WO2021222654A1 - Compositions and methods for treatment of inherited macular degeneration - Google Patents

Compositions and methods for treatment of inherited macular degeneration Download PDF

Info

Publication number
WO2021222654A1
WO2021222654A1 PCT/US2021/030007 US2021030007W WO2021222654A1 WO 2021222654 A1 WO2021222654 A1 WO 2021222654A1 US 2021030007 W US2021030007 W US 2021030007W WO 2021222654 A1 WO2021222654 A1 WO 2021222654A1
Authority
WO
WIPO (PCT)
Prior art keywords
transposase
composition
nucleic acid
mlt
promoter
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/030007
Other languages
English (en)
French (fr)
Inventor
Joseph J. HIGGINS
Scott Mcmillan
Ray Tabibiazar
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Saliogen Therapeutics Inc
Original Assignee
Saliogen Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Saliogen Therapeutics Inc filed Critical Saliogen Therapeutics Inc
Priority to US17/922,119 priority Critical patent/US20230193319A1/en
Priority to CN202180030798.2A priority patent/CN115461082A/zh
Priority to AU2021265838A priority patent/AU2021265838A1/en
Priority to JP2022565707A priority patent/JP2023523622A/ja
Priority to IL297718A priority patent/IL297718A/en
Priority to EP21797217.3A priority patent/EP4142796A4/en
Priority to KR1020227039027A priority patent/KR20230004573A/ko
Priority to CA3175197A priority patent/CA3175197A1/en
Publication of WO2021222654A1 publication Critical patent/WO2021222654A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0075Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0048Eye, e.g. artificial tears
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/48Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51Nanocapsules; Nanoparticles
    • A61K9/5107Excipients; Inactive ingredients
    • A61K9/5123Organic compounds, e.g. fats, sugars
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/007Vector systems having a special element relevant for transcription cell cycle specific enhancer/promoter combination

