WO2021195023A2 - Compositions and methods for enhancing detection of rna - Google Patents

Compositions and methods for enhancing detection of rna Download PDF

Info

Publication number
WO2021195023A2
WO2021195023A2 PCT/US2021/023589 US2021023589W WO2021195023A2 WO 2021195023 A2 WO2021195023 A2 WO 2021195023A2 US 2021023589 W US2021023589 W US 2021023589W WO 2021195023 A2 WO2021195023 A2 WO 2021195023A2
Authority
WO
WIPO (PCT)
Prior art keywords
rna
aspects
sample
primers
dna
Prior art date
Application number
PCT/US2021/023589
Other languages
French (fr)
Other versions
WO2021195023A3 (en
Inventor
Michael Springer
Original Assignee
President And Fellows Of Harvard College
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by President And Fellows Of Harvard College filed Critical President And Fellows Of Harvard College
Publication of WO2021195023A2 publication Critical patent/WO2021195023A2/en
Publication of WO2021195023A3 publication Critical patent/WO2021195023A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/702—Specific hybridization probes for retroviruses
    • C12Q1/703—Viruses associated with AIDS

Definitions

  • the technology described herein relates to isothermal amplification methods and kits comprising a RNA:DNA duplex-specific RNase.
  • the technology described herein is directed to methods, kits, and system to detect a target RNA.
  • the target RNA can be detected at the single molecular level using the methods described herein, comprising: (a) reverse transcribing the RNA target into complementary DNA (cDNA); (b) degrading the RNA target with an RNA:DNA duplex-specific RNase; (c) amplifying the cDNA to detectable levels; and (d) detecting the amplified cDNA using a method as described further herein.
  • Such methods result in an unexpectedly higher cDNA yield in a shorter timeframe than methods lacking the RNase step.
  • these methods are particularly well-suited to detecting a small amount of target RNA in a limited time period, e.g., point-of-care detection of viral RNAs.
  • a method of detecting a target RNA in a sample comprising: (a) contacting the sample with a reverse transcriptase, and a first set of primers; (b) contacting the sample with an RNA: DNA duplex-specific RNase; (c) contacting the sample with a DNA polymerase, a second set of primers, a recombinase, and single-stranded DNA binding protein; and (d) detecting an isothermal amplification product from step (c).
  • a method of detecting a target RNA in a sample comprising: (a) contacting the sample with a reverse transcriptase, and a first set of primers; (b) contacting the sample with an RNA: DNA duplex-specific RNase; (c) contacting the sample with a DNA polymerase and a second set of primers; and (d) detecting an amplification product from step (c).
  • the RNase is RNaseH.
  • steps (a), (b) and (c) are performed simultaneously in the same reaction.
  • steps (a) and (b) are performed simultaneously in the same reaction, and step (c) is performed after steps (a) and (b).
  • steps (b) and (c) are performed simultaneously in the same reaction, and step (a) is performed prior to steps (b) and (c).
  • the RNaseH is provided at a concentration of 0.1 U/pL to 5 U/pL.
  • the RNaseH is provided at a concentration of 2.5 U/pL
  • step (c) permits an isothermal amplification reaction.
  • the isothermal amplification reaction is selected from the group consisting of: Recombinase Polymerase Amplification (RPA), Loop Mediated Isothermal Amplification (LAMP), Helicase-dependent isothermal DNA amplification (HDA), Rolling Circle Amplification (RCA), and strand displacement amplification (SDA).
  • RPA Recombinase Polymerase Amplification
  • LAMP Loop Mediated Isothermal Amplification
  • HDA Helicase-dependent isothermal DNA amplification
  • RCA Rolling Circle Amplification
  • SDA strand displacement amplification
  • the isothermal amplification reaction is Recombinase Polymerase Amplification (RPA).
  • step (c) further comprises contacting the sample with a recombinase and single-stranded DNA binding protein.
  • the first set of primers comprises primers that bind to target RNA and non-target RNA in the sample.
  • the first set of primers comprises random hexamers.
  • the first set of primers is specific to the target RNA.
  • the second set of primers is specific to the target RNA.
  • steps (a), (b), and/or (c) are performed between 12°C and 45 °C.
  • steps (a), (b) and/or (c) are performed at room temperature.
  • steps (a), (b), and (c) are performed on a heat block.
  • steps (a), (b), and (c) are performed in less than 20 minutes.
  • steps (a), (b), (c), and (d) are performed faster than a method comprising steps (a), (c), and (d) without the RNA:DNA duplex-specific RNase.
  • steps (a), (b), and (c) produce a higher yield of amplification product than a method comprising steps (a) and (c) without the RNA:DNA duplex- specific RNase.
  • step (a) prior to step (a) total RNA is isolated from the sample.
  • step (a) prior to step (a), the sample is contacted with a detergent.
  • the target RNA is a viral RNA.
  • the detection of step (d) is selected from the group consisting of: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
  • kits for detecting a target RNA in a sample comprising: (a) an RNA:DNA duplex-specific RNase; (b) a reverse transcriptase; (c) a DNA polymerase; (d) a recombinase; and (e) single -stranded DNA binding protein.
  • kits for detecting a target RNA in a sample comprising: (a) an RNA:DNA duplex-specific RNase; (b) a reverse transcriptase; and (c) a DNA polymerase.
  • the RNA:DNA duplex-specific RNase is RNaseH.
  • the reverse transcriptase is selected from the group consisting of: a Moloney murine leukemia virus (M-MLV) reverse transcriptase (RT), an avian myeloblastosis virus (AMV) RT, a retrotransposon RT, atelomerase reverse transcriptase, an HIV-1 reverse transcriptase, or a recombinant version thereof.
  • M-MLV Moloney murine leukemia virus
  • AMV avian myeloblastosis virus
  • retrotransposon RT a retrotransposon RT
  • atelomerase reverse transcriptase an HIV-1 reverse transcriptase
  • HIV-1 reverse transcriptase HIV-1 reverse transcriptase
  • the DNA polymerase is a strand-displacing
  • the strand-displacing DNA polymerase is selected from the group consisting of: Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase.
  • the kit further comprises a first and/or second set of primers.
  • the first set of primers comprises primers that bind to target RNA and non-target RNA in the sample.
  • the first set of primers comprises random hexamers.
  • the first set of primers is specific to the target
  • the second set of primers are specific to the target RNA.
  • the second set of primers comprises a forward and reverse primer
  • the first set of primers comprises the reverse primer of the second set of primers
  • the kit further comprises a recombinase and single-stranded DNA binding protein.
  • the kit further comprises a reaction buffer and magnesium acetate.
  • the kit further comprises reagents for isolating RNA from the sample.
  • the kit further comprises detergent for lysing the sample.
  • the kit is used to reverse transcribe the target
  • RNA into DNA and to amplify the DNA to a detectable amplification product.
  • the kit further comprises reagents for detecting the amplification product, comprising reagents appropriate for a detection method selected from: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
  • a detection method selected from: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
  • the kit further comprises one or more lateral flow strips specific for the target amplification product.
  • described herein is a method of detecting an RNA virus in a sample from a subject, comprising: (a) isolating viral RNA from the subject; and (b) performing a method as described herein.
  • the RNA virus is selected from influenza virus, human immunodeficiency virus (HIV), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
  • a method of detecting a target nucleic acid in a sample comprising: (a) contacting the sample with a DNA polymerase and a first set of primers; (b) contacting a first isothermal amplification product of step (a) with a DNA polymerase and a second set of primers; and (c) detecting a second isothermal amplification product from step (b).
  • the first and second set of primers are specific to the target nucleic acid.
  • the second set of primers are specific to the first isothermal amplification product of step (a).
  • step (a) comprises a first isothermal amplification reaction, wherein the target nucleic acid and first set of primers produce the first isothermal amplification product.
  • step (b) comprises a second isothermal amplification reaction, wherein the first isothermal amplification product and second set of primers produce the second isothermal amplification product.
  • steps (a) and (b) are performed sequentially.
  • step (a) and prior to step (b) the first isothermal amplification product is diluted, and the dilution is used for the second isothermal amplification reaction.
  • the first isothermal amplification product is diluted at least 1:400.
  • step (a) is performed in less than 10 minutes.
  • step (b) is performed in less than 30 minutes.
  • steps (a) and (b) are performed at room temperature.
  • the isothermal amplification reactions of steps (a) and (b) are selected from the group consisting of: Recombinase Polymerase Amplification (RPA), Loop Mediated Isothermal Amplification (LAMP), Helicase -dependent isothermal DNA amplification (HD A), Rolling Circle Amplification (RCA), and strand displacement amplification (SDA).
  • RPA Recombinase Polymerase Amplification
  • LAMP Loop Mediated Isothermal Amplification
  • HD A Helicase -dependent isothermal DNA amplification
  • RCA Rolling Circle Amplification
  • SDA strand displacement amplification
  • the isothermal amplification reaction is Recombinase Polymerase Amplification (RPA).
  • steps (a) and (b) further comprise contacting the sample or the first isothermal amplification product with a recombinase.
  • the target nucleic acid is an RNA.
  • the target nucleic acid is a viral RNA.
  • step (a) prior to step (a) total RNA is isolated from the sample.
  • the sample prior to step (a), is contacted with a reverse transcription enzyme and a third set of primers.
  • the third set of primers comprises primers that bind to target RNA and non-target RNA in the sample.
  • the third set of primers comprises random hexamers.
  • the detection of step (c) is selected from the group consisting of: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
  • kits for detecting a target nucleic acid using isothermal amplification reactions comprising: (a) a first and second set of primers; and (b) a DNA polymerase.
  • the kit is used to produce a first isothermal amplification product from the target nucleic acid and first set of primers using a first isothermal amplification reaction.
  • the kit is used to produce a second isothermal amplification product from the first isothermal amplification product and the second set of primers using a second isothermal amplification reaction.
  • the first and second set of primers are specific to the target nucleic acid.
  • the second set of primers are specific to the first isothermal amplification product produced by the first set of primers.
  • the kit further comprises a dilution reagent for diluting the first isothermal amplification product between the first and second isothermal amplification reactions.
  • the isothermal amplification reactions are selected from the group consisting of: Recombinase Polymerase Amplification (RPA), Loop Mediated Isothermal Amplification (LAMP), Helicase-dependent isothermal DNA amplification (HDA), Rolling Circle Amplification (RCA), and strand displacement amplification (SDA).
  • RPA Recombinase Polymerase Amplification
  • LAMP Loop Mediated Isothermal Amplification
  • HDA Helicase-dependent isothermal DNA amplification
  • RCA Rolling Circle Amplification
  • SDA strand displacement amplification
  • the isothermal amplification reaction isothermal amplification reaction
  • RPA Recombinase Polymerase Amplification
  • the DNA polymerase is a strand-displacing DNA polymerase.
  • the strand-displacing DNA polymerase is selected from the group consisting of: Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase.
  • the strand-displacing DNA polymerase comprises Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase.
  • the kit further comprises a recombinase and single-stranded DNA binding protein.
  • the kit further comprises a reaction buffer and magnesium acetate.
  • the kit further comprises reagents for isolating nucleic acid from a sample.
  • the target nucleic acid is an RNA.
  • the target nucleic acid is a viral RNA.
  • the kit further comprises a reverse transcription enzyme.
  • the kit is used to reverse transcribe target RNA into DNA, and to amplify the DNA to a detectable second amplification product.
  • the kit further comprises for detecting the second amplification product, comprising reagents appropriate for a detection method selected from: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
  • a detection method selected from: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
  • the kit further comprises one or more lateral flow strips specific for the second amplification product.
  • a method of detecting a target RNA in a sample comprising: (a) contacting the sample with a reverse transcriptase, and a first set of primers; (b) contacting the sample with an RNA: DNA duplex-specific RNase; (c) contacting the sample with a DNA polymerase and a second set of primers; (d) contacting a first isothermal amplification product of step (c) with a DNA polymerase and a third set of primers; and (e) detecting a second isothermal amplification product from step (d).
  • the second and third set of primers are specific to the target nucleic acid.
  • the third set of primers are specific to the first isothermal amplification product of step (c).
  • Fig. 1 is a dot plot showing a two pot rt-RPA experiment done in parallel with a one pot rt-RPA with DNA or RNA from an influenza megamer (H1N1) as an input. Both the RNA and DNA input concentrations were 10 L 4 molecules. 2 U/uL Protoscriptase® II was used in each reaction. In the two pot reactions the RT step was carried out for either 5 or 20 minutes. Then 1 pL from the RT reaction was transferred to the RPA reaction as the input. 1 pL of RNaseH at a concentration of 1.25 U was added at the start of the RPA reaction. The RPA was run for one hour in a one pot reaction and 30 min for the two pot reactions.
  • the total reaction time for the one-pot RT-RPA reaction was 1 hour, and the total reaction time for the two-pot RT-RPA was 35 to 50 minutes (5 min or 20 min RT followed by 30 min RPA).
  • the RPA products were then diluted 1: 1000 prior to being read by qPCR. RNaseH thus improves detection of influenza RNA.
  • Fig. 2 is a dot plot testing whether RNaseH improves detection in two pot reactions for HIV RNA at varying concentrations.
  • the RNA was first reverse transcribed to DNA in a 20 pL volume for either 1 min or 5 min. Then 1 pL from the RT reaction was used as template for the RPA reaction, which was run for 10 min.
  • 1 uL of RNaseH was added at a concentration of 0.5 U to the RPA reaction following the RT step.
  • lpL of water was added to the RPA.
  • the RPA products were diluted 1:200 before detection by qPCR.
  • RNaseH thus improves the yield of a two-pot RT-RPA reaction, especially when the input RNA is at a low concentration.
  • Fig. 3 is a dot plot showing optimization of a one pot RPA reaction, using HIV as template. This experiment tested whether or not the addition of RNaseH would lower the Ct value measured by qPCR. HIV RNA was diluted to concentrations of 10 L 5, 10 L 4, 10 L 3, and 10 L 2 molecules/pL. A large master mix for the RPA reaction was prepared using six TwistDxTM pellets. This master mix omitted the RNaseH as well as the template. 9 pL was set aside for the negative control, water. The master mix was then split into four Eppendorfs to which template was added. The master mix was then distributed to 24 PCR tubes.
  • RNaseH diluted to 0.5 U was added to the time 0 samples at RNA concentrations of 10 L 5, 10 L 4, 10 L 3, and 10 L 2 molecules/pL.
  • RPA primer extension primer
  • the RPA products were diluted 1:200 before detection by qPCR. RNaseH thus improves the yield of a one-pot RT-RPA reaction, especially when the input RNA is at a low concentration.
  • Fig. 4 is a bar graph showing testing of different concentrations of RNaseH and HIV RNA input.
  • the stock RNaseH was further diluted to test whether or not there was a more optimal concentration of RNaseH than 0.5 U.
  • the RPA reaction volumes were kept at 10 pL, the Protoscriptase® II was held at 20 U/pL, and 1 pL of diluted RNaseH was added to each one pot reaction. This experiment indicated that more concentrated RNaseH led to lower Ct values.
  • the RPA products were diluted 1:200 before detection by qPCR.
  • the left-right order of the bars for each concentration is the same as the top-down order of the legend.
  • Fig. 5 is a bar graph showing a test to see whether or not RNaseH performed optimally with a smaller dilution.
  • the RPA conditions were the same as in Fig. 4 and the RNaseH was diluted with less rehydration buffer.
  • An additional condition of two different timepoints for the RPA reaction was included for 10 and 25 min reaction times.
  • Lower RNaseH dilutions did not significantly differ from one another, however, the 1:2 dilution of RNaseH to rehydration buffer did appear to have a slightly lower Ct than the 1:10 dilution of RNaseH.
  • the RPA products were diluted 1:200 before detection by qPCR.
  • Fig. 6 is a series of images of laminar flow test strips showing that viral transport media does not inhibit 1-pot RT-RPA-RNaseH of SARS-CoV-2 RNA.
  • Fig. 7A-7C shows a COVID-19 N-gene primer screen of 6 primer pairs by qPCR of RT- RPA.
  • Fig. 7A shows a map of the COV-19 N-gene; different primer and probe sites were tested to improve sensitivity and specificity.
  • Fig. 7B shows a gel, and
  • Fig. 7C shows the qPCR summary of a 1-pot RT-RPA-RNaseH reaction.
  • the criteria for the primer screen included: (1) the largest delta Ct differences between RPA H20 and the saturating condition, and (2) the least primer dimers. Primer pairs 3 and 4 were the best candidates.
  • the left-right order of the bars for each concentration is the same as the top-down order of the legend.
  • Fig. 8 shows an exemplary schematic of a system as described herein.
  • Fig. 9 is an image of laminar flow strips showing detection of 10 molecules (1 loglO) of
  • SARS-CoV-2 RNA The input was in vitro transcription (IVT) RNA of CoV-2 full length N gene.
  • the reaction was a 1-pot RT-RPA-RNaseH, using nested RPA primers (see e.g., Example 2).
  • the resolution was near single molecule.
  • the total time from inputting RNA to visualization was 30 minutes.
  • the equipment requirements include 1 heat block at ⁇ 95°C, pipette, tips, 2 tubes, and reagents.
  • the throughput for one technician is ⁇ 96 tests in 45 minutes, with prospects of even higher efficiency.
  • the cost is under $5 per test, which could be decreased significantly.
  • Fig. 10A-10C is a series of images representative of a protocol described herein (see e.g., Example 2).
  • Fig. 10A-10B are images showing proper spacing of reaction tubes or wells to avoid cross contamination.
  • Fig. IOC is an image showing test strip results of positive controls (e.g., SARS- CoV-2) and negative controls (e.g., Middle East Respiratory Syndrome (MERS), SARS, and LEO).
  • Fig. 11A-11D shows the development of FIND: an enhanced RT-RPA based assay for detection of SARS-CoV-2.
  • Fig. 11A Screen for reverse transcriptase (RT) enzyme and effect of RNase H.
  • SARS-CoV-2 RNA was amplified by RT-recombinase polymerase amplification (RT-RPA) using five different RTs with or without RNase H addition and the yield of each reaction was determined by quantitative PCR (qPCR). At least two biological and two technical replicates were used for each data point; numbers in each square represent mean log2 fold amplification. Samples labeled as zero yielded only non-specific amplification products. (Fig. 11B) Primer optimization screen. SARS-CoV-2 RNA was amplified by RT-RPA using forward and reverse primers specific to the S gene. The yield of each reaction was determined by qPCR using the same primer pair as for the RT-RPA reaction.
  • FIG. 11C Lateral flow strip readout of RT-RPA reactions of SARS-CoV-2 RNA using primer pairs FP2/F AM-labeled RP1 and FP3/F AM-labeled RP1. All lateral flow strips contain a control (C) and test (T) band.
  • FIG. 11D Schematic of FIND. Viral RNA is first copied to cDNA by RT, then degraded by RNase H. The cDNA product is amplified by RPA using a forward and a FAM labeled reverse pair of primers specific to the target sequence. The amplified material is then denatured and hybridized to a biotinylated probe. Dual FAM- and biotin-labeled products are detected on lateral flow strips.
  • Fig. 12A-12C shows the sensitivity and specificity of RNA detection.
  • Fig. 12A Summary of FIND test results for detection of RNA from SARS-CoV-2 or from other viruses. Synthetic full genome SARS-CoV-2 RNA was amplified by FIND using primers targeting the N or S gene and reactions were read out by lateral flow strip. The specificity of FIND was tested against either in vitro transcribed (IVT) RNA of the related viruses MERS and SARS-CoV, or IVT RNA of the common cold coronaviruses HCoV-HKU 1 and HCoV-229E, or viral genomic RNA extracted from 2009 H1N1 Influenza.
  • IVTT in vitro transcribed
  • FIG. 12C Lateral flow strip readouts for all N gene data shown in Fig. 12A.
  • Fig. 13A-13H shows the lysis and detection of SARS-CoV-2 N gene from contrived samples.
  • Fig. 13A Viral particle temperature lysis determination. AccuPlexTM packaged SARS- CoV-2 virus was diluted into TCEP buffer and heated for 5 min at the given temperature (see e.g., Methods).
  • Fig. 13B Detection of RNase activity of VTM. RNaseAlertTM was added to viral transport media (VTM) with or without the addition of RNasin PlusTM before heating for 5 min at 94°C or added to a 1 : 1 VTM and viral lysis buffer mix and incubating for 10 min at 25 °C. Data represent the average of 4 technical replicates and were determined by normalizing the fluorescence intensity 10 minutes after the heating step to a fully degraded control.
  • FIG. 13C Schematic of sample processing of patient samples in VTM for input into FIND.
  • FIG. 13D Heatmap displaying FIND test calls for detection of AccuPlexTM packaged SARS- CoV-2 lysed with conditions displayed in Fig. 13C.
  • AccuPlexTM packaged SARS-CoV-2 virus was mixed 1:1 with VTM, PBS, or viral lysis buffer and incubated as shown. All samples included RNasin Plus. Values represent the number of positive test calls : number of negative test calls for each condition.
  • Fig. 13E Inactivation of RNase activity in saliva by TCEP and heat. Saliva was first mixed 1:1 with a buffer containing 1 mM (black diamonds) or 100 mM (grey triangles) TCEP and heated at the indicated temperature for 5 min.
  • FIG. 13F The combined activities of an RNase inhibitor and TCEP protect RNA from degradation in saliva.
  • RNaseAlertTM was added to saliva diluted 1:1 with TCEP buffer containing an RNase inhibitor and treated as shown.
  • RNaseAlertTM degradation was assessed an in Fig. 13B. See e.g., additional data in Fig. 17G.
  • FIG. 13G Schematic of sample processing of patient saliva samples for input into FIND.
  • Fig. 13H Heatmap displaying FIND test calls for detection of SARS-CoV-2 RNA or AccuPlexTM packaged virus from saliva treated as displayed in Fig. 13G.
  • AccuPlexTM packaged SARS-CoV-2 virus or SARS-CoV-2 N gene IVT RNA were added to saliva and extracted as shown. Values represent the number of positive test calls : number of negative test calls for each condition.
  • FIG. 14A-14D shows the detection of SARS-CoV-2 in clinical samples using FIND.
  • FIG. 14 A Schematic of the workflow for benchmarking FIND against RT-qPCR using patient samples.
  • FIG. 14B Sampling of lateral flow strip readouts of SARS-CoV-2 N gene FIND tests of unextracted (Top) or extracted (Bottom) patient samples of known infection status. Unextracted patient samples were run in duplicates both by FIND (calls of positive (+) or negative (-) were made within 20 min of detection) and by one-step RT-qPCR (Ct values shown). See e.g., additional data in Fig. 18A.
  • Fig. 14C Summary of FIND test results of 51 patient samples and comparison to RT-qPCR. The y axis represents patient viral titer determined using a commercial one-step RT-qPCR assay from unextracted samples or extracted RNA samples with a standard curve.
  • Fig. 14D (Left) Matched RT- qPCR Ct values of unextracted and extracted patient samples. (Right) Difference between extracted and unextracted Ct values for all patients. Patient samples were provided in multitrans media (black) or universal transport media (grey).
  • FIG. 15A-15D shows the development of FIND.
  • Fig. 15A Organization of the SARS- CoV-2 genome and location of regions in the S and N genes targeted by FIND. Detailed mapping of the binding site of all forward and reverse primers tested in the primer optimization screen and of the biotin hybridization probe was shown for S gene only for display purposes. SARS-CoV-2 was aligned to the closely related SARS-CoV and MERS to identify regions of low homology which were targeted by primers and hybridization probes used in the assay.
  • Fig. 15B Schematic of the workflow used for optimization of FIND.
  • cDNA product amplified by recombinase polymerase amplification (RPA) using forward and reverse unlabeled primers was quantified in a subsequent qPCR assay.
  • Fig. 15C Comparison of the performance of Superscript IV® and ProtoScript II®.
  • IVTT In vitro transcribed N gene SARS-CoV-2 RNA was amplified by RT-RPA and reactions were read out on a lateral flow strip.
  • IVT N gene SARS-CoV-2 RNA was amplified by RT-RPA with or without RNase H addition and the yield of each reaction was determined by quantitative PCR. Data represent the average yield of two technical replicates and is staggered on the x axis for visualization purposes.
  • Fig. 16A-16G shows the sensitivity and specificity of RNA detection.
  • Fig. 16A Blinded and randomized plate layout used in FIND assays used for generation of the data displayed in Fig. 12A.
  • Fig. 16B Lateral flow strip readouts for the S gene dataset displayed in Fig. 12A. Individual strips are labeled with the test call made within 20 minutes of detection (positive (+) or negative (-)).
  • the positive (Pos.) FIND control is 1,000 copies of synthetic full genome SARS-CoV-2 RNA and the negative (Neg.) FIND control is a water-only input. Images taken for the purpose of display were allowed to dry which reduced the intensity of some weak bands (labeled with asterisks).
  • Fig. 16A Blinded and randomized plate layout used in FIND assays used for generation of the data displayed in Fig. 12A.
  • Fig. 16B Lateral flow strip readouts for the S gene dataset displayed in Fig. 12A. Individual strips are labeled
  • FIG. 16C Heatmap displaying the rate of FIND test calls for detection of RNA from SARS-CoV-2 or from other viruses as shown in Fig. 12A. Values represent the number of positive test calls : number of negative test calls for each condition.
  • FIG. 16D- Fig. 16E RT-qPCR quantification of in vitro transcribed (IVT) RNA from MERS, SARS- CoV, HCoV-229E, and HCoV-HKUl used as specificity control tests in FIND; N gene shown in Fig. 16D and S gene in Fig. 16E.
  • FIG. 16F RT-qPCR quantification of RNA extracted from 2009 H1N1 Influenza.
  • Fig. 17A-17G shows the optimization of sample processing conditions for detection of SARS-CoV-2 in clinical samples.
  • Heating VTM in presence of TCEP leads to formation of a gelatinous substance (highlighted by arrowhead).
  • Fig. 17B Addition of RNase inhibitor to patient samples prior to heat inactivation increases the RNA titer as quantified by RT-qPCR. Unextracted known positive patient samples were heat inactivated for 5 min at 94°C with or without RNasin Plus. Viral RNA was quantified using a commercial one-step RT-qPCR assay.
  • Left Ct values for matched samples with and without RNase inhibitor.
  • Fig. 17C Addition of RNase inhibitor to patient samples prior to heat inactivation increases the signal of the FIND assay. Heat inactivated samples prepared in Fig. 17B were tested using FIND.
  • Fig. 17D TCEP and heat (not EDTA) are required to inactivate the RNase activity in saliva as determined using RNaseAlertTM assays. Saliva (or water control) was mixed 1 : 1 with a buffer containing TCEP and EDTA as shown. RNaseAlertTM was added and the sample was heated as indicated. RNase A was added to a set of water samples post addition of RNaseAlertTM as control.
  • FIG. 17F RNase inhibitors protect RNA against degradation in saliva at low temperature only. Saliva was mixed 1 : 1 with a buffer containing an RNase inhibitor as shown. RNaseAlertTM was added and the sample heated as indicated. Data represent the fluorescence intensity 10 minutes after the heating step normalized to a fully degraded control.
  • FIG. 17G The combined activities of an RNase inhibitor and TCEP protect RNA from degradation in saliva (additional data for Fig. 13F).
  • Fig. 18A-18E shows the detection of SARS-CoV-2 from unextracted and extracted clinical samples.
  • Fig. 18A-Fig. 18B Lateral flow strip readouts of all FIND tests from unextracted (Fig. 18A) and extracted (Fig. 18B) patient samples summarized in Fig. 14D. Individual strips are labeled with the FIND test call made within 20 minutes of detection (positive (+) or negative (-)).
  • the positive (Pos.) FIND control is 100 copies of synthetic full genome SARS-CoV-2 RNA and the negative (Neg.) FIND control is a water-only input.
  • FIG. 18C Heatmap displaying the rate of positive FIND test calls for detection of SARS-CoV-2 N gene from the 51 patient samples as shown in Fig. 14D binned by RNA input determined by one step RT-qPCR. Values represent the number of positive test calls : number of negative test calls for each condition.
  • Fig. 18D The one-step RT- qPCR assay was validated against the CDC N 1 RT-qPCR assay using synthetic SARS-CoV-2 RNA as input.
  • FIG. 18E Comparison between the sensitivity of the CDC N1 RT-qPCR assay ran on 5 pL extracted sample and the one-step RT-qPCR assay ran on 2 pL extracted sample.
  • Fig. 19A-19D shows the detection of SARS-CoV-2 S gene from clinical samples.
  • Fig. 19A Lateral flow strip readouts of S gene FIND performed on patient samples of known infection status. Individual strips are labeled with the test call made within 20 minutes of detection (positive (+) or negative (-)).
  • the positive (Pos.) FIND control is 100 copies of synthetic full genome SARS-CoV- 2 RNA and the negative (Neg.) FIND control is a water-only input. Negative control samples 25-29 were not screened by RT-qPCR.
  • Fig. 19B Comparison of Ct values obtained by RT-qPCR targeting SARS-CoV2 N and S genes on the same input patient samples.
  • Fig. 20 shows the equipment required for FIND assay.
  • FIND only requires a limited set of equipment including micropipettes and disposable plastic tips, a heat block capable of reaching 42°C and 94°C, and plastic microtubes or multi-well plates.
  • Embodiments of the technology described herein comprise methods, kits, and systems for detecting a target RNA, such as a small amount of viral RNA.
  • a target RNA such as a small amount of viral RNA.
  • described herein are methods of detecting the target RNA.
  • described herein are kits and systems suitable to practice the methods described herein to detect the target RNA.
  • RNA molecules can be detected at the single molecular level using the methods, kits, and systems as described herein.
  • the methods described herein comprise: (a) reverse transcribing the RNA target into complementary DNA (cDNA); (b) degrading the RNA target with an RNA:DNA duplex-specific RNase; (c) amplifying the cDNA to detectable levels; and (d) detecting the amplified cDNA using a method as described further herein or known in the art.
  • Such methods result in an unexpectedly higher cDNA yield in a shorter timeframe than methods the inclusion of the RNA:DNA duplex-specific RNase. As such, these methods are particularly well-suited to detecting a small amount of target RNA in a limited time period.
  • a method of detecting a target RNA in a sample comprising: (a) contacting the sample with a reverse transcriptase, and a first set of primers; (b) contacting the sample with an RNA:DNA duplex-specific RNase; (c) contacting the sample with a DNA polymerase, a second set of primers, a recombinase, and single-stranded DNA binding protein; and (d) detecting an isothermal amplification product from step (c).
  • a method of detecting a target RNA in a sample comprising: (a) contacting the sample with a reverse transcriptase, and a first set of primers; (b) contacting the sample with an RNA:DNA duplex-specific RNase; (c) contacting the sample with a DNA polymerase and a second set of primers; and (d) detecting an amplification product from step (c).
  • step (a) is also referred to as the reverse transcription (RT) step; step (b) is also referred to as the RNase step; step (c) is also referred to as the amplification or isothermal amplification step; and step (d) is also referred to as the detection step.
  • steps (a), (b) and (c) are performed simultaneously in the same reaction (see e.g., Fig. 1, Fig. 3-5), which is also referred to herein as a “one pot” reaction or experiment.
  • RNA target inhibits the amplification reaction of step (c); thus, removing the RNA target with the RNA:DNA duplex-specific RNase (e.g., at any time prior to or during the amplification) can permit the amplification reaction to proceed faster and with a higher yield of cDNA.
  • steps (a) and (b) are performed simultaneously in the same reaction; in other words, the RNA:DNA duplex-specific RNase is added during the reverse transcription step.
  • step (c) is performed after steps (a) and (b).
  • steps (a) and (b) are performed simultaneously in the same reaction
  • step (c) is performed after steps (a) and (b).
  • steps (b) and (c) are performed simultaneously in the same reaction; in other words, the RNA:DNA duplex-specific RNase is added during the amplification step.
  • steps (b) and (c) are performed simultaneously in the same reaction, and step (a) is performed prior to steps (b) and (c).
  • Such reactions comprising a first step (e.g., (a) and (b), or (a)) and a second step (e.g., (c), or (b) and (c)) is also referred to herein as a “two pot” reaction or experiment (see e.g., Fig. 1-2).
  • steps (a), (b) and (c) are each performed in separate reactions, which can be referred to as a “three pot” reaction or experiment.
  • step (a) is performed prior to steps (b) and (c).
  • step (b) is performed after step (a) and prior to step (c).
  • step (c) is performed after to steps (a) and (b).
  • step (a) is performed prior to step (b), and step (b) is performed prior to step (c).
  • the reaction product is diluted before being added to the next reaction step. In some embodiments of any of the aspects, the reaction product of step (a) is diluted prior to being added to step (b). In some embodiments of any of the aspects, the reaction product of step (a) is diluted prior to being added to simultaneous steps (b) and (c). In some embodiments of any of the aspects, the reaction product of simultaneous steps (a) and (b) is diluted prior to being added to step (c). In some embodiments of any of the aspects, the reaction product of step (b) is diluted prior to being added to step (c). In some embodiments of any of the aspects, the reaction product of step (c) (or simultaneous step (b) and (c); or simultaneous step (a), (b), and (c)) is diluted prior to being added to step (d).
  • the diluent comprises the reaction buffer of the next reaction or an aqueous solution.
  • the dilution comprises a ratio of at least 4:5, at least 2:3, at least 1:2, at least 1:3, at least 1:4, at least 1:5, at least 1:6, at least 1:7, at least 1:8, at least 1:9, at least 1: 10, at least 1:20, at least 1:30, at least 1:40, at least 1:50, at least 1:60, at least 1:70, at least 1:80, at least 1:90, at least 1: 10, at least 1: 100, least 1:200, least 1:300, least 1:400, least 1:500, least 1:600, least 1:700, least 1:800, least 1:900, at least 1 : 10 3 , at least 1 : 10 4 , or at least 1 : 10 5 , of reaction product to diluent.
  • steps (a), (b), (c), and/or (d) are performed between 12°C and 45°C.
  • steps (a), (b), (c), and/or (d) are performed at at least 12°C, at least 13°C, at least 14°C, at least 15°C, at least 16°C, at least 17°C, at least 18°C, at least 19°C, at least 20°C, at least 21°C, at least 22°C, at least 23°C, at least 24°C, at least 25°C, at least 26°C, at least 27°C, at least 28°C, at least 29°C, at least 30°C, at least 31°C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C, at least 38°C, at least 39°C, at least 40°C, at least 41°C, at least 42°C, at
  • steps (a), (b), (c), and/or (d) are performed at at most 12°C, at most 13°C, at most 14°C, at most 15°C, at most 16°C, at most 17°C, at most 18°C, at most 19°C, at most 20°C, at most 21°C, at most 22°C, at most 23°C, at most 24°C, at most 25°C, at most 26°C, at most 27°C, at most 28°C, at most 29°C, at most 30°C, at most 31°C, at most 32°C, at most 33°C, at most 34°C, at most 35°C, at most 36°C, at most 37°C, at most 38°C, at most 39°C, at most 40°C, at most 41°C, at most 42°C, at most 43°C, at most 44°C, at most 45°C.
  • steps (a), (b), (c), and/or (d) are performed at room temperature.
  • room temperature refers to the ambient temperature of a space, which is typically 20°C-22°C.
  • steps (a), (b), (c), and/or (d) are performed at body temperature.
  • body temperature refers to the temperature of the subject such as that of a human subject, which is typically 37°C.
  • steps (a), (b), (c), and/or (d) are performed on a heat block, which can be a Hybex® or any other heat block capable of maintaining a stable temperature.
  • the heat block is set to approximately 42°C.
  • steps (a), (b), (c), and/or (d) are performed faster than a method comprising steps (a), (c), and/or (d) without the RNA:DNA duplex-specific RNase.
  • the method as carried out provides, in the time specified, sufficient amplified material to be detected.
  • a method that is “performed faster” with RNA:DNA duplex-specific RNase provides sufficient amplified material to be detected faster or in a shorter time than the same method performed without the RNA:DNA duplex-specific RNase.
  • RNA refers to a determination of the presence of a target RNA in a sample.
  • the term “faster” (or “less time”) when used in the context of a reaction or a method of detecting an RNA means that the reaction provides product, e.g., sufficient amplified material to be detected/confirm the presence of a target in at least 10% less time than the same reaction performed without RNA:DNA duplex-specific RNase addition, e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or less time.
  • steps (a), (b), (c), and/or (d) are performed in at most 20 minutes.
  • steps (a), (b), (c), and/or (d) are performed in at most 5 minutes, at most 6 minutes, at most 7 minutes, at most 8 minutes, at most 9 minutes, at most 10 minutes, at most 15 minutes, at most 20 minutes, at most 25 minutes, at most 30 minutes, at most 40 minutes, at most 50 minutes, at most 60 minutes, at most 70 minutes, at most 80 minutes, at most 90 minutes, or at most 100 minutes.
  • steps (a), (b), and (c) are performed in at most 20 minutes. In some embodiments of any of the aspects, steps (a), (b), and (c) (e.g., RT-RPA with RNaseH) are performed in at most 10 minutes. [00132] In some embodiments of any of the aspects, steps (a), (b), and/or (c) produce a higher yield of amplification product than a method comprising steps (a) and/or (c) without the RNA:DNA duplex-specific RNase.
  • the term “higher yield of amplification product” refers to providing at least 10% more than a reaction performed in the same manner and for the same amount of time but without added RNA:DNA duplex-specific RNase, e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, two-fold, three-fold, four-fold, five-fold, ten-fold or more increase of amplification product.
  • steps (a), (b), and/or (c) produce at least a 1,000,000-fold increase in the yield of amplification product compared to a method comprising steps (a) and/or (c) without the RNA:DNA duplex-specific RNase.
  • steps (a), (b), and/or (c) produce at least 2 L 25 to 2 L 30 molecules of amplification product.
  • RNA in a complex with cDNA is degraded by an RNA:DNA duplex-specific RNase, while the cDNA is amplified and detected.
  • the methods described herein comprise a step (b) (i.e., the RNase step) comprising contacting the sample with an RNA:DNA duplex-specific RNase.
  • an RNA:DNA duplex-specific RNase is included in one of the reaction steps described herein.
  • RNA:DNA duplex- specific RNase refers to an enzyme that specifically degrades RNA in a duplex comprising one strand of RNA and one strand of complementary DNA.
  • ribonuclease can be used interchangeably with RNase.
  • An RNA:DNA duplex-specific RNase does not degrade RNA in an RNA:RNA duplex.
  • An RNA:DNA duplex-specific RNase does not degrade DNA in an DNA:RNA duplex or a DNA:DNA duplex.
  • the RNA:DNA duplex-specific RNase degrades the RNA target that is complexed with cDNA. In some embodiments of any of the aspects, the RNA:DNA duplex-specific RNase degrades the RNA target after the cDNA has been synthesized by the reverse transcriptase cDNA.
  • the RNA:DNA duplex-specific RNase is provided as separate enzyme, e.g., from the reverse transcriptase or DNA polymerase. In some embodiments of any of the aspects, the RNA:DNA duplex-specific RNase is not comprised by (e.g., is not a domain of) the reverse transcriptase or DNA polymerase. In some embodiments of any of the aspects, the RNA:DNA duplex-specific RNase is not present as a contaminant of the reaction mixture. [00136] In some embodiments of any of the aspects, the RNA:DNA duplex-specific RNase is included in the reverse transcription step (i.e., step (a)).
  • the RNA:DNA duplex-specific RNase is included in the amplification step (i.e., step (c)). In some embodiments of any of the aspects, the RNA:DNA duplex-specific RNase is included in its own separate reaction step (i.e., step (b)).
  • RNA:DNA duplex-specific RNase is
  • RNaseH is an endoribomiclease that specifically hydrolyzes the phosphodiester bonds of RNA, when hybridized to DNA.
  • RNase H is an endoribomiclease that specifically hydrolyzes the phosphodiester bonds of RNA, when hybridized to DNA.
  • RNase H family can be found in nearly all organisms, from bacteria to archaea to eukaryotes.
  • the RNaseH family is divided into evolutionarily related groups with slightly different substrate preferences, broadly designated ribonuclease HI and H2.
  • the human genome encodes both HI and H2.
  • Human ribonuclease H2 is a heterotrimeric complex composed of three subunits.
  • a third type “H3”, closely related to H2, is found only in a few prokaryotes, whereas HI and H2 occur in all domains of life.
  • RNase HI -like retroviral ribonuclease H domains occur in multi- domain reverse transcriptase proteins, which are encoded by retroviruses such as HIV and are required for viral replication.
  • the RNaseH used in the methods, kits, and systems described herein is isolated or derived from a prokaryotic, archaeal, or eukaryotic RNaseH.
  • the RNaseH used herein comprises an RNaseHl, RNaseH2, RNaseH3, or RNase Hl-like retroviral ribonuclease H domain.
  • the RNaseH is isolated or derived from an E. coli strain that carries the cloned RNase H gene (mh) from Escherichia coli.
  • the RNaseH is encoded by a nucleic acid sequence comprising SEQ ID NO: 1 or a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 1 that maintains the same function (e.g., degradation of RNA in a RNA:DNA duplex) or a codon-optimized version of SEQ ID NO: 1.
  • the RNaseH is encoded by a nucleic acid sequence comprising SEQ ID NO: 1 or a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%,
  • the RNaseH comprises SEQ ID NO: 2 or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% similar to SEQ ID NO: 2 that maintains the same function (e.g., degradation of RNA in a RNA:DNA duplex).
  • the RNaseH comprises SEQ ID NO: 2 or an amino acid sequence that is at least 95% similar to SEQ ID NO: 2 that maintains the same function.
  • the RNaseH comprises SEQ ID NO: 2 or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2 that maintains the same function (e.g., degradation of RNA in a RNA:DNA duplex).
  • the RNaseH comprises SEQ ID NO: 2 or an amino acid sequence that is at least 95% identical to SEQ ID NO: 2 that maintains the same function.
  • SEQ ID NO: 1 Escherichia coli str. K-12 substr. MG1655, complete genome NCBI Reference Sequence: NC_000913.3 REGION: complement (235535-236002), Gene ID: 946955; 468 nucleotides (nt)
  • the RNaseH is provided (i.e., added to the reaction mixture) at a concentration of 0.1 U/pL to 5 U/pL.
  • one unit (“U”) of RNaseH is defined as the amount of enzyme which produces 1 nmol acid-soluble ribonucleotides from[ 3 H] poly (A) x poly(dT) in 20 minutes at +37 °C under the stated assay conditions.
  • RNase H activity cab be assayed according to Hillenbrand and Staudenbauer (Nucleic Acids Res. 1982 Feb 11; 10(3): 833— 853).
  • the RNaseH is provided at a concentration of at least 0.1 U/pL, at least 0.2 U/pL, at least 0.3 U/pL, at least 0.4 U/pL, at least 0.5 U/pL, at least 0.6 U/pL, at least 0.7 U/pL, at least 0.8 U/pL, at least 0.9 U/pL, at least 1.0 U/pL, at least 1.1 U/pL, at least 1.2 U/pL, at least 1.3 U/pL, at least 1.4 U/pL, at least 1.5 U/pL, at least 1.6 U/pL, at least 1.7 U/pL, at least 1.8 U/pL, at least 1.9 U/pL, at least 2.0 U/pL, at least 2.1 U/pL, at least 2.2 U/pL, at least 2.3 U/pL, at least 2.4 U/pL, at least 2.5 U/pL, at least 2.6 U/pL, at
  • the RNaseH is added to a reaction mixture that totals (e.g., including the RNase) 10 pL.
  • the final concentration of the RNaseH in the reaction mixture is a 1: 10 dilution of the concentration at which the RNaseH was provided.
  • the final concentration of the RNaseH in the reaction mixture is at least 0.01 U/pL, at least 0.02 U/pL, at least 0.03 U/pL, at least 0.04 U/pL, at least 0.05 U/pL, at least 0.06 U/pL, at least 0.07 U/pL, at least 0.08 U/pL, at least 0.09 U/pL, at least 0.1 U/pL, at least 0.2 U/pL, at least 0.3 U/pL, at least 0.4 U/pL, at least 0.5 U/pL, at least 0.6 U/pL, at least 0.7 U/pL, at least 0.8 U/pL, at least 0.9 U/pL, at least 1.0 U/pL, at least 1.1 U/pL, at least 1.2 U/pL, at least 1.3 U/pL, at least 1.4 U/pL, at least 1.5 U/pL, at least 1.6 U/pL, at least 1.7 U
  • the RNase step (i.e., step (b)) is performed between 12°C and 45°C.
  • the RNase step is performed at at least 12°C, at least 13°C, at least 14°C, at least 15°C, at least 16°C, at least 17°C, at least 18°C, at least 19°C, at least 20°C, at least 21°C, at least 22°C, at least 23°C, at least 24°C, at least 25°C, at least 26°C, at least 27°C, at least 28°C, at least 29°C, at least 30°C, at least 31°C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C, at least 38°C, at least 39°C, at least 40°C, at least 41°C, at least 42°C, at least 43°C, at least 44°C, at least
  • the RNase step is performed at at most 12°C, at most 13°C, at most 14°C, at most 15°C, at most 16°C, at most 17°C, at most 18°C, at most 19°C, at most 20°C, at most 21°C, at most 22°C, at most 23°C, at most 24°C, at most 25°C, at most 26°C, at most 27°C, at most 28°C, at most 29°C, at most 30°C, at most 31°C, at most 32°C, at most 33°C, at most 34°C, at most 35°C, at most 36°C, at most 37°C, at most 38°C, at most 39°C, at most 40°C, at most 41°C, at most 42°C, at most 43°C, at most 44°C, at most 45°C.
  • the RNase step is performed at room temperature (e.g., 20°C-22°C). In some embodiments of any of the aspects, the RNase step is performed at body temperature (e.g., 37°C). In some embodiments of any of the aspects, the RNase step is performed on a heat block set to approximately 42°C.
  • the RNase step is performed at most 20 minutes. In some embodiments of any of the aspects, the RNase step is performed at most 5 minutes. As a non-limiting example, the RNase step is performed in at most 5 minutes, at most 6 minutes, at most 7 minutes, at most 8 minutes, at most 9 minutes, at most 10 minutes, at most 15 minutes, at most 20 minutes, at most 25 minutes, at most 30 minutes, at most 40 minutes, at most 50 minutes, at most 60 minutes, at most 70 minutes, at most 80 minutes, at most 90 minutes, or at most 100 minutes.
  • RNA Ribonucleic acid
  • RNA Ribonucleic acid
  • a base is attached to the G position, in general, adenine (A), cytosine (C), guanine (G), or uracil (U).
  • a phosphate group is attached to the 3' position of one ribose and the 5' position of the next.
  • RNA can be any known type of RNA.
  • target RNA comprises an RNA selected from Table 5.
  • the target RNA can be detected at single molecular level. In some embodiments of any of the aspects, less than 10 molecules of the target RNA can be detected using the methods, kits, and systems described herein. As a non-limiting example, at least 1 molecule, at least 2 molecules, at least 3 molecules, at least 4 molecules, at least 5 molecules, at least 6 molecules, at least 7 molecules, at least 8 molecules, at least 9 molecules, at least 10 molecules, at least 20 molecules, at least 30 molecules, at least 40 molecules, at least 50 molecules, at least 60 molecules, at least 70 molecules, at least 80 molecules, at least 90 molecules, at least 10 molecules, at least 10 2 molecules, at least 10 3 molecules, at least 10 4 molecules, or at least 10 5 molecules of the target RNA can be detected using the methods, kits, or systems described herein.
  • the target RNA can be a viral RNA.
  • a method of detecting an RNA virus in a sample from a subject comprising: (a) isolating viral RNA from the subject; and (a) performing the methods as described herein (e.g., reverse transcription, addition of an RNA:DNA duplex specific RNase, amplification, and detection).
  • RNA virus refers to a virus comprising an RNA genome.
  • the RNA virus is a double-stranded RNA virus, a positive- sense RNA virus, a negative-sense RNA virus, or a reverse transcribing virus (e.g., retrovirus).
  • the RNA virus is a Group III (i.e., double stranded RNA (dsRNA)) virus.
  • the Group III RNA virus belongs to a viral family selected from the group consisting of: Amalgaviridae, Bimaviridae, Chrysoviridae, Cystoviridae, Endomaviridae, Hypoviridae, Megabimaviridae, Partitiviridae, Picobimaviridae, Reoviridae (e.g., Rotavirus), Totiviridae, Quadriviridae.
  • the Group III RNA virus belongs to the Genus Botybimavirus. In some embodiments of any of the aspects, the Group III RNA virus is an unassigned species selected from the group consisting of: Botrytis porri RNA virus 1, Circulifer tenellus virus 1, Colletotrichum camelliae filamentous virus 1, Cucurbit yellows associated virus, Sclerotinia sclerotiorum debilitation-associated virus, and Spissistilus festinus virus 1.
  • the RNA virus is a Group IV (i.e., positive- sense single stranded (ssRNA)) virus.
  • the Group IV RNA virus belongs to a viral order selected from the group consisting of: Nidovirales, Picomavirales, and Tymovirales.
  • the Group IV RNA virus belongs to a viral family selected from the group consisting of: Arteriviridae, Coronaviridae (e.g., Coronavirus, SARS- CoV), Mesoniviridae, Roniviridae, Dicistroviridae, Iflaviridae, Mamaviridae, Picomaviridae (e.g., Poliovirus, Rhinovirus (a common cold virus), Hepatitis A virus), Secoviridae (e.g., sub Comovirinae), Alphaflexiviridae, Betaflexiviridae, Gammaflexiviridae, Tymoviridae, Alphatetraviridae, Alvemaviridae, Astroviridae, Bamaviridae, Benyviridae, Bromoviridae, Caliciviridae (e.g., Norwalk virus), Carmotetraviridae, Closteroviridae, Flaviviridae
  • Coronaviridae e
  • the Group IV RNA virus belongs to a viral genus selected from the group consisting of: Bacillariomavirus, Dicipivirus, Labymavirus, Sequiviridae, Blunervirus, Cilevirus, Higrevirus, Idaeovirus, Negevirus, Ourmiavirus, Polemovirus, Yalevirus, and Sobemovirus.
  • the Group IV RNA virus is an unassigned species selected from the group consisting of: Acyrthosiphon pisum virus, Bastrovirus, Blackford virus, Blueberry necrotic ring blotch virus, Cadicistrovirus, Chara australis virus, Extra small virus, Goji berry chlorosis virus, Hepelivirus, Jingmen tick virus, Le Blanc virus, Nedicistrovirus, Nesidiocoris tenuis virus 1, Niflavirus, Nylanderia ftilva virus 1, Orsay virus, Osedax japonicus RNA virus 1, Picalivirus, Plasmopara halstedii virus, Rosellinia necatrix fusarivirus 1, Santeuil virus, Secalivirus, Solenopsis invicta virus 3, Wuhan large pig roundworm virus.
  • the Group IV RNA virus is a satellite virus selected from the group consisting of: Family Sarthroviridae, Genus Albetovirus, Genus Aumaivirus, Genus Papanivirus, Genus Virtovirus, and Chronic bee paralysis virus.
  • the RNA virus is a Group V (i.e., negative- sense ssRNA) virus.
  • the Group V RNA virus belongs to a viral phylum or subphylum selected from the group consisting of: Negamaviricota, Haploviricotina, and Polyploviricotina.
  • the Group V RNA virus belongs to a viral class selected from the group consisting of: Chunqiuviricetes, Ellioviricetes, Insthoviricetes, Milneviricetes, Monjiviricetes, and Yunchangviricetes.
  • the Group V RNA virus belongs to a viral order selected from the group consisting of: Articulavirales, Bunyavirales, Goujianvirales, Jingchuvirales, Mononegavirales, Muvirales, and Serpentovirales.
  • the Group V RNA virus belongs to a viral family selected from the group consisting of: Amnoonviridae (e.g., Taastrup virus), Arenaviridae (e.g., Lassa virus), Aspiviridae, Bomaviridae (e.g., Boma disease virus), Chuviridae, Cruliviridae, Feraviridae, Filoviridae (e.g., Ebola virus, Marburg virus), Fimoviridae, Hantaviridae, Jonviridae, Mymonaviridae, Nairoviridae, Nyamiviridae, Orthomyxoviridae (e.g., Influenza viruses), Paramyxoviridae (e.g., Measles virus, Mumps virus, Nipah virus, Hendra virus, and NDV), Peribunyaviridae, Phasmaviridae, Phenuiviridae, Pneumovirid
  • the Group V RNA virus belongs to a viral genus selected from the group consisting of: Anphevirus, Arlivirus, Chengtivirus, Crustavirus, Tilapineviridae, Wastrivirus, and Deltavirus (e.g., Hepatitis D virus).
  • the RNA virus is a Group VI RNA virus, which comprise a virally encoded reverse transcriptase.
  • the Group VI RNA virus belongs to the viral order Ortervirales.
  • the Group VI RNA virus belongs to a viral family or subfamily selected from the group consisting of: Belpaoviridae, Caulimoviridae, Metaviridae, Pseudoviridae, Retroviridae (e.g., Retroviruses, e.g. HIV), Orthoretrovirinae, and Spumaretrovirinae.
  • the Group VI RNA virus belongs to a viral genus selected from the group consisting of: Alpharetrovirus (e.g., Avian leukosis virus; Rous sarcoma virus), Betaretrovirus (e.g., Mouse mammary tumour virus), Bovispumavirus (e.g., Bovine foamy virus), Deltaretrovirus (e.g., Bovine leukemia virus; Human T-lymphotropic virus), Epsilonretrovirus (e.g., Walleye dermal sarcoma virus), Equispumavirus (e.g., Equine foamy virus), Felispumavirus (e.g., Feline foamy virus), Gammaretrovirus (e.g., Murine leukemia virus; Feline leukemia virus), Lentivirus (e.g., Human immunodeficiency virus 1; Simian immunodeficiency virus; Feline immunodeficiency virus), Prosimiispumavirus (e.g.
  • Alpharetrovirus e.
  • the RNA virus is selected from influenza virus, human immunodeficiency virus (HIV), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
  • the RNA virus is influenza virus.
  • the RNA virus is immunodeficiency virus (HIV).
  • the RNA virus is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which causes coronavirus disease of 2019 (COVID19 or simply COVID).
  • the RNA virus is any known RNA virus.
  • the target nucleic acid comprises at least a portion of Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2, (see e.g., complete genome, SARS-CoV-2 Jan. 2020/NC_045512.2 Assembly (wuhCorl)).
  • the target nucleic acid comprises SEQ ID NO: 213 (Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2, N gene).
  • the target nucleic acid comprises SEQ ID NO: 214 (Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2, S gene).
  • the target nucleic acid comprises one of SEQ ID NOs: 213-214, or a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NO: 213-214 that maintains the same function or a codon-optimized version of SEQ ID NOs: 213-214.
  • the target nucleic acid comprises one of SEQ ID NOs: 213-214, or a nucleic acid sequence that is at least 95% identical to one of SEQ ID NOs: 213-214 that maintains the same function.
  • SEQ ID NO: 213 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, N nucleocapsid phosphoprotein, Gene ID: 43740575, 1260 bp ss-RNA, NC_045512 REGION: 28274-29533
  • SEQ ID NO: 214 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, S surface glycoprotein, Gene ID: 43740568, 3822 bp ss-RNA, NC_045512 REGION: 21563-25384
  • the viral RNA is an RNA produced by a virus with a DNA genome, i.e., a DNA virus.
  • a DNA virus is a Group I (dsDNA) virus, a Group II (ssDNA) virus, or a Group VII (dsDNA-RT) virus.
  • the RNA produced by a DNA virus comprises an RNA transcript of the DNA genome.
  • the target RNA is reverse transcribed to a complementary DNA (cDNA) that is thereafter amplified and detected, while the target RNA is degraded by an RNA:DNA duplex-specific RNase.
  • the methods described herein comprise a step (a) (i.e., the RT step) of contacting the sample with a reverse transcriptase and a first set of primers.
  • the reverse transcription step and amplification step(s) are performed simultaneously in the same reaction, which can also be referred to as a “one-pot reaction”.
  • RT refers to an RNA-dependent DNA polymerase used to generate complementary DNA (cDNA) from an RNA template.
  • the cDNA is single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA).
  • Reverse transcriptases are used by retroviruses to replicate their genomes, by retrotransposon mobile genetic elements to proliferate within the host genome, by eukaryotic cells to extend the telomeres at the ends of their linear chromosomes, and by some non-retroviruses such as the hepatitis B virus, a member of the Hepadnaviridae, which are dsDNA-RT viruses.
  • Retroviral RT has three sequential biochemical activities: RNA-dependent DNA polymerase activity, ribonuclease H (RNAse H), and/or DNA-dependent DNA polymerase activity. Collectively, these activities enable the enzyme to convert single-stranded RNA into double- stranded cDNA.
  • RNAse H ribonuclease H
  • DNA-dependent DNA polymerase activity Collectively, these activities enable the enzyme to convert single-stranded RNA into double- stranded cDNA.
  • a retroviral RT is engineered to reduce or eliminate its RNaseH activity, which can result in a single stranded cDNA.
  • the reverse transcriptase can be any enzyme that can produce cDNA from an RNA transcript.
  • the reverse transcriptase comprises a HIV-1 reverse transcriptase from human immunodeficiency virus type 1.
  • the reverse transcriptase comprises M-MuLV reverse transcriptase from the Moloney murine leukemia virus (referred to as M-MuLV, M-MLV, or MMLV).
  • the reverse transcriptase comprises AMV reverse transcriptase from the avian myeloblastosis virus (AVM).
  • the reverse transcriptase comprises telomerase reverse transcriptase that maintains the telomeres of eukaryotic chromosomes. In some embodiments of any of the aspects, the reverse transcriptase is selected from those expressed by any Group VI or Group VII virus. In some embodiments of any of the aspects, the reverse transcriptase is a naturally occurring RT selected from the group consisting of: an M-MLV RT, an AMV RT, a retrotransposon RT, a telomerase reverse transcriptase, and an HIV-1 reverse transcriptase.
  • the reverse transcriptase is an engineered or recombinant version of an M-MuLV RT, AMV RT, or another naturally occurring RT as described herein.
  • the reverse transcriptase is Proto Script® II Reverse Transcriptase, which is also referred to herein as ProtoScript® II RT or Protoscriptase II.
  • ProtoScript® II RT is a recombinant Moloney Murine Leukemia Virus (M-MuLV) reverse transcriptase, e.g., a fusion of the Escherichia coli trpE gene with the central region of the M-MuLV pol gene.
  • M-MuLV Moloney Murine Leukemia Virus
  • the reverse transcriptase is selected from the group consisting of: Maxima® RT (e.g., Maxima H Minus® RT), Omniscript® RT, PowerScript® RT, Sensiscript® RT (SES), Superscript® II (SSII or SS2), Superscript® III (SSIII or SS3), Superscript® IV (SSIV), Accuscript® RT (ACC), a recombinant HIV RT, imProm-II® (IP2) RT, M- MLV RT (MML), Protoscript® RT (PRS), Smart MMLV (SML) RT, ThermoScript® (TSR) RT (see e.g., Levesque-Sergerie et al., BMC Molecular Biology volume 8, Article number: 93 (2007); Okello et al., PLoS One.
  • Maxima® RT e.g., Maxima H Minus® RT
  • Omniscript® RT e.g
  • RTs derived from MMLV include PowerScript®, ACC, MML, SML, SS2, and SS3.
  • Non limiting examples of RTs derived from AMV include PRS and TSR.
  • Non limiting examples of RTs derived proprietary sources include IP2, SES, Omniscript®.
  • reverse transcriptase exhibits increased thermostability (e.g., up to 48°C) compared to the wild type RT.
  • the reverse transcriptase is Superscript® IV. In some embodiments of any of the aspects, the reverse transcriptase is Maxima H Minus® RT. In some embodiments of any of the aspects, the reverse transcriptase is Superscript® III. In some embodiments of any of the aspects, the reverse transcriptase is MuLV. In some embodiments of any of the aspects, the reverse transcriptase is not Protoscript® II.
  • the reverse transcriptase exhibits reduced RNase H activity compared to the wild-type RT.
  • RT enzymes are often engineered with RNAse H minus point mutations to render them non-degrading to RNA. Accordingly, it is unexpected that including a separate RNaseH would increase the yield and decrease the time of the methods described herein.
  • one unit (“U”) of reverse transcriptase (e.g., ProtoScript® II RT) is defined as is defined as the amount of enzyme that will incorporate 1 nmol of dTTP into acid- insoluble material in a total reaction volume of 50 m ⁇ in 10 minutes at 37°C using poly(rA)*oligo(dT)
  • U reverse transcriptase
  • the reverse transcriptase is provided at a concentration of at least 1 U/pL, at least 2 U/pL, at least 3 U/pL, at least 4 U/pL, at least 5 U/pL, at least 6 U/pL, at least 7 U/pL, at least 8 U/pL, at least 9 U/pL, at least 10 U/pL, at least 20 U/pL, at least 30 U/pL, at least 40 U/pL, at least 50 U/pL, at least 60 U/pL, at least 70 U/pL, at least 80 U/pL, at least 90 U/pL, at least 100 U/pL, at least 110 U/pL, at least 120 U/pL, at least 130 U/pL, at least 140 U/pL, at least 150 U/pL, at least 160 U/pL, at least 170 U/pL, at least 180 U/pL, at least 190 U/pL, at least 200 U/p
  • the reverse transcriptase is provided at a concentration of 20 U/pL. In some embodiments of any of the aspects, the reverse transcriptase is provided at a concentration of 200 U/pL.
  • the sample is contacted with a first set of primers.
  • the first set of primers comprises primers that bind to target RNA and non-target RNA in the sample, i.e., “general” primers.
  • the first set of primers comprises random hexamers, i.e., a mixture of oligonucleotides representing all possible hexamer sequences.
  • the first set of primers comprises oligo(dT) primer, which bind to the polyA tails of mRNAs or viral transcripts.
  • the first set of primers is specific to the target RNA.
  • the first set of primers comprises the reverse primer of the second set of primers (e.g., used in the amplification step).
  • the first set of primers can comprise the second set of primers, or the second set of primers can comprise the first set of primers.
  • the RT step comprises one round of polymerization, wherein the target RNA is reverse-transcribed into a single- stranded cDNA.
  • the reverse transcription step comprises contacting the sample with a reverse transcriptase, a first set of primers, and at least one of the following: a reaction buffer, water, magnesium acetate (or another magnesium compound such as magnesium chloride) dNTPs, DTT, and/or an RNase inhibitor.
  • the reaction buffer maintains the reaction at specific optimal pH (e.g., 8.1) and can include such components as Tris(pH8.1), KC1, MgC12, and other buffers or salts.
  • Magnesium ions (Mg2+) can function as a cofactor for polymerases, increasing their activity.
  • Deoxynucleoside triphosphate are free nucleoside triphosphates comprising deoxyribose as the sugar (e.g., dATP, dGTP, dCTP, and dTTP) that are used in the polymerization of the cDNA.
