WO2021204850A1

WO2021204850A1 - Biocatalytic synthesis of monomer mixtures for polyacrylamide manufacturing

Info

Publication number: WO2021204850A1
Application number: PCT/EP2021/059026
Authority: WO
Inventors: Christian WILLRODT; Tobias Joachim ZIMMERMANN; Daniel Barrera-Medrano; Anna-Corina SCHMIDT; Michael Kiefer; Hans-Juergen Lang; Christian RIEDELE
Original assignee: Basf Se
Priority date: 2020-04-09
Filing date: 2021-04-07
Publication date: 2021-10-14

Abstract

The present invention provides a process for producing an aqueous blend of ammonium (meth) acrylate and (meth) acrylamide, which blend is suitable for producing copolymers of ammonium (meth) acrylate and (meth) acrylamide, said process comprising the following steps: (a) adding the following components (i) to (iv) to a reactor to obtain a composition for bioconversion: (i) a biocatalyst capable of converting (meth) acrylonitrile to ammonium (meth) acrylate; (ii) a biocatalyst capable of converting (meth) acrylonitrile to (meth) acrylamide; (iii) (meth) acrylonitrile; (iv) water; and (b) performing a bioconversion on the composition obtained in step (a) into a reactor, wherein the aqueous blend of ammonium (meth) acrylate and (meth) acrylamide has a molar ratio of ammonium (meth) acrylate to (meth) acrylamide of from 1:99 to 99:1. The invention further includes an apparatus for carrying out process for producing the aqueous blend of ammonium (meth) acrylate and (meth) acrylamide. The apparatus may include a reactor which is a relocatable bioconversion unit or may be a bioconversion unit which is a fixed production facility. The invention also relates to an aqueous blend of ammonium (meth) acrylate and (meth) acrylamide obtainable from this inventive process. The invention further relates to copolymers obtainable by polymerising this aqueous blend of the monomers. The invention additionally relates to the use of the aqueous blend of the present invention and also contemplates the use of the so formed copolymers for various applications including mining and oilfield applications.

Description

Biocatalytic synthesis of monomer mixtures for polyacrylamide manufacturing Background of the Invention Field of the Invention

The present invention relates to a process for providing blends of monomer mixtures suitable for preparing polyacrylamide copolymers. Such monomer blends can conven iently be prepared in apparatus which may be located close to where they can be uti lised. Typically, such monomer blends may then be conveniently used in the prepara tion of polyacrylamide copolymers, for instance in on-site locations. The present inven tion also relates to an apparatus for the manufacture of such aqueous blends of mono mers. Such apparatus may be relocatable plant equipment, for instance where the equipment may need to be employed at different locations. The present invention also provides for such aqueous monomer blends, copolymers formed from such aqueous monomer blends and uses for aqueous solutions of such copolymers.

Description of the Background to the Invention

Polyacrylamides are widely used as flocculants for a variety of industries including the mining industry. Other common users of polyacrylamides include additives for enhanced oil recovery and drift reduction additives for soil treatment in agricultural applications. The raw material for polyacrylamide is typically its monomer acrylamide. In principle, there are two different methods of producing acrylamide on an industrial scale: chemical synthesis and biological synthesis wherein the biological synthesis methods are more and more on the rise due to mild reaction conditions and inherent process safety. Due to the mild the reaction conditions, the absence of copper catalyst and the quantitative conversion of the nitrile, expensive downstream processing steps such as distillation or ion-exchange can be avoided in the biological synthesis, thus resulting in cheaper plants with drastically reduced plant footprint.

Both synthesis methods use acrylonitrile as starting substance. While the chemical syn thesis method uses copper catalyst (e.g. US 4048226, US 3597481), the biological syn thesis method (also known as bio-based method) employs biocatalysts to hydrate (i.e. to convert) acrylonitrile in order to obtain acrylamide. Generally, such biocatalysts are microorganisms which are capable of producing (i.e. which encode) the enzyme nitrile hydratase (IUBMB nomenclature as of September 30, 2014: EC 4.2.1.84; CAS-No. 2391-37-5; also referred to as, e.g., NHase). Nitrile hydratase producing microorgan isms are largely distributed in the environment and comprise, inter alia, representatives of the species Rhodococcus rhodochrous, Rhodococcus pyridinovorans, Rhodococcus erythropolis, Rhodococcus equi, Rhodococcus ruber, Rhodococcus opacus, Aspergillus niger, Acidovorax avenae, Acidovorax facilis, Agrobacterium tumefaciens, Agrobacte rium radiobacter, Bacillus subtilis, Bacillus pallidus, Bacillus smithii, Bacillus sp BR449, Bradyrhizobium oligotrophicum, Bradyrhizobium diazoefficiens, Bradyrhizobium japoni- cum, Burkholderia cenocepacia, Burkholderia gladioli, Klebsiella oxytoca, Klebsiella pneumonia, Klebsiella variicola, Mesorhizobium ciceri, Mesorhizobium opportunistum, Mesorhizobium sp F28, Moraxella, Pantoea endophytica, Pantoea agglomerans, Pseu domonas chlororaphis, Pseudomonas putida, Rhizobium, Rhodopseudomonas palus- tris, Serratia liquefaciens, Serratia marcescens, Amycolatopsis, Arthrobacter, Brevibac terium sp CH1, Brevibacterium sp CH2, Brevibacterium sp R312, Brevibacterium impe- riale, Cory nebacteri urn nitrilophilus, Cory nebacteri urn pseudodiphteriticum, Corynebac- terium glutamicum, Cory nebacteri urn hoffmanii, Microbacterium imperiale, Microbacte rium smegmatis, Micrococcus luteus, Nocardia globerula, Nocardia rhodochrous, Pseu do nocardia thermophila, Trichoderma, Myrothecium verrucaria, Aureobasidium pullu- lans, Candida famata, Candida guilliermondii, Candida tropicalis, Cryptococcus flavus, Cryptococcus sp UFMG- Y28, Debaryomyces hanseii, Geotrichum candidum, Ge otrichum sp JR1, Hanseniaspora, Kluyveromyces thermotolerans, Pichia kluyveri, Rhodotorula glutinis, Comomonas testosteroni, Pyrococcus abyssi, Pyrococcus furio- sus, and Pyrococcus horikoshii. (see, e.g., Prasad, Biotechnology Advances (2010), 28(6): 725-741; FR2835531). The enzyme nitrile hydratase is either iron- or cobalt-de- pendent (i.e. it possesses either an iron or a cobalt atom coordinated in its activity cen ter) which is particularly characterized by its ability to catalyze conversion of acrylonitrile to obtain acrylamide by hydrating acrylonitrile (Kobayashi, Nature Biotechnology (1998), 16: 733 - 736).

In the manufacture of polyacrylamide copolymers, it is common to copolymers acryla mide monomer as one comonomer and acrylic acid, or salts thereof, as a further comonomer.

In principal, there exists two different methods to produce acrylic acid on an industrial scale: Chemical synthesis and biological synthesis, wherein the biological synthesis methods are more and more on the rise due to milder reaction conditions and inherent process safety. Due to the milder reaction conditions and the quantitative conversion of the nitrile, expensive downstream processing steps such as distillation or ion exchange can be avoided in the biological synthesis, thus resulting in cheaper plants with drasti cally reduced plant footprint.

There are two distinct pathways for the enzymatic hydration of nitriles in plants and mi croorganisms that have been applied in industrial production of acrylic acid. One path way comprises two enzymatic steps wherein a nitrile hydratase converts a nitrile to an amide which subsequently is hydrolysed by an amidase to yield acrylic acid (US6670158). The other pathway is a single-step reaction catalysed by nitrilases (US6162624), which is advantageous compared to the two-step reaction, because the latter requiring an extensive amount of equipment for the two stages. WO 97/21817 dis closes suitable conditions for carrying out the enzymatic hydration of nitriles using ni trilases. US 2009/0311759 describes a process for producing acrylamide by allowing acrylonitrile to undergo a hydration reaction by the use of a microbial catalyst containing nitrile hydratase in an aqueous medium to obtain acrylamide reaction solution. The pro cess includes a step of removing impurities from the reaction solution.

When making polyacrylamide copolymers that contain both acrylamide and acrylic acid, or salts thereof, acrylamide and acrylic acid are mixed to form a comonomer mixture. Acrylamide and acrylic acid are, however, each manufactured separately and typically provided as separate aqueous solutions that would need to be combined together to form an aqueous monomer mixture. Until now it has been considered necessary to manufacture acrylamide and acrylic acid separately in order to provide the necessary control of the two separate reactions, avoid competitive consumption of the raw material acrylonitrile, and avoid competitive side reactions which may lead to impurities.

However, the separate manufacture of acrylic acid and acrylamide for making copoly mers of these two monomers necessitates separate reactor equipment for the two reac tions and therefore creates a larger footprint. Further, the two separate reaction pro cesses must be separately monitored and controlled. This is particularly problematic for production plants where space is limited. This is particularly so where the manufacture of acrylamide and acrylic acid for making copolymers is carried out at end user sites where these copolymers are consumed in end user processes, such as in the mining industry, enhanced oil recovery and other applications where such anionic polyacryla mides are employed.

Summary of the Invention

The inventors have provided a process in which ammonium (meth) acrylate and (meth) acrylamide can be produced as an aqueous blend in a reactor from the starting material (meth) acrylonitrile and unexpectedly does not suffer any of the aforementioned prob lems.

The present invention provides a process for producing an aqueous blend of ammonium (meth) acrylate and (meth) acrylamide, which blend is suitable for producing copolymers of ammonium (meth) acrylate and (meth) acrylamide, said process comprising the fol lowing steps: (a) adding the following components (i) to (iv) to a reactor to obtain a composi tion for bioconversion:

(i) a biocatalyst capable of converting (meth) acrylonitrile to ammonium (meth) acrylate;

(ii) a biocatalyst capable of converting (meth) acrylonitrile to (meth) acryla mide;

(iii) (meth) acrylonitrile;

(iv) water; and

(b) performing a bioconversion on the composition obtained in step (a) into a re actor, wherein the aqueous blend of ammonium (meth) acrylate and (meth) acrylamide has a molar ratio of ammonium (meth) acrylate to (meth) acrylamide of from 1:99 to 99:1.

The invention further includes an apparatus for carrying out process for producing the aqueous blend of ammonium (meth) acrylate and (meth) acrylamide. The apparatus may include a reactor which is a relocatable bioconversion unit or may be a bioconver sion unit which is a fixed production facility.

The reactor may comprise a stirrer. Suitably the reactor may comprise an external cool ing circuit. It may be desirable for the reactor to comprise a stirrer and an external cool ing circuit. It is preferable, however, for the reactor to comprise no stirrer. In a preferred embodiment the reactor comprises an external cooling circuit and the reactor comprises no stirrer. By stirrer we mean any active mixing device located in the reactor. Typically, a stirrer may be an impeller, an agitator mounted within the reactor or a moving device which is not fixed, such as a magnetic stirrer. By a reactor comprising no stirrer we mean that no active mixing device is located in the reactor. By active mixing device we mean an operational mixing device i.e. a mixing device intended for operation.

The invention also relates to an aqueous blend of ammonium (meth) acrylate and (meth) acrylamide obtainable from this inventive process.

The invention further relates to copolymers of ammonium (meth) acrylate and (meth) acrylamide obtainable by polymerising this aqueous blend of the monomers.

The invention additionally relates to the use of the aqueous blend of ammonium (meth) acrylate and (meth) acrylamide prepared by the present inventive process or prepared in the apparatus for preparing aqueous solutions of copolymers of ammonium (meth) acrylate and (meth) acrylamide.

The invention further contemplates the use of these aqueous solutions of copolymers of ammonium (meth) acrylate and (meth) acrylamide as surface coatings, adhesives, seal ants, in mining applications, for oilfield applications or agricultural applications.

The present invention enables ammonium (meth) acrylate and (meth) acrylamide to be produced in a defined ratio in one single reaction. This reduces downstream unit opera tions and allows for easy and convenient biocatalytic manufacturing of monomer mix tures for anionic polyacrylamides with various properties. This may also reduce up stream unit operations and equipment since there is only one raw material required, i.e. (meth) acrylonitrile, rather than two raw materials i.e. the separate raw materials for pro ducing (meth) acrylamide and (meth) acrylic acid.

The term ..ammonium (meth) acrylate" means either ammonium acrylate or ammonium meth acrylate and the term „(meth) acrylamide" means either acrylamide or methacryla mide and the term „(meth) acrylonitrile" means either acrylonitrile or methacrylonitrile.

Description of Drawings

The invention is further described by the figures. These are not intended to limit the scope of the invention

Brief description of the figures

Figure 1 : Schematic representation of a bio ammonium (meth-) acrylate reactor

Figure 2: Schematic representation of a bio ammonium (meth-) acrylate reactor having a single walled reaction vessel.

Figure 3: Graphical representation of molar ratio of acrylic acid to acrylamide by vary ing the nitrilase/nitrile hydratase activity ratio.

Detailed description of the figures

Figure 1 schematically represents an embodiment of the relocatable bioconversion unit with an integrated temperature control circuit. The bioconversion unit comprises a frame (10), a double-walled reaction vessel mounted into the frame comprising an outer wall (11 ) and an inner wall (12). Preferred volumes of the reaction vessel have already been mentioned. In other embodiments, the reaction vessel is self-supporting and there is no frame (10). The reaction vessel is filled with the reaction mixture. The bioconversion unit furthermore comprises an external temperature control circuit comprising at least a pump (13) and a temperature control unit (14). The reaction mixture is circulated by means of a pump (13) from the reaction vessel to the temperature control unit (14) and is injected back into the storage vessel, preferably via an injection nozzle (16). In the depicted embodiment, (meth-) acrylonitrile is injected into the temperature control circuit thereby ensuring good mixing (15). It may be added before or after the temperature control unit. Figure 1 shows an embodiment in which (meth-) acrylonitrile is added into the temperature control circuit between the pump and the heat exchanger. The stream of reaction mixture injected back into the reaction vessel causes a circulation of the re action mixture in the reaction vessel which ensures sufficient mixing of the contents of the reaction mixture. No stirrer is installed.

Figure 2 schematically represents an embodiment of the relocatable bioconversion unit with an integrated temperature control circuit. The bioconversion unit comprises a frame (10), a reaction vessel mounted into the frame comprising a single wall (11 ). Preferred volumes of the reaction vessel have already been mentioned. In other embodiments, the reaction vessel is self-supporting and there is no frame (10). The reaction vessel is filled with the reaction mixture. The bioconversion unit, furthermore, comprises an exter nal temperature control circuit comprising at least a pump (12) and a temperature con trol circuit (13). The reaction mixture is circulated by means of a pump (12) from the re action vessel to the temperature control unit (13) and is injected back into the storage vessel, preferably via an injection nozzle (15). In the depicted embodiment, (meth-) ac rylonitrile is injected into the temperature control circuit thereby ensuring good mixing (14). It may be added before or after the temperature control unit. No stirrer is installed.

Figure 3 graphically represents the molar ratio of acrylic acid (occurring as ammonium acrylate) to acrylamide that is produced in a one pot monomer synthesis using a mixture of Rhodococcus rhodochrous and E. coli TG10+ (pDHE BD 5220div) where the nitrilase and nitrile hydratase biocatalysts have an activity ratio of 3:1 ; 30:1 and 300:1 respec tively.