Definitions

  • the present invention relates, in part, to methods, compositions, and products for therapy, e.g. treating and/or mitigating inherited Macu!ar Degeneration (IMD),
  • IMD inherited Macu!ar Degeneration
  • Macular Degeneration is a condition in which cells of the macula, found in the center of the retina - the tissue at the back of the eye that senses light - become damaged, Vision loss usually occurs gradually and typically affects both eyes at different rates.
  • IMD Inherited Macular Degeneration
  • MD Macular Dystrophy
  • STGD Stargardt disease
  • SMD Stargardt's macular dystrophy
  • STGD typically causes vision loss during childhood or adolescence, although sometimes vision loss may not be noticed until later in adulthood.
  • STGD causes progressive damage ⁇ or degeneration ⁇ of the macula, which is a small area in the center of the retina that Is responsible for sharp, straight-ahead vision.
  • Worldwide incidence of STGD is estimated to be 1 in 8,000-10,000 individuals,
  • STGD is one of several genetic disorders that cause macular degeneration, and it is characterized by a progressive worsening of vision due to the loss of light-sensing photoreceptor ceils In the retina, The loss of central vision dramatically reduces one’s ability to read, write, and navigate the surrounding environment, significantly reducing the person’s quality of life.
  • Recessive Stargardt disease (STGD1) is by far the most common form of Stargardt disease, which Is caused by mutations in the ATP binding cassette subfamily A member 4 ( ABCA4 ). The ABCA4 gene/protein is expressed in photoreceptor (PR) ceils.
  • STGD1 is manifested by deposition of lipofuscin, a fluorescent mixture of partially digested proteins and lipids, in the lysosomal compartment of the retinal pigment epithelium (RPE), which precedes photoreceptor degeneration.
  • RPE plays a role in controlling the immune response through expression of mRNAs and proteins associated with the complement portion of the immune system, which is a key component of innate immunity.
  • Age-related macular degeneration (AMD) is a disease with significant similarities to STGD1, and it is also associated with R.PE lipofuscin accumulation and complement dysregulation. Lenis et a/., Proc Nat! Acad Sci USA, 2017 Apr 11 ; 114(15):3987-3992.
  • STGD4 a rare dominant defect in the PROM1 gene. Kniazeva et a!. Am J Hum Genet. 1999; 64:1394-1399, STGD3, also known as Stargardt-!ike dystrophy, is another rare dominant form of STGD. caused by mutations in the Eiongation of Very Long-Chain Fatty Acids-Like 4 Gene (EL.OVL4), Agbaga et a/. Invest Ophthalmol Vis Sci. 2014; 55: 3669-3680.
  • EL.OVL4 Very Long-Chain Fatty Acids-Like 4 Gene
  • compositions and methods for efficiently preventing and treating IMD such as Stargardt disease, as we!! as other macular dystrophies, are needed,
  • the present invention provides compositions and methods for treating and/or mitigating Inherited Macular Degeneration (IMD) disorders, which are a major cause of blindness worldwide.
  • IMD includes Stargardt disease and other Macular dystrophies (MDs), Including Best disease, X-linked retinoschisis, pattern dystrophy, Sorsby fundus dystrophy and autosomal dominant drusen.
  • MDs Macular dystrophies
  • the compositions and methods of the present invention make use of gene transfer constructs comprising transposon expression vectors that use sequence- or locus-specific transposition (SLST) to correct gene defects associated with these diseases.
  • SLST locus-specific transposition
  • the described compositions and methods employ a non-virai mode of gene transfer.
  • a composition comprising a gene transfer construct comprises (a) a nucleic acid encoding an ATP binding cassette subfamily A member 4 ( ABCA4 ) protein, or a functional fragment thereof; (b) a retina-specific promoter; and (c) a non-virai vector comprising one or more transposase recognition sites and one or more inverted terminal repeats (iTRs) or end sequences.
  • ABCA4 ATP binding cassette subfamily A member 4
  • iTRs inverted terminal repeats
  • the gene therapy in accordance with the present disclosure can be performed using transposon-based vector systems, with the assistance by transposases, which are provided on the same vector as the gene to be transferred (cis) or on a different vector (trans) or as RNA,
  • the transposon-based vector systems can operate under the control of a retina- specific promoter.
  • the transposase e.g, one derived from Bomhyx nnori , Xenopus tropicaiis, Trichoplusia ni, Rhino!ophus ferrumequinum, Rousettus aegyptiacus, Phy!losiomus discolor , Myotis myotis, Myotis lucifugus, Pteropus vampyrus, Pipistrellus kuhiii, Pan troglodytes, Moiossus rnoiossus, or Homo sapiens, and/or is an engineered version thereof, is used to insert the ABCA4 gene, or a functional fragment thereof, into a patient’s genome.
  • a transposase Is a Myotis lucifugus transposase (MLT, or MLT transposase), which comprises an amino acid sequence of SEQ ID NO: 10, or a variant having at least about 90%, or at least about 93%, or at least about 95%, or at least about 97%, or at least about 98%, or at least about 99% identity thereto, and one or more mutations selected from L573X, E574X, and S2X, wherein X is any amino acid or no amino acid, optionally X is A, G, or a deletion,
  • the mutations are L573del, E574del, and S2A.
  • the MLT transposase comprises an amino acid sequence with mutations L573dei, E574del, and S2A (SEQ ID NO: 10), and additionally with one or more mutations that confer hyperactivity (or hyperactive mutations).
  • the hyperactive mutations are one or more of S8X, C13X, and N125X mutations, wherein X is optionally any amino acid or no amino add, optionally X is P, R, or K.
  • the mutations are S8P, C13R, and N125K.
  • the MLT transposase has S8P and C13R mutations.
  • the MLT transposase has N125K mutation, In some embodiments, the MLT transposase has all three S8P, C13R, and N125K mutations.
  • the described compositions can be delivered to a host cell using lipid nanoparticles (LNPs).
  • the LNP comprises one or more molecules selected from a neutral or structural lipid (e.g. DSPC), cationic lipid (e.g, MC3), cholesterol, PEG-conjugated lipid (CDM-PEG), and a targeting ligand (e.g. N-Acety!galactosamine (GaiNAc)),
  • the LNP comprises GaiNAc or another ligand for Asialoglycoprotein Receptor (ASGPR)- mediated uptake into cells with mutated A.BCA4 or other genes (e.g., ELOVL4, PROM1, BEST1, or PRPH2).
  • ASGPR Asialoglycoprotein Receptor
  • a method for preventing or decreasing the rate of photoreceptor loss in a patient comprises administering to a patient in need thereof a composition in accordance with embodiments of the present disclosure.
  • an ex vivo method for preventing or decreasing the rate of photoreceptor loss in a patient comprises (a) contacting a cell obtained from a patient (autologous) or other individual (allogeneic) with the described composition, and (b) administering the cel! to a patient in need thereof.
  • a method for treating and/or mitigating a class of IMDs (also referred to as Macular dystrophies (MDs)) is provided, including STGD, Best disease, X-iinked retinoschisis, pattern dystrophy, Sorsby fundus dystrophy and autosomal dominant drusen.
  • a method for treating and/or mitigating an !MD is provided, which can aiso be performed in vivo or ex vivo.
  • the method comprises administering to a patient in need thereof composition in accordance with embodiments of the present disclosure
  • the method for treating and/or mitigating an !MD comprises (a) contacting a ceil obtained from a patient or another individual with a composition of the present disclosure, and (b) administering the cell to a patient in need thereof,
  • the iMD can be a STGD, and, in some embodiments, the STGD can be STGD Type 1 (STGD1). In some embodiments, the STGD can be STGD Type 3 (STGD3) or STGD Type 4 (STGD4) disease,
  • the iMD can be characterized by one or more mutations in one or more of ABCA.4, EL0VL4, PR0M1, BEST1 , and PRPH2.
  • the ABCA4 mutations can be autosomal recessive or dominant mutations.
  • the methods in accordance with the present disciosure allow reducing, decreasing, or alleviating symptoms of !MD such as, e.g. Stargardt disease, including improved distance visual acuity and/or decreased the rate of photoreceptor loss as compared to a lack of treatment.
  • the method results in improvement of best corrected visual acuity (BCV.A) to greater than about 20/200.
  • compositions and methods in accordance with embodiments of the present disclosure are substantially non- immunogenic, do not cause any unmanageable side effects, and, in some cases, can be effectively delivered via a single administration,
  • the prevention or decreasing of the rate of photoreceptor loss can be robust and durable,
  • the described compositions and methods lower or prevent iipofuscin accumulation in the retina (e.g., in the R.PE and/or Bruch's membrane), reduce or prevent formation of retina! pigment epithelium (RPE) debris, improve distance visual acuity of the patient.
  • an isolated cell is provided that comprises the composition in accordance with embodiments of the present disciosure,
  • the method provides improved distance visual acuity and/or decreased the rate of photoreceptor loss as compared to a lack of treatment,
  • the method can aiso result in improvement of best corrected visual acuity (BCVA) to greater than about 20/200,
  • the method results in improvement of retinal or fovea! morphology, as measured by fundus autofiuorescence (FAF) or Spectral Domain-Optical Coherence Tomography (SD- OCT).
  • FAF fundus autofiuorescence
  • SD- OCT Spectral Domain-Optical Coherence Tomography
  • the methods in accordance with the present disciosure obviate the need for steroid treatment, Additionally or alternatively, the methods can obviate the need for Soraprazan, isotretinoin, Dobesi!ate, 4- methylpyrazoie, ALK-QQ1 9 (C20 deuterated vitamin A), Fenretinide (a synthetic form of vitamin A), LBS-50Q, A112Q, Emixustat, Fenofibrate, Avacincaptad pegol, and other therapeutic agents, in some embodiments, however, the present compositions and methods involve the use of one or more additional therapeutic agents selected from Soraprazan, isotretinoin.
  • FIGs. 1A, 1B, 1C, 1D, 1 E, 1F, 1J, 1H, and 11 are schematic representations of the vectors that can be used in the transfection, transposition efficacy, and expression studies in retina! cell lines.
  • FIG. 2 Illustrates a lipid nanoparticle structure used In some embodiments of the present disclosure.
  • FIG. 3 shows GFP expression of 681 W mouse photoreceptor cells 24 hours post transfection with varying !ipofectlon reagents as well as either MLT transposase 1 (MLT with the N125K mutation) or MLT transposase 2 (MLT with the S8P/C13R mutations) of the present disclosure, compared to un-transfected cells.
  • MLT transposase 1 MLT with the N125K mutation
  • MLT transposase 2 MLT transposase 2
  • the top row shows un-transfected 661 W mouse photoreceptor cells, cells transfected with a transposon with L3 (Lipofectamine 3000) and MLT 1 , and cells transfected with a transposon with L3 and MLT 2;
  • the middle row shows un-transfected 661 W mouse photoreceptor cells, cells transfected with a transposon with LTX (Lipofectamine LTX & PLUS) and MLT 1 , and cells transfected with a transposon with LTX and MLT 2;
  • the bottom row shows un-transfected 661 W mouse photoreceptor ceils, cells transfected with a transposon with MAX (Lipofectamine Messenger MAX) and MLT 1, and cells transfected with a transposon with MAX and MLT 2,
  • FIG. 4 shows stable Integration of donor DMA (GFP) by transposition in mouse photoreceptor cell line 661 W after 4 rounds of splitting over 15 days.
  • the rows show results for days 3, 6, 9, 12, and 15; the columns show results for untransfected cells, DCis transfected with a donor DNA only; cells transfected with a donor DNA and MLT 1, and cells transfected with a donor DNA and MLT 2.
  • GFP donor DMA
  • FIG. 5 is a bar chart illustrating results of FACS analysis of stable integration of a donor DNA (GFP) by transposition in mouse photoreceptor cel! line 661 W on day 15. The percent (%) of GFP expression is shown for untransfected cells, cells transfected with the donor DNA only (”+ GFP only”); cells transfected with the donor DNA and MLT 1 (“MLT 1 + GFP”); and cells transfected with the donor DNA and MLT 2 (“MLT 2 + GFP”).
  • FIG. b shows expression of GFP in ARPE-19 cells at 24 hours post transfection.
  • the top row shows un-transfected ARPE-19 cells, cells transfected with a transposon with L3 only, cells transfected with a transposon with L3 and MLT 1, and cells transfected with a transposon with L3 and MLT 2;
  • the middle row shows un-transfected ARPE-19 cells, cells transfected with a transposon with LTX only, cells transfected with a transposon with LTX and MLT 1, and cells transfected with a transposon with LTX and MLT 2;
  • the bottom row shows un-transfected ARPE-19 ceils, cells transfected with a transposon with MAX only, cells transfected with a transposon with MAX and MLT 1, and cells transfected with a transposon with MAX and MLT 2.
  • FIG. 7 shows higher resolution images of MLT transposase 1 and MLT transposase 2, visible G
  • FIG. 8 shows stable Integration of donor DNA (GFP) In photoreceptor cell line ARPE19 with MLT transposase 2 (MLT 2), The rows show results for days 4, 8. 12. and 15; the columns show results for cells transfected with a donor DNA only, and cells transfected with the donor DNA and MLT 2,
  • FIG. 9 is a bar chart illustrating results of FACS analysis of stable integration of a donor DNA (GFP) by transposition in ARPE19 cell lines after 4 generations of cell divisions. The percent (%) of GFP expression is shown for untransfected cells, cells transfected with the donor DNA only ("+ GFP only”); cells transfected with the donor DNA and MLT 1 (“MLT 1 + GFP”); and ceils transfected with the donor DNA and MLT 2 (“MLT 2 + GFP”).
  • FIGs. 10A and 10B depict Images of mouse 1-1L left (FIG. 10A) and 1-1 L right. (FIG. 10B) eyes injected with PBS.
  • FIGs. 11 A, 11B, 11C, and 11 D depict images of mice 3-1 L and 3-1R right eyes injected with only DNA (FIG. 11 A and FIG. 11C) and mice 3-1 L and 3-1 R left eyes injected with a donor DNA and MLT 2 (FIG. 11B and FIG. 11D).
  • FIGs. 12A and 12B depict images of mouse 4-1 R's right eye injected with a donor DNA (FIG. 12A) and MLT 2 (FIG. 12B).
  • FIGs. 13A and 13B depict images of mouse 4-NP right eye (FIG. 13A) injected with only a donor DNA, and left eye (FIG. 13B) injected with both the donor DNA and MLT 2.
  • FIGs. 14A and 14B depict Images of mouse 4-1 L right eye (FIG. 14A) injected with only a donor DNA, and left eye (FIG. 14B) injected with both the donor DNA and MLT 2.
  • FIGs. 15A and 15B depict images of mouse 5-BP right eye (FIG. 15A) injected with only a donor DNA, and loft eye (FIG. 1SB) injected with both the donor DNA and MLT 2.
  • FIG. 16 illustrates a design of experiments that assess effectiveness of transposition of 661 W mouse photoreceptor cells and retinal epithelium (ARPE19) cells using a DNA donor and an RNA helper in accordance with some embodiments of the present disclosure
  • FIG. 17 depicts images of mouse left and right eyes (top and bottom rows, respectively), taken on day 21 day post sub- retinal injection, with (“+ MLT”) or without (“- MLT”) the MLT transposase used In the transfection.
  • the present invention is based, in part, on the discovery that non-viral, capsid free gene therapy methods and compositions can be used for preventing or decreasing the rate of photoreceptor loss in a patient.
  • the non-viral gene therapy methods in accordance with the present disclosure find use in retina-directed gene therapy for Inherited Macular Degenerations (IMDs).
  • the present methods and compositions find use in retina- directed gene therapy for Siargardi disease (STGD) caused by mutations in an ATP binding cassette subfamily A member 4 (ABCA4).
  • STGD Siargardi disease
  • ABCA4 ATP binding cassette subfamily A member 4
  • the described methods and compositions employ transposition of ABCA4 or another gene or a functional fragment thereof, from a gene transfer construct to a host genome.
  • the described methods and compositions lower or prevent !ipofuscln accumulation in the retina (e.g., in the RPE and/or Bruch's membrane, and photoreceptors), and improve distance visual acu
  • STGD Is characterized by macular atrophy and peripheral flecks in the retinal pigment epithelium (RPE),
  • the ABCA4 gene encodes a protein (ABCA4 protein) found In rod and cone photoreceptors, which is a transmernbrane protein involved in the transport of vitamin A Intermediates, such as specifically N-retiny!id!ne-phosphat!dy!ethano!-amine (N- RPE), to the RPE.
  • ABCA4 Is responsible for the clearance of ali-frans-retina!
  • Mutations of ABCA4 are associated with a wide spectrum of phenotypes, including cone-rod dystrophy (cones and rods die away in STGD disease) and retinitis pigmentosa (a breakdown and loss of cells in the retina), See, e.g,. Song et a/., JAMA Ophthalmol. 2015; 133(1 Q):1198-1203, Similarly, mutations in other genes responsible for MDs similarly exhibit various phenotypes that differ among patients.
  • ABCA4 adeno-associated virus
  • Ei.AV equine Infectious anemia lentivirus
