the amount of an sp-lincRNA in the sample.
  • the method for diagnosis may involve a nucleotide that is able to specifically hybridise to the sp-lincRNA transcript, for example a labelled probe or a primer.
  • primers suitable for detection of SEQ ID NO:s 1, 2 or 3 in PCR are SEQ ID NO:s 48-53; namely for LINC01518 (SEQ ID NO 1): SEQ ID NO 50 and 51, for AP001476.1 (SEQ ID NO 2): SEQ ID 52 and 53 and for detection of P4HA3 (SEQ ID NO 3): SEQ ID No 48 and 49.
  • a probe for detection of one of SEQ ID NO 1 to SEQ ID NO 7 for use in an array or a northern blot experiment may be selected as a sequence that is able to hybridize to a part of SEQ ID NO 1 to SEQ ID NO 7 as is known in the art.
  • the presence of one of the target transcripts (SEQ ID NO 1- 7) is detected.
  • the presence or amount of one of the preferred targeted exons is detected.
  • Fig. 1 shows the expression patterns of sp lincRNAs showing aberrant expression of sp-linc RNAs LINC01518 (SEQ ID NO 1), AP001476.1(SEQ ID NO 2), P4HA3-AS1(SEQ ID NO 3), LINC00917 (SEQ ID NO 4), AC096541.1(SEQ ID NO 5), LINC01514 (SEQ ID NO 6) and LZTS1-AS1 (SEQ ID NO 7) in tumour tissue compared to normal tissue.
  • sp- lincRNAs was upregulated in tumours compared to normal tissue.
  • Figs. 2a and 2b shows high expression of sp-linc LINC01518 (SEQ ID NO 1), AP001476.1 (SEQ ID NO 2) and P4HA3-AS1 (SEQ ID NO 3) in HeLa cells, which is a cervical carcinoma cell line, compared to HEK293t cells, which is a human embryonic kidney cell line, confirming that these sp-lincRNAs are highly expressed in cancer cell lines.
  • Fig. 3 shows knockdown of sp-lincRNAs LINC01518, AP001476.1 and P4HA3 in HeLa cells using siRNA.
  • Fig.4-6 shows that knocking down sp-lincRNAs LINC01518, AP001476.1 and P4HA3-AS1 in HeLa cells resulted in changes in cell proliferation cell cycle profile and increase in apoptosis. Aberrant proliferation, cell cycle profile and increased apoptosis are typical properties of cancer cells.
  • the heatmap was derived using expression values of different transcriptome datasets from germ cells, preimplantation stage embryos, the human body map tissues, TCGA tumors compared with the corresponding healthy samples or TCGA tumors compared with GTEx health samples. Represented Z-score in the plots is obtained from the normalized Transcripts Per Million (TPM) expression values.
  • RNA-seq and ChIP-seq datasets were chosen after quality check using FastQC (RNA-seq and ChIP-seq), SAMstat(Lassmann et al., 2011) (RNA-seq and ChIP-seq) and deepTools (Ramirez et al., 2016) fingerprints (ChIP-seq vs input).
  • Transcriptome data for different cancers were downloaded as raw read counts using Bioconductor package TCGAbiolinks (Colaprico et al., 2016; Mounir et al., 2019; Silva et al., 2016) and the raw read count data for tissues used for comparison with TCGA patients were downloaded from GTEx consortium.
  • RNA-seq samples were first subjected to quality check with FastQC before and after adaptor removal using cutadapt (if necessary). Samples were considered for further analysis only when it passes FastQC quality check.
  • HISAT2 v2.1.0
  • mmlO mmlO
  • the known splice sites were generated from Ensembl annotation(Yates et al., 2019) GRCh38.90 (human) or GRCm38.90 (mouse) using 'hisat2_extract_splice_sites.py' and the genomes were indexed using 'hisat2-build'.
  • the generated aligned SAM files were sorted and converted into BAM files with the help of SAMtools (v 1.5)(Li et al., 2009). Alignment quality and statistics were obtained using SAMstat.