Detailed Description of Invention

In the process of the present invention an aqueous blend of ammonium (meth) acrylate and (meth) acrylamide is produced. Blends of particular ratios of ammonium (meth) acrylate and (meth) acrylamide may be provided by defining the ratio of the two biocata lysts (i) biocatalyst capable of converting (meth) acrylonitrile to ammonium (meth) acry late and (ii) biocatalyst capable of converting (meth) acrylonitrile to (meth) acrylamide. Thus, a particular ratio of ammonium (meth) acrylate and (meth) acrylamide is required in the final aqueous blend of monomers can easily be chosen by determining which ra tio of the two biocatalysts should be selected to provide the required ratio of monomers in the final aqueous blend. Although in general the relative amounts of each biocatalyst used would be proportional to the final ratio of the two monomers. Nevertheless, in view of possible differences in biocatalytic activity of the two different catalysts in order to ac curately provide the desired final ratio of the two monomers in the final aqueous mixture it may be necessary to determine which ratio of the two biocatalyst (i) and (ii) would pro vide the desired ratio of monomers by initial test work. Once the appropriate ratio of the two biocatalysts (i) and (ii) has been determined this ratio of the biocatalysts can be se lected for conducting the process.

This combination of the two biocatalysts (i) and (ii) may be provided by employing differ ent recombinant microorganisms wherein one recombinant microorganism contains bio catalyst (i) and the other recombinant microorganism contains biocatalyst (ii). The sepa rate recombinant microorganisms may be provided in a defined ratio as a single pack age that may have already been selected so as to provide the desired ratio of ammo nium (meth) acrylate and (meth) acrylamide in the aqueous blend of monomers.

Alternatively, the two biocatalysts (i) and (ii) may be in the same recombinant microor ganism. In this case a single recombinant microorganism would express both biocata lysts (i) and (ii). Thus, such a single recombinant microorganism that contains both bio catalysts would provide a specific ratio of ammonium (meth) acrylate and (meth) acryla mide monomers in the so provided aqueous blend of monomers. This would present the advantage that a single recombinant microorganism would express both biocatalysts in a predetermined ratio that would provide the desired ratio of ammonium (meth) acrylate and (meth) acrylamide in the aqueous blend of monomers. Different recombinant micro organisms expressing biocatalysts (i) and (ii) in different predetermined ratios could be used to provide desired ratios of ammonium (meth) acrylate and (meth) acrylamide.

It is preferred that the concentration of (meth) acrylonitrile during the bioconversion does not exceed 10% by wt. and normally should not exceed 6% by wt. and may for ex ample be in the range from 0.1 % by wt. to 6% by wt., preferably from 0.2 wt.% to 5% by wt., more preferably from 0.3 % by wt. to 4% by wt., even more preferably from 0.5 % by wt. to 3 % by wt., still more preferably from 0.8 % by wt. to 2 % by wt. and most pref erably from 1 % by wt. to 1 .5 % by wt., relating to the total of all components of the aqueous mixture. It is possible that the concentration may vary over time during the bio conversion reaction. In order to obtain more concentrated solutions of (meth) acryla mide and ammonium (meth) acrylate the total amount of (meth) acrylonitrile should not be added all at once but it should be added stepwise or even continuously keeping the abovementioned concentration limits in mind. The disclosure of WO 2016/050818 teaches a method of additional dosing of (meth) acrylonitrile, which is suitable to be used and applied in the present invention.

Desirably the (meth) acrylonitrile concentration of the composition at the end of the bio conversion should be below 10.0% (w/w), more desirably should be below 1.0% (w/w), by weight of the (meth) acrylonitrile in the aqueous medium. Preferably, the reaction should be carried out in such a manner that the final concentration of (meth) acrylonitrile in the final monomer blend solution obtained does not exceed 0.1%, should not exceed 0.1% (w/w), preferably below 0.01% (w/w), more preferably below 0.001% (w/w), most preferably below 0.0001 % (w/w), by weight relating to the total of all components of the reaction solution. Typical reaction times may be from 2 hours to 20 hours, in particular four hours to 12 hours, for example 6 hours to 10 hours. After completion of the addition of (meth) acrylonitrile, the reactor contents should be allowed to further circulate for some time to complete the reaction, for example for 1 hour to 3 hours. The remaining contents of (meth) acrylonitrile should preferably be less than 100 ppm, based on the complete weight of the reaction solution.

The concentration of the blend of ammonium (meth) acrylate and (meth) acrylamide at the end of the bioconversion is at least 10% (w/w), at least 15% (w/w), at least 20% (w/w), preferably at least 30% (w/w), at least 35% (w/w) by weight of the blend of the ammonium (meth) acrylate and (meth) acrylamide monomers in the aqueous medium.

Typically, the concentration of (meth) acrylamide and ammonium (meth) acrylate at the end of the bioconversion is in the range from 10% to 38% (w/w), preferably in the range from 20% to 35% (w/w), more preferably in the range from 25% to 35% (w/w), even more preferably in the range from 30% to 35% (w/w)by weight, based on the complete weight of the reaction solution.

Preferably, the molar ratio of ammonium (meth) acrylate to (meth) acrylamide is from 5:95 to 95:5, from 10:90 to 90:10, from 85:15 to 15:85, suitably from 20:80 to 80:20, from 25:75 to 75:25, from 30:70 to 70:30, from 35:65 to 65:35, from 40:60 to 60:40, from 45:55 to 55:45. Other preferred ranges of molar ratios of ammonium (meth) acrylate to (meth) acrylamide includes from 20:80 to 35:65, preferably from 23:77 to 32:68, more preferably from 25:75 to 30:70. The biocatalyst (i) capable of converting (meth) acrylonitrile to ammonium (meth) acry late may typically be an enzyme having nitrilase activity. Suitably such nitrilase enzymes are capable of catalysing the hydrolysis of (meth) acrylonitrile to ammonium (meth) acrylate. Such a process of hydrolysis may be referred to as bioconversion or bio-catal- ysis.

Preferably, the biocatalyst (i) according to the present invention may be an enzyme with nitrilase activity comprising the sequence selected from the group consisting of an amino acid molecule of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28,

30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52 and 54 or a functional fragment thereof. Further preferred is that the biocatalyst (i) is an enzyme with nitrilase activity comprising the sequence selected from the group consisting of an amino acid molecule encoded by a nucleic acid molecule of SEQ ID NO 1 , 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27,

29, 31 , 33, 35, 37, 39, 41 , 43, 45, 47, 49, 51 and 53 or a functional fragment thereof.

Preferably, the biocatalyst (i) is an isolated nitrilase, a recombinant construct or a re combinant vector, which in particular is comprising said recombinant construct. Further preferred is that the biocatalyst (i) is a recombinant microorganism comprising said re combinant construct or said recombinant vector.

Typically, nitrilase enzymes can be produced by a variety of microorganisms. Preferred microorganisms that can be used in the present invention include, but are not limited to, Gluconobacter oxydans, Gluconobacter asaii, Achromobacter delmarvae, Achromobac- ter viscosus, Achromobacter lacticum, Agrobacterium tumefaciens, Agrobacterium radi- obacter, Alcaligenes faecalis, Arthrobacter citreus, Arthrobacter tumescens, Arthrobac- ter paraffineus, Arthrobacter hydrocarboglutamicus, Arthrobacter oxydans, Aureobacte- rium saperdae, Azotobacter indicus, Brevibacterium ammoniagenes, Brevibacterium di- varicatum, Brevibacterium lactofermentum, Brevibacterium flavum, Brevibacterium glo- bosum, Brevibacterium fuscum, Brevibacterium ketoglutamicum, Brevibacterium hel- colum, Brevibacterium pusillum, Brevibacterium testaceum, Brevibacterium roseum, Brevibacterium immariophilium, Brevibacterium linens, Brevibacterium protopharmiae, Corynebacterium acetophilum, Corynebacterium glutamicum, Corynebacterium cal- lunae, Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum, Entero- bacter aerogenes, Erwinia amylovora, Erwinia carotovora, Erwinia herbicola, Erwinia chrysanthemi, Flavobacterium peregrinum, Flavobacterium fucatum, Flavobacterium aurantinum, Flavobacterium rhenanum, Flavobacterium sewanense, Flavobacterium breve, Flavobacterium meningosepticum, Micrococcus sp. CCM825, Morganella mor- ganii, Nocardia opaca, Nocardia rugosa, Planococcus eucinatus, Proteus rettgeri, Propionibacterium shermanii, Pseudomonas synxantha, Pseudomonas azotoformans, Pseudomonas jluorescens, Pseudomonas ovalis, Pseudomonas stutzeri, Pseudomonas acidovolans, Pseudomonas mucidolens, Pseudomonas testosteroni, Pseudomonas ae ruginosa, Rhodococcus erythropolis, Rhodococcus rhodochrous, Rhodococcus sp. ATCC 15592, Rhodococcus sp. ATCC 19070, Sporosarcina ureae, Staphylococcus au reus, Vibrio metschnikovii, Vibrio tyrogenes, Actinomadura madurae, Actinomyces viola- ceochromogenes, Kitasatosporia parulosa, Streptomyces avermitilis, Streptomyces coe- licolor, Streptomyces flavelus, Streptomyces griseolus, Streptomyces lividans, Strepto myces olivaceus, Streptomyces tanashiensis, Streptomyces virginiae, Streptomyces an- tibioticus, Streptomyces cacaoi, Streptomyces lavendulae, Streptomyces viridochromo- genes, Aeromonas salmonicida, Bacillus pumilus, Bacillus circulans, Bacillus thiamino- lyticus, Escherichia freundii, Microbacterium ammoniaphilum, Serratia marcescens, Sal monella typhimurium, Salmonella schottmulleri, Xanthomonas citri, Synechocystis sp., Synechococcus elongatus, Thermosynechococcus elongatus, Microcystis aeruginosa, Nostoc sp., N. commune, N.sphaericum, Nostoc punctiforme , Spirulina platensis, Lyngbya majuscula, L. lagerheimii, Phormidium tenue, Anabaena sp., Leptolyngbya sp and so forth.

In some preferred embodiments, the microorganism is a eukaryotic cell. Suitable eukar yotic cells include yeast cells, as for example Saccharomyces spec, such as Saccharo- myces cerevisiae, Hansenula spec, such as Hansenula polymorpha, Schizosaccharo- myces spec, such as Schizosaccharomyces pombe, Kluyveromyces spec, such as Kluyveromyces lactis and Kluyveromyces marxianus, Yarrowia spec, such as Yarrowia lipolytica, Pichia spec, such as Pichia methanolica, Pichia stipites and Pichia pastoris, Zygosaccharomyces spec, such as Zygosaccharomyces rouxii and Zygosaccharomy- ces bailii, Candida spec, such as Candida boidinii, Candida utilis, Candida freyschussii, Candida glabrata and Candida sonorensis, Schwanniomyces spec, such as Schwannio- myces occidentalis, Arxula spec, such as Arxula adeninivorans, Ogataea spec such as Ogataea minuta, Klebsiella spec, such as Klebsiella pneumonia.

A microorganism of the genus Cupriavidus basilensis, Flavihumibacter solisilvae, Aci- dovorax facilis 72W, Pseudomonas sp. RIT357, Nocardia brasiliensis NBRC 14402, Pseudomonas fluorscens, Agrobacterium rubi, Candidatus Dadabacteria bacterium CSP1-2, Tepidicaulis marinus, Synechococcus sp. CC9605, Aquimarina atlantica, Arthrobacter sp., Sphingomonas wittichii RW1 , Pseudomonas mandelii JR-1 , Salinisp- haera shabanensis E1L3A, Smithella sp. SDB, Bradyrhizobium diazoefficiens, Actino- bacteria bacterium RBG_13_55_18, Rhizobium sp. YK2 or Bacterium YEK0313 ex pressing any of the nitrilases of the invention is another preferred embodiment of the in vention. Further, microorganisms suitable as biocatalyst (i) for the enzymatic conversion of (meth-) acrylonitrile to ammonium (meth-) acrylate, which are known for a person skilled in the art, are able to be applied according to the present invention. Additionally, the specific methods known in the art of culturing (or cultivation, or fermentation) and/or storing the microorganism as well as the respective sequences of polynucleotides which are encoding the enzyme, particularly the nitrilase, are applicable in context of the pre sent invention.

The term "isolated" as used herein means that a material has been removed by the hand of man and exists apart from its original, native environment and is therefore not a product of nature. An isolated material or molecule (such as a DNA molecule or en zyme) may exist in a purified form or may exist in a non-native environment such as, for example, in a transgenic host cell. For example, a naturally occurring nucleic acid mole cule or polypeptide present in a living cell is not isolated, but the same nucleic acid mol ecule or polypeptide, separated from some or all of the coexisting materials in the natu ral system, is isolated. Such nucleic acid molecules can be part of a vector and/or such nucleic acid molecules or polypeptides could be part of a composition and would be iso lated in that such a vector or composition is not part of its original environment. Prefera bly, the term "isolated" when used in relation to a nucleic acid molecule, as in "an iso lated nucleic acid sequence" refers to a nucleic acid sequence that is identified and sep arated from at least one contaminant nucleic acid molecule with which it is ordinarily as sociated in its natural source. Isolated nucleic acid molecule is nucleic acid molecule present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acid molecules are nucleic acid molecules such as DNA and RNA, which are found in the state they exist in nature. For example, a given DNA sequence (e.g., a gene) is found on the host cell chromosome in proximity to neighbor ing genes; RNA sequences, such as a specific mRNA sequence encoding a specific protein, are found in the cell as a mixture with numerous other mRNAs, which encode a multitude of proteins. Flowever, an isolated nucleic acid sequence comprising for exam ple SEQ ID NO: 1 includes, by way of example, such nucleic acid sequences in cells which ordinarily contain SEQ ID NO: 1 where the nucleic acid sequence is in a genomic or plasmid location different from that of natural cells, or is otherwise flanked by a differ ent nucleic acid sequence than that found in nature. The isolated nucleic acid sequence may be present in single- or double-stranded form. When an isolated nucleic acid se quence is to be utilized to express a protein, the nucleic acid sequence will contain at a minimum at least a portion of the sense or coding strand (i.e. , the nucleic acid sequence may be single-stranded). Alternatively, it may contain both the sense and anti-sense strands (i.e., the nucleic acid sequence may be double-stranded). The term “nitrilase” as used herein refers to an enzyme catalyzing the reaction from meth-acrylonitrile to ammonium methacrylate and / or the reaction from acrylonitrile to ammonium acrylate. It also encompasses enzymes that are catalyzing additional reac tions despite those mentioned before.

As used herein, the term “nitrilase producing microorganism” or “microorganism” in the context of „nitrile producing microorganism" or “biocatalysts (i)” or the like in the context of this invention have the meaning to be able to produce (i.e. they encode and express) the enzyme nitrilase either per se (naturally) or they have been genetically modified re spectively. Microorganisms which have been “genetically modified” means that these microorganisms have been manipulated such that they have acquired the capability to express the required enzyme nitrilase, e.g. by way of incorporation of a naturally and/or modified nitrile hydratase gene or gene cluster or the like. Produced products of the mi croorganisms that can be used in the context of the present invention are also contem plated, e.g. suspensions obtained by partial or complete cell disruption of the microor ganisms.

The terms “nitrilase producing microorganism” or “microorganism” in the context of ni trile producing microorganism or “biocatalysts (i)” or the like, include the cells and/or the processed product thereof as such, and/or suspensions containing such microorgan isms and/or processed products. It is also envisaged that the microorganisms and/or processed products thereof are further treated before they are employed in the embodi ments of the present invention. “Further treated” thereby includes for example washing steps and/or steps to concentrate the microorganism etc.

It is also envisaged that the microorganisms that are employed in the embodiments of the present invention have been pre-treated by a for example drying step. Also known methods for cultivating of the microorganisms and how to optimize the cultivation condi tions via for example addition of urea or cobalt are compassed by the embodiments of the present invention. Advantageously, the microorganism can be grown in a medium containing urea, acetonitrile or acrylonitrile as an inducer of the nitrilase.