  • Another approach that addressed the relatively large size of ABCA4 was to split the gene across two AAV vectors such that the two iransgene fragments combine inside the host cell. Dyka et at., Hum Gene Ther. 2019; Nov; 30(11): 1361-1370.
  • compositions and methods of the present disclosure provide a non-viral delivery of transgenes that replace mutated copies of ABCA4 or other targeted gene(s). Accordingly, the compositions and methods of the present disclosure provide gene transfer constructs that target ABCA4, or a functional fragment thereof, to correct pathogenic variants in the patient’s genome and to thus prevent or decrease the rate of photoreceptor loss in a patient.
  • the ABCA4 protein is human ABCA4 protein, or a functional fragment thereof, in embodiments, a gene encoding the human ABCA4 is human ABCA4 (GenBank Acc. No, NM ..
  • the nucleic acid encoding the human ABCA4 may comprise a nucleotide sequence encoding a protein having an amino acid sequence of SEQ ID NO: 1, or a variant having at least about 90%, or at least about 93%, or at least about 95%, or at least about 97%, or at least about 98% identity thereto.
  • the nucleic acid encoding the human ABCA4 comprises a nucleotide sequence of SEQ ID NO: 2, or a variant having at least about 90%, or at least about 93%, or at least about 95%, or at least about 97%, or at least about 98% identity thereto, in some embodiments, the nuc!eic acid encoding the human ABCA4 comprises a nucleotide sequence encoding a protein having an amino acid sequence of SEQ ID NO: 1 , or a variant having at least about 90%, or at least about 93%, or at least about 95%, or at least about 97%, or at least about 98% identity thereto.
  • the nucleic acid encoding the human ABCA4 comprises a nucleotide sequence of SEQ ID NO: 2, or a variant having at least about 90%, or at least about 93%, or at least about 95%, or at least about 97%, or at least about 98% identity thereto.
  • SEQ ID NO: 1 is N-(SEQ ID NO: 1
  • FIGINS3A IT FILELFENNR TLLRFNAVLR KLLIVFPHFC LGRGLIDLAL SQAVTDVYAR
  • VAEERQRIIT GGNKTDILRL HELTKIYPGT SSPAVDRLCV GVRPGECFGL LGVNGAGKTT 1981 TFKMLTGDTT VTSGDATVAG KSILTNISEV HQNMGYCPQF DAIDELLTGR EHLYLYARLR 2041 GVPAEEIEKV ANWSIKSLGL TVYADCLAGT YSGGNKRKLS TAIALIGCPP LVLLDEPTTG 2101 MDPQARRMLW NVIVSIIREG RAW LTSHSM EECEALCTRL AIMVKGAFRC MGTIQHLKSK 2161 FGDGYIVTMK IKSPKDDLLP DLNPVEQFFQ GNFPGSVQRE RHYNMLQFQV SSSSLARIFQ 2221 LLLSHKDSLL IEEYSVTQTT LDQVFVNFAK QQTESHDLPL HPRAAGASRQ AQD (SEQ !D NO: 1)
  • the human ABCA4 is encoded by a nucleotide sequence of SEQ ID NO: 2, or a variant having at least about 90%, or at least about 93%, or at least about 95%, or at least about 97%, or at least about 98% identity thereto, including a codon-optimized version.
  • SEQ ID NO: 2 is:
  • the present disclosure relates to compositions and methods for gene transfer via a dual transposon and transposase system
  • Transposabie elements are non-virai gene delivery vehicles found ubiquitously in nature.
  • Transposon-based vectors have the capacity of stable genomic integration and long-lasting expression of transgene constructs in cells,
  • dual transposon and transposase systems work via a cui-and-paste mechanism whereby transposon DNA containing a transgene(s) of interest is integrated into chromosomal DNA by a transposase enzyme at a repetitive sequence site.
  • a transposon often includes an open reading frame that encodes a transgene at the middle of transposon and terminal repeat sequences at the 5' and 3 ! end of the transposon,
  • the translated transposase binds to the 5' and 3' sequence of the transposon and carries out the transposition function
  • a transposon is used interchangeably with transposabie elements, which are used to refer to poiynucieotides capable of inserting copies of themseives into other polynucleotides.
  • the term transposon is we!! known to those skilled in the art and includes classes of transposons that can be distinguished on the basis of sequence organization, for example short inverted repeats (ITRs) at each end, and/or directly repeated long terminal repeats (LTRs) at the ends, in some embodiments, the transposon as described herein may be described as a piggyBac like element, e.g. a transposon element that is characterized by its traceless excision, which recognizes TTAA sequence and restores the sequence at the insert site back to the original TTAA sequence after removal of the transposon,
  • the non-viral vector is a transposon-mediated gene transfer system (e.g., a DNA plasmid transposon system) that is flanked by ITRs recognized by a transposase, In some embodiments, the ITRs flank the nucleic acid encoding the ABCA4 gene.
  • the non-viral vector operates as a transposon-based vector system comprising a heterologous polynucleotide (also referred to as a transgene) flanked by two ends that are recognized by a transposase,
  • the transposon ends include ITRs, which may be exact or inexact repeats and that are inverted in orientation with respect to each other.
  • the transposase acts on the transposon ends to thereby “cut” the transposon (along with the transposon ends) from the vector and “paste,” or integrate, the transposon into a host genome
  • the transposase is provided as a DNA expression vector or as an expressible RNA or a protein such that long-term expression of the transposase does not occur in the transgenic cells
  • a gene transfer system is a nucleic acid (DNA) encoding a transposes and is referred to as a “donor DNA.’ in embodiments, a nucleic acid encoding a transposase is helper RNA (i,e.
  • an mRNA encoding the transposase), and a nucleic acid encoding a transposon is donor DNA (or a DNA donor transposon).
  • the donor DNA is incorporated into a plasmid.
  • the donor DNA. is a plasmid.
  • DNA donor transposons which are mobile elements that use a “cut-and-pasie” mechanism, include donor DNA that is flanked by two end sequences in the case of mammals (e.g. Myotis iucifugus , Myotis myotis, Pteropus vampyrus. Pipistrellus kuhSii, and Pan troglodytes) including humans (Homo sapiens), or Inverted Terminal Repeats (!TRs) in other living organisms such as insects (e.g. Trichnoplusia ni) or amphibians ( Xenopus species).
  • mammals e.g. Myotis iucifugus , Myotis myotis, Pteropus vampyrus. Pipistrellus kuhSii, and Pan troglodytes
  • humans Homo sapiens
  • !TRs Inverted Terminal Repeats
  • insects e.g. Trichnoplusia ni
  • amphibians
  • a duai system that uses bioengineered transposons and transposases includes (1) a source of an active transposase that “cuts” at a specific nucleotide sequences such as TTAA and (2) DNA sequence(s) that are flanked by recognition end sequences or ITRs that are mobilized by the transposase. Mobilization of the DNA sequences permits the intervening nucieic acid, or a transgene, to be inserted at the specific nucleotide sequence (i.e. TTAA) without a DNA footprint,
  • MLT Myotis Iucifugus transposase
  • a transposase Is a Myotis iucifugus transposase (MLT, or MLT transposase), which comprises an amino acid sequence of SEQ ID NO: 9, or a variant having at least about 90%, or at least about 93%, or at least about 95%, or at least about 97%, or at least about 98%, or at least about 99% identity thereto and S2X, wherein X is any amino acid or no amino acid, optionally X is A or G,
  • the mutations are L573del, E574del, and S2A.
  • the MLT transposase comprises an amino acid sequence of SEQ iD NO: 10 with mutations L573del, E574del, and S2A:
  • an MLT transposase which comprises an amino acid sequence of SEQ ID NO: 10 is encoded by following nucleotide sequence: atggcccagcacagcgactacagcgacgacgagttctgtgccgataagctgagtaactacagctgcgacagcgacctggaaacgccagcacatccgacgag gacagctctgacgacgaggtgatggtgcggcccagaaccctgagacggagaagaatcagcagcictagcagcgactctgaatccgacatcgagggcggccgg gaagagtggagccacgtggacaaccctcctgttctggaagattttctgggccatcagggcctgaacaccgacgcctggaagattttctgggccatcagggcct
  • the MLT transposase (e.g., the MLT transposase having an amino acid sequence of SEQ ID NO: 10, or an amino acid sequence having at least about 90%, or at least about 93%, or at least about 95%, or at least about 97%, or at least about 98%, or at least about 99% identity thereto) comprises one or more hyperactive mutations that confer hyperactivity upon the MLT transposase.
  • the hyperactive mutations relative to the amino acid sequence of SEQ ID NO: 10 or a functional equivalent thereof, are one or more of S8X, C13X, and N125X mutations, wherein X is optionally any amino acid or no amino acid, optionally X is P, R, or K.
  • the mutations are S8P, C13R, and N125K.
  • the MLT transposase has S8P and C13R mutations.
  • the MLT transposase has N125K mutation, in some embodiments, the MLT transposase has all three S8P, C13R, and N125K mutations.
  • an MLT transposase is encoded by a nucleotide sequence (SEQ ID NO: 12) that corresponds to an amino acid (SEQ ID NO: 13) having the N125K mutation relative to the amino acid sequence of SEQ ID NO: 10 or a functional equivalent thereof, wherein SEQ ID NO: 12 and SEQ ID NO: 13 are as follows:
  • KLRSETYMC KFCNIPLHKG ACFEKYHTLK NY (SEQ IDNO:13), or an amino acid sequence having at least about 90%, or at least about 93%, or at least about 95%, or at least about 97%, or at least about 98%, or at least about 99% identity thereto (the amino acid corresponding to the N125K mutation is underlined and bolded).
  • the MLT transposase encoded by the nucleotide sequence of SEQ ID NO: 12 and having the amino acid sequence of SEQ ID NO: 13 Is referred to as an MLT transposase 1 (or MLT 1).
  • KLRSETRYMC KFCKIPLHKG ACFEKYHTLK NY SEQ ID NO: 15
  • the MLT transposase encoded by the nucleotide sequence of SEQ ID NO: 14 and having the amino acid sequence of SEQ ID NO: 15 is referred to as an MLT transposase 2 (or MLT 2).
  • the transposase is from a Tc1/rnariner transposon system. See, e.g. P!asterk et a/. Trends in Genetics. 1999; 15 (8): 326-32,
  • the transposase is from a Sleeping Beauty transposon system (see, e.g. Cell. 1997;91 :501— 510) or a piggyBac transposon system (see, e.g. Trends Bioiechnoi. 2015 Sep; 33(9): 525-33. doi: 10.1016/j.tibtech.2015.06.009. Epub 2015 Jui 23).
  • the transposase Is from a LEAP-IN 1 type or LEAP-IN transposon system (Bioiechnoi J. 2018 Oct; 13(10):e1700748, doi: 10,1002/biot.201700748. Epub 2018 Jun 11).
  • a non-viral vector includes a LEAP-!N 1 type of LEAP!N Transposase (ATUM, Newark, CA),
  • the LEAP!N Transposase system includes a transposase (e.g., a transposase mRNA) and a vector containing one or more genes of interest (transposons), selection markers, regulatory elements, etc., flanked by the transposon cognate inverted terminal repeats (!TRs) and the transposition recognition motif (TT.AT).
  • the transiently expressed enzyme catalyzes high-efficiency and precise integration of a single copy of the transposon cassette (all sequences between the ITRs) at one or more sites across the genome of the host cell.
  • the LEAPIN Transposase generates stable transgene integrants with various advantageous characteristics, including single copy integrations at multiple genomic loci, primarily in open chromatin segments; no payload limit, so multiple independent transcriptional units may be expressed from a single construct; the integrated transgenes maintain their structural and functional integrity; and maintenance of transgene integrity ensures the desired chain ratio in every recombinant cell.
  • the ABCA4 is operab!y coupled to a promoter that can influence overall expression levels and cell-specificity of the transgenes (e.g. ABCA4 or a functional fragment thereof).
  • the promoter is a GAG promoter (cytomegalovirus (CMV) enhancer fused to the chicken b-actin promoter and rabbit beta-Globin splice acceptor) (1732 bp), which expresses In both RPE and photoreceptor levels in vivo and in vitro.
  • CMV cytomegalovirus
  • the GAG promoter comprises the following nucleotide sequence (SEQ ID NO: 16):
  • SEQ ID NO: 16 or a variant having at least about 80%, or at least about 85%, or at least about 90%, or at least about 93%, or at least about 95%, or at least about 97%, or at least about 98% identity thereto.
  • the promoter is CMV enhancer, chicken beta-Actin promoter and rabbit beta-Globin spiice acceptor site (GAG), optional!'/ comprising a nucleic acid sequence of SEQ ID NO: 16, or a variant having at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 85%, or of at least about 90%, or at least about 93%, or at least about 95%, or at least about 97%, or at least about 98% identity thereto.
  • GAG beta-Globin spiice acceptor site
  • the promoter is tissue-specific, i.e. retina-specific promoter
  • the transposase is a DNA sequence encoding the transposase
  • DMA sequence is aiso operab!y linked to a promoter.
  • a variety of promoters can be used, including tissue-specific promoters, inducible promoters, constitutive promoters, etc.
  • the retina-specific promoter is a retinal pigment epithelium (RPE) promoter, which can be RPE65 (retinal pigment epithelium-specific 65 kDa protein gene), IRBP (interphotoreceptor retinoid-binding protein), or VMD2 (viteiiiform macular dystrophy 2) promoter,
  • RPE retinal pigment epithelium
  • IRBP internal pigment epithelium-specific 65 kDa protein gene
  • IRBP interphotoreceptor retinoid-binding protein
  • VMD2 viteiiiform macular dystrophy 2
  • the RPt65, IRBP, and VMD2 promoters are described in, e.g,, Aguirre, Invest Ophthalmol Vis Sci. 2017 ; 58( 12) ; 5399— 5411 . doi:10.1167/iovs.17-22978.
  • An example of an RPE85 promoter that can be used in some embodiments is:
  • IRBP interphotoreceptor retinoid-binding protein
  • D NO: 4 or a functional fragment of a variant having at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 93%, or at least about 95%, or at least about 97%, or at least about 98% identity thereto,
  • VMD2 promoter was shown to specifically and exclusively target transgene expression to the RPE cells in vivo after a single subretinal Injection (in dogs). See Guziewicz et a/,, PioS One voi. 8,10 e75666. 15 Oct. 2013, doi: 10.1371 /journal . pone.0075666.
  • An example of a VMD2 promoter sequence (624 bp) that is the upstream region of the BEST1 gene see Esumi et a!., J. Biol. Chem. 2004; 279(18): 19064— 19073, which can be used in some embodiments, is:
  • the retina-specific promoter is a photoreceptor promoter, optionally selected from b- phosphodiesterase (PDE), rhodopsin kinase (GRK1), CAR (cone arrestin), retinitis pigmentosa 1 (RP1), and L-opsin.
  • PDE b- phosphodiesterase
  • GRK1 rhodopsin kinase
  • CAR cone arrestin
  • RP1 retinitis pigmentosa 1
  • L-opsin L-opsin.
  • the PDE and RP1 promoters, as well as a rhodopsin (Rho) promoter were shown to drive photoreceptor-specific expression in vitro. Kan eta!., Molecular Therapy, voi. 15, Suppl.
  • PDE promoter 200 bp
  • Di Polo et a/., Nucleic Acids Res. 1997 ;25(19) : 3863—3867 is:
  • GRK1 human rhodopsin kinase
  • SEQ ID NO: 7 " or a functional fragment of a variant having at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 93%, or at. least about. 95%, or at least about 97%, or at least about 98% identity thereto.
  • CAR promoters were also shown to drive strong expression in retina.
  • a CAR promoter (2026 bp) (see McDouga!d et a/,, Mol Ther Methods Clin Dev. 2019;13:380-389. Published 2019 Mar 28) is:
  • L-opsin promoter was shown to direct high-level GFP expression in mouse photoreceptors, Ye et ai, Hum Gene Then 2016;27(1 ):72— 82.
  • L-opsin promoter (1726 bp) (see Lee ei ai, Vision Res. 2008 Feb;48(3):332-8) is:
  • the retina-specific promoter is the RPE promoter that comprises a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5, or a variant having at least about 80%, or at least about 85%, or at least about 90%, or at least about 93%, or at least about 95%, or at least about 97%, or at least about 98% Identity thereto.
  • the retina-specific promoter is the photoreceptor promoter that comprises a nucleic acid sequence of SEQ ID NO: 6, SEQ ID NO: 7, SEQ !D NO: 8, or SEQ ID NO: 9, or a functional fragment of a variant having at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 93%, or at least about 95%, or at least about 97%, or at least about 98% identity thereto,
  • the present non-viral vectors may comprise at least one pair of an inverted terminal repeat at the 5' and 3' ends of the transposon.
  • an inverted terminal repeat is a sequence located at one end of a vector that can form a hairpin structure when used in combination with a complementary sequence that is located at the opposing end of the vector,
  • the pair of inverted terminal repeats is involved in the transposition activity of the transposon of the non-viral vector of the present disclosure, In particular involved in DNA addition or removal and excision of DNA of Interest.
  • the vector of the present disclosure may comprise at least two, three or four pairs of inverted terminal repeats.
  • the necessary terminal sequence may be as short as possible and thus contain as little inverted repeats as possible.
  • the vector of the present disclosure may comprise not more than one, not more than two, not more than three or not more than four pairs of inverted terminal repeats, in one embodiment, the vector of the present disclosure may comprise only one inverted terminal repeat.
  • the inverted terminal repeat of the present invention may form either a perfect inverted terminal repeat (or interchangeably referred to as “perfect inverted repeat”) or imperfect inverted terminal repeat (or interchangeably referred to as “imperfect inverted repeat”).
