WO2021167339A1 - 암 및/또는 뇌질환 바이오마커인 edb-fn 및 이를 표적하는 나노약물전달체 - Google Patents

암 및/또는 뇌질환 바이오마커인 edb-fn 및 이를 표적하는 나노약물전달체 Download PDF

Info

Publication number
WO2021167339A1
WO2021167339A1 PCT/KR2021/002008 KR2021002008W WO2021167339A1 WO 2021167339 A1 WO2021167339 A1 WO 2021167339A1 KR 2021002008 W KR2021002008 W KR 2021002008W WO 2021167339 A1 WO2021167339 A1 WO 2021167339A1
Authority
WO
WIPO (PCT)
Prior art keywords
edb
dspe
apt
delivery system
peg
Prior art date
Application number
PCT/KR2021/002008
Other languages
English (en)
French (fr)
Inventor
정규하
얼 쏘페이
이정설
Original Assignee
고려대학교 산학협력단
한국과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020210018153A external-priority patent/KR102499961B1/ko
Application filed by 고려대학교 산학협력단, 한국과학기술원 filed Critical 고려대학교 산학협력단
Priority to EP21757874.9A priority Critical patent/EP4109104A1/en
Priority to JP2022547050A priority patent/JP7460782B2/ja
Priority to US17/800,202 priority patent/US20230109491A1/en
Publication of WO2021167339A1 publication Critical patent/WO2021167339A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/10—Dispersions; Emulsions
    • A61K9/107—Emulsions ; Emulsion preconcentrates; Micelles
    • A61K9/1075—Microemulsions or submicron emulsions; Preconcentrates or solids thereof; Micelles, e.g. made of phospholipids or block copolymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6905—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
    • A61K47/6907—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a microemulsion, nanoemulsion or micelle
    • A61K47/6909—Micelles formed by phospholipids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/06—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations
    • A61K49/08—Nuclear magnetic resonance [NMR] contrast preparations; Magnetic resonance imaging [MRI] contrast preparations characterised by the carrier
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids

Definitions

  • the present invention relates to a nano-drug delivery system that targets extradomain B of fibronectin (EDB-FN) overexpressed in brain tumors.
  • EDB-FN extradomain B of fibronectin
  • MG Malignant glioma
  • GBM Glioblastoma multiforme
  • BBTB blood-brain tumor barrier
  • phenotypic-genotypic diagnostic markers include: O 6 -methylguanine-deoxyribonucleic acid (DNA) methyltransferase promoter (MGMT) methylation, isocitrate dehydrogenase-1 (IDH-1) mutation, and chromosomal 1p/19q deletion. Evaluating the above markers has a great influence on prognosis and suggesting treatment tailored to each patient. In addition, many other biomarkers such as alpha-thalassemia/mental retardation syndrome X-linked and telomerase reverse transcriptase promoter mutations are still being validated, and their effectiveness is being actively demonstrated. However, most biomarkers so far have not been evaluated and proven in malignant gliomas, and thus they have not developed into therapeutic agents. Therefore, there is still a need to discover biomarkers that can provide effective diagnosis and treatment.
  • DNA DNA
  • MGMT methyltransferase promoter
  • IDH-1 isocitrate dehydrogenase-1
  • Fibronectin is a glycoprotein mainly found in the extracellular matrix and plasma membrane. It regulates cell migration and adhesion while binding to various extracellular matrix proteins such as integrins, collagen, and fibrin.
  • Fibrillar monomers are classified into three types (types I, II and III) according to their repeating units. Alternative splicing domains prepared in the three regions of the fibrillar gene have a constant splicing pattern. The resulting isoform is named according to the splicing site located in the type III repeat unit: extra-domain A (EDA-FN) of fibrillar, extra-domain B (EDB) -FN), and type III connecting segment (IIICS-FN).
  • EDB-FN is an oncofetal antigen.
  • EDB-FN is overexpressed in various human cancers such as non small cell lung carcinoma, Hodgkin lymphoma, and prostate cancer.
  • EDB-FN is utilized as a marker of neovascularization in head and neck cancer.
  • fibrinoids in the brain, EDB-FN can be utilized as a follow-up tool to diagnose major glioblastoma multiforme in patients, as well as treatment of glioblastoma multiforme and radioimmunotherapy in rodent models.
  • the technical problem to be achieved by the present invention is to provide a drug delivery system having a micelle structure comprising a PEG 2000 -DSPE polymerized lipid and an APT EDB -PEG 2000 -DSPE polymer, wherein the APT EDB is a fibrillar extradomain B (extradomain B of fibronectin, EDB-FN) gene (FN1, Entrez Gene ID: 2335) is an aptide showing a specific binding force.
  • Another object of the present invention is to provide a pharmaceutical composition for diagnosing or treating brain tumors comprising the drug-loaded drug delivery system as an active ingredient.
  • Another object of the present invention is to provide a method for preparing a brain tumor-specific drug delivery system comprising the following steps.
  • step (2) (2) obtaining an APT EDB- PEG 2000- DSPE polymer from the mixed solution of step (1);
  • another object of the present invention includes the steps (1) to (4), wherein the step (3) is to add an anticancer agent to a solution in which APT EDB -PEG 2000 -DSPE polymer and PEG 2000 -DSPE polymerized lipid are dissolved. It is to provide a method for producing a medicament for brain tumor treatment, which is to induce the formation of a micelle structure by mixing.
  • the present invention provides a drug delivery system of a micellar structure comprising a PEG 2000 -DSPE polymerized lipid and APT EDB -PEG 2000 -DSPE polymer.
  • the APT EDB is an aptide that shows a specific binding ability to the extradomain B of fibronectin (EDB-FN) gene (FN1, Entrez Gene ID: 2335).
  • the drug delivery system may include 1 to 2.5 parts by weight of APT EDB -PEG 2000- DSPE polymer based on 100 parts by weight of PEG 2000-DSPE polymerized lipid.
  • the diameter of the drug delivery system may be 5.0 to 12.0 nm, and the zeta potential may be -8.0 to -11.0.
  • the drug delivery system passes through the blood-brain barrier (BBB) or blood-brain tumor barrier (BBTB) to deliver the drug specifically to brain tumor cells.
  • BBB blood-brain barrier
  • BBTB blood-brain tumor barrier
  • the present invention provides a pharmaceutical composition for diagnosing or treating brain tumors comprising the drug-loaded drug delivery system as an active ingredient.
  • the present invention provides a method for preventing or treating a brain tumor comprising administering the drug-loaded drug delivery system to an individual.
  • the present invention provides the use of the drug-loaded drug delivery system for the manufacture of a medicament for the prevention or treatment of brain tumors.
  • the present invention provides a method for diagnosing a brain tumor comprising administering the drug-loaded drug delivery system to a subject.
  • the present invention provides the use of a drug delivery system loaded with the drug for the manufacture of a medicament for the diagnosis of brain tumors.
  • the drug is a contrast agent or an anticancer agent
  • the anticancer agent is docetaxel, halaven, vincristine, cisplatin, vinblastine, vinorelbine.
  • Vinorelvine Paclitaxel, Etoposide, Topotecan, Irinotecan, Dactinomycin, Doxorubicin, Daunorubicin, Mitomycin , gleevec, carboplatin, valrubicin, flutamide, gemcitabine, bleomycin, temozolomide, procarbazine ), lomustine (Lomustine, CCNU; 1-(2-chloroethyl)-3-cyclohexyl-1-nitrosourea), vincristine (Vincristine) and carmustine (Carmustine, BCNU) any one or more selected from the group consisting of can
  • the brain tumor is astrocytoma, glioblastoma multiforme, oligodendroglioma, oligoastrocytoma, ependymoma, medulloblastoma ( medulloblastoma), hemangioblastoma, meningioma, pituitary adenoma, craniopharyngioma, and choroid plexus papilloma may be any one or more selected from the group consisting of.
  • the present invention provides a method for preparing a brain tumor-specific drug delivery system comprising the following steps.
  • step (2) (2) obtaining an APT EDB- PEG 2000- DSPE polymer from the mixed solution of step (1);
  • the organic solvent of step (1) is 1 selected from the group consisting of chloroform, dimethylsulfoxide, dimethylformamide, ethanol, methanol, tetrahydrofuran, toluene, xylene and hexane. may be more than one species.
  • step (1) may be performed under inert conditions at room temperature for 12 hours.
  • step (2) may be to obtain APT EDB -PEG 2000 -DSPE polymer from a mixed solution using liquid chromatography.
  • step (3) APT EDB -PEG 2000 -DSPE polymer and PEG 2000 -DSPE polymerized lipid are mixed in a solvent and sonicated to hydrate to induce micelle structure formation.
  • the step (4) may be to filter the mixed solution with a 0.0025 ⁇ 0.1 ⁇ m membrane, and to purify the micellar structure through size exclusion chromatography (size exclusion chromatography).
  • the membrane may be preferably a 0.1 ⁇ m membrane.
  • the present invention provides a drug delivery system, characterized in that it is a brain tumor-specific drug delivery system prepared by the above preparation method, has a diameter of 5.0 to 12.0 nm, and is a micellar structure having a zeta potential of -8.0 to -11.0.
  • the present invention includes steps (1) to (4) of the manufacturing method, wherein the step (3) is to add an anticancer agent to a solution in which APT EDB -PEG 2000 -DSPE polymer and PEG 2000 -DSPE polymerized lipid are dissolved. It provides a method for producing a medicament for brain tumor treatment, which is mixed with a micelle structure to induce formation.
  • the anticancer agent may be mixed so that the final concentration is 50 mg/mL.
  • the drug passes through the blood-brain barrier (BBB) or blood-brain tumor barrier (BBTB) and accumulates inside the brain tumor and tumor It may be entrapped into the cell.
  • BBB blood-brain barrier
  • BBTB blood-brain tumor barrier
  • the present invention relates to a micelle-structured drug delivery system comprising a PEG 2000- DSPE polymerized lipid and an APT EDB- PEG 2000- DSPE polymer, and a method for preparing the same.
  • the drug delivery system targets the extradomain B of fibronectin (EDB-FN), which is overexpressed in brain tumors, and passes through the blood-brain barrier (BBB) or the blood-brain tumor barrier (BBTB).
  • EDB-FN extradomain B of fibronectin
  • BBB blood-brain barrier
  • BBTB blood-brain tumor barrier
  • the present invention can provide a pharmaceutical composition for diagnosing or treating brain tumors comprising the drug-loaded drug delivery system as an active ingredient, wherein the composition accumulates inside the brain tumor and is incorporated into the tumor cells to provide specific As it can inhibit tumor growth, it can be usefully used for diagnosis or treatment of brain tumors.
  • EDB-FN shows the overexpression of EDB-FN in malignant glioma cells to demonstrate the expression of EDB-FN.
  • B shows the results of EDB-FN mRNA expression analysis using quantitative real-time PCR (qRT-PCR) after extracting total RNA from 2D cultured cells of various cancers. 2 - ⁇ Ct was used, and glyceraldehyde 3-phosphate dehydrogenase was set as an internal control.
  • D shows a malignant glioma cell line.
  • E is the result of performing qRT-PCR analysis using total RNA extracted from U373MG cells (2D monolayer culture) or U87MG cells (2D monolayer culture, 3D spheroid culture, and subcutaneous tumor tissue).
  • Statistical analysis Welch's t test. ** p ⁇ 0.01, *** p ⁇ 0.001, **** p ⁇ 0.0001, ns: not statistically significant. The results are expressed as mean ⁇ standard deviation of quadruplet determinations.
  • EDB-FN fibrillar extradomain B; MG: Malignant glioma.
  • Figure 2 shows the characterization of the synthetic APT EDB- -DSPE micellar nano-DDS.
  • A shows a synthetic method using Mal-PEG 2000- DSPE and cysteinylated APT EDB and a representative formulation of APT EDB- DSPE micellar nano-DDS (APT EDB- DSPE-DTX) encapsulated with docetaxel.
  • B shows the dynamic light scattering (DLS) size measurements of PEG 2000- DSPE micellar nano-DDS (APT EDB- unconjugated) and APT EDB- DSPE micellar nano-DDSs (APT EDB-conjugated), and both nanoparticles were 12 less than nm (3 replicates per group).
  • DLS dynamic light scattering
  • FIG. 3 shows the in vitro cell uptake of APT EDB- DSPE micellar nano-DDS by EDB-FN expression.
  • Uptake experiments and competition analysis of PEG 2000- DSPE and APT EDB- DSPE were performed in (A) EDB-FN high-expressing cells (U87MG and U251) and (B) low-expressing cells (MCF7 and B16F1). Phosphate buffered saline was compared as a control.