As used herein, the term "vector" refers to a nucleic acid molecule capable of transport ing another nucleic acid molecule to which it has been linked. One type of vector is a genomic integrated vector, or "integrated vector", which can become integrated into the genomic DNA of the host cell. Another type of vector is an episomal vector, i.e., a plas mid or a nucleic acid molecule capable of extra-chromosomal replication. Vectors capa ble of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors". In the present specification, "plasmid" and "vector" are used interchangeably unless otherwise clear from the context.

The term “recombinant microorganism” includes microorganisms which have been ge netically modified such that they exhibit an altered or different genotype and/or pheno type (e. g., when the genetic modification affects coding nucleic acid sequences of the microorganism) as compared to the wild type microorganism from which it was derived. A recombinant microorganism comprises at least one recombinant nucleic acid mole cule.

The term "recombinant" with respect to nucleic acid molecules refers to nucleic acid molecules produced by man using recombinant nucleic acid techniques. The term com prises nucleic acid molecules which as such do not exist in nature or do not exist in the organism from which the nucleic acid molecule is derived, but are modified, changed, mutated or otherwise manipulated by man. Preferably, a "recombinant nucleic acid mol ecule" is a non-naturally occurring nucleic acid molecule that differs in sequence from a naturally occurring nucleic acid molecule by at least one nucleic acid. A “recombinant nucleic acid molecules” may also comprise a “recombinant construct” which comprises, preferably operably linked, a sequence of nucleic acid molecules not naturally occurring in that order. Preferred methods for producing said recombinant nucleic acid molecules may comprise cloning techniques, directed or non-directed mutagenesis, gene synthe sis or recombination techniques.

Preferably, the biocatalyst (i) for converting (meth-) acrylonitrile to ammonium (meth-) acrylate may each be obtained from culturing the microorganism in respective suitable growth medium. The growth medium, also called fermentation (culture) medium, fer mentation broth, fermentation mixture, or the like, may comprise typical components like sugars, polysaccharides. For storage of the microorganism, the fermentation broth pref erably is removed in order to prevent putrefaction, which could result in a reduction of nitrile hydratase activity. Preferably, the storage does not influence biocatalytic activity or does not lead to a reduction in biocatalytic activity. The biocatalyst may be stored in presence of the fermentation broth components. Preferred in the sense of the present invention is that the biocatalyst may be stored in form of a frozen suspension and may be thawed before use. Further, the biocatalyst may be stored in dried form using freeze drying, spray drying, heat drying, vacuum drying, fluidized bed drying and/or spray gran ulation.

The biocatalysts that are used according to the present invention can for example be cultured under any conditions suitable for the purpose in accordance with any of the known methods, for instance as described in the mentioned prior art of this specifica tion. The biocatalyst may be used as a whole cell catalyst for the generation of acid from nitrile. The biocatalyst may be (partly) immobilized for instance entrapped in a gel or it may be used for example as a free cell suspension. For immobilization well known standard methods can be applied like for example entrapment cross linkage such as glutaraldehyde-polyethyleneimine (GA-PEI) crosslinking, cross linking to a matrix and/or carrier binding etc., including variations and/or combinations of the aforementioned methods. When using inactivated or partly inactivated cells, such cells may be inacti vated by thermal or chemical treatment.

In a preferred embodiment, the microorganisms are whole cells. The whole cells may be pre-treated by a drying step. The microorganisms that are employed in the context of the present invention may in a preferred embodiment also be used in an aqueous sus pension and in a more preferred embodiment are free whole cells in an aqueous sus pension. The term "aqueous suspension" thereby includes all kinds of liquids, such as buffers or culture medium that are suitable to keep microorganisms in suspension. Such liquids are well-known to the skilled person and include for example storage buffers at suitable pH such as storage buffers which are used to store microorganisms, TRIS- based buffers, phosphate based buffers, saline based buffers, water in all quality grades such as distilled water, pure water, tap water, or sea water, culture medium, growing medium, nutrient solutions, or fermentation broths, for example the fermentation broth that was used to culture the microorganisms. During storage for example the aqueous suspension is frozen and thawed before use.

In one preferred embodiment the biocatalyst (i) having nitrilase activity is at least one selected from the group consisting of an isolated nitrilase, a recombinant construct, a recombinant vector comprising the recombinant construct, a recombinant microorgan ism comprising the recombinant construct, and a recombinant microorganism compris ing the recombinant vector.

Preferably, the biocatalyst (i) is a recombinant microorganism selected from the group consisting of Bacillus licheniformis, Bacillus pumilus, Bacillus subtilis, Escherichia coli, Saccharomyces cerevisiae, Rhodococcus rhodochrous and Pichia pastoris. More pref erably, the biocatalyst (i) comprises Escherichia coli TG 10+ (pDHE BD5220div).

The biocatalyst (ii) capable of converting (meth) acrylonitrile to (meth) acrylamide may typically be an enzyme having nitrile hydratase activity. Suitably such nitrile hydratase enzymes are capable of catalysing the hydrolysis of (meth) acrylonitrile to (meth) acryla mide. Such a process of hydrolysis may be referred to as bioconversion or bio-catalysis. In some embodiments of the present invention, the biocatalyst (ii) is a biocatalyst having nitrile hydratase activity. According to the present invention, the biocatalyst (ii) having nitrile hydratase activity may be one selected from the group consisting of microorgan isms belonging to Rhodococcus, Aspergillus, Acidovorax, Agrobacterium, Bacillus, Bradyrhizobium, Burkholderia, Klebsiella, Mesorhizobium, Moraxella, Pantoea, Pseudo monas, Rhizobium, Rhodopseudomonas, Serratia, Amycolatopsis, Arthrobacter, Brevi- bacterium, Corynebacterium, Microbacterium, Micrococcus, Nocardia, Pseudonocardia, Trichoderma, Myrothecium, Aureobasidium, Candida, Cryptococcus, Debaryomyces, Geotrichum, Hanseniaspora, Kluyveromyces, Pichia, Rhodotorula, Escherichia, Geo bacillus, Comomonas, and Pyrococcus, and transformed microbial cells in which a ni trile hydratase gene is introduced. In preferred embodiments of the invention the biocat alyst is selected from the group consisting of Rhodococcus, pseudomonas, Escherichia and Geobacillus.

In some embodiments the biocatalyst (ii) is Rhodococcus erythropolis. In some embodi ments the biocatalyst (ii) is Rhodococcus equi. In some embodiments the biocatalyst (ii) is Rhodococcus ruber. In some embodiments the biocatalyst (ii) is Rhodococcus opa- cus. In some embodiments the biocatalyst (ii) is Rhodococcus pyridinovorans. In some embodiments the biocatalyst (ii) is Aspergillus niger. In some embodiments the biocata lyst (ii) is Acidovorax avenae. In some embodiments the biocatalyst (ii) is Acidovorax fa- cilis. In some embodiments the biocatalyst (ii) is Agrobacterium tumefaciens. In some embodiments the biocatalyst (ii) is Agrobacterium radiobacter. In some embodiments the biocatalyst (ii) is Bacillus subtilis. In some embodiments the biocatalyst (ii) is Bacil lus pallidus. In some embodiments the biocatalyst (ii) is Bacillus smithii. In some em bodiments the biocatalyst (ii) is Bacillus sp BR449. In some embodiments the biocata lyst (ii) is Bradyrhizobium oligotrophicum. In some embodiments the biocatalyst (ii) is Bradyrhizobium diazoefficiens. In some embodiments the biocatalyst (ii) is Bradyrhizo bium japonicum. In some embodiments the biocatalyst (ii) is Burkholderia cenocepacia. In some embodiments the biocatalyst (ii) is Burkholderia gladioli. In some embodiments the biocatalyst (ii) is Klebsiella oxytoca. In some embodiments the biocatalyst (ii) is Klebsiella pneumonia. In some embodiments the biocatalyst (ii) is Klebsiella variicola. In some embodiments the biocatalyst (ii) is Mesorhizobium ciceri. In some embodiments the biocatalyst (ii) is Mesorhizobium opportunistum. In some embodiments the biocata lyst (ii) is Mesorhizobium sp F28. In some embodiments the biocatalyst (ii) is Moraxella. In some embodiments the biocatalyst (ii) is Pantoea endophytica. In some embodiments the biocatalyst (ii) is Pantoea agglomerans. In some embodiments the biocatalyst (ii) is Pseudomonas chlororaphis. In some embodiments the biocatalyst (ii) is Pseudomonas putida. In some embodiments the biocatalyst (ii) is Rhizobium. In some embodiments the biocatalyst (ii) is Rhodopseudomonas palustris. In some embodiments the biocata lyst (ii) is Serratia liquefaciens, Serratia marcescens, Amycolatopsis, Arthrobacter, Brevibacterium sp CH1. In some embodiments the biocatalyst (ii) is Brevibacterium sp CH2. In some embodiments the biocatalyst (ii) is Brevibacterium sp R312. In some em bodiments the biocatalyst (ii) is Brevibacterium imperiale. In some embodiments the bio catalyst (ii) is Cory nebacteri urn nitrilophilus. In some embodiments the biocatalyst (ii) is Cory nebacteri urn pseudodiphteriticum. In some embodiments the biocatalyst (ii) is Cory nebacteri urn glutamicum. In some embodiments the biocatalyst (ii) is Corynebacte- rium hoffmanii. In some embodiments the biocatalyst (ii) is Microbacterium imperiale. In some embodiments the biocatalyst (ii) is Microbacterium smegmatis. In some embodi ments the biocatalyst (ii) is Micrococcus luteus. In some embodiments the biocatalyst (ii) is Nocardia globerula. In some embodiments the biocatalyst (ii) is Nocardia rhodo- chrous. In some embodiments the biocatalyst (ii) is Pseudonocardia thermophila. In some embodiments the biocatalyst (ii) is Trichoderma. In some embodiments the bio catalyst (ii) is Myrothecium verrucaria. In some embodiments the biocatalyst (ii) is Aure- obasidium pullulans. In some embodiments the biocatalyst (ii) is Candida famata. In some embodiments the biocatalyst (ii) is Candida guilliermondii. In some embodiments the biocatalyst (ii) is Candida tropicalis. In some embodiments the biocatalyst (ii) is Cryptococcus flavus. In some embodiments the biocatalyst (ii) is Cryptococcus sp UFMG- Y28. In some embodiments the biocatalyst (ii) is Debaryomyces hanseii. In some embodiments the biocatalyst (ii) is Geotrichum candidum. In some embodiments the biocatalyst (ii) is Geotrichum sp JR1. In some embodiments the biocatalyst (ii) is Hanseniaspora. In some embodiments the biocatalyst (ii) is Kluyveromyces thermotoler- ans. In some embodiments the biocatalyst (ii) is Pichia kluyveri. In some embodiments the biocatalyst (ii) is Rhodotorula glutinis. In some embodiments the biocatalyst (ii) is Escherichia coli. In some embodiments the biocatalyst (ii) is Geobacillus sp. In some embodiments the biocatalyst (ii) is RAPc8. In some embodiments the biocatalyst (ii) is Comomonas testosteroni. In some embodiments the biocatalyst (ii) is Pyrococcus ab- yssi. In some embodiments the biocatalyst (ii) is Pyrococcus furiosus. In some embodi ments the biocatalyst (ii) is Pyrococcus horikoshii.

In a preferred embodiment of the present invention the biocatalyst (ii) is Rhodococcus rhodochrous. In some embodiments of the present invention the biocatalyst (ii) is of the strain Rhodococcus rhodochrous NCIMB 41164. In some embodiments of the present invention the biocatalyst (ii) is of the strain Rhodococcus rhodochrous J-1 (Accession number: FERM BP-1478). In some embodiments the biocatalyst (ii) is of the strain Rho dococcus rhodochrous M8 (Accession number: VKPMB-S 926). In some embodiments of the present invention the biocatalyst (ii) is of the strain. In some embodiments of the present invention the biocatalyst (ii) is of the strain Rhodococcus rhodochrous M33. In some embodiments of the present invention the biocatalyst (ii) is of the strain Rhodo- cocus pyridinovorans. In some embodiments of the present invention biocatalyst (ii) is of the strain Escherichia coli MT-10822 (Accession number: FERM BP-5785).

More preferably, the biocatalyst (ii) comprises Rhodococcus rhodochrous NCIMB 41164.

According to the present invention, combinations of these microorganisms can be used as well. Further, the above microorganisms can be cultured by any method that is ap propriate for a given microbial species. The microbial biocatalyst (ii) of the present in vention that is prepared from microorganisms refers to a culture solution obtained by culturing microorganisms, cells obtained by a harvesting process or the like, cell dis rupted by ultrasonication or the like, or those prepared after cell disruption including a crude enzyme, a partially-purified enzyme or a purified enzyme. A mode to use the mi crobial catalyst may be appropriately selected depending on enzyme stability, produc tion scale and the like.

In some embodiments of the present invention, the biocatalyst (ii) used for converting (meth-) acrylonitrile to (meth-) acrylamide as described herein may be washed before the use in said reaction.

In some embodiments, the biocatalyst (ii) may be washed once with water, a buffer or the like, and then washed with acrylic acid before the reaction. In some embodiments the biocatalyst (ii) used herein is washed with acrylic acid before the reaction as described in detail in EP1380652. In some embodiments the biocatalyst (ii) may be washed with acrylic acid immediately before the reaction. Further, any washing methods can be employed. Examples of such a method that can be applied according to the present invention include a method which involves repeated washing and centrifugation, and a washing method using a hollow fiber membrane. Further, immobilized biocatalysts (ii) can be washed by repeating agitation and precipitation of the immobilized catalysts in a wash and the re moval of supernatant. Any washing method and any number of washing can be appropri ately set in consideration of washing efficiency, enzyme stability and the like. The con centration of acrylic acid to be used for washing is preferably between 0.01 % by mass and 10 % by mass in an aqueous acrylic solution. More preferably, the concentration is between 0.05 % by mass and 1 % by mass, and most preferably is 0.1 % by mass.

In other embodiments of the present invention, the biocatalyst (ii) used for converting (meth-) acrylonitrile to (meth-) acrylamide as described herein need not be washed before use in said reaction. In such embodiments the biocatalyst is not washed prior to use in the reaction. In this case, the other additives such as water and buffer solution would merely be added.

In context with the present invention, nitrile hydratase encoding microorganisms which are not naturally encoding nitrile hydratase may be genetically engineered microorgan isms which naturally do not contain a gene encoding a nitrile hydratase but which have been manipulated such as to contain a polynucleotide encoding a nitrile hydratase (e.g., via transformation, transduction, transfection, conjugation, or other methods suitable to transfer or insert a polynucleotide into a cell as known in the art; cf. Sambrook and Russell 2001 , Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA), thus enabling the microorganisms to produce and stably maintain the nitrile hydra tase enzyme. For this purpose, it may further be required to insert additional polynucleo tides which may be necessary to allow transcription and translation of the nitrile hydratase gene or mRNA, respectively. Such additional polynucleotides may comprise, inter alia, promoter sequences, polyT- or polyU-tails, or replication origins or other plasmid-control sequences. In this context, such genetically engineered microorganisms which naturally do not contain a gene encoding a nitrile hydratase but which have been manipulated such as to contain a polynucleotides encoding a nitrile hydratase may be prokaryotic or eukar yotic microorganisms. Examples for such prokaryotic microorganisms include, e.g., rep resentatives of the species Escherichia coli. Examples for such eukaryotic microorgan isms include, e.g., yeast (e.g., Saccharomyces cerevisiae).