  • Dithiothreitol is a redox reagent used to stabilize proteins which possess free sulfhydryl groups (e.g., RT).
  • the RNase inhibitor specifically inhibits RNases A, B and C, which specifically cleave ssRNA or dsRNA.
  • RNase A and RNase B are an endoribomiclease that specifically degrades single-stranded RNA at C and U residues.
  • RNase C recognizes dsRNA and cleaves it at specific targeted locations to transform them into mature RNAs.
  • the RNase inhibitor does not specifically inhibit RNaseH.
  • the RT reaction mixture does not comprise an RNaseH inhibitor.
  • the RT step (i.e., step (a)) is performed between 12°C and 45°C.
  • the RT step is performed at at least 12°C, at least 13°C, at least 14°C, at least 15°C, at least 16°C, at least 17°C, at least 18°C, at least 19°C, at least
  • the RT step is performed at at most 12°C, at most 13°C, at most 14°C, at most 15°C, at most 16°C, at most 17°C, at most 18°C, at most 19°C, at most 20°C, at most 21°C, at most 22°C, at most 23°C, at most 24°C, at most 25°C, at most 26°C, at most 27°C, at most 28°C, at most 29°C, at most 30°C, at most 31°C, at most 32°C, at most 33°C, at most 34°C, at most 35°C, at most 36°C, at most 37°C, at most 38°C, at most 39°C, at most 40°C, at most 41°C, at most 42°C, at most 43°C, at most 44°C, at most 45°C.
  • the RT step is performed at room temperature (e.g., 20°C-22°C). In some embodiments of any of the aspects, the RT step is performed at body temperature (e.g., 37°C). In some embodiments of any of the aspects, the RT step is performed on a heat block set to approximately 42°C.
  • the RT step is performed in at most 1 minute. In some embodiments of any of the aspects, the RT step is performed in at most 5 minutes. In some embodiments of any of the aspects, the RT step is performed in at most 20 minutes. As a non-limiting example, the RT step is performed in at most 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, at most 6 minutes, at most 7 minutes, at most 8 minutes, at most 9 minutes, at most 10 minutes, at most 15 minutes, at most 20 minutes, at most 25 minutes, at most 30 minutes, at most 40 minutes, at most 50 minutes, at most 60 minutes, at most 70 minutes, at most 80 minutes, at most 90 minutes, or at most 100 minutes.
  • RNA molecules resulting from the RT step is amplified to detectable levels, and the target RNA is degraded by an RNA:DNA duplex-specific RNase.
  • the target RNA is present a low starting amount, such that amplification is needed in order to detect the RNA.
  • amplification is defined as the production of additional copies of a nucleic acid sequence, i.e., for example, amplicons or amplification products. Methods of amplifying nucleic acid sequences are well known in the art.
  • the methods described herein comprise an amplification step (e.g., step (c)) of contacting the sample with a DNA polymerase and a second set of primers.
  • the amplification step comprises contacting the cDNA with a DNA polymerase and a second set of primers.
  • a set of primers comprises at least 2 primers and comprises a forward primer and reverse primer that amplify a target of 50 base pairs (bp) - 50,000 bp, unless indicated otherwise.
  • the amplification step permits an amplification reaction, such as polymerase chain reaction, as described further herein. In some embodiments of any of the aspects, the amplification step permits an isothermal amplification reaction.
  • isothermal amplification refers to amplification that occurs at a single temperature. Isothermal amplification is an amplification process that is performed at a single temperature or where the major aspect of the amplification process is performed at a single temperature. Generally, isothermal amplification relies on the ability of a polymerase to copy the template strand being amplified to form a bound duplex.
  • the product of the reaction is heated to separate the two strands such that a further primer can bind to the template repeating the process.
  • the isothermal amplification relies on a strand displacing polymerase in order to separate/displace the two strands of the duplex and re-copy the template.
  • the key feature that differentiates the isothermal amplification is the method that is applied in order to initiate the reiterative process. Broadly isothermal amplification can be subdivided into those methods that rely on the replacement of a primer to initiate the reiterative template copying and those that rely on continued re-use or de novo synthesis of a single primer molecule.
  • Isothermal amplification permits rapid and specific amplification of DNA at a constant temperature.
  • isothermal amplification is comprised of (i) sequence -specific hybridization of primers to specific genes or sequences within a nucleic acid sample or library, (ii) subsequent amplification involving multiple rounds of primer annealing, elongation, and strand displacement (as a non-limiting example, using a combination of recombinase, single-stranded binding proteins, and DNA polymerase), and (iii) detection of the product.
  • the isothermal amplification produce can be detected through such methods as sequencing to confirm the identity of the amplified product or general assays such as turbidity.
  • turbidity results from pyrophosphate byproducts produced during the reaction; these byproducts form a white precipitate that increases the turbidity of the solution.
  • the primers used in isothermal amplification are oligonucleotides of sufficient length and appropriate sequence to provide initiation of polymerization, i.e. each primer is specifically designed to be complementary to a strand of the template (e.g., target cDNA) to be amplified.
  • PCR polymerase chain reaction
  • isothermal amplification is carried out at one temperature, and does not require a thermal cycler or thermostable enzymes.
  • Non-limiting examples of isothermal amplification include: Recombinase Polymerase Amplification (RPA), Loop Mediated Isothermal Amplification (LAMP), Helicase-dependent isothermal DNA amplification (HD A), Rolling Circle Amplification (RCA), Nucleic acid sequence- based amplification (NASBA), strand displacement amplification (SDA), nicking enzyme amplification reaction (NEAR), and polymerase Spiral Reaction (PSR).
  • RPA Recombinase Polymerase Amplification
  • LAMP Loop Mediated Isothermal Amplification
  • HD A Helicase-dependent isothermal DNA amplification
  • RCA Rolling Circle Amplification
  • NASBA Nucleic acid sequence- based amplification
  • SDA strand displacement amplification
  • NEAR nicking enzyme amplification reaction
  • PSR polymerase Spiral Reaction
  • the isothermal amplification reaction of step (c) is Recombinase Polymerase Amplification (RPA).
  • RPA is a low temperature DNA and RNA amplification technique.
  • the RPA process employs three core enzymes - a recombinase, a single- stranded DNA-binding protein (SSB) and strand-displacing polymerase.
  • Recombinases are capable of pairing oligonucleotide primers with homologous sequence in duplex DNA.
  • SSB bind to displaced strands of DNA and prevent the primers from being displaced.
  • the strand displacing polymerase begins DNA synthesis where the primer has bound to the target DNA.
  • the single-stranded DNA-binding protein is a gp32 SSB protein.
  • the recombinase is a uvsX recombinase. See e.g., US Patent 7,666,598, the content of which is incorporated herein by reference in its entirety.
  • RPA can also be referred to as Recombinase Aided Amplification (RAA).
  • the amplification step further comprises contacting the sample with a recombinase and single -stranded DNA binding protein.
  • the amplification step comprises contacting the sample (or cDNA) with a DNA polymerase, a set of primers, a recombinase, and single-stranded DNA binding protein.
  • the isothermal amplification reaction of step (c) is Loop Mediated Isothermal Amplification (LAMP).
  • LAMP is a single tube technique for the amplification of DNA; LAMP uses 4-6 primers, which form loop structures to facilitate subsequent rounds of amplification.
  • the amplification step comprises contacting the sample (e.g., cDNA) with a DNA polymerase and a set of primers, wherein the set of primers comprises 4, 5, or 6 loop-forming primers.
  • the isothermal amplification reaction of step (c) is Helicase-dependent isothermal DNA amplification (HD A).
  • HDA uses the double-stranded DNA unwinding activity of a helicase to separate strands for in vitro DNA amplification at constant temperature.
  • the helicase is a thermostable helicase, which can improve the specificity and performance of HDA; as such, the isothermal amplification reaction(s) can be thermophilic helicase-dependent amplification (tHDA).
  • the helicase is the thermostable UvrD helicase (Tte-UvrD), which is stable and active from 45 to 65 °C.
  • the amplification step comprises contacting the sample (e.g., cDNA) with a DNA polymerase, a set of primers, and a helicase, wherein the helicase is optionally a thermostable helicase.
  • the isothermal amplification reaction of step (c) is Rolling Circle Amplification (RCA).
  • RCA starts from a circular DNA template and a short DNA or RNA primer to form a long single stranded molecule.
  • the amplification step comprises contacting the sample (e.g., a circular cDNA) with a DNA polymerase and a set of primers, wherein the set of primers comprises a single primer.
  • the isothermal amplification reaction of step (c) is Nucleic acid sequence-based amplification (NASBA), which is also known as transcription mediated amplification (TMA).
  • NASBA is an isothermal technique predominantly used for the amplification of RNA through the cyclic formation of complimentary DNA and destruction of original RNA sequence (e.g., using RNase H).
  • the NASBA reaction mixture contains three enzymes — reverse transcriptase (RT), RNase H, and T7 RNA polymerase — and two primers.
  • RT reverse transcriptase
  • RNase H RNase H
  • T7 RNA polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5' 3' direction.
  • Primer 1 contains a 3' terminal sequence that is complementary to a sequence on the target nucleic acid and a 5' terminal (+)sense sequence of a promoter that is recognized by the T7 RNA polymerase.
  • Primer 2 contains a sequence complementary to the PI -primed DNA strand.
  • the NASBA enzymes and primers operate in concert to amplify a specific nucleic acid sequence exponentially. NASBA results in the amplification of the target RNA to cDNA to RNA to cDNA, etc., with alternating reverse transcription (e.g., RNA to DNA) and transcription steps (e.g., DNA to RNA), and the RNA being degraded after each transcription.
  • the amplification step comprises contacting the sample (e.g., a cDNA) with an RNA polymerase, a reverse transcriptase, RNaseH, and a set of primers, wherein the set of primers comprise a 5’ sequence that is recognized by the RNA polymerase.
  • the isothermal amplification reaction of the amplification step is Strand Displacement Amplification (SDA).
  • SDA is an isothermal, in vitro nucleic acid amplification technique based upon the ability of the restriction endonuclease Hindi to nick the unmodified strand of a hemiphosphorothioate form of its recognition site, and the ability of exonuclease deficient klenow (exo-klenow) DNA polymerase to extend the 3 '-end at the nick and displace the downstream DNA strand.
  • Exponential amplification results from coupling sense and antisense reactions in which strands displaced from a sense reaction serve as target for an antisense reaction and vice versa.
  • the amplification step comprises contacting the sample (e.g., cDNA) with a DNA polymerase (e.g., exo-klenow), a set of primers, and a restriction endonuclease (e.g., HincII).
  • a DNA polymerase e.g., exo-klenow
  • a set of primers e.g., primers
  • a restriction endonuclease e.g., HincII
  • the isothermal amplification reaction(s) is nicking enzyme amplification reaction (NEAR), which is a similar approach to SDA.
  • NEAR nicking enzyme amplification reaction
  • DNA is amplified at a constant temperature (e.g., 55 °C to 59 °C) using a polymerase and nicking enzyme.
  • the nicking site is regenerated with each polymerase displacement step, resulting in exponential amplification.
  • the amplification step(s) comprises contacting the sample with a DNA polymerase (e.g., exo-klenow), a set of primers, and a nicking enzyme (e.g., N.BstNBI).
  • the isothermal amplification reaction(s) is Polymerase Spiral Reaction (PSR).
  • PSR Polymerase Spiral Reaction
  • the PSR method employs a DNA polymerase (e.g., Bst) and a pair of primers.
  • the forward and reverse primer sequences are reverse to each other at their 5’ end, whereas their 3’ end sequences are complementary to their respective target nucleic acid sequences.
  • the PSR method is performed at a constant temperature 61 °C-65 °C, yielding a complicated spiral structure.
  • the amplification step(s) comprises contacting the sample with a DNA polymerase (e.g., exo-klenow) and a set of primers that are reverse to each other at their 5’ end.
  • a DNA polymerase e.g., exo-klenow
  • the isothermal amplification reaction(s) is polymerase cross-linking spiral reaction (PCLSR).
  • PCLSR uses three primers (e.g., two outer-spiral primers and a cross-linking primer) to produce three independent prerequisite spiral products, which can be cross-linked into a final spiral amplification product.
  • the amplification step(s) comprises contacting the sample with a DNA polymerase and a set of primers (e.g., two outer-spiral primers and a cross-linking primer).
  • the DNA polymerase used in the amplification step is a strand-displacing polymerase.
  • the term strand displacement describes the ability to displace downstream DNA encountered during synthesis.
  • at least one (e.g. 1, 2, 3, or 4) strand-displacing DNA polymerase is selected from the group consisting of: Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase.
  • the amplification step comprising contacting the sample (e.g., cDNA) with the strand-displacing DNA polymerases Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase.
  • sample e.g., cDNA
  • strand-displacing DNA polymerases Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase.
  • the DNA polymerase is provided (i.e., added to the reaction mixture) at a sufficient concentration to promote polymerization, e.g., 0.1 U/pL to 100 U/pL.
  • a sufficient concentration to promote polymerization e.g., 0.1 U/pL to 100 U/pL.
  • one unit (“U”) of DNA polymerase is defined as the amount of enzyme that will incorporate 10 nmol of dNTP into acid insoluble material in 30 minutes at 37°C.
  • the sample is contacted with a second set of primers (i.e., after the first set of RT primers).
  • the second set of primers is specific to the target RNA.
  • the second set of primers is specific (i.e., binds specifically through complementarity) to cDNA, in other words, the DNA produced in the RT step that is complementary to the target RNA.
  • the second set of primers can be specific to any region of the target RNA.
  • SEQ ID NOs: 3-70 are non-limiting examples of nucleic acids (e.g., primers, probes, etc.) that are specific for SARS-CoV-2.
  • SEQ ID NOs: 3-14, 21- 26, 70-71, 79-102, 105-138, 190, and 192 are non-limiting examples of primers that are specific for SARS-CoV-2 and can be included in any of the primer sets described herein.
  • a set of primers as described herein is selected from Table 18 or 19.
  • Table 6 Exemplary nucleic acids for use in detecting SARS-CoV-2
  • a method, kit, or system as described herein comprises a nucleic acid sequence comprising at least one of SEQ ID NOs: 3-210 or a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NOs: 3-210 that maintains the same function (e.g., primers for CoV- 2).
  • a method, kit, or system as described herein comprises a nucleic acid sequence comprising at least one of SEQ ID NOs: 3-210 or a nucleic acid sequence that is at least 95% identical to one of SEQ ID NOs: 3-210 that maintains the same function.
  • the set of amplification primers is selected from Table 6.
  • the set of amplification primers comprises at least one (e.g., 1, 2, 3, 4, 5, or more) primer selected from SEQ ID NOs: 3-14, 21-26, 38-53, 70-71, 79-102, 105-138, 190, 192 or a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NOs: 3-14, 21-26, 38-53, 70-71, 79-102, 105-138, 190, 192 that maintains the same function (e.g., primers for CoV-2).
  • the set of amplification primers comprises at least one (e.g., 1, 2, 3, 4, 5, or more) primer selected from SEQ ID NOs: 3-14, 21-26, 38-53, 70-71, 79-102, 105-138, 190, 192 or a nucleic acid sequence that is at least 95% identical to one of SEQ ID NOs: 3-14, 21-26, 38- 53, 70-71, 79-102, 105-138, 190, 192 that maintains the same function.
  • Table 18 Exemplary Primer Sets (each number corresponds to a SEQ ID NO, see e.g., Table 6); “FW” indicates a forward primer, “RV” indicates a reverse primer.
  • Table 19 Exemplary Primer Sets (each number corresponds to a SEQ ID NO, see e.g., Table 6); “FW” indicates a forward primer, “RV” indicates a reverse primer.
  • the RNA target is SARS-CoV-2 N-gene.
  • the amplification primer set comprises JQ217 (SEQ ID NO: 6) and JQ223 (SEQ ID NO: 12).
  • the amplification product comprises:
  • the probe is JQ241 (SEQ ID NO: 30).
  • the RNA target is SARS-CoV-2 S-gene.
  • the amplification primer set comprises CCMS055 (SEQ ID NO: 119) and CCMS067 (SEQ ID NO: 131).
  • the amplification product comprises:
  • the probe is CCMS069 (SEQ ID NO: 170).
  • a primer comprises a detectable marker as described herein (e.g., FAM).
  • SEQ ID NOs: 9-14 are unlabeled primers (i.e., do not comprise a detectable label).
  • SEQ ID NOs: 9-14 further comprise a detectable label as described herein.
  • SEQ ID NOs: 21-26 are labeled primers (i.e., comprise a detectable label, e.g., FAM).
  • SEQ ID NOs: 9 and 21 can be used interchangeably.
  • SEQ ID NOs: 10 and 22 can be used interchangeably.
  • SEQ ID NOs: 11 and 23 can be used interchangeably.
  • SEQ ID NOs: 12 and 24 can be used interchangeably.
  • SEQ ID NOs: 13 and 25 can be used interchangeably.
  • SEQ ID NOs: 14 and 26 can be used interchangeably.
  • one of SEQ ID NOs: 105-115, 133-138 or a nucleic acid comprising a sequence that is at least 95% identical to one of SEQ ID NOs: 105-115 or 133-138 that maintains the same function can be used interchangeably with SEQ ID NO: 6.
  • a set of amplification primers comprises: SEQ ID NOs: 6 and 25 (e.g., JQ217 and JQ236); SEQ ID NOs: 105 and 25 (e.g., CCMS041 and JQ236); SEQ ID NOs: 111 and 25 (e.g., CCMS047 and JQ236); or SEQ ID NOs: 115 and 25 (e.g., CCMS051 and JQ236).
  • the sample is contacted with a DNA polymerase, a second set of primers, and at least one of the following: reaction buffer (e.g., hydration buffer), water, and/or magnesium acetate.
  • reaction buffer e.g., hydration buffer
  • the sample is contacted with a DNA polymerase, a second set of primers, a recombinase, single -stranded DNA binding protein, and at least one of the following: reaction buffer (e.g., hydration buffer), water, and/or magnesium acetate.
  • the recombinase and/or ssDNA binding protein are provided in an “RPA pellet” that is dissolved with rehydration buffer and/or water.
  • the isothermal amplification step (i.e., the amplification step) is performed is 12°C and 45°C.
  • the amplification step is performed at at least 12°C, at least 13°C, at least 14°C, at least 15°C, at least 16°C, at least 17°C, at least 18°C, at least 19°C, at least 20°C, at least 21°C, at least 22°C, at least 23°C, at least 24°C, at least 25°C, at least 26°C, at least 27°C, at least 28°C, at least 29°C, at least 30°C, at least 31°C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C, at least 38°C, at least 39°C, at least 40°C, at least 41°C, at least 42°C, at least 43°C, at least 44
  • the amplification step is performed at at most 12°C, at most 13°C, at most 14°C, at most 15°C, at most 16°C, at most 17°C, at most 18°C, at most 19°C, at most 20°C, at most 21°C, at most 22°C, at most 23°C, at most 24°C, at most 25°C, at most 26°C, at most 27°C, at most 28°C, at most 29°C, at most 30°C, at most 31°C, at most 32°C, at most 33°C, at most 34°C, at most 35°C, at most 36°C, at most 37°C, at most 38°C, at most 39°C, at most 40°C, at most 41°C, at most 42°C, at most 43°C, at most 44°C, at most 45°C.
  • the amplification step is performed at room temperature (e.g., 20°C-22°C). In some embodiments of any of the aspects, the amplification step is performed at body temperature (e.g., 37°C). In some embodiments of any of the aspects, the amplification step is performed on a heat block set to approximately 42°C.
  • the amplification step is performed in at most 10 minutes. In some embodiments of any of the aspects, the amplification step is performed in at most 25 minutes. As a non-limiting example, the amplification step is performed in at most 5 minutes, at most 6 minutes, at most 7 minutes, at most 8 minutes, at most 9 minutes, at most 10 minutes, at most 15 minutes, at most 20 minutes, at most 25 minutes, at most 30 minutes, at most 40 minutes, at most 50 minutes, at most 60 minutes, at most 70 minutes, at most 80 minutes, at most 90 minutes, or at most 100 minutes.
  • sample or “test sample” as used herein denotes a sample taken or isolated from a biological organism, e.g., a subject in need of testing.
  • test sample denotes a sample taken or isolated from a biological organism, e.g., a subject in need of testing.
  • the technology described herein encompasses several examples of a biological sample, including but not limited to a sputum sample, a pharyngeal sample, or a nasal sample.
  • the biological sample is cells, or tissue, or peripheral blood, or bodily fluid.
  • Exemplary biological samples include, but are not limited to, a biopsy, a tumor sample, biofluid sample; blood; serum; plasma; urine; semen; mucus; tissue biopsy; organ biopsy; synovial fluid; bile fluid; cerebrospinal fluid; mucosal secretion; effusion; sweat; saliva; and/or tissue sample etc.
  • the term also includes a mixture of the above-mentioned samples.
  • the term “test sample” also includes untreated or pretreated (or pre-processed) biological samples.
  • a test sample can comprise cells from a subject.
  • the sample is contacted with a transport media, such a viral transport media (VTM).
  • VTM viral transport media
  • transport media preserves the target RNA between the time of sample collection and detection of the target RNA.
  • suitable viral transport media are designed to provide an isotonic solution containing protective protein, antibiotics to control microbial contamination, and one or more buffers to control the pH. Isotonicity, however, is not an absolute requirement; some highly successful transport media contain hypertonic solutions of sucrose.
  • Liquid transport media are used primarily for transporting swabs or materials released into the medium from a collection swab. Liquid media may be added to other specimens when inactivation of the viral agent is likely and when the resultant dilution is acceptable.
  • a suitable VTM for use in collecting throat and nasal swabs from human patients is prepared as follows: (1) add lOg veal infusion broth and 2g bovine albumin fraction V to sterile distilled water (to 400 ml); (2) add 0.8 ml gentamicin sulfate solution (50 mg/ml) and 3.2 ml amphotericin B (250 pg/ml); and (3) sterilize by filtration.
  • Additional non-limiting examples of viral transport media include COPAN Universal Transport Medium; Eagle Minimum Essential Medium (E-MEM); Transport medium 199; and PBS-Glycerol transport medium see e.g., Johnson, Transport of Viral Specimens, CLINICAL MICROBIOLOGY REVIEWS, Apr.
  • viral transport media does not inhibit the RT-RPA methods as described herein (see e.g., Fig. 6).
  • RNA isolation prior to the RT step can be performed using standard RNA extraction methods or kits.
  • standard RNA extraction methods include: (1) organic extraction, such as phenol-Guanidine Isothiocyanate (GITC)-based solutions (e.g., TRIZOL and TRI reagent); (2) silica-membrane based spin column technology (e.g., RNeasy and its variants); (3) paramagnetic particle technology (e.g., DYNABEADS mRNA DIRECT MICRO); (4) density gradient centrifugation using cesium chloride or cesium trifluoroacetate; (5) lithium chloride and urea isolation; (6) oligo(dt) -cellulose column chromatography; and (7) non-column poly (A)+ purification/isolation.
  • organic extraction such as phenol-Guanidine Isothiocyanate (GITC)-based solutions (e.g., TRIZOL and TRI reagent)
  • RNA isolation method or kit prior to the RT step, is not used.
  • the sample prior to the RT step the sample is heated at 94°C for 5 minutes.
  • the sample is at heated at at least 90°C, at least 91°C, at least 92°C, at least 93°C, at least 94°C, at least 95°C, at least 96°C, at least 97°C, at least 98°C, or at least 99°C for 5 minutes.
  • the sample is at heated at 94°C for at least 1 minute, at least 2 minutes, at least 3 minutes, at least 4 minutes, at least 5 minutes, at least 6 minutes, at least 7 minutes, at least 8 minutes, at least 9 minutes, or at least 10 minutes.
  • This heating step can be performed by a heat block or another implement capable of heating to 94°C for 5 minutes.
  • the sample prior to the RT step, is contacted with a detergent.
  • detergents include: sodium tri-isopropyl naphthalene sulfonate; SDS; Triton; NP-40; TWEEN; and the like.
  • the detergent can function to lyse cells and/or viral particles to expose the target RNA.
  • Nucleic acid e.g., deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), molecules can be isolated from a particular biological sample using any of a number of procedures, which are known in the art, the particular isolation procedure chosen being appropriate for the particular biological sample. For example, freeze-thaw and alkaline lysis procedures can be useful for obtaining nucleic acid molecules from solid materials (Roiff, A et al. PCR: Clinical Diagnostics and Research, Springer (1994)).
  • the test sample can be an untreated test sample.
  • untreated test sample refers to a test sample that has not had any prior sample pre-treatment except for dilution and/or suspension in a solution.
  • Exemplary methods for treating a test sample include, but are not limited to, centrifugation, fdtration, sonication, homogenization, heating, freezing and thawing, and combinations thereof.
  • the test sample can be a frozen test sample. The frozen sample can be thawed before employing methods, assays and systems described herein.
  • a frozen sample can be centrifuged before being subjected to methods, assays and systems described herein.
  • the test sample is a clarified test sample, for example, by centrifugation and collection of a supernatant comprising the clarified test sample.
  • a test sample can be a pre-processed test sample, for example, supernatant or filtrate resulting from a treatment selected from the group consisting of centrifugation, homogenization, sonication, filtration, thawing, purification, and any combinations thereof.
  • the test sample can be treated with a chemical and/or biological reagent.
  • Chemical and/or biological reagents can be employed, for example, to protect and/or maintain the stability of the sample, including biomolecules (e.g., nucleic acid and protein) therein, during processing.
  • biomolecules e.g., nucleic acid and protein
  • the skilled artisan is well aware of methods and processes appropriate for pre processing of biological samples required for detection of a nucleic acid as described herein.
  • Extraction of nucleic acids from a sample prior to detection can be a limiting factor.
  • Inventors have discovered inter alia extraction free lysis methods that can rapidly lyse and inactivate viruses for use in diagnostic assays. This permits a practitioner to obtain sufficient nucleic acid material from a sample for detection without the need to extract the nucleic acid from the sample.
  • the sample can be subjected to a lysis step, e.g., to obtain the target nucleic acid.
  • lysis step comprises heating the sample to a high temperature to lyse the viral particles and to inactivate the virus.
  • viruses lyse at temperature much lower than the temperature needed to inactivate the virus.
  • the temperature needed to inactivate the virus can degrade a nucleic acid, e.g., RNA needed for the detection step.
  • the target nucleic acid e.g., RNA might be degraded during sample preparation.
  • adding a RNase inhibitor to the sample prior to heating can reduce or inhibit RNA degradation during heating. Accordingly, in some embodiments of any of the aspects, a RNase inhibitor can be added to the sample prior to lysis by heating.
  • RNase inhibitors include, but are not limited to, mammalian ribonuclease inhibitor proteins such as porcine ribonuclease inhibitor and human ribonuclease inhibitor (e.g., human placenta ribonuclease inhibitor and recombinant human ribonuclease inhibitor), vanadyl ribonucleoside complexes, proteinase K, phenylglyoxal, p-hydroxyphenylglyoxal, polyamines, spermidine, 9-aminoacridine, iodoacetate, bentonite, poly[2'-0-(2,4-dinitrophenyl)]poly(adenyhlic acid), zinc sulfate, bromopyruvic acid, formamide, dimethylformamide, copper, zinc, aurintricarboxylic acid (ATA) and salts thereof such as triammonium aurintricarboxylate (a
  • the RNase inhibitor is a ribonuclease inhibitor protein, such as a recombinant RNase inhibitor, e.g., a recombinant mammalian RNase inhibitor.
  • the RNase inhibitor is murine RNase inhibitor or RNasin ® Plus.
  • the RNase inhibitor is a thermostable RNase inhibitor, e.g., RNasin ® Plus.
  • the RNase inhibitor is a ribonuclease inhibitor protein and is added to a final concentration of at least 0.01 U/pL, at least 0.02 U/pL, at least 0.03 U/pL, at least 0.04 U/pL, at least 0.05 U/pL, at least 0.06 U/pL, at least 0.07 U/pL, at least 0.08 U/pL, at least 0.09 U/pL, at least 0.1 U/pL, at least 0.2 U/pL, at least 0.3 U/pL, at least 0.4 U/pL, at least 0.5 U/pL, at least 0.6 U/pL, at least 0.7 U/pL, at least 0.8 U/pL, at least 0.9 U/pL, at least 1.0 U/pL, at least 1.1 U/pL, at least 1.2 U/pL, at least 1.3 U/pL, at least 1.4 U/pL, at least 1.5 U/pL
  • the R ase inhibitor is added to a final concentration of about 0.01 U/pL. about 0.02 U/pL. about 0.03 U/pL. about 0.04 U/pL. about 0.05 U/pL. about 0.06 U/pL. about 0.07 U/pL. about 0.08 U/pL. about 0.09 U/pL. about 0.1 U/pL. about 0.2 U/pL. about 0.3 U/pL. about 0.4 U/pL. about 0.5 U/pL. about 0.6 U/pL. about 0.7 U/pL. about
  • a reducing agent can be added to the sample prior to lysis step. Addition of the reducing agent is particularly advantageous when the sample is saliva sample.
  • Exemplary reducing agents include, but are not limited to, tris-(2-carboxyethyl)-phosphine (TCEP), cysteine, dithionite, dithioerythritol, dithiothreitol (DTT), dysteine, 2- mercaptoethanol, mercaptoethylene, bisulfite, sodium metabisulfite, pyrosulfite, pentaerythritol, thioglycolic acid, urea, uric acid, vitamin C, vitamin E, superoxide dismutases, and analogs, derivatives and salts thereof.
  • the reducing agent is TCEP.
  • the reducing agent can be added to any desired amount.
  • the reducing agent can be added to a final concentration of at least 0.1 mM, at least 0.2 mM, at least 0.3 mM, at least 0.4 mM, at least 0.5 mM, at least 0.6 mM, at least 0.7 mM, at least 0.8 mM, at least 0.9 mM, at least 1 mM, at least 2 mM, at least 3 mM, at least 4 mM, at least 5 mM, at least 6 mM, at least 7 mM, at least 8 mM, at least 10 mM, at least 11 mM, at least 12 mM, at least 13 mM, at least 14 mM, at least 15, mM, at least 16 mM, at least 17 mM, at least 18 mM, at least 19 mM, at least 20 mM, at least 25 mM, at least 30 mM, at least 35
  • the reducing agent is added to a final concentration of about 0.1 mM, about 0.2 mM, about 0.3 mM, about 0.4 mM, about 0.5 mM, about 0.6 mM, about 0.7 mM, about 0.8 mM, about 0.9 mM, about 1 mM, about 2 mM, about 3 mM, about 4 mM, about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 10 mM, about 11 mM, about 12 mM, about 13 mM, about 14 mM, about 15, mM, about 16 mM, about 17 mM, about 18 mM, about 19 mM, about 20 mM, about 25 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, about 50 mM, about 55 mM, about 60 mM, about 65 mM
  • both a RNase inhibitor and a reducing agent can be added to the sample prior to lysis.
  • the lysis step can be performed at a temperature sufficient to inactivate viruses.
  • the sample lysed by heating the sample to a temperature from about 65°C to about 95°C.
  • the sample can be subjected to a temperature from about 65°C to about 95°C, from about 70°C to about 90°C, or from about 75°C to about 85°C.
  • the sample can be heated to at least 65°C, at least 66°C, at least 67°C, at least 68°C, at least 69°C, at least 70°C, at least 71°C, at least 72°C, at least 73°C, at least 74°C, or at least 75°C, at least 76°C, at least 77°C, at least 79°C, at least 80°C, at least 81°C, at least 82°C, at least 83°C, at least 84°C, at least 85°C, at least 86°C, at least 87°C, at least 88°C, at least 89°C, at least 90°C, at least 91°C, at least 92°C, at least 93°C, at least 94°C, or at least 95°C.
  • the lysis step is performed at, i.e., the sample is heated to, at most 65°C, at most 66°C, at most 67°C, at most 68°C, at most 69°C, at most 70°C, at most 71°C, at most 72°C, at most 73°C, at most 74°C, or at most 75°C, at most 76°C, at most 77°C, at most 79°C, at most 80°C, at most 81°C, at most 82°C, at most 83°C, at most 84°C, at most 85°C, at most 86°C, at most 87°C, at most 88°C, at most 89°C, at most 90°C, at most 91°C, at most 92°C, at most 93°C, at most 94°C, or at most 95°C.
  • the lysis step is performed at, i.e., the sample is heated, at about 65°C, at about 66°C, at about 67°C, at about 68°C, at about 69°C, at about 70°C, at about 71°C, at about 72°C, at about 73°C, at about 74°C, or at about 75°C, at about 76°C, at about 77°C, at about 79°C, at about 80°C, at about 81°C, at about 82°C, at about 83°C, at about 84°C, at about 85°C, at about 86°C, at about 87°C, at about 88°C, at about 89°C, at about 90°C, at about 91°C, at about 92°C, at about 93 °C, at about 94°C, or at about 95 °C.
  • lysis can also be carried out at room temperature by adding a viral lysis buffer to the sample.
  • Viral lysis buffers are known in the art and available to one of ordinary skill in the art.
  • a viral lysis buffer can be added to the sample and the sample can be incubated at room temperature, e.g., a temperature from about 15°C to about 30°C.
  • a RNase inhibitor and/or a reducing agent can be added along with the viral lysis buffer.
  • the sample can be subjected to lysis conditions for any desired amount of time to lyse the cells and, optionally inactivate any viruses.
  • the sample is subjected to lysis conditions, e.g., incubated at room temperature or heated, for a period of at most 30 second, at most 45 second, at most 1 minute, at most 2 minutes, at most 3 minutes, at most 4 minutes, at most 5 minutes, at most 6 minutes, at most 7 minutes, at most 8 minutes, at most 9 minutes, at most 10 minutes, at most 11 minutes, at most 12 minutes, at most 13 minutes, at most 14 minutes, or at most 15 minutes.
  • the sample is subjected to lysis conditions, e.g., incubated at room temperature or heated, for a period of about 30 second, about 45 second, about 1 minute, about 2 minutes, about 3 minutes, about 4 minutes, about 5 minutes, about 6 minutes, about 7 minutes, about 8 minutes, about 9 minutes, about 10 minutes, about 11 minutes, about 12 minutes, about 13 minutes, about 14 minutes, or about 15 minutes.
  • the sample is heated for about 4 minutes to about 6 minutes, preferably about 5 minutes.
  • the method can further comprise extracting, i.e., isolating/purifying the nucleic acid from the sample after the lysis step.
  • the method does not comprise an extraction step.
  • the sample can be used for detection after the lysis step without further isolating and/or purifying the nucleic acid. This can reduce the time for detecting the target nucleic acid. Detection Assays
  • RNA target RNA RNA target DNA
  • methods described herein comprise: (a) reverse transcribing the RNA target into complementary DNA (cDNA); (b) degrading the RNA target with an RNA:DNA duplex-specific RNase; (c) amplifying the cDNA to detectable levels; and (d) detecting the amplified cDNA using a method described herein.
  • the methods described herein comprise a step (d), comprising detecting an amplification product from the amplification step.
  • the amplification product can be detected using any detection system, including, but not limited to enzyme (e.g.,
  • ELISA as well as enzyme-based histochemical assays), fluorescent, radioactive, and luminescent systems. It is not intended that the present invention be limited to any particular detection system or label.
  • the detection of step (d) is selected from the group consisting of: lateral flow detection; hybridization with conjugated or unconjugated DNA; colorimetric assays; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
  • the detection method comprises a plate-based assay (e.g., SHERLOCK, hybridization, qPCR, sequencing, etc.).
  • the detection method comprises a lateral flow assay.
  • the detection method is colorimetric, luminescent, or fluorescent, etc.
  • the amplification product from the amplification step is detected using lateral flow detection, also known as a lateral flow immunoassay test (LFIA), laminar flow, the immunochromatographic assay, or strip test.
  • LFIAs are a simple device intended to detect the presence (or absence) of antigen, e.g. a nucleic acid or polypeptide, in a fluid sample.
  • antigen e.g. a nucleic acid or polypeptide
  • LFIA tests are a form of immunoassay in which the test sample flows along a solid substrate via capillary action.
  • a colored reagent generally comprising antibody specific for the test target antigen
  • a colored reagent (generally comprising antibody specific for the test target antigen) bound to microparticles which mixes with the sample and transits the substrate encountering lines or zones which have been pretreated with an antibody (e.g., specific for a detectable marker on the target nucleic acid or for a detectable marker on a complementary nucleic to the target nucleic acid) or pretreated with a conjugated or unconjugated DNA as described herein.
  • an antibody e.g., specific for a detectable marker on the target nucleic acid or for a detectable marker on a complementary nucleic to the target nucleic acid
  • pretreated with a conjugated or unconjugated DNA as described herein.
  • the colored reagent can be captured and become bound at the test line or zone.
  • LFIAs are essentially immunoassays adapted to operate along a single axis to suit the test strip format or a dipstick format.
  • Strip tests are extremely versatile and can be easily modified by one skilled in the art for detecting an enormous range of antigens from fluid samples such as urine, blood, water, and/or homogenized tissue samples etc. Strip tests are also known as dip stick tests, the name bearing from the literal action of "dipping" the test strip into a fluid sample to be tested. LFIA strip tests are easy to use, require minimum training and can easily be included as components of point-of- care test (POCT) diagnostics to be use on site in the field. LFIA tests can be operated as either competitive or sandwich assays. Sandwich LFIAs are similar to sandwich ELISA. The sample first encounters colored particles which are labeled with antibodies raised to the target antigen.
  • POCT point-of- care test
  • the test line will also contain antibodies to the same target, although it may bind to a different epitope on the antigen.
  • the test line will show as a colored band in positive samples.
  • the lateral flow immunoassay can be a double antibody sandwich assay, a competitive assay, a quantitative assay or variations thereof.
  • Competitive LFIAs are similar to competitive ELISA. The sample first encounters colored particles which are labeled with the target antigen or an analogue. The test line contains antibodies to the target/its analogue. Unlabeled antigen in the sample will block the binding sites on the antibodies preventing uptake of the colored particles. The test line will show as a colored band in negative samples.
  • lateral flow technology It is also possible to apply multiple capture zones to create a multiplex test.
  • the apparatuses and methods of these three patents broadly describe a first component fixed to a solid surface on a "dip stick" which is exposed to a solution containing a soluble antigen that binds to the component fixed upon the "dip stick,” prior to detection of the component-antigen complex upon the stick.
  • an amplification product is detected using hybridization with conjugated or unconjugated DNA, which can also be referred to herein as a “probe” or “DNA probe”.
  • the probe is complementary or hybridizes to an amplification product as described herein.
  • the probe is conjugated to a detectable marker as described herein.
  • a detectable marker is conjugated to the 5’ end of the probe.
  • a detectable marker is conjugated to the 3’ end of the probe.
  • a detectable marker is conjugated to the 5 ’ end of the probe, and a detectable marker is conjugated to the 3’ end of the probe.
  • the first and second labels can be same or different.
  • the probe comprises a first detectable label at the 3 ’-end and a second detectable label at the 5 ’-end, where the first and second labels are different.
  • one of the first or second label is biotin and the other is a fluorophore.
  • the probe is conjugated to a lateral flow test strip as described herein.
  • the probe is conjugated to a detectable marker as described herein (e.g., biotin, FAM, FITC, digoxigenin, etc.), and a lateral flow test strip comprises at least one region that is specific for the detectable marker conjugated to the probe (e.g., anti-biotin, streptavidin, anti-FAM, anti-FITC, anti -digoxigenin).
  • a lateral flow strip comprises a region specific for the target amplification product or a region specific for a probe that hybridizes to the target amplification product. In some embodiments of any of the aspects, a lateral flow strip comprises a region specific for the second amplification product of a nested isothermal amplification or a region specific for a probe that hybridizes to the second amplification product. In some embodiments of any of the aspects, a lateral flow strip comprises a region specific for the target and reference amplification products or a region specific for a probe that hybridizes to the target and reference amplification products. In some embodiments of any of the aspects, a lateral flow strip comprises a region specific a positive control or a region specific for a probe that hybridizes to the positive control.
  • at least one (e.g., 1, 2, 3, 4, 5, or more) probe is selected from SEQ ID NOs: 15-20, 27-32, 68, 69, 103, 104, 154-157, 170-176, 189, 191, or a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NOs: 15-20, 27-32, 68, 69, 103, 104, 154-157, 170-176, 189, 191, that maintains the same function (e.g., probes for CoV-2).
  • amplification product can be contacted with 1, 2, 3, 4, 5, or 5 different conjugated or unconjugated DNA probes.
  • a detection step as described herein comprises at least one (e.g., 1, 2, 3, 4, 5, or more) probe selected from SEQ ID NOs: 15-20, 27-32, 68, 69, 103, 104, 154-157, 170-176, 189, 191, or a nucleic acid sequence that is at least 95% identical to one of SEQ ID NOs: 15-20, 27-32, 68, 69, 103, 104, 154-157, 170-176, 189, 191, that maintains the same function.
  • the probe is selected from Table 13. [00241] Table 13: Exemplary Primer Sets and Probes; (each number corresponds to a SEQ ID NO, see e.g., Table 6); “F, R” indicates forward and reverse primers, and “PR” indicates a probe.
  • a probe comprises a detectable marker as described herein (e.g., biotin, which when conjugated to the 5’ end can also be referred to as 5Biosg; FAM).
  • a detectable marker as described herein (e.g., biotin, which when conjugated to the 5’ end can also be referred to as 5Biosg; FAM).
  • SEQ ID NOs: 15-20 are unlabeled or unconjugated probes (i.e., do not comprise a detectable label).
  • SEQ ID NOs: 15-20 further comprise a detectable label as described herein.
  • SEQ ID NOs: 27-32, 68-69, 103-104, 154-157, 170-176 are labeled or conjugated probes (i.e., comprise a detectable label, e.g., 5Biosg, FAM, biotin).
  • SEQ ID NOs: 27-32, 68-69, 103-104, 154-157, 170-176 are not labeled or conjugated probes (i.e., do not comprise a detectable label, e.g., 5Biosg, FAM, biotin).
  • SEQ ID NOs: 15 and 27 can be used interchangeably.
  • SEQ ID NOs: 16 and 28 can be used interchangeably.
  • SEQ ID NOs: 17 and 29 can be used interchangeably.
  • SEQ ID NOs: 18 and 30 can be used interchangeably.
  • SEQ ID NOs: 19 and 31 can be used interchangeably.
  • SEQ ID NOs: 20 and 32 can be used interchangeably.
  • the detection step comprises: (i) contacting the amplification product with a conjugated (e.g., SEQ ID NOs: 27-32, 68-69, 103-104, 154-157, 170- 176) or unconjugated DNA (e.g., SEQ ID NOs: 15-20) in a hybridization reaction mixture; (ii) heating the hybridization reaction mixture at 94°C for 3 min; (iii) contacting the hybridization reaction mixture with a running buffer; and (iv) contacting the reaction mixture with a test strip (see e.g., Example 2).
  • a conjugated e.g., SEQ ID NOs: 27-32, 68-69, 103-104, 154-157, 170- 176
  • unconjugated DNA e.g., SEQ ID NOs: 15-20
  • the amplification product is detected colorimetric assays.
  • Colorimetric assays use reagents that undergo a measurable color change in the presence of the analyte. For example, para-Nitrophenylphosphate is converted into a yellow product by alkaline phosphatase enzyme. Coomassie Blue once bound to proteins elicits a spectrum shift, allowing quantitative dosage.
  • a similar colorimetric assay, the Bicinchoninic acid assay uses a chemical reaction to determine protein concentration.
  • Enzyme linked immunoassays use enzyme- complexed-antibodies to detect antigens. Binding of the antibody is often inferred from the color change of reagents such as TMB.
  • a colorimetric assay can be detected using a colorimeter, which is a device used to test the concentration of a solution by measuring its absorbance of a specific wavelength of light
  • the amplification product is detected using gel electrophoresis.
  • Gel electrophoresis is a technique used to separate DNA fragments according to their size. DNA samples are loaded into wells (indentations) at one end of a gel, and an electric current is applied to pull them through the gel.
  • the gel electrophoresis can be performed according to methods known in the art.
  • the amplification product from step (c) is detected using Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK).
  • SHERLOCK is a method that can be used to detect specific RNA/DNA at low attomolar concentrations (see e.g., US Patent 10,266,886; US Patent 10,266,887; Gootenberg et al., Science. 2018 Apr 27;360(6387):439-444; Gootenberg et al., Science. 2017 Apr 28;356(6336):438-44; the content of each of which is incorporated herein by reference in its entirety).
  • a detection method using SHERLOCK comprises the following steps: (a) contacting amplified DNA with an RNA polymerase (e.g., T7 polymerase) to promote the production of complementary RNA; (b) contacting the RNA with: (i) a crRNA comprising a Cas enzyme scaffold and a region that hybridizes to the target RNA; (ii) a Cas enzyme (e.g., Casl3a (previously known as C2c2), Casl3b, Casl3c,
  • an RNA polymerase e.g., T7 polymerase
  • the level and/or sequence of an amplification product from step (c) can be measured by a quantitative sequencing technology, e.g. a quantitative next-generation sequencing technology. Methods of sequencing a nucleic acid sequence are well known in the art.
  • a sample obtained from a subject can be contacted with one or more primers which specifically hybridize to a single-strand nucleic acid sequence (e.g., primer binding sequence) flanking the target sequence (e.g., the target RNA) and a complementary strand is synthesized.
  • a single-strand nucleic acid sequence e.g., primer binding sequence
  • an adaptor double or single-stranded
  • the sequence can be determined, e.g. by determining the location and pattern of the hybridization of probes, or measuring one or more characteristics of a single molecule as it passes through a sensor (e.g.
  • Exemplary methods of sequencing include, but are not limited to, Sanger sequencing (i.e., dideoxy chain termination), 454 sequencing, SOLiD sequencing, polony sequencing, Illumina sequencing, Ion Torrent sequencing, sequencing by hybridization, nanopore sequencing, Helioscope sequencing, single molecule real time sequencing, RNAP sequencing, and the like. Methods and protocols for performing these sequencing methods are known in the art, see, e.g. “Next Generation Genome Sequencing” Ed. Michal Janitz, Wiley-VCH; “High-Throughput Next Generation Sequencing” Eds.
  • the level and/or sequence of an amplification product from step (c) can be measured using PCR.
  • the PCR procedure is a method of gene amplification comprised of (i) sequence-specific hybridization of primers to specific genes or sequences within a nucleic acid sample or library, (ii) subsequent amplification involving multiple rounds of primer annealing, elongation, and thermal denaturation using a thermostable DNA polymerase, and (iii) analyzing the PCR products for a band of the correct size or sequence.
  • the primers used in PCR are oligonucleotides of sufficient length and appropriate sequence to provide initiation of polymerization, i.e.
  • each primer is specifically designed to be complementary to a strand of the (e.g., genetic locus, genetic barcode element as described herein) to be amplified.
  • the amount of amplification product can be determined by quantitative PCR (QPCR) or real-time PCR methods, e.g., using a set of primers specific to the amplification product and/or SYBR® GREEN or a detectable probe. Methods of qPCR and real-time qPCR are well known in the art.
  • the amplification product is detected using molecular beacons.
  • Molecular beacons or molecular beacon probes, are oligonucleotide hybridization probes that can report the presence of specific nucleic acids in homogenous solutions.
  • Molecular beacons are hairpin-shaped molecules with an internally quenched fluorophore whose fluorescence is restored when they bind to a target nucleic acid sequence. See e.g., Tyagi S and Kramer FR (1996) Nat. Biotechnol. 14 (3): 303-8; Tapp et al. (Apr 2000) BioTechniques. 28 (4): 732-8; Akimitsu Okamoto (2011). Chem. Soc. Rev. 40: 5815-5828.
  • the amplification product is detected using oligo strand displacement (OSD).
  • OSD Nucleic acid strand displacement
  • the OSD probes hybridize to specific sequences in amplification products and thereby generate simple yes/no readout of fluorescence, which is readable by human eye or by off-the-shelf cellphones.
  • the OSD probes are short hemiduplex oligonucleotides. The single stranded ‘toehold’ regions of OSD probes bind to amplification products (e.g., LAMP amplicon loop sequences), and then signal via strand exchange that leads to separation of a fluorophore and quencher.
  • amplification products e.g., LAMP amplicon loop sequences
  • OSDs are the functional equivalents of TaqMan probes and can specifically report single or multiplex amplicons without interference from non-specific nucleic acids or inhibitors; see e.g., Bhadra et al. bioRxiv 291849 (2016); Jiang et al. (2015) Anal Chem 87: 3314-3320; Zhang and Winfree (2009) J Am Chem Soc 131: 17303-17314; Bhadra et al. (2015) PLoS One 10: e0123126. [00251] In some embodiments of any of the aspects, one or more of the detection reagents (e.g.
  • an antibody reagent and/or nucleic acid probe can comprise a detectable label and/or comprise the ability to generate a detectable signal (e.g. by catalyzing a reaction converting a compound to a detectable product).
  • the term “detectable label” or “detectable marker” refers to a composition capable of producing a detectable signal indicative of the presence of a target.
  • Detectable labels can comprise, for example, a light-absorbing dye, a fluorescent dye, or a radioactive label. Detectable labels, methods of detecting them, and methods of incorporating them into reagents (e.g. antibodies and nucleic acid probes) are well known in the art.
  • detectable labels can include labels that can be detected by spectroscopic, photochemical, biochemical, immunochemical, electromagnetic, radiochemical, or chemical means, such as fluorescence, chemifluorescence, or chemiluminescence, or any other appropriate means.
  • the detectable labels used in the methods described herein can be primary labels (where the label comprises a moiety that is directly detectable or that produces a directly detectable moiety) or secondary labels (where the detectable label binds to another moiety to produce a detectable signal, e.g., as is common in immunological labeling using secondary and tertiary antibodies).
  • the detectable label can be linked by covalent or non-covalent means to the reagent.
  • a detectable label can be linked such as by directly labeling a molecule that achieves binding to the reagent via a ligand-receptor binding pair arrangement or other such specific recognition molecules.
  • Detectable labels can include, but are not limited to radioisotopes, biolumine scent compounds, chromophores, antibodies, chemiluminescent compounds, fluorescent compounds, metal chelates, and enzymes.
  • a detection reagent e.g., a primer, a probe, etc.
  • a fluorescent compound e.g., a fluorescent compound
  • a detectable label can be a fluorescent dye molecule, or fluorophore.
  • a wide variety of fluorescent reporter dyes are known in the art.
  • the fluorophore is an aromatic or heteroaromatic compound and can be a pyrene, anthracene, naphthalene, acridine, stilbene, indole, benzindole, oxazole, thiazole, benzothiazole, cyanine, carbocyanine, salicylate, anthranilate, coumarin, fluorescein, rhodamine or other like compound.
  • fluorophores include, but are not limited to, 1,5 IAEDANS; 1,8-ANS ; 4-Methylumbelliferone; 5-carboxy-2,7-dichlorofluorescein; 5-Carboxyfluorescein (5-FAM); 5-Carboxynapthofluorescein (pH 10); 5-
  • Carboxytetramethylrhodamine (5-TAMRA); 5-FAM (5-Carboxyfluorescein); 5-Hydroxy Tryptamine (HAT); 5-ROX (carboxy-X-rhodamine); 5-TAMRA (5-Carboxytetramethylrhodamine); 6- Carboxyrhodamine 6G; 6-CR 6G; 6-JOE; 7-Amino-4-methylcoumarin; 7-Aminoactinomycin D (7- AAD); 7-Hydroxy -4-methylcoumarin; 9-Amino-6-chloro-2-methoxyacridine; ABQ; Acid Fuchsin; ACMA (9-Amino-6-chloro-2-methoxyacridine); Acridine Orange; Acridine Red; Acridine Yellow; Acriflavin; Acriflavin Feulgen SITSA; Aequorin (Photoprotein); Alexa Fluor 350TM; Alexa Fluor 430TM; Alexa Fluor
  • DIDS Dihydorhodamine 123 (DHR); DiO (DiOC18(3)); DiR; DiR (DiIC18(7)); Dopamine; DsRed; DTAF; DY-630-NHS; DY-635-NHS; EBFP; ECFP; EGFP; ELF 97; Eosin; Erythrosin; Erythrosin ITC; Ethidium homodimer-1 (EthD-1); Euchrysin; Europium (III) chloride; Europium; EYFP; Fast Blue; FDA; Feulgen (Pararosaniline); FITC; FL-645; Flazo Orange; Fluo-3; Fluo-4; Fluorescein Diacetate; Fluoro-Emerald; Fluoro-Gold (Hydroxystilbamidine); Fluor-Ruby; FluorX; FM 1-43TM; FM 4-46; Fura RedTM (high pH); Fura-2, high calcium; Fura-2, low calcium; Genacryl Brilliant Red B; Gen
  • SITS SITS
  • SITS Principal
  • SITS SITS (Stilbene Isothiosulphonic Acid); SPQ (6-methoxy-N-(3-sulfopropyl)- quinolinium); Stilbene; Sulphorhodamine B can C; Sulphorhodamine G Extra; Tetracycline; Tetramethylrhodamine ; Texas RedTM; Texas Red-XTM conjugate; Thiadicarbocyanine (DiSC3); Thiazine Red R; Thiazole Orange; Thioflavin 5; Thioflavin S; Thioflavin TCN; Thiolyte; Thiozole Orange; Tinopol CBS (Calcofluor White); TMR; TO-PRO-1; TO-PRO-3; TO-PRO-5; TOTO-1; TOTO-3; TriColor (PE-Cy5); TRITC (TetramethylRodaminelsoThioCyanate); True Blue; TruRed; Ultralite; Uranine B; Uvitex SFC
  • fluorophore examples include, but are not limited to fluorescein, phycoerythrin, phycocyanin, o-phthalaldehyde, fluorescamine, Cy3TM, Cy5TM, allophycocyanin, Texas Red, peridinin chlorophyll, cyanine, tandem conjugates such as phycoerythrin-Cy5TM, green fluorescent protein, rhodamine, fluorescein isothiocyanate (FITC) and Oregon GreenTM, rhodamine and derivatives (e.g., Texas red and tetramethylrhodamine isothiocyanate (TRITC)), biotin, phycoerythrin, AMCA, CyDyesTM, 6- carboxyfluorescein (commonly known by the abbreviations FAM and F), 6-carboxy-2',4',7',4,7- hexachlorofluorescein (HEX), 6-car
  • Cy3, Cy5 and Cy7 dyes include coumarins, e.g., umbelbferone; benzimide dyes, e.g. Hoechst 33258; phenanthridine dyes, e.g. Texas Red; ethidium dyes; acridine dyes; carbazole dyes; phenoxazine dyes; porphyrin dyes; polymethine dyes, e.g., cyanine dyes such as Cy3, Cy5, etc.; BODIPY dyes and quinoline dyes.
  • coumarins e.g., umbelbferone
  • benzimide dyes e.g. Hoechst 33258
  • phenanthridine dyes e.g. Texas Red
  • ethidium dyes e.g. Texas Red
  • acridine dyes e.g. Texas Red
  • carbazole dyes ethidium dyes
  • acridine dyes e.g.
  • detectable labels include luminescent and bioluminescent markers (e.g., biotin, luciferase (e.g., bacterial, firefly, click beetle and the like), luciferin, and aequorin), radiolabels (e.g., 3H, 1251, 35S, 14C, or 32P), enzymes (e.g., galactosidases, glucorinidases, phosphatases (e.g., alkaline phosphatase), peroxidases (e.g.
  • luminescent and bioluminescent markers e.g., biotin, luciferase (e.g., bacterial, firefly, click beetle and the like), luciferin, and aequorin
  • radiolabels e.g., 3H, 1251, 35S, 14C, or 32P
  • enzymes e.g., galactosidases, glucor
  • radiolabels can be detected using photographic film or scintillation counters
  • fluorescent markers can be detected using a photo-detector to detect emitted light
  • Enzymatic labels are typically detected by providing the enzyme with an enzyme substrate and detecting the reaction product produced by the action of the enzyme on the enzyme substrate, and colorimetric labels can be detected by visualizing the colored label.
  • a detectable label can be a radiolabel including, but not limited to 3 H, 125 1, 35 S, 14 C, 32 P, and 33 P.
  • Suitable non-metallic isotopes include, but are not limited to, U C, 14 C, 13 N, 18 F, 123 I, 124 I, and 125 I.
  • Suitable radioisotopes include, but are not limited to, "mTc, 95 Tc, m In, 62 Cu, 64 Cu, Ga, 68 Ga, and 153 Gd.
  • Suitable paramagnetic metal ions include, but are not limited to, Gd(III), Dy(III), Fe(III), and Mn(II).
  • Suitable X-ray absorbers include, but are not limited to, Re, Sm, Ho, Fu, Pm, Y, Bi, Pd, Gd, Fa, Au, Au, Yb, Dy, Cu, Rh, Ag, and Ir.
  • the radionuclide is bound to a chelating agent or chelating agent- linker attached to probe, primer or reagent.
  • chelating agents include, but are not limited to, diethylenetriaminepentaacetic acid (DTP A) and ethylenediaminetetraacetic acid (EDTA).
  • EDTA ethylenediaminetetraacetic acid
  • Suitable radionuclides for direct conjugation include, without limitation, 3 H, 18 F, 124 I, 125 I, 131 1. 35 S, 14 C, 32 P, and 33 P and mixtures thereof.
  • Suitable radionuclides for use with a chelating agent include, without limitation, 47 Sc, 64 Cu, 67 Cu, 89 Sr, 86 Y, 87 Y, 90 Y, 105 Rh, m Ag, In, 117 mSn, 149 Pm, 153 Sm, 166 Ho, 177 Fu, 186 Re, 188 Re, 211 At, 212 Bi, and mixtures thereof.
  • Suitable chelating agents include, but are not limited to, DOTA, BAD, TETA, DTPA, EDTA, NTA, HDTA, their phosphonate analogs, and mixtures thereof.
  • a detectable label can be an enzyme including, but not limited to horseradish peroxidase and alkaline phosphatase.
  • An enzymatic label can produce, for example, a chemiluminescent signal, a color signal, or a fluorescent signal.
  • Enzymes contemplated for use to detectably label an antibody reagent include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-V-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-VI-phosphate dehydrogenase, glucoamylase and acetylcholinesterase.
  • a detectable label is a chemiluminescent label, including, but not limited to lucigenin, luminol, luciferin, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.
  • a detectable label can be a spectral colorimetric label including, but not limited to colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, and latex) beads.
  • detection reagents can also be labeled with a detectable tag, such as c-Myc, HA, VSV-G, HSV, FLAG, V5, HIS, or biotin.
  • a detectable tag such as c-Myc, HA, VSV-G, HSV, FLAG, V5, HIS, or biotin.
  • Other detection systems can also be used, for example, a biotin-streptavidin system.
  • the antibodies immunoreactive (i. e. specific for) with the biomarker of interest is biotinylated. Quantity of biotinylated antibody bound to the biomarker is determined using a streptavidin-peroxidase conjugate and a chromogenic substrate.
  • streptavidin peroxidase detection kits are commercially available, e.g., from DAKO; Carpinteria, CA.
  • a reagent can also be detectably labeled using fluorescence emitting metals such as 152 Eu, or others of the lanthanide series. These metals can be attached to the reagent using such metal chelating groups as diethylenetriaminepentaacetic acid (DTP A) or ethylenediaminetetraacetic acid (EDTA).
  • DTP A diethylenetriaminepentaacetic acid
  • EDTA ethylenediaminetetraacetic acid
  • the level of the detected amplification product can be compared to a reference.
  • the reference can also be a level of expression of the target molecule in a control sample, a pooled sample of control items or a numeric value or range of values based on the same.
  • the reference can be the level of a target molecule in a sample obtained from the same item at an earlier point in time.
  • a level which is less than a reference level can be a level which is less by at least about 10%, at least about 20%, at least about 50%, at least about 60%, at least about 80%, at least about 90%, or less relative to the reference level. In some embodiments of any of the aspects, a level which is less than a reference level can be a level which is statistically significantly less than the reference level.
  • a level which is more than a reference level can be a level which is greater by at least about 10%, at least about 20%, at least about 50%, at least about 60%, at least about 80%, at least about 90%, at least about 100%, at least about 200%, at least about 300%, at least about 500% or more than the reference level.
  • a level which is more than a reference level can be a level which is statistically significantly greater than the reference level.
  • compositions useful in detecting an RNA target may comprise any of the reagents discussed herein.
  • the composition comprises one or more of the following: (i) a probe; (ii) a reverse transcriptase; (iii) a first primer for reverse transcription and optionally a second primer for reverse transcription; (iv) an RNA:DNA duplex-specific RNase; (v) a recombinase; (vi) single-stranded binding protein; (vii) a polymerase; (viii) a first primer and optionally a second primer for amplification; (ix) one or more reagents for nucleic acid amplification; and (x) an amplified nucleic acid.
  • compositions can comprise any one, two, three, four, five, six, seven, eight, nine, or all ten of the components listed above.
  • the composition comprises: (i) an RNA:DNA duplex-specific RNase and (ii) an amplified nucleic acid.
  • the composition further comprises at least one of the following: reaction buffer, diluent, water, magnesium salt (such as magnesium acetate or magnesium chloride) dNTPs, reducing agent (such as DTT), and/or an RNase inhibitor.
  • reaction buffer diluent
  • water water
  • magnesium salt such as magnesium acetate or magnesium chloride
  • reducing agent such as DTT
  • RNase inhibitor an RNase inhibitor
  • kits for detecting a target RNA Described herein are kit components that can be included in one or more of the kits described herein.
  • a kit for detecting a target RNA in a sample comprising: (a) an RNA:DNA duplex-specific RNase; (b) a reverse transcriptase; (c) a DNA polymerase; (c) a recombinase; and (d) single-stranded DNA binding protein.
  • kits for detecting a target RNA in a sample comprising: (a) an RNA:DNA duplex-specific RNase; (b) a reverse transcriptase; and (c) a DNA polymerase.
  • the RNA:DNA duplex-specific RNase is RNaseH.
  • the RNaseH is provided at a sufficient amount, such that at least 0.1 U/pL to 5 U/pL can be added to the reaction mixture.
  • the kit further comprises a reverse transcriptase.
  • the kit is used to reverse transcribe target RNA into DNA, and to amplify the DNA to a detectable amplification product.
  • the reverse transcriptase is selected from the group consisting of: a Moloney murine leukemia virus (M-MLV) reverse transcriptase (RT), an avian myeloblastosis virus (AMV)
  • the reverse transcriptase is provided at a sufficient amount, such that at least 200 U/pL can be added to the reaction mixture.
  • the DNA polymerase is a strand-displacing
  • the strand-displacing DNA polymerase is selected from the group consisting of: Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase.