  • APT EDB EDB-FN-specific aptamer-like aptide
  • APT EDB -DSPE APT EDB -conjugated PEG 2000 -DSPE
  • PEG 2000 -DSPE polyethylene glycol ( 2000 )-1,2-distearoyl- sn -glycero-3-phosphoethanolamine.
  • FIG. 4 shows in vitro EDB-FN- and time-dependent cellular uptake of APT EDB- DSPE micellar nano-DDS.
  • A confirms the siRNA-mediated EDB-FN knockdown through qRT-PCR. GAPDH expression was used as an internal control.
  • Statistical analysis Welch's t test. ** p ⁇ 0.01. The results are presented as the mean ⁇ standard deviation of triplicate determinations.
  • B shows the cellular uptake of APT EDB- DSPE micellar nano-DDS according to EDB-FN expression.
  • FIG. 5 shows in vitro cell uptake and cytotoxicity of APT EDB- DSPE and APT EDB- DSPE-DTX micellar nano-DDS.
  • Quantification analysis of APT EDB- DSPE micellar nano-DDS cell uptake via ImageJ is shown (right). Fluorescence intensity was normalized to the DAPI signal of each cell line (quadruplet determinations).
  • APT EDB -DSPE APT EDB -conjugated PEG 2000 -DSPE; APT EDB- DSPE-DTX: DTX-loaded APT EDB- DSPE micellar nano-DDS; DSPE-DTX: DTX-loaded PEG 2000 -DSPE micellar nano-DDS; DTX: docetaxel; PEG 2000 -DSPE: polyethylene glycol ( 2000 )-DSPE (ammonium salt).
  • Figure 6 shows the in vivo absorption and anticancer efficacy of APT EDB- -DSPE-DTX in the U87MG subcutaneous xenograft mouse model.
  • (C) shows the anticancer effect of micellar nano-DDS.
  • E shows the experimental schedule of the orthotopic model
  • Brain slices with the largest tumor volume in each sample were selected and analyzed.
  • (G) is a representative image showing the comparison of brain tumor sizes.
  • Statistical analysis Welch's t test. * p ⁇ 0.05, ** p ⁇ 0.01, *** p ⁇ 0.001, **** p ⁇ 0.0001, ns: not statistically significant. The results are presented as mean ⁇ standard deviation.
  • APT EDB- DSPE-DTX docetaxel-loaded APT EDB- DSPE micellar nano-DDS; DDS: drug delivery system; DSPE-DTX: docetaxel-loaded PEG 2000 -DSPE micellar nano-DDS; DTX: docetaxel; nano DDS Tx: nano drug delivery system treatment.
  • FIG. 7 shows the in vivo biocompatibility of APT EDB- DSPE-DTX .
  • A shows the cancer-targeting ability of APT EDB-DSPE-DTX.
  • B shows the minimal toxicity of micellar nano-DDS on normal major organs.
  • micellar nano-DDS docetaxel-loaded APT EDB- DSPE micellar nano-DDS; DSPE-DTX: docetaxel-loaded PEG 2000 -DSPE micellar nano-DDS.
  • EDB-FN expression in an orthotopic xenograft model More specifically, the expression of EDB-FN in orthotopic xenografted brain tumors is shown.
  • the model mice were injected with saline (control), DSPE-DTX, or APT EDB -DSPE-DTX micellar nano-DDS for 2 weeks.
  • the mouse brain was dissected to a thickness of 20 ⁇ m.
  • APT EDB- DSPE-DTX docetaxel-loaded APT EDB- DSPE micellar nano-DDS; DSPE-DTX: docetaxel-loaded PEG 2000 -DSPE micellar nano-DDS.
  • EDB-FN shows the clinical significance of EDB-FN as a potential biomarker and its feasibility as a target ligand for malignant gliomas.
  • EDB-FN extradomain B of fibronectin
  • the term “aptide” refers to an aptamer-like peptide with improved stability while maintaining affinity for a target.
  • the aptide has a scaffold composed of a cyclic ⁇ -hairpin-based peptide binder and n amino acids at both ends of the scaffold, which can bind to specific biological targets. Aptide builds various libraries This may include a possible target-binding region.
  • the aptide may be composed of any one or more amino acids selected from the group consisting of L-amino acids and D-amino acids.
  • Stability may include the physical, chemical and biological stability of aptide, and specifically may refer to biological stability. That is, the biologically stable aptide may have resistance to the action of proteolytic enzymes in vivo.
  • Aptide according to the present invention is an aptide that specifically binds to the EDB-FN gene (Entrez Gene ID: 2335), and specifically may be composed of the amino acid sequence shown in SEQ ID NO: 1.
  • the amino acid sequence may be characterized in that a cysteine (C) residue is attached to a lysine (K) (FIG. 2A).
  • the aptide for EDB-FN is stable with a size of 3 kDa, and can bind to EDB-FN with a high affinity of ⁇ 100 nM.
  • the aptide according to the present invention may be a variant or fragment of the aptide having a different sequence by deletion, insertion, substitution, or a combination of amino acid residues within a range that does not affect the structure and activity of the aptide according to the present invention.
  • Amino acid exchanges in proteins or peptides that do not entirely alter the activity of the molecule are known in the art. In some cases, it may be modified by phosphorylation, sulfation, acrylation, saccharification, methylation, farnesylation, and the like.
  • the aptide may have 70, 80, 85, 90, 95 or 98% homology to the amino acid sequence set forth in SEQ ID NO: 1.
  • drug carrier refers to a complex chemically or physically bound to an active ingredient (eg, drug) to a target cell, tissue, or organ, and a carrier or vehicle suitable for transporting and delivering the active ingredient.
  • the chemical bond means a chemical bond through a chemical reaction, and the physical bond is not only physical fixation such as adsorption, coheison, chain entanglement, entrapment, but also van der Waals bonds. It is a concept that includes non-chemical fixation in which an electrical interaction occurs either alone or in conjunction with the physical fixation.
  • nano drug carrier means that the drug carrier has a size range of about 1 nanometer (nm) to about 1000 nm.
  • the nano-drug carrier may be a pharmaceutically acceptable carrier.
  • drug has pharmacological activity and includes polypeptides, proteins, and the like, and in the present invention, preferably means a contrast agent or an anticancer agent.
  • anticancer agent include docetaxel, halaven, vincristine, cisplatin, vinblastine, vinorelbine, paclitaxel, etoposide.
  • Topotecan Irinotecan, Dactinomycin, Doxorubicin, Daunorubicin, Mitomycin, Gleevec, Carboplatin, Carboplatin valrubicin, flutamide, gemcitabine, bleomycin, temozolomide, procarbazine, lomustine, CCNU; 1-(2) -chloroethyl)-3-cyclohexyl-1-nitrosourea), vincristine (Vincristine) or carmustine (Carmustine, BCNU), and the like, but are not limited thereto.
  • prevention refers to any action that inhibits or delays the occurrence, spread, or recurrence of cancer by administration of the composition of the present invention
  • treatment refers to the symptoms of the disease by administration of the composition of the present invention. means any action that is improved or changed for the better.
  • diagnosis refers to determining the susceptibility of an individual to a specific disease or disorder, determining whether an individual currently has a specific disease or disorder, or an individual suffering from a specific disease or disorder determining the prognosis of, or therametrics (eg, monitoring a subject's condition to provide information about treatment efficacy).
  • the term "pharmaceutical composition” means one prepared for the purpose of preventing or treating a disease, and each may be formulated in various forms according to a conventional method and used. For example, it may be formulated in oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, and syrups, and may be formulated in the form of external preparations, suppositories, and sterile injection solutions.
  • “included as an active ingredient” means that the ingredient is included in an amount necessary or sufficient to realize a desired biological effect.
  • the amount may be determined taking into account other non-toxic factors and may vary depending on various factors, such as, for example, the disease or condition being treated, the form of the composition being administered, the size of the subject, or the severity of the disease or condition.
  • a person of ordinary skill in the art to which the present invention pertains can empirically determine the effective amount of an individual composition without undue experimentation.
  • composition of the present invention may be administered orally or parenterally in a pharmaceutically effective amount according to a desired method
  • pharmaceutically effective amount means a disease with a reasonable benefit/risk ratio applicable to medical treatment. It means an amount sufficient to treat the drug and does not cause side effects, and the effective dose level includes the patient's health condition, severity, drug activity, drug sensitivity, administration method, administration time, administration route, and excretion rate; It may be determined according to factors including the duration of treatment, combination or concurrent drugs, and other factors well known in the medical field.
  • the 'brain tumor' is malignant or benign, regardless of whether all neonatal It refers to all pre-cancerous cells and cancer cells that exhibit cell growth and proliferation, preferably malignant glioma.
  • Non-limiting examples include astrocytoma, glioblastoma multiforme, oligodendroglioma, oligoastrocytoma, ependymoma, medulloblastoma, hemangioblastoma. ), meningioma, pituitary adenoma, craniopharyngioma, or choroid plexus papilloma.
  • the term "individual” may be a mammal, such as a rat, livestock, mouse, or human, preferably a human.
  • compositions of the present invention may be formulated in various forms for administration to an individual, and a representative formulation for parenteral administration is an injection formulation, preferably an isotonic aqueous solution or suspension.
  • Formulations for injection may be prepared according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. For example, each component may be dissolved in saline or buffer to be formulated for injection.
  • formulations for oral administration include, for example, ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups and wafers.
  • the tablet may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, and optionally starch, agar, alginic acid or It may further contain disintegrating agents, such as sodium salts thereof, absorbents, colorants, flavoring agents and/or sweetening agents.
  • the formulation may be prepared by conventional mixing, granulating or coating methods.
  • composition of the present invention may further contain adjuvants such as preservatives, wettable powders, emulsification accelerators, salts or buffers for osmotic pressure control, and other therapeutically useful substances, and may be formulated according to a conventional method. .
  • the pharmaceutical composition according to the present invention may be administered through several routes including oral, transdermal, subcutaneous, intravenous or intramuscular, and the dosage of the active ingredient may vary depending on the route of administration, age, sex, weight, and severity of the patient. It may be appropriately selected according to several factors.
  • the composition of the present invention may be administered in parallel with a known compound capable of enhancing the desired effect.
  • the term 'animal model' refers to an animal having a disease that is very similar to a human disease.
  • the significance of disease model animals in the study of human diseases is due to the physiological or genetic similarity between humans and animals.
  • biomedical disease model animals provide research materials for various causes, pathogenesis, and diagnosis of diseases, and through the study of disease model animals, it is possible to find out genes related to diseases and to understand the interactions between genes. It is possible to obtain basic data for judging the feasibility of practical use through actual efficacy and toxicity tests of the developed new drug candidates.
  • the term "animal” or “experimental animal” refers to any mammalian animal other than humans.
  • Such animals include animals of all ages, including embryos, fetuses, newborns and adults.
  • Animals for use in the present invention are available, for example, from commercial sources.
  • Such animals include laboratory animals or other animals, rabbits, rodents (eg, mice, rats, hamsters, gerbils and guinea pigs), cattle, sheep, pigs, goats, horses, dogs, cats, birds (eg, chickens, turkeys, ducks, geese), and primates (eg, chimpanzees, monkeys, rhesus monkeys).
  • the term 'cultivation' refers to growing an organism or a part of an organism (organs, tissues, cells, etc.) in an appropriately artificially controlled environmental condition. (partial pressure of carbon dioxide or oxygen), etc. are important, and the medium (incubator) that has the most important direct effect on the cultured organism is the direct environment of the organism as well as the supply site of various nutrients necessary for survival or proliferation.
  • the term 'in vitro culture' refers to a series of laboratory processes in which cells are grown in a body and the like are cultured in a laboratory incubator under conditions similar to the internal environment.
  • the term 'medium' or 'medium composition' refers to the growth and proliferation of cells in vitro, including essential elements for the growth and proliferation of cells, such as sugar, amino acids, various nutrients, serum, growth factors, and minerals. mixture for
  • a single sample normalization method was used for oncopression data, and all samples were obtained from the Affymetrix Human Genome U133 Plus 2.0 (GPL570 or A-AFFY-44) platform. Expression values ranged from 0.0 to 1.0, with 1.0 indicating complete transcriptional activation. The ratio of cancer cells to normal cells (cancer-to-normal ratio) was calculated by dividing the expression value in cancer cells by the average expression value in normal cells. For survival analysis, after collecting brain tumor datasets, including expression profiles and patient prognostic information, up to 30 samples were excluded from analysis. All gene expression values were quantile normalized by the dataset. Z-value was calculated by log-rank test with each dataset, and Lipt using the square root of the number of patients in each dataset as body weight Averaged by k method.
  • tissue samples were stored in paraffin blocks after surgery and pathological diagnosis.
  • the patients were 21 adults, aged 18 to 75 years, and were diagnosed with glioblastoma multiforme.