In context of the present invention, the term “nitrile hydratase” (also referred to herein as NHase) generally means an enzyme which is capable of catalyzing the conversion (i.e. hydration) of (meth-) acrylonitrile to (meth-) acrylamide. Such an enzyme may be, e.g., the enzyme registered under IUBMB nomenclature as of April 1 , 2014: EC 4.2.1 .84; CAS- No. 2391-37-5. However, the term “nitrile hydratase” as used herein also encompasses modified or enhanced enzymes which are, e.g. , capable of converting (meth-) acrylonitrile to (meth-) acrylamide more quickly, or which can be produced at a higher yield/time-ratio, or which are more stable, as long as they are capable to catalyze conversion (i.e. hydra tion) of (meth-) acrylonitrile to (meth-) acrylamide. Methods for determining the ability of a given biocatalyst (e.g., microorganism or enzyme) for catalyzing the conversion of (meth-) acrylonitrile to (meth-) acrylamide are known in the art. As an example, in context with the present invention, activity of a given biocatalyst to act as a nitrile hydratase in the sense of the present invention may be determined as follows: First reacting 100 pi of a cell suspension, cell lysate, dissolved enzyme powder or any other preparation containing the supposed nitrile hydratase with 875 mI of an 50 mM potassium phosphate buffer and 25 mI of acrylonitrile at 25 °C on an Eppendorf tube shaker at 1 ,000 rpm for 10 minutes. After 10 minutes of reaction time, samples may be drawn and immediately quenched by adding the same volume of 1 .4% hydrochloric acid. After mixing of the sample, cells may be removed by centrifugation for 1 minute at 10,000 rpm and the amount of acrylamide formed is determined by analyzing the clear supernatant by HPLC. For affirmation of an enzyme to be a nitrile hydratase in context with the present invention, the concentration of acrylamide shall be between 0.25 and 1 .25 mmol/l - if necessary, the sample has to be diluted accordingly and the conversion has to be repeated. The enzyme activity may then be deduced from the concentration of acrylamide by dividing the acrylamide concentra tion derived from HPLC analysis by the reaction time, which has been 10 minutes and by multiplying this value with the dilution factor between HPLC sample and original sample. Activities >5 U/mg dry cell weight, preferably >25 U/mg dry cell weight, more preferably >50 U/mg dry cell weight, most preferably >100 U/mg dry cell weight indicate the pres ence of a functional biocatalyst and are considered as biocatalyst capable of converting acrylonitrile to acrylamide in context with the present invention.

In context with the present invention, the nitrile hydratase may be a polypeptide encoded by a polynucleotide which comprises or consists of a nucleotide sequence which is at least 70%, preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99,5%, and most preferably 100% identical to the nucleo tide sequence of SEQ ID NO: 66 (alpha-subunit of nitrile hydratase of Rhodococcus rhodochrous:

GTGAGCGAGCACGTCAATAAGTACACGGAGTACGAGGCACGTACCAAGGCGATC

GAAACCTTGCTGTACGAGCGAGGGCTCATCACGCCCGCCGCGGTCGACCGAGTC

GTTTCGTACTACGAGAACGAGATCGGCCCGATGGGCGGTGCCAAGGTCGTGGCC

AAGTCCTGGGTGGACCCTGAGTACCGCAAGTGGCTCGAAGAGGACGCGACGGCC

GCGATGGCGTCATTGGGCTATGCCGGTGAGCAGGCACACCAAATTTCGGCGGTCT

TCAACGACTCCCAAACGCATCACGTGGTGGTGTGCACTCTGTGTTCGTGCTATCC

GTGGCCGGTGCTTGGTCTCCCGCCCGCCTGGTACAAGAGCATGGAGTACCGGTC

CCGAGTGGTAGCGGACCCTCGTGGAGTGCTCAAGCGCGATTTCGGTTTCGACATC

CC C GAT G AG GT G G AG GT C AG G GTTT G G GAC AG C AG CTC C G AAAT C C G CTAC AT C

GTCATCCCGGAACGGCCGGCCGGCACCGACGGTTGGTCCGAGGAGGAGCTGAC

GAAGCTGGTGAGCCGGGACTCGATGATCGGTGTCAGTAATGCGCTCACACCGCA

GGAAGTGATCGTATGA) and/or to the nucleotide sequence of SEQ ID NO: 68 (beta- subunit of nitrile hydratase of Rhodococcus rhodochrous:

ATGGATGGTATCCACGACACAGGCGGCATGACCGGATACGGACCGGTCCCCTATC AGAAGGACGAGCCCTTCTTCCACTACGAGTGGGAGGGTCGGACCCTGTCAATTCT GACTTGGATGCATCTCAAGGGCATATCGTGGTGGGACAAGTCGCGGTTCTTCCGG GAGT C GAT G G G G AAC G AAAACT AC GT C AAC GAG ATT C G C AACT C GTACT AC AC C C ACTG G CT G AGT G C G G C AG AAC GT ATCCTCGTCGCC G AC AAG AT CAT C AC C G AAG A AGAGCGAAAGCACCGTGTGCAAGAGATCCTTGAGGGTCGGTACACGGACAGGAA GCCGTCGCGGAAGTTCGATCCGGCCCAGATCGAGAAGGCGATCGAACGGCTTCA CGAGCCCCACTCCCTAGCGCTTCCAGGAGCGGAGCCGAGTTTCTCTCTCGGTGAC AAG AT C AAAGT G AAG AGT AT G AAC C C G CTG G G AC AC AC AC G GTG C C C G AAAT AT G TGCGGAACAAGATCGGGGAAATCGTCGCCTACCACGGCTGCCAGATCTATCCCGA GAGCAGCTCCGCCGGCCTCGGCGACGATCCTCGCCCGCTCTACACGGTCGCGTT TTCCGCCCAGGAACTGTGGGGCGACGACGGAAACGGGAAAGACGTAGTGTGCGT CGATCTCTGGGAACCGTACCTGATCTCTGCGTGA), provided that the polypeptide encoded by said polynucleotide is capable of catalyzing hydration of acrylonitrile to acrylamide (i.e. has nitrile hydratase activity) as described and exemplified herein. Also in the context with the present invention, the nitrile hydratase may be a polypeptide which comprises or consists of an amino acid sequence which is at least 70%, preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99,5%, and most preferably 100% identical to the amino acid sequence of SEQ ID NO: 67 (alpha-subunit of nitrile hydratase of Rhodococcus rhodochrous: VSEHVNKYTE YEARTKAIET LLYERGLITP AAVDRVVSYY ENEIGPMGGA

KVVAKSWVDP EYRKWLEEDA TAAMASLGYA GEQAHQISAV FNDSQTHHVV VCTLCSCYPW PVLGLPPAWY KSMEYRSRVV ADPRGVLKRD FGFDIPDEVE VRVWDSSSEI RYIVIPERPA GTDGWSEEEL TKLVSRDSMI GVSNALTPQE VIV) and/or to the amino acid sequence of SEQ ID NO: 69 (beta-subunit of nitrile hydratase of R. rhodochrous^·. MDGIHDTGGM TGYGPVPYQK DEPFFHYEWE GRTLSILTWM HLKGISWWDK SRFFRESMGN ENYVNEIRNSY YTHWLSAAE RILVADKIIT EEERKHRVQE ILEGRYTDRK PSRKFDPAQI EKAIERLHEP HSLALPGAEP

SFSLGDKIKV KSMNPLGHTR CPKYVRNKIG EIVAYHGCQI YPESSSAGLG

DDPRPLYTVA FSAQELWGDD GNGKDVVCVD LWEPYLISA), provided that said polypeptide is capable of catalyzing hydration of acrylonitrile to acrylamide as described and exemplified herein.

The biocatalyst (i) and/or biocatalyst (ii) may be provided as powder, as granulate or as aqueous suspension to the reactor for bioconversion. If provided as powder or granulate it is frequently advisable to prepare an aqueous suspension before adding the catalyst into the reactor / bioconversion unit. In an embodiment, the biocatalyst suspension may be conducted by suspending the biocatalyst powder in water in a vessel comprising at least a mixing device, for example a stirrer, one or more inlets for water, the biocatalyst and optionally further additives and one outlet for the biocatalyst suspension. The vol ume of the vessel may be for example from 0.1 m³ to 1 m³ The concentration of the biocatalyst in the aqueous biocatalyst suspension may be for example from 1 % to 30% by wt., for example from 5 to 15% by wt. relating to the total of all components of the aqueous suspension. A biocatalyst suspension may be added directly to the bioconver sion unit. In another embodiment, a concentrated suspension may be diluted before adding it to the bioconversion unit / reactor where the bioconversion takes place.

The term „bioconversion“ as used herein in the context with any of the processes of the present invention in general denotes a reaction, wherein (meth-) acrylonitrile is con verted to the aqueous blend of ammonium (meth) acrylate and (meth) acrylamide in the presence of aqueous medium and biocatalyst (i) and biocatalyst (ii). As used herein, the term ..composition" includes all components present in the reactor, such as, for exam ple, the biocatalysts (i) and (ii), (meth) acrylonitrile, ammonium (meth) acrylate, (meth) acrylamide and water. The composition may also be called a reaction mixture.

Particularly, the bioconversion is performed by contacting a mixture comprising aqueous medium and (meth) acrylonitrile with biocatalyst (i) and biocatalyst (ii). The term „con- tacting" is not specifically limited and includes for example bringing into contact with, mixing, ad mixing, shaking, pouring into, flowing into, or incorporating into. It is thus only did decisive that the mentioned ingredients come into contact with each other no matter how the contact is achieved.

Aqueous medium comprises all kinds of aqueous liquids, such as buffers at suitable pH, TRIS-based buffers, phosphate based buffers, saline based buffers, water in all quality grades such as distilled water, pure water, tap water or seawater. The buffer pH may be, for example, in the range of from 4 to 9.

In one embodiment the present invention relates to a process for producing an aqueous blend of ammonium (meth) acrylate and (meth) acrylamide, which blend is suitable for producing copolymers of ammonium (meth) acrylate and (meth) acrylamide, said pro cess comprising the following steps:

(a) adding the following components (i) to (iv) to a reactor to obtain a composi tion for bioconversion:

(iii) (meth) acrylonitrile;

(iv) water; and (b) performing a bioconversion on the composition obtained in step (a) into a re actor, wherein the aqueous blend of ammonium (meth) acrylate and (meth) acrylamide has a molar ratio of ammonium (meth) acrylate to (meth) acrylamide of from 1 :99 to 99:1.

The bioconversion in accordance with the process of the present invention may be car ried out in any vessel suitable for conducting bioconversion processes. Such a vessel may be referred to as „reactor“, „bioconversion reactor" and/or „bioconversion unit".

The addition of components (i) to (iv) in step (a) may take place in any order or se quence. Also preparing a pre-mix of some or all components (i) to (iv) is possible to ob tain a composition for bioconversion according to step (a). The bioconversion can for example be conducted under any conditions suitable for the purpose in accordance with any of the known methods.

When adding the biocatalysts (i) and (ii) to the reactor in any one of the methods (pro cess) of the present invention, one or both of the biocatalysts may be taken directly from the respective fermentation broth(s). Alternatively, in accordance with any one of the methods described herein, the biocatalyst may have been dried before being added to the reactor. In this context the term “before” does not necessarily mean that the biocata lyst or biocatalysts has/have been dried and is/are then directly added to the reactor. It is rather sufficient that the biocatalyst(s) has/have undergone a drying step at any time before it is/they are added to the reactor, independently of whether further steps be tween the drying and the addition are performed or not. As non-limiting examples, such further steps between the drying step and the addition to the reactor may be storage or reconstitution. However, it is also possible to add the biocatalyst(s) to the reactor di rectly after drying. According to any one of the methods of the present invention a dried biocatalyst or biocatalysts may be added to the reactor. This means that the one or both biocatalysts may be added to the reactor in a dried form. In particular, the one or both biocatalysts may have the form of a powder or a granule. As an alternative to adding a dried biocatalyst or both dried biocatalysts to the reactor, the one or both dried biocata lysts may be reconstituted before being added to the reactor. For example, the one or both biocatalysts may be reconstituted by suspending in an aqueous composition. With this respect, the aqueous composition may be water or a buffer. As a further alternative, a biocatalyst or both biocatalysts in form of matrix bound microorganism (s) may be added to the reactor. The conversion of (meth-) acrylonitrile to the aqueous blend of ammonium (meth-) acry late and (meth) acrylamide may be carried out by any of a batch process and a continu ous process, and the conversion may be carried out by selecting its reaction system from reaction systems such as suspended bed, a fixed bed, a fluidized bed and the like or by combining different reaction systems according to the form of the catalyst. Particu larly, the method of the present invention may be carried out using a semi-batch pro cess. In particular, the term "semi-batch process" as used herein may comprise that an aqueous blend of ammonium (meth-) acrylate and (meth) acrylamide solution is pro duced in a discontinuous manner. In yet another embodiment, the biocatalysts (i) and (ii) are recovered from the reaction mixture after the bioconversion and re-used in a subsequent bioconversion reaction.

According to a non-limiting example for carrying out such a semi-batch process water, a certain amount of (meth-) acrylonitrile and the biocatalyst are placed in the bioconver sion unit. Further (meth-) acrylonitrile is then added during the bioconversion until a de sired content of ammonium (meth-) acrylate and (meth) acrylamide of the composition is reached. After such desired content of ammonium (meth-) acrylate and (meth) acryla mide is reached, the obtained composition is for example partly or entirely recovered from the reactor, before new reactants are placed therein. In particular, in any one of the methods of the present invention the (meth-) acrylonitrile may be fed such that the con tent of (meth-) acrylonitrile during step (b) is maintained substantially constant at a pre determined value. In general, in any one of the methods of the present invention the (meth-) acrylonitrile content and/or the ammonium (meth-) acrylate and (meth) acryla mide content during step (b) may be monitored. Methods of monitoring the contents are not limited and include Fourier Transform Infrared Spectroscopy (FTIR). In another em bodiment, the heat-balance of the reaction may be used for monitoring the process.

This means that monitoring via heat-balance method takes place by measuring the heat energy of the system during bioconversion and by calculating the loss of heat energy during the reaction in order to monitor the process.

Although the conversion of (meth-) acrylonitrile to the ammonium (meth-) acrylate and (meth) acrylamide may preferably be carried out at atmospheric pressure, it may be car ried out under pressure in order to increase solubility of (meth) acrylonitrile in the aque ous medium. Because biocatalysts are temperature sensitive and the hydrolysis is an exothermic reaction temperature control is important. The reaction temperature is not specifically restricted provided that it is not lower than the freezing point of the aqueous medium. Flowever, it is desirable to carry out the bioconversion at a temperature of usu ally 0 to 50°C, preferably 10 to 40°C, more preferably 15 to 30°C. It is possible that the temperature may vary over time during the bioconversion reaction. Further suitable conditions for the bioconversion according to the present invention are for example at least 15°C, at least 20°C, at least 24°C or at least 28°C. Preferably the aqueous me dium with the composition for bioconversion is incubated between including 27°C and 33°C, more preferably the aqueous medium is incubated between including 28°C and 30°C. Most preferably the aqueous medium is incubated at 28°C. The aqueous medium may also be incubated at 38°C, 39°C, 40°C, 41 °C, 42°C, 43°C, 44°C, 45°C, 46°C, 47°C, 48°C, 49°C or 50°C.

At the start of the process of the invention, the aqueous medium may comprise at least 0.05% (meth-) acrylonitrile, preferably at least 0.1 % (meth-) acrylonitrile, more prefera bly at least 0.5% (meth-) acrylonitrile, most preferably at least 1 .0% (meth-) acrylonitrile (w/w). Throughout the bioconversion (incubation) the concentration of (meth-) acryloni trile may be kept at a concentration of about 0.5% to 1 .5%, preferably about 1 .0% (meth-) acrylonitrile by continuous feeding of (meth-) acrylonitrile. Alternatively, the con centration of (meth-) acrylonitrile in the aqueous medium may be 5% or 6% at the start of the incubation and might be kept at that concentration or no further (meth-) acryloni trile may be added during bioconversion (incubation).