  • both the sperm donors were similar in age (Dl-32 and D2-37), both white- Caucasian, comparable semen parameters (progressive motility ⁇ 65%, sperm count ⁇ 80xl06).
  • Oocytes samples were obtained from Yan L et al 2013 in which the couples who had more than 20 oocytes derived from the same IVF cycle were sequenced. Embryos that were produced by routine fertilization were cultured individually. The women had an average age of 30 years (25-35 years).
  • Promoters of Sp and SpOc transcripts were clustered by chromatin profiles using k-means clustering and tested up to 10 clusters to find optimal number of clusters.
  • We optimized the cluster numbers by considering only non-repetitive combination (H3K27me3 and H3K4me3) of clusters.
  • the protein coding genes (PCGs) from individual clusters were used for further functional enrichment analysis.
  • GeneSCF(Subhash and Kanduri, 2016) to derive enriched biological process from individual clusters by using gene ontology from human and mouse.
  • the raw read counts for TCGA patient data and its corresponding controls were downloaded using TCGAbiolinks. Obtained raw reads were normalized to TPM and calculated average expression of patients and normal sample groups per gene.
  • the primers used for qRT-PCR were 5'AAGAGCGGCAAGAGGACAG3' (SEQ ID NO 48) and 5' GGACTATGCAGTTCCTTCCTG3' for P4HA3-AS1 (SEQ ID NO 49); 5' ACTGAAGCTGGTGGCTGTG3' (SEQ ID NO 50) and 5' CATGGACTCGAGAGCTGACA3' (SEQ ID NO 51) for LINC01518 (SEQ ID NO 1) and 5'
  • siRNAs Two Custom designed small interfering RNAs (siRNAs) for each IncRNA were used for transfections along with control siRNA (Invitrogen) (Table 2 which shows the sense sequences for the siRNA pairs without the deoxythymidine overhangs).
  • Percentage of cell proliferation was analyzed using MTT assay after 48 h of post transfection according to the manufacturer's protocol using CellTiter-Glo ® 3D Cell Viability Assay (G9681, Promega Madison, USA).
  • Proliferation capacity of HeLa cells as measured based on the Ultra-Glo Recombinant Luciferase, which generates a stable luminescent signal measured using Clariostar Plus Microplate Reader (BMG labtech). The error bars were calculated based on two independent transfections.
  • the cell cycle profiling was performed using NucleoCounter NC-3000 platform (Chemometec, Denmark). The cells were fixed using absolute ethanol after transfection and were stained with DAPI solution provided by the manufacturer and analyzed according to manufacturer'
  • FSC-A forward scatter area
  • SSC-A side scatter area
  • Annexin V positively stained cells in cells transfected with two different siRNAs for each Sp-lincRNAs (sil and si2, Table 3) along with corresponding control siRNAs.
  • A549 cells were transfected with the indicated siRNA or control using RnaiMAX.
  • the adherent cells were scraped with a p200 pipet tip to make a straight scratch and cells washed with media to remove the debris. After 72 h from the transfection fresh media was added and the width of the scratch was measured under the microscope and plotted as % open wound assay. Imaging was performed using phase contrast and 4x magnification. References to the examples
  • NGSUtils a software suite for analyzing and manipulating next- generation sequencing datasets. Bioinformatics 29, 494-496.
  • TCGAbiolinks an R/Bioconductor package for integrative analysis of TCGA data. Nucleic Acids Res 44, e71.
  • Genome Analysis Toolkit a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 20, 1297-1303.