  • Tissue microarray slides containing a total of 65 tissue samples from 3 to 4 different tumor sites for each patient were prepared.
  • the tissue core was implanted with a recipient paraffin block having a diameter of 2 mm and containing 45 holes for each block.
  • the block filled with paraffin was cut into 3 ⁇ m thick and placed on a slide. Thereafter, the tissue was stained as described in the immunohistochemistry section to be described later. After immunostaining, a read-out of EDG-FN presence and levels was obtained from a pathologist via blind review.
  • the staining intensity ranged from none or '1+' (very weak positivity) to '4+' (very strong positivity).
  • '1+' and '2+' were classified as a low-expression group
  • '3+' and '4+' were classified as a high-expression group.
  • PFS progression-free survival
  • OS overall survival
  • Polyethylene glycol ( 2000 )-1,2-distearo yl- sn -glycero-3-phosphoethanolamine (ammonium salt) (PEG 2000 -DSPE), DSPE-N-(lissamine rhodamine B sulfonyl ) (ammonium salt) (Rh-DSPE) , and N-maleimide-PEG 2000 -DSPE (ammonium salt) (Mal-PEG 2000 -DSPE) were purchased from Avanti Polar Lipids (CA, USA).
  • EDB-FN-specific peptide N'- CSSPIQGSWTWENGK(C)WTWGIIRLEQ- C' was obtained from Anygen Corp. (Gwangju, Republic of Korea) made to order.
  • Mouse anti-EDB-FN antibody and anti-mouse fluorescein isothiocyanate (FITC)-conjugated secondary antibody were purchased from Abcam (Cambridge, UK).
  • Docetaxel (DTX) and Sepharose CL-4B columns were purchased from Sigma-Aldrich (MO, USA), mounting solutions were purchased from Dako Diagnostics (Glostrup, Denmark), and an Alamar Blue assay kit was purchased from Thermo Fisher Scientific (MA, USA). ) was purchased from All reagents were laboratory grade and used as received.
  • U87MG, U251MG, U373MG, MCF-7, PC3, B16F10, and B16F1 cells were purchased from the American Type Culture Collection (VA, USA). All cells were maintained at 37 °C in a humidified 5% CO 2 environment. Cells were prepared by adding 10% fetal bovine serum (FBS; Gibco, IL, USA), 100 U/mL penicillin (Gibco), and 100 ⁇ g/mL streptomycin (Gibco) to minimal essential medium (MCF-7), RPMI (PC3). , B16F10, B16F1), or in Dulbecco's modified Eagle's medium (U87MG, U251MG, U373MG). All of the above cell culture media were purchased from Gibco.
  • 3D spheroid culture all three malignant glioma cell lines (U87MG, U251MG, and U373MG) were treated with 1-5 ⁇ 10 3 cells per well in a Nunclon Sphera Microplate 96-well round bottom plate (Thermo). Fisher Scientific). The plate was centrifuged at 200 x g for 2 minutes, and then placed in an incubator at 37° C., 5% CO 2 . The cells were cultured for 6 days, and half of the medium was changed on the 3rd day.
  • the formed spheroids were transferred to an 8-well chambered coverglass slide (Thermo Fisher Scientific) fixed with 4% (w/v) paraformaldehyde (Wako, VA, USA), followed by immunocytochemistry ( immunocytochemistry) was performed.
  • Example 6 Malignant glioma flank xenograft model for in vivo EDB-FN immunocytochemistry
  • RNA Ribo Ex using an RNA isolation kit (GeneAll, Seoul, Republic of Korea).
  • cDNA Complementary DNA
  • EDB-FN gene forward primer: 5'-AACTCACTGACCTAAGCTTT -3'; reverse primer: 5'-CGTTTGTTGTGTCAGTGTAG-3'
  • glyceraldehyde 3-phosphate dehydrogenase gene forward primer: 5′-AATCCCATCACCATCTTCCA-3′; reverse primer: 5′-TGGACTCCACGACGTACTCA-3′.
  • the polymerase chain reaction protocol was as follows: an initial denaturation step at 94 °C for 5 min; 30 repetitions of denaturation at 94° C. for 1 minute, primer annealing at 55° C. for 1 minute, and extension at 72° C. for 2 minutes; and final stretching at 72° C. for 7 minutes.
  • the messenger RNA (mRNA) level of each gene was quantified using the - ⁇ Ct method, and normalized to the messenger RNA of glyceraldehyde 3-phosphate dehydrogenase.
  • the cultured cells were washed three times with cold phosphate buffered saline (PBS; Welgene, Gyeongsan, Republic of Korea), fixed with 4% (w/v) paraformaldehyde for 15 minutes at room temperature, washed with PBS, and 0.1% Permeabilized with (v/v) Triton X-100 (Amresco, PA, USA)/PBS for 10 min and 1% (w/v) bovine serum albumin (BSA; Millipore, MA, USA)/0.1 overnight at 4°C % (v/v) Triton X-100/PBS was incubated with primary antibody against EDB-FN (ab154210, 1:500 for 2D, 1:100 for 3D; Abcam).
  • PBS cold phosphate buffered saline
  • BSA bovine serum albumin
  • the immuno-labeled protein was visualized by treatment with fluorescence-conjugated secondary antibodies at room temperature for 60 minutes. After washing with PBS, the cells were sealed with 4',6-diamidino-2-phenylindole (DAPI) mounting medium (Vector laboratories, CA, USA), sealed with cover slips, and followed by a confocal laser. Scanning was performed using a confocal laser scanning microscope (LSM 700; Carl Zeiss, NY, USA).
  • DAPI 4',6-diamidino-2-phenylindole
  • the degree of EDB-FN staining was analyzed by applying tissue microarrays to patient tissue samples and immunohistochemistry to subcutaneous xenograft animal tissue samples.
  • the tissue microarray slides were heated at 55 °C for 30 minutes to remove wax, washed three times for 5 minutes, and then washed with 100, 95, and 80% (v/v) ethanol for 5 minutes to continuously rehydrate to pure distilled water. (rehydration).
  • Antigen retrieval was performed by heating the section at 95 °C for 30 minutes in 10 mM sodium citrate (pH 6.0). Endogenous peroxidase activity was inhibited by incubation in 3% (w/v) hydrogen peroxide for 30 min.
  • APT EDB cysteinylated EDB-FN-specific aptamer-like peptide
  • APT EDB Anygen
  • APT EDB :Mal-PEG 2000- DSPE in a molar ratio of 1:2 was carried out a conjugation reaction for 12 hours at ambient temperature (ambient temperature) under inert conditions.
  • APT EDB- conjugated PEG 2000- DSPE was purified by reversed-phase high-performance liquid chromatography, followed by matrix-demodulation laser desorption/ionization time-of-flight mass spectrometry (matrix-assisted laser The conjugation efficiency was determined using desorption/ionization time-of-flight mass spectrometry.
  • dialysis was performed based on a molecular weight of 3.5 kDa using a dialysis membrane (Spectrum Chemical, NJ, USA). After 48 hours, the conjugate was lyophilized under reduced pressure.
  • Anionic lipid film of 2 mg/mL PEG 2000 -DSPE was prepared from stock solution.
  • Rh-DSPE labeled with 0.5 wt% rhodamine B fluorophore was added to PEG 2000-DSPE solution.
  • APT EDB- DSPE was added to the formulation at a concentration of 1.0, 2.5, or 5.0 wt %.
  • APT EDB- DSPE micelle nano-DDS (APT EDB- conjugated) of 1.0 wt% APT EDB -DSPE
  • 20 ⁇ g of APT EDB- DSPE conjugate was added.
  • passive/non-targeting PEG 2000- DSPE micellar nano-DDS (APT EDB -unconjugated) was synthesized. All components were placed in a glass vial, dried under vacuum, and lyophilized overnight under reduced pressure to remove all remaining chloroform.
  • micellar preparations in PBS were analyzed by dynamic light scattering (DLS) and zeta potential analysis.
  • 1 mL of 2 mg/mL micelles was transferred to a transparent cuvette, and the hydrodynamic diameter and zeta potential of each micell were measured using a Zetasizer Nano ZS90 (Malvern Instruments, Malvern, UK).
  • APT EDB-unconjugated Passive / non-target DSPE-DTX (APT EDB -unconjugated), and active target APT EDB -DSPE- DTX (APT EDB -conjugated ) was developed by applying the conventional method described (Chong K et al., Chem Commun (Camb) 2013; 49: 11476-8).
  • cysteinylated APT EDB was conjugated with maleimide group of PEG 2000-DSPE lipid.
  • DTX was dissolved in chloroform and added to the micellar lipid film to a final concentration of 50 mg/mL during rehydration.
  • DTX-loaded PEG 2000- DSPE micellar nano-DDS and APT EDB- DSPE micellar nano-DDS were named 'DSPE-DTX' and 'APT EDB-DSPE-DTX', respectively.
  • DSPE-DTX and APT EDB- DPSE-DTX were filtered through a 0.1- ⁇ m membrane and purified by size exclusion chromatography.
  • Example 10 EDB-FN validation as a therapeutic target for malignant glioma using APT EDB-conjugated micellar nanoparticles
  • the cell uptake efficiency of APT E DB- DSPE micellar nano-DDS was determined by treating EDB-FN-positive U87MG and U251MG cells with each micelle preparation.
  • U87MG and U251MG cells were cultured in 96-well plates at 5,000 cells/well. After culturing the cells to confluence on sterile coverslips, the cells were treated with APT EDB- DSPE at a concentration of 1.0, 2.5, or 5.0 wt%, and 100 ⁇ g/mL PEG 2000- DS PE micellar nano-DDSs or APT EDB- DSPE micelles were incubated with Nano-D DS at 37°C for 1 hour.
  • the cells were washed with PBS, fixed with 4% (w/v) paraformaldehyde, counterstained with nuclear dye DAPI (Invitrogen, CA, USA), sealed with glass slides, and rhodamine B). -Confocal laser scanning microscopy was used to confirm the absorption rate of the labeled micelles.
  • EDB-FN high-expressing cells U87MG and U251MG
  • EDB-FN low-expressing cells MF-7 and B16F1
  • the cells were pretreated with free APT EDB peptide at various concentrations (100 ⁇ g/ml and 500 ⁇ g/ml) for 30 min.
  • rhodamine-labeled APT EDB- DSPE was added, and the cells were further incubated for 30 minutes.
  • the cells were washed with PBS, fixed with 4% (w/v) paraformaldehyde, and sealed with a microscope slide for viewing under a confocal microscope.
  • EDB-FN-specific siRNA and scrambled control siRNA were purchased from Bioneer (Daejeon, Republic of Korea).
  • the target sequence of EDB-FN siRNA used for RNA interference is as follows; sense; ACAGUCCCAGAUCAUGGAG, antisense; CUCCAUGAUCUGGGACUGU.
  • Lipofectamine 2000 Invitrogen, CA, USA
  • cells were grown overnight and then cultured in 96-well or 6-well plates at 60-70% confluence. Lipofectamine-siRNA complexes were prepared according to the manufacturer's instructions. Transfection efficacy was analyzed after 48 hours.
  • U87MG cells were transfected with the above-described control siRNA or EDB-FN siRNA.
  • the transfected cells were treated with PEG 2000- DSPE micelle nano-DDS or APT EDB- DSPE micelle nano-DDS at a concentration of 1.0 wt% at 100 ⁇ g/mL and incubated at 37° C. for 1 hour.
  • APT EDB- DSPE was stained through immunocytochemistry using an antibody against EDB-FN, and encapsulated with DAPI-containing mounting solution.
  • APT EDB- DSPE micellar nano-DDS with 1.0 wt% concentration of APT EDB- DSPE was added to U87MG cells for 5 min, 15 min, 30 min, 1 h and 4 h. treated during
  • E DB-FN as a molecular target for malignant gliomas
  • DTX was encapsulated into the core of PEG 2000- DSPE and APT EDB-DSPE micelle nano-DDSs by the method described above.
  • Each nano-DDS formulation was serially diluted and co-cultured with cells for 24 hours. After removing the agent, the cells were cultured for an additional 24 hours before Alamar Blue assay (Bio-Rad, CA, USA).
  • the IC 50 value of each formulation was determined by ProBit analysis.
  • mice were euthanized to collect major organs (heart, lung, spleen, lung, and kidney) for H&E staining.
  • the tissue was counterstained with 4',6-diamidino-2-phenylindole (DAPI, Invitrogen, NY, USA), covered with a cover slide, followed by a confocal laser scanning microscope and a slide scanner (Axio Scan.Z1; Carl Zeiss). , NY, USA) was used for analysis.
  • DAPI 4',6-diamidino-2-phenylindole
  • Tumor volume was calculated using the following equation: (length) x width (width) x height (height) x 0.5.