It is preferred, that the concentration of (meth-) acrylonitrile during the bioconversion does not exceed 10% by wt. and normally should not exceed 6 % by wt. and may for example be in the range from 0.1 % by wt. to 6 % by wt., preferably from 0.2 % by wt. to 5 % by wt., more preferably from 0.3 % by wt. to 4 % by wt., even more preferably from 0.5 % by wt. to 3 % by wt., still more preferably from 0.8 % by wt. to 2 % by wt. and most preferably from 1 % by wt. to 1 .5 % by wt., relating to the total of all components of the aqueous mixture. It is possible that the concentration may vary over time during the bioconversion reaction. In order to obtain more concentrated solutions of ammonium (meth-) acrylate and (meth-) acrylamide the total amount of (meth-) acrylonitrile should not be added all at once but it should be added stepwise or even continuously keeping the abovementioned concentration limits in mind.

The concentration of ammonium (meth-) acrylate and (meth-) acrylamide in the ob tained solution (aqueous medium) i.e. aqueous blend may be at least 10% (w/w), at least 15% (w/w), at least 20% (w/w), preferably at least 30% (w/w), at least 35% (w/w) by weight of the blend of the ammonium (meth) acrylate and (meth) acrylamide mono mers in the aqueous medium. Suitably the concentration lies in the range from 10% to 38%, preferably in the range from 20% to 35%, more preferably in the range from 25% to 35%, even more preferably in the range from 30% to 35% by weight, based on the complete weight of the reaction solution. The reaction should be carried out in such a manner that the final concentration of (meth-) acrylonitrile in the final ammonium (meth-) acrylate solution obtained does not exceed 0.1 % by weight relating to the total of all components of the aqueous solution.

Typical reaction times may be from 2 h to 20 h, in particular 4 h to 12 h, for example 6 h to 10 h. After completion of the addition of (meth-) acrylonitrile, the reactor contents are allowed to further circulate for some time to complete the reaction, for example for 1 hour to 3 hours. The remaining contents of (meth-) acrylonitrile should preferably be less than 100 ppm, based on the complete weight of the reaction solution. Further pre ferred bioconversion times (incubation times) of the aqueous medium may be at least 5h, at least 10h or at least 12h. Preferably the bioconversion (incubation) time is at least 18h, for example about 24h or about 30h. More preferably the bioconversion (incuba tion) time is about 36h or about 42h. Most preferably, the bioconversion (incubation) time is about 48h. Depending on the nitrilase used and the reaction rate of said nitrilase, the bioconversion (incubation) time may also exceed 48h.

In the aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide the con centration of each of the ammonium (meth-) acrylate and (meth-) acrylamide content may be determined using HPLC.

The hydrolysis of (meth-) acrylonitrile to the aqueous blend of ammonium (meth-) acry late and (meth-) acrylamide by means of a biocatalyst (i) and a biocatalyst (ii) is con ducted in a reactor which may be any suitable vessel for conducting bioconversion pro cesses. Suitable reactors for performing the bioconversion are known to the skilled arti san. Examples comprise vessels of any shape, for example cylindrical or spherical ves sels, or tube reactors. Such reactors may suitably comprise a pumping circuit compris ing a heat exchanger. The reactor may be termed a bioconversion reactor and/or a bio conversion unit. In one desirable form of the invention the reactor is a bioconversion unit. The bioconversion unit may be a relocatable bioconversion unit or may be a bio conversion unit which is a fixed production facility. By fixed production facility we mean that the bioconversion unit is or is part of a static production apparatus which is a fixed construction secured to a particular location and not designed for easy relocation. Such fixed production facilities may for instance be typical permanent production plants. Suit ably the bioconversion unit may be a relocatable bioconversion unit. By relocatable unit we mean that the unit is transportable as a whole and that is it not necessary to disas semble the entire unit into individual parts for transport. Transport may happen on trucks, railcars or ships. Such a relocatable unit may be for instance a production ap paratus which may be temporarily position at a location and if required relocated and re installed in another location. Typically, such relocatable bioconversion unit may be transportable as a whole without disassembling. However, such relocatable bioconversion unit may be of a design where the whole relocatable bioconversion unit is constructed of a multiplicity of components, such as interchangeable modules, which easily connect together and when required disconnect easily for relocation.

Suitably the bioconversion unit comprises a reaction vessel. The volume of the reaction vessel is not specifically limited and may range from 10 m³ to 150 m³, for example it may be from about 20 m³ to about 120 m³, suitably from about 20 m³ to about 100 m³, preferably about 20 m³ to 50 m³. Suitably, the reaction vessel may be arranged in any suitable orientation including substantially vertical, substantially horizontal or inclined at any angle between vertical and horizontal. The reaction vessel may be mounted in a suitable frame. Such a construction may avoid installing a pit for the collection of any leakage thereby ensuring an easier and quicker relocation of the reaction unit.

The bioconversion unit furthermore may desirably comprise means for controlling the temperature of the contents of the vessel. The hydrolysis of (meth-) acrylonitrile to am monium (meth-) acrylate and (meth-) acrylamide is an exothermal reaction and there fore heat generated in course of the reaction should desirably be removed in order to maintain an optimum temperature for bioconversion. The bioconversion unit furthermore usually comprises means for measurement and control, for example means for control ling the temperature or for controlling the pressure in the reaction vessel.

For temperature control, the preferred bioconversion unit comprises an external temper ature control circuit comprising a pump which pumps the aqueous reactor contents from the reaction vessel through a heat exchanger and back into the reaction vessel, prefera bly via an injection nozzle.

In one embodiment, a separate, relocatable temperature control unit is used comprising pump and heat exchanger and which is connected with the bioconversion unit by pipes or flexible tubes. In a preferred embodiment, the temperature control circuit is integrated into the bioconversion unit. It may, for example, be located at one end of the unit next to the reaction vessel.

It has been found, that the external temperature control circuit described above may also be used as means for mixing. The stream of the aqueous reaction mixture which passes through the temperature control circuit and which is injected back into the reac tion vessel causes a circulation of the aqueous reaction mixture within the reaction ves sel which is sufficient to mix the aqueous reaction mixture.

Preferably, no stirrer is used for the mobile bioconversion unit (i.e. reaction vessel). A stirrer is an additional mechanical device, which increases the technical complexity. When using the external temperature control cycle for mixing instead of a stirrer, the technical complexity can be reduced while still sufficient mixing during bioconversion can be ensured. Advantageously, without a stirrer a transportation step is easier, since no stirrer as additional technical component has to be removed before transportation of the mobile bioconversion unit. Further, a bioconversion unit without a stirrer offers more flexibility in form, shape, mechanical stability requirements and size for the bioconver sion unit. In particular, a horizontal set-up for the relocatable bioconversion unit can be realized easier without a stirrer and with mixing just via the external temperature control cycle.

Having no stirrer in the bioconversion reactor offers the advantage of reduced engineer ing costs and less effort in process control. A further advantage is that with having diffi cult construction requirements for constructing a production unit for producing an aque ous blend of ammonium (meth-) acrylate and (meth-) acrylamide, with the present in vention the bioconversion manufacturing unit can be of a much more simple construc tion, with less effort and leads to a less complex bioconversion reactor construction. Based on the state of the art, if bioconversion reactors are not vertical designed but hor izontal, this would require more stirrers or more stirring. Advantageously, with the pre sent invention mixing by the external cooling circuit, stirrers are no longer needed. Un expectedly, the external cooling circuit is sufficient also with horizontal and/or vertical reactors to obtain a satisfactory mixture of the reaction composition / reaction mixture. It is possible to do mixing without a stirrer when producing the aqueous blend of ammo nium (meth-) acrylate and (meth-) acrylamide from (meth-) acrylonitrile by a biocatalyst method. Additionally, the reduced equipment complexity offers the possibility to conduct the bioconversion in a relocatable unit.

Adding (meth-) acrylonitrile to the contents of the bioconversion unit may be performed in various ways. It may be added into the reaction vessel or it may be added into the temperature control circuit, for example after the pump and before the heat exchanger or after the heat exchanger. Injecting (meth-) acrylonitrile into the temperature control circuit ensures good mixing of the reaction mixture with freshly added (meth-) acryloni trile. Preferably, (meth-) acrylonitrile is added between pump and heat exchanger.

The amount of reaction mixture cycled per hour through the temperature control circuit is chosen such that sufficient mixing to the contents of the reactor as well as sufficient temperature control is achieved. In one embodiment, the amount of reaction mixture cy cled per hour through the temperature control circuit may be from 100 % to 1000 % of the total volume of the reaction mixture in the bioconversion unit, in particular from 200 % to 1000 % and for example from 500% to 800%. Further possible is that the amount of reaction mixture cycled per hour through the temperature control circuit is from 100 % to 10000 %, preferably from 100 % to 5000 %.

Off-gases of the bioconversion unit may comprise acrylonitrile, acrylic acid and acryla mide. If necessary, according to the applicable rules such off-gases may be treated in a manner known in the art. For example, it may be possible to combust the off-gases.

In one embodiment, all off-gases containing acrylonitrile, acrylic acid and acrylamide may be washed in a scrubber. The scrubber vessel may have a volume of 1 m³ to 100 m³, preferably a volume of 5 m³ to 100 m³, more preferably a volume of 10 m³ to 100 m³. It may be for example an ISOtank or relocatable storage vessel, preferably a single walled vessel or a double walled vessel. The scrubber water may preferably be col lected in a tank and it may be re-used for next bio-conversion batch.

In another embodiment of the invention, for temperature control an external temperature control circuit, for example a cooling circuit is used, which comprises a pump which pumps the monomer from the storage vessel through a heat exchanger and back into the storage vessel or reaction vessel.

The temperature control circuit may be a separate, relocatable temperature control unit comprising pump and heat exchanger and which is connected with the storage vessel or reaction vessel by pipes or flexible tubes.

In one embodiment of the invention, aqueous blend of bio ammonium (meth-) acrylate and (meth-) acrylamide for use in the method according to the present invention may be manufactured at a fixed chemical plant, and may be shipped to another location for fur ther processing. However, in another preferred embodiment of the present invention the manufacture of the aqueous blend of ammonium (meth-) acrylate and (meth-) acryla mide may be performed in a modular, relocatable plant. Further preferred is for example a relocatable bioconversion unit, which can be combined with installations and/or units of a fixed chemical plant. Such combination of an existing plant with a modular, relocat able bioconversion unit offers flexibility in building a production line based on case spe cific needs. Such production line at a certain plant can be adjusted easily in case the production requirements change. The existing plant for example may be a fixed polymerization plant for copolymers of (meth-) acrylic acid and (meth-) acrylamide. So, the combination of a relocatable bioconversion unit offers the possibility of combining the manufacturing of aqueous blends of ammonium (meth-) acrylate and (meth-) acryla mide with units for further processing the aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide obtained from a bioconversion unit. Particularly, in the light of the present invention it is possible to reduce the food print and complexity of the bio ammonium (meth-) acrylate manufacturing site. Having a biocon version reactor without a stirrer / no agitating element reduces the engineering and pro cessing control significantly. Further, no drying, cleaning and/or separation (e.g. centrif ugation) facility for ammonium (meth-) acrylate is needed. The obtained aqueous am monium (meth-) acrylate solution can be used directly for further processing. Therefore, in a preferred embodiment of the invention, the bioconversion unit / bioconversion reac tor is a relocatable bioconversion unit. In one embodiment, the relocatable bioconver sion unit is similar to the storage unit for (meth-) acrylonitrile, which also may be relocat able. Therefore, it is possible to using largely the same equipment for storing the (meth- ) acrylonitrile and for the bioconversion step. This contributes to an economic process for manufacturing aqueous ammonium (meth-) acrylate solutions.

Due to the flexibility of having a relocatable bioconversion unit / bioconversion reactor without a mechanical stirrer / agitating device and without installations for cleaning and/or drying, it is possible to conduct the method for production of an aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide at the location where the further processing for example to a polymer takes place.

Manufacturing bio ammonium (meth-) acrylate directly at the site of further processing the aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide to for exam ple poly acrylamide/acrylic acids saves significant transport costs. (Meth-) acrylonitrile is a liquid and may be transported as pure compound to the site of further processing. The molecular weight of ammonium (meth-) acrylate and that of (meth-) acrylamide is about 30 to 70 % higher than that of (meth-) acrylonitrile and ammonium (meth-) acrylate is typically provided as about 50 % aqueous solution. So, for a 50 % aqueous solution of ammonium (meth-) acrylate and (meth-) acrylamide the mass to be transported is about 2.5-fold as much as compared to transporting pure (meth-) acrylonitrile. Transporting pure, solid acrylic acid/acrylamide means transporting only about 30 to 40 % more mass as compared to transporting pure (meth-) acrylonitrile, however, additional equipment for handling and dissolving the solid (meth-) acrylic acid /(meth-) acrylamide is neces sary at the location where further processing takes place.

Furthermore, (meth-) acrylic acid is caustic and it is therefore an advantage to reduce the transportation distance or amount of (meth-) acrylic acid to be transported in order to reduce the risk of accidents when transporting acrylic acid. A bioconversion accord ing to the present invention in a relocatable bioconversion unit enables that advantage. (Meth-) acrylonitrile for bio-catalysis may be stored in one or more than one storage unit, for instance one or more than one relocatable storage unit. The storage unit com prises a storage vessel. The volume of the storage vessel is not specifically limited and may range from 50 m³ to 150 m³, for example it may be about 100 m³ Suitably, the storage vessel may be arranged in any orientation including substantially vertical, sub stantially horizontal or inclined at any angle between vertical and horizontal. The stor age vessel may be mounted in a frame. Such a construction avoids installing a pit for the collection of any leakage thereby ensuring an easier and quicker relocation of the storage unit. Single walled or double-walled vessels may be placed on every good bear ing soil. The storage unit furthermore comprises means for charging and discharging the vessel, means for controlling the pressure in the vessel, for example a valve for set tling low-pressure or overpressure, and means for controlling the temperature of the (meth-) acrylonitrile which preferably should not exceed 25°C. It furthermore may com prise means for measurement and control to the extent necessary.

Examples of relocatable storage units comprise relocatable cuboid, storage tanks, pref erably double-walled tanks or single walled tanks. Further, any considerable form, shape and size of container is suitable and applicable for the storage and/or provision of acrylonitrile in the sense of the present invention. Particularly, standard iso-tanks are applicable for the storage and/or provision of (meth-) acrylonitrile. Other examples com prise tank containers having a cuboid frame, preferably a frame according to the ISO 668 norm mentioned above and one or more storage vessels mounted into the frame. Such normed tank containers may be stacked and transported on trucks, railcars or ships in the same manner closed intermodal containers.

Several different relocatable units may be bundled together to have a relocatable plant. Each relocatable unit may have certain functions. Examples of such relocatable units comprise units for storing and optionally cooling monomers and/or other raw materials, hydrolyzing (meth-) acrylonitrile, mixing monomers, further processing the aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide to for example an aqueous solution of a copolymer of (meth-) acrylic acid and (meth-) acrylamide. For performing different processes, individual units may be connected with each other in a suitable manner thereby obtaining a production line. Also bundling a relocatable bioconversion unit with non-relocatable units is possible.

“Relocatable unit” means that the unit is transportable basically as a whole and that is it not necessary to disassemble the entire unit into individual parts for transport. Transport may happen on trucks, railcars or ships. Such a relocatable unit may be for instance a production apparatus which may be temporarily position at a location and if required relocated and reinstalled in another location. Typically, such relocatable bioconversion unit may be transportable as a whole without disassembling. However, such relocatable bioconversion unit may be of a design where the whole relocatable bioconversion unit is constructed of a multiplicity of components, such as interchangeable modules, which easily connect together and when required disconnect easily for relocation.

