WO2021218043A1

WO2021218043A1 - Application of cxorf67 in determination of sensitivity of tumors to dna damage drugs

Info

Publication number: WO2021218043A1
Application number: PCT/CN2020/120906
Authority: WO
Inventors: 李林; 韩记昌
Original assignee: 中国科学院分子细胞科学卓越创新中心
Priority date: 2020-04-28
Filing date: 2020-10-14
Publication date: 2021-11-04
Also published as: CN113564249B; CN113564249A

Abstract

The present invention provides use of a CXorf67 gene, mRNA, cDNA or protein or a detection reagent thereof in detection of the sensitivity of tumor cells to DNA damage repair inhibitor drugs.

Description

Application of CXorf67 in judging the sensitivity of tumors to DNA damage drugs

Technical field

The present invention relates to the field of oncology and diagnosis. More specifically, the present invention relates to the application of CXorf67 in judging the sensitivity of tumors to DNA damage drugs.

Background technique

DNA double-strand breaks (DSBs) in cells are the most serious type of DNA damage that cells face. DNA double-strand break repairs are generally divided into two types according to whether homologous sequences are involved. One is the classical non-homologous end joining (cNHEJ), which does not depend on homologous sequences, and mainly plays a role in the G0/G1 phase of the cell cycle. The other is the homologous recombination (HR) repair pathway, which is a kind of error-free repair, mainly in the S/G2 phase of the cell cycle, using homologous DNA in the cell as a template to repair broken DNA. This homologous DNA can be sister chromatids, or sequences on homologous chromosomes or ectopic chromosomes.

Poly(ADP-ribose) polymerase inhibitors (PARPi) is a recently discovered drug that can use synergistic lethality to kill cancer cells. Poly(ADP-ribose) polymerase (PARP) has 17 family members. They are a type of nuclear protein, among which PARP1 and PARP2 are the main proteins involved in DNA damage response. PARP inhibitors were first reported in 2005 to specifically kill tumors with BRCA1 or BRCA2 mutations. There are currently 5 PARP inhibitors, but their abilities in PARP-trapping are quite different.

CXorf67 (chromosome X open reading frame 67) is located at the Xp11.22 position of the chromosome. It has only one exon, no introns, and encodes 503 amino acids. CXorf67 is a protein with unknown function, which is mainly located in the nucleus. According to website prediction, there is no known domain and most of it is disordered.

Tumors with defective HR repair pathways are very sensitive to PARP inhibitors. When PARP inhibitors block DNA single-strand break repair, DNA replication produces double strands. If tumor cells have HR repair defects, they will cause cell death; normal cells have complete HR repair, so they will not be killed.

Ependymoma (EPN) is a neuroepithelial malignant tumor that occurs in the central nervous system (CNS), which occurs in both children and adults. EPN mainly occurs in three locations: supratentorial (ST), posterior fossa (PF), and spinal (SP). The 2015 study further classified the ependymomas in these three locations by molecular subtypes through the analysis of DNA methylation. ST includes ST-SE, ST-EPN-YAP1 and ST-EPN-RELA; PF Including PF-SE, PFA and PFB; SP includes SP-SE, SP-MPE and SP-EPN. PFA mainly occurs in infants and young children (average age 3 years old, range 0-51 years old), and the healing is poor; PFB mainly occurs in adolescents (average age 30 years old, range 10-65 years old), and the healing is better.

The PFA subtype of ependymoma mainly occurs in the back of the brain in children, and the recovery is poor. At present, surgery and radiotherapy are the mainstays, and there is a lack of effective drug treatment.

Therefore, there is an urgent need in this field to develop new targets that enhance the sensitivity of tumors with defective HR repair pathways to DNA damage drugs, so as to more effectively treat tumors with defective HR repair pathways.

Summary of the invention

The purpose of the present invention is to provide a new target for enhancing the sensitivity of tumors with defective HR repair pathways to DNA damage drugs, thereby more effectively treating tumors with defective HR repair pathways.

The first aspect of the present invention provides a use of CXorf67 gene, mRNA, cDNA, or protein or its detection reagent, (i) as a marker for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs; and/or (ii) Preparation of diagnostic reagents or kits for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs.

In another preferred embodiment, the DNA damage repair inhibitor drug includes a PARP inhibitor.

In another preferred embodiment, the PARP inhibitor is selected from the group consisting of talazoparib, olaparib, Veliparib, Rucaparib, and Niraparib.

In another preferred embodiment, the diagnostic reagents include antibodies, primers, probes, sequencing libraries, nucleic acid chips (such as DNA chips) or protein chips.

In another preferred embodiment, the protein includes a full-length protein or protein fragment.

In another preferred embodiment, the protein contains a PALB2 binding motif (PALB2-binding motif).

In another preferred example, the PALB2 binding motif is located at positions 420-432 of the CXorf67 protein.

In another preferred example, the CXorf67 gene, mRNA, cDNA, or protein is derived from mammals, preferably from rodents (such as mice, rats), primates and humans, more preferably, From patients diagnosed with tumors with defective HR repair pathways.

In another preferred embodiment, the tumor with defective HR repair pathway is selected from the following group: Ependymoma (Posterior Fossa Group A), Kidney Renal Clear Cell Carcinoma (KIRC), Renal Papillary Cell Cancer (kidney renal papillary cell carcinoma, KIRP), or a combination thereof.

In another preferred embodiment, the ependymoma includes PFA.

In another preferred embodiment, the tumor cell is a tumor cell expressing or highly expressing CXorf67.

In another preferred embodiment, the tumor cells include tumor cells defective in the HR repair pathway.

In another preferred embodiment, the tumor cell is selected from one or more tumors of the following group: ependymoma, renal clear cell carcinoma (KIRC), renal papillary cell carcinoma.

In another preferred example, the accession number of the CXorf67 gene is Gene ID: 340602.

In another preferred example, the accession number of the CXorf67 mRNA is NM_203407.3.

In another preferred example, the accession number of the CXorf67 protein is NP_981952.1.

In another preferred embodiment, the detection is a tissue sample detection.

In another preferred example, the detection includes immunohistochemistry, immunoblotting and fluorescence quantitative PCR detection.

In another preferred embodiment, the detection is the determination of tumor tissue.

In another preferred embodiment, the detection reagent includes a specific antibody of CXorf67, a specific binding molecule of CXorf67, a specific amplification primer, a probe or a chip.

In another preferred embodiment, the CXorf67 protein or its specific antibody or specific binding molecule is coupled with or bears a detectable label.

In another preferred embodiment, the detectable label is selected from the following group: chromophore, chemiluminescent group, fluorophore, isotope or enzyme.

In another preferred embodiment, the specific antibody of CXorf67 is a monoclonal antibody or a polyclonal antibody.

The second aspect of the present invention provides a diagnostic kit for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs. The kit contains a container for detecting CXorf67 gene, mRNA, and cDNA. , Or protein detection reagents; and labels or instructions, the label or instructions indicate that the kit is used to detect the sensitivity of tumor cells to DNA damage repair inhibitor drugs.

In another preferred embodiment, the detection reagent for detecting CXorf67 gene, mRNA, cDNA, or protein includes:

(a). Anti-CXorf67 protein specific antibody; and/or

(b). Specific primers for specifically amplifying mRNA or cDNA of CXorf67.

In another preferred embodiment, the detection is a tissue sample detection.

The third aspect of the present invention provides a method for judging the sensitivity to DNA damage repair inhibitor drugs, the method comprising:

a) Provide test samples from subjects;

b) Detect the expression level of CXorf67 protein in the test sample; and

c) Based on the CXorf67 protein expression measured in step b), the sensitivity to DNA damage repair inhibitor drugs can be judged.

In another preferred example, when CXorf67 protein is present in the test sample, it can be judged that it is sensitive to DNA damage repair inhibitor drugs.

In another preferred example, when the expression level of CXorf67 protein in the test sample is greater than 0.5, preferably, greater than 1.5, and more preferably, greater than 2, it can be judged to be sensitive to DNA damage repair inhibitor drugs .

In another preferred embodiment, the subject is a human or non-human mammal.

In another preferred embodiment, the test sample is a tumor cell or tissue expressing or highly expressing CXorf67.

In another preferred embodiment, the test sample is a tumor cell or tissue defective in the HR repair pathway.

In another preferred embodiment, the detecting step (b) includes detecting the amount of CXorf67 mRNA, or the amount of CXorf67 cDNA; and/or detecting the amount of CXorf67 protein.

In another preferred embodiment, the expression level of CXorf67 protein in the sample is detected by fluorescent quantitative PCR or immunohistochemistry.

In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

The fourth aspect of the present invention provides a method for determining a treatment plan, including:

a) Provide test samples from subjects;

b) Detect the expression level of CXorf67 protein in the test sample; and

c) Determine a treatment plan based on the expression level of CXorf67 protein in the sample.

In another preferred embodiment, the subject is a human or non-human mammal.

In another preferred example, when CXorf67 protein is present in the sample (preferably, the expression level of CXorf67 protein>0.5, preferably,>1.5, more preferably,>2), the treatment plan includes CXorf67 inhibitor therapy , DNA damage repair inhibitor drug therapy, radiotherapy (such as irradiation (IR)), CXorf67 inhibitor and DNA damage repair inhibitor drug combination therapy, DNA damage repair inhibitor drug and radiotherapy (such as irradiation (IR)) Combination therapy.