  • perfect inverted repeat refers to two identical DNA sequences placed at opposite direction
  • imperfect inverted repeat refers to two DNA sequences that are similar to one another except that they contain a few mismatches. These repeats (l.e. both perfect inverted repeat and imperfect inverted repeat) are the binding sites of transposase.
  • the ITRs of the non-viral vector are those of a piggyBac-!ike transposon, optionally comprising a TTAA repetitive sequence, and/or the ITRs flank the ABCA4.
  • the piggyBac-!ike transposon transposes through a “cut-and-paste” mechanism, and the plggyBac-like transposon can comprise a TTAA repetitive sequence.
  • the piggyBac transposon is a frequently used transposon system for gene modifications and does not require DNA synthesis during the actual transposition event.
  • the piggyBac element can be cut down from the donor chromosome by a transposase, and the split donor DNA can be reconnected with DNA iigase.
  • the gene transfer construct comprises a Super piggyBacTM (SPB) transposase. See Barnett eial. Blood 2016; 128(22):2167,
  • non-viral gene transfer tools can be used such as, for example, the Sleeping Beauty transposon system. See, e.g., Aronovich et ai. Human Molecular Genetics, 2011; 20(R1), R14-R20.
  • sequences of the transposon systems can be codon optimized to provide improved mRNA stability and protein expression in mammalian systems.
  • the gene transfer construct can be any suitable genetic construct, such as a nucleic acid construct, a plasmid, or a vector.
  • the gene transfer construct is DNA.
  • the gene transfer construct is RNA,
  • the gene transfer conduct can have DNA sequences and RNA sequences.
  • the present nucleic acids include polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides, or analogs or derivatives thereof.
  • transcriptionally- activated polynucleotides such as methylated or capped polynucleotides are provided.
  • the present compositions are RNA or DNA.
  • the present non-viral vectors are linear or circular DNA molecules that comprise a polynucleotide encoding a polypeptide and is operabiy linked to control sequences, wherein the control sequences provide for expression of the polynucleotide encoding the polypeptide.
  • the non-viral vector comprises a promoter sequence, and transcriptional and translational stop signal sequences.
  • Such vectors may include, among others, chromosomal and episomal vectors, e.g., vectors derived from bacterial plasmids, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, and vectors derived from combinations thereof,
  • the present constructs may contain control regions that regulate as we!! as engender expression.
  • the gene transfer construct can be codon optimized.
  • nucleic acid encoding the ABCA4. or a functional fragment thereof function as transgenes that are integrated into a host genome ⁇ e.g., a human genome) to provide desired clinical outcomes.
  • Transgene codon optimization can be used to optimize therapeutic potential of the transgene and its expression in the host organism. Codon optimization is performed to match the codon usage In the transgene with the abundance of transfer RNA (tRNA) for each codon in a host organism or cell. Codon optimization methods are known in the art and described in, for example, WO 2007/142954, which is incorporated by reference herein in its entirety. Optimization strategies can include, for example, the modification of translation initiation regions, alteration of mRNA structural elements, and the use of different codon biases.
  • the non-virai vector is a DNA plasmid that can comprise one or more insulator sequences that prevent or mitigate activation or inactivation of nearby genes.
  • the one or more insulator sequences comprise an HS4 insulator (1 ,2-kb 5'-HS4 chicken b-g!obin (cHS4) insulator element) and an D4Z4 insulator (tandem macrosatel!ite repeats linked to Facio-Scapulo-Humerai Dystrophy (FSHD).
  • the sequences of the HS4 insulator and the D4Z4 insulator are as described in Riva!-Gerv!er et ai. Mot Ther, 2013 Aug; 21 (8): 1538-50, which is incorporated herein by reference in its entirety,
  • the gene of the gene transfer construct is capable of transposition in the presence of a transposase.
  • the non-virai vector in accordance with embodiments of the present disclosure comprises a nucleic acid construct encoding a transposase
  • the transposase can be an RNA transposase plasmid, in some embodiments, the non-virai vector further comprises a nucleic acid construct encoding a DNA transposase plasmid, in some embodiments, the transposase is an in v/ira-iranscribed RNA transposase.
  • the transposase is capable of excising and/or transposing the gene from the gene transfer construct to site- or locus-specific genomic regions.
  • a composition comprising a gene transfer construct in accordance with the present disclosure can include one or more non-virai vectors.
  • the transposase can be disposed on the same (cis) or different vector (trans) than a transposon with a transgene. Accordingly, in some embodiments, the transposase and the transposon encompassing a transgene are in c/s configuration such that they are included in the same vector. In some embodiments, the transposase and the transposon encompassing a transgene are in trans configuration such that they are Included in different vectors.
  • the vector is any non-virai vector in accordance with the present disclosure.
  • the transposase is derived from Bornhyxmon, Xenopus tropicalis, Trichopiusia ni s Rhindophus ferrumequinum, Rousettus aegyptiacus, Phyi!osiornus discolor , Myotis myotis, Myotis iucifugus, Pteropus varnpyrus, Pipistreiius kuhlii, Pan troglodytes, Moiossus molossus, or Homo sapiens, and/or Is an engineered version thereof, in some embodiments, the transposase specifically recognizes the ITRs.
  • the transposase can include DNA or RNA sequences encoding Bombyxmori, Xenopus tropicalis, or Trichopiusia ni proteins, See, e.g., U.S. Pat. No, 10,041,077, which is incorporated herein by reference in its entirety.
  • a transposase may be introduced into the cell directly as protein, for example using cell-penetrating peptides (e.g., as described in Ramsey and Flynn. Pharmacol. Ther 2915; 154: 78-86); using small molecules including salt plus propanebetalne (e.g., as described in Astoifo et ai. Ceil 2015; 161 :674-690); or electroporation (e.g, as described In Morgan and Day. Methods in Molecular Biology 1995; 48: 63-71),
  • the transposon system can be implemented as described, e.g., In U.S. Pat. No. 10,435,696, which is incorporated herein by reference in its entirety.
  • the described composition includes a transgene (e.g., ABCA4 or a functional fragment thereof) and a transposase in a certain ratio.
  • a transgene to transposase ratio is selected that improves efficiency of transpositional activity.
  • the transgene to transposase ratio can be dependent on the concentration of the transfected gene transfer construct, and other factors, in some embodiments, the ratio of the nucleic acid encoding the ABCA4 , or a functional fragment thereof, to the nucleic acid construct encoding the transposase is about 5:1, or about 4: 1 , or about 3: 1 , or about 2: 1 , or about 1 : 1 , or about 1 :2, or about 1 :3, or about 1 :4, or about 1 :5.
  • the ratio of the nucleic acid encoding the ABCA4 porte!n to the nucleic acid construct encoding the transposase is about 2:1.
  • a composition comprising a gene transfer construct comprises (a) a nucleic acid encoding an ATP Binding Cassette Subfamily A Member 4 (ABC) transporter ( ABCA4 ) protein, or a functional fragment thereof; (b) CAG promoter; and (c) a non-virai vector comprising one or more transposase recognition sites and one or more inverted terminal repeats (ITRs) or end sequences, wherein the ABCA4 protein is human ABCA4 protein, or a functional fragment thereof, that comprises a nucleotide sequence encoding a protein having an amino acid sequence of SEQ ID NO: 1, or a variant having at least about 95% identity thereto.
  • a composition comprising a gene transfer construct.
  • the composition comprises (a) a nucleic acid encoding an ATP Binding Cassette Subfamily A Member 4 (ABC) transporter ( ABCA4 ) protein, or a functional fragment thereof; (b) CAG promoter; and (c) a non -vira! vector comprising one or more transposase recognition sites and one or more inverted terminal repeats (!TRs) or end sequences, wherein the ABCA4 protein is human ABCA4, or a functional fragment thereof, that is encoded by a nucleotide sequence of SEQ ID NO: 2, or a valiant having at least about 95% Identity thereto.
  • ABSC ATP Binding Cassette Subfamily A Member 4
  • !TRs inverted terminal repeats
  • a method for treating and/or mitigating Inherited Macular Degeneration comprising: (a) contacting a cel! obtained from a patient or another individual with a composition of claim 62; (b) contacting the cell with a nucleic acid construct encoding a transposase that is derived from Bombyxmori, Xenopus tropicalis, Trichopiusia ni, Rhinotophus ferrumequinum, Rousettus aegyptiacus, Phyiiostomus discoior, Myotis myotis, Myotis !ucifugus, Pteropus vampyrus, Pipistrellus kuhlii, Pan trog!od es, Mo!ossus moiossus, or Homo sapiens, and/or an engineered version thereof, wherein the ratio of the nucleic acid encoding the ABCA4 protein, or a functional
  • the non-viral vector Is a conjugated polynucleotide sequence that is introduced Into cells by various transfection methods such as, e.g., methods that employ lipid particles.
  • a composition, including a gene transfer construct comprises a delivery particle, in some embodiments, the delivery particle comprises a lipid-based particle (e.g., a lipid nanoparticle (LNP)), cationic lipid, or a biodegradable polymer).
  • LNP lipid nanoparticle
  • Lipid nanoparticle (LNP) delivery of gene transfer construct provi es certain advantages, including transient, non-integrating expression to limit potential off-target events and immune responses, and efficient delivery with the capacity to transport large cargos.
  • LNPs have been used for delivery of mRNA into the retina. See Patel et as. , J Control Release. 2019 Jun 10:303:91-100. doi: 10.1016/j.jconrel.2019.04.015. Epub 2019 Apr 12, Also, U.S. Pat. No. 10,195,291, for example, describes the use of LNPs for delivery of RNA interference (RNAi) therapeutic agents,
  • the composition in accordance with embodiments of the present disclosure is in the form of an LNP.
  • the LNP comprises one or more lipids selected from 1,2-dioleoyi-3-trimethylammonium propane (DOTAP); N,N-dioleyl-N,N-dimethylammonium chloride (DODAC); N-(2,3-dia!ey!oxy)propyl)-N,N,N- tr!methy!ammonium chloride (DOTMA); N,N-distearyi-N,N-dimethylammonium bromide (DDAB), a cationic cholesterol derivative mixed with dimethylaminoethane-carbamoyl (DC-Chol), phosphatidylcholine (PC), triolein (glyceryl trioleate), and 1 ,2-distearoyl-sn-g!ycero-3-phosphoethano!amine-N-[carboxy(po!yethylene DOTAP
  • DODAC N
  • an LNP can be as shown in FIG. 2, which is adapted from Pate! etal., J Control Release 2019; 303:91-100.
  • the LNP can comprise one or more of a structural lipid (e.g. DSPC), a PEG-conjugated lipid (CDM-PEG), a cationic lipid (MC3), cholesterol, and a targeting ligand (e.g. Ga!NAc).
  • a structural lipid e.g. DSPC
  • CD-PEG PEG-conjugated lipid
  • MC3 cationic lipid
  • cholesterol e.g. Ga!NAc
  • a targeting ligand e.g. Ga!NAc
  • the composition can have a lipid and a polymer In various ratios, wherein the lipid can be selected from, e.g., DOTAP, DC-Chol, PC, Triolein, DSPE-PEG, and wherein the polymer can be, e.g., PE! or Poly Laetic-co- Glycolic Acid (PLGA).
  • lipid can be selected from, e.g., DOTAP, DC-Chol, PC, Triolein, DSPE-PEG, and wherein the polymer can be, e.g., PE! or Poly Laetic-co- Glycolic Acid (PLGA).
  • the ratio of the !ipid and the polymer is about 0.5:1, or about 1 :1, or about 1:1.5, or about 1 :2, or about 1 :2.5, or about 1 :3, or about 3:1, or about 2.5:1, or about 2:1, or about 1.5:1, or about 1 :1 , or about 1:0.5.
  • the LNP comprises a cationic lipid, non-limiting examples of which include N, N-dioieyi-N, N- dimethy!ammonium chloride (DODAC), N,N-disteary1-N,N-dimethy!ammonium bromide (DDAB), N-(!-(2,3- d i o I eoy I oxy ) p ro py I )- N , N , N -trl me thy I am rno n i u m chloride (DOTAP), N-(i-(2,3-dio!ey!oxy)propyl)-N,N,N- trimethylammonium chloride (DOTMA), N,N-dimethyi-2,3-dioieyioxy)propy!amine (DODMA), 1,2-DiLinoiey!oxy-N,N- dimethylaminopropane (DLinD
  • DODAC
  • the LNP comprises one or more molecules selected from poiyethyienimine (PEI) and poiy(iactic- co-glycoiic acid) (RIGA), and N-Acety!ga!actosarnine (GalNAc), which are suitab!e for hepatic delivery
  • the LNP comprises a hepatic-directed compound as described, e.g., in U.S, Pat. No. 5,985,826, which is incorporated by reference herein in its entirety, GalNAc is known to target Asialogiycoprotein Receptor (ASGPR) expressed on mammalian hepatic cells, See Hu etai. Protein PeptLett. 2G14;21 (10): 1025-30.
  • ASGPR Asialogiycoprotein Receptor
  • the gene transfer constructs of the present disclosure can be formulated or comp!exed with PEI or a derivative thereof, such as polyethyieneimine-po!yethy!enegiycoi-N-acetylgalactosamine (PE!-PEG-GAL) or polyethyieneimine-poiyethyleneglycoi-tri-N-acetylgalactosamine (P E ⁇ -P EG-tri GAL) derivatives.
  • PEI polyethyieneimine-po!yethy!enegiycoi-N-acetylgalactosamine
  • P E ⁇ -P EG-tri GAL polyethyieneimine-poiyethyleneglycoi-tri-N-acetylgalactosamine
  • the LNP is a conjugated iipid, non-limiting examples of which include a polyethyleneglycol (PEG)--lipid including, without limitation, a PEG-diaey!glycero! (DAG), a PEG-dia!ky!oxypropy! (DM), a PEG- phospholipid, a PEG-ceramide (Cer), or a mixture thereof
  • PEG-DAA conjugate may be, for example, a PEG- di!auryioxypropy! (C12, a PEG-dimyristy!oxypropy! (C14), a PEG-dipa!mlty!oxypropyi (C16), or a PEG- disteary!oxypropy! (C18).
  • a nanoparticle is a particle having a diameter of less than about 1000 nm.
  • nanoparticies of the present disclosure have a greatest dimension (e.g,, diameter) of about 500 nm or less, or about 400 nm or less, or about 300 n or less, or about 200 nm or less, or about 100 nm or less in some embodiments, nanoparticies of the present invention have a greatest dimension ranging between about 50 nm and about 150 nm, or between about 70 n and about 130 n , or between about 80 nm and about 120 nm, or between about 90 nm and about 110 nm.
  • the nanoparticies of the present invention have a greatest dimension (e.g., a diameter) of about 100 nm, in some aspects, the compositions in accordance with the present disc!osure can be delivered via an in vivo genetic modification method. In some embodiments, a genetic modification in accordance with the present disclosure can be performed via an ex vivo method.
  • a method for preventing or decreasing the rate of photoreceptor loss in a patient comprises administering to a patient in need thereof a composition according to any embodiment, or a combination of embodiments, of the present disclosure.
  • the method Includes delivering the composition via a suitable route, including administering by injection.
  • the present methods and compositions can provide durable prevention or decreasing of the rate of photoreceptor loss, and the need for additional therapeutic agents can therefore be decreased or eliminated.
  • the method is performed in the absence of a steroid treatment.
  • the method can be substantially non-lmmunogenic.
  • the present invention provides an ex vivo gene therapy approach. Accordingly, in some aspects, a method for preventing or decreasing the rate of photoreceptor loss in a patient is provided that comprises (a) contacting a ceil obtained from a patient (autologous) or another individual (a!!ogeneic) with a composition in accordance with embodiments of the present disclosure; and (fa) administering the cell to a patient in need thereof.
  • the method for treating and/or mitigating an Inherited Macular Degeneration comprises administering to a patient in need thereof a composition in accordance with embodiments of the present disclosure.
  • the composition is administered using any of the techniques described herein, in some embodiments, the in vivo and ex vivo methods described herein can treat and slow progression of various MDs which are a heterogeneous group of disorders characterized by bilateral symmetrical central visual loss. MDs include Stargardt disease, Best disease, X-!!nked reti noschisis, pattern dystrophy, Sorsby fundus dystrophy, and autosomal dominant drusen.
  • Best disease is an autosomal dominant condition associated with disease-causing variants in BEST ⁇ , X-!inked retinoschisis (XLRS) is the most common form of juvenile-onset retinal degeneration in male adolescents; pattern dystrophy (PD) is a group of disorders characterized by variable distributions of pigment deposition at the level of the RPE; Sorsby fundus dystrophy (SFD) is a rare macular dystrophy often leading to bl!aterai centra! visual loss In the fifth decade of life; and autosomal dominant drusen (ADD) Is an autosomal dominant condition characterized by drusen-iike deposits at the macula, which may have a radiating or honeycomb-like appearance.
  • an e.x vivo method for treating and/or mitigating an iMD comprises (a) contacting a DCi obtained from a patient or another individual with a composition in accordance with embodiments of the present disclosure, and (b) administering cells to a patient in need thereof.