In one embodiment, such modular, relocatable units are containerized units which may be transported in the same manner as closed intermodal containers for example on trucks, railcars or ships. Intermodal containers are large standardized (for example ac cording to ISO 668) shipping containers, in particular designed and built for intermodal freight transport. Such containers are also known as ISO containers. Such ISO contain ers may have external dimensions of a height of ~ 2.59 m, a width of ~ 2.44 m and a length of ~ 6.05 m. Larger ISO containers have external dimensions of a height of ~

2.59 m, a width of ~ 2.44 m and a length of ~12.19 m.

In another embodiment, the relocatable units are combined, thereby obtaining modular production plants for performing different processes according to the present invention. Such a modular construction using relocatable units provides the advantage, that the plants may be easily relocated if aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide solutions are no longer needed at one location but at another loca tion.

At the site of manufacturing the blend of aqueous ammonium (meth-) acrylate and (meth-) acrylamide, at the site of further processing the aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide to obtain subsequent further products (e.g. (meth-) acrylate/(meth-) acrylamide copolymers) and/or at the site of applying / using for example aqueous solutions of (meth-) acrylic acid / acrylamide copolymers (e.g. for oil field or mining applications) different relocatable units according to the present invention may be used and combined, for example: o a relocatable storage unit for (meth-) acrylonitrile, o a relocatable bioconversion unit for hydrolyzing (meth-) acrylonitrile in water in the presence of biocatalysts (i) and (ii) capable of converting (meth-) acrylonitrile to an aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide, o relocatable unit(s) for storing the biocatalysts (i) and (ii) o a relocatable unit for removing the biocatalysts (i) and (ii) from an aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide, o a relocatable storage unit for an aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide, o relocatable units for further processing the aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide, for instance adjusting concentration or mixing with other water-soluble, monoethylenically unsaturated monomers different from either of (meth-) acrylic acid or (meth-) acrylamide, o a relocatable unit for polymerization to obtain aqueous solutions of (meth-) acrylic acid/(meth-) acrylamide copolymers, and/or o a relocatable unit for subsequent applications.

In one desirable embodiment the bioconversion unit is a relocatable bioconversion unit and comprises and external cooling circuit. In a further desirable embodiment the bio conversion unit is a relocatable bioconversion unit and comprises no stirrer. More desir ably, the bioconversion unit is a relocatable bioconversion unit and comprises an exter nal cooling circuit and comprises no stirrer.

The invention further includes an apparatus for carrying out process for producing the aqueous blend of ammonium (meth) acrylate and (meth) acrylamide. The apparatus may include a reactor which is a relocatable bioconversion unit or may be a bioconver sion unit which is a fixed production plant.

The apparatus may include any of the aforementioned features described regarding the reactor employed in the process of the present invention. As given above, by reactor we include any reference to bioconversion unit or bioconversion reactor.

Specifically, the apparatus may in particular include any of the following features.

In one desirable embodiment the apparatus may comprise a reactor that comprises an external cooling circuit. In another desirable embodiment the apparatus may include a reactor comprising no stirrer.

In a still further desirable embodiment the apparatus may comprise:

(A) a relocatable storage unit for (meth) acrylonitrile;

(B) a relocatable bioconversion unit for hydrolysing (meth) acrylonitrile in water in the presence of a biocatalyst (i) capable of converting (meth) acrylonitrile to ammonium (meth) acrylate solution and a biocatalyst (ii) capable of converting (meth) acrylonitrile to (meth) acrylamide; (C) equipment for delivering into the relocatable bioconversion unit the biocatalyst (i) capable of converting (meth) acrylonitrile to ammonium (meth) acrylate solution and the biocatalyst (ii) capable of converting (meth) acrylonitrile to (meth) acrylamide;

(D) optionally, a relocatable unit for removing the biocatalysts (i) and (ii) from an aque ous blend of ammonium (meth) acrylate and (meth) acrylamide;

(E) optionally, a relocatable storage unit for the aqueous blend of ammonium (meth) acrylate and (meth) acrylamide;

(F) optionally, at least one relocatable unit for further processing an aqueous blend of ammonium (meth) acrylate and (meth) acrylamide; and

(G) optionally, at least one relocatable storage unit for the biocatalysts (i) and (ii).

In one other embodiment of the present invention the apparatus for manufacturing an aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide is used at a fixed production facility. In one aspect of this, the apparatus may be a fixed production plant and in another aspect of this, the apparatus may be a relocatable production plant but located in a fixed production facility.

After having obtained the aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide further processing is possible. Further processing steps may include adjust ing the concentration of the aqueous blend and/or mixing further aqueous monomers different from ammonium (meth-) acrylate or (meth-) acrylamide. Further processing also comprises processing the obtained ammonium (meth-) acrylate in the aqueous blend to other acrylic monomers or to produce acrylic acid or salts thereof (e.g. sodium acrylate) to be used for instance as a polymerisable monomer. In general though, it would not normally be necessary to adjust the concentration of the aqueous blend or an further monomers the aqueous blend as the advantage of the present invention is that the inventive process already provides an aqueous blend of the ammonium (meth-) acrylate and (meth-) acrylamide suitable for polymerisation.

Due to the benefits of a bioconversion reaction (particularly, without a stirrer or without mechanical agitation device) it is in particular possible to use the bioconversion reactor as make-up and/or storage device for a monomer solution, which could subsequently be used for a polymerisation reaction. The different further processing steps may be per formed at different locations. For example, each further processing step may be per formed at a different location. Alternatively, all or some of the further processing steps may be performed at the same location, in particular at the location of use of either the aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide or at the location of use of the resulting polymer solution. If performed at the same location, it is possible to connect the different modular units / modular reactors with each other as needed to perform for example the different steps comprising the bioconversion of (meth-) acrylo nitrile to the blend of ammonium (meth-) acrylate and (meth-) acrylamide and subse quent preparation of a monomer solution and polymerisation to obtain copolymers of (meth-) acrylic acid and (meth-) acrylamide directly after another.

After bioconversion, the reaction vessel comprises an aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide, which still comprises the biocatalysts (i) and (ii) suspended therein. The biocatalysts preferably become removed completely, essen tially completely, or partially before polymerisation, however, removing the biocatalysts may not be absolutely necessary in every case. Whether it is necessary to remove the biocatalysts substantially depends on two factors, namely whether remaining biocata lysts negatively affect polymerisation and/or the properties of the polymer obtained and/or the biocatalysts negatively affect the application of the obtained polymer solution. In one embodiment, at least 75 %, preferably at least 90 % by weight of the biomass - relating to the total of the biomass present- should be removed.

The method for removing the biocatalysts is not specifically limited. Separation of the biocatalysts may take place by for example filtration or centrifugation. In other embodi ments, active carbon may be used for separation purpose.

Procedurally, for removing the biocatalysts there are several options.

In one embodiment, the aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide comprising the biocatalysts is removed from the bioconversion unit, passed through a unit for removing the biocatalysts, and thereafter the aqueous blend of ammo nium (meth-) acrylate and (meth-) acrylamide is filled into a suitable storage unit for the aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide, for example a re locatable storage unit for the aqueous blend ammonium (meth-) acrylate and (meth-) acrylamide as described above.

In another embodiment, the aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide comprising the biocatalysts is removed from the bioconversion unit, passed through a unit for removing the biocatalysts and thereafter the aqueous blend of ammo nium (meth-) acrylate and (meth-) acrylamide is filled directly into a monomer make-up unit for further processing, i.e. without intermediate storing in an ammonium (meth-) acrylate / (meth-) acrylamide blend storage unit.

In another embodiment, the aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide comprising the biocatalysts is removed from the bioconversion unit and is filled directly, i.e. without removing the biocatalysts, into the monomer make-up unit. In said embodiment, the biocatalysts are still present in course of monomer make-up for further processing and is removed after preparing an aqueous monomer solution.

In another embodiment it is even possible that the biocatalysts are not removed from the aqueous monomer solution and the biocatalyst is present during further processing. This non-removal of the biocatalyst is of advantage, because the processing step of re moving the biocatalysts can be avoided which therefore leads to less process steps and makes the overall process simpler.

In another embodiment, the aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide comprising the biocatalysts is removed from the bioconversion unit, passed through a unit for removing the biocatalysts and thereafter filled back into the bioconver sion unit. In order to ensure complete discharge of the bioconversion unit before re-fill- ing it, the unit for removing the biocatalysts should comprise a buffer vessel having a volume sufficient for absorbing the contents of the bioconversion unit.

The above-mentioned methods for biocatalyst removal are for example applicable for partwise and/or complete removal of the biocatalysts. Further, it is preferred, that the completely or partly removed biocatalysts may be reused for a subsequent bioconver sion reaction.

In a preferred embodiment, the aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide no longer comprises the biocatalysts. However, in another embodi ment the aqueous blend of ammonium (meth-) acrylate and (meth-) acrylamide still comprise the biomass. In said embodiment, the biocatalysts may be removed after pre paring an aqueous monomer solution for further processing in the same manner as de scribed above or it may not be removed. Criteria for deciding in which cases it may not be necessary to remove the biocatalysts have already been mentioned above.

In course of further processing, an aqueous monomer solution comprising at least wa ter, ammonium (meth-) acrylate, (meth-) acrylamide and optionally further water-soluble, monoethylenically unsaturated monomers is prepared. Basically, the kind and amount of water-soluble, monoethylenically unsaturated comonomers to be used besides acrylic acid an acrylamide is not limited and depends on the desired properties and the desired use of the aqueous solutions of copolymers of acrylamide with (meth-) acrylates to be manufactured. Typical monomers fall under the definitions of neutral comonomers, ani onic comonomers, cationic comonomers and/or associative comonomers, which an artisan knows from the state of the art and is also applicable in the context of the pre sent invention.

Examples of neutral comonomers are comprising hydroxyl and/or ether groups, for ex ample hydroxyethyl(meth)acrylate, hydroxypropyl(meth)acrylate, allyl alcohol, hy- droxyvinylethylether, hydroxyvinylpropylether, hydroxyvinylbutylether, polyethylene gly col (meth)acrylate, N-vinylformamide, N-vinylacetamide, N-vinylpyrrolidone or N-vi- nylcaprolactam, and vinyl esters, for example vinylformate or vinyl acetate. Examples of neutral comonomers also comprise N-methyl(meth)acrylamide, N,N’-dime- thyl(meth)acrylamide, N-methylol(meth)acrylamide.

Examples of anionic comonomers may be selected from water-soluble, monoethyleni- cally unsaturated monomers comprising at least one acidic group, or salts thereof. The acidic groups are preferably selected from the group of -COOH, -SO3H and -PO3H2 or salts thereof. Preference is given to monomers comprising COOH groups and/or -SO3H groups or salts thereof. Suitable counterions include especially alkali metal ions such as Li⁺, Na⁺ or K⁺, and also ammonium ions such as NH4⁺ or ammonium ions having or ganic radicals. Examples of ammonium ions having organic radicals include [NH(CH₃)3]⁺, [NH₂(CH₃)2]⁺, [NH3(CH₃)]⁺, [NH(C H5 )3]⁺, [NH₂(C2H₅ )2]⁺, [NH3(C H5 )]⁺, [NH3(CH2CH₂0H)]⁺, [H3N-CH2CH2-NH3P or [H(H3q)₂N-OH2qH2qH₂NH3]²⁺.

Examples of anionic comonomers comprising -COOH groups include crotonic acid, ita- conic acid, maleic acid or fumaric acid or salts thereof. Examples of comonomers com prising -SO3H groups or salts thereof include vinylsulfonic acid, allylsulfonic acid, 2- acrylamido-2-methylpropanesulfonic acid (ATBS), 2-methacrylamido-2-methylpropane- sulfonic acid, 2-acrylamidobutanesulfonic acid, 3-acrylamido-3-methylbutanesulfonic acid or 2-acrylamido-2,4,4-trimethylpentanesulfonic acid. Preference is given to 2- acrylamido-2-methylpropanesulfonic acid (ATBS) or salts thereof. Examples of mono mers comprising -PO3H2 groups or salts thereof include vinylphosphonic acid, al- lylphosphonic acid, N-(meth)acrylamidoalkylphosphonic acids or (meth)acryloyloxyalkyl- phosphonic acids, preferably vinylphosphonic acid.

Examples of cationic comonomers may be selected from water-soluble, monoethyleni- cally unsaturated monomers comprising cationic groups. Suitable cationic monomers include especially monomers having ammonium groups, especially ammonium deriva tives of N-(co-aminoalkyl)(meth)acrylamides or co-aminoalkyl(meth)-acrylates such as 2-trimethylammonioethyl acrylate chloride H2C=CH-CO-CH2CH2N⁺(CH3)3 Cl (DMA3Q). Further examples have been mentioned in WO 2015/158517 A1 page 8, lines 15 to 37. Preference is given to DMA3Q. Associative monomers impart hydrophobically associating properties to polyacrylates and/or polyacrylamides. Associative monomers to be used in the context of this inven tion are water-soluble, monoethylenically unsaturated monomers having at least one hy drophilic group and at least one, preferably terminal, hydrophobic group. Examples of associative monomers have been described for example in WO 2010/133527, WO 2012/069478, WO 2015/086468 or WO 2015/158517. “Hydrophobically associating co polymers” are understood by a person skilled in the art to mean water-soluble copoly mers which, as well as hydrophilic units (in a sufficient amount to assure water solubil ity), have hydrophobic groups in lateral or terminal positions. In aqueous solution, the hydrophobic groups can associate with one another. Because of this associative inter action, there is an increase in the viscosity of the aqueous polymer solution compared to a polymer of the same kind that merely does not have any associative groups.

Examples of suitable associative monomers comprise monomers having the general formula H2C=C(R¹)-R²-R³ (I) wherein R¹ is H or methyl, R² is a linking hydrophilic group and R³ is a terminal hydrophobic group. Further examples comprise having the general formula H2C=C(R¹)-R²-R³-R⁴ (II) wherein R¹, R² and R³ are each as defined above, and R⁴ is a hydrophilic group.

The linking hydrophilic R² group may be a group comprising ethylene oxide units, for ex ample a group comprising 5 to 80 ethylene oxide units, which is joined to the H2C=C(R¹)- group in a suitable manner, for example by means of a single bond or of a suitable linking group. In another embodiment, the hydrophilic linking group R² may be a group comprising quaternary ammonium groups.

In one embodiment, the associative monomers are monomers of the general formula H₂C=C(R¹ )-0-(CH₂CH₂0)k-R^3a (III) or H2C=C(R⁵)-(C=0)-0-(CH2CH₂0)k-R^3a (IV), wherein R¹ has the meaning defined above and k is a number from 10 to 80, for exam ple, 20 to 40. R^3a is an aliphatic and/or aromatic, straight-chain or branched hydrocarbyl radical having 8 to 40 carbon atoms, preferably 12 to 32 carbon atoms. Examples of such groups include n-octyl, n-decyl, n-dodecyl, n-tetradecyl, n-hexadecyl or n-octade- cyl groups. In a further embodiment, the groups are aromatic groups, especially substi tuted phenyl radicals, especially distyrylphenyl groups and/or tristyrylphenyl groups.

In another embodiment, the associative monomers are monomers of the general for mula H2C=C(R¹)-0-(CH2)n-0-(CH2CH20)x-(CH2-CH(R⁵)0)y-(CH2CH₂0)zH (V), wherein R¹ is defined as above and the R⁵ radicals are each independently selected from hydro carbyl radicals comprising at least 2 carbon atoms, preferably from ethyl or propyl groups. In formula (V) n is a natural number from 2 to 6, for example 4, x is a number from 10 to 50, preferably from 12 to 40, and for example, from 20 to 30 and y is a num ber from 5 to 30, preferably 8 to 25. In formula (V), z is a number from 0 to 5, for exam ple 1 to 4, i.e. the terminal block of ethylene oxide units is thus merely optionally pre sent. In an embodiment of the invention, it is possible to use at least two monomers (V), wherein the R¹ and R⁵ radicals and indices n, x and y are each the same, but in one of the monomers z = 0 while z > 0 in the other, preferably 1 to 4.