Abstract

L'invention concerne un polynucléotide qui est apte à se lier à et à inhiber un transcrit d'ARN qui comprend un segment de séquence d'au moins 30 nucléotides choisi parmi l'une de la SEQ ID NO 1 à la SEQ ID NO 7. Le polynucléotide peut être utilisé dans le traitement du cancer.
PCT/EP2021/062196 2020-05-07 2021-05-07 Traitement et diagnostic du cancer impliquant un arn linc WO2021224475A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
SE2050536-8 2020-05-07
SE2050536 2020-05-07

Publications (1)

Publication Number Publication Date
WO2021224475A1 true WO2021224475A1 (fr) 2021-11-11

Family

ID=75904920

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2021/062196 WO2021224475A1 (fr) 2020-05-07 2021-05-07 Traitement et diagnostic du cancer impliquant un arn linc

Country Status (1)

Country Link
WO (1) WO2021224475A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7407943B2 (en) 2001-08-01 2008-08-05 Isis Pharmaceuticals, Inc. Antisense modulation of apolipoprotein B expression
WO2012018881A2 (fr) * 2010-08-03 2012-02-09 Alnylam Pharmaceuticals, Inc. Procédés et compositions pour la régulation d'arn
WO2012065143A1 (fr) * 2010-11-12 2012-05-18 The General Hospital Corporation Arn non codants associés à polycomb

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7407943B2 (en) 2001-08-01 2008-08-05 Isis Pharmaceuticals, Inc. Antisense modulation of apolipoprotein B expression
WO2012018881A2 (fr) * 2010-08-03 2012-02-09 Alnylam Pharmaceuticals, Inc. Procédés et compositions pour la régulation d'arn
WO2012065143A1 (fr) * 2010-11-12 2012-05-18 The General Hospital Corporation Arn non codants associés à polycomb

Non-Patent Citations (32)