  • the kit comprises a sufficient amount of Polymerase I Klenow fragment, Bst polymerase, Phi -29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase.
  • the DNA polymerase(s) is provided at a sufficient amount to be added to the reaction mixture.
  • the kit further comprises a first set of primers
  • the first set of primers comprises primers that bind to target RNA and non-target RNA in the sample, i.e., “general” primers.
  • the first set of primers comprises random hexamers, i.e., a mixture of oligonucleotides representing all possible hexamer sequences.
  • the first set of primers comprises oligo(dT) primer, which bind to the polyA tails of mRNAs or viral transcripts.
  • the first set of primers is specific to the target
  • the first set of primers comprises the reverse primer of the second set of primers (e.g., used in the amplification step). In some embodiments of any of the aspects, the first set of primers can comprise the second set of primers, or the second set of primers can comprise the first set of primers.
  • the kit further comprises a second set of primers (e.g., for isothermal amplification).
  • the second set of primers is specific to the target RNA.
  • the second set of primers is specific (i.e., binds specifically through complementarity) to cDNA, in other words, the DNA produced in the RT step that is complementary to the target RNA.
  • the second set of primers can be specific to any region of the target RNA.
  • SEQ ID NOs: 3-70 include non-limiting examples of primers that are specific for SARS-CoV-2.
  • the first and second set primers are provided at a sufficient concentration, e.g., 5 uM to 35 uM, to be added to reaction mixture.
  • the first and/or second set of primers are provided at a concentration of at least 1 uM, at least 2 uM, at least 3 uM, at least 4 uM, at least 5 uM, at least 6uM, at least 7 uM, at least 8 uM, at least 9 uM, at least 10 uM, at least 11 uM, at least 12 uM, at least 13 uM, at least 14 uM, at least 15 uM, at least 16uM, at least 17 uM, at least 18 uM, at least 19 uM, at least 20 uM, at least 21 uM, at least 22 uM, at least 23 uM, at least 24 uM, at least 25 uM, at least 26
  • the first and/or second set of primers comprise any combination of the primers listed in Table 6 (e.g., SEQ ID NOs: 3-210) or any combination of primers that are at least 95% identical to one of SEQ ID NOs: 3-210 that maintains the same function.
  • the kit further comprises a recombinase and single -stranded DNA binding (SSB) protein.
  • the single- stranded DNA-binding protein is a gp32 SSB protein.
  • the recombinase is a uvsX recombinase.
  • the recombinase and single -stranded DNA binding proteins are provided at a sufficient amount to be added to the reaction mixture.
  • the kit comprises RPA pellets comprising RPA reagents (e.g., DNA polymerase, helicase, SSB) at a sufficient concentration.
  • RPA reagents e.g., DNA polymerase, helicase, SSB
  • the kit further comprises at least one of the following: reaction buffer, diluent, water, magnesium acetate (or another magnesium compound such as magnesium chloride) dNTPs, DTT, and/or an RNase inhibitor.
  • the kit further comprises reagents for isolating RNA from the sample.
  • the kit further comprises detergent, e.g., for lysing the sample.
  • the kit further comprises a sample collection device, such a swab.
  • the kit further comprises a sample collection container, optionally containing transport media.
  • the kit is used to reverse transcribe the target RNA into DNA, and to amplify the DNA to a detectable amplification product.
  • the kit further comprises reagents for detecting the amplification product, comprising reagents appropriate for a detection method selected from: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
  • the kit further comprises a third set of primers and/or a detectable probe (e.g., for detection using qPCR, sequencing).
  • the kit further comprises one or more lateral flow strips specific for the target amplification product.
  • the kit further comprises reagents for amplifying and/or detecting a control.
  • Neg-limiting examples of negative controls for SARS-CoV-2 include MERS, SARS, 229e, NL63, and hKul, which can be detected using specific primers (e.g., SEQ ID NOs: 33-36, 139-153, 197-208).
  • the kit further comprises one or more lateral flow strips specific for the target amplification product.
  • the kit further comprises a set of probes for detection through hybridization with a target amplification product.
  • the kit comprises an effective amount of the reagents as described herein.
  • the reagents can be supplied in a lyophilized form or a concentrated form that can diluted or suspended in liquid prior to use.
  • the kit reagents described herein can be supplied in aliquots or in unit doses.
  • kits can be provided singularly or in any combination as a kit.
  • a kit includes the components described herein and packaging materials thereof.
  • a kit optionally comprises informational material.
  • compositions in a kit can be provided in a watertight or gas tight container which in some embodiments is substantially free of other components of the kit.
  • the reagents described herein can be supplied in more than one container, e.g., it can be supplied in a container having sufficient reagent for a predetermined number of applications, e.g., 1,
  • One or more components as described herein can be provided in any form, e.g., liquid, dried or lyophilized form. Liquids or components for suspension or solution of the reagents can be provided in sterile form and should not contain microorganisms or other contaminants. When the components described herein are provided in a liquid solution, the liquid solution preferably is an aqueous solution.
  • the informational material can be descriptive, instructional, marketing or other material that relates to the methods described herein.
  • the informational material of the kits is not limited in its form.
  • the informational material can include information about production of the reagents, concentration, date of expiration, batch or production site information, and so forth.
  • the informational material relates to methods for using or administering the components of the kit.
  • the kit will typically be provided with its various elements included in one package, e.g., a fiber-based, e.g., a cardboard, or polymeric, e.g., a Styrofoam box.
  • the enclosure can be configured so as to maintain a temperature differential between the interior and the exterior, e.g., it can provide insulating properties to keep the reagents at a preselected temperature for a preselected time.
  • the kit can further comprise a detection device.
  • a detection device can comprise a light-emitting diode (LED) light source and/or a filter (e.g., plastic filter specific for the emitting wavelength of a detectable marker).
  • the kit and/or the detection device is field-deployable, i.e., transportable, non-refrigerated, and/or inexpensive.
  • a detection device further comprises a wireless device (e.g., a cell phone, a personal digital assistant (PDA), a tablet).
  • PDA personal digital assistant
  • Fig. 8 shows an exemplary schematic of a system as described herein.
  • the amplification product as described herein can be detected using a plate-based assay 100 as described herein (e.g., SHERLOCK, hybridization, qPCR, sequencing, etc.).
  • the results of the assay can be detected by exposing the detection assay 100 to a light source 200 (according to the specific excitation wavelength of a detection molecule in the assay) and a filter 300 (according to the specific emission wavelength of a detection molecule in the assay).
  • the emitted wavelength of the detection molecule in the assay can be detected by the camera 405 of a portable computing device 400 (e.g., a mobile phone) or any other device comprising a camera 405.
  • the amplification product is detected using a test strip 150 (e.g., using lateral flow detection and/or conjugated or unconjugated DNA).
  • the colorimetric signals of the test strip 150 can be detected by the camera 405 of a portable computing device 400 (e.g., a mobile phone) or any other device comprising a camera 405.
  • the portable computing device 400 can be connected to a network 500.
  • the network 500 can be connected to another computing device 600 and/or a server 800.
  • the network 500 can be connected to various other devices, servers, or network equipment for implementing the present disclosure.
  • a computing device 600 can be connected to a display 700.
  • Computing device 400 or 600 can be any suitable computing device, including a desktop computer, server (including remote servers), mobile device, or any other suitable computing device.
  • programs for implementing the system can be stored in database 900 and run on server 800. Additionally, data and data processed or produced by said programs can be stored in database 900.
  • kits, methods and/or components for the performance thereof can include the use of a single device at a single location, or multiple devices at a single, or multiple, locations that are connected together using any appropriate communication protocols over any communication medium such as electric cable, fiber optic cable, or in a wireless manner.
  • modules which perform particular functions. It should be understood that these modules are merely schematically illustrated based on their function for clarity purposes only, and do not necessary represent specific hardware or software. In this regard, these modules can be hardware and/or software implemented to substantially perform the particular functions discussed. Moreover, the modules can be combined together within the disclosure, or divided into additional modules based on the particular function desired. Thus, the disclosure should not be construed to limit the present technology as disclosed herein, but merely be understood to illustrate one example implementation thereof.
  • the computing system can include clients and servers.
  • a client and server are generally remote from each other and typically interact through a communication network. The relationship of client and server arises by virtue of computer programs running on the respective computers and having a client-server relationship to each other.
  • a server transmits data (e.g., an HTML page) to a client device (e.g., for purposes of displaying data to and receiving user input from a user interacting with the client device).
  • client device e.g., for purposes of displaying data to and receiving user input from a user interacting with the client device.
  • Data generated at the client device e.g., a result of the user interaction
  • Implementations of the subject matter described in this specification can be performed in a computing system that includes a back end component, e.g., as a data server, or that includes a middleware component, e.g., an application server, or that includes a front end component, e.g., a client computer having a graphical user interface or a Web browser through which a user can interact with an implementation of the subject matter described in this specification, or any combination of one or more such back end, middleware, or front end components.
  • the components of the system can be interconnected by any form or medium of digital data communication, e.g., a communication network. Examples of communication networks include a local area network (“LAN”) and a wide area network (“WAN”), an inter-network (e.g., the Internet), and peer-to-peer networks (e.g., ad hoc peer to-peer networks).
  • LAN local area network
  • WAN wide area network
  • Internet inter-network
  • peer-to-peer networks e.
  • Implementations of the subject matter and the operations described in this specification can be implemented in digital electronic circuitry, or in computer software, firmware, or hardware, including the structures disclosed in this specification and their structural equivalents, or in combinations of one or more of them.
  • Implementations of the subject matter described in this specification can be implemented as one or more computer programs, i.e., one or more modules of computer program instructions, encoded on computer storage medium for execution by, or to control the operation of, data processing apparatus.
  • the program instructions can be encoded on an artificially generated propagated signal, e.g., a machine-generated electrical, optical, or electromagnetic signal that is generated to encode information for transmission to suitable receiver apparatus for execution by a data processing apparatus.
  • a computer storage medium can be, or be included in, a computer-readable storage device, a computer-readable storage substrate, a random or serial access memory array or device, or a combination of one or more of them. Moreover, while a computer storage medium is not a propagated signal, a computer storage medium can be a source or destination of computer program instructions encoded in an artificially generated propagated signal. The computer storage medium can also be, or be included in, one or more separate physical components or media (e.g., CDs, disks, or other storage devices). [00291] The operations described in this specification can be implemented as operations performed by a “data processing apparatus” on data stored on one or more computer-readable storage devices or received from other sources.
  • the term “data processing apparatus” encompasses all kinds of apparatus, devices, and machines for processing data, including by way of example a programmable processor, a computer, a system on a chip, or multiple ones, or combinations, of the foregoing.
  • the apparatus can include special purpose logic circuitry, e.g., an FPGA (field programmable gate array) or an ASIC (application specific integrated circuit).
  • the apparatus can also include, in addition to hardware, code that creates an execution environment for the computer program in question, e.g., code that constitutes processor firmware, a protocol stack, a database management system, an operating system, a cross platform runtime environment, a virtual machine, or a combination of one or more of these.
  • the apparatus and execution environment can realize various different computing model infrastructures, such as web services, distributed computing and grid computing infrastructures.
  • a computer program (also known as a program, software, software application, script, or code) can be written in any form of programming language, including compiled or interpreted languages, declarative or procedural languages, and it can be deployed in any form, including as a standalone program or as a module, component, subroutine, object, or other unit suitable for use in a computing environment.
  • a computer program can, but need not, correspond to a file in a file system.
  • a program can be stored in a portion of a file that holds other programs or data (e.g., one or more scripts stored in a markup language document), in a single file dedicated to the program in question, or in multiple coordinated files (e.g., files that store one or more modules, sub programs, or portions of code).
  • a computer program can be deployed to be executed on one computer or on multiple computers that are located at one site or distributed across multiple sites and interconnected by a communication network.
  • processors suitable for the execution of a computer program include, by way of example, both general and special purpose microprocessors, and any one or more processors of any kind of digital computer.
  • a processor will receive instructions and data from a read only memory or a random access memory or both.
  • the essential elements of a computer are a processor for performing actions in accordance with instructions and one or more memory devices for storing instructions and data.
  • a computer will also include, or be operatively coupled to receive data from, or transfer data to, or both, one or more mass storage devices for storing data, e.g., magnetic, magneto optical disks, or optical disks.
  • mass storage devices for storing data, e.g., magnetic, magneto optical disks, or optical disks.
  • a computer need not have such devices.
  • a computer can be embedded in another device, e.g., a mobile telephone, a personal digital assistant (PDA), a mobile audio or video player, a game console, a Global Positioning System (GPS) receiver, or a portable storage device (e.g., a universal serial bus (USB) flash drive), to name just a few.
  • Devices suitable for storing computer program instructions and data include all forms of nonvolatile memory, media and memory devices, including by way of example semiconductor memory devices, e.g., EPROM, EEPROM, and flash memory devices; magnetic disks, e.g., internal hard disks or removable disks; magneto optical disks; and CD ROM and DVD-ROM disks.
  • the processor and the memory can be supplemented by, or incorporated in, special purpose logic circuitry.
  • “reduction” or “inhibition” does not encompass a complete inhibition or reduction as compared to a reference level.
  • “Complete inhibition” is a 100% inhibition as compared to a reference level.
  • a decrease can be preferably down to a level accepted as within the range of normal for an individual without a given disorder.
  • the terms “increased”, “increase”, “enhance”, or “activate” are all used herein to mean an increase by a statically significant amount.
  • the terms “increased”, “increase”, “enhance”, or “activate” can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level.
  • a “increase” is a statistically significant increase in
  • a "subject” means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters.
  • Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon.
  • the subject is a mammal, e.g., a primate, e.g., a human.
  • the terms, “individual,” “patient” and “subject” are used interchangeably herein.
  • the subject is a mammal.
  • the mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of viral infection.
  • a subject can be male or female.
  • a subject can be one who has been previously diagnosed with or identified as suffering from or having a condition in need of treatment (e.g. a viral infection) or one or more complications related to such a condition, and optionally, have already undergone treatment for a viral infection or the one or more complications related to a viral infection.
  • a subject can also be one who has not been previously diagnosed as having a viral infection or one or more complications related to a viral infection.
  • a subject can be one who exhibits one or more risk factors for a viral infection or one or more complications related to a viral infection or a subject who does not exhibit risk factors.
  • a “subject in need” of testing for a particular condition can be a subject having that condition, diagnosed as having that condition, or at risk of developing that condition.
  • protein and “polypeptide” are used interchangeably to designate a series of amino acid residues, connected to each other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues.
  • protein and “polypeptide” refer to a polymer of amino acids, including modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of its size or function.
  • modified amino acids e.g., phosphorylated, glycated, glycosylated, etc.
  • amino acid analogs regardless of its size or function.
  • Protein and “polypeptide” are often used in reference to relatively large polypeptides, whereas the term “peptide” is often used in reference to small polypeptides, but usage of these terms in the art overlaps.
  • polypeptide proteins and “polypeptide” are used interchangeably herein when referring to a gene product and fragments thereof.
  • exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, fragments, and analogs of the foregoing.
  • variants naturally occurring or otherwise
  • alleles homologs
  • conservatively modified variants conservative substitution variants of any of the particular polypeptides described are encompassed.
  • amino acid sequences one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters a single amino acid or a small percentage of amino acids in the encoded sequence is a “conservatively modified variant” where the alteration results in the substitution of an amino acid with a chemically similar amino acid and retains the desired activity of the polypeptide.
  • conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles consistent with the disclosure.
  • a given amino acid can be replaced by a residue having similar physiochemical characteristics, e.g., substituting one aliphatic residue for another (such as lie, Val, Leu, or Ala for one another), or substitution of one polar residue for another (such as between Lys and Arg; Glu and Asp; or Gin and Asn).
  • Other such conservative substitutions e.g., substitutions of entire regions having similar hydrophobicity characteristics, are well known.
  • Polypeptides comprising conservative amino acid substitutions can be tested confirm that a desired activity and specificity of a native or reference polypeptide is retained.
  • Amino acids can be grouped according to similarities in the properties of their side chains (in A. L. Lehninger, in Biochemistry, second ed., pp. 73-75, Worth Publishers, New York (1975)): (1) non-polar: Ala (A), Val (V), Leu (L), lie (I), Pro (P), Phe (F), Trp (W), Met (M); (2) uncharged polar: Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gin (Q); (3) acidic: Asp (D), Glu (E); (4) basic: Lys (K), Arg (R), His (H).
  • Naturally occurring residues can be divided into groups based on common side-chain properties: (1) hydrophobic: Norleucine, Met, Ala, Val, Leu, He; (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gin; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; (6) aromatic: Trp, Tyr, Phe.
  • Non-conservative substitutions will entail exchanging a member of one of these classes for another class.
  • Particular conservative substitutions include, for example; Ala into Gly or into Ser; Arg into Lys; Asn into Gin or into His; Asp into Glu; Cys into Ser; Gin into Asn; Glu into Asp; Gly into Ala or into Pro; His into Asn or into Gin; He into Leu or into Val; Leu into He or into Val; Lys into Arg, into Gin or into Glu; Met into Leu, into Tyr or into He; Phe into Met, into Leu or into Tyr; Ser into Thr; Thr into Ser; Trp into Tyr; Tyr into Trp; and/or Phe into Val, into He or into Leu.
  • the polypeptide described herein can be a functional fragment of one of the amino acid sequences described herein.
  • a “functional fragment” is a fragment or segment of a polypeptide which retains at least 50% of the wild-type reference polypeptide’s activity according to the assays described herein.
  • a functional fragment can comprise conservative substitutions of the sequences disclosed herein.
  • the polypeptide described herein can be a variant of a sequence described herein.
  • the variant is a conservatively modified variant.
  • Conservative substitution variants can be obtained by mutations of native nucleotide sequences, for example.
  • a “variant,” as referred to herein, is a polypeptide substantially homologous to a native or reference polypeptide, but which has an amino acid sequence different from that of the native or reference polypeptide because of one or a plurality of deletions, insertions or substitutions.
  • Variant polypeptide encoding DNA sequences encompass sequences that comprise one or more additions, deletions, or substitutions of nucleotides when compared to a native or reference DNA sequence, but that encode a variant protein or fragment thereof that retains activity.
  • a wide variety of PCR-based site-specific mutagenesis approaches are known in the art and can be applied by the ordinarily skilled artisan to generate and test artificial variants.
  • a variant DNA or amino acid sequence can be at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, identical to a native or reference sequence.
  • the degree of homology (percent identity) between a native and a mutant sequence can be determined, for example, by comparing the two sequences using freely available computer programs commonly employed for this purpose on the world wide web (e.g. BLASTp or BLASTn with default settings).
  • the methods described herein relate to measuring, detecting, or determining the level of at least one target, e.g., the target RNA.
  • detecting or “measuring” refers to observing a signal from, e.g. a probe, label, or target molecule to indicate the presence of an analyte in a sample. Any method known in the art for detecting a particular label moiety can be used for detection. Exemplary detection methods include, but are not limited to, spectroscopic, fluorescent, photochemical, biochemical, immunochemical, electrical, optical or chemical methods.
  • measuring can be a quantitative observation. Sequence determination, e.g., that indicates or confirms the presence of a given sequence element, e.g., a barcode element or region thereof, is a form of detecting.
  • a polypeptide, nucleic acid, cell, or microorganism as described herein can be engineered.
  • engineered refers to the aspect of having been manipulated by the hand of man.
  • a polynucleotide is considered to be “engineered” when at least one aspect of the polynucleotide, e.g., its sequence, has been manipulated by the hand of man to differ from the aspect as it exists in nature.
  • contacting refers to any suitable means for delivering, or exposing, an agent to at least one component as described herein (e.g., sample, target R A, cDNA, amplification product, etc.).
  • contacting comprises physical human activity, e.g., an injection; an act of dispensing, mixing, and/or decanting; and/or manipulation of a delivery device or machine.
  • specific binding refers to a chemical interaction between two molecules, compounds, cells and/or particles wherein the first entity binds to the second, target entity with greater specificity and affinity than it binds to a third entity which is a non-target.
  • specific binding can refer to an affinity of the first entity for the second target entity which is at least 10 times, at least 50 times, at least 100 times, at least 500 times, at least 1000 times or greater than the affinity for the third non-target entity.
  • a reagent specific for a given target is one that exhibits specific binding for that target under the conditions of the assay being utilized.
  • compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
  • Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein.
  • One or more members of a group can be included in, or deleted from, a group for reasons of convenience and/or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.
  • a method of detecting a target RNA in a sample comprising: a. contacting the sample with a reverse transcriptase, and a first set of primers; b. contacting the sample with an RNA:DNA duplex-specific RNase; c. contacting the sample with a DNA polymerase, a second set of primers, a recombinase, and single -stranded DNA binding protein; and d. detecting an isothermal amplification product from step (c).
  • a method of detecting a target RNA in a sample comprising: a. contacting the sample with a reverse transcriptase, and a first set of primers; b. contacting the sample with an RNA:DNA duplex-specific RNase; c. contacting the sample with a DNA polymerase and a second set of primers; and d. detecting an amplification product from step (c).
  • steps (a), (b) and (c) are performed simultaneously in the same reaction.
  • step (c) is performed after steps (a) and (b).
  • steps (b) and (c) are performed simultaneously in the same reaction, and step (a) is performed prior to steps (b) and (c).
  • step (c) permits an isothermal amplification reaction.
  • the isothermal amplification reaction is selected from the group consisting of: Recombinase Polymerase Amplification (RPA), Loop Mediated Isothermal Amplification (LAMP), Helicase -dependent isothermal DNA amplification (HDA), Rolling Circle Amplification (RCA), and strand displacement amplification (SDA).
  • RPA Recombinase Polymerase Amplification
  • LAMP Loop Mediated Isothermal Amplification
  • HDA Helicase -dependent isothermal DNA amplification
  • RCA Rolling Circle Amplification
  • SDA strand displacement amplification
  • the method of paragraph 9 wherein the isothermal amplification reaction is Recombinase Polymerase Amplification (RPA).
  • step (c) further comprises contacting the sample with a recombinase and single-stranded DNA binding protein.
  • the first set of primers comprises primers that bind to target RNA and non-target RNA in the sample.
  • the method of paragraph 13, wherein the first set of primers comprises random hexamers.
  • the method of paragraphs 1 or 2, wherein the first set of primers is specific to the target RNA.
  • the method of paragraphs 1 or 2, wherein the second set of primers is specific to the target RNA.
  • steps (a), (b), and/or (c) are performed between 12°C and 45°C.
  • steps (a), (b) and/or (c) are performed at room temperature.
  • steps (a), (b), and (c) are performed on a heat block.
  • steps (a), (b), and (c) are performed in less than 20 minutes.
  • steps (a), (b), (c), and (d) are performed faster than a method comprising steps (a), (c), and (d) without the RNA:DNA duplex-specific RNase.
  • steps (a), (b), and (c) produce a higher yield of amplification product than a method comprising steps (a) and (c) without the RNA:DNA duplex-specific RNase.
  • prior to step (a) total RNA is isolated from the sample.
  • the sample is contacted with a detergent.
  • the method of paragraphs 1 or 2, wherein the target RNA is a viral RNA.
  • step (d) is selected from the group consisting of: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
  • a kit for detecting a target RNA in a sample comprising: a. an RNA:DNA duplex-specific RNase; b . a reverse transcriptase ; c. a DNA polymerase; d. a recombinase; and e. single -stranded DNA binding protein.
  • a kit for detecting a target RNA in a sample comprising: a.
  • RNA:DNA duplex-specific RNase an RNA:DNA duplex-specific RNase
  • b a reverse transcriptase
  • c a DNA polymerase
  • the reverse transcriptase is selected from the group consisting of: a Moloney murine leukemia virus (M-MLV) reverse transcriptase (RT), an avian myeloblastosis virus (AMV) RT, a retrotransposon RT, a telomerase reverse transcriptase, an HIV-1 reverse transcriptase, or a recombinant version thereof.
  • M-MLV Moloney murine leukemia virus
  • AMV avian myeloblastosis virus
  • retrotransposon RT a retrotransposon RT
  • telomerase reverse transcriptase an HIV-1 reverse transcriptase, or a recombinant version thereof.
  • the kit of paragraphs 27 or 28, wherein the DNA polymerase is a strand-displacing DNA polymerase.
  • the kit of paragraph 31 wherein the strand-displacing DNA polymerase is selected from the group consisting of: Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase.
  • 33. The kit of paragraphs 27 or 28, furthering comprising a first and second set of primers.
  • the first set of primers comprises primers that bind to target RNA and non-target RNA in the sample.
  • kit of paragraph 28 further comprising a recombinase and single -stranded DNA binding protein.
  • kit 43 The kit of any of paragraphs 27-42, wherein the kit is used to reverse transcribe the target RNA into DNA, and to amplify the DNA to a detectable amplification product.
  • kit of paragraph 43 further comprising reagents for detecting the amplification product, comprising reagents appropriate for a detection method selected from: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High- sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
  • a detection method selected from: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High- sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
  • kit of paragraphs 43 or 44 further comprising one or more lateral flow strips specific for the target amplification product.
  • a method of detecting an RNA virus in a sample from a subject comprising: a. isolating viral RNA from the subject; and b. performing the method of paragraphs 1-26.
  • RNA virus is selected from influenza virus, human immunodeficiency virus (HIV), and severe acute respiratory syndrome coronavirus 2 (SARS- CoV-2).
  • RT-RPA Enhancement of RT-RPA reaction by the addition of RNaseH
  • POC point-of- care
  • a key part of this process is the conversion of an RNA to be measured to DNA, typically by a reverse transcriptase (RT) followed by method such as the recombinase polymerase amplification (RPA), which can isothermally amplify the cDNA sequence of interest.
  • RT-RPA is slow compared to RPA alone.
  • RPA alone, using DNA as a template can amplify a single molecule of product to completion in approximately 7 minutes.
  • An RT- RPA reaction typically takes 25 minutes and can have lower yield.
  • RNA e.g., target RNA
  • a direct test of this hypothesis and a method for greatly improving the time and yield of an RT-RPA was to include RNaseH in the RT-RPA reaction.
  • RNaseH only degrades the RNA in RNA:DNA hybrids.
  • Using RNaseH allows the RT reaction to proceed but after a DNA molecule is made, the RNaseH destroys the RNA and thereby enhances the RPA reaction. Indeed, as described below, RNaseH greatly improves the RT-RPA reaction.
  • the reformulated RT reaction i.e., an RT reaction containing RNaseH
  • the addition of RNaseH to loop-mediated isothermal amplification (LAMP) improves the reaction and allows the reaction to be performed at room temperature (traditional LAMP protocols need to be performed at 65 °C). This change in temperature simplifies the LAMP protocol, allows the reaction to be performed at room temperature, and lowers the background signal.
  • LAMP loop-mediated isothermal amplification
  • the standard RT-RPA consists of an RPA reaction pellet by TwistDxTM, rehydration buffer supplied with the TwistDxTM pellets, UltraPureTM water, Protoscriptase II Reverse TranscriptaseTM (RT) by NEBTM, magnesium acetate, as well as forward and reverse primers.
  • the formulation includes RNaseH by NEB.
  • RNAse H added (see e.g., Figure 1).
  • the RPA primers were used at 5 mM concentrations.
  • the Protoscriptase IITM 200 U/pL was diluted in rehydration buffer to reach a final concentration of 20 U/pL.
  • RNaseH was diluted in rehydration buffer to reach a final concentration of 1.25 U/pL.
  • 1 pL of the RT reaction was transferred to a 10 pL standard RPA reaction with the RT serving as the template.
  • RNaseH greatly increased the yield of the RPA reaction (see e.g., Figure 1).
  • DNA was used instead of RNA as an input to the RPA reaction there was no effect of RNaseH (see e.g., Figure 1).
  • This experiment was repeated as a one pot reaction (RT-RPA in one reaction following the standard protocol) and found it also greatly improved the timing and yield (see e.g., Figure 2).
  • RNaseH was added at different concentrations and for different amounts of time. Specifically, the RPA primers were used at 5 mM concentrations.
  • the Protoscriptase IITM 200 U/pL was diluted in rehydration buffer to reach a final concentration of 20 U/pL.
  • a series of concentrations of RNaseH were tested from 0.1 U/pL to 5 U/pL by diluting the stock RNaseH from 5,000 U/mL with rehydration buffer (see e.g., Figures 4 and 5). The optimal concentration was found to be 2.5 U/pL (see e.g., Figure 5).
  • a heat block was set to 42°C, and the RPA reaction was run for 10 min or 25 min minutes on the heat block (see e.g., Figure 3).
  • a negative control was included for which all of the components were added to the reaction with the exception of the template being replaced by water.
  • the detection used for each of the experiments was qPCR. After the RPA was complete, 2 pL from each reaction was diluted 1 :200 in water. 10 pL of a qPCR master mix composed of PowerUp SYBR Green Master MixTM by Thermo FisherTM, 5 pM primer mix, and UltraPureTM water was distributed into a 96 well plate.
  • the primer used for the reverse transcription (RT) reaction can be the same as the reverse primer for RPA. Run the RT reaction in a Hybex® heated to 42°C. After the RT reaction is complete, transfer it to ice and remove 1 pL for use as the template in the RPA protocol described below.
  • Standard RNAse inhibitors like the Murine RNAse Inhibitor do not inhibit the RNaseH reaction. This is due to the fact that RNaseH works by a distinct mechanism from standard RNases and is not affected by the standard inhibitors.
  • RPA Recombinase Polymerase Amplification
  • the RPA protocol is derived from TwistDxTM.
  • Table 4 The following protocol is derived from Thermo Fisher.
  • SARS-CoV-2 RT-RPA-RNaseH Reagents and Equipment
  • Table 7 Reagents _
  • the lysis/RNA extraction protocol can follow Method 1 or Method 2.
  • Method 1 1) Put swab into viral transport media following standard protocol of local hospital. 2) Use an inactivation and RNA extraction kit.
  • Method 2 1) Put swab or sputum into viral transport media (e.g., 100 uL viral transport media. (A small volume of viral transport media is preferred, as the viral load per uL will be higher.) (2) Add RNAse inhibitor of choice at lU/uL to viral transport media (e.g., 25 uL of Murine RNAse inhibitor per mL of viral transport media). (3) Heat for 5 minutes at 94 C.
  • viral transport media e.g., 100 uL viral transport media. (A small volume of viral transport media is preferred, as the viral load per uL will be higher.)
  • RNAse inhibitor of choice e.g., 25 uL of Murine RNAse inhibitor per mL of viral transport media.
  • reaction volumes for the detection protocol below are formulated for 10 samples to be tested. The volumes can be adjusted accordingly. Prepare all reactions on ice.
  • Rehydration Buffer is very viscous.
  • steps with viscous solutions 1) Pipette slowly to avoid bubbles. 2) Mix 5 times using 75% of total volume being resuspended (i.e. for a 100 uL volume, set pipette to 75 uL). 3) After dispensing most volume, wait 5 seconds until remaining liquid settles inside the pipette tip, then slowly dispense remaining volume.
  • RT-RPA master mix Place RT-RPA master mix on ice. Make sure the solution is cool before adding to the TwistDx RPA pellets. For 10 samples, 5 TwistDx RPA pellets are added to the RT-RPA master mix. Resuspend each TwistDx RPA pellet with the RT-RPA master mix by dispensing 40 uL of master mix per pellet and let it sit on ice in a metal block for 2 min. (Note: expect a cloudy and viscous solution). Pipette each pellet reaction up and down with 20 uL volume and transfer the entire re suspension back to the original master mix tube.
  • nested amplification refers to a first amplification reaction comprising an outer set of primers and a second amplification reaction using the product of the first amplification reaction and an inner set of primers specific to the first amplification reaction.
  • Results should be visible after the control line appears. Signal should be visible within 5- 10 minutes.
  • Example 3 An enhanced isothermal amplification assay for viral detection
  • Rapid, inexpensive, robust diagnostics are essential to control the spread of infectious diseases.
  • Current state of the art diagnostics are highly sensitive and specific, but slow, and require expensive equipment.
  • Described herein is a molecular diagnostic test for SARS-CoV-2, FIND (Fast Isothermal Nucleic acid Detection), based on an enhanced isothermal recombinase polymerase amplification reaction.
  • FIND has a detection limit on patient samples close to that of RT-qPCR, requires minimal instrumentation, and is highly scalable and cheap.
  • FIND can be performed in high throughput, does not cross-react with other common coronaviruses, avoids bottlenecks caused by the current worldwide shortage of RNA isolation kits, and takes ⁇ 45 minutes from sample collection to results.
  • FIND can be adapted to future novel viruses in days once sequence is available.
  • the FIND assay or methods can also be referred to as an enhanced recombinase polymerase amplification (eRPA) reaction.
  • eRPA enhanced recombinase polymerase amplification
  • SARS-CoV-2 has rapidly spread around the world with serious consequences for human life and the global economy ( 1 ).
  • efforts to contain the virus have been hampered by a lack of adequate testing (2). Rapid, inexpensive, and sensitive testing is essential for contact tracing and isolation strategies to be effective (3). While numerous different tests exist, the overwhelming global need for testing has led to limitations in both the supplies of reagents, e.g. swabs and purification kits, and instrumentation, e.g. quantitative polymerase chain reaction (qPCR) or ID NOW machines. In most cases, overcoming these limitations would require scaling of supply lines by several orders of magnitude over current production capacities.
  • qPCR quantitative polymerase chain reaction
  • Isothermal amplification technologies have long held promise to offer highly sensitive detection at high throughput, and to allow for widely distributed testing including at-home/point of- need (PON) tests (10, 11).
  • PON point of- need
  • isothermal amplification is plagued by nonspecific amplification events that require secondary amplification and detection steps. These steps add extra complexity to the reactions, removing many of the benefits of the isothermal amplification approach.
  • Many ongoing efforts aim to circumvent these problems for SARS-CoV-2 detection.
  • RT-RPA Reverse transcription recombinase polymerase amplification
  • RT-RPA is an isothermal amplification method in which the double stranded DNA denaturation and strand invasion that is typically achieved by heat cycling in PCR is instead accomplished by a cocktail of recombinase enzyme, single-stranded binding proteins, and ATP (12).
  • RPA has potential advantages over other isothermal amplification technologies such as loop-mediated isothermal amplification (LAMP) (13) as it can be performed near ambient temperature (37-42°C). While several creative applications of LAMP technologies to detect COVID-19, the disease caused by SARS-CoV-2, have recently been developed and show promise (14-18), RT-RPA has been less explored.
  • LAMP loop-mediated isothermal amplification
  • RPA primers were designed to both the SARS-CoV-2 N gene and S gene (see e.g., Fig. 15A and Table 12) and quantified the amplification performance of a RT-RPA assay with ProtoScript II® reverse transcriptase by qPCR (see e.g., Fig. 15B).
  • the detection limit of this standard assay was poor, requiring between 100 and 300 RNA molecules for reliable detection (see e.g., Fig. 11A, Fig. 15C bottom panel).
  • Fig. 15A The primer designs avoided regions with strong homology to other coronaviruses including MERS and SARS-CoV, as well as HCoV-229E, HCoV-HKUl, HCoV-NL63, HCoV-OC43, which cause respiratory illnesses such as the common cold. Regions were also avoided that have high variability across sequenced SARS-CoV-2 strains. All pairwise combinations of primers were screened to find pairs that gave a high yield of the desired target sequence while minimizing the amount of non-specific amplicons. Primer pairs were screened by performing qPCR on diluted RT- RPA products so that both specific and non-specific reaction yield could be determined (see e.g., Fig. 11B) (20). Many pairs gave high levels of amplification at 100 molecules of input RNA, but only a small fraction of those yielded significant amplification products at 10 molecules of input RNA.
  • the optimized RT-RPA assay’s product can be hybridized and detected with a commercial lateral flow assay (LFA) without further amplification.
  • LFAs allow accurate read-out by eye by minimally trained personnel, and even opens up the possibility of home-based testing (22).
  • Milenia BiotecTM HybriDetectTM lateral flow test strips were used that contain a streptavidin band, an anti-Ig band, and carry gold nanoparticle-labeled anti-FAM antibodies for visualization.
  • two primer pairs were selected that amplify part of the S gene, a FAM label was added to the reverse primer, and the product amplicon was hybridized to a biotinylated capture probe.
  • FIND a sensitive, specific, rapid test for SARS-CoV-2
  • FIND is highly sensitive and specific for SARS-CoV-2 N and S genes (see e.g., Fig. 12 and Fig. 16).
  • the sensitive and specific assays were conducted by two independent groups, each of whom randomized the RNA input in a 96-well plate in a checkerboard pattern, then handed the blinded plate to the other group fortesting by FIND (see e.g., Fig. 16A).
  • 52 positive samples were included with a concentration ranging from 100 molecules to 1 molecule of total RNA input (see e.g., Figs. 12A and 12C and Figs. 16B and 16C).
  • RNA dilutions were confirmed by RT-qPCR (see e.g., Fig. 12B and Figs. 16D-16F). Strips were scored at ⁇ 20 minutes as this decreases the variability in band intensity that can be observed at low molecule input (see e.g., Fig. 12C and Fig. 16B). At or above 10 molecules of RNA input, 87 of 88 N gene samples and 88 of 88 S gene samples were accurately identified as SARS-CoV-2 positive (see e.g., Fig. 16C).
  • RNA detection was achieved even as low as 3 (13 of 24 tests) or 1 (5 of 16 tests) molecules of RNA input.
  • the assay is also highly specific, showing no cross-reactivity (0 of 80 tests) with 10,000 copies of RNA from other coronaviruses, i.e. MERS, SARS-CoV, CoV-HKUl, or CoV- 229E. It also showed no cross reactivity with the 2009 H1N1 Influenza virus, a respiratory virus with similar initial clinical presentation (see e.g., Figs. 12A and 12C, Fig. 16B).
  • RNA extraction free lysis approach as RNA extraction from clinical samples has become a limiting factor as the global need for SARS-CoV-2 tests has increased.
  • RNA extraction kits are currently hard to obtain, the process of extraction depends on skilled workers, and often involves equipment such as centrifuges.
  • Heat-based lysis has shown promise as a way to rapidly lyse and inactivate viruses for use in diagnostic assays (23, 24).
  • the replication-deficient virus in the AccuPlexTM panel is lysed at ⁇ 75°C, a temperature that is likely similar to the temperature required to lyse wild-type SARS-CoV-2 (see e.g., Fig. 13 A) (25).
  • RNase inhibitors prevent RNA degradation from nasopharyngeal swabs suspended in viral transport media (NP in VTM), the standard clinical sample.
  • NP in VTM viral transport media
  • RNaseAlertTM to measure RNase activity, significant RNase activity was found in VTM (see e.g., Fig. 13B).
  • TCEP tris(2-carboxyethyl)phosphine was tested, which has been used to inactivate RNases from saliva and urine (26).
  • RNasin PlusTM a thermostable RNase inhibitor
  • a room temperature viral lysis buffer Intact Genomic FastAmp® Viral and Cell Solution for Covid-19 Testing was also tested, and it was found that RNaseAlertTM was protected from degradation in the presence of RNasin PlusTM (see e.g., Fig. 13B and Figs. 17B and 17C).
  • RNAsin PlusTM protected RNA from degradation at low temperatures, with RNasin PlusTM being more effective at high temperatures (see e.g., Fig. 17F).
  • the combination of RNAsin PlusTM and TCEP protects RNaseAlertTM from degradation during a heat lysis protocol (see e.g., Fig. 13F and Fig. 17G). Using this protocol (see e.g., Fig. 13G) SARS-CoV-2 signal was detected in -70% of samples with 25-100 AccuPlexTM viral particles in saliva (see e.g., Fig.
  • N gene is expressed at up to 10-fold higher levels than the S gene in infected human cells (35), if NP swabs collect cells or cellular debris this would bias the observed N gene to S gene copy number ratio. This may be important for other assays as many COVID tests target ORFlab, which is one of the lower expressed transcripts in human cells.
  • RNA extraction was performed on all samples and then RT-qPCR and FIND was repeated (see e.g., Fig. 14A). Overall, RNA extraction increased RNA titer by ⁇ 5-fold, matching expectations given that 240 pF of initial sample was concentrated into 50 pF of final volume (see e.g., Figs. 14B-14D).
  • FIND gives concordant results with RT-qPCR in all extracted samples except those with extremely low titer.
  • 23 had at least 3 copies of input RNA, and all of these were positively identified by FIND (see e.g., Fig. 18B).
  • Three samples had ⁇ 1 copy of input RNA, of which one was identified by FIND.
  • the four samples with undetectable signal by RT-qPCR before extraction were still negative by both RT-qPCR and FIND even with extraction. Modest changes in sample collection methods could make FIND even more sensitive.
  • NP swabs are typically collected into 3 mF of VTM. Only a small fraction of this volume is used for detection assays.
  • FIND The FIND protocol reported here was developed and optimized in just under 3 weeks, with an additional 4 weeks for sample preparation, optimization, and patient sample acquisition. In future epidemics and pandemics, this process could be shortened to several days after standardizing sample preparation methods and primer design. Improvements in RT-RPA developed in FIND can also improve other detection approaches, allowing these assays to become 1-pot, closed-tube, fluorescent readout reactions.
  • FIND addresses many of the problems of current SARS-CoV-2 testing methods: it is scalable, compatible with both swabs and saliva samples, can be performed in high throughput by minimally trained personnel in low-resource settings (see e.g., Fig. 20), and can be automated. FIND is capable of reliably detecting SARS-CoV-2 virus in patient samples that contain as low as 2 viral particles/pF, and is therefore fully adequate to detect infection during the period of peak transmission (27-30, 36, 37). [00410] References and Notes:
  • RNA ma.076232.120 (2020).
  • Saliva is more sensitive for SARS-CoV-2 detection in COVID-19 patients than nasopharyngeal swabs. medRxiv, 2020.04.16.20067835 (2020).
  • RNA template preparation SARS-CoV-2, SARS-CoV, and MERS N gene containing plasmids were obtained from IDT (2019-nCoV Plasmid Controls). HCoV-229E and HCoV-HKUl N gene, SARS-CoV-2, SARS-CoV, MERS, HCoV-229E and HCoV-HKUl S gene were synthesized by Twist BioscienceTM. All genes were cloned into a T7 promoter expression plasmid. To produce RNA template, in vitro transcription was performed with NxGen® T7 RNA Polymerase (LucigenTM #F88904-1) according to the manufacturer's suggested protocol with minor modifications.
  • Final concentrations of the reaction mixture components were 50 units T7 RNA polymerase, 1 c reaction buffer, 625 mM NTPs, 10 mM DTT, 500 ng of linearized plasmid template, and RNase-free water to a final volume of 20 pL per reaction. After 10 h at 37 °C, 4 units of DNase I (NEB #M0303S) was added and reactions were further incubated for 10 min at 37 °C. DNase I was heat inactivated by adding EDTA (5 mM final) and heating at 75 °C for 10 min.
  • RNA was purified by RNAClean XPTM (Beckman CoulterTM) at 0.6 the volume of the reaction, washed twice with 80% EtOH, then eluted into 20 pL RNase-free water. The size and quality of the RNA product was checked by BioanalyzerTM (AgilentTM) after denaturation at 70 °C for 2 min to unfold any RNA structure; all samples were determined to contain the correct RNA product.
  • Reverse transcription and RNase H screen FIND assay master mixes targeting SARS- CoV -2 N gene as described below with or without addition of RNase H (NEB) and without reverse transcriptase.
  • the following RT enzymes were added to aliquots of the master mixes: Superscript III ® (ThermoFisher) TM, Superscript IV ® (ThermoFisherTM), MMLV (Moloney Murine Leukemia Virus RT, NEB), ProtoScript II ® (NEB), Maxima H Minus ® RT (ThermoFisher). All enzymes were added at 20 U per reaction. N gene IVT RNA diluted with EbO was used as input to the reactions.
  • Primer Oligomerization Products Four N gene forward primers (JQ217, CCMS041, CCMS047, and CCMS051) were paired with the reverse primer JQ224. These four primer pairs as well as JQ217 + JQ223 were used in FIND assays with a water-only sample input. FIND assays were incubated at 42 °C for 10 min. Amplification products were cleaned up using RNA Clean XPTM (Beckman CoulterTM) at 2.5 c concentration and eluted in 20 pL of nuclease-free water.
  • SARS-CoV-2 FIND assay primer sequence alignment To calculate the percent identity between the SARS-CoV-2 N and S gene primers and the analogous sites in other betacoronaviruses, the RefSeq entries for SARS-CoV-2, SARS-CoV, MERS, HCoV-229E, HCoV- NL63, HCoV-OC43, and HCoV-HKUl were obtained from NCBI. The sequences were then compared using the EMBL-EBI web tool Clustal OmegaTM to identify indels and mismatches.
  • the subsequences for the forward and reverse primers for both the N gene and the S gene were then located within the SARS-CoV-2 sequence, and the number of mismatches with the antagonist betacoronavirus sequence was tallied. The percent identity was then calculated by dividing the number of matching bases by the length of the primer sequence.
  • To calculate the number of mismatches between FIND assay primer and probe sequences and known SARS-CoV-2 variants the full set of all available SARS-CoV-2 genomes were downloaded from NCBI and were arranged into a single fasta file. This dataset was then converted into a BLAST database using the BLAST+ (v2.6.0) tool and then queried by each of the sequences for the N and S gene FIND assay.
  • Primer screening Regions of low homology between SARS-CoV-2 and both SARS- CoV and MERS were identified by sequence alignment and were used as target sequences for the biotinylated probe. Unlabeled forward and reverse primers were designed to amplify a region of 100- 200 nt encompassing the target sequence. Combinations of forward and reverse primers were screened by testing amplification at low RNA input. Reactions were prepared as described below and S gene IVT SARS-CoV-2 RNA was used as input.
  • FIND assay Isothermal amplification reactions were based on the TwistAmpTM Basic RPA KitTM (TwistDxTM) with added modifications described below. Each lyophilized pellet was resuspended in a solution of 38 pL rehydration buffer (TwistDxTM), 1 pL RNase H (5U/pL) (NEB), 0.5 pL Superscript IV RT® (200 U/pL) (ThermoFisher ScientificTM), and 0.5 pL of forward and reverse primer mix each at 50 pM (N gene, JQ217+JQ235; S gene, CCMS055+CCMS073).
  • This mix was then activated by addition of 1 pL 700 mM magnesium acetate followed by thorough mixing with a pipette.
  • Reactions were prepared by dispensing 8 pL of master mix and 2 pL of input template (RNA, AccuplexTM virus, or patient samples) per reaction well, mixing the reaction by pipetting, and incubating at 42 °C for 25 min.
  • a hybridization mix was prepared by combining 1 vol biotinylated probe at 5 pM (N gene, JQ241 or JQ312; S gene, CCMS069) with 19 vol 10 mM Tris pH 8. 20 pL of hybridization mix was added to each reaction, and samples were heated at 94 °C for 3 min followed by a cooling step at room temperature for 3 min.
  • qPCR and RT-qPCR SYBR green qPCR reactions were prepared in 10 pL reaction volume rising PowerUp SYBR Green PCR Master mixTM (Thermo Fisher ScientificTM), 2 pL sample, and 0.4 pM of primers (JQ217 + JQ223 for N gene or CCMS055 + CCMS067 for S gene unless otherwise mentioned).
  • RT-qPCR reactions were prepared in 10 pL reaction volume using the Luna Universal One-Step RT-qPCR kitTM (NEB), 2 pL sample, and 0.4 pM of primers following the manufacturer’s instructions.
  • the CDC one-step RT-qPCR assay used to benchmark the RT-qPCR was performed using the Luna Universal Probe One-step RT-qPCR kitTM (NEB) and N 1 probe/primer mix against SARS- CoV-2 from IDT (2019-nCoV CDC EUA Kit) (see e.g., Fig. 18D). Reactions were prepared according to the manufacturer’s instructions following the CDC protocol. qPCR and RT- qPCR reactions were monitored on either a Bio-Rad Cl 000 Touch Thermo CyclerTM (Bio-RadTM) or QuantStudio 6 Real Time PCR systemTM (Thermo Fisher ScientificTM).
  • Sensitivity and specificity of FIND with RNA input Data presented in Figure 12 was generated as a blinded and randomized experiment. Synthetic full genome SARS-CoV-2 RNA (Twist BioscienceTM) was used as RNA template for FIND assay on SARS-CoV-2. For the cross-reactivity samples, a single dilution series of RNA input was prepared by mixing at equimolar ratio N and S gene IVT RNA products for each of: SARS-CoV, MERS, HCoV-HKUl, and HCoV-229E. Genomic 2009 H1N1 Influenza (ATCC) was also serially diluted for input to the assay.
  • RNA stocks used in these tests were validated by testing dilution series in a one-step RT-qPCR as described above (see e g., Fig. 12B and Figs. 16D-16F).
  • RNaseAlert tests with viral transport media (VTM) and saliva The RNaseAlert substrate (IDT) was used at 2 pM to assess the RNase activity of saliva and VTM (BD, universal viral transport medium #220220). Fluorescence intensity was determined using an excitation of 485 nm and emission of 528 nm over the course of 10-60 min in a 96-well plate reader (Synergy HI Plate ReaderTM, BioTekTM). In general, the degradation of the RNaseAlert substrate was assessed after 10 minutes and fluorescence intensities were averaged over 3 time points and reported normalized to a fully degraded control.
  • RNasin PlusTM (PromegaTM) was added to VTM to a final concentration of 1 U/pL and was incubated for 5 min at 25 °C before addition of RNaseAlertTM.
  • viral lysis buffer FestAmp Viral and Cell solutionTM, Intact GenomicsTM
  • TCEP buffer (20 mM Tris pH 8, 10 mM EDTA pH 8, TCEP 1-100 mM) was prepared as a 2 / solution and was mixed 1 : 1 with saliva.
  • RNase inhibitor (RI) was added to 1 U/pL final concentration as shown.
  • RNase A (LucigenTM) was added to 0.25 pg/pL final concentration. Saliva obtained from two healthy donors was pooled and adjusted to 1 mM TCEP to reduce viscosity. Aliquots of a single pooled sample stored at -20 °C were used for all assays.
  • Virus extraction The AccuPlexTM SARS-CoV-2 verification panel (SeracareTM) containing the N gene, E gene, ORFla, and RdRp was used as a surrogate to SARS-CoV-2 to optimize the full processing of clinical samples.
  • SeracareTM The AccuPlexTM SARS-CoV-2 verification panel (SeracareTM) containing the N gene, E gene, ORFla, and RdRp was used as a surrogate to SARS-CoV-2 to optimize the full processing of clinical samples.
  • To determine the temperature lysis of AccuPlexTM SARS-CoV-2 virus at le5 copies/mL was diluted 1 : 1 in 2 lysis buffer (final: 10 mM Tris HC1 pH 8, 5 mM EDTA pH 8, 100 mM TCEP, 1 U/pL RNasin Plus), then incubated for 5 min at a temperature between 55 °C and 95 °C in 5 °C increments.
  • Detection of AccuPlexTM SARS-CoV-2 in contrived samples AccuPlexTM SARS-CoV- 2 was extracted using conditions mimicking patient sample processing. FIND assays targeting SARS- CoV-2 N gene were performed as above. For extraction in VTM and PBS, AccuPlex SARS-CoV-2 at 100 copies/pL was serially diluted 1 : 1 (v/v) in either VTM or PBS containing a final concentration of 1 U/pL RNasin Plus. After heating at 94 °C for 5 min, samples were kept on ice before being used as input into FIND. For extraction in viral lysis buffer at 25 °C, AccuPlex SARS-CoV-2 at 100 copies/pL was serially diluted 1:1 (v/v) in viral lysis buffer (FastAmp Viral and Cell solutionTM
  • TCEP buffer + RI RNase inhibitor
  • Lower input samples were prepared by serial dilution with 1:1 (v/v) saliva in 2x TCEP buffer. After heating at 94 °C for 5 min, 1/10 vol of 1M H2O2 was added and samples were incubated at 25 °C for 10 min. Saliva samples were diluted 1 : 1 with water and kept on ice before being used as input into FIND. For extraction of virus from saliva with viral lysis buffer, 1 vol of AccuPlexTM SARS-CoV-2 virus at 100 copies/pL was mixed with 1 vol of pooled saliva and 2 vol of viral lysis buffer adjusted to 2 U/pL RNasin PlusTM. Lower input samples were prepared by serial dilution with 1:3 (v/v) viral lysis buffer + RI mixed with saliva.
  • saliva was mixed 1 : 1 with 2 TCEP buffer + RI. After 5 minutes at 25 °C, N gene IVT SARS-CoV-2 RNA was spiked into saliva in TCEP buffer and lower input samples were prepared by serial dilution on ice. After heating at 94 °C for 5 min, 1/10 vol of 1 M H2O2 was added and samples were incubated at 25 °C for 10 min. Samples were diluted 1 : 1 with water and kept on ice before being used as input into FIND. For RNA added post heat inactivation, a similar protocol was followed using saliva mixed 1 : 1 with 2x TCEP buffer + RI that was pre-incubated for 5 min at 94 °C.
  • Clinical samples A cohort of nasal swab patient samples was purchased from BocaBiolisticsTM (Florida) containing 30 SARS-CoV-2 positive samples and 21 SARS-CoV-2 negative samples. Samples were thawed on ice and 40 pL aliquots were made and subsequently stored at -80 °C. At the time of testing, sample aliquots were thawed and RNasin PlusTM was added to a final concentration of 1 U/pL. The samples were placed on a heat block set to 99 °C for 5 min for virus inactivation and lysis. After cooling, samples were spun down and transferred to a 96-well DNA LoBindTM plate (EppendorfTM).
  • RNA extraction from clinical samples Virions were pelleted by centrifugation at approximately 21,000 xg for 2 h at 4 °C. The supernatant was removed and 750 pL of TRIzol-LSTM Reagent (ThermoFisherTM) was added to the pellets and then incubated on ice for 10 min. Following incubation, 200 pF of chloroform (MilliporeSigmaTM) was added, vortexed, and incubated on ice for 2 min. Phases were separated by centrifugation at 21,000 xg for 15 min at 4 °C, and subsequently the aqueous layer was removed and treated with 1 vol isopropanol (SigmaTM).
  • GlycoBlueTM Coprecipitant 15 mg/mF (ThermoFisherTM) and 100 pF 3M Sodium Acetate (Fife TechnologyTM) were added to each sample and incubated on dry ice until frozen. RNA was pelleted by centrifugation at 21,000 xg for 45 min at 4 °C. The supernatant was discarded and the RNA pellet was washed with cold 70% ethanol. RNA was eluted in 50 pF of DEPC-treated water (ThermoFisherTM).
  • Quantitative SARS-CoV-2 RT-qPCR Assay Fevels of SARS-CoV-2 RNA in extracted samples were detected using the United States Centers for Disease Control and Prevention (US CDC) 2019-nCoV_Nl primers and probe set. Each reaction contained extracted RNA, lx TaqPathTM 1-Step RT-qPCR Master Mix, CG (ThermoFisherTM), 500 nM of each the forward and reverse primers, and 125 nM of probe. Viral copy numbers were quantified using N1 qPCR standards to generate a standard curve. The assay was run in triplicate for each sample and two non-template control (NTC) wells were included to confirm there was no contamination.
  • NTC non-template control
  • IP08 Importin8 housekeeping gene RNA level
  • An internal virion control e.g., RCAS, Rous Sarcoma Virus
  • house RT-qPCR data was converted from Ct values to copies/mF by direct comparison to the CDC RT-qPCR quantitation.
  • the Ct values from the in house RT-qPCR were plotted against the CDC RT-qPCR Ct values which yielded a linear relationship, R2>0.99, with a slope within error of 1, confirming that the amplification dynamics of both primer sets were similar.
  • Table 12 List of exemplary primers used herein.
  • SARS-Co V-2 SARS-Co V2 S-gene Target
  • the lysis/RNA extraction protocol can follow Method 1 or Method 2.
  • Method 1 1) Put swab into viral transport media following standard protocol of local hospital. 2) Use an inactivation and RNA extraction kit.
  • Method 2 1) Put swab or sputum into viral transport media (e.g., 100 uL viral transport media; a small volume of viral transport media is preferred, as the viral load per uL will be higher.) (2) Add RNAse inhibitor of choice at lU/uL to viral transport media (e.g., 25 uL of Murine RNAse inhibitor per mL of viral transport media). (3) Heat for 5 minutes at 94 C. RT-RPA-RNaseH Master Mix
  • reaction volumes for the detection protocol below are formulated for 48 samples to be tested. The volumes can be adjusted accordingly. Prepare all reactions on ice. Keep on ice at all times until starting RPA reaction.
  • Rehydration Buffer is very viscous.
  • steps with viscous solutions 1) Pipette slowly to avoid bubbles. 2) Mix 5 times using 75% of total volume being resuspended (i.e. for a 100 uL volume, set pipette to 75 uL). 3) After dispensing most volume, wait 5 seconds until remaining liquid settles inside the pipette tip, then slowly dispense remaining volume.
  • RT-RPA master mix Place RT-RPA master mix on ice. Make sure the solution is cool before adding to the TwistDx RPA pellets. For 48 samples, 12 TwistDx RPA pellets are added to the RT-RPA master mix. Resuspend each TwistDx RPA pellet with the RT-RPA master mix by dispensing 40 uL of master mix per pellet and let it sit on ice in a metal block for 2 min. (Note: expect a cloudy and viscous solution). Pipette each pellet reaction up and down with 20 uL volume and transfer the entire re suspension back to the original master mix tube.
  • Results should be visible after the control line appears. Signal should be visible within 5- 10 minutes. Image strips within lh of testing. Negative control sometimes develops when left overnight.