  • mice were sacrificed for tumor size analysis. After spraying with 10% (v/v) formalin (Sigma-Aldrich), each brain was removed and inserted into an optimal cutting temperature compound (Sakura Finetek, Tokyo, Japan). The brain samples were frozen and sliced into 20 ⁇ m using cryostat sectioning.
  • the brain slices were stained using a hematoxylin and eosin (H&E) staining kit (ScyTek, UT, USA), and the tumor volume was calculated using the following equation: (length x width x width) x 0.5. The longest dimension was set as the length, and the longest vertical diameter was set as the width.
  • H&E hematoxylin and eosin
  • EDB-FN a diagnostic marker and drug delivery target for malignant glioma
  • EDB-FN expression was determined in various human cancer cell lines.
  • Breast cancer cell lines MCF7, prostate cancer cell lines PC3, melanoma cell lines B16F1 and B16F10, and malignant glioma cell lines U373MG, U87MG, and U251MG were used in the experiments.
  • the expression pattern of EDB-FN protein was confirmed by quantitative analysis during two-dimensional monolayer culture (FIG. 1A).
  • EDB-FN expression was detected as weak in PC3 cell line and U373MG cell line, but clear expression was observed in U87MG cell line.
  • qRT-PCR was performed by extracting mRNA for quantitative analysis of EDB-FN expression (Fig. 1B).
  • a malignant glioma cell line was cultured in 3D, and a malignant glioma flank xenograft animal model was prepared.
  • EDB-FN was more overexpressed in U87MG cell lines than in U251MG and U373MG cell lines during 3D culture ( FIG. 1C ).
  • U251MG and U87MG cell lines showed relatively higher expression patterns than U373MG cell lines (Fig. 1D).
  • Fig. 1D As a result of quantitative analysis through mRNA qRT-PCR (Fig.
  • EDB-FN was significantly expressed in the U87MG cell line compared to the 2D cultured U373MG cell line ( p ⁇ 0.01, Welch's t test).
  • the 3D cultured U87MG cell line mimicking the tumor microenvironment showed higher EDB-FN expression ( p ⁇ 0.001, compared to the 2D cultured U87MG cell line, Welch's t test)
  • xenograft animal model showed the highest EDB-FN expression in ( p ⁇ 0.0001, compared with the 3D cultured U87MG cell line, Welch's t test).
  • PEG 2000 -DSPE Mai nano cell as compared to the same DDS in comparison with -DDS point to the measured size of the APT DLS- EDB -DSPE micelle nano -DDS decreased and, 1.0 wt% concentrations of 2.5 and 5.0 wt% concentration of APT EDB -
  • the increase in the measured size of APT EDB- DSPE micellar nano-DDS in DSPE indicates that the presence of APT EDB on the outer surface of micelles affects the morphological changes in micellar nano-DDS.
  • the zeta potential of each nano-DDS (the surface charge of nanoparticles can be inferred) was measured;
  • the zeta potential of PEG 2000- DSPE micellar nano-DDS was -9.3 ⁇ 1.1 mV, and the zeta potential of APT EDB- DSPE micellar nano-DDS treated with 1.0, 2.5, and 5.0 wt% of APT EDB-DSPE was - 9.5 ⁇ 0.7 mV, -10.4 ⁇ 1.3 mV, and -12.1 ⁇ 0.7 mV (Fig. 2C).
  • APT EDB -DSPE was added to a chloroform solution of Rh-DSPE mixed with PEG 2000 -DSPE at concentrations of 1.0, 2.5, and 5.0 wt% prior to lipid film formation.
  • the uptake efficacy of active target APT EDB- D SPE micellar nano-DDS in cancer cells was higher than that of passive/non-target PEG 2000- DSPE micellar nano-DDS ( FIG. 4A ).
  • APT EDB- DSPE micellar nano-DDS treated with APT EDB- DSP E at a concentration of 2.5 wt% showed the highest cellular uptake in U251MG cells (PEG 2000 -DSPE, 44.5 ⁇ 9.6; 1.0% APT EDB - DSPE, 76.4 ⁇ 8.1; 2.
  • APT EDB -DSPE 128.8 ⁇ 12.1; 5.0% APT EDB -DSPE, 53.4 ⁇ 5.1
  • APT EDB at a concentration of 1.0 wt% - APT EDB -DSPE micelles treated with DSPE Nano-DDS U87MG cells showed the highest cellular uptake (PEG 2000 -DSPE, 6.8 ⁇ 5.1; 1.0% APT EDB -DSPE, 165.7 ⁇ 3.7; 2.5% APT EDB -DSPE, 93.2 ⁇ 6.7; 5.0% APT EDB -DSPE, 56.7 ⁇ 7.9).
  • concentration of APT EBD- DSPE increased, it was more negative (Fig.
  • EDB-FN was knocked down in U87MG cells. EDB-FN expression in U87MG cells was significantly reduced after EDB-FN-siRNA treatment; On the other hand, EDB-FN expression in cells treated with control siRNA (control siRNA, 1.00 ⁇ 0.08; EDB-FN siRNA, 0.45 ⁇ 0.01; p ⁇ 0.01, Welch's t test) was constant ( FIG. 4A ). After treatment with the siRNA, there was no change in the absorption of the remaining amount of APT EDB-DSPE micellar nano-DDS.
  • EDB-FN as a molecular target for malignant gliomas
  • the loading capacity of each micelle nano-DDS was calculated to be 10 wt%, and the encapsulation efficiency was calculated to be about 95%.
  • Cell viability was evaluated using DSPE-DTX and APT EDB -DSPE-DTX ( FIG. 5B ). Although DTX inhibited the viability of U251MG and U87MG cells in DSPE-DTX and APT EDB-DSPE-DTX systems, the degree of inhibition was different.
  • APT EDB- DSPE micelle nano-DDS showed a significant increase in tumor localization compared to passive/non-target PEG 2000-DSPE micelle nano-DDS.
  • the increase in tumor localization was continuously observed from 15 min to 120 min (Fig. 6A). At 15 min, minimal nanoparticle accumulation was observed. After 30 min, higher accumulation started in the APT EDB- DSPE micellar nano-DDS group. After 60 min, the APT EDB -DSPE micelle nano-DDS group exhibited more accumulation at the tumor site than the PEG 2000-DSPE micelle nano-DDS group.
  • micellar nano-DDS tissue uptake of micellar nano-DDS was measured for 48 h (Fig. 7A). Passive/ untargeted PEG 2000- DSPE micellar nano-DDS gradually diffused throughout the body within 48 h. However, APT EDB- DSPE micellar nano-DDS remained stable and limited tumor sites. The above results indicate the stability and high malignant glioma-targeting ability of APT EDB-DSPE micelle nano-DDS. Since APT EDB- DSPE has high EDB-FN targeting ability, it has significantly increased retention time of APT EDB- DSPE micellar nano-DDS in malignant gliomas by binding to EDB-FN with high affinity. and thus had the bioavailability of the drug in increased tumors.
  • In vivo anticancer efficacy Validated in the U87MG subcutaneous xenograft animal model. The efficacy was assessed by comparing the trends of tumor growth in the control group, DSPE-DTX, and APT EDB -DSPE-DTX groups over time ( FIG. 6B ). In the control group, the tumor volume increased approximately 5.9-fold within 16 days (day 17) compared to the first day (day 1) (Day 1: 91.5 ⁇ 7.4 mm 3 vs. Day 17: 538.0 ⁇ 115.9 mm 3 ; p ⁇ 0.01, Welch's) t test). Tumor growth was significantly inhibited by treatment with DSPE-DTX or APT EDB-DSPE-DTX.
  • DSPE-DTX inhibited tumor growth by about 54.8% (Day 1: 87.9 ⁇ 12.6 mm 3 vs. Day 17: 281.7 ⁇ 29.4 mm 3 ; p ⁇ 0.001, Welch's t test)
  • APT EDB- DSPE-DTX significantly inhibited tumor growth by about 97.6% (Day 1: 87.5 ⁇ 12.6 mm 3 vs. Day 17: 97.8 ⁇ 2.6 mm 3 ; p ⁇ 0.20) , Welch's t test).
  • tumor volume did not differ significantly between groups.
  • the present invention relates to EDB-FN located on the surface of cancer cells and in the extracellular matrix. More specifically, the protein in the surface and extracellular matrix can be utilized as a useful target for drug delivery systems (DDSs), as well as a cancer diagnostic biomarker.
  • DDSs drug delivery systems
  • the present inventors performed in vitro and in vivo experiments including subcutaneous xenograft animal model experiments for verification.
  • BBTB to which the BBB is developed to prevent invasion of the central nervous system such as bacteria has a microphysiological pore size smaller than 12 nm.
  • the present inventors developed an ultra-small micelle ( ⁇ 12 nm) using DSPE polymer to improve drug delivery and attached APT EDB to the surface of the micelles, thereby providing a system that can be used for diagnosis and treatment of malignant glioma. crafted.
  • the drug delivery system was very large, including liposomes with a size of about 115 ⁇ 13 nm or superparamagnetic iron oxide nanoparticles with a size of 34 nm, but the present invention has greatly reduced it to small 12 nm micelles. (Fig. 2).
  • the present inventors quantitatively compared the correlation between the EDB-FN expression level and the prognosis of patients (FIG. 2) and verified the usefulness of the EDB-FN target in malignant gliomas (FIGS. 5 and 6).
  • EDB-FN overexpression and enhanced drug delivery by EDB-FN-targeted DDS were confirmed in monolayer cell culture as well as in orthotopic xenograft models, indicating that EDB-FN is expressed in malignant glioma cells and tissues, and nano-DDS is associated with or based on malignant gliomas via EDB-FN targets (Fig. 9).
  • the DTX dose for the orthotopic xenograft animal model was determined to be a total of 10 mg/kg, 33% less than 15 mg/kg for the flank xenograft animal model, taking into account the neurotoxicity of DTX, the flank model in the xenograft model showed significant anticancer efficacy.
  • the prepared EDB-FN-targeted micelle nano-DDS showed a significant therapeutic effect compared to the non-targeted micelle nano-DDS without statistically significant anticancer efficacy.
  • Specific binding to malignant glioma cells in brain APT EDB will increase the retention time of tumor APT EDB -DSPE micelle nano -DDS efficiently, exhibited excellent anti-cancer efficacy.
  • EDB-FN showed high expression specifically in malignant glioma tissues, but minimal expression in adjacent normal tissues and normal brain tissues. This property will help to increase the feasibility of using EDB-FN as a target ligand for the treatment of malignant gliomas.
  • the present invention relates to a micelle drug delivery system comprising a PEG 2000 -DSPE polymerized lipid and an APT EDB -PEG 2000 -DSPE polymer, wherein the drug delivery system is overexpressed in a brain tumor (brain tumor). Since it targets extradomain B of fibronectin (EDB-FN), it can pass through the blood-brain barrier (BBB) or blood-brain tumor barrier (BBTB) to deliver drugs specifically to brain tumor cells. Therefore, the composition comprising the drug delivery system of the present invention loaded with a drug such as a contrast agent or an anticancer agent as an active ingredient accumulates inside the brain tumor and can be incorporated into the tumor cells, so it is useful in the field of brain tumor diagnosis and treatment. possible.
  • a drug such as a contrast agent or an anticancer agent

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Dispersion Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Nanotechnology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Radiology & Medical Imaging (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 PEG2000-DSPE 중합지질 및 APTEDB-PEG2000-DSPE 중합체를 포함하는 마이셀 구조의 약물전달체 및 이의 제조방법에 관한 것이다. 상기 약물전달체는 뇌 종양(brain tumor)에서 과발현되는 섬유결합소 엑스트라도메인 B(extradomain B of fibronectin, EDB-FN)를 표적하는 바, 뇌혈관장벽(BBB) 또는 뇌혈관 종양 장벽(BBTB)를 통과하여 뇌 종양 세포 특이적으로 약물을 전달할 수 있다. 또한, 본 발명은 약물이 로딩된 상기 약물전달체를 유효성분으로 포함하는 뇌 종양 진단 또는 치료용 약학적 조성물을 제공할 수 있으며, 상기 조성물은 뇌 종양 내부에 축적되고 종양 세포 내부로 함입되어 특이적으로 종양 성장을 억제할 수 있는 바, 뇌 종양 진단 또는 치료에 유용하게 활용될 수 있다.

Description

암 및/또는 뇌질환 바이오마커인 EDB-FN 및 이를 표적하는 나노약물전달체
본 발명은 뇌 종양(brain tumor)에서 과발현되는 섬유결합소 엑스트라도메인 B(extradomain B of fibronectin, EDB-FN)를 표적으로 하는 나노약물전달체 등에 관한 것이다.