* Cited by examiner, † Cited by third party
Title
BREESE, M.R.LIU, Y.: "NGSUtils: a software suite for analyzing and manipulating next-generation sequencing datasets", BIOINFORMATICS, vol. 29, 2013, pages 494 - 496
BROWN ET AL., AMBION TECHNOTES, vol. 9, no. 1, 2002, pages 3 - 5
BRUMMELKAMP, T.R. ET AL., SCIENCE, vol. 296, pages 550 - 553
COLAPRICO, A.SILVA, T.C.OLSEN, C.GAROFANO, L.CAVA, C.GAROLINI, D.SABEDOT, T.S.MALTA, T.M.PAGNOTTA, S.M.CASTIGLIONI, I. ET AL.: "TCGAbiolinks: an R/Bioconductor package for integrative analysis of TCGA data", NUCLEIC ACIDS RES, vol. 44, 2016, pages e71
DUTTKE, S.H.CHANG, M.W.HEINZ, S.BENNER, C.: "Identification and dynamic quantification of regulatory elements using total RNA", GENOME RES, vol. 29, 2019, pages 1836 - 1846
EGUCHI ET AL., J HEPATOL, vol. 64, no. 3, March 2016 (2016-03-01), pages 699 - 707
ELBASHIR ET AL., EMBO J, vol. 20, 2001, pages 6877 - 6888
FRIEDMAN, C.E.NGUYEN, Q.LUKOWSKI, S.W.HEIFER, A.CHIU, H.S.MIKLAS, J.LEVY, S.SUO, S.HAN, J.J.OSTEIL, P. ET AL.: "Single-Cell Transcriptomic Analysis of Cardiac Differentiation from Human PSCs Reveals HOPX-Dependent Cardiomyocyte Maturation", CELL STEM CELL, vol. 23, 2018, pages 586 - 598,e588
JACQUE, J.-M. ET AL., NATURE, vol. 411, no. 6836, 24 May 2001 (2001-05-24), pages 494 - 438
KANASTY ET AL., NAT MATER, vol. 12, no. 11, November 2013 (2013-11-01), pages 967 - 77
KASUYA ET AL., SCI REP, vol. 27, no. 6, July 2016 (2016-07-01), pages 30377
KASUYA ET AL., SCI REP, vol. 6, 27 July 2016 (2016-07-27), pages 30377
KIM, D.PAGGI, J.M.PARK, C.BENNETT, C.SALZBERG, S.L.: "Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype", NAT BIOTECHNOL, vol. 37, 2019, pages 907 - 915, XP036850003, DOI: 10.1038/s41587-019-0201-4
KURRECK J ET AL., NUCLEIC ACIDS RES., vol. 30, no. 9, 1 May 2002 (2002-05-01), pages 1911 - 8
LASSMANN, T.HAYASHIZAKI, Y.DAUB, C.O.: "SAMStat: monitoring biases in next generation sequencing data", BIOINFORMATICS, vol. 27, 2011, pages 130 - 131, XP055233149, DOI: 10.1093/bioinformatics/btq614
LI, H.DURBIN, R.: "Fast and accurate short read alignment with Burrows-Wheeler transform", BIOINFORMATICS, vol. 25, 2009, pages 1754 - 1760, XP055553969, DOI: 10.1093/bioinformatics/btp324
LI, H.HANDSAKER, B.WYSOKER, A.FENNELL, T.RUAN, J.HOMER, N.MARTH, G.ABECASIS, G.DURBIN, R.GENOME PROJECT DATA PROCESSING, S.: "The Sequence Alignment/Map format and SAMtools", BIOINFORMATICS, vol. 25, 2009, pages 2078 - 2079, XP055229864, DOI: 10.1093/bioinformatics/btp352
LIAO, Y.SMYTH, G.K.SHI, W.: "featureCounts: an efficient general purpose program for assigning sequence reads to genomic features", BIOINFORMATICS, vol. 30, 2014, pages 923 - 930, XP055693027, DOI: 10.1093/bioinformatics/btt656
MCKENNA, A.HANNA, M.BANKS, E.SIVACHENKO, A.CIBULSKIS, K.KERNYTSKY, A.GARIMELLA, K.ALTSHULER, D.GABRIEL, S.DALY, M. ET AL.: "The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data", GENOME RES, vol. 20, 2010, pages 1297 - 1303, XP055573785, DOI: 10.1101/gr.107524.110
MIYAGISHI, M.TAIRA, K., NATURE BIOTECHNOLOGY, vol. 20, 2002, pages 497 - 500
MOUNIR, M.LUCCHETTA, M.SILVA, T.C.OLSEN, C.BONTEMPI, G.CHEN, X.NOUSHMEHR, H.COLAPRICO, A.PAPALEO, E.: "New functionalities in the TCGAbiolinks package for the study and integration of cancer data from GDC and GTEx", PLOS COMPUT BIOL, vol. 15, 2019, pages e1006701
PADDISON, P.J. ET AL., GENES DEVEL, vol. 16, pages 948 - 958
QUINLAN, A.R.HALL, I.M.: "BEDTools: a flexible suite of utilities for comparing genomic features", BIOINFORMATICS, vol. 26, 2010, pages 841 - 842, XP055307411, DOI: 10.1093/bioinformatics/btq033
RAMIREZ, F.RYAN, D.P.GRUNING, B.BHARDWAJ, V.KILPERT, F.RICHTER, A.S.HEYNE, S.DUNDAR, F.MANKE, T.: "deepTools2: a next generation web server for deep-sequencing data analysis", NUCLEIC ACIDS RES, vol. 44, 2016, pages W160 - 165
SILVA, T.C.COLAPRICO, A.OLSEN, C.D'ANGELO, F.BONTEMPI, G.CECCARELLI, M.NOUSHMEHR, H.: "TCGA Workflow: Analyze cancer genomics and epigenomics data using Bioconductor packages", F1000RES, vol. 5, 2016, pages 1542
SOUTSCHEK ET AL., NATURE, vol. 432, 2004, pages 173 - 178
SUBHASH SANTHILAL ET AL: "Sperm Originated Chromatin Imprints and LincRNAs in Organismal Development and Cancer", ISCIENCE, vol. 23, no. 6, 1 June 2020 (2020-06-01), US, pages 101165, XP055823860, ISSN: 2589-0042, DOI: 10.1016/j.isci.2020.101165 *
SUBHASH, S.KANDURI, C.: "GeneSCF: a real-time based functional enrichment tool with support for multiple organisms", BMC BIOINFORMATICS, vol. 17, 2016, pages 365
SUI, G. ET AL., PROC. NATL. ACAD. SCI. US A, vol. 99, no. 8, pages 5515 - 5520
WITTRUPLIEBERMAN, NATURE REVIEWS GENTICS, vol. 16, 2015, pages 543 - 552
YATES, A.D.ACHUTHAN, P.AKANNI, W.ALLEN, J.ALLEN, J.ALVAREZ-JARRETA, J.AMODE, M.R.ARMEAN, I.M.AZOV, A.G.BENNETT, R.: "Ensembl 2020", NUCLEIC ACIDS RES, 2019
YU, J.-Y. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 99, no. 9, pages 6047 - 6052