Abstract

The technology described herein is directed to methods, kits, and systems for detecting a target RNA, such as a small amount of viral RNA. In one aspect, described herein are methods of detecting the target RNA. In other aspects, described herein are kits and systems suitable to practice the methods described herein to detect the target RNA.

Description

COMPOSITIONS AND METHODS FOR ENHANCING DETECTION OF RNA
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 62/993,521 filed March 23, 2020, and U.S. Provisional Application No. 63/031,120 filed May 28, 2020, the contents of each of which are incorporated herein by reference in their entireties.
GOVERNMENT SUPPORT
[0002] This invention was made with government support under HR0011-18-2-0014 awarded by the Dept of Defense (DOD)/DARPA. The government has certain rights in the invention.
SEQUENCE LISTING
[0003] The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on March 23, 2021, is named 002806-097160WOPT_SL.txt and is 57,358 bytes in size.
TECHNICAL FIELD
[0004] The technology described herein relates to isothermal amplification methods and kits comprising a RNA:DNA duplex-specific RNase.
BACKGROUND
[0005] There is a critical need for rapid robust isothermal amplification methods for point-of- care (POC) diagnostics.
SUMMARY
[0006] The technology described herein is directed to methods, kits, and system to detect a target RNA. The target RNA can be detected at the single molecular level using the methods described herein, comprising: (a) reverse transcribing the RNA target into complementary DNA (cDNA); (b) degrading the RNA target with an RNA:DNA duplex-specific RNase; (c) amplifying the cDNA to detectable levels; and (d) detecting the amplified cDNA using a method as described further herein. Such methods result in an unexpectedly higher cDNA yield in a shorter timeframe than methods lacking the RNase step. As such, these methods are particularly well-suited to detecting a small amount of target RNA in a limited time period, e.g., point-of-care detection of viral RNAs.
[0007] In one aspect, described herein is a method of detecting a target RNA in a sample, comprising: (a) contacting the sample with a reverse transcriptase, and a first set of primers; (b) contacting the sample with an RNA: DNA duplex-specific RNase; (c) contacting the sample with a DNA polymerase, a second set of primers, a recombinase, and single-stranded DNA binding protein; and (d) detecting an isothermal amplification product from step (c).
[0008] In another aspect, described herein is a method of detecting a target RNA in a sample, comprising: (a) contacting the sample with a reverse transcriptase, and a first set of primers; (b) contacting the sample with an RNA: DNA duplex-specific RNase; (c) contacting the sample with a DNA polymerase and a second set of primers; and (d) detecting an amplification product from step (c).
[0009] In some embodiments of any of the aspects, the RNase is RNaseH.
[0010] In some embodiments of any of the aspects, steps (a), (b) and (c) are performed simultaneously in the same reaction.
[0011] In some embodiments of any of the aspects, steps (a) and (b) are performed simultaneously in the same reaction, and step (c) is performed after steps (a) and (b).
[0012] In some embodiments of any of the aspects, steps (b) and (c) are performed simultaneously in the same reaction, and step (a) is performed prior to steps (b) and (c).
[0013] In some embodiments of any of the aspects, the RNaseH is provided at a concentration of 0.1 U/pL to 5 U/pL.
[0014] In some embodiments of any of the aspects, the RNaseH is provided at a concentration of 2.5 U/pL
[0015] In some embodiments of any of the aspects, step (c) permits an isothermal amplification reaction.
[0016] In some embodiments of any of the aspects, the isothermal amplification reaction is selected from the group consisting of: Recombinase Polymerase Amplification (RPA), Loop Mediated Isothermal Amplification (LAMP), Helicase-dependent isothermal DNA amplification (HDA), Rolling Circle Amplification (RCA), and strand displacement amplification (SDA).
[0017] In some embodiments of any of the aspects, the isothermal amplification reaction is Recombinase Polymerase Amplification (RPA).
[0018] In some embodiments of any of the aspects, step (c) further comprises contacting the sample with a recombinase and single-stranded DNA binding protein.
[0019] In some embodiments of any of the aspects, the first set of primers comprises primers that bind to target RNA and non-target RNA in the sample.
[0020] In some embodiments of any of the aspects, the first set of primers comprises random hexamers.
[0021] In some embodiments of any of the aspects, the first set of primers is specific to the target RNA.
[0022] In some embodiments of any of the aspects, the second set of primers is specific to the target RNA. [0023] In some embodiments of any of the aspects, steps (a), (b), and/or (c) are performed between 12°C and 45 °C.
[0024] In some embodiments of any of the aspects, steps (a), (b) and/or (c) are performed at room temperature.
[0025] In some embodiments of any of the aspects, steps (a), (b), and (c) are performed on a heat block.
[0026] In some embodiments of any of the aspects, steps (a), (b), and (c) are performed in less than 20 minutes.
[0027] In some embodiments of any of the aspects, steps (a), (b), (c), and (d) are performed faster than a method comprising steps (a), (c), and (d) without the RNA:DNA duplex-specific RNase.
[0028] In some embodiments of any of the aspects, steps (a), (b), and (c) produce a higher yield of amplification product than a method comprising steps (a) and (c) without the RNA:DNA duplex- specific RNase.
[0029] In some embodiments of any of the aspects, prior to step (a) total RNA is isolated from the sample.
[0030] In some embodiments of any of the aspects, prior to step (a), the sample is contacted with a detergent.
[0031] In some embodiments of any of the aspects, the target RNA is a viral RNA.
[0032] In some embodiments of any of the aspects, the detection of step (d) is selected from the group consisting of: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
[0033] In one aspect, described herein is a kit for detecting a target RNA in a sample, comprising: (a) an RNA:DNA duplex-specific RNase; (b) a reverse transcriptase; (c) a DNA polymerase; (d) a recombinase; and (e) single -stranded DNA binding protein.
[0034] In another aspect described herein is a kit for detecting a target RNA in a sample, comprising: (a) an RNA:DNA duplex-specific RNase; (b) a reverse transcriptase; and (c) a DNA polymerase.
[0035] In some embodiments of any of the aspects, the RNA:DNA duplex-specific RNase is RNaseH.
[0036] In some embodiments of any of the aspects, the reverse transcriptase is selected from the group consisting of: a Moloney murine leukemia virus (M-MLV) reverse transcriptase (RT), an avian myeloblastosis virus (AMV) RT, a retrotransposon RT, atelomerase reverse transcriptase, an HIV-1 reverse transcriptase, or a recombinant version thereof. [0037] In some embodiments of any of the aspects, the DNA polymerase is a strand-displacing
DNA polymerase.
[0038] In some embodiments of any of the aspects, the strand-displacing DNA polymerase is selected from the group consisting of: Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase.
[0039] In some embodiments of any of the aspects, the kit further comprises a first and/or second set of primers.
[0040] In some embodiments of any of the aspects, the first set of primers comprises primers that bind to target RNA and non-target RNA in the sample.
[0041] In some embodiments of any of the aspects, the first set of primers comprises random hexamers.
[0042] In some embodiments of any of the aspects, the first set of primers is specific to the target
RNA.
[0043] In some embodiments of any of the aspects, the second set of primers are specific to the target RNA.
[0044] In some embodiments of any of the aspects, the second set of primers comprises a forward and reverse primer, and the first set of primers comprises the reverse primer of the second set of primers.
[0045] In some embodiments of any of the aspects, the kit further comprises a recombinase and single-stranded DNA binding protein.
[0046] In some embodiments of any of the aspects, the kit further comprises a reaction buffer and magnesium acetate.
[0047] In some embodiments of any of the aspects, the kit further comprises reagents for isolating RNA from the sample.
[0048] In some embodiments of any of the aspects, the kit further comprises detergent for lysing the sample.
[0049] In some embodiments of any of the aspects, the kit is used to reverse transcribe the target
RNA into DNA, and to amplify the DNA to a detectable amplification product.
[0050] In some embodiments of any of the aspects, the kit further comprises reagents for detecting the amplification product, comprising reagents appropriate for a detection method selected from: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
[0051] In some embodiments of any of the aspects, the kit further comprises one or more lateral flow strips specific for the target amplification product. [0052] In another aspect, described herein is a method of detecting an RNA virus in a sample from a subject, comprising: (a) isolating viral RNA from the subject; and (b) performing a method as described herein.
[0053] In some embodiments of any of the aspects, the RNA virus is selected from influenza virus, human immunodeficiency virus (HIV), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
[0054] In one aspect, described herein is a method of detecting a target nucleic acid in a sample, comprising: (a) contacting the sample with a DNA polymerase and a first set of primers; (b) contacting a first isothermal amplification product of step (a) with a DNA polymerase and a second set of primers; and (c) detecting a second isothermal amplification product from step (b).
[0055] In some embodiments of any of the aspects, the first and second set of primers are specific to the target nucleic acid.
[0056] In some embodiments of any of the aspects, the second set of primers are specific to the first isothermal amplification product of step (a).
[0057] In some embodiments of any of the aspects, step (a) comprises a first isothermal amplification reaction, wherein the target nucleic acid and first set of primers produce the first isothermal amplification product.
[0058] In some embodiments of any of the aspects, step (b) comprises a second isothermal amplification reaction, wherein the first isothermal amplification product and second set of primers produce the second isothermal amplification product.
[0059] In some embodiments of any of the aspects, steps (a) and (b) are performed sequentially.
[0060] In some embodiments of any of the aspects, after step (a) and prior to step (b), the first isothermal amplification product is diluted, and the dilution is used for the second isothermal amplification reaction.
[0061] In some embodiments of any of the aspects, the first isothermal amplification product is diluted at least 1:400.
[0062] In some embodiments of any of the aspects, step (a) is performed in less than 10 minutes.
[0063] In some embodiments of any of the aspects, step (b) is performed in less than 30 minutes.
[0064] In some embodiments of any of the aspects, steps (a) and (b) are performed at room temperature.
[0065] In some embodiments of any of the aspects, the isothermal amplification reactions of steps (a) and (b) are selected from the group consisting of: Recombinase Polymerase Amplification (RPA), Loop Mediated Isothermal Amplification (LAMP), Helicase -dependent isothermal DNA amplification (HD A), Rolling Circle Amplification (RCA), and strand displacement amplification (SDA). [0066] In some embodiments of any of the aspects, the isothermal amplification reaction is Recombinase Polymerase Amplification (RPA).
[0067] In some embodiments of any of the aspects, steps (a) and (b) further comprise contacting the sample or the first isothermal amplification product with a recombinase.
[0068] In some embodiments of any of the aspects, the target nucleic acid is an RNA.
[0069] In some embodiments of any of the aspects, the target nucleic acid is a viral RNA.
[0070] In some embodiments of any of the aspects, prior to step (a) total RNA is isolated from the sample.
[0071] In some embodiments of any of the aspects, prior to step (a), the sample is contacted with a reverse transcription enzyme and a third set of primers.
[0072] In some embodiments of any of the aspects, the third set of primers comprises primers that bind to target RNA and non-target RNA in the sample.
[0073] In some embodiments of any of the aspects, the third set of primers comprises random hexamers.
[0074] In some embodiments of any of the aspects, the detection of step (c) is selected from the group consisting of: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
[0075] In one aspect, described herein is a kit for detecting a target nucleic acid using isothermal amplification reactions, comprising: (a) a first and second set of primers; and (b) a DNA polymerase. [0076] In some embodiments of any of the aspects, the kit is used to produce a first isothermal amplification product from the target nucleic acid and first set of primers using a first isothermal amplification reaction.
[0077] In some embodiments of any of the aspects, the kit is used to produce a second isothermal amplification product from the first isothermal amplification product and the second set of primers using a second isothermal amplification reaction.
[0078] In some embodiments of any of the aspects, the first and second set of primers are specific to the target nucleic acid.
[0079] In some embodiments of any of the aspects, the second set of primers are specific to the first isothermal amplification product produced by the first set of primers.
[0080] In some embodiments of any of the aspects, the kit further comprises a dilution reagent for diluting the first isothermal amplification product between the first and second isothermal amplification reactions.
[0081] In some embodiments of any of the aspects, the isothermal amplification reactions are selected from the group consisting of: Recombinase Polymerase Amplification (RPA), Loop Mediated Isothermal Amplification (LAMP), Helicase-dependent isothermal DNA amplification (HDA), Rolling Circle Amplification (RCA), and strand displacement amplification (SDA).
[0082] In some embodiments of any of the aspects, the isothermal amplification reaction is
Recombinase Polymerase Amplification (RPA).
[0083] In some embodiments of any of the aspects, the DNA polymerase is a strand-displacing DNA polymerase.
[0084] In some embodiments of any of the aspects, the strand-displacing DNA polymerase is selected from the group consisting of: Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase.
[0085] In some embodiments of any of the aspects, the strand-displacing DNA polymerase comprises Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase.
[0086] In some embodiments of any of the aspects, the kit further comprises a recombinase and single-stranded DNA binding protein.
[0087] In some embodiments of any of the aspects, the kit further comprises a reaction buffer and magnesium acetate.
[0088] In some embodiments of any of the aspects, the kit further comprises reagents for isolating nucleic acid from a sample.
[0089] In some embodiments of any of the aspects, the target nucleic acid is an RNA.
[0090] In some embodiments of any of the aspects, the target nucleic acid is a viral RNA.
[0091] In some embodiments of any of the aspects, the kit further comprises a reverse transcription enzyme.
[0092] In some embodiments of any of the aspects, the kit is used to reverse transcribe target RNA into DNA, and to amplify the DNA to a detectable second amplification product.
[0093] In some embodiments of any of the aspects, the kit further comprises for detecting the second amplification product, comprising reagents appropriate for a detection method selected from: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
[0094] In some embodiments of any of the aspects, the kit further comprises one or more lateral flow strips specific for the second amplification product.
[0095] In one aspect described herein is a method of detecting a target RNA in a sample, comprising: (a) contacting the sample with a reverse transcriptase, and a first set of primers; (b) contacting the sample with an RNA: DNA duplex-specific RNase; (c) contacting the sample with a DNA polymerase and a second set of primers; (d) contacting a first isothermal amplification product of step (c) with a DNA polymerase and a third set of primers; and (e) detecting a second isothermal amplification product from step (d).
[0096] In some embodiments of any of the aspects, the second and third set of primers are specific to the target nucleic acid.
[0097] In some embodiments of any of the aspects, the third set of primers are specific to the first isothermal amplification product of step (c).
BRIEF DESCRIPTION OF THE DRAWINGS
[0098] Fig. 1 is a dot plot showing a two pot rt-RPA experiment done in parallel with a one pot rt-RPA with DNA or RNA from an influenza megamer (H1N1) as an input. Both the RNA and DNA input concentrations were 10L4 molecules. 2 U/uL Protoscriptase® II was used in each reaction. In the two pot reactions the RT step was carried out for either 5 or 20 minutes. Then 1 pL from the RT reaction was transferred to the RPA reaction as the input. 1 pL of RNaseH at a concentration of 1.25 U was added at the start of the RPA reaction. The RPA was run for one hour in a one pot reaction and 30 min for the two pot reactions. Thus, the total reaction time for the one-pot RT-RPA reaction was 1 hour, and the total reaction time for the two-pot RT-RPA was 35 to 50 minutes (5 min or 20 min RT followed by 30 min RPA). The RPA products were then diluted 1: 1000 prior to being read by qPCR. RNaseH thus improves detection of influenza RNA.
[0099] Fig. 2 is a dot plot testing whether RNaseH improves detection in two pot reactions for HIV RNA at varying concentrations. For a two pot reaction the RNA was first reverse transcribed to DNA in a 20 pL volume for either 1 min or 5 min. Then 1 pL from the RT reaction was used as template for the RPA reaction, which was run for 10 min. In Fig. 2, 1 uL of RNaseH was added at a concentration of 0.5 U to the RPA reaction following the RT step. For the conditions without RNaseH, lpL of water was added to the RPA. The RPA products were diluted 1:200 before detection by qPCR. RNaseH thus improves the yield of a two-pot RT-RPA reaction, especially when the input RNA is at a low concentration.
[00100] Fig. 3 is a dot plot showing optimization of a one pot RPA reaction, using HIV as template. This experiment tested whether or not the addition of RNaseH would lower the Ct value measured by qPCR. HIV RNA was diluted to concentrations of 10L5, 10L4, 10L3, and 10L2 molecules/pL. A large master mix for the RPA reaction was prepared using six TwistDx™ pellets. This master mix omitted the RNaseH as well as the template. 9 pL was set aside for the negative control, water. The master mix was then split into four Eppendorfs to which template was added. The master mix was then distributed to 24 PCR tubes. RNaseH diluted to 0.5 U was added to the time 0 samples at RNA concentrations of 10L5, 10L4, 10L3, and 10L2 molecules/pL. RNaseH was either added at time 0 (RNaseH positive t=0), after 5 min of RPA (RNaseH positive t=5), or not added at all (RNaseH negative). For each of the conditions and concentrations or RNA two timepoints were tested for the RPA at 10 and 25 min. The RPA products were diluted 1:200 before detection by qPCR. RNaseH thus improves the yield of a one-pot RT-RPA reaction, especially when the input RNA is at a low concentration.
[00101] Fig. 4 is a bar graph showing testing of different concentrations of RNaseH and HIV RNA input. In this experiment the stock RNaseH was further diluted to test whether or not there was a more optimal concentration of RNaseH than 0.5 U. In this experiment the RPA reaction volumes were kept at 10 pL, the Protoscriptase® II was held at 20 U/pL, and 1 pL of diluted RNaseH was added to each one pot reaction. This experiment indicated that more concentrated RNaseH led to lower Ct values. The RPA products were diluted 1:200 before detection by qPCR. The left-right order of the bars for each concentration is the same as the top-down order of the legend.
[00102] Fig. 5 is a bar graph showing a test to see whether or not RNaseH performed optimally with a smaller dilution. For this experiment the RPA conditions were the same as in Fig. 4 and the RNaseH was diluted with less rehydration buffer. An additional condition of two different timepoints for the RPA reaction was included for 10 and 25 min reaction times. Lower RNaseH dilutions did not significantly differ from one another, however, the 1:2 dilution of RNaseH to rehydration buffer did appear to have a slightly lower Ct than the 1:10 dilution of RNaseH. The RPA products were diluted 1:200 before detection by qPCR.
[00103] Fig. 6 is a series of images of laminar flow test strips showing that viral transport media does not inhibit 1-pot RT-RPA-RNaseH of SARS-CoV-2 RNA.
[00104] Fig. 7A-7C shows a COVID-19 N-gene primer screen of 6 primer pairs by qPCR of RT- RPA. Fig. 7A shows a map of the COV-19 N-gene; different primer and probe sites were tested to improve sensitivity and specificity. Fig. 7B shows a gel, and Fig. 7C shows the qPCR summary of a 1-pot RT-RPA-RNaseH reaction. The criteria for the primer screen included: (1) the largest delta Ct differences between RPA H20 and the saturating condition, and (2) the least primer dimers. Primer pairs 3 and 4 were the best candidates. The left-right order of the bars for each concentration is the same as the top-down order of the legend.
[00105] Fig. 8 shows an exemplary schematic of a system as described herein.
[00106] Fig. 9 is an image of laminar flow strips showing detection of 10 molecules (1 loglO) of
SARS-CoV-2 RNA. The input was in vitro transcription (IVT) RNA of CoV-2 full length N gene.
The reaction was a 1-pot RT-RPA-RNaseH, using nested RPA primers (see e.g., Example 2). The resolution was near single molecule. The total time from inputting RNA to visualization was 30 minutes. The equipment requirements include 1 heat block at ~95°C, pipette, tips, 2 tubes, and reagents. The throughput for one technician is ~96 tests in 45 minutes, with prospects of even higher efficiency. The cost is under $5 per test, which could be decreased significantly.
[00107] Fig. 10A-10C is a series of images representative of a protocol described herein (see e.g., Example 2). Fig. 10A-10B are images showing proper spacing of reaction tubes or wells to avoid cross contamination. Fig. IOC is an image showing test strip results of positive controls (e.g., SARS- CoV-2) and negative controls (e.g., Middle East Respiratory Syndrome (MERS), SARS, and LEO). [00108] Fig. 11A-11D shows the development of FIND: an enhanced RT-RPA based assay for detection of SARS-CoV-2. (Fig. 11A) Screen for reverse transcriptase (RT) enzyme and effect of RNase H. SARS-CoV-2 RNA was amplified by RT-recombinase polymerase amplification (RT-RPA) using five different RTs with or without RNase H addition and the yield of each reaction was determined by quantitative PCR (qPCR). At least two biological and two technical replicates were used for each data point; numbers in each square represent mean log2 fold amplification. Samples labeled as zero yielded only non-specific amplification products. (Fig. 11B) Primer optimization screen. SARS-CoV-2 RNA was amplified by RT-RPA using forward and reverse primers specific to the S gene. The yield of each reaction was determined by qPCR using the same primer pair as for the RT-RPA reaction. Data represent mean log2 fold amplification from 2 technical replicates for each RNA input. (Fig. 11C) Lateral flow strip readout of RT-RPA reactions of SARS-CoV-2 RNA using primer pairs FP2/F AM-labeled RP1 and FP3/F AM-labeled RP1. All lateral flow strips contain a control (C) and test (T) band. (Fig. 11D) Schematic of FIND. Viral RNA is first copied to cDNA by RT, then degraded by RNase H. The cDNA product is amplified by RPA using a forward and a FAM labeled reverse pair of primers specific to the target sequence. The amplified material is then denatured and hybridized to a biotinylated probe. Dual FAM- and biotin-labeled products are detected on lateral flow strips.
[00109] Fig. 12A-12C shows the sensitivity and specificity of RNA detection. (Fig. 12A) Summary of FIND test results for detection of RNA from SARS-CoV-2 or from other viruses. Synthetic full genome SARS-CoV-2 RNA was amplified by FIND using primers targeting the N or S gene and reactions were read out by lateral flow strip. The specificity of FIND was tested against either in vitro transcribed (IVT) RNA of the related viruses MERS and SARS-CoV, or IVT RNA of the common cold coronaviruses HCoV-HKU 1 and HCoV-229E, or viral genomic RNA extracted from 2009 H1N1 Influenza. Data points represent positive (grey) or negative (black) FIND tests for each sample tested and are staggered on both axes for visualization. (Fig. 12B) Quantification of the synthetic full genome SARS-CoV-2 RNA used as input in the FIND assay by RT-qPCR. Data are Ct values determined using a one-step commercial RT-qPCR assay using primers targeting either the N or S gene of SARS-CoV-2. Data points at Ct=40 represent non-specific or no amplification. N gene and S gene data are offset on the x-axis for visualization purposes. (Fig. 12C) Lateral flow strip readouts for all N gene data shown in Fig. 12A. Individual strips are labeled with the test call made within 20 minutes of detection (positive (+) or negative (-)). The positive (Pos.) FIND control is 1,000 copies of synthetic full genome SARS-CoV-2 RNA and the negative (Neg.) FIND control is a water- only input. Images taken for the purpose of display were allowed to dry which reduced the intensity of some weak bands (labeled with asterisks). [00110] Fig. 13A-13H shows the lysis and detection of SARS-CoV-2 N gene from contrived samples. (Fig. 13A) Viral particle temperature lysis determination. AccuPlex™ packaged SARS- CoV-2 virus was diluted into TCEP buffer and heated for 5 min at the given temperature (see e.g., Methods). Released RNA was amplified by FIND and product formation was quantified by qPCR. (Fig. 13B) Detection of RNase activity of VTM. RNaseAlert™ was added to viral transport media (VTM) with or without the addition of RNasin Plus™ before heating for 5 min at 94°C or added to a 1 : 1 VTM and viral lysis buffer mix and incubating for 10 min at 25 °C. Data represent the average of 4 technical replicates and were determined by normalizing the fluorescence intensity 10 minutes after the heating step to a fully degraded control. (Fig. 13C) Schematic of sample processing of patient samples in VTM for input into FIND. (Fig. 13D) Heatmap displaying FIND test calls for detection of AccuPlex™ packaged SARS- CoV-2 lysed with conditions displayed in Fig. 13C. AccuPlex™ packaged SARS-CoV-2 virus was mixed 1:1 with VTM, PBS, or viral lysis buffer and incubated as shown. All samples included RNasin Plus. Values represent the number of positive test calls : number of negative test calls for each condition. (Fig. 13E) Inactivation of RNase activity in saliva by TCEP and heat. Saliva was first mixed 1:1 with a buffer containing 1 mM (black diamonds) or 100 mM (grey triangles) TCEP and heated at the indicated temperature for 5 min. After cooling, RNaseAlert™ was added and degradation was assessed as in Fig. 13B. (Fig. 13F) The combined activities of an RNase inhibitor and TCEP protect RNA from degradation in saliva. RNaseAlert™ was added to saliva diluted 1:1 with TCEP buffer containing an RNase inhibitor and treated as shown. RNaseAlert™ degradation was assessed an in Fig. 13B. See e.g., additional data in Fig. 17G. (Fig. 13G) Schematic of sample processing of patient saliva samples for input into FIND. (Fig. 13H) Heatmap displaying FIND test calls for detection of SARS-CoV-2 RNA or AccuPlex™ packaged virus from saliva treated as displayed in Fig. 13G. AccuPlex™ packaged SARS-CoV-2 virus or SARS-CoV-2 N gene IVT RNA were added to saliva and extracted as shown. Values represent the number of positive test calls : number of negative test calls for each condition.
[00111] Fig. 14A-14D shows the detection of SARS-CoV-2 in clinical samples using FIND. (Fig. 14 A) Schematic of the workflow for benchmarking FIND against RT-qPCR using patient samples. (Fig. 14B) Sampling of lateral flow strip readouts of SARS-CoV-2 N gene FIND tests of unextracted (Top) or extracted (Bottom) patient samples of known infection status. Unextracted patient samples were run in duplicates both by FIND (calls of positive (+) or negative (-) were made within 20 min of detection) and by one-step RT-qPCR (Ct values shown). See e.g., additional data in Fig. 18A. RNA was extracted from clinical samples according to standard procedure (see e.g., Methods) and was subsequently used as input to FIND and RT-qPCR. See e.g., additional data in Fig. 18B. (Fig. 14C) Summary of FIND test results of 51 patient samples and comparison to RT-qPCR. The y axis represents patient viral titer determined using a commercial one-step RT-qPCR assay from unextracted samples or extracted RNA samples with a standard curve. (Fig. 14D) (Left) Matched RT- qPCR Ct values of unextracted and extracted patient samples. (Right) Difference between extracted and unextracted Ct values for all patients. Patient samples were provided in multitrans media (black) or universal transport media (grey).
[00112] Fig. 15A-15D shows the development of FIND. (Fig. 15A) Organization of the SARS- CoV-2 genome and location of regions in the S and N genes targeted by FIND. Detailed mapping of the binding site of all forward and reverse primers tested in the primer optimization screen and of the biotin hybridization probe was shown for S gene only for display purposes. SARS-CoV-2 was aligned to the closely related SARS-CoV and MERS to identify regions of low homology which were targeted by primers and hybridization probes used in the assay. (Fig. 15B) Schematic of the workflow used for optimization of FIND. The cDNA product amplified by recombinase polymerase amplification (RPA) using forward and reverse unlabeled primers was quantified in a subsequent qPCR assay. (Fig. 15C) Comparison of the performance of Superscript IV® and ProtoScript II®. In vitro transcribed (IVT) N gene SARS-CoV-2 RNA was amplified by RT-RPA and reactions were read out on a lateral flow strip. (Fig. 15D) IVT N gene SARS-CoV-2 RNA was amplified by RT-RPA with or without RNase H addition and the yield of each reaction was determined by quantitative PCR. Data represent the average yield of two technical replicates and is staggered on the x axis for visualization purposes. [00113] Fig. 16A-16G shows the sensitivity and specificity of RNA detection. (Fig. 16A) Blinded and randomized plate layout used in FIND assays used for generation of the data displayed in Fig. 12A. (Fig. 16B) Lateral flow strip readouts for the S gene dataset displayed in Fig. 12A. Individual strips are labeled with the test call made within 20 minutes of detection (positive (+) or negative (-)). The positive (Pos.) FIND control is 1,000 copies of synthetic full genome SARS-CoV-2 RNA and the negative (Neg.) FIND control is a water-only input. Images taken for the purpose of display were allowed to dry which reduced the intensity of some weak bands (labeled with asterisks). (Fig. 16C) Heatmap displaying the rate of FIND test calls for detection of RNA from SARS-CoV-2 or from other viruses as shown in Fig. 12A. Values represent the number of positive test calls : number of negative test calls for each condition. (Fig. 16D- Fig. 16E) RT-qPCR quantification of in vitro transcribed (IVT) RNA from MERS, SARS- CoV, HCoV-229E, and HCoV-HKUl used as specificity control tests in FIND; N gene shown in Fig. 16D and S gene in Fig. 16E. (Fig. 16F) RT-qPCR quantification of RNA extracted from 2009 H1N1 Influenza. (Fig. 16G) Comparison of the specificity and sensitivity of two hybridization probes targeting SARS- CoV-2 N gene. IVT RNA from SARS-CoV- 2, MERS, or SARS-CoV was amplified by FIND. After splitting the reactions in half and hybridizing with a biotinylated probe as shown, each reaction was read out on a lateral flow strip. Individual strips are labeled with the test call made within 20 minutes of detection (positive (+) or negative (-)).
[00114] Fig. 17A-17G shows the optimization of sample processing conditions for detection of SARS-CoV-2 in clinical samples. (Fig. 17A) Heating VTM in presence of TCEP leads to formation of a gelatinous substance (highlighted by arrowhead). (Fig. 17B) Addition of RNase inhibitor to patient samples prior to heat inactivation increases the RNA titer as quantified by RT-qPCR. Unextracted known positive patient samples were heat inactivated for 5 min at 94°C with or without RNasin Plus. Viral RNA was quantified using a commercial one-step RT-qPCR assay. (Left) Ct values for matched samples with and without RNase inhibitor. (Right) Difference between Ct values in all matched samples. Error bars represent +/- 1 standard deviation. (Fig. 17C) Addition of RNase inhibitor to patient samples prior to heat inactivation increases the signal of the FIND assay. Heat inactivated samples prepared in Fig. 17B were tested using FIND. (Fig. 17D) TCEP and heat (not EDTA) are required to inactivate the RNase activity in saliva as determined using RNaseAlert™ assays. Saliva (or water control) was mixed 1 : 1 with a buffer containing TCEP and EDTA as shown. RNaseAlert™ was added and the sample was heated as indicated. RNase A was added to a set of water samples post addition of RNaseAlert™ as control. Data represent the average of 2 technical replicates and was determined from the fluorescence signal 10 minutes after the heating step normalized to a fully degraded control. (Fig. 17E) TCEP and heat irreversibly inactivate the RNase activity of saliva. Saliva was mixed 1 : 1 with a buffer containing TCEP and was processed as indicated. Data represent the average of 3 technical replicates and was determined as in Fig. 17D.
(Fig. 17F) RNase inhibitors protect RNA against degradation in saliva at low temperature only. Saliva was mixed 1 : 1 with a buffer containing an RNase inhibitor as shown. RNaseAlert™ was added and the sample heated as indicated. Data represent the fluorescence intensity 10 minutes after the heating step normalized to a fully degraded control. (Fig. 17G) The combined activities of an RNase inhibitor and TCEP protect RNA from degradation in saliva (additional data for Fig. 13F).
[00115] Fig. 18A-18E shows the detection of SARS-CoV-2 from unextracted and extracted clinical samples. (Fig. 18A-Fig. 18B) Lateral flow strip readouts of all FIND tests from unextracted (Fig. 18A) and extracted (Fig. 18B) patient samples summarized in Fig. 14D. Individual strips are labeled with the FIND test call made within 20 minutes of detection (positive (+) or negative (-)). The positive (Pos.) FIND control is 100 copies of synthetic full genome SARS-CoV-2 RNA and the negative (Neg.) FIND control is a water-only input. (Fig. 18C) Heatmap displaying the rate of positive FIND test calls for detection of SARS-CoV-2 N gene from the 51 patient samples as shown in Fig. 14D binned by RNA input determined by one step RT-qPCR. Values represent the number of positive test calls : number of negative test calls for each condition. (Fig. 18D) The one-step RT- qPCR assay was validated against the CDC N 1 RT-qPCR assay using synthetic SARS-CoV-2 RNA as input. (Fig. 18E) Comparison between the sensitivity of the CDC N1 RT-qPCR assay ran on 5 pL extracted sample and the one-step RT-qPCR assay ran on 2 pL extracted sample.
[00116] Fig. 19A-19D shows the detection of SARS-CoV-2 S gene from clinical samples. (Fig. 19A) Lateral flow strip readouts of S gene FIND performed on patient samples of known infection status. Individual strips are labeled with the test call made within 20 minutes of detection (positive (+) or negative (-)). The positive (Pos.) FIND control is 100 copies of synthetic full genome SARS-CoV- 2 RNA and the negative (Neg.) FIND control is a water-only input. Negative control samples 25-29 were not screened by RT-qPCR. (Fig. 19B) Comparison of Ct values obtained by RT-qPCR targeting SARS-CoV2 N and S genes on the same input patient samples. In the left panel, matched samples are connected by a solid line. Synthetic full genome SARS-CoV-2 RNA and AccuPlex™ packaged SARS-CoV-2 were used as controls as they both contain an equal amount of N and S gene. In the right panel, the difference between the Ct values for each patient sample is plotted and the error bar is +/- 1 standard deviation. (Fig. 19C- Fig. 19D) Sensitivity and specificity of S gene FIND on patient samples shown in Fig. 19A. (Fig. 19C) Comparison between S gene SARS-CoV-2 FIND and one- step RT-qPCR performed on the same input samples. The y axis is RNA copies in patient input samples determined by one-step RT-qPCR with standard curve. (Fig. 19D) Heatmap displaying the rate of FIND positive tests for detection of SARS-CoV-2 S gene in the 51 patient samples. Values represent the number of positive test calls : number of negative test calls for each condition.
[00117] Fig. 20 shows the equipment required for FIND assay. FIND only requires a limited set of equipment including micropipettes and disposable plastic tips, a heat block capable of reaching 42°C and 94°C, and plastic microtubes or multi-well plates.
DETAILED DESCRIPTION
[00118] Embodiments of the technology described herein comprise methods, kits, and systems for detecting a target RNA, such as a small amount of viral RNA. In one aspect, described herein are methods of detecting the target RNA. In other aspects, described herein are kits and systems suitable to practice the methods described herein to detect the target RNA.
Methods
[00119] In multiple aspects, described herein are methods of detecting a target RNA. The target RNA can be detected at the single molecular level using the methods, kits, and systems as described herein. The methods described herein comprise: (a) reverse transcribing the RNA target into complementary DNA (cDNA); (b) degrading the RNA target with an RNA:DNA duplex-specific RNase; (c) amplifying the cDNA to detectable levels; and (d) detecting the amplified cDNA using a method as described further herein or known in the art. Such methods result in an unexpectedly higher cDNA yield in a shorter timeframe than methods the inclusion of the RNA:DNA duplex-specific RNase. As such, these methods are particularly well-suited to detecting a small amount of target RNA in a limited time period.
[00120] Accordingly, in one aspect described herein is a method of detecting a target RNA in a sample, comprising: (a) contacting the sample with a reverse transcriptase, and a first set of primers; (b) contacting the sample with an RNA:DNA duplex-specific RNase; (c) contacting the sample with a DNA polymerase, a second set of primers, a recombinase, and single-stranded DNA binding protein; and (d) detecting an isothermal amplification product from step (c). [00121] In another aspect described herein is a method of detecting a target RNA in a sample, comprising: (a) contacting the sample with a reverse transcriptase, and a first set of primers; (b) contacting the sample with an RNA:DNA duplex-specific RNase; (c) contacting the sample with a DNA polymerase and a second set of primers; and (d) detecting an amplification product from step (c).
[00122] In some embodiments of any of the aspects, step (a) is also referred to as the reverse transcription (RT) step; step (b) is also referred to as the RNase step; step (c) is also referred to as the amplification or isothermal amplification step; and step (d) is also referred to as the detection step. In some embodiments of any of the aspects, steps (a), (b) and (c) are performed simultaneously in the same reaction (see e.g., Fig. 1, Fig. 3-5), which is also referred to herein as a “one pot” reaction or experiment. It is unexpected that such a one pot reaction would result in such high yields of detectable cDNA, wherein the RNA:DNA duplex-specific RNase is present in the same reaction as the RNA template. Without wishing to be bound by theory, it is proposed that the RNA target inhibits the amplification reaction of step (c); thus, removing the RNA target with the RNA:DNA duplex-specific RNase (e.g., at any time prior to or during the amplification) can permit the amplification reaction to proceed faster and with a higher yield of cDNA.
[00123] In some embodiments of any of the aspects, steps (a) and (b) are performed simultaneously in the same reaction; in other words, the RNA:DNA duplex-specific RNase is added during the reverse transcription step. In some embodiments of any of the aspects, step (c) is performed after steps (a) and (b). In some embodiments of any of the aspects, steps (a) and (b) are performed simultaneously in the same reaction, and step (c) is performed after steps (a) and (b). In some embodiments of any of the aspects, steps (b) and (c) are performed simultaneously in the same reaction; in other words, the RNA:DNA duplex-specific RNase is added during the amplification step. In some embodiments of any of the aspects, steps (b) and (c) are performed simultaneously in the same reaction, and step (a) is performed prior to steps (b) and (c). Such reactions, comprising a first step (e.g., (a) and (b), or (a)) and a second step (e.g., (c), or (b) and (c)) is also referred to herein as a “two pot” reaction or experiment (see e.g., Fig. 1-2).
[00124] In some embodiments of any of the aspects, steps (a), (b) and (c) are each performed in separate reactions, which can be referred to as a “three pot” reaction or experiment. In some embodiments of any of the aspects, step (a) is performed prior to steps (b) and (c). In some embodiments of any of the aspects, step (b) is performed after step (a) and prior to step (c). In some embodiments of any of the aspects, step (c) is performed after to steps (a) and (b). In some embodiments of any of the aspects, step (a) is performed prior to step (b), and step (b) is performed prior to step (c).
[00125] In some embodiments of any of the aspects, between any of the steps, the reaction product is diluted before being added to the next reaction step. In some embodiments of any of the aspects, the reaction product of step (a) is diluted prior to being added to step (b). In some embodiments of any of the aspects, the reaction product of step (a) is diluted prior to being added to simultaneous steps (b) and (c). In some embodiments of any of the aspects, the reaction product of simultaneous steps (a) and (b) is diluted prior to being added to step (c). In some embodiments of any of the aspects, the reaction product of step (b) is diluted prior to being added to step (c). In some embodiments of any of the aspects, the reaction product of step (c) (or simultaneous step (b) and (c); or simultaneous step (a), (b), and (c)) is diluted prior to being added to step (d).
[00126] In some embodiments of any of the aspects, the diluent comprises the reaction buffer of the next reaction or an aqueous solution. In some embodiments of any of the aspects, the dilution comprises a ratio of at least 4:5, at least 2:3, at least 1:2, at least 1:3, at least 1:4, at least 1:5, at least 1:6, at least 1:7, at least 1:8, at least 1:9, at least 1: 10, at least 1:20, at least 1:30, at least 1:40, at least 1:50, at least 1:60, at least 1:70, at least 1:80, at least 1:90, at least 1: 10, at least 1: 100, least 1:200, least 1:300, least 1:400, least 1:500, least 1:600, least 1:700, least 1:800, least 1:900, at least 1 : 103, at least 1 : 104, or at least 1 : 105, of reaction product to diluent.
[00127] In some embodiments of any of the aspects, steps (a), (b), (c), and/or (d) are performed between 12°C and 45°C. As a non-limiting example, steps (a), (b), (c), and/or (d) are performed at at least 12°C, at least 13°C, at least 14°C, at least 15°C, at least 16°C, at least 17°C, at least 18°C, at least 19°C, at least 20°C, at least 21°C, at least 22°C, at least 23°C, at least 24°C, at least 25°C, at least 26°C, at least 27°C, at least 28°C, at least 29°C, at least 30°C, at least 31°C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C, at least 38°C, at least 39°C, at least 40°C, at least 41°C, at least 42°C, at least 43°C, at least 44°C, at least 45°C.
[00128] In some embodiments of any of the aspects, steps (a), (b), (c), and/or (d) are performed at at most 12°C, at most 13°C, at most 14°C, at most 15°C, at most 16°C, at most 17°C, at most 18°C, at most 19°C, at most 20°C, at most 21°C, at most 22°C, at most 23°C, at most 24°C, at most 25°C, at most 26°C, at most 27°C, at most 28°C, at most 29°C, at most 30°C, at most 31°C, at most 32°C, at most 33°C, at most 34°C, at most 35°C, at most 36°C, at most 37°C, at most 38°C, at most 39°C, at most 40°C, at most 41°C, at most 42°C, at most 43°C, at most 44°C, at most 45°C.
[00129] In some embodiments of any of the aspects, steps (a), (b), (c), and/or (d) are performed at room temperature. As used herein, the term “room temperature” refers to the ambient temperature of a space, which is typically 20°C-22°C. In some embodiments of any of the aspects, steps (a), (b), (c), and/or (d) are performed at body temperature. As used herein, the term “body temperature” refers to the temperature of the subject such as that of a human subject, which is typically 37°C. In some embodiments of any of the aspects, steps (a), (b), (c), and/or (d) are performed on a heat block, which can be a Hybex® or any other heat block capable of maintaining a stable temperature. In some embodiments of any of the aspects, the heat block is set to approximately 42°C. [00130] In some embodiments of any of the aspects, steps (a), (b), (c), and/or (d) are performed faster than a method comprising steps (a), (c), and/or (d) without the RNA:DNA duplex-specific RNase. By “performed” in this context is meant that the method as carried out provides, in the time specified, sufficient amplified material to be detected. Thus, a method that is “performed faster” with RNA:DNA duplex-specific RNase provides sufficient amplified material to be detected faster or in a shorter time than the same method performed without the RNA:DNA duplex-specific RNase. In this context, “detected” refers to a determination of the presence of a target RNA in a sample. As used herein, the term “faster” (or “less time”) when used in the context of a reaction or a method of detecting an RNA means that the reaction provides product, e.g., sufficient amplified material to be detected/confirm the presence of a target in at least 10% less time than the same reaction performed without RNA:DNA duplex-specific RNase addition, e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or less time.
[00131] In some embodiments of any of the aspects, steps (a), (b), (c), and/or (d) are performed in at most 20 minutes. As a non-limiting example, steps (a), (b), (c), and/or (d) are performed in at most 5 minutes, at most 6 minutes, at most 7 minutes, at most 8 minutes, at most 9 minutes, at most 10 minutes, at most 15 minutes, at most 20 minutes, at most 25 minutes, at most 30 minutes, at most 40 minutes, at most 50 minutes, at most 60 minutes, at most 70 minutes, at most 80 minutes, at most 90 minutes, or at most 100 minutes. In some embodiments of any of the aspects, steps (a), (b), and (c) (e.g., RT-RPA with RNaseH) are performed in at most 20 minutes. In some embodiments of any of the aspects, steps (a), (b), and (c) (e.g., RT-RPA with RNaseH) are performed in at most 10 minutes. [00132] In some embodiments of any of the aspects, steps (a), (b), and/or (c) produce a higher yield of amplification product than a method comprising steps (a) and/or (c) without the RNA:DNA duplex-specific RNase. As used herein the term “higher yield of amplification product” refers to providing at least 10% more than a reaction performed in the same manner and for the same amount of time but without added RNA:DNA duplex-specific RNase, e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, two-fold, three-fold, four-fold, five-fold, ten-fold or more increase of amplification product. As a non-limiting example, steps (a), (b), and/or (c) produce at least a 1,000,000-fold increase in the yield of amplification product compared to a method comprising steps (a) and/or (c) without the RNA:DNA duplex-specific RNase. In some embodiments of any of the aspects, steps (a), (b), and/or (c) produce at least 2L25 to 2L30 molecules of amplification product.
RNA.DNA duplex-specific RNase
[00133] Described are methods, kits, and systems that can be used to detect a target RNA. In some embodiments of any of the aspects, target RNA in a complex with cDNA is degraded by an RNA:DNA duplex-specific RNase, while the cDNA is amplified and detected. Accordingly, the methods described herein comprise a step (b) (i.e., the RNase step) comprising contacting the sample with an RNA:DNA duplex-specific RNase.
[00134] In some embodiments of any of the aspects, an RNA:DNA duplex-specific RNase is included in one of the reaction steps described herein. As used herein, the term “RNA:DNA duplex- specific RNase” refers to an enzyme that specifically degrades RNA in a duplex comprising one strand of RNA and one strand of complementary DNA. The term “ribonuclease” can be used interchangeably with RNase. An RNA:DNA duplex-specific RNase does not degrade RNA in an RNA:RNA duplex. An RNA:DNA duplex-specific RNase does not degrade DNA in an DNA:RNA duplex or a DNA:DNA duplex. In some embodiments of any of the aspects, the RNA:DNA duplex- specific RNase degrades the RNA target that is complexed with cDNA. In some embodiments of any of the aspects, the RNA:DNA duplex-specific RNase degrades the RNA target after the cDNA has been synthesized by the reverse transcriptase cDNA.
[00135] In some embodiments of any of the aspects, the RNA:DNA duplex-specific RNase is provided as separate enzyme, e.g., from the reverse transcriptase or DNA polymerase. In some embodiments of any of the aspects, the RNA:DNA duplex-specific RNase is not comprised by (e.g., is not a domain of) the reverse transcriptase or DNA polymerase. In some embodiments of any of the aspects, the RNA:DNA duplex-specific RNase is not present as a contaminant of the reaction mixture. [00136] In some embodiments of any of the aspects, the RNA:DNA duplex-specific RNase is included in the reverse transcription step (i.e., step (a)). In some embodiments of any of the aspects, the RNA:DNA duplex-specific RNase is included in the amplification step (i.e., step (c)). In some embodiments of any of the aspects, the RNA:DNA duplex-specific RNase is included in its own separate reaction step (i.e., step (b)).
[00137] In some embodiments of any of the aspects, the RNA:DNA duplex-specific RNase is
RNaseH. RNase H (Ribonuclease H or RNH) is an endoribomiclease that specifically hydrolyzes the phosphodiester bonds of RNA, when hybridized to DNA. Members of the RNase H family can be found in nearly all organisms, from bacteria to archaea to eukaryotes.
[00138] The RNaseH family is divided into evolutionarily related groups with slightly different substrate preferences, broadly designated ribonuclease HI and H2. The human genome encodes both HI and H2. Human ribonuclease H2 is a heterotrimeric complex composed of three subunits. A third type “H3”, closely related to H2, is found only in a few prokaryotes, whereas HI and H2 occur in all domains of life. Additionally, RNase HI -like retroviral ribonuclease H domains occur in multi- domain reverse transcriptase proteins, which are encoded by retroviruses such as HIV and are required for viral replication.
[00139] Accordingly, in some embodiments of any of the aspects, the RNaseH used in the methods, kits, and systems described herein, is isolated or derived from a prokaryotic, archaeal, or eukaryotic RNaseH. In some embodiments of any of the aspects, the RNaseH used herein comprises an RNaseHl, RNaseH2, RNaseH3, or RNase Hl-like retroviral ribonuclease H domain.
[00140] In some embodiments of any of the aspects, the RNaseH is isolated or derived from an E. coli strain that carries the cloned RNase H gene (mh) from Escherichia coli. In some embodiments of any of the aspects, the RNaseH is encoded by a nucleic acid sequence comprising SEQ ID NO: 1 or a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 1 that maintains the same function (e.g., degradation of RNA in a RNA:DNA duplex) or a codon-optimized version of SEQ ID NO: 1. In some embodiments of any of the aspects, the RNaseH is encoded by a nucleic acid sequence comprising SEQ ID NO: 1 or a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 1 that maintains the same function.
[00141] In some embodiments of any of the aspects, the RNaseH comprises SEQ ID NO: 2 or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% similar to SEQ ID NO: 2 that maintains the same function (e.g., degradation of RNA in a RNA:DNA duplex). In some embodiments of any of the aspects, the RNaseH comprises SEQ ID NO: 2 or an amino acid sequence that is at least 95% similar to SEQ ID NO: 2 that maintains the same function.
[00142] In some embodiments of any of the aspects, the RNaseH comprises SEQ ID NO: 2 or an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 2 that maintains the same function (e.g., degradation of RNA in a RNA:DNA duplex). In some embodiments of any of the aspects, the RNaseH comprises SEQ ID NO: 2 or an amino acid sequence that is at least 95% identical to SEQ ID NO: 2 that maintains the same function.
[00143] SEQ ID NO: 1, Escherichia coli str. K-12 substr. MG1655, complete genome NCBI Reference Sequence: NC_000913.3 REGION: complement (235535-236002), Gene ID: 946955; 468 nucleotides (nt)
1 atgcttaaac aggtagaaat tttcaccgat ggttcgtgtc tgggcaatcc aggacctggg 61 ggttacggcg ctattttacg ctatcgcgga cgcgagaaaa cctttagcgc tggctacacc 121 cgcaccacca acaaccgtat ggagttgatg gccgctattg tcgcgctgga ggcgttaaaa 181 gaacattgcg aagtcatttt gagtaccgac agccagtatg tccgccaggg tatcacccag 241 tggatccata actggaaaaa acgtggctgg aaaaccgcag acaaaaaacc agtaaaaaat 301 gtcgatctct ggcaacgtct tgatgctgca ttggggcagc atcaaatcaa atgggaatgg 361 gttaaaggcc atgccggaca cccggaaaac gaacgctgtg atgaactggc tcgtgccgcg 421 gcgatgaatc ccacactgga agatacaggc taccaagttg aagtttaa [00144] SEQ ID NO: 2, ribonuclease HI [Escherichia coli str. K-12 substr. MG1655], NCBI Reference Sequence: NP_414750.1, 155 amino acids (aa)
1 mlkqveiftd gsclgnpgpg gygailryrg rektfsagyt rttnnrmelm aaivalealk 61 ehcevilstd sqyvrqgitq wihnwkkrgw ktadkkpvkn vdlwqrldaa lgqhqikwew 121 vkghaghpen ercdelaraa amnptledtg yqvev
[00145] In some embodiments of any of the aspects, the RNaseH is provided (i.e., added to the reaction mixture) at a concentration of 0.1 U/pL to 5 U/pL. As used herein, one unit (“U”) of RNaseH is defined as the amount of enzyme which produces 1 nmol acid-soluble ribonucleotides from[3H] poly (A) x poly(dT) in 20 minutes at +37 °C under the stated assay conditions. RNase H activity cab be assayed according to Hillenbrand and Staudenbauer (Nucleic Acids Res. 1982 Feb 11; 10(3): 833— 853).
[00146] As a non-limiting example, the RNaseH is provided at a concentration of at least 0.1 U/pL, at least 0.2 U/pL, at least 0.3 U/pL, at least 0.4 U/pL, at least 0.5 U/pL, at least 0.6 U/pL, at least 0.7 U/pL, at least 0.8 U/pL, at least 0.9 U/pL, at least 1.0 U/pL, at least 1.1 U/pL, at least 1.2 U/pL, at least 1.3 U/pL, at least 1.4 U/pL, at least 1.5 U/pL, at least 1.6 U/pL, at least 1.7 U/pL, at least 1.8 U/pL, at least 1.9 U/pL, at least 2.0 U/pL, at least 2.1 U/pL, at least 2.2 U/pL, at least 2.3 U/pL, at least 2.4 U/pL, at least 2.5 U/pL, at least 2.6 U/pL, at least 2.7 U/pL, at least 2.8 U/pL, at least 2.9 U/pL, at least 3.0 U/pL, at least 3.1 U/pL, at least 3.2 U/pL, at least 3.3 U/pL, at least 3.4 U/pL, at least 3.5 U/pL, at least 3.6 U/pL, at least 3.7 U/pL, at least 3.8 U/pL, at least 3.9 U/pL, at least 4.0 U/pL, at least 4.1 U/pL, at least 4.2 U/pL, at least 4.3 U/pL, at least 4.4 U/pL, at least 4.5 U/pL, at least 4.6 U/pL, at least 4.7 U/pL, at least 4.8 U/pL, at least 4.9 U/pL, at least 5.0 U/pL, at least 5.1 U/pL, at least 5.2 U/pL, at least 5.3 U/pL, at least 5.4 U/pL, at least 5.5 U/pL, at least 5.6 U/pL, at least 5.7 U/pL, at least 5.8 U/pL, at least 5.9 U/pL, at least 6.0 U/pL, at least 6.1 U/pL, at least 6.2 U/pL, at least 6.3 U/pL, at least 6.4 U/pL, at least 6.5 U/pL, at least 6.6 U/pL, at least 6.7 U/pL, at least 6.8 U/pL, at least 6.9 U/pL, at least 7.0 U/pL, at least 7.1 U/pL, at least 7.2 U/pL, at least 7.3 U/pL, at least 7.4 U/pL, at least 7.5 U/pL, at least 7.6 U/pL, at least 7.7 U/pL, at least 7.8 U/pL, at least 7.9 U/pL, at least 8.0 U/pL, at least 8.1 U/pL, at least 8.2 U/pL, at least 8.3 U/pL, at least 8.4 U/pL, at least 8.5 U/pL, at least 8.6 U/pL, at least 8.7 U/pL, at least 8.8 U/pL, at least 8.9 U/pL, at least 9.0 U/pL, at least 9.1 U/pL, at least 9.2 U/pL, at least 9.3 U/pL, at least 9.4 U/pL, at least 9.5 U/pL, at least 9.6 U/pL, at least 9.7 U/pL, at least 9.8 U/pL, at least 9.9 U/pL, at least 10 U/pL, at least 20 U/pL, at least 30 U/pL, at least 40 U/pL, or at least 50 U/pL. In some embodiments of any of the aspects, the RNaseH is provided at a concentration of 2.5 U/pL. In some embodiments of any of the aspects, the RNaseH is provided at a concentration of 5.0 U/pL.
[00147] In some embodiments of any the aspects, the RNaseH is added to a reaction mixture that totals (e.g., including the RNase) 10 pL. In embodiments wherein 1 pL of RNaseH is added to a total reaction volume of 10 pL. the final concentration of the RNaseH in the reaction mixture is a 1: 10 dilution of the concentration at which the RNaseH was provided. Accordingly, in some embodiments of any of the aspects, the final concentration of the RNaseH in the reaction mixture is at least 0.01 U/pL, at least 0.02 U/pL, at least 0.03 U/pL, at least 0.04 U/pL, at least 0.05 U/pL, at least 0.06 U/pL, at least 0.07 U/pL, at least 0.08 U/pL, at least 0.09 U/pL, at least 0.1 U/pL, at least 0.2 U/pL, at least 0.3 U/pL, at least 0.4 U/pL, at least 0.5 U/pL, at least 0.6 U/pL, at least 0.7 U/pL, at least 0.8 U/pL, at least 0.9 U/pL, at least 1.0 U/pL, at least 1.1 U/pL, at least 1.2 U/pL, at least 1.3 U/pL, at least 1.4 U/pL, at least 1.5 U/pL, at least 1.6 U/pL, at least 1.7 U/pL, at least 1.8 U/pL, at least 1.9 U/pL, at least 2.0 U/pL, at least 2.1 U/pL, at least 2.2 U/pL, at least 2.3 U/pL, at least 2.4 U/pL, at least 2.5 U/pL, at least 2.6 U/pL, at least 2.7 U/pL, at least 2.8 U/pL, at least 2.9 U/pL, at least 3.0 U/pL, at least 3.1 U/pL, at least 3.2 U/pL, at least 3.3 U/pL, at least 3.4 U/pL, at least 3.5 U/pL, at least 3.6 U/pL, at least 3.7 U/pL, at least 3.8 U/pL, at least 3.9 U/pL, at least 4.0 U/pL, at least 4.1 U/pL, at least 4.2 U/pL, at least 4.3 U/pL, at least 4.4 U/pL, at least 4.5 U/pL, at least 4.6 U/pL, at least 4.7 U/pL, at least 4.8 U/pL, at least 4.9 U/pL, at least 5.0 U/pL, at least 5.1 U/pL, at least 5.2 U/pL, at least 5.3 U/pL, at least 5.4 U/pL, at least 5.5 U/pL, at least 5.6 U/pL, at least 5.7 U/pL, at least 5.8 U/pL, at least 5.9 U/pL, at least 6.0 U/pL, at least 6.1 U/pL, at least 6.2 U/pL, at least 6.3 U/pL, at least 6.4 U/pL, at least 6.5 U/pL, at least 6.6 U/pL, at least 6.7 U/pL, at least 6.8 U/pL, at least 6.9 U/pL, at least 7.0 U/pL, at least 7.1 U/pL, at least 7.2 U/pL, at least 7.3 U/pL, at least 7.4 U/pL, at least 7.5 U/pL, at least 7.6 U/pL, at least 7.7 U/pL, at least 7.8 U/pL, at least 7.9 U/pL, at least 8.0 U/pL, at least 8.1 U/pL, at least 8.2 U/pL, at least 8.3 U/pL, at least 8.4 U/pL, at least 8.5 U/pL, at least 8.6 U/pL, at least 8.7 U/pL, at least 8.8 U/pL, at least 8.9 U/pL, at least 9.0 U/pL, at least 9.1 U/pL, at least 9.2 U/pL, at least 9.3 U/pL, at least 9.4 U/pL, at least 9.5 U/pL, at least 9.6 U/pL, at least 9.7 U/pL, at least 9.8 U/pL, at least 9.9 U/pL, at least 10 U/pL, at least 20 U/pL, at least 30 U/pL, at least 40 U/pL, or at least 50 U/pL. In some embodiments of any of the aspects, the final concentration of the RNaseH in the reaction mixture is 0.25 U/pL.
[00148] In some embodiments of any of the aspects, the RNase step (i.e., step (b)) is performed between 12°C and 45°C. As a non-limiting example, the RNase step is performed at at least 12°C, at least 13°C, at least 14°C, at least 15°C, at least 16°C, at least 17°C, at least 18°C, at least 19°C, at least 20°C, at least 21°C, at least 22°C, at least 23°C, at least 24°C, at least 25°C, at least 26°C, at least 27°C, at least 28°C, at least 29°C, at least 30°C, at least 31°C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C, at least 38°C, at least 39°C, at least 40°C, at least 41°C, at least 42°C, at least 43°C, at least 44°C, at least 45°C.
[00149] In some embodiments of any of the aspects, the RNase step is performed at at most 12°C, at most 13°C, at most 14°C, at most 15°C, at most 16°C, at most 17°C, at most 18°C, at most 19°C, at most 20°C, at most 21°C, at most 22°C, at most 23°C, at most 24°C, at most 25°C, at most 26°C, at most 27°C, at most 28°C, at most 29°C, at most 30°C, at most 31°C, at most 32°C, at most 33°C, at most 34°C, at most 35°C, at most 36°C, at most 37°C, at most 38°C, at most 39°C, at most 40°C, at most 41°C, at most 42°C, at most 43°C, at most 44°C, at most 45°C. In some embodiments of any of the aspects, the RNase step is performed at room temperature (e.g., 20°C-22°C). In some embodiments of any of the aspects, the RNase step is performed at body temperature (e.g., 37°C). In some embodiments of any of the aspects, the RNase step is performed on a heat block set to approximately 42°C.
[00150] In some embodiments of any of the aspects, the RNase step is performed at most 20 minutes. In some embodiments of any of the aspects, the RNase step is performed at most 5 minutes. As a non-limiting example, the RNase step is performed in at most 5 minutes, at most 6 minutes, at most 7 minutes, at most 8 minutes, at most 9 minutes, at most 10 minutes, at most 15 minutes, at most 20 minutes, at most 25 minutes, at most 30 minutes, at most 40 minutes, at most 50 minutes, at most 60 minutes, at most 70 minutes, at most 80 minutes, at most 90 minutes, or at most 100 minutes.
RNA Target
[00151] Described herein are methods, kits, and systems that can be used to detect a target RNA, which can also be referred to as “an RNA of interest.” Ribonucleic acid (RNA) is a polymeric nucleic acid molecule essential in various biological roles in coding, decoding, regulation and expression of genes. Each nucleotide in RNA contains a ribose sugar, with carbons numbered 1' through 5'. A base is attached to the G position, in general, adenine (A), cytosine (C), guanine (G), or uracil (U). A phosphate group is attached to the 3' position of one ribose and the 5' position of the next. The phosphate groups have a negative charge each, making RNA a charged molecule (polyanion). An important structural component of RNA that distinguishes it from DNA is the presence of a hydroxyl group at the 2' position of the ribose sugar. In some embodiments of any of the aspects, the target RNA can be any known type of RNA. In some embodiments of any of the aspects, the target RNA comprises an RNA selected from Table 5.
[00152] Table 5: Non-limiting Examples of Target RNAs
Figure imgf000023_0001
Figure imgf000024_0001
Figure imgf000025_0001
[00153] In some embodiments of any of the aspects, the target RNA can be detected at single molecular level. In some embodiments of any of the aspects, less than 10 molecules of the target RNA can be detected using the methods, kits, and systems described herein. As a non-limiting example, at least 1 molecule, at least 2 molecules, at least 3 molecules, at least 4 molecules, at least 5 molecules, at least 6 molecules, at least 7 molecules, at least 8 molecules, at least 9 molecules, at least 10 molecules, at least 20 molecules, at least 30 molecules, at least 40 molecules, at least 50 molecules, at least 60 molecules, at least 70 molecules, at least 80 molecules, at least 90 molecules, at least 10 molecules, at least 102 molecules, at least 103 molecules, at least 104 molecules, or at least 105 molecules of the target RNA can be detected using the methods, kits, or systems described herein. [00154] In some embodiments of any of the aspects, the target RNA can be a viral RNA. Accordingly in one aspect described herein is a method of detecting an RNA virus in a sample from a subject, comprising: (a) isolating viral RNA from the subject; and (a) performing the methods as described herein (e.g., reverse transcription, addition of an RNA:DNA duplex specific RNase, amplification, and detection).
[00155] As used herein, the term “RNA virus” refers to a virus comprising an RNA genome. In some embodiments of any of the aspects, the RNA virus is a double-stranded RNA virus, a positive- sense RNA virus, a negative-sense RNA virus, or a reverse transcribing virus (e.g., retrovirus).
[00156] In some embodiments of any of the aspects, the RNA virus is a Group III (i.e., double stranded RNA (dsRNA)) virus. In some embodiments of any of the aspects, the Group III RNA virus belongs to a viral family selected from the group consisting of: Amalgaviridae, Bimaviridae, Chrysoviridae, Cystoviridae, Endomaviridae, Hypoviridae, Megabimaviridae, Partitiviridae, Picobimaviridae, Reoviridae (e.g., Rotavirus), Totiviridae, Quadriviridae. In some embodiments of any of the aspects, the Group III RNA virus belongs to the Genus Botybimavirus. In some embodiments of any of the aspects, the Group III RNA virus is an unassigned species selected from the group consisting of: Botrytis porri RNA virus 1, Circulifer tenellus virus 1, Colletotrichum camelliae filamentous virus 1, Cucurbit yellows associated virus, Sclerotinia sclerotiorum debilitation-associated virus, and Spissistilus festinus virus 1.
[00157] In some embodiments of any of the aspects, the RNA virus is a Group IV (i.e., positive- sense single stranded (ssRNA)) virus. In some embodiments of any of the aspects, the Group IV RNA virus belongs to a viral order selected from the group consisting of: Nidovirales, Picomavirales, and Tymovirales. In some embodiments of any of the aspects, the Group IV RNA virus belongs to a viral family selected from the group consisting of: Arteriviridae, Coronaviridae (e.g., Coronavirus, SARS- CoV), Mesoniviridae, Roniviridae, Dicistroviridae, Iflaviridae, Mamaviridae, Picomaviridae (e.g., Poliovirus, Rhinovirus (a common cold virus), Hepatitis A virus), Secoviridae (e.g., sub Comovirinae), Alphaflexiviridae, Betaflexiviridae, Gammaflexiviridae, Tymoviridae, Alphatetraviridae, Alvemaviridae, Astroviridae, Bamaviridae, Benyviridae, Bromoviridae, Caliciviridae (e.g., Norwalk virus), Carmotetraviridae, Closteroviridae, Flaviviridae (e.g., Yellow fever virus, West Nile virus, Hepatitis C virus, Dengue fever virus, Zika virus), Fusariviridae, Hepeviridae, Hypoviridae, Leviviridae, Luteoviridae (e.g., Barley yellow dwarf virus), Polycipiviridae, Namaviridae, Nodaviridae, Permutotetraviridae, Potyviridae, Sarthroviridae, Statovirus, Togaviridae (e.g., Rubella virus, Ross River virus, Sindbis virus, Chikungunya virus), Tombusviridae, and Virgaviridae. . In some embodiments of any of the aspects, the Group IV RNA virus belongs to a viral genus selected from the group consisting of: Bacillariomavirus, Dicipivirus, Labymavirus, Sequiviridae, Blunervirus, Cilevirus, Higrevirus, Idaeovirus, Negevirus, Ourmiavirus, Polemovirus, Sinaivirus, and Sobemovirus. In some embodiments of any of the aspects, the Group IV RNA virus is an unassigned species selected from the group consisting of: Acyrthosiphon pisum virus, Bastrovirus, Blackford virus, Blueberry necrotic ring blotch virus, Cadicistrovirus, Chara australis virus, Extra small virus, Goji berry chlorosis virus, Hepelivirus, Jingmen tick virus, Le Blanc virus, Nedicistrovirus, Nesidiocoris tenuis virus 1, Niflavirus, Nylanderia ftilva virus 1, Orsay virus, Osedax japonicus RNA virus 1, Picalivirus, Plasmopara halstedii virus, Rosellinia necatrix fusarivirus 1, Santeuil virus, Secalivirus, Solenopsis invicta virus 3, Wuhan large pig roundworm virus. In some embodiments of any of the aspects, the Group IV RNA virus is a satellite virus selected from the group consisting of: Family Sarthroviridae, Genus Albetovirus, Genus Aumaivirus, Genus Papanivirus, Genus Virtovirus, and Chronic bee paralysis virus.