악성 뇌교종(malignant glioma, MG)은 적극적인 치료에도 낫기 어려운 무서운 종양 중 하나이다. 다형성교모세포종(glioblastoma multiforme, GBM)은 가장 악성이고 흔한 신경교종(glioma)으로서, 외과적 및 내과적 치료에도 생존 기간의 평균값이 2년 이하이다. 악성 뇌교종는 빠르게 증식하며, 침습성이 높을 뿐 아니라, 뇌혈관 장벽(blood-brain barrier)과의 세포 이질성(cellular heterogeneity) 및 뇌혈관 종양 장벽(blood-brain tumor barrier, BBTB)에 의해 치료가 어렵다. 상기 한계를 극복하기 위해, 뇌 종양 분류에 대한 분자적, 유전적 연구가 더욱 중요한 실정이다. 이는 병리학적 분류에 분자생물학을 접목하고, 진단적, 치료적 전략을 개선하는데 영향을 주었다.
현재 이용되는 대표적인 표현형-유전자형 진단 마커는 다음과 같다: O6-methylguanine-deoxyribonucleic acid (DNA) methyltransferase promoter (MGMT) methylation, isocitrate dehydrogenase-1 (IDH-1) mutation, 및 chromosomal 1p/19q deletion. 상기 마커들을 평가하는 것은 환자 개개인에 맞는 치료를 제안하고 예후를 예측하는데 큰 영향을 미친다. 또한, alpha-thalassemia/mental retardation syndrome X-linked 및 telomerase reverse transcriptase promoter mutations와 같은 많은 다른 바이오마커들은 아직 검증 중이며, 상기 마커들의 유효성은 활발히 입증되고 있다. 그러나, 지금까지 대부분 바이오마커들은 악성 뇌교종에서 평가 및 입증되어 치료제로 발전하지 못하는 실정이다. 따라서, 효과적인 진단 및 치료를 제공할 수 있는 바이오마커 발굴이 여전히 필요하다.
섬유결합소(fibronectin)는 세포외 기질(extracellular matrix) 및 원형질 막(plasma membrane)에서 주로 발견되는 당단백질(glycoprotein)이다. 이는 인테그린, 콜라겐, 및 피브린과 같은 다양한 세포외 기질 단백질에 결합하면서 세포 이동 및 부착(cell migration and adhesion)을 조절한다. 섬유결합소 단량체는 반복되는 유닛에 따라 세 가지 유형(type I, II 및 III)으로 분류된다. 섬유결합소 유전자의 세 영역에서 제조된 선택적 스플라이싱 도메인(alternative splicing domain)은 일정한 스플라이싱 패턴을 가진다. 생성된 동형 단백질(isoform)은 type III 반복 유닛에 위치한 스플라이싱 부위에 따라 명명된다: 섬유결합소의 엑스트라도메인 A(extra-domain A, EDA-FN), 엑스트라도메인 B(extra-domain B, EDB-FN), 및 type III 연결 부분(type III connecting segment, IIICS-FN). EDB-FN은 종양태아성 항원(oncofetal antigen)이다. EDB-FN은 비소세포폐암(non small cell lung carcinoma), 호지킨 림프종(Hodgkin lymphoma), 및 전립선암(prostate cancer)과 같은 다양한 인간 암에서 과발현된다. 또한, EDB-FN은 두경부암(head and neck cancer)의 신혈관생성 마커로 활용된다. 뇌에서 섬유결합소의 역할에도 불구하고, EDB-FN은 환자의 주요 다형성교모세포종을 진단하기 위한 추적 도구로 활용될 수 있음은 물론, 설치류 모델에서 다형성교모세포종 치료 및 신경교종 방사면역치료(radioimmunotherapy)의 신규 표적(target)으로 제안되었다. EDB-FN에 대한 연구가 활발히 이루어지고 있음에도 불구하고, EDB-FN의 역할은 여전히 밝혀지지 않았다.
종래에 모든 주요 기관의 암에서 EDB-FN 발현 수준을 비교하는 연구는 수행된 바 없으며, 생물정보학 데이터세트를 이용하여 EDB-FN 발현을 통한 예후 예측을 포함하는 연구는 아직 수행되지 않았다.
종래에 EDB-FN을 표적하는 특이적인 크기가 34 nm 크기 무기물 초상자석 산화철 나노입자(superparamagnetic iron oxide nanoparticles, SPIONs) 나노약물전달체 또는 115 ± 13 nm 크기 리포좀 구조의 약물전달체에 관한 연구가 수행되었으나, 12 nm 이상 크기 나노약물전달체의 경우 뇌혈관 장벽 및 뇌혈관 종양 장벽의 한계에 부딪혀 전임상에서부터 약물전달에 한계를 보인 결과가 보고된 바 있다. 따라서, 본 발명자들은 악성 뇌교종에 대한 잠재적인 진단 바이오마커로서 EDB-FN를 연구하고, 이를 표적하는 12 nm 이하 크기를 가진 마이셀 구조의 나노 약물 전달체를 개발함으로써 본 발명을 완성하였다.
본 발명이 이루고자 하는 기술적 과제는 PEG2000-DSPE 중합지질 및 APTEDB-PEG2000-DSPE 중합체를 포함하는 마이셀 구조의 약물전달체를 제공하는 것으로서, 상기 APTEDB는 섬유결합소 엑스트라도메인 B(extradomain B of fibronectin, EDB-FN) 유전자(FN1, Entrez Gene ID: 2335)에 특이적 결합력을 나타내는 앱타이드이다.
또한, 본 발명의 다른 목적은 약물이 로딩된 상기 약물전달체를 유효성분으로 포함하는 뇌 종양 진단 또는 치료용 약학적 조성물을 제공하는 것이다.
또한, 본 발명의 다른 목적은 하기 단계를 포함하는 뇌 종양 특이적 약물전달체의 제조방법을 제공하는 것이다.
(1) 시스테인 잔기를 포함하는 APTEDB 및 Mal-PEG2000-DSPE을 유기용매에 1:2 몰비율로 혼합하고 중합반응을 유도하는 단계;
(2) 상기 (1) 단계의 혼합 용액에서 APTEDB-PEG2000-DSPE 중합체를 수득하는 단계;
(3) 물, PBS, HBS 및 HBG로 이루어지는 군으로부터 1 종 이상 선택되는 용매에 상기 APTEDB-PEG2000-DSPE 중합체와 PEG2000-DSPE 중합지질을 혼합하여 마이셀 구조체 형성을 유도하는 단계; 및
(4) 상기 (3) 단계의 혼합 용액을 여과하고 마이셀 구조체를 정제하는 단계.
또한, 본 발명의 다른 목적은 상기 (1) 내지 (4) 단계를 포함하되, 상기 (3) 단계는 APTEDB-PEG2000-DSPE 중합체 및 PEG2000-DSPE 중합지질이 용해된 용액에 항암제를 추가로 혼합하여 마이셀 구조체 형성을 유도하는 것인, 뇌 종양 치료용 약제의 제조방법을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당해 기술분야의 통상의 기술자에게 명확하게 이해될 수 있을 것이다.
상기 과제를 해결하기 위하여, 본 발명은 PEG2000-DSPE 중합지질 및 APTEDB-PEG2000-DSPE 중합체를 포함하는 마이셀 구조의 약물전달체를 제공한다.
본 발명의 일 구현 예로서, 상기 APTEDB는 섬유결합소 엑스트라도메인 B(extradomain B of fibronectin, EDB-FN) 유전자(FN1, Entrez Gene ID: 2335)에 특이적 결합력을 나타내는 앱타이드이다.
본 발명의 다른 구현예로서, 상기 약물전달체는 PEG2000-DSPE 중합지질 100 중량부 기준으로 APTEDB- PEG2000-DSPE 중합체를 1 내지 2.5 중량부 포함하는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 약물전달체의 직경은 5.0 내지 12.0 nm이고, zeta potential은 -8.0 내지 -11.0일 수 있다.
본 발명의 또 다른 구현예로서, 상기 약물전달체는 뇌혈관장벽(blood-brain barrier, BBB) 또는 뇌혈관 종양 장벽(blood-brain tumor barrier, BBTB)을 통과하여 뇌 종양 세포 특이적으로 약물을 전달하는 것일 수 있다.
또한, 본 발명은 약물이 로딩된 상기 약물전달체를 유효성분으로 포함하는 뇌 종양 진단 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 약물이 로딩된 상기 약물전달체를 개체에 투여하는 단계를 포함하는 뇌 종양 예방 또는 치료 방법을 제공한다.
또한, 본 발명은 뇌종양 예방 또는 치료용 약제의 제조를 위한 상기 약물이 로딩된 약물전달체의 용도를 제공한다.
또한, 본 발명은 약물이 로딩된 상기 약물전달체를 개체에 투여하는 단계를 포함하는 뇌 종양의 진단 방법을 제공한다.
또한, 본 발명은 뇌 종양의 진단용 약제의 제조를 위한 상기 약물이 로딩된 약물전달체의 용도를 제공한다.
본 발명의 일 구현 예로서, 상기 약물은 조영제 또는 항암제이고, 상기 항암제는 도세탁셀(Docetaxel), 할라벤(Halaven), 빈크리스틴(Vincristine), 시스플라틴(cisplatin), 빈블라스틴(Vinblastine), 비노렐빈(Vinorelvine), 파클리탁셀(Paclitaxel), 에토포사이드(Etoposide), 토포테칸(Topotecan), 이리노테칸(Irinotecan), 닥티노마이신(Dactinomycin), 독소루비신(Doxorubicin), 다우노루비신(Daunorubicin), 미토마이신(Mitomycin), 글리벡(gleevec), 카보플라틴(carboplatin), 발루비신(valrubicin), 플로타미드(flutamide), 젬시타빈(gemcitabine), 블레오마이신(Bleomycin), 테모졸로마이드(Temozolomide), 프로카바진(Procarbazine), 로무스틴(Lomustine, CCNU; 1-(2-chloroethyl)-3-cyclohexyl-1-nitrosourea), 빈크리스틴(Vincristine) 및 카르무스틴(Carmustine, BCNU) 등으로 이루어진 군으로부터 선택되는 어느 하나 이상일 수 있다.
본 발명의 다른 구현예로서, 상기 뇌 종양은 성상세포종(astrocytoma), 다형성교모세포종(glioblastoma multiforme), 핍지신경교종(oligodendroglioma), 핍지교성상세포종(oligoastrocytoma), 상의세포종(ependymoma), 수모세포종(medulloblastoma), 혈관모세포종(hemangioblastoma), 뇌수막종(meningioma), 뇌하수체선종(pituitary adenoma), 두개인두종(craniopharyngioma), 및 맥락총유두종(choroid plexus papilloma)으로 이루어진 군으로부터 선택되는 어느 하나 이상일 수 있다.
또한, 본 발명은 하기 단계를 포함하는 뇌 종양 특이적 약물전달체의 제조방법을 제공한다.
(1) 시스테인 잔기를 포함하는 APTEDB 및 Mal-PEG2000-DSPE을 유기용매에 1:2 몰비율로 혼합하고 중합반응을 유도하는 단계;
(2) 상기 (1) 단계의 혼합 용액에서 APTEDB-PEG2000-DSPE 중합체를 수득하는 단계;
(3) 물, PBS, HBS 및 HBG로 이루어지는 군으로부터 1 종 이상 선택되는 용매에 상기 APTEDB-PEG2000-DSPE 중합체와 PEG2000-DSPE 중합지질을 혼합하여 마이셀 구조체 형성을 유도하는 단계; 및
(4) 상기 (3) 단계의 혼합 용액을 여과하고 마이셀 구조체를 정제하는 단계.
본 발명의 일 구현예로서, 상기 (1) 단계의 유기용매는 클로로포름, 다이메틸설폭사이드, 다이메틸포름아마이드, 에탄올, 메탄올, 테트라하이드로퓨란, 톨루엔, 자일렌 및 헥산으로 이루어진 군으로부터 선택되는 1종 이상일 수 있다.
본 발명의 다른 구현예로서, 상기 (1) 단계는 상온에서 12시간 동안 불활성 조건 유지하에 수행되는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 (2) 단계는 액체 크로마토그래피(liquid chromatography)를 이용하여 혼합 용액에서 APTEDB-PEG2000-DSPE 중합체를 수득하는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 (3) 단계는 APTEDB-PEG2000-DSPE 중합체와 PEG2000-DSPE 중합지질을 용매에 혼합하고 음파 파쇄를 수행하여 수화시켜 마이셀 구조체 형성을 유도하는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 (4) 단계는 0.0025~0.1 ㎛ membrane으로 혼합 용액을 여과하고, 크기 배제 크로마토그래피(size exclusion chromatography)를 통해 마이셀 구조체를 정제하는 것일 수 있다. 상기 membrane은 바람직하게는 0.1 ㎛ membrane일 수 있다.