In another preferred embodiment, the CXorf67 inhibitor therapy and DNA damage repair inhibitor drug therapy are selected from the following group:

CXorf67 inhibitor therapy: antibodies, small molecule compounds, microRNA, siRNA, shRNA, or a combination thereof;

DNA damage repair inhibitor drug therapy: PARP inhibitor.

In another preferred example, when the subject is more sensitive to DNA damage repair inhibitor drugs than the general population (control group), the treatment plan also includes CXorf67 inhibitor therapy, DNA damage repair inhibitor drug therapy , Radiotherapy (such as radiation (IR)), CXorf67 inhibitors and DNA damage repair inhibitor drugs combined therapy, DNA damage repair inhibitor drugs and radiotherapy (such as radiation (IR)) combined therapy.

The fifth aspect of the present invention provides a method for killing tumor cells in vitro, including the steps:

In the presence of DNA damage repair inhibitor drugs, tumor cells are cultured to kill tumor cells.

In another preferred embodiment, the method is performed under radiotherapy (such as irradiation).

In another preferred embodiment, the tumor cells include CXorf67 expressing or highly expressing tumor cells.

In another preferred embodiment, the tumor cells are selected from the following group: ependymoma PFA type tumor cells, other tumor cells that highly express CXorf67 (for example, Daoy cells, exogenously transfected U87 and U251 cells expressing CXorf67) .

In another preferred embodiment, the tumor cell is a cell cultured in vitro.

The sixth aspect of the present invention provides a method for treating cancer or tumor, including:

Administer DNA damage repair inhibitor drugs to subjects in need of treatment.

In another preferred embodiment, the method further includes administering radiotherapy (such as irradiation) to the subject.

In another preferred example, the cancer or tumor includes a cancer or tumor that expresses or highly expresses CXorf67.

In another preferred example, the cancer or tumor is selected from the following group: ependymoma PFA type, other tumors that highly express CXorf67 (for example, renal clear cell carcinoma, renal papillary cell carcinoma).

In another preferred embodiment, the subject includes humans or non-human mammals.

In another preferred embodiment, the non-human mammals include rodents and primates, preferably mice, rats, rabbits, and monkeys.

It should be understood that, within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described in the following (such as the embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, I will not repeat them one by one here.

Description of the drawings

Figure 1 shows the expression level of CXorf67 and drug sensitivity. (a) Analyze the relationship between CXorf67 expression and drug activity in brain cell lines in the GDSC database. According to the correlation coefficient greater than 0.1 and p value less than 0.05, 93 drugs were screened out. (b) Perform targeted pathway analysis on 60 drugs with classification information among 93 drugs.

Figure 2 shows that CXorf67 is a DNA damage responsive protein. (a) Plate U2OS cells in a small dish with a glass bottom, and transfect the EGFP-CXorf67 plasmid 24 hours later. After 24 hours, add Hoechst dye for 15 minutes, and then wash three times with culture solution. A 405nm laser was used to damage the live cell workstation, and a picture was taken every 20 seconds. (b) Stimulate U2OS with 0.1μM CPT, then collect cells at different time points, and then perform chromatin separation. (c) Spread U2OS cells on a 24-Well glass slide, then stimulate with IR or add 0.1μM CPT, fix with 4% paraformaldehyde after 1 hour, wash with PBST and add CXorf67 antibody overnight, the next day Add fluorescent secondary antibody and DAPI to block for 1 hour, and then film.

Figure 3 shows that CXorf67 can inhibit DNA damage repair. (a) CXorf67 WT and KO U2OS cells were seeded in 24-well, and then stimulated with IR (10 Gy), samples were collected at different time points, and r-H2AX levels were detected by WB. (b) CXorf67 was re-expressed in U2OS of CXorf67 KO, then IR stimulated, and WB detected the level of r-H2AX. (c) In CXorf67 WT, KO and U2OS that reverted to CXorf67 expression, stimulated with IR (10Gy), and then collected 0.5h and 24h samples for immunofluorescence staining to detect the formation of r-H2AXfoci. (d) After CXorf67 WT and KO U2OS were stimulated by IR (10Gy), the cells were collected for comet electrophoresis experiment to detect the tailing of nuclear DNA. Figure 4 shows that CXorf67 inhibits HR without affecting NHEJ. (a) Two concentrations of CXorf67 plasmid (0.1μg and 0.5μg) and I-SceI plasmid (3μg) were transfected into 6-well U2OS DR-GFP cells. After 48 hours, the cells were collected for flow cytometric analysis for GFP and RFP positive Number of cells. t-test analysis p value. (b) Transfect CXorf67 plasmid (0.5μg) and I-SceI plasmid (3μg) into 6-well U2OS EJ5-GFP cells, and collect the cells after 48 hours for flow cytometric analysis of the number of GFP and RFP positive cells.

Figure 5 shows that CXorf67 affects Rad51 foci, but not RPA2 and BRCA1 foci. (a) After U2OS CXorf67-WT, KO and CXorf67 KO cells were treated with CPT 0.1μM for 4 hours, the cells were fixed, and Rad51 antibody was used for immunofluorescence experiment to observe Rad51 foci. And use Image-pro plus software to count the number of foci of each cell. t-test analysis of p value. (b,c) After U2OS CXorf67-WT and KO cells were treated with CPT 0.1μM for 4 hours, the cells were fixed, and immunofluorescence experiments were performed with RPA2 and BRCA1 antibodies to observe the corresponding foci. (d) After Daoy CXorf67-WT, KO and CXorf67 KO cells were treated with CPT 0.1μM for 4 hours, the cells were fixed, and Rad51 antibody was used for immunofluorescence experiment to observe Rad51 foci. (e, f) After Daoy CXorf67-WT and KO cells were treated with CPT 0.1μM for 4 hours, the cells were fixed, and the RPA2 and BRCA1 antibodies were used for immunofluorescence experiments to observe the corresponding foci.

Figure 6 shows that CXorf67 binds to PALB2. (a) In Daoy cells, immunoprecipitate CXorf67 and then detect the binding of PALB2, BRCA1, RPA2 and Rad51. (b) Transfect CXorf67-HA, PALB2-Flag or BRCA1-Flag into 293T cells, then immunoprecipitate CXorf67 with HA antibody, and then analyze PALB2 and BRCA1 by Western blot. (c) Transfect the PALB2-HA plasmid in U2OS cells, and observe the co-localization of endogenous CXorf67 and PALB2.

Figure 7 shows the binding of CXorf67 to the WD40 domain of PALB2. (a) According to the reported PALB2 domains, three fragment plasmids of PALB2 were constructed. (b) In 293T cells, transfect different fragments of PALB2 plasmid and CXorf67 plasmid, and perform Flag immunoprecipitation, and then detect CXorf67. (c) Purify the His-tagged CXorf67 protein and the GST-tagged WD40 protein in E. coli, and then perform the GST pull-down experiment.

Figure 8 shows that CXorf67 binds to PALB2(a) via PALB2-binding motif and it is found that the 420-432 amino acid sequence of CXorf67 is highly similar to the 26-38 amino acid sequence of BRCA2. Synthesize Biotin modified CXorf67 WT and W425C mutant peptides (420-432), and then do streptavidin pull-down experiment with GST-WD40 protein. (b) Transfect CXorf67 WT and W425C mutant plasmids in 293T, and then do immunoprecipitation to detect the binding of PALB2. (c) U2OS DR-GFP cells were transfected with I-SceI and WT CXorf67 or W425C mutants. After 48 hours, the cells were collected for FACS analysis of the proportion of positive cells accounted for by GFP and RFP. Use t-test to detect and analyze the p value. (d) Replenish WT CXorf67 or W425C mutants in Daoy CXorf67-KO cells respectively, then add CPT stimulation and fix it with Rad51 foci, and analyze the p value by t-test.

Figure 9 shows that CXorf67 competes with BRCA2 for binding to PALB2. (a) Transfect PALB2-Myc, BRCA2-N-GFP (1-200 amino acids) and gradient CXorf67-HA plasmids into 293T cells, and then immunoprecipitate PALB2. (b) Transfect PALB2-GFP and BRCA2-N-Myc into U2OS cells, and observe the co-localization of PALB2 and BRCA2 in the presence or absence of CXorf67. (c) Transfect CXorf67-GFP and Myc-LacR or Myc-LacR-PALB2 plasmids into U2OS-LacO cells, and then do immunofluorescence experiments. (d) Transfect GFP-LacR, GFP-LacR-PALB2, Myc-BRCA2-N(1-200) or CXorf67-HA plasmid into U2OS-LacO cells, and then do immunofluorescence experiment. Use ImageJ software to do fluorescence quantitative analysis.