[00158] In some embodiments of any of the aspects, the RNA virus is a Group V (i.e., negative- sense ssRNA) virus. In some embodiments of any of the aspects, the Group V RNA virus belongs to a viral phylum or subphylum selected from the group consisting of: Negamaviricota, Haploviricotina, and Polyploviricotina. In some embodiments of any of the aspects, the Group V RNA virus belongs to a viral class selected from the group consisting of: Chunqiuviricetes, Ellioviricetes, Insthoviricetes, Milneviricetes, Monjiviricetes, and Yunchangviricetes. In some embodiments of any of the aspects, the Group V RNA virus belongs to a viral order selected from the group consisting of: Articulavirales, Bunyavirales, Goujianvirales, Jingchuvirales, Mononegavirales, Muvirales, and Serpentovirales. In some embodiments of any of the aspects, the Group V RNA virus belongs to a viral family selected from the group consisting of: Amnoonviridae (e.g., Taastrup virus), Arenaviridae (e.g., Lassa virus), Aspiviridae, Bomaviridae (e.g., Boma disease virus), Chuviridae, Cruliviridae, Feraviridae, Filoviridae (e.g., Ebola virus, Marburg virus), Fimoviridae, Hantaviridae, Jonviridae, Mymonaviridae, Nairoviridae, Nyamiviridae, Orthomyxoviridae (e.g., Influenza viruses), Paramyxoviridae (e.g., Measles virus, Mumps virus, Nipah virus, Hendra virus, and NDV), Peribunyaviridae, Phasmaviridae, Phenuiviridae, Pneumoviridae (e.g., RSV and Metapneumovirus), Qinviridae, Rhabdoviridae (e.g., Rabies virus), Sunviridae, Tospoviridae, and Yueviridae. In some embodiments of any of the aspects, the Group V RNA virus belongs to a viral genus selected from the group consisting of: Anphevirus, Arlivirus, Chengtivirus, Crustavirus, Tilapineviridae, Wastrivirus, and Deltavirus (e.g., Hepatitis D virus).
[00159] In some embodiments of any of the aspects, the RNA virus is a Group VI RNA virus, which comprise a virally encoded reverse transcriptase. In some embodiments of any of the aspects, the Group VI RNA virus belongs to the viral order Ortervirales. In some embodiments of any of the aspects, the Group VI RNA virus belongs to a viral family or subfamily selected from the group consisting of: Belpaoviridae, Caulimoviridae, Metaviridae, Pseudoviridae, Retroviridae (e.g., Retroviruses, e.g. HIV), Orthoretrovirinae, and Spumaretrovirinae. In some embodiments of any of the aspects, the Group VI RNA virus belongs to a viral genus selected from the group consisting of: Alpharetrovirus (e.g., Avian leukosis virus; Rous sarcoma virus), Betaretrovirus (e.g., Mouse mammary tumour virus), Bovispumavirus (e.g., Bovine foamy virus), Deltaretrovirus (e.g., Bovine leukemia virus; Human T-lymphotropic virus), Epsilonretrovirus (e.g., Walleye dermal sarcoma virus), Equispumavirus (e.g., Equine foamy virus), Felispumavirus (e.g., Feline foamy virus), Gammaretrovirus (e.g., Murine leukemia virus; Feline leukemia virus), Lentivirus (e.g., Human immunodeficiency virus 1; Simian immunodeficiency virus; Feline immunodeficiency virus), Prosimiispumavirus (e.g., Brown greater galago prosimian foamy virus), and Simiispumavirus (e.g., Eastern chimpanzee simian foamy virus).
[00160] In some embodiments of any of the aspects, the RNA virus is selected from influenza virus, human immunodeficiency virus (HIV), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). In some embodiments of any of the aspects, the RNA virus is influenza virus. In some embodiments of any of the aspects, the RNA virus is immunodeficiency virus (HIV). In some embodiments of any of the aspects, the RNA virus is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which causes coronavirus disease of 2019 (COVID19 or simply COVID). In some embodiments of any of the aspects, the RNA virus is any known RNA virus.
[00161] In some embodiments of any of the aspects, the target nucleic acid comprises at least a portion of Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2, (see e.g., complete genome, SARS-CoV-2 Jan. 2020/NC_045512.2 Assembly (wuhCorl)). In some embodiments of any of the aspects, the target nucleic acid comprises SEQ ID NO: 213 (Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2, N gene). In some embodiments of any of the aspects, the target nucleic acid comprises SEQ ID NO: 214 (Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2, S gene). In some embodiments of any of the aspects, the target nucleic acid comprises one of SEQ ID NOs: 213-214, or a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NO: 213-214 that maintains the same function or a codon-optimized version of SEQ ID NOs: 213-214. In some embodiments of any of the aspects, the target nucleic acid comprises one of SEQ ID NOs: 213-214, or a nucleic acid sequence that is at least 95% identical to one of SEQ ID NOs: 213-214 that maintains the same function.
[00162] SEQ ID NO: 213, Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, N nucleocapsid phosphoprotein, Gene ID: 43740575, 1260 bp ss-RNA, NC_045512 REGION: 28274-29533
ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCC
TCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACG
TCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGG
CAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTCCAATTAACACCAATAGCAGTC
CAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGT
AAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGC
TGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTT
GAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCT
ACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCG
GCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTC
CAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCT
CTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGC
CAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCC
TCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTG
GTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGAT
TACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATG
TCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATC
AAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATT
GACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTG
ATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCT
GCTGCAGATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCA
ACTCAGGCCTAA
[00163] SEQ ID NO: 214, Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, S surface glycoprotein, Gene ID: 43740568, 3822 bp ss-RNA, NC_045512 REGION: 21563-25384
Figure imgf000028_0001
Figure imgf000029_0002
CACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGA
TTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTA
CTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGA
TGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAAT
TACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGG
TTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGA
GAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGG
TTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTAC
CAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGT
GGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGT
TTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTT
GGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGAGATTCTT
GACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCT
AACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATG
Figure imgf000029_0001
CCAGATCCATCAAAACCAAGCAAGAGGTCATTTATTGAAGATCTACTTTTCAACAAAGTG
ACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATTGCCTTGGTGATATTGCTGCT AGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACA
GATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGG
ACCTTTGGTGCAGGTGCTGCATTACAAATACCATTTGCTATGCAAATGGCTTATAGGTTT
AATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACCAAAAATTGATTGCCAACCAA
TTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGA
AAACTTCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTT
AGCTCCAATTTTGGTGCAATTTCAAGTGTTTTAAATGATATCCTTTCACGTCTTGACAAAG
TTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCAGACTTCAAAGTTTGCAGACA
TATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCT
Figure imgf000030_0001
CTATCATCTTATGTCCTTCCCTCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACT
TATGTCCCTGCACAAGAAAAGAACTTCACAACTGCTCCTGCCATTTGTCATGATGGAAAA
GCACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACACACTGGTTTGTAACACAA
AGGAATTTTTATGAACCACAAATCATTACTACAGACAACACATTTGTGTCTGGTAACTGT
GATGTTGTAATAGGAATTGTCAACAACACAGTTTATGATCCTTTGCAACCTGAATTAGAC
TCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACATCACCAGATGTTGATTTA
GGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTC
AATGAGGTTGCCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTAT
GAGCAGTATATAAAATGGCCATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCC
ATAGTAATGGTGACAATTATGCTTTGCTGTATGACCAGTTGCTGTAGTTGTCTCAAGGGC
TGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAA
GGAGTCAAATTACATTACACATAA
[00164] In some embodiments of any of the aspects, the viral RNA is an RNA produced by a virus with a DNA genome, i.e., a DNA virus. As a non-limiting example the DNA virus is a Group I (dsDNA) virus, a Group II (ssDNA) virus, or a Group VII (dsDNA-RT) virus. In some embodiments of any of the aspects, the RNA produced by a DNA virus comprises an RNA transcript of the DNA genome.
Reverse Transcription
[00165] Described are methods, kits, and systems that can be used to detect a target RNA. In some embodiments of any of the aspects, the target RNA is reverse transcribed to a complementary DNA (cDNA) that is thereafter amplified and detected, while the target RNA is degraded by an RNA:DNA duplex-specific RNase. Accordingly, the methods described herein comprise a step (a) (i.e., the RT step) of contacting the sample with a reverse transcriptase and a first set of primers. In some embodiments of any of the aspects, the reverse transcription step and amplification step(s) are performed simultaneously in the same reaction, which can also be referred to as a “one-pot reaction”. [00166] The term “reverse transcriptase” (RT) refers to an RNA-dependent DNA polymerase used to generate complementary DNA (cDNA) from an RNA template. In some embodiments of any of the aspects, the cDNA is single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA). Reverse transcriptases are used by retroviruses to replicate their genomes, by retrotransposon mobile genetic elements to proliferate within the host genome, by eukaryotic cells to extend the telomeres at the ends of their linear chromosomes, and by some non-retroviruses such as the hepatitis B virus, a member of the Hepadnaviridae, which are dsDNA-RT viruses. Reverse transcriptases are also used in the synthesis of extrachromosomal DNA/RNA chimeric elements called multicopy single -stranded DNA (msDNA) in bacteria. Retroviral RT has three sequential biochemical activities: RNA-dependent DNA polymerase activity, ribonuclease H (RNAse H), and/or DNA-dependent DNA polymerase activity. Collectively, these activities enable the enzyme to convert single-stranded RNA into double- stranded cDNA. In some embodiments of any of the aspects, a retroviral RT is engineered to reduce or eliminate its RNaseH activity, which can result in a single stranded cDNA.
[00167] In some embodiments of any of the aspects, the reverse transcriptase can be any enzyme that can produce cDNA from an RNA transcript. In some embodiments of any of the aspects, the reverse transcriptase comprises a HIV-1 reverse transcriptase from human immunodeficiency virus type 1. In some embodiments of any of the aspects, the reverse transcriptase comprises M-MuLV reverse transcriptase from the Moloney murine leukemia virus (referred to as M-MuLV, M-MLV, or MMLV). In some embodiments of any of the aspects, the reverse transcriptase comprises AMV reverse transcriptase from the avian myeloblastosis virus (AVM). In some embodiments of any of the aspects, the reverse transcriptase comprises telomerase reverse transcriptase that maintains the telomeres of eukaryotic chromosomes. In some embodiments of any of the aspects, the reverse transcriptase is selected from those expressed by any Group VI or Group VII virus. In some embodiments of any of the aspects, the reverse transcriptase is a naturally occurring RT selected from the group consisting of: an M-MLV RT, an AMV RT, a retrotransposon RT, a telomerase reverse transcriptase, and an HIV-1 reverse transcriptase.
[00168] In some embodiments of any of the aspects, the reverse transcriptase is an engineered or recombinant version of an M-MuLV RT, AMV RT, or another naturally occurring RT as described herein. In some embodiments of any of the aspects, the reverse transcriptase is Proto Script® II Reverse Transcriptase, which is also referred to herein as ProtoScript® II RT or Protoscriptase II. ProtoScript® II RT is a recombinant Moloney Murine Leukemia Virus (M-MuLV) reverse transcriptase, e.g., a fusion of the Escherichia coli trpE gene with the central region of the M-MuLV pol gene.
[00169] In some embodiments of any of the aspects, the reverse transcriptase is selected from the group consisting of: Maxima® RT (e.g., Maxima H Minus® RT), Omniscript® RT, PowerScript® RT, Sensiscript® RT (SES), Superscript® II (SSII or SS2), Superscript® III (SSIII or SS3), Superscript® IV (SSIV), Accuscript® RT (ACC), a recombinant HIV RT, imProm-II® (IP2) RT, M- MLV RT (MML), Protoscript® RT (PRS), Smart MMLV (SML) RT, ThermoScript® (TSR) RT (see e.g., Levesque-Sergerie et al., BMC Molecular Biology volume 8, Article number: 93 (2007); Okello et al., PLoS One. 2010 Nov 10;5(l l):el3931). Non limiting examples of RTs derived from MMLV include PowerScript®, ACC, MML, SML, SS2, and SS3. Non limiting examples of RTs derived from AMV include PRS and TSR. Non limiting examples of RTs derived proprietary sources include IP2, SES, Omniscript®. In some embodiments of any of the aspects, reverse transcriptase exhibits increased thermostability (e.g., up to 48°C) compared to the wild type RT.
[00170] In some embodiments of any of the aspects, the reverse transcriptase is Superscript® IV. In some embodiments of any of the aspects, the reverse transcriptase is Maxima H Minus® RT. In some embodiments of any of the aspects, the reverse transcriptase is Superscript® III. In some embodiments of any of the aspects, the reverse transcriptase is MuLV. In some embodiments of any of the aspects, the reverse transcriptase is not Protoscript® II.
[00171] In some embodiments of any of the aspects, the reverse transcriptase exhibits reduced RNase H activity compared to the wild-type RT. For example, RT enzymes are often engineered with RNAse H minus point mutations to render them non-degrading to RNA. Accordingly, it is unexpected that including a separate RNaseH would increase the yield and decrease the time of the methods described herein.
[00172] As used herein, one unit (“U”) of reverse transcriptase (e.g., ProtoScript® II RT) is defined as is defined as the amount of enzyme that will incorporate 1 nmol of dTTP into acid- insoluble material in a total reaction volume of 50 mΐ in 10 minutes at 37°C using poly(rA)*oligo(dT)|X as template. In some embodiments of any of the aspects, the reverse transcriptase is provided at a concentration of at least 1 U/pL, at least 2 U/pL, at least 3 U/pL, at least 4 U/pL, at least 5 U/pL, at least 6 U/pL, at least 7 U/pL, at least 8 U/pL, at least 9 U/pL, at least 10 U/pL, at least 20 U/pL, at least 30 U/pL, at least 40 U/pL, at least 50 U/pL, at least 60 U/pL, at least 70 U/pL, at least 80 U/pL, at least 90 U/pL, at least 100 U/pL, at least 110 U/pL, at least 120 U/pL, at least 130 U/pL, at least 140 U/pL, at least 150 U/pL, at least 160 U/pL, at least 170 U/pL, at least 180 U/pL, at least 190 U/pL, at least 200 U/pL, at least 210 U/pL, at least 220 U/pL, at least 230 U/pL, at least 240 U/pL, at least 250 U/pL, at least 260 U/pL, at least 270 U/pL, at least 280 U/pL, at least 290 U/pL, at least 300 U/pL, at least 310 U/pL, at least 320 U/pL, at least 330 U/pL, at least 340 U/pL, at least 350 U/pL, at least 360 U/pL, at least 370 U/pL, at least 380 U/pL, at least 390 U/pL, at least 400 U/pL, at least 410 U/pL, at least 420 U/pL, at least 430 U/pL, at least 440 U/pL, at least 450 U/pL, at least 460 U/pL, at least 470 U/pL, at least 480 U/pL, at least 490 U/pL, or at least 500 U/pL. In some embodiments of any of the aspects, the reverse transcriptase is provided at a concentration of 20 U/pL. In some embodiments of any of the aspects, the reverse transcriptase is provided at a concentration of 200 U/pL. [00173] In some embodiments of any of the aspects, the sample is contacted with a first set of primers. In some embodiments of any of the aspects, the first set of primers comprises primers that bind to target RNA and non-target RNA in the sample, i.e., “general” primers. In some embodiments of any of the aspects, the first set of primers comprises random hexamers, i.e., a mixture of oligonucleotides representing all possible hexamer sequences. In some embodiments of any of the aspects, the first set of primers comprises oligo(dT) primer, which bind to the polyA tails of mRNAs or viral transcripts.
[00174] In some embodiments of any of the aspects, the first set of primers is specific to the target RNA. In some embodiments of any of the aspects, the first set of primers comprises the reverse primer of the second set of primers (e.g., used in the amplification step). In embodiments comprising a one-pot reaction, the first set of primers can comprise the second set of primers, or the second set of primers can comprise the first set of primers. In some embodiments of any of the aspects, the RT step comprises one round of polymerization, wherein the target RNA is reverse-transcribed into a single- stranded cDNA.
[00175] In some embodiments of any of the aspects, the reverse transcription step comprises contacting the sample with a reverse transcriptase, a first set of primers, and at least one of the following: a reaction buffer, water, magnesium acetate (or another magnesium compound such as magnesium chloride) dNTPs, DTT, and/or an RNase inhibitor. In some embodiments of any of the aspects, the reaction buffer maintains the reaction at specific optimal pH (e.g., 8.1) and can include such components as Tris(pH8.1), KC1, MgC12, and other buffers or salts. Magnesium ions (Mg2+) can function as a cofactor for polymerases, increasing their activity. Deoxynucleoside triphosphate (dNTPs) are free nucleoside triphosphates comprising deoxyribose as the sugar (e.g., dATP, dGTP, dCTP, and dTTP) that are used in the polymerization of the cDNA. Dithiothreitol (DTT) is a redox reagent used to stabilize proteins which possess free sulfhydryl groups (e.g., RT). In some embodiments of any of the aspects, the RNase inhibitor specifically inhibits RNases A, B and C, which specifically cleave ssRNA or dsRNA. RNase A and RNase B are an endoribomiclease that specifically degrades single-stranded RNA at C and U residues. RNase C recognizes dsRNA and cleaves it at specific targeted locations to transform them into mature RNAs. In some embodiments of any of the aspects, the RNase inhibitor does not specifically inhibit RNaseH. In some embodiments of any of the aspects, the RT reaction mixture does not comprise an RNaseH inhibitor.
[00176] In some embodiments of any of the aspects, the RT step (i.e., step (a)) is performed between 12°C and 45°C. As a non-limiting example, the RT step is performed at at least 12°C, at least 13°C, at least 14°C, at least 15°C, at least 16°C, at least 17°C, at least 18°C, at least 19°C, at least
20°C, at least 21°C, at least 22°C, at least 23°C, at least 24°C, at least 25°C, at least 26°C, at least
27°C, at least 28°C, at least 29°C, at least 30°C, at least 31°C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C, at least 38°C, at least 39°C, at least 40°C, at least 41°C, at least 42°C, at least 43°C, at least 44°C, at least 45°C.
[00177] In some embodiments of any of the aspects, the RT step is performed at at most 12°C, at most 13°C, at most 14°C, at most 15°C, at most 16°C, at most 17°C, at most 18°C, at most 19°C, at most 20°C, at most 21°C, at most 22°C, at most 23°C, at most 24°C, at most 25°C, at most 26°C, at most 27°C, at most 28°C, at most 29°C, at most 30°C, at most 31°C, at most 32°C, at most 33°C, at most 34°C, at most 35°C, at most 36°C, at most 37°C, at most 38°C, at most 39°C, at most 40°C, at most 41°C, at most 42°C, at most 43°C, at most 44°C, at most 45°C. In some embodiments of any of the aspects, the RT step is performed at room temperature (e.g., 20°C-22°C). In some embodiments of any of the aspects, the RT step is performed at body temperature (e.g., 37°C). In some embodiments of any of the aspects, the RT step is performed on a heat block set to approximately 42°C.
[00178] In some embodiments of any of the aspects, the RT step is performed in at most 1 minute. In some embodiments of any of the aspects, the RT step is performed in at most 5 minutes. In some embodiments of any of the aspects, the RT step is performed in at most 20 minutes. As a non-limiting example, the RT step is performed in at most 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, at most 6 minutes, at most 7 minutes, at most 8 minutes, at most 9 minutes, at most 10 minutes, at most 15 minutes, at most 20 minutes, at most 25 minutes, at most 30 minutes, at most 40 minutes, at most 50 minutes, at most 60 minutes, at most 70 minutes, at most 80 minutes, at most 90 minutes, or at most 100 minutes.
Amplification
[00179] Described are methods, kits, and systems that can be used to detect a target RNA. In some embodiments of any of the aspects, the cDNA resulting from the RT step is amplified to detectable levels, and the target RNA is degraded by an RNA:DNA duplex-specific RNase. In some embodiments, the target RNA is present a low starting amount, such that amplification is needed in order to detect the RNA. As used herein, “amplification” is defined as the production of additional copies of a nucleic acid sequence, i.e., for example, amplicons or amplification products. Methods of amplifying nucleic acid sequences are well known in the art. Such methods include, but are not limited to, isothermal amplification, polymerase chain reaction (PCR) and variants of PCR such as Rapid amplification of cDNA ends (RACE), ligase chain reaction (LCR), multiplex RT-PCR, immuno-PCR, SSIPA, Real Time RT-qPCR and nanofluidic digital PCR. Accordingly, the methods described herein comprise an amplification step (e.g., step (c)) of contacting the sample with a DNA polymerase and a second set of primers. In some embodiments of any of the aspects, the amplification step comprises contacting the cDNA with a DNA polymerase and a second set of primers. In some embodiments of any of the aspects, a set of primers comprises at least 2 primers and comprises a forward primer and reverse primer that amplify a target of 50 base pairs (bp) - 50,000 bp, unless indicated otherwise.
[00180] In some embodiments of any of the aspects, the amplification step permits an amplification reaction, such as polymerase chain reaction, as described further herein. In some embodiments of any of the aspects, the amplification step permits an isothermal amplification reaction. As used herein, “isothermal amplification” refers to amplification that occurs at a single temperature. Isothermal amplification is an amplification process that is performed at a single temperature or where the major aspect of the amplification process is performed at a single temperature. Generally, isothermal amplification relies on the ability of a polymerase to copy the template strand being amplified to form a bound duplex. In the multi-step PCR process the product of the reaction is heated to separate the two strands such that a further primer can bind to the template repeating the process. Conversely, the isothermal amplification relies on a strand displacing polymerase in order to separate/displace the two strands of the duplex and re-copy the template. The key feature that differentiates the isothermal amplification is the method that is applied in order to initiate the reiterative process. Broadly isothermal amplification can be subdivided into those methods that rely on the replacement of a primer to initiate the reiterative template copying and those that rely on continued re-use or de novo synthesis of a single primer molecule.
[00181] Isothermal amplification permits rapid and specific amplification of DNA at a constant temperature. In general, isothermal amplification is comprised of (i) sequence -specific hybridization of primers to specific genes or sequences within a nucleic acid sample or library, (ii) subsequent amplification involving multiple rounds of primer annealing, elongation, and strand displacement (as a non-limiting example, using a combination of recombinase, single-stranded binding proteins, and DNA polymerase), and (iii) detection of the product. In some embodiments of any of the aspects, the isothermal amplification produce can be detected through such methods as sequencing to confirm the identity of the amplified product or general assays such as turbidity. In some types of isothermal amplification, turbidity results from pyrophosphate byproducts produced during the reaction; these byproducts form a white precipitate that increases the turbidity of the solution. The primers used in isothermal amplification are oligonucleotides of sufficient length and appropriate sequence to provide initiation of polymerization, i.e. each primer is specifically designed to be complementary to a strand of the template (e.g., target cDNA) to be amplified. In contrast to the polymerase chain reaction (PCR) technology in which the reaction is carried out with a series of alternating temperature steps or cycles, isothermal amplification is carried out at one temperature, and does not require a thermal cycler or thermostable enzymes.
[00182] Non-limiting examples of isothermal amplification include: Recombinase Polymerase Amplification (RPA), Loop Mediated Isothermal Amplification (LAMP), Helicase-dependent isothermal DNA amplification (HD A), Rolling Circle Amplification (RCA), Nucleic acid sequence- based amplification (NASBA), strand displacement amplification (SDA), nicking enzyme amplification reaction (NEAR), and polymerase Spiral Reaction (PSR). See e.g., Yan et al.,
Isothermal amplified detection of DNA and RNA, March 2014, Molecular BioSystems 10(5), DOI: 10.1039/c3mb70304e, the content of which is incorporated herein by reference in its entirety.
[00183] In some embodiments of any of the aspects, the isothermal amplification reaction of step (c) is Recombinase Polymerase Amplification (RPA). RPA is a low temperature DNA and RNA amplification technique. The RPA process employs three core enzymes - a recombinase, a single- stranded DNA-binding protein (SSB) and strand-displacing polymerase. Recombinases are capable of pairing oligonucleotide primers with homologous sequence in duplex DNA. SSB bind to displaced strands of DNA and prevent the primers from being displaced. Finally, the strand displacing polymerase begins DNA synthesis where the primer has bound to the target DNA. By using two opposing primers, much like PCR, if the target sequence is indeed present, an exponential DNA amplification reaction is initiated. No other sample manipulation such as thermal or chemical melting is required to initiate amplification. At optimal temperatures (e.g., 37-42 °C), the RPA reaction progresses rapidly and results in specific DNA amplification from just a few target copies to detectable levels, typically within 10 minutes, for rapid detection of the target nucleic acid. In some embodiments of any of the aspects, the single-stranded DNA-binding protein is a gp32 SSB protein.
In some embodiments of any of the aspects, the recombinase is a uvsX recombinase. See e.g., US Patent 7,666,598, the content of which is incorporated herein by reference in its entirety. In some embodiments of any of the aspects, RPA can also be referred to as Recombinase Aided Amplification (RAA). Accordingly, in some embodiments of any of the aspects, the amplification step further comprises contacting the sample with a recombinase and single -stranded DNA binding protein. In some embodiments of any of the aspects, the amplification step comprises contacting the sample (or cDNA) with a DNA polymerase, a set of primers, a recombinase, and single-stranded DNA binding protein.
[00184] In some embodiments of any of the aspects, the isothermal amplification reaction of step (c) is Loop Mediated Isothermal Amplification (LAMP). LAMP is a single tube technique for the amplification of DNA; LAMP uses 4-6 primers, which form loop structures to facilitate subsequent rounds of amplification. Accordingly, in some embodiments of the aspects, the amplification step comprises contacting the sample (e.g., cDNA) with a DNA polymerase and a set of primers, wherein the set of primers comprises 4, 5, or 6 loop-forming primers.
[00185] In some embodiments of any of the aspects, the isothermal amplification reaction of step (c) is Helicase-dependent isothermal DNA amplification (HD A). HDA uses the double-stranded DNA unwinding activity of a helicase to separate strands for in vitro DNA amplification at constant temperature. In some embodiments of any of the aspects, the helicase is a thermostable helicase, which can improve the specificity and performance of HDA; as such, the isothermal amplification reaction(s) can be thermophilic helicase-dependent amplification (tHDA). As a non-limiting example, the helicase is the thermostable UvrD helicase (Tte-UvrD), which is stable and active from 45 to 65 °C. Accordingly, in some embodiments of the aspects, the amplification step comprises contacting the sample (e.g., cDNA) with a DNA polymerase, a set of primers, and a helicase, wherein the helicase is optionally a thermostable helicase.
[00186] In some embodiments of any of the aspects, the isothermal amplification reaction of step (c) is Rolling Circle Amplification (RCA). RCA starts from a circular DNA template and a short DNA or RNA primer to form a long single stranded molecule. Accordingly, in some embodiments of the aspects, the amplification step comprises contacting the sample (e.g., a circular cDNA) with a DNA polymerase and a set of primers, wherein the set of primers comprises a single primer.
[00187] In some embodiments of any of the aspects, the isothermal amplification reaction of step (c) is Nucleic acid sequence-based amplification (NASBA), which is also known as transcription mediated amplification (TMA). NASBA is an isothermal technique predominantly used for the amplification of RNA through the cyclic formation of complimentary DNA and destruction of original RNA sequence (e.g., using RNase H). The NASBA reaction mixture contains three enzymes — reverse transcriptase (RT), RNase H, and T7 RNA polymerase — and two primers. T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5' 3' direction. Primer 1 (PI) contains a 3' terminal sequence that is complementary to a sequence on the target nucleic acid and a 5' terminal (+)sense sequence of a promoter that is recognized by the T7 RNA polymerase. Primer 2 (P2) contains a sequence complementary to the PI -primed DNA strand. The NASBA enzymes and primers operate in concert to amplify a specific nucleic acid sequence exponentially. NASBA results in the amplification of the target RNA to cDNA to RNA to cDNA, etc., with alternating reverse transcription (e.g., RNA to DNA) and transcription steps (e.g., DNA to RNA), and the RNA being degraded after each transcription. The RT and RNase methods described herein (e.g., steps (a) and (b)) do not require a transcription step, nor do they require a DNA to RNA polymerase. While steps (a) and (b) are thus distinct from NASBA, the amplification step as described herein can comprise NASBA. Accordingly, in some embodiments of the aspects, the amplification step comprises contacting the sample (e.g., a cDNA) with an RNA polymerase, a reverse transcriptase, RNaseH, and a set of primers, wherein the set of primers comprise a 5’ sequence that is recognized by the RNA polymerase.
[00188] In some embodiments of any of the aspects, the isothermal amplification reaction of the amplification step is Strand Displacement Amplification (SDA). SDA is an isothermal, in vitro nucleic acid amplification technique based upon the ability of the restriction endonuclease Hindi to nick the unmodified strand of a hemiphosphorothioate form of its recognition site, and the ability of exonuclease deficient klenow (exo-klenow) DNA polymerase to extend the 3 '-end at the nick and displace the downstream DNA strand. Exponential amplification results from coupling sense and antisense reactions in which strands displaced from a sense reaction serve as target for an antisense reaction and vice versa. Accordingly, in some embodiments of the aspects, the amplification step comprises contacting the sample (e.g., cDNA) with a DNA polymerase (e.g., exo-klenow), a set of primers, and a restriction endonuclease (e.g., HincII).
[00189] In some embodiments of any of the aspects, the isothermal amplification reaction(s) is nicking enzyme amplification reaction (NEAR), which is a similar approach to SDA. In NEAR, DNA is amplified at a constant temperature (e.g., 55 °C to 59 °C) using a polymerase and nicking enzyme. The nicking site is regenerated with each polymerase displacement step, resulting in exponential amplification. Accordingly, in some embodiments of the aspects, the amplification step(s) comprises contacting the sample with a DNA polymerase (e.g., exo-klenow), a set of primers, and a nicking enzyme (e.g., N.BstNBI).
[00190] In some embodiments of any of the aspects, the isothermal amplification reaction(s) is Polymerase Spiral Reaction (PSR). The PSR method employs a DNA polymerase (e.g., Bst) and a pair of primers. The forward and reverse primer sequences are reverse to each other at their 5’ end, whereas their 3’ end sequences are complementary to their respective target nucleic acid sequences. The PSR method is performed at a constant temperature 61 °C-65 °C, yielding a complicated spiral structure. Accordingly, in some embodiments of the aspects, the amplification step(s) comprises contacting the sample with a DNA polymerase (e.g., exo-klenow) and a set of primers that are reverse to each other at their 5’ end.
[00191] In some embodiments of any of the aspects, the isothermal amplification reaction(s) is polymerase cross-linking spiral reaction (PCLSR). PCLSRuses three primers (e.g., two outer-spiral primers and a cross-linking primer) to produce three independent prerequisite spiral products, which can be cross-linked into a final spiral amplification product. Accordingly, in some embodiments of the aspects, the amplification step(s) comprises contacting the sample with a DNA polymerase and a set of primers (e.g., two outer-spiral primers and a cross-linking primer).
[00192] In some embodiments of any of the aspects, the DNA polymerase used in the amplification step is a strand-displacing polymerase. The term strand displacement describes the ability to displace downstream DNA encountered during synthesis. In some embodiments of any of the aspects, at least one (e.g. 1, 2, 3, or 4) strand-displacing DNA polymerase is selected from the group consisting of: Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase. In some embodiments of any of the aspects, the amplification step comprising contacting the sample (e.g., cDNA) with the strand-displacing DNA polymerases Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase.
[00193] In some embodiments of any of the aspects, the DNA polymerase is provided (i.e., added to the reaction mixture) at a sufficient concentration to promote polymerization, e.g., 0.1 U/pL to 100 U/pL. As used herein, one unit (“U”) of DNA polymerase is defined as the amount of enzyme that will incorporate 10 nmol of dNTP into acid insoluble material in 30 minutes at 37°C.
[00194] In some embodiments of any of the aspects, the sample is contacted with a second set of primers (i.e., after the first set of RT primers). In some embodiments of any of the aspects, the second set of primers is specific to the target RNA. In some embodiments of any of the aspects, the second set of primers is specific (i.e., binds specifically through complementarity) to cDNA, in other words, the DNA produced in the RT step that is complementary to the target RNA. The second set of primers can be specific to any region of the target RNA. SEQ ID NOs: 3-70 are non-limiting examples of nucleic acids (e.g., primers, probes, etc.) that are specific for SARS-CoV-2. SEQ ID NOs: 3-14, 21- 26, 70-71, 79-102, 105-138, 190, and 192 are non-limiting examples of primers that are specific for SARS-CoV-2 and can be included in any of the primer sets described herein. In some embodiments of any of the aspects, a set of primers as described herein is selected from Table 18 or 19.
[00195] Table 6: Exemplary nucleic acids for use in detecting SARS-CoV-2
Figure imgf000039_0001
Figure imgf000040_0001
Figure imgf000041_0001
Figure imgf000042_0001
Figure imgf000043_0001
Figure imgf000044_0001
Figure imgf000045_0001
Figure imgf000046_0001
Figure imgf000047_0001
Figure imgf000048_0001
[00196] In some embodiments of any of the aspects, a method, kit, or system as described herein comprises a nucleic acid sequence comprising at least one of SEQ ID NOs: 3-210 or a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NOs: 3-210 that maintains the same function (e.g., primers for CoV- 2). a method, kit, or system as described herein comprises a nucleic acid sequence comprising at least one of SEQ ID NOs: 3-210 or a nucleic acid sequence that is at least 95% identical to one of SEQ ID NOs: 3-210 that maintains the same function. [00197] In some embodiments of any of the aspects, the set of amplification primers is selected from Table 6. In some embodiments of any of the aspects, the set of amplification primers comprises at least one (e.g., 1, 2, 3, 4, 5, or more) primer selected from SEQ ID NOs: 3-14, 21-26, 38-53, 70-71, 79-102, 105-138, 190, 192 or a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NOs: 3-14, 21-26, 38-53, 70-71, 79-102, 105-138, 190, 192 that maintains the same function (e.g., primers for CoV-2). In some embodiments of any of the aspects, the set of amplification primers comprises at least one (e.g., 1, 2, 3, 4, 5, or more) primer selected from SEQ ID NOs: 3-14, 21-26, 38-53, 70-71, 79-102, 105-138, 190, 192 or a nucleic acid sequence that is at least 95% identical to one of SEQ ID NOs: 3-14, 21-26, 38- 53, 70-71, 79-102, 105-138, 190, 192 that maintains the same function.
[00198] Table 18: Exemplary Primer Sets (each number corresponds to a SEQ ID NO, see e.g., Table 6); “FW” indicates a forward primer, “RV” indicates a reverse primer.
Figure imgf000049_0001
[00199] Table 19: Exemplary Primer Sets (each number corresponds to a SEQ ID NO, see e.g., Table 6); “FW” indicates a forward primer, “RV” indicates a reverse primer.
Figure imgf000049_0002
[00200] In some embodiments, the RNA target is SARS-CoV-2 N-gene. In some embodiments, the amplification primer set comprises JQ217 (SEQ ID NO: 6) and JQ223 (SEQ ID NO: 12). In some embodiments, the amplification product comprises:
CAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGG CAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCC A (SEQ ID NO: 211). In some embodiments, the probe is JQ241 (SEQ ID NO: 30). [00201] In some embodiments, the RNA target is SARS-CoV-2 S-gene. In some embodiments, the amplification primer set comprises CCMS055 (SEQ ID NO: 119) and CCMS067 (SEQ ID NO: 131). In some embodiments, the amplification product comprises:
TCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTA CCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGAT CCTCAGTTTTACATTC (SEQ ID NO: 212). In some embodiments, the probe is CCMS069 (SEQ ID NO: 170).
[00202] In some embodiments of any of the aspects, a primer comprises a detectable marker as described herein (e.g., FAM). In some embodiments of any of the aspects, SEQ ID NOs: 9-14 are unlabeled primers (i.e., do not comprise a detectable label). In some embodiments of any of the aspects, SEQ ID NOs: 9-14 further comprise a detectable label as described herein. In some embodiments of any of the aspects, SEQ ID NOs: 21-26 are labeled primers (i.e., comprise a detectable label, e.g., FAM). In some embodiments of any of the aspects, SEQ ID NOs: 9 and 21 can be used interchangeably. In some embodiments of any of the aspects, SEQ ID NOs: 10 and 22 can be used interchangeably. In some embodiments of any of the aspects, SEQ ID NOs: 11 and 23 can be used interchangeably. In some embodiments of any of the aspects, SEQ ID NOs: 12 and 24 can be used interchangeably. In some embodiments of any of the aspects, SEQ ID NOs: 13 and 25 can be used interchangeably. In some embodiments of any of the aspects, SEQ ID NOs: 14 and 26 can be used interchangeably.
[00203] In some embodiments of any of the aspects, one of SEQ ID NOs: 105-115, 133-138 or a nucleic acid comprising a sequence that is at least 95% identical to one of SEQ ID NOs: 105-115 or 133-138 that maintains the same function can be used interchangeably with SEQ ID NO: 6. In some embodiments of any of the aspects, a set of amplification primers comprises: SEQ ID NOs: 6 and 25 (e.g., JQ217 and JQ236); SEQ ID NOs: 105 and 25 (e.g., CCMS041 and JQ236); SEQ ID NOs: 111 and 25 (e.g., CCMS047 and JQ236); or SEQ ID NOs: 115 and 25 (e.g., CCMS051 and JQ236). [00204] In some embodiments of any of the aspects, the sample is contacted with a DNA polymerase, a second set of primers, and at least one of the following: reaction buffer (e.g., hydration buffer), water, and/or magnesium acetate. In some embodiments of any of the aspects, the sample is contacted with a DNA polymerase, a second set of primers, a recombinase, single -stranded DNA binding protein, and at least one of the following: reaction buffer (e.g., hydration buffer), water, and/or magnesium acetate. In some embodiments of any of the aspects, the recombinase and/or ssDNA binding protein are provided in an “RPA pellet” that is dissolved with rehydration buffer and/or water.
[00205] In some embodiments of any of the aspects, the isothermal amplification step (i.e., the amplification step) is performed is 12°C and 45°C. As anon-limiting example, the amplification step is performed at at least 12°C, at least 13°C, at least 14°C, at least 15°C, at least 16°C, at least 17°C, at least 18°C, at least 19°C, at least 20°C, at least 21°C, at least 22°C, at least 23°C, at least 24°C, at least 25°C, at least 26°C, at least 27°C, at least 28°C, at least 29°C, at least 30°C, at least 31°C, at least 32°C, at least 33°C, at least 34°C, at least 35°C, at least 36°C, at least 37°C, at least 38°C, at least 39°C, at least 40°C, at least 41°C, at least 42°C, at least 43°C, at least 44°C, at least 45°C.
[00206] In some embodiments of any of the aspects, the amplification step is performed at at most 12°C, at most 13°C, at most 14°C, at most 15°C, at most 16°C, at most 17°C, at most 18°C, at most 19°C, at most 20°C, at most 21°C, at most 22°C, at most 23°C, at most 24°C, at most 25°C, at most 26°C, at most 27°C, at most 28°C, at most 29°C, at most 30°C, at most 31°C, at most 32°C, at most 33°C, at most 34°C, at most 35°C, at most 36°C, at most 37°C, at most 38°C, at most 39°C, at most 40°C, at most 41°C, at most 42°C, at most 43°C, at most 44°C, at most 45°C. In some embodiments of any of the aspects, the amplification step is performed at room temperature (e.g., 20°C-22°C). In some embodiments of any of the aspects, the amplification step is performed at body temperature (e.g., 37°C). In some embodiments of any of the aspects, the amplification step is performed on a heat block set to approximately 42°C.
[00207] In some embodiments of any of the aspects, the amplification step is performed in at most 10 minutes. In some embodiments of any of the aspects, the amplification step is performed in at most 25 minutes. As a non-limiting example, the amplification step is performed in at most 5 minutes, at most 6 minutes, at most 7 minutes, at most 8 minutes, at most 9 minutes, at most 10 minutes, at most 15 minutes, at most 20 minutes, at most 25 minutes, at most 30 minutes, at most 40 minutes, at most 50 minutes, at most 60 minutes, at most 70 minutes, at most 80 minutes, at most 90 minutes, or at most 100 minutes.
Sample Preparation
[00208] Described herein are methods, kits, and systems permitting detection of a target RNA from a sample. The term “sample” or “test sample” as used herein denotes a sample taken or isolated from a biological organism, e.g., a subject in need of testing. In some embodiments of any of the aspects, the technology described herein encompasses several examples of a biological sample, including but not limited to a sputum sample, a pharyngeal sample, or a nasal sample. In some embodiments of any of the aspects, the biological sample is cells, or tissue, or peripheral blood, or bodily fluid. Exemplary biological samples include, but are not limited to, a biopsy, a tumor sample, biofluid sample; blood; serum; plasma; urine; semen; mucus; tissue biopsy; organ biopsy; synovial fluid; bile fluid; cerebrospinal fluid; mucosal secretion; effusion; sweat; saliva; and/or tissue sample etc. The term also includes a mixture of the above-mentioned samples. The term “test sample” also includes untreated or pretreated (or pre-processed) biological samples. In some embodiments of any of the aspects, a test sample can comprise cells from a subject. [00209] In some embodiments of any of the aspects, the sample is contacted with a transport media, such a viral transport media (VTM). In some embodiments of any of the aspects, transport media preserves the target RNA between the time of sample collection and detection of the target RNA. The constituents of suitable viral transport media are designed to provide an isotonic solution containing protective protein, antibiotics to control microbial contamination, and one or more buffers to control the pH. Isotonicity, however, is not an absolute requirement; some highly successful transport media contain hypertonic solutions of sucrose. Liquid transport media are used primarily for transporting swabs or materials released into the medium from a collection swab. Liquid media may be added to other specimens when inactivation of the viral agent is likely and when the resultant dilution is acceptable. A suitable VTM for use in collecting throat and nasal swabs from human patients is prepared as follows: (1) add lOg veal infusion broth and 2g bovine albumin fraction V to sterile distilled water (to 400 ml); (2) add 0.8 ml gentamicin sulfate solution (50 mg/ml) and 3.2 ml amphotericin B (250 pg/ml); and (3) sterilize by filtration. Additional non-limiting examples of viral transport media include COPAN Universal Transport Medium; Eagle Minimum Essential Medium (E-MEM); Transport medium 199; and PBS-Glycerol transport medium see e.g., Johnson, Transport of Viral Specimens, CLINICAL MICROBIOLOGY REVIEWS, Apr. 1990, p. 120-131; Collecting, preserving and shipping specimens for the diagnosis of avian influenza A(H5N1) virus infection, Guide for field operations, October 2006. In some embodiments of any of the aspects, viral transport media does not inhibit the RT-RPA methods as described herein (see e.g., Fig. 6).
[00210] In some embodiments of any of the aspects, prior to the RT step total RNA is isolated from the sample. In some embodiments of any of the aspects, RNA isolation prior to the RT step can be performed using standard RNA extraction methods or kits. Non-limiting examples of standard RNA extraction methods include: (1) organic extraction, such as phenol-Guanidine Isothiocyanate (GITC)-based solutions (e.g., TRIZOL and TRI reagent); (2) silica-membrane based spin column technology (e.g., RNeasy and its variants); (3) paramagnetic particle technology (e.g., DYNABEADS mRNA DIRECT MICRO); (4) density gradient centrifugation using cesium chloride or cesium trifluoroacetate; (5) lithium chloride and urea isolation; (6) oligo(dt) -cellulose column chromatography; and (7) non-column poly (A)+ purification/isolation.
[00211] In some embodiments of any of the aspects, prior to the RT step, a standard RNA isolation method or kit is not used. In some embodiments of any of the aspects, prior to the RT step the sample is heated at 94°C for 5 minutes. As a non-limiting example, the sample is at heated at at least 90°C, at least 91°C, at least 92°C, at least 93°C, at least 94°C, at least 95°C, at least 96°C, at least 97°C, at least 98°C, or at least 99°C for 5 minutes. As a non-limiting example, the sample is at heated at 94°C for at least 1 minute, at least 2 minutes, at least 3 minutes, at least 4 minutes, at least 5 minutes, at least 6 minutes, at least 7 minutes, at least 8 minutes, at least 9 minutes, or at least 10 minutes. This heating step can be performed by a heat block or another implement capable of heating to 94°C for 5 minutes.
[00212] In some embodiments of any of the aspects, prior to the RT step, the sample is contacted with a detergent. Non-limiting examples of detergents include: sodium tri-isopropyl naphthalene sulfonate; SDS; Triton; NP-40; TWEEN; and the like. The detergent can function to lyse cells and/or viral particles to expose the target RNA.
[00213] Nucleic acid, e.g., deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), molecules can be isolated from a particular biological sample using any of a number of procedures, which are known in the art, the particular isolation procedure chosen being appropriate for the particular biological sample. For example, freeze-thaw and alkaline lysis procedures can be useful for obtaining nucleic acid molecules from solid materials (Roiff, A et al. PCR: Clinical Diagnostics and Research, Springer (1994)).
[00214] In some embodiments of any of the aspects, the test sample can be an untreated test sample. As used herein, the phrase “untreated test sample” refers to a test sample that has not had any prior sample pre-treatment except for dilution and/or suspension in a solution. Exemplary methods for treating a test sample include, but are not limited to, centrifugation, fdtration, sonication, homogenization, heating, freezing and thawing, and combinations thereof. In some embodiments of any of the aspects, the test sample can be a frozen test sample. The frozen sample can be thawed before employing methods, assays and systems described herein. After thawing, a frozen sample can be centrifuged before being subjected to methods, assays and systems described herein. In some embodiments of any of the aspects, the test sample is a clarified test sample, for example, by centrifugation and collection of a supernatant comprising the clarified test sample. In some embodiments of any of the aspects, a test sample can be a pre-processed test sample, for example, supernatant or filtrate resulting from a treatment selected from the group consisting of centrifugation, homogenization, sonication, filtration, thawing, purification, and any combinations thereof. In some embodiments of any of the aspects, the test sample can be treated with a chemical and/or biological reagent. Chemical and/or biological reagents can be employed, for example, to protect and/or maintain the stability of the sample, including biomolecules (e.g., nucleic acid and protein) therein, during processing. The skilled artisan is well aware of methods and processes appropriate for pre processing of biological samples required for detection of a nucleic acid as described herein.
[00215] Extraction of nucleic acids from a sample prior to detection can be a limiting factor. Inventors have discovered inter alia extraction free lysis methods that can rapidly lyse and inactivate viruses for use in diagnostic assays. This permits a practitioner to obtain sufficient nucleic acid material from a sample for detection without the need to extract the nucleic acid from the sample. Accordingly, in some embodiments of any of the aspects, the sample can be subjected to a lysis step, e.g., to obtain the target nucleic acid. Generally, when working with viruses, lysis step comprises heating the sample to a high temperature to lyse the viral particles and to inactivate the virus. However, many viruses lyse at temperature much lower than the temperature needed to inactivate the virus. The temperature needed to inactivate the virus can degrade a nucleic acid, e.g., RNA needed for the detection step. Thus, the target nucleic acid, e.g., RNA might be degraded during sample preparation.
[00216] As the data presented herein show, adding a RNase inhibitor to the sample prior to heating can reduce or inhibit RNA degradation during heating. Accordingly, in some embodiments of any of the aspects, a RNase inhibitor can be added to the sample prior to lysis by heating. Exemplary RNase inhibitors include, but are not limited to, mammalian ribonuclease inhibitor proteins such as porcine ribonuclease inhibitor and human ribonuclease inhibitor (e.g., human placenta ribonuclease inhibitor and recombinant human ribonuclease inhibitor), vanadyl ribonucleoside complexes, proteinase K, phenylglyoxal, p-hydroxyphenylglyoxal, polyamines, spermidine, 9-aminoacridine, iodoacetate, bentonite, poly[2'-0-(2,4-dinitrophenyl)]poly(adenyhlic acid), zinc sulfate, bromopyruvic acid, formamide, dimethylformamide, copper, zinc, aurintricarboxylic acid (ATA) and salts thereof such as triammonium aurintricarboxylate (aluminon), adenosine 5 '-pyrophosphate, 2'- cytidine monophosphate free acid (2'-CMP), 5'-diphosphoadenosine 3'-phosphate (ppA-3'-p), 5'- diphosphoadenosine 2'-phosphate (ppA-2'-p), leucine, oligovinysulfonic acid, poly(aspartic acid), tyrosine-glutamic acid polymer, 5'-phospho-2'-deoxyuridine 3 '-pyrophosphate P' 5 '-ester with adenosine 3 '-phosphate (pdUppAp), and analogs, derivatives and salts thereof.
[00217] In some embodiments of any of the aspects, the RNase inhibitor is a ribonuclease inhibitor protein, such as a recombinant RNase inhibitor, e.g., a recombinant mammalian RNase inhibitor. In some embodiments of any of the aspects, the RNase inhibitor is murine RNase inhibitor or RNasin® Plus.
[00218] In some embodiments of any of the aspects, the RNase inhibitor is a thermostable RNase inhibitor, e.g., RNasin® Plus.
[00219] In some embodiments of any of the aspects, the RNase inhibitor is a ribonuclease inhibitor protein and is added to a final concentration of at least 0.01 U/pL, at least 0.02 U/pL, at least 0.03 U/pL, at least 0.04 U/pL, at least 0.05 U/pL, at least 0.06 U/pL, at least 0.07 U/pL, at least 0.08 U/pL, at least 0.09 U/pL, at least 0.1 U/pL, at least 0.2 U/pL, at least 0.3 U/pL, at least 0.4 U/pL, at least 0.5 U/pL, at least 0.6 U/pL, at least 0.7 U/pL, at least 0.8 U/pL, at least 0.9 U/pL, at least 1.0 U/pL, at least 1.1 U/pL, at least 1.2 U/pL, at least 1.3 U/pL, at least 1.4 U/pL, at least 1.5 U/pL, at least 1.6 U/pL, at least 1.7 U/pL, at least 1.8 U/pL, at least 1.9 U/pL, at least 2.0 U/pL, at least 2.1 U/pL, at least 2.2 U/pL, at least 2.3 U/pL, at least 2.4 U/pL, at least 2.5 U/pL, at least 2.6 U/pL, at least 2.7 U/pL, at least 2.8 U/pL, at least 2.9 U/pL, at least 3.0 U/pL, at least 3.1 U/pL, at least 3.2 U/pL, at least 3.3 U/pL, at least 3.4 U/pL, at least 3.5 U/pL, at least 3.6 U/pL, at least 3.7 U/pL, at least 3.8 U/pL, at least 3.9 U/pL, at least 4.0 U/pL, at least 4.1 U/pL, at least 4.2 U/pL, at least 4.3 U/pL, at least 4.4 U/pL, at least 4.5 U/pL, at least 4.6 U/pL, at least 4.7 U/pL, at least 4.8 U/pL, at least 4.9 U/pL, at least 5.0 U/pL, at least 5.1 U/pL, at least 5.2 U/pL, at least 5.3 U/pL, at least 5.4 U/pL, at least 5.5 U/pL, at least 5.6 U/pL, at least 5.7 U/pL, at least 5.8 U/pL, at least 5.9 U/pL, at least 6.0 U/pL, at least 6.1 U/pL, at least 6.2 U/pL, at least 6.3 U/pL, at least 6.4 U/pL, at least 6.5 U/pL, at least 6.6 U/pL, at least 6.7 U/pL, at least 6.8 U/pL, at least 6.9 U/pL, at least 7.0 U/pL, at least 7.1 U/pL, at least 7.2 U/pL, at least 7.3 U/pL, at least 7.4 U/pL, at least 7.5 U/pL, at least 7.6 U/pL, at least 7.7 U/pL, at least 7.8 U/pL, at least 7.9 U/pL, at least 8.0 U/pL, at least 8.1 U/pL, at least 8.2 U/pL, at least 8.3 U/pL, at least 8.4 U/pL, at least 8.5 U/pL, at least 8.6 U/pL, at least 8.7 U/pL, at least 8.8 U/pL, at least 8.9 U/pL, at least 9.0 U/pL, at least 9.1 U/pL, at least 9.2 U/pL, at least 9.3 U/pL, at least 9.4 U/pL, at least 9.5 U/pL, at least 9.6 U/pL, at least 9.7 U/pL, at least 9.8 U/pL. at least 9.9 U/pL. at least 10 U/pL. at least 20 U/pL. at least 30 U/pL. at least 40 U/pL. or at least 50 U/pL.
[00220] In some embodiments of any of the aspects, the R ase inhibitor is added to a final concentration of about 0.01 U/pL. about 0.02 U/pL. about 0.03 U/pL. about 0.04 U/pL. about 0.05 U/pL. about 0.06 U/pL. about 0.07 U/pL. about 0.08 U/pL. about 0.09 U/pL. about 0.1 U/pL. about 0.2 U/pL. about 0.3 U/pL. about 0.4 U/pL. about 0.5 U/pL. about 0.6 U/pL. about 0.7 U/pL. about
0.8 U/pL. about 0.9 U/pL. about 1.0 U/pL. about 1.1 U/pL. about 1.2 U/pL. about 1.3 U/pL. about
1.4 U/pL. about 1.5 U/pL. about 1.6 U/pL. about 1.7 U/pL. about 1.8 U/pL. about 1.9 U/pL. about
2.0 U/pL. about 2.1 U/pL. about 2.2 U/pL. about 2.3 U/pL. about 2.4 U/pL. about 2.5 U/pL. about
2.6 U/pL. about 2.7 U/pL. about 2.8 U/pL. about 2.9 U/pL. about 3.0 U/pL. about 3.1 U/pL. about
3.2 U/pL. about 3.3 U/pL. about 3.4 U/pL. about 3.5 U/pL. about 3.6 U/pL. about 3.7 U/pL. about
3.8 U/pL. about 3.9 U/pL. about 4.0 U/pL. about 4.1 U/pL. about 4.2 U/pL. about 4.3 U/pL. about
4.4 U/pL. about 4.5 U/pL. about 4.6 U/pL. about 4.7 U/pL. about 4.8 U/pL. about 4.9 U/pL. about
5.0 U/pL. about 5.1 U/pL. about 5.2 U/pL. about 5.3 U/pL. about 5.4 U/pL. about 5.5 U/pL. about
5.6 U/pL. about 5.7 U/pL. about 5.8 U/pL. about 5.9 U/pL. about 6.0 U/pL. about 6.1 U/pL. about
6.2 U/pL. about 6.3 U/pL. about 6.4 U/pL. about 6.5 U/pL. about 6.6 U/pL. about 6.7 U/pL. about
6.8 U/pL. about 6.9 U/pL. about 7.0 U/pL. about 7.1 U/pL. about 7.2 U/pL. about 7.3 U/pL. about
7.4 U/pL. about 7.5 U/pL. about 7.6 U/pL. about 7.7 U/pL. about 7.8 U/pL. about 7.9 U/pL. about
8.0 U/pL. about 8.1 U/pL. about 8.2 U/pL. about 8.3 U/pL. about 8.4 U/pL. about 8.5 U/pL. about
8.6 U/pL. about 8.7 U/pL. about 8.8 U/pL. about 8.9 U/pL. about 9.0 U/pL. about 9.1 U/pL. about
9.2 U/pL. about 9.3 U/pL. about 9.4 U/pL. about 9.5 U/pL. about 9.6 U/pL. about 9.7 U/pL. about
9.8 U/pL. about 9.9 U/pL. about 10 U/pL. about 20 U/pL. about 30 U/pL. about 40 U/pL. or about 50 U/pL.
[00221] Many biological samples have high viscosity, which can be problematic. For example, saliva is a challenging fluid to work with. Inventors have discovered inter alia that adding a reducing agent to a saliva sample can reduce the viscosity of the sample. Accordingly, in some embodiments of any of the aspects, a reducing agent can be added to the sample prior to lysis step. Addition of the reducing agent is particularly advantageous when the sample is saliva sample.
[00222] Exemplary reducing agents include, but are not limited to, tris-(2-carboxyethyl)-phosphine (TCEP), cysteine, dithionite, dithioerythritol, dithiothreitol (DTT), dysteine, 2- mercaptoethanol, mercaptoethylene, bisulfite, sodium metabisulfite, pyrosulfite, pentaerythritol, thioglycolic acid, urea, uric acid, vitamin C, vitamin E, superoxide dismutases, and analogs, derivatives and salts thereof. In some preferred embodiments of any of the aspects, the reducing agent is TCEP.
[00223] The reducing agent can be added to any desired amount. For example, the reducing agent can be added to a final concentration of at least 0.1 mM, at least 0.2 mM, at least 0.3 mM, at least 0.4 mM, at least 0.5 mM, at least 0.6 mM, at least 0.7 mM, at least 0.8 mM, at least 0.9 mM, at least 1 mM, at least 2 mM, at least 3 mM, at least 4 mM, at least 5 mM, at least 6 mM, at least 7 mM, at least 8 mM, at least 10 mM, at least 11 mM, at least 12 mM, at least 13 mM, at least 14 mM, at least 15, mM, at least 16 mM, at least 17 mM, at least 18 mM, at least 19 mM, at least 20 mM, at least 25 mM, at least 30 mM, at least 35 mM, at least 40 mM, at least 45 mM, at least 50 mM, at least 55 mM, at least 60 mM, at least 65 mM, at least 70 mM, at least 75 mM, at least 80 mM, at least 85 mM, at least 90 mM, at least 95 mM, at least 100 mM or more.
[00224] In some embodiments of any of the aspects, the reducing agent is added to a final concentration of about 0.1 mM, about 0.2 mM, about 0.3 mM, about 0.4 mM, about 0.5 mM, about 0.6 mM, about 0.7 mM, about 0.8 mM, about 0.9 mM, about 1 mM, about 2 mM, about 3 mM, about 4 mM, about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 10 mM, about 11 mM, about 12 mM, about 13 mM, about 14 mM, about 15, mM, about 16 mM, about 17 mM, about 18 mM, about 19 mM, about 20 mM, about 25 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, about 50 mM, about 55 mM, about 60 mM, about 65 mM, about 70 mM, about 75 mM, about 80 mM, about 85 mM, about 90 mM, about 95 mM, or about 100 mM.
[00225] In some embodiments of any of the aspects, both a RNase inhibitor and a reducing agent can be added to the sample prior to lysis.
[00226] The lysis step can be performed at a temperature sufficient to inactivate viruses. For example, the sample lysed by heating the sample to a temperature from about 65°C to about 95°C. In some embodiments of any of the aspects, the sample can be subjected to a temperature from about 65°C to about 95°C, from about 70°C to about 90°C, or from about 75°C to about 85°C. As a non limiting example, the sample can be heated to at least 65°C, at least 66°C, at least 67°C, at least 68°C, at least 69°C, at least 70°C, at least 71°C, at least 72°C, at least 73°C, at least 74°C, or at least 75°C, at least 76°C, at least 77°C, at least 79°C, at least 80°C, at least 81°C, at least 82°C, at least 83°C, at least 84°C, at least 85°C, at least 86°C, at least 87°C, at least 88°C, at least 89°C, at least 90°C, at least 91°C, at least 92°C, at least 93°C, at least 94°C, or at least 95°C. [00227] In some embodiments of any of the aspects, the lysis step is performed at, i.e., the sample is heated to, at most 65°C, at most 66°C, at most 67°C, at most 68°C, at most 69°C, at most 70°C, at most 71°C, at most 72°C, at most 73°C, at most 74°C, or at most 75°C, at most 76°C, at most 77°C, at most 79°C, at most 80°C, at most 81°C, at most 82°C, at most 83°C, at most 84°C, at most 85°C, at most 86°C, at most 87°C, at most 88°C, at most 89°C, at most 90°C, at most 91°C, at most 92°C, at most 93°C, at most 94°C, or at most 95°C.
[00228] In some embodiments of any of the aspects, the lysis step is performed at, i.e., the sample is heated, at about 65°C, at about 66°C, at about 67°C, at about 68°C, at about 69°C, at about 70°C, at about 71°C, at about 72°C, at about 73°C, at about 74°C, or at about 75°C, at about 76°C, at about 77°C, at about 79°C, at about 80°C, at about 81°C, at about 82°C, at about 83°C, at about 84°C, at about 85°C, at about 86°C, at about 87°C, at about 88°C, at about 89°C, at about 90°C, at about 91°C, at about 92°C, at about 93 °C, at about 94°C, or at about 95 °C.
[00229] It is noted that lysis can also be carried out at room temperature by adding a viral lysis buffer to the sample. Viral lysis buffers are known in the art and available to one of ordinary skill in the art. Thus, in some embodiments of the any of the aspects, a viral lysis buffer can be added to the sample and the sample can be incubated at room temperature, e.g., a temperature from about 15°C to about 30°C. In some embodiments of any of the aspects, a RNase inhibitor and/or a reducing agent can be added along with the viral lysis buffer.
[00230] For lysis, the sample can be subjected to lysis conditions for any desired amount of time to lyse the cells and, optionally inactivate any viruses. Generally, the sample is subjected to lysis conditions, e.g., incubated at room temperature or heated, for a period of at most 30 second, at most 45 second, at most 1 minute, at most 2 minutes, at most 3 minutes, at most 4 minutes, at most 5 minutes, at most 6 minutes, at most 7 minutes, at most 8 minutes, at most 9 minutes, at most 10 minutes, at most 11 minutes, at most 12 minutes, at most 13 minutes, at most 14 minutes, or at most 15 minutes.
[00231] In some embodiments of the various aspect, the sample is subjected to lysis conditions, e.g., incubated at room temperature or heated, for a period of about 30 second, about 45 second, about 1 minute, about 2 minutes, about 3 minutes, about 4 minutes, about 5 minutes, about 6 minutes, about 7 minutes, about 8 minutes, about 9 minutes, about 10 minutes, about 11 minutes, about 12 minutes, about 13 minutes, about 14 minutes, or about 15 minutes. In some preferred embodiments of any of the aspects, the sample is heated for about 4 minutes to about 6 minutes, preferably about 5 minutes. [00232] In some embodiments of any of the aspects, the method can further comprise extracting, i.e., isolating/purifying the nucleic acid from the sample after the lysis step. In some other embodiments of any of the aspects, the method does not comprise an extraction step. In other words, the sample can be used for detection after the lysis step without further isolating and/or purifying the nucleic acid. This can reduce the time for detecting the target nucleic acid. Detection Assays
[00233] Described herein are methods, kits, and systems for detecting a target RNA. The methods described herein comprise: (a) reverse transcribing the RNA target into complementary DNA (cDNA); (b) degrading the RNA target with an RNA:DNA duplex-specific RNase; (c) amplifying the cDNA to detectable levels; and (d) detecting the amplified cDNA using a method described herein. Accordingly, in some embodiments of any of the aspects, the methods described herein comprise a step (d), comprising detecting an amplification product from the amplification step. The amplification product can be detected using any detection system, including, but not limited to enzyme (e.g.,
ELISA, as well as enzyme-based histochemical assays), fluorescent, radioactive, and luminescent systems. It is not intended that the present invention be limited to any particular detection system or label.
[00234] Any of a number of different assays can be used to detect the amplification product of the amplification step as described herein. In some embodiments of any of the aspects, the detection of step (d) is selected from the group consisting of: lateral flow detection; hybridization with conjugated or unconjugated DNA; colorimetric assays; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR). In some embodiments of any of the aspects, the detection method comprises a plate-based assay (e.g., SHERLOCK, hybridization, qPCR, sequencing, etc.). In some embodiments of any of the aspects, the detection method comprises a lateral flow assay. In some embodiments of any of the aspects, the detection method is colorimetric, luminescent, or fluorescent, etc.
[00235] In some embodiments of any of the aspects, the amplification product from the amplification step is detected using lateral flow detection, also known as a lateral flow immunoassay test (LFIA), laminar flow, the immunochromatographic assay, or strip test. LFIAs are a simple device intended to detect the presence (or absence) of antigen, e.g. a nucleic acid or polypeptide, in a fluid sample. There are currently many LFIA tests used for medical diagnostics, either for home testing, point of care testing, or laboratory use. LFIA tests are a form of immunoassay in which the test sample flows along a solid substrate via capillary action. After the sample is applied to the test strip it encounters a colored reagent (generally comprising antibody specific for the test target antigen) bound to microparticles which mixes with the sample and transits the substrate encountering lines or zones which have been pretreated with an antibody (e.g., specific for a detectable marker on the target nucleic acid or for a detectable marker on a complementary nucleic to the target nucleic acid) or pretreated with a conjugated or unconjugated DNA as described herein. Depending upon the level of target present in the sample the colored reagent can be captured and become bound at the test line or zone. LFIAs are essentially immunoassays adapted to operate along a single axis to suit the test strip format or a dipstick format. Strip tests are extremely versatile and can be easily modified by one skilled in the art for detecting an enormous range of antigens from fluid samples such as urine, blood, water, and/or homogenized tissue samples etc. Strip tests are also known as dip stick tests, the name bearing from the literal action of "dipping" the test strip into a fluid sample to be tested. LFIA strip tests are easy to use, require minimum training and can easily be included as components of point-of- care test (POCT) diagnostics to be use on site in the field. LFIA tests can be operated as either competitive or sandwich assays. Sandwich LFIAs are similar to sandwich ELISA. The sample first encounters colored particles which are labeled with antibodies raised to the target antigen. The test line will also contain antibodies to the same target, although it may bind to a different epitope on the antigen. The test line will show as a colored band in positive samples. In some embodiments of any of the aspects, the lateral flow immunoassay can be a double antibody sandwich assay, a competitive assay, a quantitative assay or variations thereof. Competitive LFIAs are similar to competitive ELISA. The sample first encounters colored particles which are labeled with the target antigen or an analogue. The test line contains antibodies to the target/its analogue. Unlabeled antigen in the sample will block the binding sites on the antibodies preventing uptake of the colored particles. The test line will show as a colored band in negative samples. There are a number of variations on lateral flow technology. It is also possible to apply multiple capture zones to create a multiplex test.