또한, 본 발명은 상기 제조방법으로 제조된 뇌 종양 특이적 약물전달체로서, 5.0 내지 12.0 nm 직경을 갖고, -8.0 내지 -11.0의 zeta potential인 마이셀 구조체인 것을 특징으로 하는, 약물전달체를 제공한다.
또한, 본 발명은 상기 제조방법의 (1) 내지 (4) 단계를 포함하되, 상기 (3) 단계는 APTEDB-PEG2000-DSPE 중합체 및 PEG2000-DSPE 중합지질이 용해된 용액에 항암제를 추가로 혼합하여 마이셀 구조체 형성을 유도하는 것인, 뇌 종양 치료용 약제의 제조방법을 제공한다.
본 발명의 일 구현예로서, 상기 항암제를 최종 농도가 50 mg/mL가 되도록 혼합하는 것일 수 있다.
본 발명의 다른 구현예로서, 상기 약제는 뇌혈관장벽(blood-brain barrier, BBB) 또는 뇌혈관 종양 장벽(blood-brain tumor barrier, BBTB)을 통과하여 뇌 종양(brain tumor) 내부에 축적되고 종양 세포 내부로 함입되는 것일 수 있다.
본 발명은 PEG2000-DSPE 중합지질 및 APTEDB-PEG2000-DSPE 중합체를 포함하는 마이셀 구조의 약물전달체 및 이의 제조방법에 관한 것이다. 상기 약물전달체는 뇌 종양(brain tumor)에서 과발현되는 섬유결합소 엑스트라도메인 B(extradomain B of fibronectin, EDB-FN)를 표적하는 바, 뇌혈관장벽(BBB) 또는 뇌혈관 종양 장벽(BBTB)를 통과하여 뇌 종양 세포 특이적으로 약물을 전달할 수 있다. 또한, 본 발명은 약물이 로딩된 상기 약물전달체를 유효성분으로 포함하는 뇌 종양 진단 또는 치료용 약학적 조성물을 제공할 수 있으며, 상기 조성물은 뇌 종양 내부에 축적되고 종양 세포 내부로 함입되어 특이적으로 종양 성장을 억제할 수 있는 바, 뇌 종양 진단 또는 치료에 유용하게 활용될 수 있다.
도 1는 EDB-FN의 발현을 입증하기 위해, 악성 뇌교종 세포에서 EDB-FN의 과발현을 나타낸 것이다. (A)는 다양한 암 세포주의 2D 배양에서 EDB-FN 발현 패턴을 나타낸 것이다(크기 바 = 100 ㎛). 초록은 EDB-FN를 가리키고; 파랑은 4',6-diamidino-2-phenylindole (DAPI)를 가리킨다. (B)는 다양한 암의 2D 배양된 세포로부터 총 RNA를 추출한 후, 정량적인 실시간 PCR(qRT-PCR)을 이용하여 EDB-FN mRNA 발현 분석을 수행한 결과를 나타낸 것이다. 2-△△Ct가 사용되었고, 글리세르알데하이드 3-인산 탈수소효소(glyceraldehyde 3-phosphate dehydrogenase)를 내부 대조군으로 설정하였다. 3D 배양에서 면역 형광 염색을 통해 EDB-FN 발현 패턴을 확인하였다(크기 바 = 200 ㎛). (C)는 피하 이식된 암 조직을 나타낸 것이다(크기 바 = 100 ㎛). (D)는 악성 뇌교종 세포주를 나타낸 것이다. (E)는 U373MG 세포(2D 단일층 배양) 또는 U87MG 세포(2D 단일층 배양, 3D 회전 타원체 배양, 및 피하 종양 조직)로부터 추출한 총 RNA를 이용하여 qRT-PCR 분석을 수행한 결과이다. 통계학적 분석: Welch's t test. **p < 0.01, ***p < 0.001, ****p < 0.0001, ns: 통계학적으로 유의하지 않음. 상기 결과는 4중성 결정(quadruplet determinations)의 평균 ± 표준편차로 나타내었다. EDB-FN: 섬유결합소 엑스트라도메인 B; MG: 악성 뇌교종.
도 2는 합성 APTEDB--DSPE 마이셀 나노-DDS의 특성 분석을 나타낸 것이다. (A)는 Mal-PEG2000-DSPE과 cysteinylated APTEDB를 이용한 합성 방법 및 도세탁셀(docetaxel)로 캡슐화한 APTEDB-DSPE 마이셀 나노-DDS(APTEDB-DSPE-DTX) 대표적인 제제를 나타낸 것이다. (B)는 PEG2000-DSPE 마이셀 나노-DDS (APTEDB-unconjugated)과 APTEDB-DSPE 마이셀 나노-DDSs (APTEDB-conjugated)의 동적광산란(DLS) 크기 측정을 나타낸 것이며, 양 나노입자는 12 nm보다 작았다(3 replicates per group). (C)는 모든 나노입자 제제가 음의 zeta potetial을 가진다는 점을 나타낸 것이다. APTEDB-DSPE 농도가 증가함에 따라, 나노-DDS의 zeta potential은 더욱 음의 방향이 된다. 통계학적 분석 : Welch's t test. *p < 0.05, ns: 통계학적으로 유의하지 않음. 상기 결과는 4중성 결정(quadruplet determinations)의 평균 ± 표준편차로 나타내었다. DMSO: dimethyl sulfoxide; PEG2000-DSPE: polyethylene glycol (2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine (ammonium salt); Rh-DSPE: DSPE-N-(lissamine rhodamine B sulfonyl) (ammonium salt).
도 3은 EDB-FN 발현에 의한 APTEDB-DSPE 마이셀 나노-DDS의 In vitro 세포흡수를 나타낸 것이다. PEG2000-DSPE 및 APTEDB-DSPE의 흡수 실험 및 경쟁 분석은 (A) EDB-FN 고발현 세포(U87MG and U251) 및 (B) 저발현 세포(MCF7 및 B16F1)에서 수행하였다. Phosphate buffered saline을 대조군으로 비교하였다. PEG2000-DSPE, 및 APTEDB-DSPE는 APTEDB 처리하거나 처리하지 않고 세포주에 첨가되었으며 로다민 B-표지된 마이셀 DDS의 흡수(빨강)를 공초점 현미경으로 확인하였다(크기 바= 100 ㎛). APTEDB: EDB-FN-특이적 압타머 유사 팹타이드(aptide); APTEDB-DSPE: APTEDB-conjugated PEG2000-DSPE; PEG2000-DSPE: polyethylene glycol (2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine.
도 4는 APTEDB-DSPE 마이셀 나노-DDS의 In vitro EDB-FN- 및 시간-의존적 세포 흡수를 나타낸 것이다. (A)는 qRT-PCR을 통해 siRNA-매개 EDB-FN 녹다운을 확인한 것이다. 내부 대조군으로 GAPDH 발현을 사용하였다. 통계학적 분석: Welch's t test. **p < 0.01. 상기 결과는 삼중성 결정(triplicate determinations)의 평균 ± 표준편차로 나타내었다. (B)는 EDB-FN 발현에 따른 APTEDB-DSPE 마이셀 나노-DDS의 세포 흡수를 나타낸 것이다. 염색 이미지상 siRNA 형질주입된 U87 세포에서 EDB-FN (초록), 로다민 B-표지된 APTEDB-DSPE 마이셀 나노-DDS (빨강), 및 nuclei (파랑)을 나타낸다. 크기 바 = 100 ㎛. (C)는 U87MG 세포에서 APTEDB-DSPE 마이셀 나노-DDS의 시간-의존적 세포 흡수를 나타낸 것이다. 빨강: 로다민 B-표지된 APTEDB-DSPE 마이셀 나노-DDS, 파랑: DAPI, 크기 바 = 100 ㎛. NP: 나노입자.
도 5는 APTEDB-DSPE 및 APTEDB-DSPE-DTX 마이셀 나노-DDS의 In vitro 세포 흡수 및 세포 독성을 나타낸 것이다. (A)는 악성 뇌교종에서 APTEDB-DSPE의 농도에 따른 로다민 B fluorophore-표지된 나노-DDSs의 세포 흡수를 나타낸 것이다(왼쪽). 빨강: 나노-DDSs, 파랑: DAPI, 크기 바 = 100 ㎛. ImageJ을 통해 APTEDB-DSPE 마이셀 나노-DDS 세포 흡수의 수량화 분석(Quantification analysis)을 나타낸 것이다(오른쪽). 형광 강도는 각 세포주의 DAPI 신호로 정규화하였다(4중성 결정(quadruplet determinations)). (B)는 U251MG 및 U87MG 세포에서 DSPE-DTX 및 APTEDB-DSPE-DTX의 In vitro 세포독성을 나타낸 것이다. 나노-DDS 하 O.D. 값을 PBS 처리 하 O.D. 값으로 나눔으로써(DSPE-DTX의 경우 7 replicates, APTEDB-DSPE-DTX의 경우 6 replicates) Y축의 % 세포 생존능을 계산하였다. (C)는 치료하는데 사용한 나노입자의 종류에 따라 계산한(DSPE-DTX의 경우 7 replicates, APTEDB-DSPE-DTX의 경우 6 replicates) U87MG 및 U251MG 세포에서 IC50 값을 나타낸 것이다. 통계학적 분석 : Welch's t test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns: 통계학적으로 유의하지 않음. 상기 결과는 평균 ± 표준편차로 나타내었다. A.U: arbitrary unit. APTEDB-DSPE: APTEDB-conjugated PEG2000-DSPE; APTEDB-DSPE-DTX: DTX-loaded APTEDB-DSPE micellar nano-DDS; DSPE-DTX: DTX-loaded PEG2000-DSPE micellar nano-DDS; DTX: docetaxel; PEG2000-DSPE: polyethylene glycol (2000)-DSPE (ammonium salt).
도 6은 U87MG 피하 이종이식 마우스 모델에서 APTEDB--DSPE-DTX의 in vivo 흡수 및 항암 효능을 나타낸 것이다. (A)는 U87MG 이종이식 종양 보유 설치류 모델에서(n = 3 mice per group) PEG2000-DSPE 마이셀 나노-DDS 및 APTEDB-DSPE 마이셀 나노-DDS 흡수의 IVIS 로다민 B 실시간 이미지를 나타낸 것이다. 크기 바 = 10 mm. (B)는 약물 치료에 따른 U87MG 이종이식 종양 성장 곡선을 나타낸 것이다. 마우스에서 종양 크기를 3 일마다 측정하였다(n = 4 mice per group). 빨강 화살표는 drug IV infusion schedule을 나타낸 것이다. (C)는 마이셀 나노-DDS의 항암 효과를 나타낸 것이다. DSPE-DTX, APTEDB-DSPE-DTX, 또는 염분(saline) 처리에 따른 종양 크기 변화를 나타냈으며, 염분은 음성 대조군으로 비교하였다(n = 4 mice per group). (D)는 이종이식 모델로부터 절개한 종양의 대표적인 이미지를 나타낸 것이다. 약물 처리한 마우스를 각각 7, 10, 14, 및 17 일째에 희생하였다(n = 1 mouse per group). 크기 바 = 10 mm. U87MG 피하 이종이식 마우스 모델에서, (E)는 동소 모델의 실험 스케줄을 나타낸 것이고, (F)는 악성 뇌 종양에서 마이셀 나노-DDS의 저해 효과를 나타낸 것이다(n = 4 per group). 각 검체에서 가장 큰 종양 부피의 뇌 슬라이스를 선별하고 분석하였다. (G)는 뇌 종양 크기의 비교를 나타낸 대표적인 이미지이다. 마우스 뇌는 20 ㎛의 두께로 절단하였고, 뇌 종양은 H&E 염색으로 나타내었다. 크기 바 = 1 mm. 통계학적 분석 : Welch's t test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns: 통계학적으로 유의하지 않음. 상기 결과는 평균 ± 표준편차로 나타내었다. APTEDB-DSPE-DTX: docetaxel-loaded APTEDB-DSPE micellar nano-DDS; DDS: drug delivery system; DSPE-DTX: docetaxel-loaded PEG2000-DSPE micellar nano-DDS; DTX: docetaxel; nano DDS Tx: nano drug delivery system treatment.