Figure 10 shows that Daoy cells expressing CXorf67 are more sensitive to PARP inhibitors. (a) Spread Daoy CXorf67 WT and KO cells in 96-well, add different concentrations of Talazoparib for 5 days, then use CellTiter-Glo kit to detect the survival rate of the cells, and analyze the p value by Two-way ANOVA. (b) Revert to express CXorf67 in Daoy CXorf67 KO cells, spread the cells in 96-well and treat them with different concentrations of Talazoparib or Olaparib for 5 days, and then test the survival rate of the cells. (c) Daoy CXorf67-KO cells and cells that reverted to CXorf67 expression in KO and Matrigel were mixed 1:1 and injected subcutaneously in 5-week-old BALB/c nude mice, 5 in each group, when the tumor volume reached 100mm ³ , Talazoparib (0.33mg/kg) was given orally, and the tumor volume was measured twice a week. (d) CXorf67 was overexpressed in U251 and U87 cells, and then treated with different concentrations of Talazoparib for 5 days. CellTiter-Glo kit was used to detect the survival rate of the cells.

Figure 11 shows the high expression of CXorf67 in PFA subtypes of ependymoma (a) Analysis of GSE64415 (PFA, 72 cases; non-PFA, 137 cases) and GSE94349 (PFA, 12 cases; non-PFA, 179 cases) data The mRNA level of CXorf67. (b) 28 samples of ependymoma samples (numbered 1-28) were collected to extract protein, and western blotting was used to detect the protein expression level of CXorf67 and the level of γ-H2AX, and then Pearson correlation analysis was used for detection.

Figure 12 shows that PFA tumors with high expression of CXorf67 are more sensitive to PARP inhibitors. (a) Fresh specimens of PFA 1-4 and MB-1 were collected from 5 cases of posterior brain tumors in children, and then the expression levels of CXorf67 and γ-H2AX were detected by Western blotting. (b) The primary cells derived from PFA-1 and PFA-2 tumors were established, and then treated with different concentrations of Talazoparib for 5 days, and then the cell survival rate was measured with the CellTiter-Glo kit. Two-way ANOVA analysis p value. (c) PDXs derived from PFA-3, PFA-4 and MB-1 tumors were established. Each group of PDX was inoculated with 10 nude mice, and then divided into two groups: drug-fed and non-fed. When the tumor volume reached 50mm ³ , Talazoparib (0.33mg/kg) was administered intragastrically for 5 days a week, and the tumor volume was measured. When the tumor volume reaches 1000 mm ³ , the survival curve of the mouse is drawn. Log rank (Mantel-Cox) test was used to analyze the p value. (d) Measure the tumor volume of PFA-3, PFA-4 and MB-1 in the administration and non-administration groups, and analyze the p value by Two-way ANOVA.

Figure 13 shows the expression analysis of CXorf67 in other cancers. (a) Analyze the mRNA expression level of CXorf67 in 16 cancers in the TCGA database. (b) Analyze the relationship between KIRC (higher, n=55; lower, n=53) and KIRP (higher, n=59; lower, n=57) two cancers, the expression level of CXorf67 and the patient's recovery, log-rank Detection and analysis of p-value.

Figure 14 shows that the combination of PARP inhibitors and irradiation (IR) can kill CXorf67-expressing tumor cells more effectively. (a) CXorf67 expression was restored in Daoy CXorf67 KO cells, treated with IR (2Gy) the next day, and then treated with different concentrations of Talazoparib or Niraparib for 5 days. CellTiter-Glo kit was used to detect the survival rate of the cells, Two- Way ANOVA analyzes the p value. (b) Separate and culture the corresponding cells from PFA-3 and PFA-4 PDX, spread the cells in a 96-well, treat them with IR (2Gy), and then add different concentrations of Talazoparib for 5 days, and then detect the cells Survival rate. (c) Construct a stable transgenic strain expressing luciferase in Daoy CXorf67 KO cells and cells that revert to expressing CXorf67, and then inoculate them into the posterior fossa of BALB/c nude mice. Niraparib (50mg/kg), IR (2Gy) were administered 7 days after inoculation. /Day, 4 days) and Niraparib+IR treatment. The bioluminescence level of the tumor was measured with the IVIS SpectrumCT imaging system every 10 days. (d) PFA-3 and PFA-4 cells were mixed with Matrigel 1:1 and injected subcutaneously in 6-week-old BALB/c nude mice, 5 mice in each group. When the tumor volume reached about 150mm ³ , Olaparib (50mg /kg), Talazoparib (0.33mg/kg), IR (2Gy/day, 4 days), Olaparib+IR and Talazoparib+IR treatment, and the tumor volume was measured once a week.

Detailed ways

After extensive and in-depth research, the inventors unexpectedly discovered for the first time that tumor cell lines or tumor tissues with high expression of CXorf67 are more sensitive to DNA damage repair inhibitor drugs (such as PARP inhibitors). Therefore, CXorf67 gene or its protein can be used as a marker for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs. The present invention also unexpectedly discovered that DNA damage repair inhibitor drugs (such as PARP inhibitors) can kill expression or high Tumor cells expressing CXorf67. On this basis, the inventor completed the present invention.

Tumors with defective HR repair pathways

The homologous recombination (HR) repair pathway is a kind of error-free repair, which mainly uses the homologous DNA in the cell as a template to repair broken DNA during the S/G2 phase of the cell cycle. Defects or insufficiencies of HR can lead to genome instability, which will accompany the occurrence and development of tumors. For example, genes such as BRCA1, PLAB2 and BRCA2 in the HR pathway have been found to have gene mutations in many tumors. Mutations in these genes can result in DNA double-strand breaks that cannot be effectively repaired, causing changes in cell gene copy numbers, rearrangements and mutations, which in turn can cause tumors and diseases, such as breast cancer, pancreatic cancer, and prostate cancer.

In a preferred embodiment, the tumor deficient in the HR repair pathway is a tumor with high expression of CXorf67, selected from the following group: Ependymoma (posterior fossa group A), renal clear cell carcinoma (kidney renal clear cell carcinoma, KIRC), renal papillary cell carcinoma (KIRP) ependymoma, renal clear cell carcinoma (KIRC), renal papillary cell carcinoma, or a combination thereof.

sample

The term "sample" or "sample" as used herein refers to a material specifically associated with a subject, from which specific information related to the subject can be determined, calculated, or inferred. The sample may be composed wholly or partly of biological material from the subject. The sample can also be a material that has been in contact with the subject in some way. This contact method allows the test on the sample to provide information about the subject. The sample can also be a material that has been in contact with other materials. This other material is not of the subject, but enables the first material to be subsequently tested to determine information related to the subject. For example, the sample can be a probe or anatomy. Knife cleaning fluid. The sample may be a source of biological material other than the subject, as long as the professionals in the technical field can still determine the information related to the subject from the sample.

Express

As used herein, the term "expression" includes the production of mRNA from a gene or part of a gene, and the production of a protein encoded by RNA or a gene or part of a gene, as well as the presence of a detection substance related to expression. For example, cDNA, binding of a binding ligand (such as an antibody) to genes or other oligonucleotides, proteins or protein fragments, and the chromogenic part of the binding ligand are all included within the scope of the term "expression". Therefore, the increase in half-dot density on immunoblots such as western blots is also within the scope of the term "expression" based on biological molecules.

Reference value

As used herein, the term "reference value" refers to a value that is statistically related to a specific result when compared to an analysis result. In a preferred embodiment, the reference value is determined based on a statistical analysis of studies comparing the expression of CXorf67 with known clinical results. Some of these studies are shown in the example section of this document. However, research from the literature and user experience of the methods disclosed herein can also be used to produce or adjust reference values. The reference value can also be determined by considering the conditions and results that are particularly relevant to the patient's medical history, genetics, age, and other factors.

In the present invention, the reference value refers to a cut-off value (cut-off value), which refers to the expression level of CXorf67 in tumor cells or tissues with defects in the HR repair pathway, preferably the expression level of CXorf67>0.5, preferably>1.5 , More preferably, >2.

Non-tumor cell samples

As used herein, the term "sample of non-tumor cells" includes, but is not limited to, people who do not have tumors with defective HR repair pathways.

CXorf67 protein and polynucleotide

In the present invention, the terms "protein of the present invention", "CXorf67 protein" and "CXorf67 polypeptide" are used interchangeably, and all refer to a protein or polypeptide having the amino acid sequence of CXorf67. They include CXorf67 protein with or without starting methionine. In addition, the term also includes full-length CXorf67 and fragments thereof. The CXorf67 protein referred to in the present invention includes its complete amino acid sequence, its secreted protein, its mutants, and its functionally active fragments.

The human CXorf67 protein has a total length of 503 amino acids (accession number is NP_981952.1). The mouse CXorf67 protein has a full length of 589 amino acids (accession number is NP_001159905.1).

In the present invention, the terms "CXorf67 gene" and "CXorf67 polynucleotide" are used interchangeably, and both refer to a nucleic acid sequence having the nucleotide sequence of CXorf67.

The genome of the human CXorf67 gene is 1896 bp in length (NCBI GenBank accession number is Gene ID: 340602), and its transcription product mRNA sequence is 1512 bp in length (NCBI GenBank accession number is NM_203407.3).

The mouse CXorf67 gene has a full-length 2203bp genome (NCBI GenBank accession number Gene ID: 102991), and its transcription product mRNA sequence has a full-length 1770bp (NCBI GenBank accession number NM_001166433.1).

The similarity of human and mouse CXorf67 at the DNA level is 39%, and the similarity of protein sequence is 39%.