[00236] The use of lateral flow tests to detect nucleic acids have been described in the art; see e.g., U.S. Pat. Nos. 9,121,849; 9,207,236; and 9,651,549; the content of each of which is incorporated herein by reference in its entirety. The use of "dip sticks" or LFIA test strips and other solid supports have been described in the art in the context of an immunoassay for a number of targets. U.S. Pat.
Nos. 4,943,522; 6,485,982; 6,187,598; 5,770,460; 5,622,871; 6,565,808, U. S. patent applications Ser. No. 10/278,676; U.S. Ser. No. 09/579,673 and U.S. Ser. No. 10/717,082, which are incorporated herein by reference in their entirety, are non-limiting examples of such lateral flow test devices. Examples of patents that describe the use of "dip stick" technology to detect soluble antigens via immunochemical assays include, but are not limited to US Patent Nos. 4,444,880; 4,305,924; and 4,135,884; which are incorporated by reference herein in their entireties. The apparatuses and methods of these three patents broadly describe a first component fixed to a solid surface on a "dip stick" which is exposed to a solution containing a soluble antigen that binds to the component fixed upon the "dip stick," prior to detection of the component-antigen complex upon the stick.
[00237] In some embodiments of any of the aspects, an amplification product is detected using hybridization with conjugated or unconjugated DNA, which can also be referred to herein as a “probe” or “DNA probe”. In some embodiments of any of the aspects, the probe is complementary or hybridizes to an amplification product as described herein. In some embodiments of any of the aspects, the probe is conjugated to a detectable marker as described herein. In some embodiments of any of the aspects, a detectable marker is conjugated to the 5’ end of the probe. In some embodiments of any of the aspects, a detectable marker is conjugated to the 3’ end of the probe. In some embodiments of any of the aspects, a detectable marker is conjugated to the 5 ’ end of the probe, and a detectable marker is conjugated to the 3’ end of the probe. The first and second labels can be same or different. In some embodiments of the various aspects described herein, the probe comprises a first detectable label at the 3 ’-end and a second detectable label at the 5 ’-end, where the first and second labels are different. For example, one of the first or second label is biotin and the other is a fluorophore.
[00238] In some embodiments of any of the aspects, the probe is conjugated to a lateral flow test strip as described herein. In some embodiments of any of the aspects, the probe is conjugated to a detectable marker as described herein (e.g., biotin, FAM, FITC, digoxigenin, etc.), and a lateral flow test strip comprises at least one region that is specific for the detectable marker conjugated to the probe (e.g., anti-biotin, streptavidin, anti-FAM, anti-FITC, anti -digoxigenin).
[00239] In some embodiments of any of the aspects, a lateral flow strip comprises a region specific for the target amplification product or a region specific for a probe that hybridizes to the target amplification product. In some embodiments of any of the aspects, a lateral flow strip comprises a region specific for the second amplification product of a nested isothermal amplification or a region specific for a probe that hybridizes to the second amplification product. In some embodiments of any of the aspects, a lateral flow strip comprises a region specific for the target and reference amplification products or a region specific for a probe that hybridizes to the target and reference amplification products. In some embodiments of any of the aspects, a lateral flow strip comprises a region specific a positive control or a region specific for a probe that hybridizes to the positive control.
[00240] In some embodiments of any of the aspects, the probe selected from Table 6. In some embodiments of any of the aspects, at least one (e.g., 1, 2, 3, 4, 5, or more) probe is selected from SEQ ID NOs: 15-20, 27-32, 68, 69, 103, 104, 154-157, 170-176, 189, 191, or a nucleic acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to one of SEQ ID NOs: 15-20, 27-32, 68, 69, 103, 104, 154-157, 170-176, 189, 191, that maintains the same function (e.g., probes for CoV-2). In some embodiments of any of the aspects, the amplification product can be contacted with 1, 2, 3, 4, 5, or 5 different conjugated or unconjugated DNA probes. In some embodiments of any of the aspects, a detection step as described herein comprises at least one (e.g., 1, 2, 3, 4, 5, or more) probe selected from SEQ ID NOs: 15-20, 27-32, 68, 69, 103, 104, 154-157, 170-176, 189, 191, or a nucleic acid sequence that is at least 95% identical to one of SEQ ID NOs: 15-20, 27-32, 68, 69, 103, 104, 154-157, 170-176, 189, 191, that maintains the same function. In some embodiments of any of the aspects, the probe is selected from Table 13. [00241] Table 13: Exemplary Primer Sets and Probes; (each number corresponds to a SEQ ID NO, see e.g., Table 6); “F, R” indicates forward and reverse primers, and “PR” indicates a probe.
Figure imgf000061_0001
[00242] In some embodiments of any of the aspects, a probe comprises a detectable marker as described herein (e.g., biotin, which when conjugated to the 5’ end can also be referred to as 5Biosg; FAM). In some embodiments of any of the aspects, SEQ ID NOs: 15-20 are unlabeled or unconjugated probes (i.e., do not comprise a detectable label). In some embodiments of any of the aspects, SEQ ID NOs: 15-20 further comprise a detectable label as described herein. In some embodiments of any of the aspects, SEQ ID NOs: 27-32, 68-69, 103-104, 154-157, 170-176 are labeled or conjugated probes (i.e., comprise a detectable label, e.g., 5Biosg, FAM, biotin). In some embodiments of any of the aspects, SEQ ID NOs: 27-32, 68-69, 103-104, 154-157, 170-176 are not labeled or conjugated probes (i.e., do not comprise a detectable label, e.g., 5Biosg, FAM, biotin). In some embodiments of any of the aspects, SEQ ID NOs: 15 and 27 can be used interchangeably. In some embodiments of any of the aspects, SEQ ID NOs: 16 and 28 can be used interchangeably. In some embodiments of any of the aspects, SEQ ID NOs: 17 and 29 can be used interchangeably. In some embodiments of any of the aspects, SEQ ID NOs: 18 and 30 can be used interchangeably. In some embodiments of any of the aspects, SEQ ID NOs: 19 and 31 can be used interchangeably. In some embodiments of any of the aspects, SEQ ID NOs: 20 and 32 can be used interchangeably. [00243] In some embodiments of any of the aspects, the detection step comprises: (i) contacting the amplification product with a conjugated (e.g., SEQ ID NOs: 27-32, 68-69, 103-104, 154-157, 170- 176) or unconjugated DNA (e.g., SEQ ID NOs: 15-20) in a hybridization reaction mixture; (ii) heating the hybridization reaction mixture at 94°C for 3 min; (iii) contacting the hybridization reaction mixture with a running buffer; and (iv) contacting the reaction mixture with a test strip (see e.g., Example 2).
[00244] In some embodiments of any of the aspects, the amplification product is detected colorimetric assays. Colorimetric assays use reagents that undergo a measurable color change in the presence of the analyte. For example, para-Nitrophenylphosphate is converted into a yellow product by alkaline phosphatase enzyme. Coomassie Blue once bound to proteins elicits a spectrum shift, allowing quantitative dosage. A similar colorimetric assay, the Bicinchoninic acid assay, uses a chemical reaction to determine protein concentration. Enzyme linked immunoassays use enzyme- complexed-antibodies to detect antigens. Binding of the antibody is often inferred from the color change of reagents such as TMB. A colorimetric assay can be detected using a colorimeter, which is a device used to test the concentration of a solution by measuring its absorbance of a specific wavelength of light
[00245] In some embodiments of any of the aspects, the amplification product is detected using gel electrophoresis. Gel electrophoresis is a technique used to separate DNA fragments according to their size. DNA samples are loaded into wells (indentations) at one end of a gel, and an electric current is applied to pull them through the gel. The gel electrophoresis can be performed according to methods known in the art.
[00246] In some embodiments of any of the aspects, the amplification product from step (c) is detected using Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK). SHERLOCK is a method that can be used to detect specific RNA/DNA at low attomolar concentrations (see e.g., US Patent 10,266,886; US Patent 10,266,887; Gootenberg et al., Science. 2018 Apr 27;360(6387):439-444; Gootenberg et al., Science. 2017 Apr 28;356(6336):438-44; the content of each of which is incorporated herein by reference in its entirety). Briefly, a detection method using SHERLOCK comprises the following steps: (a) contacting amplified DNA with an RNA polymerase (e.g., T7 polymerase) to promote the production of complementary RNA; (b) contacting the RNA with: (i) a crRNA comprising a Cas enzyme scaffold and a region that hybridizes to the target RNA; (ii) a Cas enzyme (e.g., Casl3a (previously known as C2c2), Casl3b, Casl3c,
Cas 12a, and/or Csm6); and (iii) a detection molecule cleavable by the Cas enzyme; (c) detecting cleavage of the detection molecule, wherein said cleavage indicates presence of the target RNA. [00247] In some embodiments of any of the aspects, the level and/or sequence of an amplification product from step (c) can be measured by a quantitative sequencing technology, e.g. a quantitative next-generation sequencing technology. Methods of sequencing a nucleic acid sequence are well known in the art. Briefly, a sample obtained from a subject can be contacted with one or more primers which specifically hybridize to a single-strand nucleic acid sequence (e.g., primer binding sequence) flanking the target sequence (e.g., the target RNA) and a complementary strand is synthesized. In some next-generation technologies, an adaptor (double or single-stranded) is ligated to nucleic acid molecules in the sample and synthesis proceeds from the adaptor or adaptor compatible primers. In some third-generation technologies, the sequence can be determined, e.g. by determining the location and pattern of the hybridization of probes, or measuring one or more characteristics of a single molecule as it passes through a sensor (e.g. the modulation of an electrical field as a nucleic acid molecule passes through a nanopore). Exemplary methods of sequencing include, but are not limited to, Sanger sequencing (i.e., dideoxy chain termination), 454 sequencing, SOLiD sequencing, polony sequencing, Illumina sequencing, Ion Torrent sequencing, sequencing by hybridization, nanopore sequencing, Helioscope sequencing, single molecule real time sequencing, RNAP sequencing, and the like. Methods and protocols for performing these sequencing methods are known in the art, see, e.g. “Next Generation Genome Sequencing” Ed. Michal Janitz, Wiley-VCH; “High-Throughput Next Generation Sequencing” Eds. Kwon and Ricke, Humanna Press, 2011; and Sambrook et ak, Molecular Cloning: A Laboratory Manual (4 ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012); which are incorporated by reference herein in their entireties.
[00248] In some embodiments of any of the aspects, the level and/or sequence of an amplification product from step (c) can be measured using PCR. In general, the PCR procedure is a method of gene amplification comprised of (i) sequence-specific hybridization of primers to specific genes or sequences within a nucleic acid sample or library, (ii) subsequent amplification involving multiple rounds of primer annealing, elongation, and thermal denaturation using a thermostable DNA polymerase, and (iii) analyzing the PCR products for a band of the correct size or sequence. The primers used in PCR are oligonucleotides of sufficient length and appropriate sequence to provide initiation of polymerization, i.e. each primer is specifically designed to be complementary to a strand of the (e.g., genetic locus, genetic barcode element as described herein) to be amplified. In some embodiments of any of the aspects, the amount of amplification product can be determined by quantitative PCR (QPCR) or real-time PCR methods, e.g., using a set of primers specific to the amplification product and/or SYBR® GREEN or a detectable probe. Methods of qPCR and real-time qPCR are well known in the art.
[00249] In some embodiments of any of the aspects, the amplification product is detected using molecular beacons. Molecular beacons, or molecular beacon probes, are oligonucleotide hybridization probes that can report the presence of specific nucleic acids in homogenous solutions. Molecular beacons are hairpin-shaped molecules with an internally quenched fluorophore whose fluorescence is restored when they bind to a target nucleic acid sequence. See e.g., Tyagi S and Kramer FR (1996) Nat. Biotechnol. 14 (3): 303-8; Tapp et al. (Apr 2000) BioTechniques. 28 (4): 732-8; Akimitsu Okamoto (2011). Chem. Soc. Rev. 40: 5815-5828.
[00250] In some embodiments of any of the aspects, the amplification product is detected using oligo strand displacement (OSD). Nucleic acid strand displacement (OSD) probes hybridize to specific sequences in amplification products and thereby generate simple yes/no readout of fluorescence, which is readable by human eye or by off-the-shelf cellphones. In some embodiments of any of the aspects, the OSD probes are short hemiduplex oligonucleotides. The single stranded ‘toehold’ regions of OSD probes bind to amplification products (e.g., LAMP amplicon loop sequences), and then signal via strand exchange that leads to separation of a fluorophore and quencher. OSDs are the functional equivalents of TaqMan probes and can specifically report single or multiplex amplicons without interference from non-specific nucleic acids or inhibitors; see e.g., Bhadra et al. bioRxiv 291849 (2018); Jiang et al. (2015) Anal Chem 87: 3314-3320; Zhang and Winfree (2009) J Am Chem Soc 131: 17303-17314; Bhadra et al. (2015) PLoS One 10: e0123126. [00251] In some embodiments of any of the aspects, one or more of the detection reagents (e.g. an antibody reagent and/or nucleic acid probe) can comprise a detectable label and/or comprise the ability to generate a detectable signal (e.g. by catalyzing a reaction converting a compound to a detectable product). As used herein, the term “detectable label” or “detectable marker” refers to a composition capable of producing a detectable signal indicative of the presence of a target. Detectable labels can comprise, for example, a light-absorbing dye, a fluorescent dye, or a radioactive label. Detectable labels, methods of detecting them, and methods of incorporating them into reagents (e.g. antibodies and nucleic acid probes) are well known in the art.
[00252] In some embodiments of any of the aspects, detectable labels can include labels that can be detected by spectroscopic, photochemical, biochemical, immunochemical, electromagnetic, radiochemical, or chemical means, such as fluorescence, chemifluorescence, or chemiluminescence, or any other appropriate means. The detectable labels used in the methods described herein can be primary labels (where the label comprises a moiety that is directly detectable or that produces a directly detectable moiety) or secondary labels (where the detectable label binds to another moiety to produce a detectable signal, e.g., as is common in immunological labeling using secondary and tertiary antibodies). The detectable label can be linked by covalent or non-covalent means to the reagent. Alternatively, a detectable label can be linked such as by directly labeling a molecule that achieves binding to the reagent via a ligand-receptor binding pair arrangement or other such specific recognition molecules. Detectable labels can include, but are not limited to radioisotopes, biolumine scent compounds, chromophores, antibodies, chemiluminescent compounds, fluorescent compounds, metal chelates, and enzymes.
[00253] In other embodiments, a detection reagent (e.g., a primer, a probe, etc.) is labeled with a fluorescent compound. When the fluorescently labeled reagent is exposed to light of the proper wavelength, its presence can then be detected due to fluorescence. In some embodiments of any of the aspects, a detectable label can be a fluorescent dye molecule, or fluorophore. A wide variety of fluorescent reporter dyes are known in the art. Typically, the fluorophore is an aromatic or heteroaromatic compound and can be a pyrene, anthracene, naphthalene, acridine, stilbene, indole, benzindole, oxazole, thiazole, benzothiazole, cyanine, carbocyanine, salicylate, anthranilate, coumarin, fluorescein, rhodamine or other like compound. Exemplary fluorophores include, but are not limited to, 1,5 IAEDANS; 1,8-ANS ; 4-Methylumbelliferone; 5-carboxy-2,7-dichlorofluorescein; 5-Carboxyfluorescein (5-FAM); 5-Carboxynapthofluorescein (pH 10); 5-
Carboxytetramethylrhodamine (5-TAMRA); 5-FAM (5-Carboxyfluorescein); 5-Hydroxy Tryptamine (HAT); 5-ROX (carboxy-X-rhodamine); 5-TAMRA (5-Carboxytetramethylrhodamine); 6- Carboxyrhodamine 6G; 6-CR 6G; 6-JOE; 7-Amino-4-methylcoumarin; 7-Aminoactinomycin D (7- AAD); 7-Hydroxy -4-methylcoumarin; 9-Amino-6-chloro-2-methoxyacridine; ABQ; Acid Fuchsin; ACMA (9-Amino-6-chloro-2-methoxyacridine); Acridine Orange; Acridine Red; Acridine Yellow; Acriflavin; Acriflavin Feulgen SITSA; Aequorin (Photoprotein); Alexa Fluor 350™; Alexa Fluor 430™; Alexa Fluor 488™; Alexa Fluor 532™; Alexa Fluor 546™; Alexa Fluor 568™; Alexa Fluor 594™; Alexa Fluor 633™; Alexa Fluor 647™; Alexa Fluor 660™; Alexa Fluor 680™; Alizarin Complexon; Alizarin Red; Allophycocyanin (APC); AMC, AMCA-S; AMCA (Aminomethylcoumarin); AMCA-X; Aminoactinomycin D; Aminocoumarin; Anilin Blue; Anthrocyl stearate; APC-Cy7; APTS; Astrazon Brilliant Red 4G; Astrazon Orange R; Astrazon Red 6B; Astrazon Yellow 7 GLL; Atabrine; ATTO-TAG™ CBQCA; ATTO-TAG™ FQ; Auramine; Aurophosphine G; Aurophosphine; BAO 9 (Bisaminophenyloxadiazole); BCECF (high pH); BCECF (low pH); Berberine Sulphate; Beta Lactamase; BFP blue shifted GFP (Y66H); BG-647; Bimane; Bisbenzamide; Blancophor FFG; Blancophor SV; BOBO™ -1; BOBO™ -3; Bodipy 492/515; Bodipy 493/503; Bodipy 500/510; Bodipy 505/515; Bodipy 530/550; Bodipy 542/563; Bodipy 558/568; Bodipy 564/570; Bodipy 576/589; Bodipy 581/591; Bodipy 630/650-X; Bodipy 650/665-X; Bodipy 665/676; Bodipy FI; Bodipy FL ATP; Bodipy Fl-Ceramide; Bodipy R6G SE; Bodipy TMR; Bodipy TMR-X conjugate; Bodipy TMR-X, SE; Bodipy TR; Bodipy TR ATP; Bodipy TR-X SE; BO-PRO™ -1; BO-PRO™ -3; Brilliant Sulphoflavin FF; Calcein; Calcein Blue; Calcium Crimson™; Calcium Green; Calcium Green- 1 Ca2+ Dye; Calcium Green-2 Ca2+; Calcium Green-5N Ca2+; Calcium Green-C18 Ca2+; Calcium Orange; Calcofluor White; Carboxy-X-rhodamine (5-ROX); Cascade Blue™; Cascade Yellow; Catecholamine; CFDA; CFP - Cyan Fluorescent Protein; Chlorophyll; Chromomycin A; Chromomycin A; CMFDA; Coelenterazine ; Coelenterazine cp; Coelenterazine f; Coelenterazine fcp; Coelenterazine h; Coelenterazine hep; Coelenterazine ip; Coelenterazine O; Coumarin Phalloidin; CPM Methylcoumarin; CTC; Cy2™; Cy3.1 8; Cy3.5™; Cy3™; Cy5.1 8; Cy5.5™; Cy5™; Cy7™; Cyan GFP; cyclic AMP Fluorosensor (FiCRhR); d2; Dabcyl; Dansyl;
Dansyl Amine; Dansyl Cadaverine; Dansyl Chloride; Dansyl DHPE; Dansyl fluoride; DAPI;
Dapoxyl; Dapoxyl 2; Dapoxyl 3; DCFDA; DCFH (Dichlorodihydrofluorescein Diacetate); DDAO; DHR (Dihydorhodamine 123); Di-4-ANEPPS; Di-8-ANEPPS (non-ratio); DiA (4-Di- 16-ASP);
DIDS; Dihydorhodamine 123 (DHR); DiO (DiOC18(3)); DiR; DiR (DiIC18(7)); Dopamine; DsRed; DTAF; DY-630-NHS; DY-635-NHS; EBFP; ECFP; EGFP; ELF 97; Eosin; Erythrosin; Erythrosin ITC; Ethidium homodimer-1 (EthD-1); Euchrysin; Europium (III) chloride; Europium; EYFP; Fast Blue; FDA; Feulgen (Pararosaniline); FITC; FL-645; Flazo Orange; Fluo-3; Fluo-4; Fluorescein Diacetate; Fluoro-Emerald; Fluoro-Gold (Hydroxystilbamidine); Fluor-Ruby; FluorX; FM 1-43™; FM 4-46; Fura Red™ (high pH); Fura-2, high calcium; Fura-2, low calcium; Genacryl Brilliant Red B; Genacryl Brilliant Yellow 10GF; Genacryl Pink 3G; Genacryl Yellow 5GF; GFP (S65T); GFP red shifted (rsGFP); GFP wild type, non-UV excitation (wtGFP); GFP wild type, UV excitation (wtGFP); GFPuv; Gloxalic Acid; Granular Blue; Haematoporphyrin; Hoechst 33258; Hoechst 33342; Hoechst 34580; HPTS; Hydroxy coumarin; Hydroxystilbamidine (FluoroGold); Hydroxytryptamine; Indodicarbocyanine (DiD); Indotricarbocyanine (DiR); Intrawhite Cf; JC-1; JO-JO-1; JO-PRO-1; LaserPro; Laurodan; LDS 751; Leucophor PAF; Leucophor SF; Leucophor WS; Lissamine Rhodamine; Lissamine Rhodamine B; LOLO-1; LO-PRO-1; Lucifer Yellow; Mag Green; Magdala Red (Phloxin B); Magnesium Green; Magnesium Orange; Malachite Green; Marina Blue; Maxilon Brilliant Flavin 10 GFF; Maxilon Brilliant Flavin 8 GFF; Merocyanin; Methoxycoumarin;
Mitotracker Green FM; Mitotracker Orange; Mitotracker Red; Mitramycin; Monobromobimane; Monobromobimane (mBBr-GSH); Monochlorobimane; MPS (Methyl Green Pyronine Stilbene); NBD; NBD Amine; Nile Red; Nitrobenzoxadidole; Noradrenaline; Nuclear Fast Red; Nuclear Yellow; Nylosan Brilliant Iavin E8G; Oregon Green™; Oregon Green 488-X; Oregon Green™ 488; Oregon Green™ 500; Oregon Green™ 514; Pacific Blue; Pararosaniline (Feulgen); PE-Cy5; PE-Cy7; PerCP; PerCP-Cy5.5; PE-TexasRed (Red 613); Phloxin B (Magdala Red); Phorwite AR; Phorwite BKL; Phorwite Rev; Phorwite RPA; Phosphine 3R; PhotoResist; Phycoerythrin B [PE];
Phycoerythrin R [PE]; PKH26 ; PKH67; PMIA; Pontochrome Blue Black; POPO-1; POPO-3; PO- PRO-1; PO-PRO-3; Primuline; Procion Yellow; Propidium Iodid (PI); PyMPO; Pyrene; Pyronine; Pyronine B; Pyrozal Brilliant Flavin 7GF; QSY 7; Quinacrine Mustard; Resorufm; RH 414; Rhod-2; Rhodamine; Rhodamine 110; Rhodamine 123; Rhodamine 5 GLD; Rhodamine 6G; Rhodamine B 540; Rhodamine B 200 ; Rhodamine B extra; Rhodamine BB; Rhodamine BG; Rhodamine Green; Rhodamine Phallicidine; Rhodamine Phalloidine; Rhodamine Red; Rhodamine WT; Rose Bengal; R- phycoerythrin (PE); red shifted GFP (rsGFP, S65T); S65A; S65C; S65L; S65T; Sapphire GFP; Serotonin; Sevron Brilliant Red 2B; Sevron Brilliant Red 4G; Sevron Brilliant Red B; Sevron Orange; Sevron Yellow L; sgBFP™; sgBFP™ (super glow BFP); sgGFP™; sgGFP™ (super glow GFP);
SITS; SITS (Primuline); SITS (Stilbene Isothiosulphonic Acid); SPQ (6-methoxy-N-(3-sulfopropyl)- quinolinium); Stilbene; Sulphorhodamine B can C; Sulphorhodamine G Extra; Tetracycline; Tetramethylrhodamine ; Texas Red™; Texas Red-X™ conjugate; Thiadicarbocyanine (DiSC3); Thiazine Red R; Thiazole Orange; Thioflavin 5; Thioflavin S; Thioflavin TCN; Thiolyte; Thiozole Orange; Tinopol CBS (Calcofluor White); TMR; TO-PRO-1; TO-PRO-3; TO-PRO-5; TOTO-1; TOTO-3; TriColor (PE-Cy5); TRITC (TetramethylRodaminelsoThioCyanate); True Blue; TruRed; Ultralite; Uranine B; Uvitex SFC; wt GFP; WW 781; XL665; X-Rhodamine; XRITC; Xylene Orange; Y66F; Y66H; Y66W; Yellow GFP; YFP; YO-PRO-1; YO-PRO-3; YOYO-1; and YOYO-3. Many suitable forms of these fluorescent compounds are available and can be used. Additional fluorophore examples include, but are not limited to fluorescein, phycoerythrin, phycocyanin, o-phthalaldehyde, fluorescamine, Cy3™, Cy5™, allophycocyanin, Texas Red, peridinin chlorophyll, cyanine, tandem conjugates such as phycoerythrin-Cy5™, green fluorescent protein, rhodamine, fluorescein isothiocyanate (FITC) and Oregon Green™, rhodamine and derivatives (e.g., Texas red and tetramethylrhodamine isothiocyanate (TRITC)), biotin, phycoerythrin, AMCA, CyDyes™, 6- carboxyfluorescein (commonly known by the abbreviations FAM and F), 6-carboxy-2',4',7',4,7- hexachlorofluorescein (HEX), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfmorescein (JOE or J), N,N,N',N'-tetramethyl-6carboxyrhodamine (TAMRA or T), 6-carboxy-X-rhodamine (ROX or R), 5- carboxyrhodamine-6G (R6G5 or G5), 6-carboxyrhodamine-6G (R6G6 or G6), and rhodamine 110; cyanine dyes, e.g. Cy3, Cy5 and Cy7 dyes; coumarins, e.g., umbelbferone; benzimide dyes, e.g. Hoechst 33258; phenanthridine dyes, e.g. Texas Red; ethidium dyes; acridine dyes; carbazole dyes; phenoxazine dyes; porphyrin dyes; polymethine dyes, e.g., cyanine dyes such as Cy3, Cy5, etc.; BODIPY dyes and quinoline dyes.
[00254] Other exemplary detectable labels include luminescent and bioluminescent markers (e.g., biotin, luciferase (e.g., bacterial, firefly, click beetle and the like), luciferin, and aequorin), radiolabels (e.g., 3H, 1251, 35S, 14C, or 32P), enzymes (e.g., galactosidases, glucorinidases, phosphatases (e.g., alkaline phosphatase), peroxidases (e.g. , horseradish peroxidase), and cholinesterases), and colorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, and latex) beads. Patents teaching the use of such labels include U.S. Pat. Nos. 3,817,837, 3,850,752, 3,939,350, 3,996,345, 4,277,437, 4,275,149, and 4,366,241, each of which is incorporated herein by reference. [00255] Means of detecting such labels are well known to those of skill in the art. Thus, for example, radiolabels can be detected using photographic film or scintillation counters, fluorescent markers can be detected using a photo-detector to detect emitted light. Enzymatic labels are typically detected by providing the enzyme with an enzyme substrate and detecting the reaction product produced by the action of the enzyme on the enzyme substrate, and colorimetric labels can be detected by visualizing the colored label.
[00256] In some embodiments of any of the aspects, a detectable label can be a radiolabel including, but not limited to 3H, 1251, 35S, 14C, 32P, and 33P. Suitable non-metallic isotopes include, but are not limited to, UC, 14C, 13N, 18F, 123I, 124I, and 125I. Suitable radioisotopes include, but are not limited to, "mTc, 95Tc, mIn, 62Cu, 64Cu, Ga, 68Ga, and 153Gd. Suitable paramagnetic metal ions include, but are not limited to, Gd(III), Dy(III), Fe(III), and Mn(II). Suitable X-ray absorbers include, but are not limited to, Re, Sm, Ho, Fu, Pm, Y, Bi, Pd, Gd, Fa, Au, Au, Yb, Dy, Cu, Rh, Ag, and Ir.
[00257] In some embodiments, the radionuclide is bound to a chelating agent or chelating agent- linker attached to probe, primer or reagent. Exemplary chelating agents include, but are not limited to, diethylenetriaminepentaacetic acid (DTP A) and ethylenediaminetetraacetic acid (EDTA). Suitable radionuclides for direct conjugation include, without limitation, 3H, 18F, 124I, 125I, 1311. 35S, 14C, 32P, and 33P and mixtures thereof. Suitable radionuclides for use with a chelating agent include, without limitation, 47Sc, 64Cu, 67Cu, 89Sr, 86Y, 87Y, 90Y, 105Rh, mAg, In, 117mSn, 149Pm, 153Sm, 166Ho, 177Fu, 186Re, 188Re, 211At, 212Bi, and mixtures thereof. Suitable chelating agents include, but are not limited to, DOTA, BAD, TETA, DTPA, EDTA, NTA, HDTA, their phosphonate analogs, and mixtures thereof. One of skill in the art will be familiar with methods for attaching radionuclides, chelating agents, and chelating agent-linkers to molecules such nucleic acids. [00258] In some embodiments of any of the aspects, a detectable label can be an enzyme including, but not limited to horseradish peroxidase and alkaline phosphatase. An enzymatic label can produce, for example, a chemiluminescent signal, a color signal, or a fluorescent signal. Enzymes contemplated for use to detectably label an antibody reagent include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-V-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-VI-phosphate dehydrogenase, glucoamylase and acetylcholinesterase. In some embodiments of any of the aspects, a detectable label is a chemiluminescent label, including, but not limited to lucigenin, luminol, luciferin, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester. In some embodiments of any of the aspects, a detectable label can be a spectral colorimetric label including, but not limited to colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, and latex) beads.
[00259] In some embodiments of any of the aspects, detection reagents can also be labeled with a detectable tag, such as c-Myc, HA, VSV-G, HSV, FLAG, V5, HIS, or biotin. Other detection systems can also be used, for example, a biotin-streptavidin system. In this system, the antibodies immunoreactive (i. e. specific for) with the biomarker of interest is biotinylated. Quantity of biotinylated antibody bound to the biomarker is determined using a streptavidin-peroxidase conjugate and a chromogenic substrate. Such streptavidin peroxidase detection kits are commercially available, e.g., from DAKO; Carpinteria, CA. A reagent can also be detectably labeled using fluorescence emitting metals such as 152Eu, or others of the lanthanide series. These metals can be attached to the reagent using such metal chelating groups as diethylenetriaminepentaacetic acid (DTP A) or ethylenediaminetetraacetic acid (EDTA).
[00260] In some embodiments of any of the aspects, the level of the detected amplification product can be compared to a reference. In some embodiments of any of the aspects, the reference can also be a level of expression of the target molecule in a control sample, a pooled sample of control items or a numeric value or range of values based on the same. In some embodiments of any of the aspects, the reference can be the level of a target molecule in a sample obtained from the same item at an earlier point in time.
[00261] A level which is less than a reference level can be a level which is less by at least about 10%, at least about 20%, at least about 50%, at least about 60%, at least about 80%, at least about 90%, or less relative to the reference level. In some embodiments of any of the aspects, a level which is less than a reference level can be a level which is statistically significantly less than the reference level.
[00262] A level which is more than a reference level can be a level which is greater by at least about 10%, at least about 20%, at least about 50%, at least about 60%, at least about 80%, at least about 90%, at least about 100%, at least about 200%, at least about 300%, at least about 500% or more than the reference level. In some embodiments of any of the aspects, a level which is more than a reference level can be a level which is statistically significantly greater than the reference level.
Compositions
[00263] In another aspect, provided herein are compositions useful in detecting an RNA target. The composition may comprise any of the reagents discussed herein. Generally, the composition comprises one or more of the following: (i) a probe; (ii) a reverse transcriptase; (iii) a first primer for reverse transcription and optionally a second primer for reverse transcription; (iv) an RNA:DNA duplex-specific RNase; (v) a recombinase; (vi) single-stranded binding protein; (vii) a polymerase; (viii) a first primer and optionally a second primer for amplification; (ix) one or more reagents for nucleic acid amplification; and (x) an amplified nucleic acid. It is noted that a composition can comprise any one, two, three, four, five, six, seven, eight, nine, or all ten of the components listed above. In one aspect, the composition comprises: (i) an RNA:DNA duplex-specific RNase and (ii) an amplified nucleic acid.
[00264] In some embodiments, the composition further comprises at least one of the following: reaction buffer, diluent, water, magnesium salt (such as magnesium acetate or magnesium chloride) dNTPs, reducing agent (such as DTT), and/or an RNase inhibitor.
Kits
[00265] Another aspect of the technology described herein relates to kits for detecting a target RNA. Described herein are kit components that can be included in one or more of the kits described herein. In one aspect, described herein is a kit for detecting a target RNA in a sample, comprising: (a) an RNA:DNA duplex-specific RNase; (b) a reverse transcriptase; (c) a DNA polymerase; (c) a recombinase; and (d) single-stranded DNA binding protein. In another aspect, described herein is a kit for detecting a target RNA in a sample, comprising: (a) an RNA:DNA duplex-specific RNase; (b) a reverse transcriptase; and (c) a DNA polymerase.
[00266] In some embodiments of any of the aspects, the RNA:DNA duplex-specific RNase is RNaseH. In some embodiments of any of the aspects, the RNaseH is provided at a sufficient amount, such that at least 0.1 U/pL to 5 U/pL can be added to the reaction mixture.
[00267] In some embodiments of any of the aspects, the kit further comprises a reverse transcriptase. In some embodiments of any of the aspects, the kit is used to reverse transcribe target RNA into DNA, and to amplify the DNA to a detectable amplification product. In some embodiments of any of the aspects, the reverse transcriptase is selected from the group consisting of: a Moloney murine leukemia virus (M-MLV) reverse transcriptase (RT), an avian myeloblastosis virus (AMV)
RT, a retrotransposon RT, atelomerase reverse transcriptase, an HIV-1 reverse transcriptase, or a recombinant version thereof. In some embodiments of any of the aspects, the reverse transcriptase is provided at a sufficient amount, such that at least 200 U/pL can be added to the reaction mixture. [00268] In some embodiments of any of the aspects, the DNA polymerase is a strand-displacing
DNA polymerase. In some embodiments of any of the aspects, the strand-displacing DNA polymerase is selected from the group consisting of: Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase. In some embodiments of any of the aspects, the kit comprises a sufficient amount of Polymerase I Klenow fragment, Bst polymerase, Phi -29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase. In some embodiments of any of the aspects, the DNA polymerase(s) is provided at a sufficient amount to be added to the reaction mixture.
[00269] In some embodiments of any of the aspects, the kit further comprises a first set of primers
(e.g., for RT). In some embodiments of any of the aspects, the first set of primers comprises primers that bind to target RNA and non-target RNA in the sample, i.e., “general” primers. In some embodiments of any of the aspects, the first set of primers comprises random hexamers, i.e., a mixture of oligonucleotides representing all possible hexamer sequences. In some embodiments of any of the aspects, the first set of primers comprises oligo(dT) primer, which bind to the polyA tails of mRNAs or viral transcripts.
[00270] In some embodiments of any of the aspects, the first set of primers is specific to the target
RNA. In some embodiments of any of the aspects, the first set of primers comprises the reverse primer of the second set of primers (e.g., used in the amplification step). In some embodiments of any of the aspects, the first set of primers can comprise the second set of primers, or the second set of primers can comprise the first set of primers.
[00271] In some embodiments of any of the aspects, the kit further comprises a second set of primers (e.g., for isothermal amplification). In some embodiments of any of the aspects, the second set of primers is specific to the target RNA. In some embodiments of any of the aspects, the second set of primers is specific (i.e., binds specifically through complementarity) to cDNA, in other words, the DNA produced in the RT step that is complementary to the target RNA. The second set of primers can be specific to any region of the target RNA. SEQ ID NOs: 3-70 include non-limiting examples of primers that are specific for SARS-CoV-2.
[00272] In some embodiments of any of the aspects, the first and second set primers are provided at a sufficient concentration, e.g., 5 uM to 35 uM, to be added to reaction mixture. As a non-limiting example, the first and/or second set of primers are provided at a concentration of at least 1 uM, at least 2 uM, at least 3 uM, at least 4 uM, at least 5 uM, at least 6uM, at least 7 uM, at least 8 uM, at least 9 uM, at least 10 uM, at least 11 uM, at least 12 uM, at least 13 uM, at least 14 uM, at least 15 uM, at least 16uM, at least 17 uM, at least 18 uM, at least 19 uM, at least 20 uM, at least 21 uM, at least 22 uM, at least 23 uM, at least 24 uM, at least 25 uM, at least 26 uM, at least 27 uM, at least 28 uM, at least 29 uM, at least 30 uM, at least 35 uM, at least 40 uM, at least 45 uM, at least or at least 50 uM. In some embodiments of any of the aspects, the first and/or second set of primers comprise any combination of the primers listed in Table 6 (e.g., SEQ ID NOs: 3-210) or any combination of primers that are at least 95% identical to one of SEQ ID NOs: 3-210 that maintains the same function.
[00273] In some embodiments of any of the aspects, the kit further comprises a recombinase and single -stranded DNA binding (SSB) protein. In some embodiments of any of the aspects, the single- stranded DNA-binding protein is a gp32 SSB protein. In some embodiments of any of the aspects, the recombinase is a uvsX recombinase. In some embodiments of any of the aspects, the recombinase and single -stranded DNA binding proteins are provided at a sufficient amount to be added to the reaction mixture. In some embodiments of any of the aspects, the kit comprises RPA pellets comprising RPA reagents (e.g., DNA polymerase, helicase, SSB) at a sufficient concentration. See e.g., US Patent 7,666,598, the content of which is incorporated herein by reference in its entirety.
[00274] In some embodiments of any of the aspects, the kit further comprises at least one of the following: reaction buffer, diluent, water, magnesium acetate (or another magnesium compound such as magnesium chloride) dNTPs, DTT, and/or an RNase inhibitor.
[00275] In some embodiments of any of the aspects, the kit further comprises reagents for isolating RNA from the sample. In some embodiments of any of the aspects, the kit further comprises detergent, e.g., for lysing the sample. In some embodiments of any of the aspects, the kit further comprises a sample collection device, such a swab. In some embodiments of any of the aspects, the kit further comprises a sample collection container, optionally containing transport media.
[00276] In some embodiments of any of the aspects, the kit is used to reverse transcribe the target RNA into DNA, and to amplify the DNA to a detectable amplification product. In some embodiments of any of the aspects, the kit further comprises reagents for detecting the amplification product, comprising reagents appropriate for a detection method selected from: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR). In some embodiments of any of the aspects, the kit further comprises a third set of primers and/or a detectable probe (e.g., for detection using qPCR, sequencing). In some embodiments of any of the aspects, the kit further comprises one or more lateral flow strips specific for the target amplification product.
[00277] In some embodiments of any of the aspects, the kit further comprises reagents for amplifying and/or detecting a control. Non-limiting examples of negative controls for SARS-CoV-2 include MERS, SARS, 229e, NL63, and hKul, which can be detected using specific primers (e.g., SEQ ID NOs: 33-36, 139-153, 197-208). In some embodiments of any of the aspects, the kit further comprises one or more lateral flow strips specific for the target amplification product. In some embodiments of any of the aspects, the kit further comprises a set of probes for detection through hybridization with a target amplification product. [00278] In some embodiments, the kit comprises an effective amount of the reagents as described herein. As will be appreciated by one of skill in the art, the reagents can be supplied in a lyophilized form or a concentrated form that can diluted or suspended in liquid prior to use. The kit reagents described herein can be supplied in aliquots or in unit doses.
[00279] In some embodiments, the components described herein can be provided singularly or in any combination as a kit. Such a kit includes the components described herein and packaging materials thereof. In addition, a kit optionally comprises informational material.
[00280] In some embodiments, the compositions in a kit can be provided in a watertight or gas tight container which in some embodiments is substantially free of other components of the kit. For example, the reagents described herein can be supplied in more than one container, e.g., it can be supplied in a container having sufficient reagent for a predetermined number of applications, e.g., 1,
2, 3 or greater. One or more components as described herein can be provided in any form, e.g., liquid, dried or lyophilized form. Liquids or components for suspension or solution of the reagents can be provided in sterile form and should not contain microorganisms or other contaminants. When the components described herein are provided in a liquid solution, the liquid solution preferably is an aqueous solution.
[00281] The informational material can be descriptive, instructional, marketing or other material that relates to the methods described herein. The informational material of the kits is not limited in its form. In some embodiments, the informational material can include information about production of the reagents, concentration, date of expiration, batch or production site information, and so forth. In some embodiments, the informational material relates to methods for using or administering the components of the kit.
[00282] The kit will typically be provided with its various elements included in one package, e.g., a fiber-based, e.g., a cardboard, or polymeric, e.g., a Styrofoam box. The enclosure can be configured so as to maintain a temperature differential between the interior and the exterior, e.g., it can provide insulating properties to keep the reagents at a preselected temperature for a preselected time.
[00283] In some embodiments of any of the aspects, the kit can further comprise a detection device. As a non-limiting example, a detection device can comprise a light-emitting diode (LED) light source and/or a filter (e.g., plastic filter specific for the emitting wavelength of a detectable marker). In some embodiments of any of the aspects, the kit and/or the detection device is field-deployable, i.e., transportable, non-refrigerated, and/or inexpensive. In some embodiments of any of the aspects, a detection device further comprises a wireless device (e.g., a cell phone, a personal digital assistant (PDA), a tablet).
Systems [00284] Fig. 8 shows an exemplary schematic of a system as described herein. As a non-limiting example, the amplification product as described herein can be detected using a plate-based assay 100 as described herein (e.g., SHERLOCK, hybridization, qPCR, sequencing, etc.). In embodiments where the assay is detected using detectable markers such as fluorophores, the results of the assay can be detected by exposing the detection assay 100 to a light source 200 (according to the specific excitation wavelength of a detection molecule in the assay) and a filter 300 (according to the specific emission wavelength of a detection molecule in the assay). The emitted wavelength of the detection molecule in the assay can be detected by the camera 405 of a portable computing device 400 (e.g., a mobile phone) or any other device comprising a camera 405. In some embodiments of any of the aspects, the amplification product is detected using a test strip 150 (e.g., using lateral flow detection and/or conjugated or unconjugated DNA). The colorimetric signals of the test strip 150 can be detected by the camera 405 of a portable computing device 400 (e.g., a mobile phone) or any other device comprising a camera 405.
[00285] The portable computing device 400 can be connected to a network 500. In some embodiments, the network 500 can be connected to another computing device 600 and/or a server 800. The network 500 can be connected to various other devices, servers, or network equipment for implementing the present disclosure. A computing device 600 can be connected to a display 700. Computing device 400 or 600 can be any suitable computing device, including a desktop computer, server (including remote servers), mobile device, or any other suitable computing device. In some examples, programs for implementing the system can be stored in database 900 and run on server 800. Additionally, data and data processed or produced by said programs can be stored in database 900. [00286] It should initially be understood that the methods and systems described herein can be implemented with any type of hardware and/or software, and can include use of a pre-programmed general purpose computing device. For example, the system can be implemented using a server, a personal computer, a portable computer, a thin client, or any suitable device or devices. The kits, methods and/or components for the performance thereof can include the use of a single device at a single location, or multiple devices at a single, or multiple, locations that are connected together using any appropriate communication protocols over any communication medium such as electric cable, fiber optic cable, or in a wireless manner.
[00287] It should also be noted that the systems as described herein can be arranged or used in a format having a plurality of modules which perform particular functions. It should be understood that these modules are merely schematically illustrated based on their function for clarity purposes only, and do not necessary represent specific hardware or software. In this regard, these modules can be hardware and/or software implemented to substantially perform the particular functions discussed. Moreover, the modules can be combined together within the disclosure, or divided into additional modules based on the particular function desired. Thus, the disclosure should not be construed to limit the present technology as disclosed herein, but merely be understood to illustrate one example implementation thereof.
[00288] The computing system can include clients and servers. A client and server are generally remote from each other and typically interact through a communication network. The relationship of client and server arises by virtue of computer programs running on the respective computers and having a client-server relationship to each other. In some implementations, a server transmits data (e.g., an HTML page) to a client device (e.g., for purposes of displaying data to and receiving user input from a user interacting with the client device). Data generated at the client device (e.g., a result of the user interaction) can be received from the client device at the server.
[00289] Implementations of the subject matter described in this specification can be performed in a computing system that includes a back end component, e.g., as a data server, or that includes a middleware component, e.g., an application server, or that includes a front end component, e.g., a client computer having a graphical user interface or a Web browser through which a user can interact with an implementation of the subject matter described in this specification, or any combination of one or more such back end, middleware, or front end components. The components of the system can be interconnected by any form or medium of digital data communication, e.g., a communication network. Examples of communication networks include a local area network (“LAN”) and a wide area network (“WAN”), an inter-network (e.g., the Internet), and peer-to-peer networks (e.g., ad hoc peer to-peer networks).
[00290] Implementations of the subject matter and the operations described in this specification can be implemented in digital electronic circuitry, or in computer software, firmware, or hardware, including the structures disclosed in this specification and their structural equivalents, or in combinations of one or more of them. Implementations of the subject matter described in this specification can be implemented as one or more computer programs, i.e., one or more modules of computer program instructions, encoded on computer storage medium for execution by, or to control the operation of, data processing apparatus. Alternatively or in addition, the program instructions can be encoded on an artificially generated propagated signal, e.g., a machine-generated electrical, optical, or electromagnetic signal that is generated to encode information for transmission to suitable receiver apparatus for execution by a data processing apparatus. A computer storage medium can be, or be included in, a computer-readable storage device, a computer-readable storage substrate, a random or serial access memory array or device, or a combination of one or more of them. Moreover, while a computer storage medium is not a propagated signal, a computer storage medium can be a source or destination of computer program instructions encoded in an artificially generated propagated signal. The computer storage medium can also be, or be included in, one or more separate physical components or media (e.g., CDs, disks, or other storage devices). [00291] The operations described in this specification can be implemented as operations performed by a “data processing apparatus” on data stored on one or more computer-readable storage devices or received from other sources.
[00292] The term “data processing apparatus” encompasses all kinds of apparatus, devices, and machines for processing data, including by way of example a programmable processor, a computer, a system on a chip, or multiple ones, or combinations, of the foregoing. The apparatus can include special purpose logic circuitry, e.g., an FPGA (field programmable gate array) or an ASIC (application specific integrated circuit). The apparatus can also include, in addition to hardware, code that creates an execution environment for the computer program in question, e.g., code that constitutes processor firmware, a protocol stack, a database management system, an operating system, a cross platform runtime environment, a virtual machine, or a combination of one or more of these. The apparatus and execution environment can realize various different computing model infrastructures, such as web services, distributed computing and grid computing infrastructures.
[00293] A computer program (also known as a program, software, software application, script, or code) can be written in any form of programming language, including compiled or interpreted languages, declarative or procedural languages, and it can be deployed in any form, including as a standalone program or as a module, component, subroutine, object, or other unit suitable for use in a computing environment. A computer program can, but need not, correspond to a file in a file system. A program can be stored in a portion of a file that holds other programs or data (e.g., one or more scripts stored in a markup language document), in a single file dedicated to the program in question, or in multiple coordinated files (e.g., files that store one or more modules, sub programs, or portions of code). A computer program can be deployed to be executed on one computer or on multiple computers that are located at one site or distributed across multiple sites and interconnected by a communication network.
[00294] The processes and logic flows described in this specification can be performed by one or more programmable processors executing one or more computer programs to perform actions by operating on input data and generating output. The processes and logic flows can also be performed by, and apparatus can also be implemented as, special purpose logic circuitry, e.g., an FPGA or an ASIC as noted above.
[00295] Processors suitable for the execution of a computer program include, by way of example, both general and special purpose microprocessors, and any one or more processors of any kind of digital computer. Generally, a processor will receive instructions and data from a read only memory or a random access memory or both. The essential elements of a computer are a processor for performing actions in accordance with instructions and one or more memory devices for storing instructions and data. Generally, a computer will also include, or be operatively coupled to receive data from, or transfer data to, or both, one or more mass storage devices for storing data, e.g., magnetic, magneto optical disks, or optical disks. However, a computer need not have such devices. Moreover, a computer can be embedded in another device, e.g., a mobile telephone, a personal digital assistant (PDA), a mobile audio or video player, a game console, a Global Positioning System (GPS) receiver, or a portable storage device (e.g., a universal serial bus (USB) flash drive), to name just a few. Devices suitable for storing computer program instructions and data include all forms of nonvolatile memory, media and memory devices, including by way of example semiconductor memory devices, e.g., EPROM, EEPROM, and flash memory devices; magnetic disks, e.g., internal hard disks or removable disks; magneto optical disks; and CD ROM and DVD-ROM disks. The processor and the memory can be supplemented by, or incorporated in, special purpose logic circuitry.
Definitions
[00296] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims, are provided below. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided within the specification shall prevail.
[00297] For convenience, certain terms employed herein, in the specification, examples and appended claims are collected here.
[00298] The terms “decrease”, “reduced”, “reduction”, or “inhibit” are all used herein to mean a decrease by a statistically significant amount. In some embodiments, “reduce,” “reduction" or “decrease" or “inhibit” typically means a decrease by at least 10% as compared to a reference level (e.g. the absence of a given treatment or agent) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% , or more. As used herein, “reduction” or “inhibition” does not encompass a complete inhibition or reduction as compared to a reference level. “Complete inhibition” is a 100% inhibition as compared to a reference level. A decrease can be preferably down to a level accepted as within the range of normal for an individual without a given disorder.
[00299] The terms “increased”, “increase”, “enhance”, or “activate” are all used herein to mean an increase by a statically significant amount. In some embodiments, the terms “increased”, “increase”, “enhance”, or “activate” can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3 -fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. In the context of a marker or symptom, a “increase” is a statistically significant increase in such level.
[00300] As used herein, a "subject" means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. In some embodiments, the subject is a mammal, e.g., a primate, e.g., a human. The terms, “individual,” “patient” and “subject” are used interchangeably herein.
[00301] Preferably, the subject is a mammal. The mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of viral infection. A subject can be male or female.
[00302] A subject can be one who has been previously diagnosed with or identified as suffering from or having a condition in need of treatment (e.g. a viral infection) or one or more complications related to such a condition, and optionally, have already undergone treatment for a viral infection or the one or more complications related to a viral infection. Alternatively, a subject can also be one who has not been previously diagnosed as having a viral infection or one or more complications related to a viral infection. For example, a subject can be one who exhibits one or more risk factors for a viral infection or one or more complications related to a viral infection or a subject who does not exhibit risk factors. A “subject in need” of testing for a particular condition can be a subject having that condition, diagnosed as having that condition, or at risk of developing that condition.
[00303] As used herein, the terms “protein" and “polypeptide" are used interchangeably to designate a series of amino acid residues, connected to each other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues. The terms "protein", and "polypeptide" refer to a polymer of amino acids, including modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of its size or function. "Protein" and “polypeptide” are often used in reference to relatively large polypeptides, whereas the term "peptide" is often used in reference to small polypeptides, but usage of these terms in the art overlaps. The terms "protein" and "polypeptide" are used interchangeably herein when referring to a gene product and fragments thereof. Thus, exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, fragments, and analogs of the foregoing.
[00304] In the various embodiments described herein, it is further contemplated that variants (naturally occurring or otherwise), alleles, homologs, conservatively modified variants, and/or conservative substitution variants of any of the particular polypeptides described are encompassed. As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters a single amino acid or a small percentage of amino acids in the encoded sequence is a “conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid and retains the desired activity of the polypeptide. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles consistent with the disclosure.
[00305] A given amino acid can be replaced by a residue having similar physiochemical characteristics, e.g., substituting one aliphatic residue for another (such as lie, Val, Leu, or Ala for one another), or substitution of one polar residue for another (such as between Lys and Arg; Glu and Asp; or Gin and Asn). Other such conservative substitutions, e.g., substitutions of entire regions having similar hydrophobicity characteristics, are well known. Polypeptides comprising conservative amino acid substitutions can be tested confirm that a desired activity and specificity of a native or reference polypeptide is retained.
[00306] Amino acids can be grouped according to similarities in the properties of their side chains (in A. L. Lehninger, in Biochemistry, second ed., pp. 73-75, Worth Publishers, New York (1975)): (1) non-polar: Ala (A), Val (V), Leu (L), lie (I), Pro (P), Phe (F), Trp (W), Met (M); (2) uncharged polar: Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gin (Q); (3) acidic: Asp (D), Glu (E); (4) basic: Lys (K), Arg (R), His (H). Alternatively, naturally occurring residues can be divided into groups based on common side-chain properties: (1) hydrophobic: Norleucine, Met, Ala, Val, Leu, He; (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gin; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; (6) aromatic: Trp, Tyr, Phe. Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Particular conservative substitutions include, for example; Ala into Gly or into Ser; Arg into Lys; Asn into Gin or into His; Asp into Glu; Cys into Ser; Gin into Asn; Glu into Asp; Gly into Ala or into Pro; His into Asn or into Gin; He into Leu or into Val; Leu into He or into Val; Lys into Arg, into Gin or into Glu; Met into Leu, into Tyr or into He; Phe into Met, into Leu or into Tyr; Ser into Thr; Thr into Ser; Trp into Tyr; Tyr into Trp; and/or Phe into Val, into He or into Leu.
[00307] In some embodiments, the polypeptide described herein (or a nucleic acid encoding such a polypeptide) can be a functional fragment of one of the amino acid sequences described herein. As used herein, a “functional fragment” is a fragment or segment of a polypeptide which retains at least 50% of the wild-type reference polypeptide’s activity according to the assays described herein. A functional fragment can comprise conservative substitutions of the sequences disclosed herein.
[00308] In some embodiments, the polypeptide described herein can be a variant of a sequence described herein. In some embodiments, the variant is a conservatively modified variant. Conservative substitution variants can be obtained by mutations of native nucleotide sequences, for example. A “variant," as referred to herein, is a polypeptide substantially homologous to a native or reference polypeptide, but which has an amino acid sequence different from that of the native or reference polypeptide because of one or a plurality of deletions, insertions or substitutions. Variant polypeptide encoding DNA sequences encompass sequences that comprise one or more additions, deletions, or substitutions of nucleotides when compared to a native or reference DNA sequence, but that encode a variant protein or fragment thereof that retains activity. A wide variety of PCR-based site-specific mutagenesis approaches are known in the art and can be applied by the ordinarily skilled artisan to generate and test artificial variants.
[00309] A variant DNA or amino acid sequence can be at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, identical to a native or reference sequence. The degree of homology (percent identity) between a native and a mutant sequence can be determined, for example, by comparing the two sequences using freely available computer programs commonly employed for this purpose on the world wide web (e.g. BLASTp or BLASTn with default settings).
[00310] In some embodiments, the methods described herein relate to measuring, detecting, or determining the level of at least one target, e.g., the target RNA. As used herein, the term "detecting" or “measuring” refers to observing a signal from, e.g. a probe, label, or target molecule to indicate the presence of an analyte in a sample. Any method known in the art for detecting a particular label moiety can be used for detection. Exemplary detection methods include, but are not limited to, spectroscopic, fluorescent, photochemical, biochemical, immunochemical, electrical, optical or chemical methods. In some embodiments of any of the aspects, measuring can be a quantitative observation. Sequence determination, e.g., that indicates or confirms the presence of a given sequence element, e.g., a barcode element or region thereof, is a form of detecting.
[00311] In some embodiments of any of the aspects, a polypeptide, nucleic acid, cell, or microorganism as described herein can be engineered. As used herein, “engineered" refers to the aspect of having been manipulated by the hand of man. For example, a polynucleotide is considered to be “engineered" when at least one aspect of the polynucleotide, e.g., its sequence, has been manipulated by the hand of man to differ from the aspect as it exists in nature. [00312] As used herein, “contacting" refers to any suitable means for delivering, or exposing, an agent to at least one component as described herein (e.g., sample, target R A, cDNA, amplification product, etc.). In some embodiments, contacting comprises physical human activity, e.g., an injection; an act of dispensing, mixing, and/or decanting; and/or manipulation of a delivery device or machine. [00313] As used herein, the term “specific binding” refers to a chemical interaction between two molecules, compounds, cells and/or particles wherein the first entity binds to the second, target entity with greater specificity and affinity than it binds to a third entity which is a non-target. In some embodiments, specific binding can refer to an affinity of the first entity for the second target entity which is at least 10 times, at least 50 times, at least 100 times, at least 500 times, at least 1000 times or greater than the affinity for the third non-target entity. A reagent specific for a given target is one that exhibits specific binding for that target under the conditions of the assay being utilized.
[00314] The term “statistically significant" or “significantly" refers to statistical significance and generally means a two standard deviations (2SD) or greater difference.
[00315] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term “about.” The term “about” when used in connection with percentages can mean ±1%. In some embodiments of any of the aspects, the term “about” when used in connection with percentages can mean ±5%.
[00316] As used herein, the term “comprising” means that other elements can also be present in addition to the defined elements presented. The use of “comprising” indicates inclusion rather than limitation.
[00317] The term "consisting of' refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
[00318] As used herein the term "consisting essentially of' refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.
[00319] The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The abbreviation, "e.g." is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation "e.g." is synonymous with the term "for example." [00320] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and/or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.
[00321] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art to which this disclosure belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 20th Edition, published by Merck Sharp & Dohme Corp., 2018 (ISBN 0911910190, 978-0911910421); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Wemer Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), W. W. Norton & Company, 2016 (ISBN 0815345054, 978-0815345053); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN- 1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of which are all incorporated by reference herein in their entireties. [00322] Other terms are defined herein within the description of the various aspects of the invention.
[00323] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.
[00324] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. Moreover, due to biological functional equivalency considerations, some changes can be made in protein structure without affecting the biological or chemical action in kind or amount. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.
[00325] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.
[00326] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting.
[00327] Some embodiments of the technology described herein can be defined according to any of the following numbered paragraphs:
1. A method of detecting a target RNA in a sample, comprising: a. contacting the sample with a reverse transcriptase, and a first set of primers; b. contacting the sample with an RNA:DNA duplex-specific RNase; c. contacting the sample with a DNA polymerase, a second set of primers, a recombinase, and single -stranded DNA binding protein; and d. detecting an isothermal amplification product from step (c).