도 7은 APTEDB-DSPE-DTX의 in vivo 생체적합성을 나타낸 것이다. (A)는 APTEDB-DSPE-DTX의 암 표적 능력을 나타낸 것이다. 각 U87MG 옆구리 이종이식 마우스에(n = 3 mice per group) PEG2000-DSPE 마이셀 나노-DDS 또는 APTEDB-DSPE 마이셀 나노-DDS를 주입하였고, 미리 지정된 시간(6, 12, 24, 및 48 시간)에, IVIS in vivo 이미징 시스템을 이용하여 로다민 B-표지된 마이셀의 종양 흡수를 비교하였다. 크기 바 = 1 cm. (B)는 정상 주요 기관에 미치는 마이셀 나노-DDS의 최소 독성을 나타낸 것이다. 실험 마지막에(day 17, 종양 부피가 80-120 mm3일 때), U87MG 옆구리 이종이식 모델로부터 심장, 간, 비장, 폐, 및 신장을 추출하였고, H&E 염색을 수행하였다. 크기 바 = 100 ㎛. (C)는 U87MG 피하 이종이식 모델에서(왼쪽, n = 3 mice per group), 마우스 체중에 미치는 마이셀 나노-DDS의 최소 독성을 나타낸 것이다. 실험에서, 마우스의 체중을 매일 측정했으며, 마우스의 초기 및 최종 체중을 그래프로 나타내었다. 통계학적 분석 : Welch's t test. *p < 0.05. 상기 결과는 평균 ± 표준편차로 나타내었다. APTEDB-DSPE-DTX: docetaxel-loaded APTEDB-DSPE micellar nano-DDS; DSPE-DTX: docetaxel-loaded PEG2000-DSPE micellar nano-DDS.
도 8은 동소 이종이식 모델에서 EDB-FN 발현을 나타낸 것이다. 보다 구체적으로 동소 이종이식된 뇌 종양에서 EDB-FN의 발현을 나타낸 것이다. 모델 마우스에 염분(대조군), DSPE-DTX, 또는 APTEDB-DSPE-DTX 마이셀 나노-DDS를 2 주간 주입하였다. 마우스 뇌는 20 ㎛의 두께로 절개하였다. (A)는 EDB-FN (초록) 및 Nuclei (파랑)으로 IHC 이미지를 나타내었다. 크기 바 = 1 mm. (B)는 종양 부위의 확대 이미지를 나타낸 것이다. 크기 바 = 100 ㎛. APTEDB-DSPE-DTX: docetaxel-loaded APTEDB-DSPE micellar nano-DDS; DSPE-DTX: docetaxel-loaded PEG2000-DSPE micellar nano-DDS.
도 9는 EDB-FN의 잠재적 바이오마커로서 임상적 중요성 및 악성 뇌교종의 표적 리간드로서 실현가능성을 나타낸 것이다.
본 발명자들은 뇌 종양(brain tumor)에서 과발현되는 섬유결합소 엑스트라도메인 B(extradomain B of fibronectin, EDB-FN)에 대해 예의 연구한 결과, EDB-FN을 표적하는 나노약물전달체를 개발하여 본 발명을 완성하였다.
보다 구체적으로, 중합지질인 PEG2000-DSPE로 형성된 마이셀 나노 제제보다 APTEDB : PEG2000-DSPE = 1:2로 포함하는 APTEDB-DSPE 마이셀 나노 제제가 EDB-FN 친화력이 높아 뇌 종양에서 세포 흡수율이 더 높으며, 종양 내에 많이 축적될 수 있다는 점, 상기 나노 제제가 12 nm 이하로서 뇌혈관 종양 장벽을 용이하게 투과할 수 있다는 점, 상기 나노제제를 포함하는 나노약물전달체는 종양 억제 효과가 높고 정상 조직 및 다른 기관에 영향을 미치지 않아 항암 효능이 높은 것을 확인하였다.
본 발명에서, 용어 "앱타이드(aptide)"는 표적에 대한 친화도는 유지하면서 안정성이 개선된 앱타머 유사 펩타이드(aptamer-like peptide)를 의미한다. 상기앱타이드는 환형의 β-헤어핀 기반의 펩타이드 바인더로 구성된 스캐폴드와 상기 스캐폴드의 양 말단에 n개의 아미노산이 포함되는 구성으로, 이는 특정 생물학적 표적과 결합할 수 있다.앱타이드는 다양한 라이브러리 구축이 가능한 표적 결합 부위(target-binding region)를 포함할 수 있다. 상기앱타이드는 L-아미노산 및 D-아미노산으로 구성된 군으로부터 선택되는 어느 하나 이상의 아미노산으로 구성될 수 있다. 상기용어, "안정성"은앱타이드의 물리적, 화학적 및 생물학적 안정성을 포함할 수 있고, 구체적으로는 생물학적 안정성을 의미할 수 있다. 즉, 생물학적으로 안정한앱타이드는 생체 내에서 단백질 분해효소의 작용에 대한 내성을 가질 수 있다.
본 발명에 따른앱타이드는 EDB-FN 유전자(Entrez Gene ID: 2335)에 특이적으로 결합하는앱타이드이고, 구체적으로 서열번호 1로 기재되는 아미노산 서열로 구성될 수 있다. 상기 아미노산 서열은 리신(K)에 시스테인(C) 잔기가 붙어있는 것을 특징으로 할 수 있다(도 2A). 상기 EDB-FN에 대한앱타이드는 3 kDa의 크기로 안정적이며, EDB-FN에 대해 < 100 nM의 높은 친화도로 결합할 수 있다.
APTEDB 아미노산 서열 N'-CSSPIQGSWTWENGK(C)WTWGIIRLEQ-C' 서열번호 1
상기앱타이드는 본 발명에 따른앱타이드의 구조 및 활성에 영향을 미치지 않는 범위 내에서 아미노산 잔기의 결실, 삽입, 치환 또는 이들의 조합에 의해 상이한 서열을 갖는앱타이드의 변이체 또는 단편일 수 있다. 분자의 활성을 전체적으로 변경시키지 않는 단백질 또는 펩타이드에서의 아미노산 교환은 통상의 기술분야에 공지되어 있다. 경우에 따라서는 인산화, 황화, 아크릴화, 당화, 메틸화, 파네실화 등으로 수식될 수 있다. 상기앱타이드는 서열번호 1로 기재되는 아미노산 서열과 70, 80, 85, 90, 95 또는 98%의 상동성을 가질 수 있다.
본 발명에서, 용어"약물전달체"는 표적 세포, 조직, 또는 기관에 활성 성분(예를 들어, 약물)과 화학적 또는 물리적으로 결합된 복합체로서, 상기 활성 성분을 운반 및전달하기에 적합한 담체 또는 비히클을 의미한다. 상기 화학적 결합은 화학반응을 통한 화학결합을 의미하고, 물리적인 결합은 흡착(adsorption), 응집(coheison), 사슬엉킴(entanglement), 잡힘(entrapment) 등과 같은 물리적 고정뿐만 아니라 반데르 발스 결합과 같은 전기적 상호작용이 그 단독으로 또는 상기 물리적 고정과 함께 작용하여 발생하는 비화학적 고정을 포함하는 개념이다.
본 발명에서,용어"나노약물전달체"란 상기 약물전달체가 약 1나노미터(nm) 내지 약 1000 nm의 크기 범위를 가지는 것을 의미한다. 상기나노약물전달체는 약제학적으로 허용가능한 담체일 수 있다.
상기 용어"약물"은 약리활성을 가지는 것으로서 폴리펩타이드, 단백질 등을 포함하며, 본 발명에서는 바람직하게 조영제 또는 항암제를 의미한다. 상기 항암제의 구체적인 예로는 도세탁셀(Docetaxel), 할라벤(Halaven), 빈크리스틴(Vincristine), 시스플라틴(cisplatin), 빈블라스틴(Vinblastine), 비노렐빈(Vinorelvine), 파클리탁셀(Paclitaxel), 에토포사이드(Etoposide), 토포테칸(Topotecan), 이리노테칸(Irinotecan), 닥티노마이신(Dactinomycin), 독소루비신(Doxorubicin), 다우노루비신(Daunorubicin), 미토마이신(Mitomycin), 글리벡(gleevec), 카보플라틴(carboplatin), 발루비신(valrubicin), 플로타미드(flutamide), 젬시타빈(gemcitabine), 블레오마이신(Bleomycin), 테모졸로마이드(Temozolomide), 프로카바진(Procarbazine), 로무스틴(Lomustine, CCNU; 1-(2-chloroethyl)-3-cyclohexyl-1-nitrosourea), 빈크리스틴(Vincristine) 또는 카르무스틴(Carmustine, BCNU) 등을 포함하나, 이에 제한되지 않는다.
본 발명에서 용어, "예방"은 본 발명의 조성물의 투여로 암의 발생, 확산 또는 재발을 억제시키거나 지연시키는 모든 행위를 의미하고, "치료"는 본 발명의 조성물의 투여로 상기 질환의 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 발명에서 "진단"은 특정 질병 또는 질환에 대한 한 개체의 감수성(susceptibility)을 판정하는 것, 한 개체가 특정 질병 또는 질환을 현재 가지고 있는지 여부를 판정하는 것, 특정 질병 또는 질환에 걸린 한 개체의 예후(prognosis)를 판정하는 것, 또는 테라메트릭스(therametrics)(예컨대, 치료 효능에 대한 정보를 제공하기 위하여 개체의 상태를 모니터링하는 것)을 포함한다.
본 발명에서 용어, "약학적 조성물"은 질병의 예방 또는 치료를 목적으로 제조된 것을 의미하며, 각각 통상의 방법에 따라 다양한 형태로 제형화하여 사용될 수 있다. 예컨대, 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽 등의 경구형 제형으로 제형화할 수 있고, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다.
본 발명에서, "유효성분으로 포함"은 원하는 생물학적 효과를 실현하는데 필요하거나 또는 충분한 양으로 해당 성분이 포함되는 것을 의미한다 실제 적용에 있어서 유효 성분으로 포함되는 양의 결정은 대상 질병을 치료하기 위한 양으로서, 다른 독성을 야기하지 않는 사항을 고려해서 결정될 수 있으며, 예를 들어 치료되는 질병 또는 병태, 투여되는 조성물의 형태, 피험체의 크기, 또는 질병 또는 병태의 심각도 등과 같은 다양한 인자에 따라서 변화될 수 있다 본 발명이 속하는 분야에서 통상의 기술을 지닌 기술자라면 과도한 실험을 동반하지 않고 개별적 조성물의 유효량을 경험적으로 결정할 수 있다.
본 발명의 조성물은 목적하는 방법에 따라 약학적으로 유효한 양으로 경구 투여하거나 비경구 투여할 수 있으며, 본 발명의 용어 "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분하며 부작용을 일으키 지 않을 정도의 양을 의미하며, 유효용량 수준은 환자의 건강상태, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 방법, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 배합 또는 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
따라서, 본 발명의 약학적 조성물을 개체에 투여하여 뇌 종양(brain tumor)을 예방, 치료, 및/또는 진단할 수 있으며, 상기 '뇌 종양(brain tumor)'은 악성이거나 양성이든지 관계없이 모든 신생 세포 성장 및 증식을 나타내는 모든 전암(pre-cancerous) 세포 및 암 세포를 칭하며, 바람직하게는 악성 뇌교종(malignant glioma)를 의미한다. 비제한적인 예로서 성상세포종(astrocytoma), 다형성교모세포종(glioblastoma multiforme), 핍지신경교종(oligodendroglioma), 핍지교성상세포종(oligoastrocytoma), 상의세포종(ependymoma), 수모세포종(medulloblastoma), 혈관모세포종(hemangioblastoma), 뇌수막종(meningioma), 뇌하수체선종(pituitary adenoma), 두개인두종(craniopharyngioma), 또는 맥락총유두종(choroid plexus papilloma)일 수 있다.
본 발명에서 용어, "개체"는 쥐, 가축, 생쥐, 인간 등 포유류일 수 있으며, 바람직하게는 인간일 수 있다.
본 발명의 약학적 조성물은 개체에 투여를 위한 다양한 형태로 제형화 될 수 있으며, 비경구 투여용 제형의 대표적인 것은 주사용 제형으로 등장성 수용액 또는 현탁액이 바람직하다. 주사용 제형은 적합한 분산제 또는 습윤제 및 현탁화제를 사용하여 당업계에 공지된 기술에 따라 제조할 수 있다. 예를 들면, 각 성분을 식염수 또는 완충액에 용해시켜 주사용으로 제형화 될 수 있다. 또한, 경구 투여용 제형으로는 예를들면 섭취형 정제, 협측 정제, 트로키, 캡슐, 엘릭시르, 서스펜션, 시럽 및 웨이퍼 등이 있는데, 이들 제형은 유효성분 이외에 희석제 (예: 락토즈, 덱스트로즈, 수크로즈, 만니톨, 솔비톨, 셀룰로즈 및/또는 글리신)와 활탁제(예: 실리카, 탈크, 스테아르산 및 그의 마그네슘 또는 칼슘염 및/또는 폴리에틸렌 글리콜)를 포함할 수 있다. 상기 정제는 마그네 슘 알루미늄 실리케이트, 전분페이스트, 젤라틴, 트라가칸스, 메틸셀룰로즈, 나트륨 카복시메틸셀룰로즈 및/또는 폴리비닐피롤리딘과 같은 결합제를 포함할 수 있으며, 경우에 따라 전분, 한천, 알긴산 또는 그의 나트륨 염 과 같은 붕해제, 흡수제, 착색제, 향미제 및/또는 감미제를 추가로 포함할 수 있다. 상기 제형은 통상적인 혼합, 과립화 또는 코팅 방법에 의해 제조될 수 있다.