  • the IMD is a STGD.
  • the STGD is STGD Type 1 (STGD1).
  • the STGD disease can be STGD Type 3 (STGD3) or STGD Type 4 (STGD4) disease.
  • the iMD is characterized by one or more mutations in one or more of ABCA4, ELOVL4, PROM1, BEST 1 and PRPH2.
  • the ABCA4 mutations are autosoma! recessive mutations.
  • PROM1 gene Mutations in PROM1 gene have been shown to result in retinitis pigmentosa and Stargardt disease, and this gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. See, e.g., Lonnroth et al., Int J Oncol. 2014; 45(6): 2208- 2220.
  • the BEST1 gene provides instructions for making a protein caiied bestrophin-1, which appears to play a critical roie in norma! vision
  • Mutations in the BEST1 gene cause detachment of the retina and degeneration of photoreceptor (PR) cells due to a primary channelopathy in the neighboring RPE ceils, Guziewicz et a!., PNAS March 20, 2018 115 (12) E2839-E2848; see a/so Petrukhin et a!., Nature Genetics 1998; voi.19:241-247, Disease-causing variants in BEST 1 have been linked to Best Disease (BD), which is the second most common MD, affecting approximately 1 in 10 000, Rahman et a!., Br J Ophthalmol.
  • BD Best Disease
  • BEST1 sequence variants also account for at least four other phenotypes, such as adult vite!iform MD, autosomal dominant vitreochoroidopathy, autosomal recessive bestrophinopathy, and retinitis pigmentosa. Id.
  • the PRPH2 (peripherin-2) gene encodes a PR-specific tetraspanin protein called peripherin-2/retinal degeneration slow (RDS), and mutations in PRPH2 have been shown to cause forms of retinitis pigmentosa and macular degeneration. Conley & Naash. Cold Spring Harb Perspect Med. 2014 Aug 28;4(11):a017376, Mutations in PRPH2 have been identified in patients with Siargardt macular degeneration.
  • RDS peripherin-2/retinal degeneration slow
  • pathogenic mutations in one or more of ABCA4, ELOVL4, PROM1, BEST1 and PRPH2 can be corrected using the described methods for treating and/or mitigating related macular dystrophy conditions.
  • One of the advantages of ex vivo gene therapy is the ability to “sample” the transduced ceils before patient administration, This facilitates efficacy and allows performing safety checks before introducing the ce!!(s) to the patient, For example, the transduction efficiency and/or the clonailty of integration can be assessed before infusion of the product.
  • the present disclosure provides compositions and methods that can be effectively used for ex vivo gene modification,
  • any of the in vivo and ex vivo methods described herein improve distance visual acuity of the patient of the patient, In some embodiments, the method is substantia!y non-immunogenic.
  • the method requires a single administration, which simp!ifies the delivery of the present composition and improves overall patient experience.
  • Many patients afflicted by various IMDs disorders are children, and delivering a durable, substantially non-immunogenic treatment in accordance with some embodiments of the present disclosure - as a one-time administration - facilitates the therapy delivery process and decreases the burden on the patient.
  • accumulation of lipofuscin in the RPE has been associated with the development of STGD, age- related macular degeneration, and other retinal diseases.
  • the clumps of lipofuscin, a yellow substance that forms flecks accumulate in and around the macula, impairing central vision.
  • a main component of lipofuscin is the bis-retinoid N-retinyiidene-N-retinylethanoiamine (A2E), though lipofuscin includes other bis-retinoids.
  • A2E is a fluorescent material that accumulates, with age or in some retinal disorders such as STGD, in the lysosomes of RF 5 E of the eye, RPE lipofuscin includes A2E and an additional f!uorophore - a double bond isomer of A2E, /so-A2E.
  • A2E was shown to trigger the accumulation of llpofuscin-like debris in the RPE, Mihai & Washington, Cell Death & Disease 5, el 348(2014).
  • A2E can be responsible tor RPE debris found in the human eye, which encompass llpofuscin-like bodies, iate-stage lysosomes, abnormal glycogen and lipid deposits, and inclusions that show heterogeneous electron density, id.
  • A2E thus drives retinal senescence and associated degeneration, A2E’s chemical precursor, vitamin A aldehyde (retinaldehyde), also plays a role in the degenerative process, id.
  • lowering levels of one or more of retinaldehyde, A2E, and /so-A2E can treat or mitigate lipofuscin accumulation in the retina, e,g,, in the RPE and/or the underlying Bruch’s membrane, In some embodiments, the method reduces or prevents the formation of RPE debris. In some embodiments, the lowering levels of one or more of retinaldehyde, A2E, and /so- A2E can treat or mitigate accumulation of vitamin A dimers in the RPE and Bruch’s membrane (BM).
  • BM Bruch’s membrane
  • the method provides a lowering of one or more of retinaldehyde, N-retiny!idene- N-reti nyiethanoiamine (A2E) and iso- A2E relative to a level of one or more of retinaldehyde, A2E, and iso-A2E without the administration of the present composition
  • levels of one or more of retinaldehyde, A2E, and /SO-A2E are lowered (relative to a level of one or more of retinaldehyde, A2E. and iso-A2E without the administration of the present composition) are lowered by greater than at least about a 40%.
  • the method provides greater than about a 40%, or greater than about a 50%, or greater than about a 80%, or greater than about a 70%, or greater than about a 80%, or greater than about a 90% lowering, in some embodiments, a nucleic acid construct encoding a iransposase is administering to the patient.
  • the transposase can be derived from Bombyx mod, Xenopus tropicaiis, Trichopiusia ni, Rhinolophus ferrumequinum , Rousettus aegyptiacus, Phyiiostomus discolor, Myotis myotis, Myotis !ucifugus, Pieropus vampyrus, Pipistreilus kuhiii, Part troglodytes, Molossus moiossus, or Homo sapiens, and/or an engineered version thereof.
  • the ex vivo method for preventing or decreasing the rate of photoreceptor loss in a patient comprises contacting the ceils with a nucleic acid construct encoding a transposase, optionally derived from Bombyx mod, Xenopus tropicaiis, Trichopiusia ni, Rhinoiophus ferrumequinum, Rousettus aegyptiacus, Phyiiostomus discolor, Myoiis yotis, Myoiis iucifugus, Pteropus vampyrus, Pipistre!!us kuhlii, Pan troglodytes, Moiossus molossus, or Homo sapiens, and/or an engineered version thereof.
  • a transposase optionally derived from Bombyx mod, Xenopus tropicaiis, Trichopiusia ni, Rhinoiophus ferrumequinum, Rousettus aegypt
  • the method for preventing or decreasing the rate of photoreceptor loss in a patient is performed in the absence of a steroid treatment.
  • Steroids such as glucocorticoid steroids (e.g., prednisone) have been used to improve effectiveness of AAV-based gene therapy by reducing immune response.
  • glucocorticoid steroids e.g., prednisone
  • steroid treatment is not without side effects,
  • the compositions and methods of the present disclosure can be substantially non-immunogenic, and can therefore eliminate the need for a steroid treatment.
  • the methods are performed in combination with a steroid treatment.
  • the method can be used to administer the described composition in combination with one or more additional therapeutic agents.
  • additional therapeutic agents comprise one or more of an anti-Vascular endothelial growth factor (VEGF) therapeutic agents including aflibercept (EYLEA), ranlbizumab (LUCENT!S), and bevac!zumab (Avast!n).
  • VEGF anti-Vascular endothelial growth factor
  • EYLEA aflibercept
  • LLUCENT!S ranlbizumab
  • bevac!zumab Avast!n
  • the additional therapeutic agents can include deuterated vitamin A and/or other vitamins or nutritional supplements (e.g., beta carotene, lutein, and zeaxanthin).
  • the administration can be intra-vitreal or intra-retinai.
  • the administering is to RPE ce!s and/or photoreceptors.
  • the compositions for non-vira! gene therapy in accordance with the present disclosure can be administered via various delivery routes, including the administration by injection.
  • the injection is intra-vitreal or intra-retinai.
  • the injection is sub-vitrea! or sub-retina!, in some embodiments, the Injection is sub-RPE,
  • the in vitro or ex vivo method for treating and/or mitigating an i!viD provides improved distance visual acuity and/or decreased the rate of photoreceptor loss as compared to a lack of treatment. In some embodiments, the method results in improvement of best corrected visual acuity (BCVA) to greater than about 20/200,
  • the method for treating and/or mitigating an IMD results in improvement of retinal or foveal morphology, as measured by fundus autofluorescence (FAF) or Spectral Domain-Optica! Coherence Tomography (SD- OCT).
  • FAF is a non-invasive retina! imaging modality used to provide a density map of !ipofuscin in the retina! pigment epithelium. See Madeline et ai, int J Retin Vttr2, 12 (2016); Sepah et al, Saudi J Ophthalmol. 2014;28(2): 111-116; Sparrow et a!., investigative Ophthalmology & Visual Science September 2010; vo!, 51 :4351-4357.
  • SD-OCT is an interferometric technique that provides depth-resolved tissue structure information encoded in the magnitude and delay of the back-scattered light by spectral analysis of the interference fringe pattern, Yaqoob et ai, Biotechniques, voi. 39, No. 6S; published Online:30 May 2018,
  • Other imaging technologies can be used as well, including, e.g., a scanning laser ophthalmoscopy (SLQ), Fluorescence lifetime imaging ophthalmoscopy (FLIO), and two-photon microscopic imaging (TPM), Images (of one or both eyes) acquired using a suitable technology can be analyzed to assess parameters of a patient, including fluorescence intensity, For example, FAF that is characterized by a genera! increase of autofiuorescence intensity is indicative of the Stargardf disease, at early stages of the disease. Burke etai... invest Ophthalmol Vis Sci. 2014; 55: 2841 -2852.
  • the method results in reduction or prevention of one or more of wavy vision, blind spots, blurriness, loss of depth perception, sensitivity to glare, impaired color vision, and difficulty adapting to dim lighting (delayed dark adaptation) in the patient.
  • the method can be used to administer the described composition in combination with one or more additional therapeutic agents.
  • additional therapeutic agents comprise one or more of Soraprazan, isotretinoin, Dobesiiate, 4-methyipyrazo!e, ALK-001 9 (C20 deuterated vitamin A), Fenretinide (a synthetic form of vitamin A), LBS-50Q, A1120, Emixustat, Fenofibrate, and Avacincaptad pegol.
  • the method obviates the need for an additional therapeutic agent, which can be any of the above therapeutic agents.
  • the method obviates the need for steroid treatment.
  • composition in accordance with the present disclosure comprises a pharmaceutically acceptable carrier, excipient or diluent.
  • compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
  • suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS).
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, ch!orobutanoi, phenol, ascorbic acid, thimerosa!, and the like.
  • isotonic agents tor example, sugars, poiyaicohois such as mannitol, sorbitol, sodium chloride in the composition
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin,
  • Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of Ingredients enumerated above, as required, followed by filtered sterilization, Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • sterile powders for the preparation of sterile injectable solutions the preferred methods of preparation are vacuum drying and freeze-drying, which yield a powder of the active ingredient plus any additional desired ingredient from a previously steriie-fiitered solution thereof.
  • Therapeutic compounds can be prepared with carriers that will protect the therapeutic compounds against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatibie polymers can be used, such as collagen, ethylene vinyl acetate, polyanhydrides (e.g., poiyj1,3-bis(carboxyphenoxy)propane-co-sebac!c-acid] (PCPP-SA) matrix, fatty acid dimer- sebacic acid (FAD-SA) copolymer, po!y(iactide-co-giyco!ide)), po!yg!ycoiic acid, collagen, poiyorthoesters, polyethyienegiycoi-coated liposomes, and po!ylactic acid.
  • PCPP-SA polyanhydrides
  • FAD-SA fatty acid dimer- sebacic acid copolymer
  • Such formulations can be prepared using standard techniques, or obtained commercially, e.g., from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811. Semisolid, gelling, soft-ge!, or other formulations (including controlled release) can be used, e.g., when administration to a surgical site is desired. Methods of making such formulations are known In the art and can include the use of biodegradable, biocompatibie polymers. See, e.g., Sawyer eta!., Yale J Biol Med. 2006; 79(3-4): 141-152.
  • the stable integration comprises an introduction of a poiynuc!eotide into a chromosome or mini-chromosome of the cell and, therefore, becomes a relatively permanent pari of the cellular genome
  • the present Invention relates to determining whether a gene of interest, e.g. ABCA4 transferred into a genome of a host
  • the method may include performing a polymerase chain reaction with primers flanking the gene of interest; determining the size of the amplified polymerase chain reaction products obtained; and comparing the size of products obtained with a reference size, wherein if the size of the products obtained matches the expected size, then the gene of interest was successfully transferred.
  • a host ceil comprising a composition as described herein (e.g., without limitation, a composition comprising the gene transfer construct and/or transposase).
  • the host cell Is a prokaryotic or eukaryotic cell, e.g. a mammalian cell.
  • a transgenic organism that may comprise cells which have been transformed by the methods of the present disclosure, in one example, the organism may be a mamma! or an insect.
  • the organism may include, but is not limited to, a mouse, a rat, a monkey, a dog, a rabbit and the like.
  • the organism When the organism is an insect, the organism may include, but is not limited to, a fruit fly, a mosquito, a bo!!worm and the like.
  • compositions can be included in a container, kit, pack, or dispenser together with instructions for administration,
  • kits comprising: i) any of the aforementioned gene transfer constructs of this invention, and/or any of the aforementioned DCis of this invention and ii) a container.
  • the kits further comprise instructions for the use thereof.
  • any of the aforementioned kits can further comprise a recombinant DMA construct comprising a nucleic acid sequence that encodes a transposase,
  • the term “about” when used in connection with a referenced numeric indication means the referenced numeric indication plus or minus up to 10% of that referenced numeric indication, For example, the language “about 50” covers the range of 45 to 55.
  • an “effective amount,” when used in connection with medical uses is an amount that is effective for providing a measurable treatment, prevention, or reduction in the rate of pathogenesis of a disease of interest.
  • compositional percentages are by weight of the total composition, unless otherwise specified.
  • the word “include,” and its variants is intended to be non-limiting, such that recitation of items in a list is not to the exclusion of other iike items that may also be useful in the compositions and methods of this technology.
  • the terms “can” and “may” and their variants are intended to be non-limiting, such that recitation that an embodiment can or may comprise certain elements or features does not exclude other embodiments of the present technology that do not contain those elements or features,
  • the words “preferred” and “preferably” refer to embodiments of the technology that afford certain benefits, under certain circumstances. However, other embodiments may also be preferred, under the same or other circumstances, Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful, and is not intended to exclude other embodiments from the scope of the technology,
  • compositions described herein needed for achieving a therapeutic effect may be determined empirically in accordance with conventional procedures for the particular purpose.
  • the therapeutic agents are given at a pharmacologically effective dose
  • a “pharmacologically effective amount,’’ “pharmacologically effective dose,” “therapeutically effective amount,” or “effective amount” refers to an amount sufficient to produce the desired physiological effect or amount capable of achieving the desired result, particularly for treating the disorder or disease
  • An effective amount as used herein would include an amount sufficient to, for example, delay the development of a symptom of the disorder or disease, alter the course of a symptom of the disorder or disease (e.g., slow the progression of a symptom of the disease), reduce or eliminate one or more symptoms or manifestations of the disorder or disease, and reverse a symptom of a disorder or disease.
  • Therapeutic benefit also includes halting or slowing the progression of the underlying disease or disorder, regardless of whether improvement is realized,