2. A method of detecting a target RNA in a sample, comprising: a. contacting the sample with a reverse transcriptase, and a first set of primers; b. contacting the sample with an RNA:DNA duplex-specific RNase; c. contacting the sample with a DNA polymerase and a second set of primers; and d. detecting an amplification product from step (c). The method of any of paragraphs 1-2, wherein the RNase is RNaseH. The method of any of paragraphs 1-3, wherein steps (a), (b) and (c) are performed simultaneously in the same reaction. The method of any of paragraphs 1-4, wherein steps (a) and (b) are performed simultaneously in the same reaction, and step (c) is performed after steps (a) and (b). The method of any of paragraphs 1-4, wherein steps (b) and (c) are performed simultaneously in the same reaction, and step (a) is performed prior to steps (b) and (c). The method of any of paragraphs 1-6, wherein the RNaseH is provided at a concentration of 0.1 U/pL to 5 U/pL. The method of any of paragraphs 1-7, wherein the RNaseH is provided at a concentration of 2.5 U/pL The method of paragraphs 1 or 2, wherein step (c) permits an isothermal amplification reaction. The method of paragraph 9, wherein the isothermal amplification reaction is selected from the group consisting of: Recombinase Polymerase Amplification (RPA), Loop Mediated Isothermal Amplification (LAMP), Helicase -dependent isothermal DNA amplification (HDA), Rolling Circle Amplification (RCA), and strand displacement amplification (SDA). The method of paragraph 9, wherein the isothermal amplification reaction is Recombinase Polymerase Amplification (RPA). The method of paragraph 2, wherein step (c) further comprises contacting the sample with a recombinase and single-stranded DNA binding protein. The method of paragraphs 1 or 2, wherein the first set of primers comprises primers that bind to target RNA and non-target RNA in the sample. The method of paragraph 13, wherein the first set of primers comprises random hexamers. The method of paragraphs 1 or 2, wherein the first set of primers is specific to the target RNA. The method of paragraphs 1 or 2, wherein the second set of primers is specific to the target RNA. The method of paragraphs 1 or 2, wherein steps (a), (b), and/or (c) are performed between 12°C and 45°C. The method of paragraph 17, wherein steps (a), (b) and/or (c) are performed at room temperature. The method of paragraph 17, wherein steps (a), (b), and (c) are performed on a heat block. The method of paragraphs 1 or 2, wherein steps (a), (b), and (c) are performed in less than 20 minutes. The method of paragraphs 1 or 2, wherein steps (a), (b), (c), and (d) are performed faster than a method comprising steps (a), (c), and (d) without the RNA:DNA duplex-specific RNase. The method of paragraphs 1 or 2, wherein steps (a), (b), and (c) produce a higher yield of amplification product than a method comprising steps (a) and (c) without the RNA:DNA duplex-specific RNase. The method of paragraphs 1 or 2, wherein prior to step (a) total RNA is isolated from the sample. The method of paragraphs 1 or 2, wherein prior to step (a), the sample is contacted with a detergent. The method of paragraphs 1 or 2, wherein the target RNA is a viral RNA. The method of paragraphs 1 or 2, wherein the detection of step (d) is selected from the group consisting of: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR). A kit for detecting a target RNA in a sample, comprising: a. an RNA:DNA duplex-specific RNase; b . a reverse transcriptase ; c. a DNA polymerase; d. a recombinase; and e. single -stranded DNA binding protein. A kit for detecting a target RNA in a sample, comprising: a. an RNA:DNA duplex-specific RNase; b. a reverse transcriptase; and c. a DNA polymerase. The kit of paragraphs 27 or 28, wherein the RNA:DNA duplex-specific RNase is RNaseH. The kit of paragraphs 27 or 28, wherein the reverse transcriptase is selected from the group consisting of: a Moloney murine leukemia virus (M-MLV) reverse transcriptase (RT), an avian myeloblastosis virus (AMV) RT, a retrotransposon RT, a telomerase reverse transcriptase, an HIV-1 reverse transcriptase, or a recombinant version thereof. The kit of paragraphs 27 or 28, wherein the DNA polymerase is a strand-displacing DNA polymerase. The kit of paragraph 31, wherein the strand-displacing DNA polymerase is selected from the group consisting of: Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase. 33. The kit of paragraphs 27 or 28, furthering comprising a first and second set of primers.
34. The kit of paragraph 33, wherein the first set of primers comprises primers that bind to target RNA and non-target RNA in the sample.
35. The kit of paragraphs 33 or 34, wherein the first set of primers comprises random hexamers.
36. The kit of paragraph 35, wherein the first set of primers is specific to the target RNA.
37. The kit of paragraph 35, wherein the second set of primers are specific to the target RNA.
38. The kit of any of paragraphs 33-37, wherein the second set of primers comprises a forward and reverse primer, and the first set of primers comprises the reverse primer of the second set of primers.
39. The kit of paragraph 28, further comprising a recombinase and single -stranded DNA binding protein.
40. The kit of paragraphs 27 or 28, further comprising a reaction buffer and magnesium acetate.
41. The kit of paragraphs 27 or 28, further comprising reagents for isolating RNA from the sample.
42. The kit of paragraphs 27 or 28, further comprising detergent for lysing the sample.
43. The kit of any of paragraphs 27-42, wherein the kit is used to reverse transcribe the target RNA into DNA, and to amplify the DNA to a detectable amplification product.
44. The kit of paragraph 43, further comprising reagents for detecting the amplification product, comprising reagents appropriate for a detection method selected from: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High- sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
45. The kit of paragraphs 43 or 44, further comprising one or more lateral flow strips specific for the target amplification product.
46. A method of detecting an RNA virus in a sample from a subject, comprising: a. isolating viral RNA from the subject; and b. performing the method of paragraphs 1-26.
47. The method of paragraph 46, wherein the RNA virus is selected from influenza virus, human immunodeficiency virus (HIV), and severe acute respiratory syndrome coronavirus 2 (SARS- CoV-2).
EXAMPLES
Example 1
[00328] Enhancement of RT-RPA reaction by the addition of RNaseH [00329] There is a critical need for rapid robust isothermal amplification methods for point-of- care (POC) diagnostics. A key part of this process is the conversion of an RNA to be measured to DNA, typically by a reverse transcriptase (RT) followed by method such as the recombinase polymerase amplification (RPA), which can isothermally amplify the cDNA sequence of interest. It has been observed that RT-RPA is slow compared to RPA alone. RPA alone, using DNA as a template, can amplify a single molecule of product to completion in approximately 7 minutes. An RT- RPA reaction typically takes 25 minutes and can have lower yield. This difference in time and often robustness is relevant for the rapid diagnostics needed in at-home and point of care (POC) settings. Surprisingly, performing the RT-RPA as sequential reactions (RT first in one tube followed by RPA second in a second tube) did not have a marked improvement over a single pot reaction for either time or yield. More critically, in RT followed by RPA, it was determined that the RPA reaction was slow. [00330] It was thus deduced that there must be an inhibitor from the RT reaction. The RPA reaction time was not reduced by the addition of reverse transcriptase, generic RNA (e.g., not complementary to the cDNA), or reverse transcription buffers. After several lines of testing, the inhibitor was narrowed down to an RNA species. Without wishing to be bound by theory, it was theorized that the RNA (e.g., target RNA) used in the RT reaction was binding to the DNA that was being created to make a hybrid RNA:DNA molecule which was inhibiting the RPA reaction. A direct test of this hypothesis and a method for greatly improving the time and yield of an RT-RPA was to include RNaseH in the RT-RPA reaction. RNaseH only degrades the RNA in RNA:DNA hybrids. Using RNaseH allows the RT reaction to proceed but after a DNA molecule is made, the RNaseH destroys the RNA and thereby enhances the RPA reaction. Indeed, as described below, RNaseH greatly improves the RT-RPA reaction.
[00331] While on the experiments described herein focus on RT-RPA, the reformulated RT reaction (i.e., an RT reaction containing RNaseH) can be more generally useful. For example, the addition of RNaseH to loop-mediated isothermal amplification (LAMP) improves the reaction and allows the reaction to be performed at room temperature (traditional LAMP protocols need to be performed at 65 °C). This change in temperature simplifies the LAMP protocol, allows the reaction to be performed at room temperature, and lowers the background signal.
[00332] The standard RT-RPA consists of an RPA reaction pellet by TwistDx™, rehydration buffer supplied with the TwistDx™ pellets, UltraPure™ water, Protoscriptase II Reverse Transcriptase™ (RT) by NEB™, magnesium acetate, as well as forward and reverse primers. In the modified RT-RPA example, the formulation includes RNaseH by NEB.
[00333] To test if RNaseH would help, a standard RT-RPA was compared to the same reaction with 1.25 U of RNAse H added (see e.g., Figure 1). For the two pot reaction, the RPA primers were used at 5 mM concentrations. The Protoscriptase II™ (200 U/pL) was diluted in rehydration buffer to reach a final concentration of 20 U/pL. RNaseH was diluted in rehydration buffer to reach a final concentration of 1.25 U/pL. After either 5 or 20 minutes of RT, 1 pL of the RT reaction was transferred to a 10 pL standard RPA reaction with the RT serving as the template. The addition of RNaseH greatly increased the yield of the RPA reaction (see e.g., Figure 1). As expected, when DNA was used instead of RNA as an input to the RPA reaction there was no effect of RNaseH (see e.g., Figure 1). This experiment was repeated as a one pot reaction (RT-RPA in one reaction following the standard protocol) and found it also greatly improved the timing and yield (see e.g., Figure 2).
[00334] To optimize the addition of RNaseH, standard protocols of RT and RPA were used, and RNaseH was added at different concentrations and for different amounts of time. Specifically, the RPA primers were used at 5 mM concentrations. The Protoscriptase II™ (200 U/pL) was diluted in rehydration buffer to reach a final concentration of 20 U/pL. A series of concentrations of RNaseH were tested from 0.1 U/pL to 5 U/pL by diluting the stock RNaseH from 5,000 U/mL with rehydration buffer (see e.g., Figures 4 and 5). The optimal concentration was found to be 2.5 U/pL (see e.g., Figure 5).
[00335] For five RPA reactions of 10 pL volumes, each of the following were combined in a 1.5 mL Eppendorf on ice: 12.2 pL water, 29.5 pL rehydration buffer, and 4.8 pL of primer mix (5 pM each). 10 pL of the mix were transferred to a TwistDx™ pellet. After resuspending the pellet, the volume was transferred back to the original Eppendorf tube to which 5 uL of Protoscriptase II™ RT, 2.5 pL magnesium acetate, and 5 uL of template were added. 9 pL of master mix was split into five PCR tubes and 1 pL of diluted RNaseH was added to each reaction to reach a final volume of 10 pL. A heat block was set to 42°C, and the RPA reaction was run for 10 min or 25 min minutes on the heat block (see e.g., Figure 3). For each RPA reaction, a negative control was included for which all of the components were added to the reaction with the exception of the template being replaced by water. [00336] The detection used for each of the experiments (see e.g., Fig. 1-5) was qPCR. After the RPA was complete, 2 pL from each reaction was diluted 1 :200 in water. 10 pL of a qPCR master mix composed of PowerUp SYBR Green Master Mix™ by Thermo Fisher™, 5 pM primer mix, and UltraPure™ water was distributed into a 96 well plate. 2 pL of the diluted RPA template was added to 10 pL of the qPCR master mix. Each RPA condition was tested by qPCR in triplicate. The readout on the qPCR is a Ct value which indicates when the fluorescent signal is in the exponential phase.
Reverse Transcription (RT)
[00337] The primer used for the reverse transcription (RT) reaction can be the same as the reverse primer for RPA. Run the RT reaction in a Hybex® heated to 42°C. After the RT reaction is complete, transfer it to ice and remove 1 pL for use as the template in the RPA protocol described below.
[00338] The protocol for reverse transcriptase by NEB™ was followed (see e.g., Table 1), which is available on the world wide web at neb.com/protocols/2016/04/26/first-strand-cdna-synthesis- quick-protocol-neb-m0368 [00339] Table 1: RT protocol
Figure imgf000088_0001
[00340] Standard RNAse inhibitors like the Murine RNAse Inhibitor do not inhibit the RNaseH reaction. This is due to the fact that RNaseH works by a distinct mechanism from standard RNases and is not affected by the standard inhibitors.
Recombinase Polymerase Amplification (RPA)
[00341] (1) The RPA reaction must be kept on ice until the reaction is ready to begin. Preheat a
Hybex® to 42°C.
[00342] (2) In a 1.5 mL Eppendorf pipette up and down after adding the following from Table 2.
Take caution to only return to the first stop on the pipette when releasing the volume due to the viscosity of the rehydration buffer:
[00343] The RPA protocol is derived from TwistDx™.
[00344] Table 2: RPA Protocol
Figure imgf000088_0002
[00345] (3) Remove 10 uL of the master mix and transfer to one RPA pellet from TwistDx™.
Resuspend the pellet and transfer the volume back to the original Eppendorf. If using more than one pellet, remove 10 uL of master mix for each pellet being resuspended.
[00346] (4) Pipette up and down to mix well. Add the following components and mix well again. [00347] Table 3
Figure imgf000089_0001
[00348] (5) For each reaction distribute 9 pL of Master mix to a PCR tube and then add 1 pL of
RNaseH (2.5 U/pL).
[00349] (6) Place the reactions on a heat block set to 42 °C for 15 min then return to ice.
Quantitative Polymerase Chain Reaction (qPCR)
[00350] (1) Pre-Dilute the RPA (1:200) (this is variable) in water.
[00351] (2) Combine the following in a 1.5 mL Eppendorf and mix well. To calculate the amount of master mix needed, multiply the number of RPAs by three.
[00352] Table 4: The following protocol is derived from Thermo Fisher.
Figure imgf000089_0002
[00353] (3) Distribute 10 uL of master mix into each well being tested on a 96 well plate. Add 2 uL of diluted RPA to respective wells.
[00354] (4) Run the 96 well plate on a qPCR for 40 cycles.
Example 2
[00355] SARS-CoV-2: RT-RPA-RNaseH Reagents and Equipment [00356] Table 7: Reagents
Figure imgf000090_0001
_
[00357] Table 8: Instruments
Figure imgf000090_0002
Lysis/RNA Extraction Protocol
[00358] The lysis/RNA extraction protocol can follow Method 1 or Method 2.
[00359] Method 1: 1) Put swab into viral transport media following standard protocol of local hospital. 2) Use an inactivation and RNA extraction kit.
[00360] Method 2: 1) Put swab or sputum into viral transport media (e.g., 100 uL viral transport media. (A small volume of viral transport media is preferred, as the viral load per uL will be higher.) (2) Add RNAse inhibitor of choice at lU/uL to viral transport media (e.g., 25 uL of Murine RNAse inhibitor per mL of viral transport media). (3) Heat for 5 minutes at 94 C.
RT-RPA-RNaseH Master Mix
[00361] The reaction volumes for the detection protocol below are formulated for 10 samples to be tested. The volumes can be adjusted accordingly. Prepare all reactions on ice.
[00362] Rehydration Buffer is very viscous. When pipetting steps with viscous solutions: 1) Pipette slowly to avoid bubbles. 2) Mix 5 times using 75% of total volume being resuspended (i.e. for a 100 uL volume, set pipette to 75 uL). 3) After dispensing most volume, wait 5 seconds until remaining liquid settles inside the pipette tip, then slowly dispense remaining volume.
[00363] Prepare the RT-RPA master mix in DNALoBind™ tubes (see e.g., Table 9).
[00364] Table 9: RT-RPA master mix preparation
Figure imgf000091_0001
[00365] Place RT-RPA master mix on ice. Make sure the solution is cool before adding to the TwistDx RPA pellets. For 10 samples, 5 TwistDx RPA pellets are added to the RT-RPA master mix. Resuspend each TwistDx RPA pellet with the RT-RPA master mix by dispensing 40 uL of master mix per pellet and let it sit on ice in a metal block for 2 min. (Note: expect a cloudy and viscous solution). Pipette each pellet reaction up and down with 20 uL volume and transfer the entire re suspension back to the original master mix tube.
[00366] Prepare two sets of PCR strips or plates labeled “outer” and “inner”, respectively. Prepare two 1.5 mL DNALoBind tubes for the nested RT-RPA reactions (outer and inner master mixes). As used herein, nested amplification (e.g., nested RPA) refers to a first amplification reaction comprising an outer set of primers and a second amplification reaction using the product of the first amplification reaction and an inner set of primers specific to the first amplification reaction.
[00367] Pipette calculated volume of prepared master mix into each tube labelled “outer” and “inner” (see e.g., Table 10). Mix 5 times using 75% of total volume being resuspended (i.e. for a 100 uL volume, set pipette to 75 uL).
[00368] Table 10: Nested RPA Primer Mix
Figure imgf000091_0002
[00369] Distribute 8 uL of master mix into each reaction well for “outer” and “inner” corresponding strips. Skip every other well on the PCR strip or plate. Leave strips or plate uncovered until input material is added. Set up PCR strip or plate in "checkerboard" pattern, skipping every other well to avoid cross contamination.
RT-RPA Reactions
[00370] Add 2 uL of template sample (or control) to the outer RT-RPA PCR strip (or plate). For each well, use the same tip to gently mix with the pipette set to 4 uL volume. Close Lids or seal plates with Plate Seal B. [00371] Heat the tubes for 10 min at 42C on a heat block or PCR machine. (Note: change gloves between outer & inner RT-RPA reactions). Note: This is a good time to make the Probe Hybridization master mix (see below).
[00372] Remove the outer RT-RPA samples from the heater and place on ice in a metal block. Remove plate seal carefully to avoid cross contamination.
[00373] Dilute outer RPA reaction with 180 uL of RNase-free water. Using the same tip mix well using -75% volume (-140 uL), without lifting the tip out of the liquid.
[00374] Add 2 uL of diluted outer RPA reaction mix to each well that contains the prepared 8 uL of inner RT-RPA mastermix in the PCR strip (or plate). (As before, skip every other well). Using the same tips, gently mix with the pipette set to 4 uU volume. Close lids or seal plates with Plate Seal B.
[00375] Heat the inner RT-RPA reaction for 10 min at 42°C on a heat block or PCR machine.
[00376] Remove the inner RT-RPA samples from the metal block and place samples on ice.
Detection of the RPA Products
[00377] Make Probe Hybridization Mix (see e.g., Table 11; see e.g., Table 6 for exemplary probes, e.g., SEQ ID NOs: 15-20 or SEQ ID NOs: 27-32).
[00378] Table 11: Probe Hybridization Mix
Figure imgf000092_0001
[00379] Aliquot 18 uL of the Probe Hybridization Mix to a labeled PCR strip (or plate) skipping every other well. Make one well for each sample. Can leave at room temperature.
[00380] Mix the inner RT-RPA with pipette set to 2 uL without lifting the tip out of the liquid.
[00381] Transfer 2 uL of the inner RT-RPA reaction to each probe reaction well, using same tip used to mix the inner RT-RPA reaction.
[00382] Close lids for PCR strip or seal the PCR plate with Plate Seal B.
[00383] Heat the reaction at 94 C for 3 min on heatblock (with heated-lid, if available).
[00384] Cool hybridized reactions at room temperature on the bench for 3 minutes.
[00385] Open carefully to avoid cross-contamination.
[00386] Add 60 uL of Milenia™ running buffer to each reaction well.
[00387] Pipette up and down to mix. [00388] Add one lateral flow strip to each reaction. Make sure to insert the strip so the green region is closest to the reaction. Note: to conserve strips, first test positive and negative controls. If those look correct test remaining reactions.
[00389] Results should be visible after the control line appears. Signal should be visible within 5- 10 minutes.
Example 3: An enhanced isothermal amplification assay for viral detection
[00390] Sensitive, specific, rapid, scalable, enhanced isothermal amplification method for detecting SARS-CoV-2 from patient samples.
[00391] Rapid, inexpensive, robust diagnostics are essential to control the spread of infectious diseases. Current state of the art diagnostics are highly sensitive and specific, but slow, and require expensive equipment. Described herein is a molecular diagnostic test for SARS-CoV-2, FIND (Fast Isothermal Nucleic acid Detection), based on an enhanced isothermal recombinase polymerase amplification reaction. FIND has a detection limit on patient samples close to that of RT-qPCR, requires minimal instrumentation, and is highly scalable and cheap. It can be performed in high throughput, does not cross-react with other common coronaviruses, avoids bottlenecks caused by the current worldwide shortage of RNA isolation kits, and takes ~45 minutes from sample collection to results. FIND can be adapted to future novel viruses in days once sequence is available. The FIND assay or methods can also be referred to as an enhanced recombinase polymerase amplification (eRPA) reaction.
[00392] SARS-CoV-2 has rapidly spread around the world with serious consequences for human life and the global economy ( 1 ). In many countries, efforts to contain the virus have been hampered by a lack of adequate testing (2). Rapid, inexpensive, and sensitive testing is essential for contact tracing and isolation strategies to be effective (3). While numerous different tests exist, the overwhelming global need for testing has led to limitations in both the supplies of reagents, e.g. swabs and purification kits, and instrumentation, e.g. quantitative polymerase chain reaction (qPCR) or ID NOW machines. In most cases, overcoming these limitations would require scaling of supply lines by several orders of magnitude over current production capacities. Therefore, in an effort to avoid overrun health care systems and high death tolls, many countries have resorted to costly lockdowns. [00393] The ability to reopen economies safely depends crucially on the testing capacity available. Efforts to increase testing capacity have included testing from saliva (4), using non-standard storage media or dry swabs (5), and eliminating the normal RNA purification step from the standard RT-qPCR tests (6. 7). Strategies such as pooling samples followed by detection using traditional or high throughput sequencing approaches have also been proposed as a way to allow significantly more testing at a highly reduced cost (5, 9). In general, such strategies force a tradeoff between throughput and sensitivity. [00394] Isothermal amplification technologies have long held promise to offer highly sensitive detection at high throughput, and to allow for widely distributed testing including at-home/point of- need (PON) tests (10, 11). However, isothermal amplification is plagued by nonspecific amplification events that require secondary amplification and detection steps. These steps add extra complexity to the reactions, removing many of the benefits of the isothermal amplification approach. Many ongoing efforts aim to circumvent these problems for SARS-CoV-2 detection. Most of the approaches developed so far still require an extraction step and/or two amplification steps to achieve high specificity, or have low sensitivities that give poor concordance with the gold standard RT-qPCR test (11).
[00395] Described herein is the determination of the underlying reasons for the poor performance of isothermal amplification technologies in viral detection applications. Reverse transcription recombinase polymerase amplification (RT-RPA) was selected as the isothermal amplification technology. RT-RPA is an isothermal amplification method in which the double stranded DNA denaturation and strand invasion that is typically achieved by heat cycling in PCR is instead accomplished by a cocktail of recombinase enzyme, single-stranded binding proteins, and ATP (12). RPA has potential advantages over other isothermal amplification technologies such as loop-mediated isothermal amplification (LAMP) (13) as it can be performed near ambient temperature (37-42°C). While several creative applications of LAMP technologies to detect COVID-19, the disease caused by SARS-CoV-2, have recently been developed and show promise (14-18), RT-RPA has been less explored.
Reverse transcriptase choice can greatly affect recombinase polymerase amplification efficiency [00396] RPA primers were designed to both the SARS-CoV-2 N gene and S gene (see e.g., Fig. 15A and Table 12) and quantified the amplification performance of a RT-RPA assay with ProtoScript II® reverse transcriptase by qPCR (see e.g., Fig. 15B). The detection limit of this standard assay was poor, requiring between 100 and 300 RNA molecules for reliable detection (see e.g., Fig. 11A, Fig. 15C bottom panel). Some studies have used longer reaction times to partially counteract the poor yield of RT-RPA (19), but described herein is the determination of whether alternative approaches are possible.
[00397] Without wishing to be bound by theory, it was reasoned that the poor performance of RT- RPA could either be due to a specific inhibitor of the RPA reaction from the RT (reverse transcription) reaction or to non-specific primer oligomerization products that could dominate the amplification reaction before the RT reaction occurs. These possibilities are not mutually exclusive. As the RPA reaction is both fast and sensitive when DNA is used as an input (12, 20), it was further hypothesized that the product of the RT reaction, i.e. the RNA:DNA hybrid duplex, might inhibit the RPA reaction. Methods were explored to circumvent both of these possible problems. To address the problem of kinetic interference by non-specific oligomerization, multiple reverse transcriptases were screened; and to attempt to remove interference from RNA:DNA hybrids, RNase H, which selectively degrades the RNA strand in these hybrids, was introduced. As described herein, tests showed that both RT enzyme choice and RNase H addition affected the sensitivity of the RT-RPA reaction, indicating that both of the hypothesized mechanisms affect RT-RPA efficiency (see e.g., Fig. 11A, Figs. 15C and 15D). The best combination identified was Superscript IV® reverse transcriptase with RNase H. The magnitude of the effect of the addition of RNase H was correlated with the intrinsic RNase H activity of the RT enzyme. Both Superscript IV® and Maxima H Minus® reverse transcriptases are engineered to have minimal RNase H activity in order to improve their processivity, robustness, and synthesis rate (21), and the largest effect of RNase H addition was seen in RT-RPA reactions using these enzymes.
Reducing non-specific primer reactions increases RT-RPA yield
[00398] In addition to the performance issues addressed above, non-specific amplification reactions of primer dimers can greatly inhibit the ability of RPA to amplify the sequence of interest (10). To determine whether primer choice affects the importance of these non-specific reactions, forward and reverse primers were designed to both the SARS-CoV-2 N gene and S gene (see e.g.,
Fig. 15A). The primer designs avoided regions with strong homology to other coronaviruses including MERS and SARS-CoV, as well as HCoV-229E, HCoV-HKUl, HCoV-NL63, HCoV-OC43, which cause respiratory illnesses such as the common cold. Regions were also avoided that have high variability across sequenced SARS-CoV-2 strains. All pairwise combinations of primers were screened to find pairs that gave a high yield of the desired target sequence while minimizing the amount of non-specific amplicons. Primer pairs were screened by performing qPCR on diluted RT- RPA products so that both specific and non-specific reaction yield could be determined (see e.g., Fig. 11B) (20). Many pairs gave high levels of amplification at 100 molecules of input RNA, but only a small fraction of those yielded significant amplification products at 10 molecules of input RNA.
An optimized RT-RPA reaction allows for simple detection
[00399] The optimized RT-RPA assay’s product can be hybridized and detected with a commercial lateral flow assay (LFA) without further amplification. LFAs allow accurate read-out by eye by minimally trained personnel, and even opens up the possibility of home-based testing (22). Milenia Biotec™ HybriDetect™ lateral flow test strips were used that contain a streptavidin band, an anti-Ig band, and carry gold nanoparticle-labeled anti-FAM antibodies for visualization. Based on the results shown in Fig. 11B, two primer pairs were selected that amplify part of the S gene, a FAM label was added to the reverse primer, and the product amplicon was hybridized to a biotinylated capture probe. Consistent with expectations from qPCR, both primer pairs reproducibly yielded bands with 10 input molecules, and one gave consistent bands with 3 input molecules (see e.g., Fig. 11C). This optimized protocol is called FIND (Fast Isothermal Nucleic acid Detection) (see e.g., Fig. 11D). Compared to the original RT-RPA assay using Proto Script II® RT, the detection limit for FIND was improved by several orders of magnitude (see e.g., Fig. 15C).
FIND: a sensitive, specific, rapid test for SARS-CoV-2
[00400] FIND is highly sensitive and specific for SARS-CoV-2 N and S genes (see e.g., Fig. 12 and Fig. 16). The sensitive and specific assays were conducted by two independent groups, each of whom randomized the RNA input in a 96-well plate in a checkerboard pattern, then handed the blinded plate to the other group fortesting by FIND (see e.g., Fig. 16A). For each gene, 52 positive samples were included with a concentration ranging from 100 molecules to 1 molecule of total RNA input (see e.g., Figs. 12A and 12C and Figs. 16B and 16C). The titer of the RNA dilutions was confirmed by RT-qPCR (see e.g., Fig. 12B and Figs. 16D-16F). Strips were scored at ~20 minutes as this decreases the variability in band intensity that can be observed at low molecule input (see e.g., Fig. 12C and Fig. 16B). At or above 10 molecules of RNA input, 87 of 88 N gene samples and 88 of 88 S gene samples were accurately identified as SARS-CoV-2 positive (see e.g., Fig. 16C).
Significant detection was achieved even as low as 3 (13 of 24 tests) or 1 (5 of 16 tests) molecules of RNA input. Critically, the assay is also highly specific, showing no cross-reactivity (0 of 80 tests) with 10,000 copies of RNA from other coronaviruses, i.e. MERS, SARS-CoV, CoV-HKUl, or CoV- 229E. It also showed no cross reactivity with the 2009 H1N1 Influenza virus, a respiratory virus with similar initial clinical presentation (see e.g., Figs. 12A and 12C, Fig. 16B). For SARS-CoV and MERS, which have the highest target sequence identity with SARS-CoV-2 (91% and 66% respectively), cross-reactivity is dependent on probe choice; cross-reactivity was observed with MERS and SARS-CoV when a longer biotin probe was used for detection (see e.g., Fig. 16G).
[00401] Described herein is an RNA extraction free lysis approach as RNA extraction from clinical samples has become a limiting factor as the global need for SARS-CoV-2 tests has increased. RNA extraction kits are currently hard to obtain, the process of extraction depends on skilled workers, and often involves equipment such as centrifuges. Heat-based lysis has shown promise as a way to rapidly lyse and inactivate viruses for use in diagnostic assays (23, 24). To test whether heat based sample lysis made viral RNA accessible for FIND, packaged reference viral particles, the AccuPlex™ SARS-CoV-2 verification panel (Seracare™) were initially used. The relationship was determined between temperature and viral lysis by heating for 5 minutes followed by RT-RPA then qPCR for quantification. The replication-deficient virus in the AccuPlex™ panel is lysed at ~75°C, a temperature that is likely similar to the temperature required to lyse wild-type SARS-CoV-2 (see e.g., Fig. 13 A) (25).
[00402] RNase inhibitors prevent RNA degradation from nasopharyngeal swabs suspended in viral transport media (NP in VTM), the standard clinical sample. The initial experiments using AccuPlex™ samples or in vitro transcribed RNA in VTM yielded poor signal intensities by FIND. Using RNaseAlert™ to measure RNase activity, significant RNase activity was found in VTM (see e.g., Fig. 13B). In an attempt to address this, TCEP (tris(2-carboxyethyl)phosphine) was tested, which has been used to inactivate RNases from saliva and urine (26). Unfortunately, TCEP and heat treatment of samples with VTM led to gelation, likely due to the presence of gelatin and bovine serum albumin in VTM (see e.g., Fig. 17A). As an alternative, RNasin Plus™, a thermostable RNase inhibitor, was tested which significantly protected RNaseAlert™ from degradation during heat-based lysis in VTM. For future compatibility with PON testing, a room temperature viral lysis buffer (Intact Genomic FastAmp® Viral and Cell Solution for Covid-19 Testing) was also tested, and it was found that RNaseAlert™ was protected from degradation in the presence of RNasin Plus™ (see e.g., Fig. 13B and Figs. 17B and 17C).
[00403] To confirm that this protocol is effective for patient samples, heat-based lysis of NP- swabs in VTM was tested in the absence and presence of RNasin Plus™. The addition of RNasin Plus™ increased RNA yield by ~ 10-fold and significantly improved the sensitivity of FIND (see e.g., Figs. 17B and 17C). The sensitivity of FIND was also measured for AccuPlex™ viral particles diluted into VTM, PBS, or viral lysis buffer. Sensitivity in these simulated samples, which should more closely reflect what would be achieved from standard samples, was reduced by about 5 -fold in comparison to RNA samples in water (see e.g., Figs. 12 and 13D). Most patients during the initial active phase of infection deliver NP swabs with virus concentrations of >104 per mL, well within the detection limit (27-30).
Adaptation of FIND to detect virus in saliva
[00404] Given the bottleneck in NP swabs, there has been growing interest in testing saliva instead (31). Saliva is a challenging fluid due to the presence of mucins and RNases (32, 33) which can degrade RNA and clog pipettes, leading to a high rate of failed experiments or false negatives. Nevertheless, the viral titer in saliva is sufficient for SARS-CoV-2 detection (34). To adapt FIND to saliva samples, protocols that used TCEP, EDTA, and heat steps were tested (23, 24). The addition of the reducing agent TCEP was critical to decreasing the viscosity of saliva at all temperatures, but the inhibition of RNase activity by TCEP was not complete until the sample was heated above 85 °C (see e.g., Fig. 13E). Because SARS-CoV-2 viral particles lyse at around 75°C (25), the period when the sample is being heated from 75°C to 85°C offers a window in which released viral RNA might be degraded during sample preparation. Indeed, RNaseAlert™ is completely degraded even in the presence of 100 mM TCEP if it is added before the heat inactivation step, but protected if it is added after heat inactivation (see e.g., Figs. 17D and 17E). This distinction is critical as a common method of validating extraction-free saliva sample preparation protocols is to first heat-inactivate the sample and then add viral RNA to determine assay sensitivity (15). This method will overestimate assay sensitivity for saliva samples due to the inactivation of salivary RNases. Either murine RNase inhibitor or RNasin Plus™ helped protect RNA from degradation at low temperatures, with RNasin Plus™ being more effective at high temperatures (see e.g., Fig. 17F). The combination of RNAsin Plus™ and TCEP protects RNaseAlert™ from degradation during a heat lysis protocol (see e.g., Fig. 13F and Fig. 17G). Using this protocol (see e.g., Fig. 13G) SARS-CoV-2 signal was detected in -70% of samples with 25-100 AccuPlex™ viral particles in saliva (see e.g., Fig. 13H), a reduction of 2 to 4-fold compared to the sensitivity of detection in VTM (see e.g., Fig. 13D). Similar results were seen with IVT SARS-CoV-2 RNA which represents the worst-case scenario for RNA degradation (see e.g., Fig. 13H). Given that titers of SARS-CoV-2 in saliva are in the range of 104 to 1010 copies per mL (34), this extraction protocol combined with FIND can identify COVID-19 in infected patients, offering a high throughput, first pass screening approach that is important in large-scale testing. FIND can also be used to test actual saliva samples from infected individuals.
Comparison of FIND with RT-qPCR tests on unextracted clinical samples
[00405] To demonstrate that FIND can detect SARS-CoV-2 in unextracted patient samples, 30 positive and 21 negative NP swabs were obtained from BocaBiolistics™. The samples were processed using the VTM heat lysis method (see e.g., Fig. 13C) and this unextracted input was used, in parallel, in FIND and in a one-step RT-qPCR assay (see e.g., Fig. 14A). The one-step RT-qPCR assay was validated by benchmarking it against the standard CDC N 1 RT-qPCR assay (see e.g., Fig. 18, see e.g., Methods). All 21 negative samples were negative by FIND, in duplicate, confirming that the false positive rate for FIND is very low (see e.g., Figs. 14B-14C). Of the 30 positive samples, 26 had signal by RT-qPCR; 4 may have suffered degradation during transit, see below. For each of the 26 samples that were positive by RT-qPCR, the number of copies of input RNA into FIND was estimated based on standard curves. 20 samples had an input of at least 5 molecules of RNA; all 20 of these were positive by FIND in both repeats (see e.g., Fig. 18A). In 3 samples the input was between 1 and 4 copies; FIND was positive once, inconclusive once (one positive and one negative of two duplicates), and negative once. In 3 samples the input was less than 1 copy, and two of these three samples were inconclusive by RT-qPCR; FIND was negative twice and inconclusive once (see e.g., Fig. 14C). [00406] The FIND workflow was repeated on the S gene and similar results to the N gene were obtained (see e.g., Fig. 19). In all the patient samples, the RNA copy number of the S gene was on average 4-fold lower than that for the N gene (see e.g., Fig. 19B). However, the detected copy number for both genes was nearly identical from synthetic full genome SARS-CoV-2 RNA, AccuPlex™ viral particles, and IVT RNA controls (see e.g., Figs. 19B-19D). One possible explanation for this result is that viral transcripts from cells contribute significantly to the total RNA detected. Because the N gene is expressed at up to 10-fold higher levels than the S gene in infected human cells (35), if NP swabs collect cells or cellular debris this would bias the observed N gene to S gene copy number ratio. This may be important for other assays as many COVID tests target ORFlab, which is one of the lower expressed transcripts in human cells.
[00407] Sample degradation during storage could have substantially lowered the titer of some of the positive samples. Eight positive samples were stored in universal transport medium (UTM); only one of these had a titer above 2 RNA copies per pL. Four of these eight, although they were designated positive by BocaBiolistics™, were negative by RT-qPCR and by FIND for both the N and S gene. To exclude the possibility that the low apparent titer was due to interference from UTM, RNA extraction was performed on all samples and then RT-qPCR and FIND was repeated (see e.g., Fig. 14A). Overall, RNA extraction increased RNA titer by ~5-fold, matching expectations given that 240 pF of initial sample was concentrated into 50 pF of final volume (see e.g., Figs. 14B-14D).
Extraction of UTM samples did not differentially improve RT-qPCR or FIND results over VTM samples, excluding the possibility of interference from the medium and suggesting that the samples stored in UTM may have suffered RNA degradation. It is also possible that all 8 of these samples were unusually low titer on collection.
[00408] FIND gives concordant results with RT-qPCR in all extracted samples except those with extremely low titer. Of the 26 extracted samples that were detected as positive by RT-qPCR without extraction, 23 had at least 3 copies of input RNA, and all of these were positively identified by FIND (see e.g., Fig. 18B). Three samples had <1 copy of input RNA, of which one was identified by FIND. The four samples with undetectable signal by RT-qPCR before extraction were still negative by both RT-qPCR and FIND even with extraction. Modest changes in sample collection methods could make FIND even more sensitive. Currently, NP swabs are typically collected into 3 mF of VTM. Only a small fraction of this volume is used for detection assays. If instead swabs were resuspended in 150- 200 pF of liquid, the volume required to cover the head of a swab, the input to FIND would become ~ 15 -20-fold more concentrated without requiring an extraction protocol. This could make the sensitivity of FIND superior to current sample collection methods combined with RT-qPCR.
[00409] The FIND protocol reported here was developed and optimized in just under 3 weeks, with an additional 4 weeks for sample preparation, optimization, and patient sample acquisition. In future epidemics and pandemics, this process could be shortened to several days after standardizing sample preparation methods and primer design. Improvements in RT-RPA developed in FIND can also improve other detection approaches, allowing these assays to become 1-pot, closed-tube, fluorescent readout reactions. FIND addresses many of the problems of current SARS-CoV-2 testing methods: it is scalable, compatible with both swabs and saliva samples, can be performed in high throughput by minimally trained personnel in low-resource settings (see e.g., Fig. 20), and can be automated. FIND is capable of reliably detecting SARS-CoV-2 virus in patient samples that contain as low as 2 viral particles/pF, and is therefore fully adequate to detect infection during the period of peak transmission (27-30, 36, 37). [00410] References and Notes:
1. John Hopkins Coronavirus Resource Center coronavirus.jhu.edumap.html.
2. A. Park, Dr. Anthony Fauci “Not Overly Confident” With U.S. COVID-19 Testing Capabilities . time comanthony-fauci-covid— testing-capabilities .
3. J. Temple, Why contact tracing may be a mess in America.
4. Emergency use authorization granted for new biomaterial collection approach. www .rutgers. edunewsnew-rutgers-saliva-test-coronavirus-gets-fda-approval.
5. S. Srivatsan et al, Preliminary support for a “dry swab, extraction free” protocol for SARS- CoV-2 testing via RT-qPCR. bioRxiv, 2020.04.22.056283 (2020).
6. C. Beltran-Pavez et al, SARS-CoV-2 detection from nasopharyngeal swab samples without RNA extraction. bioRxiv, 2020.03.28.013508 (2020).
7. S. K. Wee, S. P. Sivalingam, E. P. H. Yap, Rapid direct nucleic acid amplification test without RNA extraction for SARS-CoV-2 using a portable PCR thermocycler. bioRxiv. 11, 2020.04.17.042366 (2020).
8. I. Yelin et al, Evaluation of COVID-19 RT-qPCR test in multi-sample pools. medRxiv, 2020.03.26.20039438 (2020).
9. A. S. Booeshaghi et al, Fast and accurate diagnostics from highly multiplexed sequencing assays. medRxiv, 2020.05.13.20100131 (2020).
10. G. A. Obande, K. K. Banga Singh, Current and Future Perspectives on Isothermal Nucleic Acid Amplification Technologies for Diagnosing Infections. Infection and Drug Resistance. 13, 455-483 (2020).
11. M. N. Esbin et al , Overcoming the bottleneck to widespread testing: A rapid review of nucleic acid testing approaches for COVID-19 detection. RNA, ma.076232.120 (2020).
12. O. Piepenburg, C. H. Williams, D. S. P. biology, 2006, DNA detection using recombination proteins . journals. plos. org.
13. T. Notomi, Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, 63e-63
(2000).
14. B. A. Rabe, C. Cepko, SARS-CoV-2 Detection Using an Isothermal Amplification Reaction and a Rapid, Inexpensive Protocol for Sample Inactivation and Purification. medRxiv, 2020.04.23.20076877 (2020).
15. Y. Zhang et al, Rapid Molecular Detection of SARS-CoV-2 (COVID-19) Virus RNA Using Colorimetric LAMP. medRxiv, 2020.02.26.20028373 (2020).
16. S. Bhadra, T. E. Riedel, S. Lakhotia, N. D. Tran, A. D. Ellington, High-surety isothermal amplification and detection of SARS-CoV-2, including with crude enzymes. bioRxiv, 2020.04.13.039941 (2020). J. P. Broughton et al, CRISPR-Casl2-based detection of SARS-CoV-2. Nat Biotechnol, 1-5
(2020). J. Joung et al, Point-of-care testing for COVID-19 using SHERLOCK diagnostics. medRxiv, 2020.05.04.20091231 (2020). F. Zhang, O. A. F. D. O. COVID-19, 2020, A protocol for detection of COVID-19 using CRISPR diagnostics go.idtdna.com. J. Qian et al, Forensic microbial system for high-resolution object provenance. bioRxiv, 2020.03.14.990804 (2020). D. Zucha, P. Androvic, M. Kubista, L. Valihrach, Performance Comparison of Reverse Transcriptases for Single-Cell Studies. Clinical Chemistry. 66, 217-228 (2019). K. M. Koczula, A. G. E. I. biochemistry, 2016, Lateral flow assays | Essays in Biochemistry | Portland Press .portlandpress.com, doi:10.1042/EBC20150012. G. Ruano, E. M. Pagliaro, T. R. Schwartz, K. Lamy, 1992, Heat-soaked PCR: an efficient method for DNA amplification with applications to forensic analysis. - Abstract - Europe PMC. europepmc.org. C. Myhrvold et al, Field-deployable viral diagnostics using CRISPR-Casl3. Science. 360, 444-448 (2018). A. Chin et al, Stability of SARS-CoV-2 in different environmental conditions. medRxiv, 2020.03.15.20036673 (2020). B. L. Pasloske, W. Wu, A. Inc, Method and reagents for inactivating ribonucleases RNase A, RNase I and RNase Tl. Google Patents (2004). X. He et al. , Temporal dynamics in viral shedding and transmissibility of COVID-19. Nat Med. 26, 672-675 (2020). S. Zheng et al, Viral load dynamics and disease severity in patients infected with SARS- CoV-2 in Zhejiang province, China, January-March 2020: retrospective cohort study. BMJ. 369, ml443 (2020). Y. Pan, D. Zhang, P. Yang, L. L. M. Poon, Q. Wang, Viral load of SARS-CoV-2 in clinical samples. The Lancet Infectious Diseases. 20, 411-412 (2020). Y. M. Bar-On, A. Flamholz, R. Phillips, R. Milo, SARS-CoV-2 (COVID-19) by the numbers. eLife. 9, 1787 (2020). Saliva sample as anon-invasive specimen for the diagnosis of coronavirus disease2019 (COVID-19): a cross-sectional study. Clinical Microbiology and Infection (2020), doi: 10.1016/j.cmi.2020.05.001. H. R. Hasan, Y. A. H. Al-Iissa, Y. A. H. Al-Iissa, A study of RNAse enzymes in saliva samples from women with breast tumors (2011). 33. A. B. ACQUIER et al, Comparison of salivary levels of mucin and amylase and their relation with clinical parameters obtained from patients with aggressive and chronic periodontal disease. Journal of Applied Oral Science. 23, 288-294.
34. A. L. Wyllie et al, Saliva is more sensitive for SARS-CoV-2 detection in COVID-19 patients than nasopharyngeal swabs. medRxiv, 2020.04.16.20067835 (2020).
35. J.-H. Seol et al, Different roles of histone H3 lysine 4 methylation in chromatin maintenance. Biochem. Biophys. Res. Commun. 349, 463-470 (2006).
36. H.-Y. Cheng et al, Contact Tracing Assessment of COVID-19 Transmission Dynamics in Taiwan and Risk at Different Exposure Periods Before and After Symptom Onset. JAMA Intern Med, 1-8 (2020).
37. R. Wolfel et al, Virological assessment of hospitalized patients with COVID-2019. Nature, 1-5 (2020).
Materials and Methods
[00411] RNA template preparation: SARS-CoV-2, SARS-CoV, and MERS N gene containing plasmids were obtained from IDT (2019-nCoV Plasmid Controls). HCoV-229E and HCoV-HKUl N gene, SARS-CoV-2, SARS-CoV, MERS, HCoV-229E and HCoV-HKUl S gene were synthesized by Twist Bioscience™. All genes were cloned into a T7 promoter expression plasmid. To produce RNA template, in vitro transcription was performed with NxGen® T7 RNA Polymerase (Lucigen™ #F88904-1) according to the manufacturer's suggested protocol with minor modifications. Final concentrations of the reaction mixture components were 50 units T7 RNA polymerase, 1 c reaction buffer, 625 mM NTPs, 10 mM DTT, 500 ng of linearized plasmid template, and RNase-free water to a final volume of 20 pL per reaction. After 10 h at 37 °C, 4 units of DNase I (NEB #M0303S) was added and reactions were further incubated for 10 min at 37 °C. DNase I was heat inactivated by adding EDTA (5 mM final) and heating at 75 °C for 10 min. RNA was purified by RNAClean XP™ (Beckman Coulter™) at 0.6 the volume of the reaction, washed twice with 80% EtOH, then eluted into 20 pL RNase-free water. The size and quality of the RNA product was checked by Bioanalyzer™ (Agilent™) after denaturation at 70 °C for 2 min to unfold any RNA structure; all samples were determined to contain the correct RNA product.
[00412] Reverse transcription and RNase H screen: FIND assay master mixes targeting SARS- CoV -2 N gene as described below with or without addition of RNase H (NEB) and without reverse transcriptase. The following RT enzymes were added to aliquots of the master mixes: Superscript III ® (ThermoFisher) ™, Superscript IV ® (ThermoFisher™), MMLV (Moloney Murine Leukemia Virus RT, NEB), ProtoScript II ® (NEB), Maxima H Minus ® RT (ThermoFisher). All enzymes were added at 20 U per reaction. N gene IVT RNA diluted with EbO was used as input to the reactions.
Post isothermal amplification, samples were diluted 1:400 in water and products were detected by qPCR using primers JQ289 and JQ223. Specific products were distinguished from primer dimers by analyzing the melting temperature of the qPCR products. The average Ct value of all water control reactions representing primer dimer was used as a baseline to determine the reaction yield (yield = Ct (average water controls) - Ct (specific reaction)).
[00413] Primer Oligomerization Products: Four N gene forward primers (JQ217, CCMS041, CCMS047, and CCMS051) were paired with the reverse primer JQ224. These four primer pairs as well as JQ217 + JQ223 were used in FIND assays with a water-only sample input. FIND assays were incubated at 42 °C for 10 min. Amplification products were cleaned up using RNA Clean XP™ (Beckman Coulter™) at 2.5 c concentration and eluted in 20 pL of nuclease-free water. Purified products were cloned using the Zero Blunt TOPO PCR Cloning Kit™ (Thermo Fisher Scientific™) according to the manufacturer’s instructions and Sanger sequenced. The identity of cloned products was determined by first aligning the sequences to the vector sequence using Samtools (vl.9) with an allowed multimapping of k=10000. The same files were then visualized in IGV (v2.6.2) where the direction, sequence, and copy number of primer oligomers were manually annotated. The direction of the primer indicates a forward or reverse direction with respect to the vector, while the space sequence is the string of nucleotides between two primers. Overlap indicates the primers were overlapping with respect to the vector, indicates there was no space between the primers, and listed nucleotides indicate the sequence between two primers (see e.g., Fig. 15A).
[00414] SARS-CoV-2 FIND assay primer sequence alignment: To calculate the percent identity between the SARS-CoV-2 N and S gene primers and the analogous sites in other betacoronaviruses, the RefSeq entries for SARS-CoV-2, SARS-CoV, MERS, HCoV-229E, HCoV- NL63, HCoV-OC43, and HCoV-HKUl were obtained from NCBI. The sequences were then compared using the EMBL-EBI web tool Clustal Omega™ to identify indels and mismatches. The subsequences for the forward and reverse primers for both the N gene and the S gene were then located within the SARS-CoV-2 sequence, and the number of mismatches with the antagonist betacoronavirus sequence was tallied. The percent identity was then calculated by dividing the number of matching bases by the length of the primer sequence. To calculate the number of mismatches between FIND assay primer and probe sequences and known SARS-CoV-2 variants, the full set of all available SARS-CoV-2 genomes were downloaded from NCBI and were arranged into a single fasta file. This dataset was then converted into a BLAST database using the BLAST+ (v2.6.0) tool and then queried by each of the sequences for the N and S gene FIND assay. The output from BLAST was then coalesced and filtered to remove any incomplete or partial genomes using R (v.4.0). [00415] Primer screening: Regions of low homology between SARS-CoV-2 and both SARS- CoV and MERS were identified by sequence alignment and were used as target sequences for the biotinylated probe. Unlabeled forward and reverse primers were designed to amplify a region of 100- 200 nt encompassing the target sequence. Combinations of forward and reverse primers were screened by testing amplification at low RNA input. Reactions were prepared as described below and S gene IVT SARS-CoV-2 RNA was used as input. Post amplification, samples were diluted 1:625 in water and products were detected by qPCR using the same primer pair as for isothermal amplification. Specific products were distinguished from primer dimers by analyzing the melting temperature of the qPCR products. Reactions using water only as template were used to identify primer dimer melting temperatures. All reactions with 10 or 100 copies input but leading only to the formation of primer dimers were labeled as having a reaction yield of zero. The Ct of all reactions leading to specific product formation were converted into an estimated reaction yield by subtracting the raw Ct from the Ct of the lowest specific reaction (for the S gene screen the lowest specific Ct was at 25). Primer pairs with high reaction yields at both 100 and 10 copies input were tested in a secondary screen and the top two primer pairs were subsequently tested by FIND as described above.
[00416] FIND assay: Isothermal amplification reactions were based on the TwistAmp™ Basic RPA Kit™ (TwistDx™) with added modifications described below. Each lyophilized pellet was resuspended in a solution of 38 pL rehydration buffer (TwistDx™), 1 pL RNase H (5U/pL) (NEB), 0.5 pL Superscript IV RT® (200 U/pL) (ThermoFisher Scientific™), and 0.5 pL of forward and reverse primer mix each at 50 pM (N gene, JQ217+JQ235; S gene, CCMS055+CCMS073). This mix was then activated by addition of 1 pL 700 mM magnesium acetate followed by thorough mixing with a pipette. Reactions were prepared by dispensing 8 pL of master mix and 2 pL of input template (RNA, Accuplex™ virus, or patient samples) per reaction well, mixing the reaction by pipetting, and incubating at 42 °C for 25 min. A hybridization mix was prepared by combining 1 vol biotinylated probe at 5 pM (N gene, JQ241 or JQ312; S gene, CCMS069) with 19 vol 10 mM Tris pH 8. 20 pL of hybridization mix was added to each reaction, and samples were heated at 94 °C for 3 min followed by a cooling step at room temperature for 3 min. 50 pL of Milenia GenLine Buffer™ (Milenia Biotec™) was added to each reaction, mixed by pipetting, and a lateral flow strip (Milenia HybriDetect™) was added. Lateral flow strip signals can be detected and imaged starting 3 min after addition of the strip to the hybridized reaction. Test results were called or imaged within 30 min of strip addition since background bands at the test line can appear over time and low signal test bands can lose intensity as the strip dries.
[00417] qPCR and RT-qPCR: SYBR green qPCR reactions were prepared in 10 pL reaction volume rising PowerUp SYBR Green PCR Master mix™ (Thermo Fisher Scientific™), 2 pL sample, and 0.4 pM of primers (JQ217 + JQ223 for N gene or CCMS055 + CCMS067 for S gene unless otherwise mentioned). RT-qPCR reactions were prepared in 10 pL reaction volume using the Luna Universal One-Step RT-qPCR kit™ (NEB), 2 pL sample, and 0.4 pM of primers following the manufacturer’s instructions. The CDC one-step RT-qPCR assay used to benchmark the RT-qPCR was performed using the Luna Universal Probe One-step RT-qPCR kit™ (NEB) and N 1 probe/primer mix against SARS- CoV-2 from IDT (2019-nCoV CDC EUA Kit) (see e.g., Fig. 18D). Reactions were prepared according to the manufacturer’s instructions following the CDC protocol. qPCR and RT- qPCR reactions were monitored on either a Bio-Rad Cl 000 Touch Thermo Cycler™ (Bio-Rad™) or QuantStudio 6 Real Time PCR system™ (Thermo Fisher Scientific™).
[00418] Sensitivity and specificity of FIND with RNA input: Data presented in Figure 12 was generated as a blinded and randomized experiment. Synthetic full genome SARS-CoV-2 RNA (Twist Bioscience™) was used as RNA template for FIND assay on SARS-CoV-2. For the cross-reactivity samples, a single dilution series of RNA input was prepared by mixing at equimolar ratio N and S gene IVT RNA products for each of: SARS-CoV, MERS, HCoV-HKUl, and HCoV-229E. Genomic 2009 H1N1 Influenza (ATCC) was also serially diluted for input to the assay. All dilutions series were made in water and were adjusted for a 2 pL input into the FIND assay. Two independent groups prepared fully randomized 96-well PCR plates in a checkerboard pattern using those dilutions (see e.g., Fig. 16A). Each group then used the other group’s randomized plate as input to FIND tests targeting either the N gene or the S gene of SARS-CoV-2 performed as described above. All RNA stocks used in these tests were validated by testing dilution series in a one-step RT-qPCR as described above (see e g., Fig. 12B and Figs. 16D-16F).
[00419] RNaseAlert tests with viral transport media (VTM) and saliva: The RNaseAlert substrate (IDT) was used at 2 pM to assess the RNase activity of saliva and VTM (BD, universal viral transport medium #220220). Fluorescence intensity was determined using an excitation of 485 nm and emission of 528 nm over the course of 10-60 min in a 96-well plate reader (Synergy HI Plate Reader™, BioTek™). In general, the degradation of the RNaseAlert substrate was assessed after 10 minutes and fluorescence intensities were averaged over 3 time points and reported normalized to a fully degraded control. RNasin Plus™ (Promega™) was added to VTM to a final concentration of 1 U/pL and was incubated for 5 min at 25 °C before addition of RNaseAlert™. When needed, viral lysis buffer (FastAmp Viral and Cell solution™, Intact Genomics™) was added 1:1 (v/v) to VTM. TCEP buffer (20 mM Tris pH 8, 10 mM EDTA pH 8, TCEP 1-100 mM) was prepared as a 2/ solution and was mixed 1 : 1 with saliva. RNase inhibitor (RI) was added to 1 U/pL final concentration as shown. For spike-in controls, RNase A (Lucigen™) was added to 0.25 pg/pL final concentration. Saliva obtained from two healthy donors was pooled and adjusted to 1 mM TCEP to reduce viscosity. Aliquots of a single pooled sample stored at -20 °C were used for all assays.
[00420] Virus extraction: The AccuPlex™ SARS-CoV-2 verification panel (Seracare™) containing the N gene, E gene, ORFla, and RdRp was used as a surrogate to SARS-CoV-2 to optimize the full processing of clinical samples. To determine the temperature lysis of AccuPlex™ SARS-CoV-2, virus at le5 copies/mL was diluted 1 : 1 in 2 lysis buffer (final: 10 mM Tris HC1 pH 8, 5 mM EDTA pH 8, 100 mM TCEP, 1 U/pL RNasin Plus), then incubated for 5 min at a temperature between 55 °C and 95 °C in 5 °C increments. 2 pL of each condition was used as input into FIND reactions targeting SARS-CoV-2 N gene as described above. Post amplification, samples were diluted 1:200 in water and products were detected by qPCR using primers JQ289 and JQ223. Specific product formation was distinguished from primer dimer formation by analyzing the melting temperature of the qPCR products and comparison to a water control. The average Ct value of all water control reactions representing primer dimer was used as a baseline to determine the reaction yield (yield = Ct (average water controls) - Ct (specific reaction)).
[00421] Detection of AccuPlex™ SARS-CoV-2 in contrived samples: AccuPlex™ SARS-CoV- 2 was extracted using conditions mimicking patient sample processing. FIND assays targeting SARS- CoV-2 N gene were performed as above. For extraction in VTM and PBS, AccuPlex SARS-CoV-2 at 100 copies/pL was serially diluted 1 : 1 (v/v) in either VTM or PBS containing a final concentration of 1 U/pL RNasin Plus. After heating at 94 °C for 5 min, samples were kept on ice before being used as input into FIND. For extraction in viral lysis buffer at 25 °C, AccuPlex SARS-CoV-2 at 100 copies/pL was serially diluted 1:1 (v/v) in viral lysis buffer (FastAmp Viral and Cell solution™
(Intact Genomics™)) adjusted with RNasin Plus to 1 U/pL. After 10 min at 25 °C, samples were kept on ice before being used as input into FIND. For extraction of virus in samples containing saliva, 2 vol of AccuPlex™ SARS-CoV-2 virus at 100 copies/pL was mixed with 1 vol of pooled saliva and 1 vol of 4 TCEP buffer + RI (RNase inhibitor). TCEP buffer + RI was prepared such that final buffer concentrations in the sample were 10 mM Tris HC1 pH 8, 5 mM EDTA pH 8, 100 mM TCEP and 1 U/pL RNasin Plus™. Lower input samples were prepared by serial dilution with 1:1 (v/v) saliva in 2x TCEP buffer. After heating at 94 °C for 5 min, 1/10 vol of 1M H2O2 was added and samples were incubated at 25 °C for 10 min. Saliva samples were diluted 1 : 1 with water and kept on ice before being used as input into FIND. For extraction of virus from saliva with viral lysis buffer, 1 vol of AccuPlex™ SARS-CoV-2 virus at 100 copies/pL was mixed with 1 vol of pooled saliva and 2 vol of viral lysis buffer adjusted to 2 U/pL RNasin Plus™. Lower input samples were prepared by serial dilution with 1:3 (v/v) viral lysis buffer + RI mixed with saliva. For samples with SARS-CoV-2 RNA, saliva was mixed 1 : 1 with 2 TCEP buffer + RI. After 5 minutes at 25 °C, N gene IVT SARS-CoV-2 RNA was spiked into saliva in TCEP buffer and lower input samples were prepared by serial dilution on ice. After heating at 94 °C for 5 min, 1/10 vol of 1 M H2O2 was added and samples were incubated at 25 °C for 10 min. Samples were diluted 1 : 1 with water and kept on ice before being used as input into FIND. For RNA added post heat inactivation, a similar protocol was followed using saliva mixed 1 : 1 with 2x TCEP buffer + RI that was pre-incubated for 5 min at 94 °C.
[00422] Clinical samples: A cohort of nasal swab patient samples was purchased from BocaBiolistics™ (Florida) containing 30 SARS-CoV-2 positive samples and 21 SARS-CoV-2 negative samples. Samples were thawed on ice and 40 pL aliquots were made and subsequently stored at -80 °C. At the time of testing, sample aliquots were thawed and RNasin Plus™ was added to a final concentration of 1 U/pL. The samples were placed on a heat block set to 99 °C for 5 min for virus inactivation and lysis. After cooling, samples were spun down and transferred to a 96-well DNA LoBind™ plate (Eppendorf™). 2 pL of the inactivated sample was used as input into FIND or into RT-qPCR reactions targeting both the N and S gene of SARS-CoV-2. GAPDH (Glyceraldehyde 3- phosphate dehydrogenase) was used as a control in RT-qPCR reactions. All patient sample tests included a positive control consisting in 100 copies of synthetic full genome SARS-CoV-2 RNA (Twist Bioscience™) and a water only negative control.
[00423] Standard RNA extraction from clinical samples: Virions were pelleted by centrifugation at approximately 21,000 xg for 2 h at 4 °C. The supernatant was removed and 750 pL of TRIzol-LS™ Reagent (ThermoFisher™) was added to the pellets and then incubated on ice for 10 min. Following incubation, 200 pF of chloroform (MilliporeSigma™) was added, vortexed, and incubated on ice for 2 min. Phases were separated by centrifugation at 21,000 xg for 15 min at 4 °C, and subsequently the aqueous layer was removed and treated with 1 vol isopropanol (Sigma™). GlycoBlue™ Coprecipitant (15 mg/mF) (ThermoFisher™) and 100 pF 3M Sodium Acetate (Fife Technology™) were added to each sample and incubated on dry ice until frozen. RNA was pelleted by centrifugation at 21,000 xg for 45 min at 4 °C. The supernatant was discarded and the RNA pellet was washed with cold 70% ethanol. RNA was eluted in 50 pF of DEPC-treated water (ThermoFisher™).
[00424] Quantitative SARS-CoV-2 RT-qPCR Assay: Fevels of SARS-CoV-2 RNA in extracted samples were detected using the United States Centers for Disease Control and Prevention (US CDC) 2019-nCoV_Nl primers and probe set. Each reaction contained extracted RNA, lx TaqPath™ 1-Step RT-qPCR Master Mix, CG (ThermoFisher™), 500 nM of each the forward and reverse primers, and 125 nM of probe. Viral copy numbers were quantified using N1 qPCR standards to generate a standard curve. The assay was run in triplicate for each sample and two non-template control (NTC) wells were included to confirm there was no contamination. Quantification of the Importin8 (IP08) housekeeping gene RNA level was performed to determine the quality of sample collection. An internal virion control (e.g., RCAS, Rous Sarcoma Virus) was spiked into each sample and quantified to determine the efficiency of RNA extraction and qPCR amplification. In house RT-qPCR data was converted from Ct values to copies/mF by direct comparison to the CDC RT-qPCR quantitation. In short, the Ct values from the in house RT-qPCR were plotted against the CDC RT-qPCR Ct values which yielded a linear relationship, R2>0.99, with a slope within error of 1, confirming that the amplification dynamics of both primer sets were similar. The relationship was then re-fit with the slope set to 1 which yielded a line, R2>0.99, with an intercept of between 33 and 34 (95% confidence interval). This fit was then used to directly convert Ct from the qPCR to viral copies/pF. See e.g.,
Qian et ah, An enhanced isothermal amplification assay for viral detection, Nature Communications volume 11, Article number: 5920 (published November 20, 2020), the contents of which are incorporated herein by reference in their entirety.
[00425] Table 12: List of exemplary primers used herein.
Figure imgf000108_0001
Figure imgf000109_0001
Example 4
[00426] SARS-Co V-2: SARS-Co V2 S-gene Target
Reagents and Equipment
[00427] Table 14: Reagents
Figure imgf000109_0002
[00428] Table 15: Instruments
Figure imgf000109_0003
Lysis/RNA Extraction Protocol
[00429] The lysis/RNA extraction protocol can follow Method 1 or Method 2.
[00430] Method 1: 1) Put swab into viral transport media following standard protocol of local hospital. 2) Use an inactivation and RNA extraction kit.
[00431] Method 2: 1) Put swab or sputum into viral transport media (e.g., 100 uL viral transport media; a small volume of viral transport media is preferred, as the viral load per uL will be higher.) (2) Add RNAse inhibitor of choice at lU/uL to viral transport media (e.g., 25 uL of Murine RNAse inhibitor per mL of viral transport media). (3) Heat for 5 minutes at 94 C. RT-RPA-RNaseH Master Mix
[00432] The reaction volumes for the detection protocol below are formulated for 48 samples to be tested. The volumes can be adjusted accordingly. Prepare all reactions on ice. Keep on ice at all times until starting RPA reaction.
[00433] Rehydration Buffer is very viscous. When pipetting steps with viscous solutions: 1) Pipette slowly to avoid bubbles. 2) Mix 5 times using 75% of total volume being resuspended (i.e. for a 100 uL volume, set pipette to 75 uL). 3) After dispensing most volume, wait 5 seconds until remaining liquid settles inside the pipette tip, then slowly dispense remaining volume.
[00434] Prepare the RT-RPA master mix in DNALoBind tubes (see e.g., Table 16).
[00435] Table 16: RT-RPA master mix preparation
Figure imgf000110_0001
[00436] Place RT-RPA master mix on ice. Make sure the solution is cool before adding to the TwistDx RPA pellets. For 48 samples, 12 TwistDx RPA pellets are added to the RT-RPA master mix. Resuspend each TwistDx RPA pellet with the RT-RPA master mix by dispensing 40 uL of master mix per pellet and let it sit on ice in a metal block for 2 min. (Note: expect a cloudy and viscous solution). Pipette each pellet reaction up and down with 20 uL volume and transfer the entire re suspension back to the original master mix tube.
[00437] Distribute 8 uL of master mix into each reaction well on ice. Skip every other well on the PCR strip or plate. Leave strips or plate uncovered until input material is added. Set up PCR strip or plate in "checkerboard" pattern, skipping every other well to avoid cross contamination.
RT-RPA Reactions
[00438] Add 2 uL of template sample (or control) to the outer RT-RPA PCR strip (or plate). For each well, use the same tip to gently mix with the pipette set to 4 uL volume. Close Lids or seal plates with Plate Seal B.
[00439] Heat the tubes for 25 min at 42C on a heat block or PCR machine. Note: for best results lightly flick the PCR strip or wells of plate (this is a gentile mix / no spin down of PCR strip or plate should be required).
Detection of the RPA Products [00440] Make Probe Hybridization Mix (see e.g., Table 17; see e.g., Table 6 for exemplary probes, e.g., SEQ ID NOs: 15-20 or SEQ ID NOs: 27-32, 68-69, 103-104, 154-157, 170-176).
[00441] Table 17: Probe Hybridization Mix
Figure imgf000111_0001
[00442] Aliquot 20 uL of hybridization mix to the 10 uL RPA & pipette up and down to mix.
[00443] Close lids for PCR strip or seal the PCR plate with Plate Seal B.
[00444] Heat the reaction at 94 C for 3 min on heatblock (with heated-lid, if available).
[00445] Cool hybridized reactions at room temperature on the bench for 3 minutes.
[00446] Open carefully to avoid cross-contamination.
[00447] Add 50 uL of Milenia™ running buffer to each reaction well.
[00448] Pipette up and down to mix.
[00449] Add one lateral flow strip to each reaction. Make sure to insert the strip so the green region is closest to the reaction. Note: to conserve strips, first test positive and negative controls. If those look correct test remaining reactions.
[00450] Results should be visible after the control line appears. Signal should be visible within 5- 10 minutes. Image strips within lh of testing. Negative control sometimes develops when left overnight.