It should be understood that when encoding the same amino acid, the substitution of nucleotides in the codon is acceptable. In addition, it should be understood that when conservative amino acid substitutions are produced by nucleotide substitutions, nucleotide changes are also acceptable.

When the amino acid fragment of CXorf67 is obtained, a nucleic acid sequence encoding it can be constructed based on it, and specific probes can be designed based on the nucleotide sequence. The full-length nucleotide sequence or its fragments can usually be obtained by PCR amplification, recombination or artificial synthesis. For the PCR amplification method, primers can be designed according to the CXorf67 nucleotide sequence disclosed in the present invention, especially the open reading frame sequence, and a commercially available cDNA library or a cDNA prepared by a conventional method known to those skilled in the art can be used. The library is used as a template to amplify the relevant sequences. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then splice the amplified fragments together in the correct order.

Once the relevant sequence is obtained, the recombination method can be used to obtain the relevant sequence in large quantities. This is usually done by cloning it into a vector, then transferring it into a cell, and then isolating the relevant sequence from the proliferated host cell by conventional methods.

In addition, artificial synthesis methods can also be used to synthesize related sequences, especially when the fragment length is short. Usually, by first synthesizing multiple small fragments, and then ligating to obtain fragments with very long sequences.

At present, the DNA sequence encoding the protein (or fragment or derivative thereof) of the present invention can be obtained completely through chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (such as vectors) and cells known in the art.

Through conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant CXorf67 polypeptide. Generally speaking, there are the following steps:

(1) Use the polynucleotide (or variant) encoding human CXorf67 polypeptide of the present invention, or use a recombinant expression vector containing the polynucleotide to transform or transduce a suitable host cell;

(2). Host cells cultured in a suitable medium;

(3). Separate and purify protein from culture medium or cells.

In the present invention, the CXorf67 polynucleotide sequence can be inserted into a recombinant expression vector. In short, any plasmid and vector can be used as long as it can replicate and stabilize in the host. An important feature of an expression vector is that it usually contains an origin of replication, a promoter, a marker gene, and translation control elements.

Methods well known to those skilled in the art can be used to construct an expression vector containing the DNA sequence encoding CXorf67 and appropriate transcription/translation control signals. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology. The DNA sequence can be effectively linked to an appropriate promoter in the expression vector to guide mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selecting transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and green Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

A vector containing the above-mentioned appropriate DNA sequence and an appropriate promoter or control sequence can be used to transform an appropriate host cell so that it can express the protein.

The host cell can be a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples include: Escherichia coli, bacterial cells of the genus Streptomyces; fungal cells such as yeast; plant cells; insect cells; animal cells, etc.

Transformation of host cells with recombinant DNA can be performed by conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA can be harvested after the exponential growth phase and treated with the CaCl ₂ method. The steps used are well known in the art. Another method is to use MgCl ₂ . If necessary, the transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods can be selected: calcium phosphate co-precipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

The obtained transformants can be cultured by conventional methods to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the medium used in the culture can be selected from various conventional mediums. The culture is carried out under conditions suitable for the growth of the host cell. After the host cell has grown to a suitable cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cell is cultured for a period of time.

The recombinant polypeptide in the above method can be expressed in the cell or on the cell membrane, or secreted out of the cell. If necessary, the physical, chemical, and other characteristics can be used to separate and purify the recombinant protein through various separation methods. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitation agent (salting out method), centrifugation, osmotic sterilization, ultra-treatment, ultra-centrifugation, molecular sieve chromatography (gel filtration), adsorption layer Analysis, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

Specific antibody

In the present invention, the terms "antibody of the present invention" and "anti-CXorf67 specific antibody" are used interchangeably.

The present invention also includes polyclonal antibodies and monoclonal antibodies specific to human CXorf67 polypeptide, especially monoclonal antibodies. Here, "specificity" means that the antibody can bind to the human CXorf67 gene product or fragment. Preferably, it refers to those antibodies that can bind to human CXorf67 gene products or fragments but do not recognize and bind to other unrelated antigen molecules. The antibodies in the present invention include those molecules that can bind to and inhibit the human CXorf67 protein, as well as those antibodies that do not affect the function of the human CXorf67 protein. The present invention also includes those antibodies that can bind to the human CXorf67 gene product in modified or unmodified forms.

The present invention not only includes complete monoclonal or polyclonal antibodies, but also includes immunologically active antibody fragments, such as Fab' or (Fab) ₂ fragments; antibody heavy chains; antibody light chains; genetically engineered single-chain Fv molecules ( Ladner et al., U.S. Patent No. 4,946,778); or chimeric antibodies, such as antibodies that have murine antibody binding specificity but still retain human-derived antibody portions.

The antibody of the present invention can be prepared by various techniques known to those skilled in the art. For example, the purified human CXorf67 gene product or its antigenic fragments can be administered to animals to induce the production of polyclonal antibodies. Similarly, cells expressing human CXorf67 protein or its antigenic fragments can be used to immunize animals to produce antibodies. The antibody of the present invention may also be a monoclonal antibody. Such monoclonal antibodies can be prepared using hybridoma technology (see Kohler et al.,

Nature

256; 495, 1975; Kohler et al., Eur. J. Immunol. 6: 511, 1976; Kohler et al., Eur. J. Immunol. .6:292, 1976; Hammerling et al., In Monoclonal Antibodies and T Cell Hybridomas , Elsevier, NY, 1981). The antibodies of the present invention include antibodies that can block the function of human CXorf67 protein and antibodies that do not affect the function of human CXorf67 protein. The various antibodies of the present invention can be obtained by conventional immunization techniques using fragments or functional regions of the human CXorf67 gene product. These fragments or functional regions can be prepared by recombinant methods or synthesized by a peptide synthesizer. Antibodies that bind to the unmodified form of the human CXorf67 gene product can be produced by immunizing animals with the gene product produced in prokaryotic cells (such as E.Coli); antibodies that bind to the post-translationally modified form (such as glycosylated or phosphorylated Proteins or polypeptides) can be obtained by immunizing animals with gene products produced in eukaryotic cells (such as yeast or insect cells).

Anti-human CXorf67 protein antibodies can be used in immunohistochemistry techniques to detect human CXorf67 protein in specimens (especially tissue samples or serum samples). Because the CXorf67 protein has an extracellular domain, these soluble CXorf67 extracellular domains can become the target of serum detection when the extracellular domain falls off and enters the blood.

Detection method

Taking advantage of the feature that CXorf67 is present in tumors (such as tumors with defective HR repair pathways, preferably ependymoma) cells or tissues, and is closely related to the sensitivity of DNA damage repair inhibitor drugs, the present invention also provides A method for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs.

In a preferred embodiment of the present invention, the present invention provides a high-throughput next-generation sequencing method for detecting CXorf67, as well as Sanger sequencing, fluorescent quantitative PCR (qPCR), in situ immunofluorescence (FISH) and immunohistochemistry.

Detection kit

Based on the correlation between tumor cells with high expression of CXorf67 and the sensitivity of DNA damage repair inhibitor drugs, that is, tumor cells with high expression of CXorf67 are more sensitive to DNA damage repair inhibitor drugs, so CXorf67 can be used as a guide DNA damage repair inhibitor A biomarker for drug use.

The present invention also provides a diagnostic kit for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs, which contains a detection reagent for detecting CXorf67 gene, mRNA, cDNA, or protein; and a label or instruction manual. The label or instructions indicate that the kit is used to detect the sensitivity of tumor cells to DNA damage repair inhibitor drugs.

Detection method and kit

The present invention relates to a diagnostic test method for quantitatively and locally detecting human CXorf67 protein level or mRNA level. These tests are well known in the art. The human CXorf67 protein level detected in the experiment can be used to detect the sensitivity of tumor cells to DNA damage drugs.

A method for detecting the presence of CXorf67 protein in a sample is to use the specific antibody of CXorf67 protein to detect, which includes: contacting the sample with the specific antibody of CXorf67 protein; observing whether an antibody complex is formed, and the antibody complex is formed to indicate the sample CXorf67 protein is present in it.

The CXorf67 protein or its polynucleotide can be used for the diagnosis and treatment of diseases related to the CXorf67 protein. Part or all of the polynucleotide of the present invention can be used as probes to be fixed on a microarray or a DNA chip, and used to analyze the differential expression of genes in tissues and gene diagnosis. Anti-CXorf67 antibodies can be immobilized on a protein chip to detect CXorf67 protein in samples.

The main advantages of the present invention include:

(1) The present invention discovered for the first time that CXorf67 is a DNA damage-responsive protein that can be recruited to DNA break sites. CXorf67 can also inhibit DNA homologous recombination (HR) repair.

(2) The present invention found for the first time that tumor cells with high expression of CXorf67 are more sensitive to DNA damage repair inhibitor drugs (such as PARP inhibitors).

(3) The present invention discovered for the first time that CXorf67 can be used as a biomarker to guide the use of DNA damage repair inhibitor drugs (such as PARP inhibitors).

(4) The present invention finds for the first time that CXorf67 can be used as a marker for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs.

(5) The present invention found for the first time that the expression level of CXorf67 is related to the sensitivity of DNA damage repair inhibitor drugs.

(6) The present invention found for the first time that the combination of PARP inhibitor and irradiation (IR) can kill tumor cells expressing CXorf67 more effectively.