In another embodiment, the associative monomers are cationic monomers. Examples of cationic associative monomers have been disclosed in WO 2015/158517 A1 , page 11 , line 20 to page 12, lines 14 to 42. In one embodiment, the cationic monomers having the general formula H₂C=C(R¹)-C(=0)0-(CH2)k-N⁺(CH3)(CH3)(R⁶) X (VI) or H₂C=C(R¹)-C(=0)N(R¹)-(CH2)k-N⁺(CH3)(CH3)(R⁶) X (VII) may be used, wherein R¹ has the meaning as defined above, k is 2 or 3, R⁶ is a hydrocarbyl group, preferably an ali phatic hydrocarbyl group, having 8 to 18 carbon atoms, and X is a negatively charged counterion, preferably Cl and/or Br.

Besides water-soluble monoethylenically unsaturated monomers, also water-soluble, ethylenically unsaturated monomers having more than one ethylenic group may be used as further comonomers. Monomers of this kind can be used in special cases in or der to achieve easy crosslinking of the polymers. The amount thereof should generally not exceed 2% by weight, preferably 1 % by weight and especially 0.5% by weight, based on the sum total of all the monomers. More preferably, the monomers to be used in the present invention are only monoethylenically unsaturated monomers.

Besides the monomers, further additives and auxiliaries may be added to the aqueous monomer solution. Furthermore, before polymerization also suitable initiators for radical polymerization may be added. Examples of such further additives and auxiliaries com prise complexing agents, defoamers, surfactants, stabilizers, and bases or acids for ad justing the pH value. In certain embodiments of the invention, the pH-value of the aque ous monomer solution is adjusted to values from pH 5 to pH 7, for example pH 6 to pH 7. Preferably, it is also possible that the pH adjustment takes place in-situ, which means that via adjusting the acrylic acid content in the aqueous monomer solutions the pH can be adjusted. This adjustment can take place directly without addition of further pH ad justing additives during the reaction. This adjustment can also take place directly during the reaction by addition of for example a suitable buffer.

In one embodiment, the aqueous monomer solution comprises at least one stabilizer for the prevention of polymer degradation. Such stabilizers for the prevention of polymer degradation are what are called “free-radical scavengers”, i.e. compounds which can re act with free radicals (for example free radicals formed by heat, light, redox processes), such that said radicals can no longer attack and hence degrade the polymer. Using such kind of stabilizers for the stabilization of aqueous solutions of polyacrylates and/or polyacrylamides basically is known in the art, as disclosed for example in WO 2015/158517 A1 , WO 2016/131940 A1 , or WO 2016/131941 A1 .

The stabilizers may be selected from the group of non-polymerizable stabilizers and polymerizable stabilizers. Polymerizable stabilizers comprise a monoethylenically un saturated group and become incorporated into the polymer chain in course of polymeri zation. Non-polymerizable stabilizers don’t comprise such monoethylenically unsatu rated groups and are not incorporated into the polymer chain.

In one embodiment of the invention, stabilizers are non-polymerizable stabilizers se lected from the group of sulfur compounds, sterically hindered amines, N-oxides, nitroso compounds, aromatic hydroxyl compounds or ketones. Examples of sulfur compounds include thiourea, substituted thioureas such as N,N‘-dimethylthiourea, N,N‘-diethylthiou- rea, N,N'-diphenylthiourea, thiocyanates, for example ammonium thiocyanate or potas sium thiocyanate, tetramethylthiuram disulfide, and mercaptans such as 2-mercapto- benzothiazole or 2-mercaptobenzimidazole or salts thereof, for example the sodium salts, sodium dimethyldithiocarbamate, 2,2‘-dithiobis(benzo-thiazole), 4,4‘-thiobis(6-t- butyl-m-cresol). Further examples include dicyandiamide, guanidine, cyanamide, paramethoxyphenol, 2,6-di-t-butyl-4-methylphenol, butylhydroxyanisole, 8-hydroxyquin- oline, 2,5-di(t-amyl)-hydroquinone, 5-hydroxy-1 ,4-naphthoquinone, 2,5-di(t-amyl)hydro- quinone, dimedone, propyl 3,4,5-trihydroxy-benzoate, ammonium N-nitrosophenylhy- droxylamine, 4-hydroxy-2,2,6,6-tetramethy-oxylpiperidine, (N-(1 ,3-dimethylbutyl)-N'- phenyl-p-phenylenediamine and 1 ,2,2,6, 6-pentamethyl-4-piperidinol. Preference is given to sterically hindered amines such as 1 ,2,2,6,6-pentamethyl-4-piperidinol and sul fur compounds, preferably mercapto compounds, especially 2-mercaptobenzothiazole or 2-mercaptobenzimidazole or the respective salts thereof, for example the sodium salts, and particular preference is given to 2-mercaptobenzothiazole or salts thereof, for example the sodium salts. The amount of such non-polymerizable stabilizers -if present- may be from 0.1 % to 2.0 % by weight, relating to the total of all monomers in the aque ous monomer solution, preferably from 0.15 % to 1 .0 % by weight and more preferably from 0.2 % to 0.75 % by weight.

In another embodiment of the invention, the stabilizers are polymerizable stabilizers substituted by a monoethylenically unsaturated group. With other words, such stabi lizers are also monomers (C). Examples of stabilizers comprising monoethylenically unsaturated groups comprise (meth)acrylic acid esters of 1 ,2,2,6,-pentamethyl-4-piperi- dinol or other monoethylenically unsaturated groups comprising 1 ,2,2,6,6-pentamethyl- piperidin-4-yl groups. Specific examples of suitable polymerizable stabilizers are dis closed in WO 2015/024865 A1 , page 22, lines 9 to 19. In one embodiment of the inven tion, the stabilizer is a (meth)acrylic acid ester of 1 ,2,2,6,6-pentamethyl-4-piperidinol.

The amount of polymerizable stabilizers -if present- may be from 0.01 to 2% by weight, based on the sum total of all the monomers in the aqueous monomer solution, prefera bly from 0.02 % to 1 % by weight, more preferably from 0.05 % to 0.5 % by weight.

In one embodiment, the aqueous monomer solution comprises at least one non- polymerizable surfactant. Examples of suitable surfactants including preferred amounts have been disclosed in WO 2015/158517 A1 , page 19, line, 23 to page 20, line 27. In the manufacture of hydrophobically associating polyacrylamides, the surfactants lead to a distinct improvement of the product properties. If present, such non-polymerizable sur factant may be used in an amount of 0.1 to 5% by weight, for example 0.5 to 3 % by weight based on the amount of all the monomers used.

As used herein, the term “water-soluble monomers” in the context of this invention means that the monomers are to be soluble in the aqueous monomer solution to be used for polymerization in the desired use concentration. It is thus not absolutely neces sary that the monomers to be used are miscible with water without any gap; instead, it is sufficient if they meet the minimum requirement mentioned. It is to be noted that the presence of acrylamide and/or acrylic acid in the monomer solution might enhance the solubility of other monomers as compared to water only. In general, the solubility of the water-soluble monomers in water at room temperature should be at least 50 g/l, prefera bly at least 100 g/l.

Besides water, the aqueous monomer solution may also comprise additionally water- miscible organic solvents. However, as a rule the amount of water should be at least 70 % by wt. relating to the total of all solvents used, preferably at least 85 % by wt. and more preferably at least 95 % by wt.. In one embodiment, only water is used as solvent.

Depending on the chemical nature, the water-soluble, monoethylenically unsaturated monomers to be used may be provided as pure monomers or as aqueous solutions for further processing. It is also possible to provide a mixture of water-soluble, monoeth ylenically unsaturated monomers, in aqueous solution or as pure monomers for further processing. Water-soluble, monoethylenically unsaturated monomers such as 2- acrylamido-2-methylpropane-sulfonic acid (ATBS), or 2-trimethylammonioethyl acrylate chloride H2C=CHCO-CH2CH2N+(CH3)3 Cl (DMA3Q), or mixtures thereof preferably may be stored in suitable storage units. The monomers may be provided by road tankers,

ISO tanks, or rail cars and pumped into relocatable storage units.

The aqueous monomer solution for polymerization comprises water and 5 % to 45 % by weight, preferably 15 % to 45 % by weight of water-soluble, monoethylenically unsatu rated monomers, relating to the total of all components of the aqueous monomer solu tion. The water-soluble, monoethylenically unsaturated monomers comprise at least the aqueous blend of ammonium (meth-) acrylate an (meth-) acrylamide, which preferably is manufactured as described above.

In one embodiment of the invention, the monomer concentration is from 8 % by weight to 24.9 % by weight, preferably from 15 % by weight to 24.9 % by weight, for example from 20 to 24.9 % by weight, relating to the total of all components of the aqueous mon omer solution. The monomer concentration may be selected by the skilled artisan ac cording to his/her needs. For preparing the aqueous monomer solution, the water-solu ble, monoethylenically unsaturated monomers to be used are mixed with each other. All monomers and optionally additives may be mixed with each other in a single step but it may also be possible to mix some monomers and add further monomers in a second step. Also, water for adjusting the concentration of the monomers may be added. Water eventually used for rinsing lines in course of transferring the monomer solution into the polymerization unit, needs to be taken into consideration when adjusting the concentra tion.

Preferably, the preparation of the aqueous monomer solution is performed in a relocata ble monomer make-up unit. In one embodiment, the monomer make-up may be the unit which is similar to the bioconversion unit as described above. Using largely the same equipment for storing (meth-) acrylonitrile, for the bioconversion step and for further pro cessing the aqueous blend of ammonium (meth-) acrylate an (meth-) acrylamide con tributes to an economic process for manufacturing aqueous mixtures of ammonium (meth-) acrylate an (meth-) acrylamide solutions. It is possible that the bioconversion unit may also be used for monomer make-up.

If the monomer make-up vessel is different to the bioconversion unit, it may be equipped with a stirrer for mixing the components of the aqueous monomer solution with each other. However, in the same manner as with the bioreactor, the external tem perature control circuit may be used as means for mixing. The stream of the aqueous monomer mixture which passes through the temperature control circuit and which is in jected back into the monomer make-up vessel causes a circulation of the aqueous reaction mixture within the reaction vessel which is sufficient to mix the aqueous reac tion mixture.

Furthermore, the present invention relates to a copolymer obtainable or being obtained by polymerising the aqueous blend of ammonium (meth-) acrylate an (meth-) acryla mide of the aqueous solution as described herein. With this respect, the copolymer the term “polymerising” refers to a copolymerisation reaction. The copolymerisation may be performed using the aqueous blend of ammonium (meth-) acrylate and (meth-) acryla mide solution obtainable in accordance with the present invention or being obtained by co-polymerising the aqueous blend of ammonium (meth-) acrylate and (meth-) acryla mide with any of the aforementioned monomers described above. Preferably, the aque ous blend of aqueous ammonium (meth-) acrylate and (meth-) acrylamide prepared ac cording to the present invention, from which the biocatalyst has been separated prior to the polymerization, is used for the copolymerisation.

The (meth-) acrylic acid/(meth-) acrylamide copolymers, provided according to the pre sent invention, may be, for example, used as surface coatings, adhesives, sealants, oil industry injection fluid additives, flocculants used in mining etc. By (meth-) acrylic acid/(meth-) acrylamide copolymers we include the corresponding ammonium salt pre pared directly by the present invention and also other salts, in particular sodium salts, or the free acid. In particular, use of (meth-) acrylic acid / (meth-) acrylamide copolymers are made in tertiary oil recovery, which is also denoted as enhanced oil recovery. With this respect, in methods of tertiary oil recovery an aqueous solution of the polymer may be injected into the rock in order to promote oil displacement and thus increase the yield of crude oil. The present invention is therefore also related to an aqueous solution of any (meth-) acrylic acid / (meth-) acrylamide copolymer described herein. As water for the aqueous solution seawater may be used.

Although the invention has been described with respect to specific embodiments and examples, it should be appreciated that other embodiments utilizing the concept of the present invention are possible without departing from the scope of the invention. The present invention is defined by the claimed elements, and any and all modifications, var iations, or equivalents that fall within the true spirit and scope of the underlying princi ples.

The following examples are intended to illustrate the invention without in any way limit ing the scope.

Examples Materials and procedures

Bioconversions were carried on in different scales; activity screenings were carried out in Eppendorf tubes (1 mL scale) and initial scale-up and parameter screenings were done in a 4 L reactor. The basic reaction procedures are summarized in the following sections.

Biocatalyst material

Nitrilase containing E. coli TG10+ (pDHE5220div) (Biocatalyst (i)) material was obtained from a fermentation experiment on a Biological pilot plant. Cells were harvested via cen trifugation after completion of the fermentation. The resulting pellet (wet biomass) was stored frozen. A portion of this cell pellet was thawed and combined with water to recon stitute a whole-cell biocatalyst suspension containing a cell wet weight (cww) of 200 gcww/L. The activity of this whole-cell biocatalyst suspension for ammonium acrylate syn thesis was assessed using 1 ml_ scale activity assays.

Nitrile hydratase containing Rhodococcus rhodocrous (Biocatalyst (ii)) material was ob tained from biocatalyst production run on a production plant. The broth was concen trated via a disc stack centrifuge after fermentation resulting in a whole-cell biocatalyst suspension containing approximately 16 wt-% dry mass (biomass + fermentation me dium components). The concentrate was stored at 4°C until further use. The concen trate was directly applied for small scale activity assays or mixed with 100 mM potas sium phosphate buffer (pH 7) for preparative monomer synthesis.

1 mL scale activity assays.

Small scale activity assays were performed to determine the activity of the whole-cell biocatalyst suspensions for ammonium acrylate and acrylamide synthesis, respectively. Activity assays for ammonium acrylate synthesis were performed in the presence of acrylamide to investigate the inhibition of the nitrilase by acrylamide. Vice versa, ammo nium nitrile hydratase activity assays were performed in the presence of ammonium acrylate. Furthermore, different acrylonitrile concentration were supplied in order to in vestigate the effect of the acrylonitrile concentration on the respective enzyme activity.

For illustration, an assay composition for the determination of the activity of the nitrilase containing whole-cell biocatalyst E. coli TG10+ (pDHE5220div) is given. The total assay volume is 1000 pL. 50 pl_ of a 100 mM potassium phosphate buffer are mixed with 878 mI_ water in 2 mL Eppendorf tube. 10 pL of 200 g_Cww/L biocatalyst suspension is added. Mixing is facilitated by inverting the reaction tube. 62 mI_ of neat acrylonitrile (5 vol-% fi nal concentration) are added to start the reaction. The tube is incubated at 25°C in an Eppendorf thermomixer and reaction is terminated after the desired incubation period by diluting a portion of the reaction mixture with the double amount of 1.4 wt-% HCI. Prod uct formation is quantified using a HPLC instrument.

One-pot monomer synthesis: 1 mL scale proof-of-concept experiments.

Initial one-pot monomer synthesis experiments were performed in batch mode at the 1 mL scale. The previously determined activity for the synthesis of either monomer were used to generate mixed-biocatalyst suspensions at defined ratios. The two whole-cell biocatalysts are mixed at defined ratios. The activities of the individual biocatalyst sus pensions serve as a basis for composing the mixed-biocatalyst suspensions. For a ac tivity ratio (nitrilase:nitrile hydratase) of 3:1 , 42 pL of the E. coli TG10+ (pDHE5220div) biocatalyst suspension and 9 pL of the Rhodococcus rhodocrous biocatalyst suspen sion are added sequentially to 888 pL potassium phosphate buffer (100 mM, pH 7). The reaction is started by addition of 68 pL acrylonitrile. For each time point, that is 2 h and 23 h, a separate reaction tube is prepared. The tubes are incubated and analysed as described above.