  • Effective amounts, toxicity, and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g,, for determining the LDso (the dose lethal to about 50% of the population) and the ED ® (the dose therapeutically effective in about 50% of the population).
  • the dosage can vary depending upon the dosage form employed and the route of administration utilized,
  • the dose ratio between toxic and therapeutic effects Is the therapeutic index and can be expressed as the ratio LDso/ED ®.
  • compositions and methods that exhibit large therapeutic indices are preferred.
  • a therapeutically effective dose can be estimated initially from in vitro assays, including, for example, cell culture assays, Also, a dose can be formulated in animal models to achieve a circulating plasma concentration range that Includes the IC ® as determined in DCi culture, or in an appropriate animal model. Levels of the described compositions in plasma can be measured, for example, by high performance liquid chromatography. The effects of any particular dosage can be monitored by a suitable bioassay. The dosage can be determined by a physician and adjusted, as necessary, to suit observed effects of the treatment.
  • compositions for treating the diseases or disorders described herein are equally applicable to use of a composition for treating the diseases or disorders described herein and/or compositions for use and/or uses in the manufacture of a medicaments for treating the diseases or disorders described herein.
  • Non-virai, transposon expression vectors schematically shown in FIGs. 1A-1I are designed and cloned for in vitro, in vivo, and e; ⁇ vivo studies of transfection, transposition efficacy, and expression studies in retinal cell lines.
  • FIG. 1A shows a phosphogiycerate kinase (PGK)-GFP iransposon construct with a PGK promoter, which is used to determine a transposon (In): transposase (Is) ratio and transposition efficacy by GFP fluorescent-activated cell sorting (FACS).
  • FIG. 1B and 1C show transposon constructs that are used to assess effectiveness if a retinal pigment epithelium promoter (RPEP) (FIG. 1B) and a photoreceptor promoter (PRP) (FIG. 1C) to selectively maximize GFP expression (determined by FACS) and copy number [determined using Droplet Digital PCR (ddPCR) or quantitative PCR (qPCR) technology],
  • RPEP retinal pigment epithelium promoter
  • PRP photoreceptor promoter
  • FIG. 1D shows a BEST-RPEP construct that can be used to assess the expression of ABCA4 by flow cytometry and ABCA4 copy number (using, e.g. ddPCR or qPCR).
  • FIG. 1E shows a BEST-PR.P construct that can similarly be used to assess the expression of ABCA4 by flow cytometry and ABCA4 copy number (using, e.g. ddPCR or qPCR),
  • the transposon constructs shown in FIGs. 1 F, 1G, 1H, and 11 are used in human iPSCs and transgenic ahead -/- mice studies which are discussed below.
  • the constructs in FIGs. 1F and 1H include a BEST-RPEP promoter, and constructs in FIGs. 1G and 11 include a BEST- PRP promoter.
  • Tn transposon
  • Ts transposase ratios
  • GFP Green Fluorescent Protein
  • the study involves establishing cultures of human retina! derived adherent cel! lines (ARPE-19, RPE-1) and a derived mouse photoreceptor ceil line (661 W). Cultures of HEK293 ( ABCA4 negative) and HeLa ( ABCA4 positive) cells are used as controls, in this example, the transposon vector as shown in FIG. 1A can be used. LEAPIN transposase technology can be used (ATLi!vi, Newark, CA).
  • a iransposon vector expressing a GFP driven by a constitutive promoter e.g. the vector designed as shown in FIG. 1A
  • Cells can be transfected with gene transfer constructs having two, three, or greater than three different Tn:Ts ratios, Conditions which resuit in cultures with relatively high numbers of GFP positive celis can be kept in culture by passage for 14 days, In these studies, 14 days is expected to be a sufficient period of time to allow for loss of transient expression of GFP.
  • Transfected cultures are analyzed after 14 days by flow cytometry to determine the percentage of cells which have retained GFP expression, as a measure of stable expression. Cultures with greater than 40% GFP expression can be analyzed by ddPCR or qPCR, to determine a copy number.
  • promoters are assessed and selected based on their ability to cause specific and high levels of GFP expression in retina! cel! lines derived from the retinal pigment epithelium (RPE) or photoreceptors in this example, the iransposon vectors as shown in FIGs. 1B and 1C can be used.
  • RPE (VMD2, IRBP, RPE65), photoreceptor [PDE, Rhodopsin kinase (Rk or GRK1), CAR (cone arresiin), RP1, L-opsin]
  • PDE Rhodopsin kinase
  • CAR cone arresiin
  • RP1, L-opsin non-specific promoters
  • PGK non-specific promoters
  • the generated constructs are transfected using a certain condition (which can be identified as described in Example 2), into two human RPE cell lines (ARPE-19, RPE- 1), a derived mouse photoreceptor cel! line (661 W), and two control ceil lines (HEK293. HeLa).
  • Relative expression levels are determined qualitatively (visually by eye or by flow cytometry), and promoters which express strongly in RPE or the photoreceptor cell line and relatively lower in the control cells, are to be considered retina-specific for purposes of this assay.
  • ARPE-19, RPE-1 , and 661 W transfections with promoters considered to be RPE- and photoreceptor- specific are cultured by passage for -14 days and are analyzed by flow cytometry after this period. Differential levels of GFP expression are taken as a measure of the relative strengths of these promoters in the studied DCi lines.
  • HEK293 cells Endogenous ABCfi.4 positive and negative controls are confirmed using HEK293 cells.
  • HEK293 cells are used because it has been shown that ABCA4 has a similar transport function in transfected HEK293 ceils as it does within the photoreceptor (see Sabirzhanova et a/., J Biol Chern 2015;290:19743-55; Quazi et a!,, Nat Commun 2012;3:925) and RT-PCR does not show endogenous ABCA4 expression in untransfected HEK293 (protein atlas). See Bauwens et a/., Genet Med 2019;21 :1761-71.
  • HeLa cells express endogenous ABCA4 (protein atlas).
  • HEK293 cells are labeled with an antibody against human ABCA4 using standard methods.
  • the labeled ceils are quantified by flow cytometry and visualized by immunocytochemistry techniques.
  • mRNA levels of endogenous ABCA4 are quantified by ddPCR or RT qPCR,
  • an RPE-specific promoter and a photoreceptor promoter can be used that are selected as described in Example 3,
  • the selected promoters are cloned into transposon vectors such as, e.g. the transposon vectors as shown in FIGs. 1D and 1 E, driving expression of both human and mouse ABCA4.
  • the transposon constructs are transfected using a transfection condition determined, e.g., as described in Example 2, into human retinal derived adherenttiti lines (ARPE-19, RPE-1), and a photoreceptor cell line (661 W).
  • HEK293 ( ABCA4 negative) and HeLa ( ABCA4 positive) cells are used as untransfected controls.
  • the ceils are cultured by passage for ⁇ 14 days. After this period, cultured cells were labeled using an anti- ABCA4 antibody, and the percentage of cells which express ABCA4 was quantified by flow cytometry. Percentage of fluorescent cells, analyzed by flow cytometry, is used to monitor transfection
  • ABCA4 transcript is quantified by ddPCR or RT qPCR using known methods.
  • Example 5 Generating Transposon (Tn) and Transposase (Ts) Constructs for Studies in STGD Patient iPSCs, Transgenic abca4 -/- Mice, and Large Animal Models
  • the aim of this study is to identify iead transposon (In) and transposase (Ts) constructs for in vivo, in vitro , . and ex vivo testing in patient’s individual p!uripotent stem ceils (iPSCs), transgenic ahca4 -I- mice, and iarge animal models (e.g, abcd4 mutant Labrador retriever).
  • Vector constructs as shown in FIGs. 1 F, 1 G, 1 H, and 11 can be used.
  • the constructs can include a Luciferase (pLuc) or a GFP gene, and photoreceptor and RPE-specific promoters.
  • An objective of this study was to determine the lipofection conditions to transpose 661 VV photoreceptor ceils using the MLT transposase (RNA helper) of the present disclosure, using green fluorescent protein (GFP) driven by a CAG-GFP donor construct.
  • MLT transposase RNA helper
  • GFP green fluorescent protein
  • the following agents were used in the present study: a donor DNA (>1 ug/u!, 300 ui, 1xTE buffer, endotoxin-free, sterile), helper RNA MLT transposase 1 (>500 ng/ul, 100 ui, nuclease-free water, sterile), and helper RNA MLT transposase 2 (>500 ng/ul, 100 ui, nuclease-free water, sterile).
  • Table 1 shows reagents used in the present study.
  • FIG. 3 shows GFP expression of 661 W mouse photoreceptor ceils 24 hours post transfection with varying !ipofection reagents as well as either MLT transposase 1 or MLT 1 (which comprises the amino acid sequence of SEQ ID NO: 13), or MLT transposase 2 or MLT 2 (which comprises the amino acid sequence of SEQ ID NO: 15) of the present disclosure, compared to un-transfected cells,
  • FIG. 4 shows the stable integration of donor DNA (GFP) by transposition in mouse photoreceptor cell line 661 W after 4 rounds of splitting over 15 days.
  • FIG. 5 illustrates results of FACS analysis of stable integration of donor DNA (GFP) by transposition in mouse photoreceptor cell line 661 W on day 15,
  • the GFP continued to express in the transfected cells only in conditions where helper RNA (MLT transposase 1 or MLT transposase 1) were co-overexpressed with the GFP donor DNA for long time (FIG. 4). Ceils were split. 4 times over the period of 15 days, and donor only DNA condition lost its expression, while the donor DNA (GFP) with either MLT transposase 1 or with MLT transposase 2 continued to express GFP,
  • LTX Lipofectamlne with PLUS Reagent
  • MLT transposase 1 MLT transposase 2
  • MLT transposase 2 had similar GFP expression 24 hours post transfection and thus yielded stable integration of the donor DNA by transposition.
  • MLT transposase 1 showed more effective transposition as compared to MLT transposase 2.
  • Ts helper RNA transposase
  • MLT transposase 1 and MLT transposase 2 two different helper RNA transposases
  • ARPE-19 cells were transfected with a ratio of donor transposon DNA (CAG-GFP):MLT transposase 1 and MLT transposase 2 mRNA (Donor DNA: Helper RNA) of 10 ug:5 ug.
  • CAG-GFP donor transposon DNA
  • MLT transposase 2 mRNA Donor DNA: Helper RNA
  • Conditions which result in cultures with relatively high numbers of GFP positive ce!is were kept in culture by passage for 7 to 14 days, 14 days is expected to be a sufficient period of time to allow for loss of transient expression of GFP.
  • Cells were imaged at different time points post- transfection to monitor expression and determine which condition is allowing for GFP expression out fo 14 days, Optima! transfected cultures were imaged and analyzed by flow cytometry to determine the percentage of cells which have retained GFP expression,
  • the following agents were used in the present study: donor DNA (>1 ug/u!, 300 u!, 1xTE buffer, endotoxin-free, sterile), helper RNA MLT transposase 1 (>500 ng/u!, 100 ui, nuclease-free water, sterile), helper RNA MLT transposase 2 (>500 ng/u!, 100 ui, nuclease-free water, sterile).
  • Table 2 shows reagents used In the present study,
  • FIG, 6 shows expression of GFP in ARPE-19 cells at 24 hours post transfection.
  • ARPE-19 ceils were seeded in 24 well piste. 24 hours later, the cells were transfected with three different transfection systems: L.3 (Llpofectamine 3000, ThermoFisher Catalog # L300Q-001), LTX (Lipofectamine LTX & PLUS, ThermoFisher Catalog # A12621), and MAX (Lipofectamine Messenger M.AX, ThermoFisher Catalog # LMRNA001). Then, 24 hours post- transfection, the ceils were imaged for GFP,
  • FIG. 7 shows higher resolution images of MLT transposase 1 and MLT transposase 2, visible GFP expression at 24 hours post transfection,
  • FIG. 8 shows stable integration of donor DMA (GFP) in photoreceptor DCi line ARPE19 with MLT transposase 2
  • FIG. 9 illustrates that the FACS analysis shows stable GFP expression from ARPE19 cel! lines after 4 generations of cell divisions.
  • MLT transposase 1 When MLT transposase 1 was added to the lipofectlon reagent and CAG-GFP, there was still GFP expression present in cells after 24 hours, but It was not as much as the lipofectlon reagent and only CAG-GFP, The same was true for MLT transposase 2 (see FIG, 6), MLT transposase 1 and MLT transposase 2 were similar In their GFP expression efficiency, which can be seen in FIG. 7, with a side-by-side comparison of lipofectlon reagent + DNA with both MLT transposase 1 (left column) and MLT transposase 2 (right column),
  • GFP was found to be integrated stably in the ARPE19 cell line, only when it was co-overexpressed with the helper either MLT transposase 1 or MLT transposase 2.
  • the expression of GFP was investigated for 15 days and 4 splits in between to make sure the signals that are visible are not transient.
  • the donor-only condition lost its GFP expression after 2nd split (see FIG. 8).
  • MLT transposase 2 was significantly more effective In stable transposition of donor (GFP) as compared to other conditions such as untransfected or donor only, MLT transposase 1 also appeared to be effective in stable Integration of GFP (FIG. 9).
  • Lipofectamine & PLUS was an efficient lipofection reagent when using just CAG-GFP as well as using both CAG-GFP and either MLT transposase 1 or MLT transposase 2, Both MLT transposase 1 and MLT transposase 2 had similar GFP expression rates for these ARPE-19 cells.
  • MLT transposase 1 and MLT transposase 2 both are efficient in stab!e transposition of donor DNA into the genome.
  • MLT transposase 2 is more effective in stable integration of donor DNA In ARPE19 cell line than MLT transposase 1 .
  • LNP !ipid nanoparticle
  • the left eye was injected with a donor DNA (CAG-GFP) and MLT transposase 2 (MLT with S8P/C13R mutations) co- encapsuiated in a lipid nanoparticle.
  • the right eye was injected with on!y the donor DNA encapsulated by a lipid nanoparticle.
  • a goal was to demonstrate that the MLT transposase 2 can transfect ARPE-19 cells in the retina without causing cell damage.
  • a DNA encoding CAG-GFP (VB2Q0819-1024gzm) was used, and an RNA encoding the MLT transposase 2 (VB200926-1055qkq) was used.
  • the LNP formulation had a cationic lipid, cholesterol, a phospholipid, and a PEG lipid. Table 2 includes information on the mice used in the present experiments,
  • mice eyes were captured using Phoenix MICRON IVTM Retinal Imaging Microscope, fundus imaging.
  • FIGs. 10A and 10B show images of mouse 1-1 L left (FIG. 10A) and 1-1 L right (FIG. 1GB) eyes injected with PBS.
  • FIGs. 11 A, 11 B, 11C, and 11 D show images of mice 3-1 L and 3-1 R right eyes injected with only DNA (FIG. 11 A and
  • FIG. 11C mice 3-1 L and 3-1 R left eyes injected with a donor DNA and MLT 2 (FIG. 11B and FIG. 11D).
  • FIGs. 12A and 12B show images of mouse 4-1 R's right eye injected with a donor DNA (FIG. 12A) and MLT 2 (FIG. 12B).
  • FIGs. 13A and 13B show images of mouse 4-NP right eye (FIG. 13A) injected with only a donor DNA, and left eye (FIG. 13B) injected with both the donor DNA and MLT 2.
  • FIGs. 14A and 14B show images of mouse 4-1 L right eye (FIG. 14A) injected with only a donor DNA, and left eye (FIG. 14B) injected with both the donor DNA and MLT 2.
  • FIGs. 15A and 1SB show images of mouse 5-BP right eye (FIG. 15A) injected with only a donor DNA, and left eye (FIG. 1SB) injected with both the donor DNA and MLT 2
  • FIG. 16 illustrates a general set-up of the present study, and additionally shows that images were taken on day 21 post sub-retinal Injections.
  • FIG. 17 shows images of mouse left and right eyes (top and bottom rows, respectively), taken on day 21 day post sub-retinal injection, with (“+ MLT”) or without (“- MLT”) the MLT transposase used in the transfection in FIG. 17, the right eye is the control (the donor DNA only) and the left eye is the treated eye (the donor DNA + MLT 2 transposase).
  • FIGs. 15A mouse 5-BP right eye
  • FIG. 1SB left eye
  • FIG. 16 illustrates a general set-up of the present study, and additionally shows that images were taken on day 21 post sub-retinal Injections.
  • 1QA. 10B, 11A-11D, 12A, 12B, 13A, 13B, 14A, 14B, 15A. 15B and 17 show images of the mouse eyes treated with the high dose of 500 ng/uL.
  • the results of this study show that the MLT transposase 2 does not negatively affect the mouse eye when injected subretinaiiy while co-encapsulated with the donor DNA (CAG-GFP, in this example).
  • CAG-GFP donor DNA
  • both eyes. 7 days post subretinal injection were not visibly damaged and exhibited GFP expression. Some surgical efficiency variation between animal to animal and also between left and right eye of a same animal were noticed.
  • the MLT transposase dose that results in successful transposition of a gene from a donor DNA was determined to be 500 ng/uL (333 ng D N A/166 ng RNA).
  • the present study shows a positive expression of a transgene (green fluorescent protein (GFP), used as a working example of a transgene) upon injection of the LNPs into the eyes sub-retina!!y.
  • the expression of the transgene continued until 21 days (see FIG. 17), demonstrating feasibility of the present approach for a therapeutic use.
  • GFP green fluorescent protein