The present invention will be further explained below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples usually follow conventional conditions, such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions described in the manufacturing The conditions suggested by the manufacturer. Unless otherwise specified, percentages and parts are weight percentages and parts by weight.

Unless otherwise specified, the materials and reagents used in the examples of the present invention are all commercially available products.

General method

1. Cell culture

Human U2OS cells and HEK293T cells were purchased from ATCC; Daoy cells were purchased from the Stem Cell Bank of the Chinese Academy of Sciences; U2OS DR-GFP cells and U2OS EJ5-GFP cells were gifted by Professor Huang Jun of Zhejiang University; U2OS LacO cells were gifted by Professor Wang Fangwei of Zhejiang University. All cell lines were cultured in a 37°C, 5% carbon dioxide incubator. All media were purchased from Gibco, and 10% FBS (fetal bovine serum) was added for use. HEK293T uses DMEM medium, U2OS uses 1640 medium, and Daoy uses MEM medium.

The primary cell culture of ependymoma uses Neurobasal medium plus B27, N2, GlutaMAX, EGF, FGF, heparin. Poly-D (100mg, 10mg/ml), filter. Add 10μl to 10cm dish.

FGF is prepared with PBS (0.22μm filter) containing 0.1% BSA, and it is made up to 5μg/ml. EGF is prepared with PBS (0.22μm filter) containing 0.1% BSA, and it is prepared at 10μg/ml. Heparin is made up to 250μg/ml with PBS and filtered. DNase I use FBS-free DMEM culture solution to make 1 mg/ml (10×), filter, and store in -20 degrees aliquots, with a working concentration of 0.1 mg/ml.

2. Antibodies

Antibody:

Rad51 (ab88572, 1:500IF), PALB2 (ab220861, 1:1000WB), H2A.X (ab11175, 1:5000WB) were purchased from abcam company. phosphor-H2A.X(Ser139)(05-636,1:1000IF,1:2000WB) was purchased from Merck Millipore. HA-tag (3724, 1:1000IF), Flag-tag (2368, 1:1000WB), Myc-tag (2276, 1:1000WB), H3 (4620, 1:5000WB) were purchased from CST. BRCA1(sc-6954,1:500IF), LOC340602(CXorf67)(sc-515296,1:500IF,1:1000WB), Ig-G(sc-2025), β-actin(sc47778,1:2000WB) purchased from Santa Cruz Company. Flag-tag (F1804, 1:1000IF), GST-tag (G1166, 1:1000WB), His-tag (H10294, 1:1000WB) were purchased from Sigma. HA-tag (901515, 1:1000WB) was purchased from Biolegend. GFP-tag (11814460001, 1:1000WB) was purchased from Roche.

Secondary Antibodies:

Donkey anti-rabbit IgG coupled with Alexa Fluor 488, goat anti-rabbit IgG coupled with Alexa Fluor 647, goat anti-mouse IgG coupled with HRP, and goat anti-rabbit IgG coupled with HRP were purchased from Invitrogen. Cy3 conjugated goat anti-mouse IgG was purchased from Jackson ImmunoResearch.

3. Reagents

CXorf67 Biotin peptide WT: BIOTIN-GGPIPQQWDESSSSS (SEQ ID NO.: 1); Mut: BIOTIN-GGPIPQQCDESSSSS (SEQ ID NO.: 2) (purity greater than 90%) synthesized by Abclonal. Olaparib, Talazoparib, DMAC (dimethylacetamide) and Solutol (polyethylene glycol-15 hydroxystearate) were purchased from MCE. DAPI (D8417) and Paraformaldehyde (P6148) were purchased from Sigma. The mounting tablet VECTASHIELD (H-1400) was purchased from Vector Laboratories. Hoechst 33343 was purchased from Thermo Scientific. Lipofectamine 3000 transfection reagent and Lipofectamine RNAiMAX transfection reagent were purchased from Invitrogen.

4. Chromatin separation

First prepare U2OS cells, 60mm dish (~2X10 ⁶ cells). Trypsin digestion and centrifuge in 15ml centrifuge tube, transfer to 1.5ml centrifuge tube, centrifuge at 5000rpm/5min/4℃. Wash once with PBS, and rebuild with 200μl SA buffer (10mM HEPES PH 7.9, 10mM KCl, 1.5mM MgCl ₂ , 0.34M Sucrose, 10% glycerol, 1mM DTT, 10mM NaF, 1mM Na ₂ VO ₃ , 1mM PPi, 1X PI) Hang. Add 2μl 10% Triton-X 100 to make the final concentration 0.1%. Put it on ice for 5 min (at this time, you can take the total sample). Then centrifuge

The supernatant is the cytoplasmic component, and the precipitate is the nuclear component. (Cyto samples can be taken at this time). Wash the nuclear components with SA buffer, then add 200μl SB buffer (3mM EDTA, 0.2mM EGTA, 1mM DTT, 10mM NaF, 1mM Na ₂ VO ₃ , 1mM PPi, 1X PI), and place on ice for 10 minutes. After centrifugation at 1700g/5min/4℃, the supernatant is the soluble nuclear component and the precipitate is chromatin. (At this time, you can take a sample of Nuc and use 6XSDS loading). The Chromatin component was washed once with SB buffer, and then centrifuged at 13500rpm/5min/4°C. This time the supernatant was removed with a pipette tip, which was too viscous. Chromatin was resuspended with 2X SDS loading and sonicated for 10 minutes (on: 20s, off: 40s).

5. Comet electrophoresis

Production: Soak in 0.7% ordinary agarose (TAE buffer) in advance, and dry for use. Prepare the gel: 1% low melting point agarose gel, melted in a water bath at 100°C, and cooled to 37°C. Trypsin digest the cells, centrifuge at 3000rpm/5min, wash once with PBS. Mix 60μl of cell suspension with 200μl of glue and spread it on the Comet slide, and flatten it with a cover glass. Place it at 4°C for 30 minutes until it solidifies. Remove the coverslip and lyse overnight at 4°C (Lysis solution formula: 2.5M NaCl, 100mM Na ₂ EDTA, 1% sodium lauryl sarcosine, 10mM Tris, pH 7.5). (Add 1% Triton/10% DMSO before use) neutral electrophoresis solution (1X neutral electrophoresis solution pH 7.5: Tris, 89mM boric acid, 2mM EDTA) for 30min, 25V, electrophoresis for 30min. DAPI (2.5mg/ml) was diluted 1:100 with water, and 40μl was dropped on the glass slide, covered with a cover glass, and observed. Just add it 5min before observation.

6. Use CRISPR/Cas9 to prepare CXorf67 knockout cell line

The CRISPR online design website (http://crispr.mit.edu) was used to design two sgRNAs targeting the CXorf67 gene. CXorf67#1: ACGGCTCAGGCGGTGTTGCG (SEQ ID NO.: 3); CXorf67#2: ATCTTGATTCCCGGTCCCGC (SEQ ID NO.: 4). The positive and negative strands of sgRNA are annealed to form double strands and added with phosphoric acid (using T4ligation buffer, T4PNK to prepare the system. In the PCR machine, 37℃, 30min; 95℃, 5min. Gradually decrease to 25℃). After 1:200 dilution of sgRNA, PCR reaction was performed in the ligation system (pSpCas9(BB)-2A-GFP(PX458) all-in-one plasma, diluted oligo, Tango buffer, 100mM DTT, 10mM ATP, FastDigest BbSI, T4ligase) (Procedure: 37°C, 5min; 21°C, 5min; 8 cycles). Transform the constructed expression plasmid into U2OS or Daoy cells, and perform flow sorting for single cells with GFP after 24 hours. The obtained single cells were plated into a 96-well plate, and finally the single clones derived from one cell were identified.

7. HR and NHEJ reporting system

Day 1, Pour U2OS DR-GFP or U2OS EJ5-GFP cells, and pour 200,000-300,000 cells in each well of 6 well. On Day 2, I-SceI plasmid (3μg/well) and CXorf67 plasmid were transfected with lipo3000. (I-SceI plasmid is fused with an RFP, which can be used to analyze transfection efficiency) On Day 4, cells are trypsinized and flow cytometric analysis is performed (at least 50,000 cells are analyzed).

8. Protein purification

Take 100μl of glycerol bacteria and transfer it to 10ml LB(K+/Amp+), transfer it to 1L TB medium after 12h, about 3h, and measure the OD value of ~0.6-0.8. At the same time, the temperature was lowered, and 1ml of bacteria retained samples were taken for testing. Add IPTG (1M, 1:1000 use). The expression was induced at 18℃ for 24h, and 1ml of bacteria was taken for detection. The rest were collected by centrifugation and stored at -80°C. The sterilizer is pre-cooled, washed with water 3 times, and buffer washed 2 times. The centrifuge is pre-cooled. Resuspend 500ml of bacteria with 20ml buffer, and it should be sufficient, and there should be no small pieces. PMSF can be added at the same time (final concentration 0.15mM). Pour into the bacteriostasis device and slowly pressurize to 800Pa, and then it will become clear in about 3min, and then the pressure will be reduced. 13000rpm/1h/4°C. At the same time, prepare beads, wash three times with single steamed water, and wash twice with buffer. 500μl each sample. 1750rpm/2min, the speed reduction is set to 2. HIS: Pour the supernatant into a 50ml tube + glycerol (final concentration 5%) + imidazole (final concentration 10mM) + beads (28ml supernatant + 1.4g glycerol + 70ul 4M imidazole + 500 μl beads) and rotate it four degrees for 2h. GST: Pour the supernatant into a 50ml tube and add 500μl beads directly. The supernatant was directly hung on the column, and washed three times with 5 times the volume of beads, and then eluted (His-tag protein was washed with 20, 30, 40 mM imidazole concentration, 400 mM imidazole eluted, 500 μl connected to 6-7 tubes, batches Add and collect; GST is eluted with GSH).