One-pot monomer synthesis: scale-up experiments in a 4 L working volume reactor.

6.6 g (191 kU) of Rhodococcus rhodocrous fermentation concentrate are added up to 30 g using potassium phosphate buffer (100 mM, pH 7). This suspension is added to 2327 g water that have been filled into the glass reactor. For an activity ratio (ni- trilase: nitrile hydratase) of 3:1, 95.6 g (573 kU) E. coli TG10+ (pDHE5220div) biocata lyst suspension are added afterwards. The temperature and the stirrer speed are ad justed to 26°C and 250 rpm, respectively. 25 g of acrylonitrile are added to start the re action. The temperature was kept at 26°C and the acrylonitrile concentration was meas ured by on-line FTIR, and the rate of addition of acrylonitrile was adjusted to keep the acrylonitrile concentration in the reaction mixture constant at 1 ± 0.2% (w/w) until the entire acrylonitrile has been added to the reaction. The amount of acrylonitrile added to the reaction was previously determined based on the target monomer concentration.

The reaction was stopped after acrylonitrile concentration had decreased to <100 ppm.

Example 1

In a first experiment, the individual activities of the two biocatalysts are used to reconsti tute biocatalyst mixtures with a defined activity ratio of the present enzymes. The results illustrated in Figure 3 are based on an experiment in which the molar composition of one-pot monomer synthesis experiments using a mixture of Rhodococcus rhodocrous and E. coli TG10+ (pDHE BD5220div) biocatalyst suspensions. Activity ratios (ni- trilase: nitrile hydratase) of 3:1 , 30:1 , and 300:1 are translated into respective biocatalyst amounts which are then mixed. 5 vol-% of the substrate acrylonitrile is added to the bio catalyst mixture and the final monomer composition is assessed 23 h after the reaction was initiated. Reactions were performed at the 1 ml_ scale in an Eppendorf Thermomixer at 25°C. The mixed-biocatalyst approach can be applied to produce a monomer mixture with different final molar compositions (Figure 3). The ammonium acrylate (AA) fraction of the final monomer composition increased with increasing bio catalyst activity ratios (nitrilase: nitrile hydratase). Already at an initial activity ratio of 3:1 a final monomer distribution of 55-mol% acrylamide (ACM) and 45 mol-% AA was achieved. Increasing the ratio to 300:1 results in a 98 mol-% excess of AA as compared to ACM (Figure 3). Complete conversion of the initially present 5 vol-% acrylonitrile to AA/ACM was achieved. Principally, this approach can be used to produce an ACM/AA monomer mixture at any desired molar ratio.

Example 2

A series of mixed-biocatalyst experiments was performed at the 4 kg reaction scale. Thereby, the biocatalyst activity ratio is used as a parameter and the dosage of the ac rylonitrile substrate feed is controlled via an external peristaltic pump. In total, six experi ments were performed (Table 1 ). Based on the results of the small-scale experiments shown in Example 1 , biocatalyst activity ratios between 3:1 and 2:1 (nitrilase: nitrile hy dratase) and different target monomer concentrations (50 and 35 wt-%) were investi gated.

Table 1 illustrates an overview of 4 kg scale one-pot monomer synthesis experiments. The experiments were performed in order to optimize the activity ratio to reach a target monomer distribution of 75 mol-% acrylamide and 25 mol-% ammonium acrylate. The specific activities of the E. coli TG10+ (pDFIE BD5220div) (6 kU/g2oo_gccw/L) and Rhodo- cococcus rhodocrous (29 kU/gi6 wt-% suspension) biocatalyst suspensions were retrieved from individual 4 kg scale reactions aiming for the synthesis of ammonium acrylate and acryla mide, respectively.

Table 1

E. coli TG10+ (pDHE BD5220div) and Rhodococcus rhodocrous were added to the bioreactor and the FTIR controlled acrylonitrile feed was started. A biocatalyst ratio of 3:1 resulted in a final monomer concentration of 39.4 wt-% and a molar monomer composition of 45mol-% ACM and 55 mol-% AA within 8 h. A residual acrylonitrile content of approximately 0.8 wt-% was observed after 8 h of reaction. Similar results were obtained when an activity ratio of 2:1 was applied. Thereby, the final monomer composition was 82 mol-% ACM and 18 mol-% observed. The target concentration was reduced to 35 wt-% and the biocatalyst ratio was adjusted to 2.2:1. Under these conditions, an ACM/AA mixture with a concentration of ~ 35 wt-% can be produced within 12 h. The final molar compositions for the two experiments were between 72-74 mol-% ACM and 26-28 mol-% AA. Slight adjustment of the biocatalyst ratio to 2.1:1 did not cause a significant change in the monomer composition.1.3-fold in- creased total biocatalyst concentrations while keeping the activity ratio unchanged led to faster completion of the conversion. In summary, the desired target monomer ratio can be produced at a final concentration of 35 wt-% within 8 h. Slight variations in the values are due to the error introduced during dilution and HPLC measurement (accu racy of the final reported value is approximately within ± 3 wt-%).

Table 2 provides an overview of the performance results obtained for all six 4 kg scale one-pot synthesis batches. Table 2: Overview on performance results for the 4 kg scale bioconversions for the one-pot synthesis of acrylamide (ACM) and ammonim acrylate (AA). The ratio represents the initially adjusted activity ration for AA synthesis via a nitrilase (Nit) and for ACM synthesis via nitrile hydratase (NHase).

Claims

1. A process for producing an aqueous blend of ammonium (meth) acrylate and (meth) acrylamide, which blend is suitable for producing copolymers of ammonium (meth) acrylate and (meth) acrylamide, said process comprising the following steps:

(iii) (meth) acrylonitrile;

(iv) water; and

2. A process according to claim 1 , wherein the ratio of (i) and (ii) is selected so as to provide the desired ratio of ammonium (meth) acrylate and (meth) acrylamide in the aqueous blend.

3. A process according to claim 1 or claim 2, wherein the biocatalysts (i) and (ii) are each in different recombinant microorganisms.

4. A process according to claim 1 or claim 2, wherein the biocatalysts (i) and (ii) are each in the same the same recombinant microorganism.

5. A process according to any of claims 1 to 4, wherein the (meth) acrylonitrile con centration of the composition at the end of the bioconversion is below 10.0%

(w/w), is below 1.0% (w/w), is below 0.1% (w/w), preferably below 0.01% (w/w), more preferably below 0.001% (w/w), most preferably below 0.0001% (w/w) by weight of the (meth) acrylonitrile in the aqueous medium.

6. A process according to any of claims 1 to 5, wherein the concentration of the blend of ammonium (meth) acrylate and (meth) acrylamide at the end of the bioconver sion is at least 10% (w/w), at least 15% (w/w), at least 20% (w/w), preferably at least 25% (w/w), at least 30% (w/w), at least 35% (w/w) by weight of the blend of the ammonium (meth) acrylate and (meth) acrylamide monomers in the aqueous medium.

7. A process according to any of claims 1 to 6, wherein the molar ratio of ammonium (meth) acrylate to (meth) acrylamide is from 5:95 to 95:5, from 10:90 to 90:10, from 85:15 to 15:85, suitably from 20:80 to 80:20, from 25:75 to 75:25, from 30:70 to 70:30, from 35:65 to 65:35, from 40:60 to 60:40, from 45:55 to 55:45.

8. A process according to any of claims 1 to 7, wherein the molar ratio of ammonium (meth) acrylate to (meth) acrylamide is from 20:80 to 35:65, preferably from 23:77 to 32:68, more preferably from 25:75 to 30:70.

9. A process according to any of claims 1 to 8, wherein the biocatalyst (i) is an en zyme having nitrilase activity.

10. A process according to claim 9, wherein the biocatalyst (i) having nitrilase activity is at least one selected from the group consisting of an isolated nitrilase, a recom binant construct, a recombinant vector comprising the recombinant construct, a re combinant microorganism comprising the recombinant construct, and a recombi nant microorganism comprising the recombinant vector.

11. A process according to any of claims 1 to 10, wherein the biocatalyst (i) is a re combinant microorganism selected from the group consisting of Bacillus licheni- formis, Bacillus pumilus, Bacillus subtilis, Escherichia coli, Saccharomyces cere- visiae, Rhodococcus rhodochrous and Pichia pastoris.

12. A process according to any of claims 1 to 11 , wherein the biocatalyst (i) comprises Escherichia coli TG 10+ (pDHE BD5220div).

13. A process according to any of claims 1 to 12, wherein the biocatalyst (ii) is an en zyme having nitrile hydratase activity.

14. A process according to claim 13, wherein the biocatalyst (ii) having nitrile hydra- taseactivity is a recombinant microorganism selected from the group consisting of Rhodococcus rhodochrous, Rhodococcus erythropolis, Rhodococcus equi, Rho dococcus ruber, Rhodococcus opacus, Rhodococcus pyridinovorans, Asper gillus niger, Acidovorax avenae, Acidovorax facilis, Agrobacterium tumefaciens, Agrobacterium radiobacter, Bacillus subtilis, Bacillus pallidus, Bacillus smithii, Bacillus sp BR 449, Bradyrhizobium oligotrophicum, Bradyrhizobium diazoeffi- ciens, Bradyrhizobium japonicum, Burkholderia cenocepacia, Burkholderia gladioli, Klebsiella oxytoca, Klebsiella pneumonia, Klebsiella variicola, Mesorhizobium cic- eri, Mesorhizobium opportunistum, Mesorhizobium sp F28, Moraxella, Pantoea endophytica, Pantoea agglomerans, Pseudomonas chlororaphis, Pseudomonas putida, Rhizobium, Rhodopseudomonas palustris, Serratia liquefaciens, Serratia marcescens, Amycolatopsis, Arthrobacter, Brevibacterium sp CH1, Brevibacterium sp CH2, Brevibacterium sp R312, Brevibacterium imperiale, Corynebacterium ni- trilophilus, Corynebacterium pseudodiphteriticum, Corynebacterium glutamicum, Corynebacterium hoffmanii, Microbacterium imperiale, Microbacterium smegmatis, Micrococcus luteus, Nocardia globerula, Nocardia rhodochrous, Pseudonocardia thermophila, Trichoderma, Myrothecium verrucaria, Aureobasidum pullulans, Can dida famata, Candida guilliermondii, Candida tropicalis, Cryptococcus flavous, Cryptococcus sp UFMG-Y28, Debaryomyces hanseii, Geotrichum candidum, Ge otrichum sp JR1, Flanseniaspora, Kluyveromyces thermotolerans, Pichia kluyveri, Rhodotorula glutinis, Escherichia coli, Geobacillus sp RAPc8, Comomonas testos- teroni, Pyrococcus abyssi, Pyrococcus furiosus, and Pyrococcus horikoshii.

15. A process according to any of claims 1 to 14, wherein the biocatalyst (ii) comprises Rhodococcus rhodochrous NCIMB 41164.

16. A process according to any of claims 1 to 15, wherein the reactor is a relocatable bioconversion unit.

17. A process according to any of claims 1 to 16, wherein the reactor comprises a re action vessel having a volume from 10 m³ to 150 m³, and preferably is a relocata ble bioconversion unit.

18. A process according to any of claims 1 to 17, wherein the reactor comprises a re action vessel having a means for mixing the composition of step (a) and means of the composition of step (a), and preferably is a relocatable bioconversion unit.

19. A process according to any of claims 1 to 18, wherein the reactor comprises a double-walled reaction vessel, and preferably is a relocatable bioconversion unit.

20. A process according to any of claims 1 to 19, wherein the reactor comprises a sin gle walled reaction vessel, and preferably is a relocatable bioconversion unit.

21. A process according to any of claims 1 to 20, wherein the reactor comprises a frame, a reaction vessel mounted into the frame having a volume from 10 m³ to 150 m³, and an external temperature control circuit comprising at least one pump and a temperature control unit, wherein the composition of step (a) is circulated by means of a pump from the reaction vessel into the temperature control unit and back into the reaction vessel, thereby simultaneously controlling the temperature and mix in the composition of step (a), wherein the reactor preferably is a relocata ble bioconversion unit.

22. A process according to any of claims 1 to 21 , wherein the reactor comprises a temperature control circuit and amount of the composition of step (a) cycled per hour through the temperature control circuit is from 100% to 1000% of the total volume of the composition of step (a) in the reactor, wherein the reactor is prefera bly a relocatable bioconversion unit.

23. A process according to any of claims 1 to 22, wherein the reactor comprises an external cooling circuit, wherein the reactor preferably is a relocatable bioconver sion unit.

24. A process according to any of claims 16 to 23, wherein the reactor comprises no stirrer, wherein the reactor preferably is a relocatable bioconversion unit.

25. An apparatus for manufacturing an aqueous blend of ammonium (meth) acrylate and (meth) acrylamide according to the process of any of claims 1 to 24, wherein preferably the apparatus includes a reactor which is a relocatable bioconversion unit.

26. An apparatus according to claim 25, wherein the apparatus includes a reactor comprising an external cooling circuit.

27. An apparatus according to claim 25 or claim 26, wherein the apparatus includes a reactor that comprises no stirrer.

28. An apparatus according to any of claims 25 to 27, wherein the apparatus com prises:

(A) a relocatable storage unit for (meth) acrylonitrile;

(B) a relocatable bioconversion unit for hydrolysing (meth) acrylonitrile in water in the presence of a biocatalyst (i) capable of converting (meth) acrylonitrile to ammonium (meth) acrylate solution and a biocatalyst (ii) capable of converting (meth) acrylonitrile to (meth) acrylamide;

(C) equipment for delivering into the relocatable bioconversion unit the bio catalyst (i) capable of converting (meth) acrylonitrile to ammonium (meth) acrylate solution and the biocatalyst (ii) capable of converting (meth) acrylonitrile to (meth) acrylamide;

(D) optionally, a relocatable unit for removing the biocatalysts (i) and (ii) from an aqueous blend of ammonium (meth) acrylate and (meth) acrylamide;

(E) optionally, a relocatable storage unit for the aqueous blend of ammo nium (meth) acrylate and (meth) acrylamide;

(F) optionally, at least one relocatable unit for further processing an aque ous blend of ammonium (meth) acrylate and (meth) acrylamide; and

(G) optionally, a relocatable storage unit for the biocatalysts (i) and (ii).

29. An apparatus according to any of claims 25 to 28 for manufacturing an aqueous blend of ammonium (meth) acrylate and (meth) acrylamide according to the pro cess of any of claims 1 to 24, wherein the apparatus is used at a fixed production facility.

30. An aqueous blend of ammonium (meth) acrylate and (meth) acrylamide obtainable by the process according to any one of claims 1 to 24.

31. Copolymers of ammonium (meth) acrylate and (meth) acrylamide obtainable by polymerising the aqueous blend of ammonium (meth) acrylate and (meth) acryla mide according to claim 30.

32. Use of the aqueous blend of ammonium (meth) acrylate and (meth) acrylamide prepared according to any of claims 1 to 24 or prepared in an apparatus according to any of claims 25 to 29 or an aqueous blend of ammonium (meth) acrylate and (meth) acrylamide according to claim 30 for preparing aqueous solutions of copol ymers of ammonium (meth) acrylate and (meth) acrylamide.

33. Use of aqueous solutions of copolymers of ammonium (meth) acrylate and (meth) acrylamide according to claim 32 as surface coatings, adhesives, sealants, for mining applications, for oilfield applications or agricultural applications.