Similar Documents

Publication Publication Date Title
Zhao et al. P53-R273H mutation enhances colorectal cancer stemness through regulating specific lncRNAs
EP3236976B1 (fr) Agents d'interférence arn utilisables en vue de la modulation du gène p21
ES2627059T3 (es) Regiones ultraconservadas que codifican ARNnc
JP6414886B2 (ja) 抗癌治療に用いられる長鎖非コードｒｎａ
Zhan et al. MicroRNA-548j functions as a metastasis promoter in human breast cancer by targeting Tensin1
JP2010521439A (ja) 上皮腫瘍細胞における薬剤耐性のモジュレータ化合物
CN102892897A (zh) 用于肺癌的微rna表达谱分析的组合物和方法
US10612020B2 (en) Artificial mimic miRNA for controlling gene expression, and use of same
CN106701900B (zh) 长链非编码rna herc2p3基因及其在胃癌中的用途
US20110190383A1 (en) Diagnostic, Prognostic and Therapeutic Uses of MIRs in Adaptive Pathways and/or Disease Pathways
US20160024597A1 (en) miRNAs AS THERAPEUTIC TARGETS IN CANCER
WO2012006181A2 (fr) Compositions et procédés pour l'inhibition de micro-arn oncogènes et le traitement du cancer
Belter et al. Inhibition of miR-21 in glioma cells using catalytic nucleic acids
US20110118337A1 (en) Method of Using Compositions Comprising MIR-192 and/or MIR-215 for the Treatment of Cancer
US20220282250A1 (en) Long non-coding rna in cancer
Yan et al. MicroRNAs as potential therapeutics for treating spinal cord injury
WO2009149318A2 (fr) Arnmi en tant que cibles thérapeutiques dans le cancer
CN102933719A (zh) 用于结直肠癌血浆中的微rna表达谱分析的组合物和方法
Endoh et al. Triple-Helical Binding of Peptide Nucleic Acid Inhibits Maturation of Endogenous MicroRNA-197
Kamali et al. Locked nucleic acid (LNA): A modern approach to cancer diagnosis and treatment
Koffler-Brill et al. The long and short: non-coding RNAs in the mammalian inner ear
Profumo et al. Targeting microRNAs to withstand cancer metastasis
JP5812491B2 (ja) 腫瘍治療剤
Zhou et al. Role of the AKT pathway in microRNA expression of human U251 glioblastoma cells Retraction in/10.3892/ijo. 2023.5597
WO2021224475A1 (fr) Traitement et diagnostic du cancer impliquant un arn linc

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21725103

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
NENP Non-entry into the national phase

Ref country code: DE

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC

122 Ep: pct application non-entry in european phase

Ref document number: 21725103

Country of ref document: EP

Kind code of ref document: A1