9. GST Pull Down

Configure NETN buffer (100mM NaCl, 20mM Tris-HCl, 0.5mM EDTA and 0.5%NP-40). Add 0.25μg of His-CXorf67 protein and GST-WD40 protein or GST protein to 500μl reaction system, and rotate for 20min at 4℃. Then add 25μl of GST beads and rotate at 4°C for 30min. Then wash the beads 3 times with NETN buffer. Add 25μl 2XSDS loading and cook the sample.

10. Biotin-Peptide Pull Down

Take 200μl streptavidin agarose beads and wash them 3 times with Binding buffer (20mM HEPES pH 7.5, 100mM NaCl, 1mM DTT, 1mM EDTA, 0.01%IGEPAL CA-630). Divide beads into 3 parts, one part is not added, and the other two parts are added with 10μg C67-WT, C67-Mut peptide. Rotate at 4°C for 1h. The beads were washed 3 times with buffer, and 1μg of GST-WD40 protein was added respectively. Rotate at 4°C for 2h. Wash the beads with buffer solution 3 times, add 30ul 2XSDS loading and cook the sample.

11. Immunofluorescence

After soaking the cover glass in alcohol, bake it several times on the flame of an alcohol lamp, and then spread it in a 24-well plate. Add the culture solution to soak, and then wash off the culture solution. After the cells were digested and counted, they were divided into 24-well plates. On the third day, the culture solution was aspirated, and 200 μl of 4% PFA was added to fix for 15 min. Wash with PBST (0.1% Triton-X100) 3 times, add 5% BSA to block for 1 hour. Wash with PBST 3 times, add primary antibody solution at 4°C and leave overnight. After washing off the primary antibody with PBST the next day, add the corresponding fluorescent secondary antibody and DAPI, and block for 1 hour in the dark. Wash off the secondary antibody with PBST, then seal the cover glass on the slide with a mounting plate, and store at 4°C in the dark.

12. Co-immunoprecipitation

Divide the cells into 6-well plates (exogenous) or 10cm dish (internal). Prepare lysis buffer (1X Triton lysis (1% Triton, 5mM EDTA, 150mM NaCl, 50mM Tris-Hcl, pH7.4), 10m NaF, 1XPI, 1mM PPi, 2mM Na ₃ VO ₄ ). Aspirate the cell culture solution and place it on ice, and add lysis buffer. Place on a shaker for 10 minutes. Transfer the cell lysate to a cold 1.5ml EP tube and centrifuge at 13000rpm/15min/4°C. Transfer the supernatant to a new EP tube, add 30μl to 30ul 2XSDS loading and cook the sample as input. Add 0.25% BSA and the corresponding antibody to the rest. Rotate at 4°C for 2h or overnight. Add 30μl protein A/G agarose beads with a sharpened pipette tip. Rotate at 4°C for 2h. After centrifugation to remove the supernatant, wash 3 times with lysis buffer. Add 30μl 2XSDS loading and cook the sample.

13. Primary cell culture of ependymoma

The freshly resected tumor tissue in the hospital is placed in a 50ml centrifuge tube containing Neurobasal culture solution and sent to the laboratory within 1 hour. The tumor tissue is sent to the laboratory ultra-clean table, first washed with PBS (plus Penicillin-Streptomycin) to clean the blood. Use sterilized forceps and scissors (previously sterilized) to cut the sample into small pieces in PBS (operate in 60mm dish). Some are cut into pieces in the digestive juice, but there will be some blood mixed, preferably in PBS, which can be washed once. Transfer the cut sample and PBS to a 15ml centrifuge tube at 1000rpm/3min. Add Accutase digestion enzyme and place the centrifuge tube in a shaker at 37°C. Add DNaseI (0.1mg/ml) for 10min. After digesting the tissue into single cells, filter the single cells into a 50ml centrifuge tube with a 70μm cell strainer, and then transfer to a 15ml centrifuge tube for centrifugation (1700rpm/5min). Reselect the cell count and select 60mm or 10cm petri dishes according to the density (the petri dishes should be coated with Laminin in advance).

14. Mouse transplantation tumor experiment

Order 5-week-old BALB/c Nude immunodeficient male mice and acclimatize to SPF-class mice for one week. Mix 3X10 ⁶ Daoy cells with Matrigel 1:1, and then inject them into the right abdomen of nude mice. PDX-derived cells: the first successful modeling PDX tumors were removed, cut into pieces and then add Accutase digestive enzymes, digested into single cells, 3X10 ⁶ cells were counted and Matrigel 1: 1 mixture, then injected into the right flank of nude mice. When the tumor volume reaches about 50-100mm ³ , the drug can be started. Talazoparib is dissolved in 10% DMAC, 6% Solutol and 84% PBS (the mother liquor is dissolved in DMSO, 10 mg/ml). Then at 0.33mg/kg, intragastric administration. It is administered 5 days a week. The mice were observed every day, and their body weight and tumor size were recorded twice a week. (Tumor volume=(length×width×width)/2). When the maximum tumor volume reached 1000 mm ³ , the mice were euthanized.

15. Mouse brain orthotopic transplantation tumor experiment

CXorf67-KO Daoy cells were cultured, and CXorf67 cells were supplemented in KO cells. Transfect the plasmid expressing luciferase, divide the cells into single cells and spread them in 96-well plates, and screen and identify stable transfected cell lines. Order 5-week-old BALB/c Nude immunodeficient female mice and acclimatize to SPF-class mouse room for one week. ^{Inject 2} ×10 5 cells into the back of the brain of the mouse (specifically positioned at -2 lambda, +1 laterally and 3 mm deep from the surface of the skull using a locator). Then perform a bioluminescence test to confirm the success of the inoculation. Seven days later, the successfully inoculated mice were randomly divided into different treatment groups: Vehicle (0.5% methylcellulose prepared with PBS), Niraparib (50mg/kg, gavage, 5 days a week), IR (2Gy/day, 4 days) , A total of 8Gy) and Niraparib+IR processing. The IVIS SpectrumCT imaging system was used to measure tumor growth every 10 days. Mice were intraperitoneally injected with 200ul D-luciferin (15mg/ml), and imaging was performed 10min after isoflurane anesthesia. Use Living Image Software 4.5.4 to collect and analyze data

Example 1 The expression level of CXorf67 is related to the sensitivity of DNA damage drugs

Because CXorf67 is a protein with unknown function, the laboratory found that the expression of CXorf67 is related to the sensitivity of DNA damage drugs through analysis of the GDSC database. Analyze cell lines from the central nervous system in the GDSC database to screen drugs with sensitivity and CXorf67 expression (p<0.05, Pearson correlation>0.1). 93 drugs were found, marked in red in Figure 1a. After enriching the target pathway, it was found that the most drugs related to DNA damage, such as camptothecin, etoposide, doxorubicin and bleomycin, etc. (Figure 1b)

Example 2 CXorf67 is a DNA damage response protein

To explore whether CXorf67 plays a role in DNA damage repair. First, we constructed the pEGFP-CXorf67 plasmid and transfected the plasmid into U2OS cells using laser micro-damage method to observe that CXorf67 protein would be recruited at the site of DNA damage (Figure 2a). For further verification, a chromatin separation experiment was performed later and it was found that the content of CXorf67 in chromatin increased after CPT 0.1μM treatment (Figure 2b). Later, immunofluorescence experiments found that after treatment with IR or CPT, CXorf67 can be seen in some cells to form Foci (Figure 2c).

Example 3 CXorf67 inhibits DNA damage repair

Based on previous experiments and bioinformatics analysis, it is speculated that CXorf67 may be involved in DNA damage repair. Both IR and CPT can cause DNA double-strand breaks, and then cause the rapid phosphorylation of histone H2AX S139 (the phosphorylated H2AX is called γ-H2AX), and the signal of γ-H2AX gradually decreases as the DNA is repaired To the local level. First, U2OS WT and KO cells are used to receive IR stimulation, and then cells at different time points are collected for Western blot and immunofluorescence analysis of γ-H2AX. In the WB experiment, it was found that there was no difference between the initial γ-H2AX signal at 15min and 1h, but the γ-H2AX signal in KO cells decreased faster after 4h (Figure 3a). At the same time, we supplemented CXorf67 in U2OS KO and found that the level of γ-H2AX increased in duration, suggesting that DNA damage repair was slowed down (Figure 3b). In the immunofluorescence experiment, it was also found that the initial 0.5hγ-H2AX was not different, but the signal dropped faster in KO and WT at 24h, and supplementing CXorf67 in KO cells could restore this phenomenon (Figure 3c). In order to make a closer determination, we did comet electrophoresis experiment, also called single-cell gel electrophoresis analysis. The basic principle is that the nuclear DNA of undamaged cells is more complete and there is no tailing in electrophoresis. After the cell is damaged, DNA breaks to produce fragments, which migrate during electrophoresis to form a tail. Our experimental results showed that at 0.5h after IR treatment, there was no significant difference in tailing between WT and KO, but it was found that KO cells had shorter tails than WT at 4h (Figure 3d). The above experimental results indicate that CXorf67 may be a factor that inhibits DNA damage repair, and the ability of cells to repair DNA damage increases after CXorf67 is absent.