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Ophthalmology & Optometry (AREA)
  • Biophysics (AREA)
  • Optics & Photonics (AREA)
  • Dermatology (AREA)
  • Mycology (AREA)
  • Nanotechnology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2021/030007 2020-04-29 2021-04-29 Compositions and methods for treatment of inherited macular degeneration Ceased WO2021222654A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
US17/922,119 US20230193319A1 (en) 2020-04-29 2021-04-29 Compositions and methods for treatment of inherited macular degeneration
CN202180030798.2A CN115461082A (zh) 2020-04-29 2021-04-29 用于治疗遗传性黄斑变性的组合物和方法
AU2021265838A AU2021265838A1 (en) 2020-04-29 2021-04-29 Compositions and methods for treatment of inherited macular degeneration
JP2022565707A JP2023523622A (ja) 2020-04-29 2021-04-29 遺伝性黄斑変性症の治療のための組成物及び方法
IL297718A IL297718A (en) 2020-04-29 2021-04-29 Preparations and methods for the treatment of hereditary macular degeneration
EP21797217.3A EP4142796A4 (en) 2020-04-29 2021-04-29 COMPOSITIONS AND METHODS FOR TREATMENT OF HEREDITARY MACULAR DEGENERATION
KR1020227039027A KR20230004573A (ko) 2020-04-29 2021-04-29 유전성 황반변성의 치료를 위한 조성물 및 방법
CA3175197A CA3175197A1 (en) 2020-04-29 2021-04-29 Compositions and methods for treatment of inherited macular degeneration