Claims

CLAIMS What is claimed herein is:
1. A method of detecting a target RNA in a sample, comprising: a) contacting the sample with a reverse transcriptase, and a first set of primers; b) contacting the sample with an RNA:DNA duplex-specific RNase; c) contacting the sample with a DNA polymerase, a second set of primers, a recombinase, and single -stranded DNA binding protein; and d) detecting an isothermal amplification product from step (c).
2. A method of detecting a target RNA in a sample, comprising: a) contacting the sample with a reverse transcriptase, and a first set of primers; b) contacting the sample with an RNA:DNA duplex-specific RNase; c) contacting the sample with a DNA polymerase and a second set of primers; and d) detecting an amplification product from step (c).
3. The method of any of claims 1-2, wherein the RNase is RNaseH.
4. The method of any of claims 1-3, wherein steps (a), (b) and (c) are performed simultaneously in the same reaction.
5. The method of any of claims 1-4, wherein steps (a) and (b) are performed simultaneously in the same reaction, and step (c) is performed after steps (a) and (b).
6. The method of any of claims 1-4, wherein steps (b) and (c) are performed simultaneously in the same reaction, and step (a) is performed prior to steps (b) and (c).
7. The method of any of claims 1-6, wherein the RNaseH is provided at a concentration of 0.1 U/pL to 5 U/pL.
8. The method of any of claims 1-7, wherein the RNaseH is provided at a concentration of 2.5 U/pL
9. The method of claims 1 or 2, wherein step (c) permits an isothermal amplification reaction.
10. The method of claim 9, wherein the isothermal amplification reaction is selected from the group consisting of: Recombinase Polymerase Amplification (RPA), Loop Mediated Isothermal Amplification (LAMP), Helicase -dependent isothermal DNA amplification (HDA), Rolling Circle Amplification (RCA), and strand displacement amplification (SDA).
11. The method of claim 9, wherein the isothermal amplification reaction is Recombinase Polymerase Amplification (RPA).
12. The method of claim 2, wherein step (c) further comprises contacting the sample with a recombinase and single-stranded DNA binding protein.
13. The method of claims 1 or 2, wherein the first set of primers comprises primers that bind to target RNA and non-target RNA in the sample.
14. The method of claim 13, wherein the first set of primers comprises random hexamers.
15. The method of claims 1 or 2, wherein the first set of primers is specific to the target RNA.
16. The method of claims 1 or 2, wherein the second set of primers is specific to the target RNA.
17. The method of claims 1 or 2, wherein steps (a), (b), and/or (c) are performed between 12°C and 45°C.
18. The method of claim 17, wherein steps (a), (b) and/or (c) are performed at room temperature.
19. The method of claim 17, wherein steps (a), (b), and (c) are performed on a heat block.
20. The method of claims 1 or 2, wherein steps (a), (b), and (c) are performed in less than 20 minutes.
21. The method of claims 1 or 2, wherein steps (a), (b), (c), and (d) are performed faster than a method comprising steps (a), (c), and (d) without the RNA:DNA duplex-specific RNase.
22. The method of claims 1 or 2, wherein steps (a), (b), and (c) produce a higher yield of amplification product than a method comprising steps (a) and (c) without the RNA:DNA duplex-specific RNase.
23. The method of claims 1 or 2, wherein prior to step (a) total RNA is isolated from the sample.
24. The method of claims 1 or 2, wherein prior to step (a), the sample is contacted with a detergent.
25. The method of claims 1 or 2, wherein the target RNA is a viral RNA.
26. The method of claims 1 or 2, wherein the detection of step (d) is selected from the group consisting of: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High-sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
27. A kit for detecting a target RNA in a sample, comprising: a) an RNA:DNA duplex-specific RNase; b) a reverse transcriptase; c) a DNA polymerase; d) a recombinase; and e) single -stranded DNA binding protein.
28. A kit for detecting a target RNA in a sample, comprising: a) an RNA:DNA duplex-specific RNase; b) a reverse transcriptase; and c) a DNA polymerase.
29. The kit of claims 27 or 28, wherein the RNA:DNA duplex-specific RNase is RNaseH.
30. The kit of claims 27 or 28, wherein the reverse transcriptase is selected from the group consisting of: a Moloney murine leukemia virus (M-MLV) reverse transcriptase (RT), an avian myeloblastosis virus (AMV) RT, a retrotransposon RT, a telomerase reverse transcriptase, an HIV-1 reverse transcriptase, or a recombinant version thereof.
31. The kit of claims 27 or 28, wherein the DNA polymerase is a strand-displacing DNA polymerase.
32. The kit of claim 31, wherein the strand-displacing DNA polymerase is selected from the group consisting of: Polymerase I Klenow fragment, Bst polymerase, Phi-29 polymerase, and Bacillus subtilis Pol I (Bsu) polymerase.
33. The kit of claims 27 or 28, furthering comprising a first and second set of primers.
34. The kit of claim 33, wherein the first set of primers comprises primers that bind to target R A and non-target RNA in the sample.
35. The kit of claims 33 or 34, wherein the first set of primers comprises random hexamers.
36. The kit of claim 35, wherein the first set of primers is specific to the target RNA.
37. The kit of claim 35, wherein the second set of primers are specific to the target RNA.
38. The kit of any of claims 33-37, wherein the second set of primers comprises a forward and reverse primer, and the first set of primers comprises the reverse primer of the second set of primers.
39. The kit of claim 28, further comprising a recombinase and single -stranded DNA binding protein.
40. The kit of claims 27 or 28, further comprising a reaction buffer and magnesium acetate.
41. The kit of claims 27 or 28, further comprising reagents for isolating RNA from the sample.
42. The kit of claims 27 or 28, further comprising detergent for lysing the sample.
43. The kit of any of claims 27-42, wherein the kit is used to reverse transcribe the target RNA into DNA, and to amplify the DNA to a detectable amplification product.
44. The kit of claim 43, further comprising reagents for detecting the amplification product, comprising reagents appropriate for a detection method selected from: lateral flow detection; hybridization with conjugated or unconjugated DNA; gel electrophoresis; Specific High- sensitivity Enzymatic Reporter unLOCKing (SHERLOCK); sequencing; and quantitative polymerase chain reaction (qPCR).
45. The kit of claims 43 or 44, further comprising one or more lateral flow strips specific for the target amplification product.
46. A method of detecting an RNA virus in a sample from a subject, comprising: a) isolating viral RNA from the subject; and b) performing the method of claims 1-26.
47. The method of claim 46, wherein the RNA virus is selected from influenza virus, human immunodeficiency virus (HIV), and severe acute respiratory syndrome coronavirus 2 (SARS- CoV-2).
PCT/US2021/023589 2020-03-23 2021-03-23 Compositions and methods for enhancing detection of rna WO2021195023A2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202062993521P 2020-03-23 2020-03-23
US62/993,521 2020-03-23
US202063031120P 2020-05-28 2020-05-28
US63/031,120 2020-05-28

Publications (2)

Publication Number Publication Date
WO2021195023A2 true WO2021195023A2 (en) 2021-09-30
WO2021195023A3 WO2021195023A3 (en) 2021-11-04

Family

ID=77892628

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/023589 WO2021195023A2 (en) 2020-03-23 2021-03-23 Compositions and methods for enhancing detection of rna

Country Status (1)

Country Link
WO (1) WO2021195023A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113913557A (en) * 2021-11-10 2022-01-11 中国人民解放军东部战区疾病预防控制中心 Kit for rapidly detecting SEOV-S4 subtype hantavirus and detection method thereof
CN114231664A (en) * 2021-11-30 2022-03-25 华南农业大学 Epinephelus akaara nervous necrosis virus RGNNV detection kit and detection method
WO2023095018A1 (en) * 2021-11-24 2023-06-01 D-Nome Private Limited Rapid method for room temperature reverse transcription loop-mediated isothermal amplification (rt-lamp) and reagent kit

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11401558B2 (en) * 2015-12-18 2022-08-02 Clear Gene, Inc. Methods, compositions, kits and devices for rapid analysis of biological markers
WO2018075502A1 (en) * 2016-10-17 2018-04-26 Arizona Board Of Regents On Behalf Of Arizona State University Unimolecular aptamer-based sensors for pathogen detection

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113913557A (en) * 2021-11-10 2022-01-11 中国人民解放军东部战区疾病预防控制中心 Kit for rapidly detecting SEOV-S4 subtype hantavirus and detection method thereof
CN113913557B (en) * 2021-11-10 2023-08-25 中国人民解放军东部战区疾病预防控制中心 Kit for rapidly detecting Hantavirus SEOV-S4 subtype and detection method thereof
WO2023095018A1 (en) * 2021-11-24 2023-06-01 D-Nome Private Limited Rapid method for room temperature reverse transcription loop-mediated isothermal amplification (rt-lamp) and reagent kit
CN114231664A (en) * 2021-11-30 2022-03-25 华南农业大学 Epinephelus akaara nervous necrosis virus RGNNV detection kit and detection method
CN114231664B (en) * 2021-11-30 2023-07-28 华南农业大学 Epinephelus akaara nerve necrosis virus RGNNV detection kit and detection method

Also Published As

Publication number Publication date
WO2021195023A3 (en) 2021-11-04

Similar Documents

Publication Publication Date Title
Ding et al. Sensitive quantitative detection of SARS-CoV-2 in clinical samples using digital warm-start CRISPR assay
Qian et al. An enhanced isothermal amplification assay for viral detection
WO2021195023A2 (en) Compositions and methods for enhancing detection of rna
Sherrill-Mix et al. Detection of SARS-CoV-2 RNA using RT-LAMP and molecular beacons
US20230203567A1 (en) Isothermal methods, compositions, kits, and systems for detecting nucleic acids
WO2021202158A1 (en) Nested rpa and competitive reference standard
Liang et al. Rapid detection and tracking of Omicron variant of SARS-CoV-2 using CRISPR-Cas12a-based assay
JP2017536813A (en) Compositions and methods for detecting RNA viruses
ES2605303T3 (en) Qualitative and quantitative detection of microbial nucleic acids
Li et al. An exonuclease protection and CRISPR/Cas12a integrated biosensor for the turn-on detection of transcription factors in cancer cells
Gupta et al. CRISPR detectives against SARS-CoV-2: a major setback against COVID-19 blowout
Sherrill-Mix et al. LAMP-BEAC: detection of SARS-CoV-2 RNA using RT-LAMP and molecular beacons
Choi et al. Dual-site ligation-assisted loop-mediated isothermal amplification (dLig-LAMP) for colorimetric and point-of-care determination of real SARS-CoV-2
KR101857684B1 (en) Primers and probe for detection of middle east respiratory syndrome coronavirus and detecting method for middle east respiratory syndrome coronavirus using the same
BR112020004071A2 (en) amplification reaction by nicking and (near) extension of respiratory syncytial virus species
Li et al. Signal-amplified detection of biomarker transcription factors with improved accuracy based on T4 DNA ligase protection and rolling circle amplification
Liao et al. A highly adaptable platform powered by CRISPR-Cas12a to diagnose lumpy skin disease in cattle
ES2234680T3 (en) MULTIPLEX PCR FOR THE DETECTION OF INFECTIONS BY EHEC.
Gui et al. Direct detection of circulating free DNA extracted from serum samples of breast cancer using locked nucleic acid molecular beacon
KR20220158774A (en) Assay for detection of coronavirus disease 2019 (COVID-19)
WO2021263013A1 (en) Multiplex, sensitive and rapid nucleic acid detection
Li et al. A Fluorescence Assay for HIV-1 Ribonuclease H Activity and Inhibition Detection Using Graphene Oxide as Sensing Platform
Yi et al. RdRp activity test using CRISPR/Cas13a enzyme (RACE) for screening of SARS-CoV-2 inhibitors
Chen et al. A CRISPR-Cas12a-based assay for one-step preamplification-free detection of viral DNA
AU774181B2 (en) Method for detecting and/or quantifying a known function from a nucleic acid sample

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21775450

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21775450

Country of ref document: EP

Kind code of ref document: A2