Example 4 CXorf67 inhibits HR without affecting NHEJ

In the previous experiment, IR and CPT were used. These two forms of DNA damage mainly caused DNA double-strand break damage. There are two main ways to repair double-strand breaks: one is homologous recombination (HR), which is an error-free repair that uses homologous sister chromatids as a template repair in the S and G2 phases; Another type of repair is non-homologous end joining (NHEJ), which is a mismatch repair. The DNA ends can be directly joined by ligase to generate DNA insertion or deletion mutations.

In order to explore which repair pathway CXorf67 plays a role in, the U2OS DR-GFP and EJ5-GFP reporter cell lines (Lou et al., 2017) were used. The cleavage plasmid I-SceI was transferred into these two reporter cell lines, and flow cytometry analysis can be used to indicate the repair efficiency of HR or NHEJ in the cells. Overexpression of CXorf67 in cell lines was found to only inhibit HR, but not NHEJ (Figures 4a and 4b).

Example 5 CXorf67 affects the formation of Rad51 foci

In HR repair, a key protein is Rad51, which can be recruited to DNA damage repair sites through the BRCA1-PALB2-BRCA2 complex. By observing the Rad51 foci induced by DNA damage, the impact on HR can be judged. It was found that under CPT treatment, U2OS KO cells formed more Rad51 foci compared with WT, and this phenomenon could be reverted by transfection with CXorf67 (Figure 5a). After observing the upstream RPA2 and BRCA1 of Rad51, it was found that RPA2 and BRCA1 foci did not change (Figure 5b and Figure 5c). In order to verify whether the same phenomenon occurs in different cell lines, we also did the same experiment in Daoy cells later, and found that in the case of CPT treatment, Rad51 foci increased in KO compared with WT (Figure 5d). RPA2 and BRCA1 foci have not changed (Figure 5e and Figure 5f). These results indicate that CXorf67 may play a role between BRCA1 and Rad51.

Example 6 CXorf67 is combined with PALB2

According to the previous experimental results: CXorf67 affects Rad51 foci but not BRCA1 foci, it is speculated that CXorf67 may play a role between the two. In Daoy cells IP CXorf67, PALB2 and BRCA1 could be detected in immunoprecipitation, but RPA2 and Rad51 were not detected (Figure 6a). In 293T cells, CXorf67-HA, PALB2-Flag or BRCA1-Flag was transfected, and CXorf67 was immunoprecipitated. It can be seen that CXorf67 mainly binds PALB2, but the binding with BRCA1 is weak. In the presence of PALB2, the binding of CXorf67 and BRCA1 is enhanced, and it is very likely that the two are indirectly bound through PALB2 (Figure 6b). Later, we used immunofluorescence to find that CXorf67 and PALB2 were co-localized with or without damage stimulation (Figure 6c). We speculate that CXorf67 may play a role by binding to PALB2.

Example 7 CXorf67 binds to the WD40 domain of PALB2

In order to find the region where CXorf67 binds to PALB2, we divided it into 3 fragments according to the known PALB2 domain (Figure 7a). Exogenous immunoprecipitation revealed that CXorf67 mainly binds to the WD40 domain of PALB2 (Figure 7b). In order to verify whether the binding of CXorf67 and WD40 domain is a direct interaction, we purified the full-length His-CXorf67 protein and GST-WD40 (853-1186aa) protein. Through the GST pull-down experiment, it is found that WD40 does have a direct interaction with CXorf67 (Figure 7c).

Example 8 CXorf67 binds PALB2 through PALB2-binding motif

WD40 is known to be essential to the function of PALB2, and BRCA2 also mainly binds to WD40 of PALB2, and then recruits Rad51. Very interestingly, we found that CXorf67 (420-432aa) has strong homology with BRCA2 PALB2-binding motif (26-38aa) through protein sequence alignment (Figure 8a). This small peptide of BRCA2 has been reported to be sufficient to bind to the WD40 domain of PALB2, and the tryptophan at position 31 plays a key role, and it happens that the 425 position of CXorf67 is also tryptophan. In order to verify that amino acids 420-432 of CXorf67 can indeed directly bind to the WD40 domain, a biotin-labeled peptide was synthesized. In the pull-down experiment with streptavidin, it was found that this small peptide was sufficient to bind to the WD40 domain. However, the W425C mutant peptide cannot bind (Figure 8a). In the CO-IP experiment, it was also found that after W425 of the full-length CXorf67 was mutated to cysteine, it was found that the binding of CXorf67 to PALB2 was weakened (Figure 8b).

In order to detect whether the CXorf67 W425 mutation still has the function of inhibiting HR, the U2OS DR-GFP reporting system was used to find that the inhibitory effect on HR was significantly weakened after the W425C mutant CXorf67 was transfected (Figure 8c). At the same time, we supplemented WT or W425C mutants in Daoy cells of CXorf67 KO, and then stimulated with CPT, and found that the ability of W425 mutants to inhibit Rad51 foci was significantly reduced (Figure 8d)

Example 9 CXorf67 can inhibit PALB2-BRCA2 binding

It is speculated that CXorf67 may play a role by simulating the PALB2-binding motif of BRCA2, and competing with PALB2 to interrupt the BRCA2-PALB2 binding. Through CO-IP experiments, it was found that as the amount of CXorf67 transfection increased, the combination of PALB2 and BRCA2 weakened (Figure 9a). In addition, fluorescence colocalization experiments also found that when CXorf67 was transfected, the colocalization of PALB2 and BRCA2 was weakened (Figure 9b). In order to further verify our guess, the U2OS-LacO cell line was used. This cell line stably transfers plasmids containing LacO into U2OS cells, and proteins containing LacR tags can bind to LacO sequences (Wang et al., 2010). This system can observe the co-localization of proteins at the single-cell molecular level. Firstly, a plasmid of Myc-LacR-PALB2 was constructed, and after transfection into the cell line, GFP-CXorf67 was co-transfected, and it was observed that it had specific co-localization at PALB2 (Figure 9c). In order to verify the relationship between CXorf67, PALB2 and BRCA2, GFP-LacR-PALB2, Myc-BRCA2-N(1-200) and HA-CXorf67 plasmids were constructed. It was found that in the presence of CXorf67, the fluorescence signal enrichment of BRCA2 on PALB2 would be reduced (Figure 9d). This single-molecule cell-level co-localization experiment further validated the previous experimental results: one is that CXorf67 and PALB2 bind to each other, and the other is that the combination of the two can inhibit the binding of BRCA2 and PALB2.

Example 10 Cancer cells with high CXorf67 expression are more sensitive to PARP inhibitors

The cell survival test was carried out in Daoy cells expressing CXorf67. The sensitivity of C67-WT and KO Daoy cells to PARP inhibitors was compared, and it was found that Daoy cells lacking CXorf67 were less sensitive to inhibitors (Figure 10a). Reverting the expression of CXorf67 in KO cells significantly increased the sensitivity of cells to PARP inhibitors (talazoparib and olaparib) compared with KO cells (Figure 10b). At the same time, the constructed stable transgenic cell line was injected into the subcutaneously of 6-week-old BALB/c nude mice to construct the transplanted tumor model. When the tumor grew to 100mm ³ , the mice were gavaged with talazoparib (0.33mg/kg, 5 days/week) The tumor volume was measured twice a week, and the experiment was terminated after 28 days. The experimental results found that transplanted tumors that reverted to CXorf67 expression were more sensitive to drugs, and the tumor volume was significantly reduced after administration of mice (Figure 10c). Based on the above experiments, it can be found that Daoy cells with high expression of CXorf67 are very sensitive to PARP inhibitors. So, is there the same phenomenon in overexpressing CXorf67 in tumor cells that do not express CXorf67? We collected two human glioblastomas U251 and U87 that do not express CXorf67. We found that overexpression of CXorf67 in these two cells can make tumor cells more sensitive to PARP inhibitors (Figure 10d).

Example 11 CXorf67 was highly expressed in PFA and caused accumulation of DNA damage

The analysis of GEO data also confirmed that CXorf67 is indeed highly expressed in PFA (Figure 11a). In cooperation with the Children's Hospital of Fudan University, we collected 28 samples of ependymoma cryopreserved in the hospital from 2013 to 2018 (and carried out the numbers in sequence). Number), these tumor samples come from children, with an average age of 3 years. After Western blot analysis of the frozen samples, it was found that CXorf67 was expressed in most tumor samples, and the expression of the samples varied greatly. In addition, we also tested the protein level of γ-H2AX, an indicator of DNA damage repair. Interestingly, it was found that the expression level of CXorf67 was positively correlated with the protein level of γ-H2AX (R=0.698, P=0.075), which also verified our previous findings at the tissue level of ependymoma, that is, the high level of CXorf67 Expression can inhibit DNA damage repair (Figure 11b).