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063017442P 2020-04-29 2020-04-29
US63/017,442 2020-04-29

Publications (1)

Publication Number Publication Date
WO2021222654A1 true WO2021222654A1 (en) 2021-11-04

Family

ID=78332210

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/030007 Ceased WO2021222654A1 (en) 2020-04-29 2021-04-29 Compositions and methods for treatment of inherited macular degeneration

Country Status (9)

Country Link
US (1) US20230193319A1 (https=)
EP (1) EP4142796A4 (https=)
JP (1) JP2023523622A (https=)
KR (1) KR20230004573A (https=)
CN (1) CN115461082A (https=)
AU (1) AU2021265838A1 (https=)
CA (1) CA3175197A1 (https=)
IL (1) IL297718A (https=)
WO (1) WO2021222654A1 (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11542528B2 (en) 2020-05-04 2023-01-03 Saliogen Therapeutics, Inc. Transposition-based therapies
WO2023160454A1 (zh) * 2022-02-25 2023-08-31 北京中因科技有限公司 表达盒组合及其应用
WO2023205626A3 (en) * 2022-04-18 2023-11-30 Abeona Therapeutics Inc. Compositions and methods for treating dominant optic atrophy and x-linked retinoschisis

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN120230798A (zh) * 2023-12-29 2025-07-01 上海朗昇生物科技有限公司 用于视网膜基因递送的重组腺相关病毒载体及其应用
WO2025147466A1 (en) * 2024-01-02 2025-07-10 Alkeus Pharmaceuticals, Inc. Treatment for asymptomatic stargardt disease patients
WO2025188836A1 (en) * 2024-03-05 2025-09-12 Saliogen Therapeutics, Inc. Compositions and methods of using gene coding for treating ocular disease

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070042462A1 (en) * 2005-08-21 2007-02-22 Markus Hildinger Super-size adeno-associated viral vector harboring a recombinant genome larger than 5.7 kb
US20140065124A1 (en) * 2009-02-25 2014-03-06 The Johns Hopkins University Piggybac transposon variants and methods of use

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7309487B2 (en) * 2004-02-09 2007-12-18 George Inana Methods and compositions for detecting and treating retinal diseases
WO2008137066A1 (en) * 2007-05-02 2008-11-13 The Board Of Regents Of The University Of Oklahoma Use of compacted nucleic acid nanoparticles in non-viral treatments of ocular diseases
CN101873852A (zh) * 2007-09-27 2010-10-27 锐视医药公司 治疗视黄醇相关性疾病的方法和化合物
US20090214478A1 (en) * 2008-02-21 2009-08-27 Alberto Auricchio Method of treating ocular diseases by gene therapy
US20150141320A1 (en) * 2012-05-16 2015-05-21 Rana Therapeutics, Inc. Compositions and methods for modulating gene expression
AU2014255665B2 (en) * 2013-04-18 2018-08-02 Fondazione Telethon Effective delivery of large genes by dual AAV vectors
AU2015234242B2 (en) * 2014-03-21 2020-09-24 Children's Medical Research Institute Stable gene transfer to proliferating cells
JP7036723B2 (ja) * 2015-12-14 2022-03-15 コールド スプリング ハーバー ラボラトリー 眼疾患の処置のための組成物および方法
EP3687580A1 (en) * 2017-09-27 2020-08-05 Sigilon Therapeutics, Inc. Methods, compositions, and implantable elements comprising active cells
WO2020077360A1 (en) * 2018-10-12 2020-04-16 Poseida Therapeutics, Inc. Hematopoietic stem cell compositions, methods of making and method of use

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070042462A1 (en) * 2005-08-21 2007-02-22 Markus Hildinger Super-size adeno-associated viral vector harboring a recombinant genome larger than 5.7 kb
US20140065124A1 (en) * 2009-02-25 2014-03-06 The Johns Hopkins University Piggybac transposon variants and methods of use

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP4142796A4 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11542528B2 (en) 2020-05-04 2023-01-03 Saliogen Therapeutics, Inc. Transposition-based therapies
US11993784B2 (en) 2020-05-04 2024-05-28 Saliogen Therapeutics, Inc. Transposition-based therapies
WO2023160454A1 (zh) * 2022-02-25 2023-08-31 北京中因科技有限公司 表达盒组合及其应用
WO2023205626A3 (en) * 2022-04-18 2023-11-30 Abeona Therapeutics Inc. Compositions and methods for treating dominant optic atrophy and x-linked retinoschisis

Also Published As

Publication number Publication date
EP4142796A4 (en) 2024-06-26
AU2021265838A1 (en) 2022-10-20
IL297718A (en) 2022-12-01
US20230193319A1 (en) 2023-06-22
CA3175197A1 (en) 2021-11-04
CN115461082A (zh) 2022-12-09
KR20230004573A (ko) 2023-01-06
JP2023523622A (ja) 2023-06-06
EP4142796A1 (en) 2023-03-08

Similar Documents

Publication Publication Date Title
US20230193319A1 (en) Compositions and methods for treatment of inherited macular degeneration
AU2019239880B2 (en) Transcription modulation in animals using CRISPR/Cas systems
KR102584873B1 (ko) 심부 인트론 돌연변이의 유전자 편집
US20230067480A1 (en) Method for treating usher syndrome and composition thereof
AU2018338790B2 (en) Non-human animals comprising a humanized TTR locus and methods of use
KR102780441B1 (ko) Cas-형질전환 마우스 배아 줄기 세포 및 마우스 및 이것의 용도
KR102938671B1 (ko) 생물학적 및 생물공학적 적용에 최적화된 수여 스플라이싱 부위 모듈
AU2016355343A1 (en) Compositions and methods for correction of heritable ocular disease
AU2024202293A1 (en) Nuclease-mediated repeat expansion
KR20220062079A (ko) 지질 나노입자에 의해 전달되는 CRISPR/Cas 시스템을 사용한 동물에서의 전사 조절
US20230081547A1 (en) Non-human animals comprising a humanized klkb1 locus and methods of use
KR20250155004A (ko) 폐쇄 말단 dna 가닥 분자를 제조하기 위한 제제 및 방법
WO2023091943A2 (en) Compositions and methods to prevent, inhibit or treat neurodegenerative diseases
KR20240010467A (ko) 인간 미토콘드리아 게놈을 표적화하는 조작된 메가뉴클레아제
US20260109985A1 (en) Therapy by trans-splicing of opa1 pre-messenger rnas for the treatment of diseases associated with opa1 gene mutations
WO2026080515A2 (en) Crispr sam biosensor cells and cell lines and methods of use thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21797217

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3175197

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2021265838

Country of ref document: AU

Date of ref document: 20210429

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2022565707

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 297718

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 20227039027

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021797217

Country of ref document: EP

Effective date: 20221129