Example 12 Ependymoma with high CXorf67 expression is more sensitive to PARP inhibitors

Collect fresh samples of surgically removed ependymoma to establish some research systems. Collected 5 fresh ependymal samples (4 samples of ependymoma, PFA 1-4 and 1 case of medulloblastoma, MB-1). The expression of CXorf67 in these 5 tumor specimens was detected, and PFA was found The expression of CXorf67 in -1 and PFA-4 was higher than that in PFA-2 and PFA-3, and the expression of CXorf67 was not detected in MB-1 (Figure 12a). We took PFA-1 and PFA-2 for primary cell culture and drug testing, and found that PFA-1 with high expression of CXorf67 is more sensitive to talazoparib drugs than PFA-2 with low expression of CXorf67 (Figure 12b). Later, it was discovered that the number of passages of primary cells was limited, and in vitro culture may have changed the original state of the tumor. Therefore, with fresh tumor samples collected later, we constructed a human-derived tumor xenograft model (Patient-Derived tumor Xenograft, PDX). Compared with tumor cell lines, the PDX model retains the tumor microenvironment better, and is closer to the original tumor in histopathological morphology, and can be better evaluated with drugs. We planted fresh tumor samples of PFA-3, PFA-4 and MB-1 under the skin of NOD-SCID mice. After 3-6 months, they grew into the first generation of PDX. Later, we took out the PDX and digested it into a single Then, 3X10 ⁶ cells were injected subcutaneously into nude mice. When the tumor grew to 50 mm ³ , the mice were given talazoparib (0.33 mg/kg, 5 days/week) and the tumor volume was measured for a week. The survival curve was drawn with 1000mm ³ as the death endpoint of mice. The experimental results showed that the survival time of the PFA-3 and PFA-4 administration groups was prolonged compared with the non-administration group, but the PFA-4 with high expression of CXorf67 survived The prolongation of time was more significant, and the survival time of MB-1, which did not express CXorf67, had basically no difference in survival time between the administration and non-administration groups (Figure 12c). At the same time, it was also found that the tumor volume of the mice in the PFA-4 administration group was significantly smaller (Figure 12d). These results indicate that PARP inhibitors are also sensitive to ependymomas that express CXorf67.

Example 13 Expression of CXorf67 in other cancers

Later, further analysis of TCGA data revealed that CXorf67 is highly expressed in cancers such as kidney clear cell carcinoma (KIRC) and renal papillary cell carcinoma (KIRP) (Figure 13a). And the survival rate analysis of patients with KIRC and KIRP found that patients with high expression of CXorf67 had worse prognosis (Figure 13b). These results indicate that CXorf67, as an oncogene, may play a role in tumorigenesis and development.

Example 14 The combination of PARP inhibitor and irradiation (IR) can kill tumor cells expressing CXorf67 more effectively

Radiotherapy is the standard treatment for patients with PFA. It was previously found that CXorf67 can inhibit DNA homologous recombination repair, and it is speculated that radiotherapy can increase the sensitivity of PFA tumor cells to PARP inhibitors. First, CXorf67 was restored to express CXorf67 in Daoy CXorf67 KO cells, and then treated with IR (2Gy) on the second day, and then treated with different concentrations of Talazoparib or Niraparib for 5 days. CellTiter-Glo kit was used to detect the survival rate of the cells, and the expression was found CXorf67 tumor cells are more sensitive to the combination of PARP inhibitors and IR (Figure 14a). At the same time, the tumor cells of PFA-3 and PFA-4 were isolated and cultured, and the same experiment was also found that the combination of PARP inhibitor and IR can kill PFA-4 cells with high expression of CXorf67 more effectively (Figure 14b). In order to verify that PARP inhibitors have therapeutic effects on brain tumors, a brain orthotopic transplantation tumor model was constructed. A stable transgenic strain expressing luciferase was constructed in Daoy CXorf67 KO cells and cells reverting to expressing CXorf67, and inoculated into the posterior fossa of BALB/c nude mice (2X10 ⁵ cells/mouse). Niraparib (50mg/kg) was administered 7 days after inoculation. IR (2Gy/day, 4 days) and Niraparib+IR treatment. The bioluminescence level of the tumor was measured with the IVIS SpectrumCT imaging system every 10 days. Mice were intraperitoneally injected with 200ul D-luciferin (15mg/ml), and imaging was performed 10min after isoflurane anesthesia. The results show that Niraparib can effectively inhibit the growth of brain tumors through the blood-brain barrier, and its combination with IR can kill tumor cells more efficiently (Figure 14c). Finally, in the subcutaneous transplanted tumor models of PFA-3 and PFA-4, the therapeutic effects of PARP inhibitors and IR on CXorf67-expressing tumor cells were further verified. The PFA-3 PFA-4 cells and Matrigel 1: 1 mixture injected in BALB / c nude mice subcutaneously (3X10 ⁶ cells / mouse) and 5 mice in each group when the tumor volume reached about 150mm ^3, administered Olaparib ( 50mg/kg), Talazoparib (0.33mg/kg), IR (2Gy/day, 4 days), Olaparib+IR and Talazoparib+IR treatment. The drug was administered by intragastric administration, 5 days a week. During the irradiation treatment, only the tumor area is exposed for treatment, and the rest is covered with a lead plate. The tumor volume was measured once a week (Figure 14d).

discuss

CXorf67 is not expressed in most tumor cell lines, but it is very interesting that CXorf67 is highly expressed in PFA subtypes of ependymoma. PFA mainly occurs in the back of the brain in children, and there has been little progress in its treatment in the past dozens of years. At present, surgical resection is still the mainstay, supplemented by radiotherapy, and there is still no consensus on chemotherapy. The Daoy cell line and the established PFA patient-derived primary cells and PDX model of the present invention all show that the higher the expression level of CXorf67, the more sensitive the PAPR inhibitor is. Radiotherapy is currently the standard method for the treatment of PFA, and the present invention further shows that PARP inhibitor combined with radiotherapy is an effective means to kill tumor cells with high expression of CXorf67. The above studies have shown that CXorf67 is a biomarker to guide the medication of PFA patients. In addition, the specific expression of CXorf67 in PFA patients can also be used as a molecular classification index for ependymoma.

references

1.Lou,J.,Chen,H.,Han,J.,He,H.,Huen,MSY,Feng,XH,Liu,T.,and Huang,J.(2017).AUNIP/C1orf135 directs DNA double -strand breaks towards the homogeneous recombination repair pathway. Nat Commun 8,985.

2.Wang,F.,Dai,J.,Daum,JR,Niedzialkowska,E.,Banerjee,B.,Stukenberg,PT,Gorbsky,GJ,and Higgins,JM(2010).Histone H3 Thr-3 phosphorylation by Haspin positions Aurora B at centromeres in mitosis. Science 330,231-235.

All documents mentioned in the present invention are cited as references in this application, as if each document was individually cited as a reference. In addition, it should be understood that after reading the above teaching content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims

A use of CXorf67 gene, mRNA, cDNA, or protein or its detection reagent, characterized in that (i) used as a marker for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs; and/or (ii) It is used to prepare diagnostic reagents or kits for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs.
The use according to claim 1, wherein the DNA damage repair inhibitor drug comprises a PARP inhibitor.
The use according to claim 1, wherein the tumor cells comprise tumor cells defective in the HR repair pathway.
The use according to claim 3, wherein the tumors with defects in the HR repair pathway are selected from the following group: Ependymoma (Posterior Fossa Group A), Kidney Renal Clear Cell Carcinoma (KIRC) ), renal papillary cell carcinoma (KIRP), or a combination thereof.
The use according to claim 4, wherein the ependymoma comprises PFA.
A diagnostic kit for detecting the sensitivity of tumor cells to DNA damage repair inhibitor drugs, characterized in that the kit contains a container that contains the detection of CXorf67 gene, mRNA, cDNA, or protein The detection reagent; and the label or instructions, the label or instructions indicate that the kit is used to detect the sensitivity of tumor cells to DNA damage repair inhibitor drugs.
A method for judging the sensitivity to DNA damage repair inhibitor drugs, characterized in that the method comprises:

a) Provide test samples from subjects;

b) Detect the expression level of CXorf67 protein in the test sample; and

c) Based on the CXorf67 protein expression measured in step b), the sensitivity to DNA damage repair inhibitor drugs can be judged.
8. The method of claim 7, wherein when the CXorf67 protein is present in the test sample, it is judged that it is sensitive to DNA damage repair inhibitor drugs.
The method of claim 7, wherein the test sample is a tumor cell or tissue expressing or highly expressing CXorf67.
A method for determining a treatment plan, characterized in that it comprises:

a) Provide test samples from subjects;

b) Detect the expression level of CXorf67 protein in the test sample; and

c) Determine a treatment plan based on the expression level of CXorf67 protein in the sample.
A method for killing tumor cells in vitro, which is characterized in that it comprises the steps:

In the presence of DNA damage repair inhibitor drugs, tumor cells are cultured to kill tumor cells.
The method of claim 11, wherein the method is performed under radiotherapy.
The method according to claim 11, wherein the tumor cells comprise CXorf67 expression or high expression tumor cells.