또한, 본 발명의 약학적 조성물은 방부제, 수화제, 유화 촉진제, 삼투압 조절을 위한 염 또는 완충제와 같은 보조제와 기타 치료적으로 유용한 물질을 추가로 포함할 수 있으며, 통상적인 방법에 따라 제제화 될 수 있다.
본 발명에 따른 약학적 조성물은 경구, 경피, 피하, 정맥 또는 근육을 포함한 여러 경로를 통해 투여될 수 있으며, 활성 성분의 투여량은 투여 경로, 환자의 연령, 성별, 체중 및 환자의 중증도 등의 여러 인자에 따라 적절히 선택될 수 있다. 또한, 본 발명의 조성물은 목적하는 효과를 상승시킬 수 있는 공지의 화합물과도 병행하여 투여할 수 있다.
본 발명에서, 용어'동물모델'은 사람의 질병과 아주 유사한 형태의 질병을 가진 동물을 말한다. 사람의 질병 연구에 있어 질환모델 동물이 의미를 갖는 것은 사람과 동물들 간의 생리적 또는 유전적인 유사성에 의한다. 질병 연구에 있어 생체의학 질환모델 동물은 질병의 다양한 원인과 발병과정 및 진단에 대한 연구용 재료를 제공해주고, 질환모델 동물의 연구를 통해 질병에 관련된 유전자들을 알아내고, 유전자들 간의 상호작용을 이해할 수 있게 하고, 개발된 신약후보물질의 실제 효능 및 독성 검사를 통해 실용화 가능성의 여부를 판단하는 기초 자료를 얻을 수 있다. 상기 용어 "동물" 또는 "실험동물"은 인간 이외의 임의의 포유류 동물을 의미한다. 상기 동물은 배아, 태아, 신생아 및 성인을 포함하는 모든 연령의 동물을 포함한다. 본 발명에서 사용하기 위한 동물들은, 예를 들어, 상업용 소스로부터 이용할 수 있다. 이런 동물들은 실험용 동물 또는 다른 동물, 토끼, 설치류(예를 들어, 생쥐, 쥐, 햄스터, 게르빌루스 및 기니피그), 소,양, 돼지, 염소, 말, 개, 고양이, 새(예를 들어, 닭, 칠면조, 오리, 거위), 영장류(예를 들어, 침팬지, 원숭이, 붉은털원숭이)를 포함하나 이에 한정되지 않는다.
본 발명에서, 용어'배양'은 생물체나 생물체의 일부(기관 ·조직 ·세포 등)를 적당히 인공적으로 조절한 환경조건에서 생육시키는 일로써, 이 경우 외적 조건으로 온도 ·습도 ·빛 ·기체상의 조성(이산화탄소나 산소의 분압) 등이 중요하며, 그 밖에 배양되는 생물체에 가장 중요한 직접적인 영향을 주는 것은 배지(배양기)로, 그 생물체의 직접적인 환경인 동시에 생존이나 증식에 필요한 각종 영양소의 공급장이다.
본 발명에서,용어'체외배양'은 세포 등이 체내에서 자라는 상태와 구분되는 방법으로 실험실의 인큐베이터(incubator)에서 체내의 환경과 유사한 조건으로 배양하는 일련의 실험실 과정을 의미하는 것이다.
본 발명에서,용어'배지' 또는 '배지 조성물'은 당, 아미노산, 각종 영양물질, 혈청, 성장인자, 무기질 등의 세포의 성장 및 증식 등에 필수적인 요소를 포함하는 생체 외에서 세포 등의 성장 및 증식을 위한 혼합물을 말한다.
본 발명은 다양한 변환을 가할 수 있고 여러 가지 실시예를 가질 수 있는 바, 이하 특정 실시예들을 도면에 예시하고 상세한 설명에 상세하게 설명하고자 한다. 그러나, 이는 본 발명을 특정한 실시 형태에 대해 한정하려는 것이 아니며, 본 발명의 사상 및 기술 범위에 포함되는 모든 변환, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다. 본 발명을 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 본 발명의 요지를 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다.
실시예 1. 유전자 발현 프로파일(gene expression profile) 및 생존 분석(survival analysis)
모든 유전자 발현 프로파일은 Oncopression으로부터 내려받았으며, EDB-FN 관련 데이터는 FN 또는 ED-B로도 알려진 섬유결합소 1(fibronectin 1, FN1, Entrez Gene ID: 2335)을 연구함으로써 수집하였다. FN1 유전자의 변이체는 ClinVar(https://www.ncbi.nlm.nih.gov/clinvar)를 사용하여 조사했으며, 126개의 변이체가 확인되었다. 악성 뇌교종에서 발현 수준을 스크리닝하기 위해, 전사체학 데이터베이스 분석을 수행했기 때문에, 변이체의 분석은 본 발명에서 수행되지 않았다. EDB-FN의 전사체학 발현 수준은 Single Channel Array Normalization and Universal exPression Codes(SCAN.UPC) package of R로 정규화하였고, UPC 값으로 나타내었다. 보다 구체적으로, Oncopression 데이터를 위해 단일 샘플 정규화 방법(single sample normalization method)를 사용했으며, 모든 샘플은 Affymetrix Human Genome U133 Plus 2.0 (GPL570 or A-AFFY-44) platform으로부터 받았다. 발현 값은 0.0 내지 1.0으로 나타내었으며, 1.0은 완전히 전사 활성화된 경우를 나타낸다. 정상세포 대비 암세포의 비율(cancer-to-normal ratio)은 암세포에서 발현 값을 정상 세포에서 평균 발현 값으로 나누어 계산하였다. 생존 분석을 위해, 발현 프로파일 및 환자 예후 정보를 포함한 뇌 종양 데이터세트를 수집한 후, 30개 이하의 샘플은 분석에서 제외하였다. 모든 유전자 발현 값은 데이터세트에 의해 퀀타일 정규화(quantile normalization)되었다. Z-value는 각 데이터세트로 로그순위 검정(log-rank test)하여 계산하였고, 체중으로서 각 데이터세트의 환자 수의 제곱근을 이용하여 Lipt
Figure PCTKR2021002008-appb-I000001
k method로 평균을 내었다.
실시예 2. 환자 조직 마이크로어레이(tissue microarray, TMA) 샘플 제조 및 해석
환자 조직 샘플은 수술 및 병리학적 진단 후 파라핀 블록(paraffin block)에 보관하였으며, 상기 환자는 성인 21명으로, 연령 18세부터 75세이며, 다형성교모세 포종으로 진단받았다. 각 환자별로 3 ~4가지의 다른 종양 부위로부터 총 65개의 조 직 샘플을 포함하는 조직 마이크로어레이 슬라이드를 제조하였다. 조직 심(tissue core)은 직경 2 mm로 각 블록별로 45개의 구멍을 포함하는 피이식자 파라핀 블 록(recipient paraffin block)으로 이식되었다. 파라핀으로 채워진 상기 블록을 3 ㎛ 두깨로 잘라 슬라이드 위에 두었다. 이후 상기 조직을 후술할 면역 조직 화 학(immunohistochemistry) 부분에 기재한 바와 같이 염색하였다. 면역 염색 후, 병 리학자로부터 맹목적 재검토(blind review)를 통한해 EDG-FN 존재 및 수준에 대한 판독을 받았다. 염색 강도는 none 또는 '1+'(매우 약한 양성) 부터 '4+'(매우 강한 양성)으로 나타내었다. 본 발명에서, '1+' 및 '2+'는 저발현군(low-expression group)으로, '3+' 및 '4+'는 고발현군(high-expression group)으로 분류하였다. EDB-FN 발현과 환자의 예후 예측간의 상관관계를 분석하기 위해 환자 조직 마이크 로어레이에서 EDB-FN 발현 수준의 결과와 각 환자의 임상적 데이터를 연결시키는 작업을 수행하였다. 변수로서 무진행 생존기간(progression-free survival, PFS) 및 전체 생존기간(overall survival, OS)을 이용하여 환자 예후를 분석하였다.
실시예 3. 재료(materials)
Polyethylene glycol (2000)-1,2-distearo yl-sn-glycero-3-phosphoethanolamine (ammonium salt) (PEG 2000-DSPE), DSPE-N-(lissamine rhodamine B sulfonyl ) (ammonium salt) (Rh-DSPE), and N-maleimide-PEG2000-DSPE (ammonium salt) (Mal-PEG2000-DSPE)은 Avanti Polar Lipids (CA, USA)로부터 구매하였다. EDB- FN-특이적 펩타이드 N'-CSSPIQGSWTWENGK(C)WTWGIIRLEQ-C' 는 Anygen Corp. (Gwangju, Republic of Korea)에서 주문 제작하였다. mouse anti-EDB-FN antibody 및 anti-mouse fluorescein isothiocyanate (FITC)-conjugated secondary antibody 는 Abcam (Cambridge, UK)로부터 구매하였다. Docetaxel (DTX) 및 Sepharose CL-4B columns은 Sigma-Aldrich (MO, USA)로부터 구매하였으며, mounting solution은 Dako Diagnostics (Glostrup, Denmark)에서 구매하였고, an Alamar Blue assay kit 는 Thermo Fisher Scientific (MA, USA)에서 구매하였다. 모든 시약은 laboratory grade이며, 제공받은대로 사용하였다.
실시예 4. 세포 배양
U87MG, U251MG, U373MG, MCF-7, PC3, B16F10, 및 B16F1 세포는 American Type Culture Collection (VA, USA)에서 구매하였다. 모든 세포는 습도 5% CO2 환경 에서 37 ℃를 유지하였다. 세포는 10% fetal bovine serum (FBS; Gibco, IL, USA), 100 U/mL penicillin (Gibco), 및 100 ㎍/mL streptomycin (Gibco)을 첨가 하여 minimal essential medium (MCF-7), RPMI (PC3, B16F10, B16F1), 또는 Dulbecco's modified Eagle's medium (U87MG, U251MG, U373MG)에서 배양하였다. 상 기 모든 세포 배양 배지는 Gibco에서 구매하였다.
실시예 5. In vitro 3D 회전 타원체 배양(spheroid culture)
3D 회전 타원체 배양을 위해 , 모든 세 악성 뇌교종 세포주(U87MG, U251MG, and U373MG)를 웰(we ll) 당 1-5 Х 103 세포(cell)로 Nunclon Sphera Microplate 96-well round bottom plate (Thermo Fisher Scientific)에서 배양하였다. 상기 플 레이트(plate)를 2 분동안 200 x g로 원심분리한 후, 37 ℃, 5% CO2 배양기에 두었 다. 상기 세포는 6 일동안 배양하였으며, 3 일째에 배지의 절반을 변경하였다. 이 미징을 위해, 형성된 회전 타원체를 4% (w/v) paraformaldehyde (Wako, VA, USA)로 고정된 8-well chambered coverglass slide (Thermo Fisher Scientific)로 옮겼으 며, 이후 후술할 면역 세포 화학(immunocytochemistry)이 수행되었다.
실시예 6. In vivo EDB-FN 면역 세포 화학을 위한 악성 뇌교종 옆구리 이종 이식(MG flank xenograft) 모델
옆구리 피하 이종이 식(flank subcutaneous xenograft) 마우스 모델(n = 1 mouse per gr oup)을 형성하기 위해 BALB/c nude 마우스의 오른쪽 옆구리에 마우스 당 5 X 106 세포로 U87MG, U251MG, 및 U373MG 세포를 주입하였다. 종양이 80-120 mm3의 부피가 되면, 마우스를 희생하고, 잘라낸 종양의 면역 세포 화학을 수행하였 다.
실시예 7. 실시간 정량 역전사-중합효소 연쇄 반응(Real-time quantitive reverse transcription-pol ymerase chain reaction)
세포를 수집하고, RNA is olation kit (GeneAll, Seoul, Republic of Korea)를 이용하여 Ribo Ex로 리보핵산(ribonucleic acid, RNA)를 추출하였다. 각 샘플로부터 총 1 ㎍의 RNA를 이용하여 역전사(reverse transcription)로 상보적 DNA(complementary DNA, cDNA)를 합성하였다. 그 결과 하기의 유전자가 추정되었 다: EDB-FN 유전자 (정방향 프라이머: 5′- AACTCACTGACCTAAGCTTT -3′; 역방향 프 라이머: 5′- CGTTTGTTGTGTCAGTGTAG-3′); 및 글리세프알데하이드 3-인산 탈수소효 소(glyceraldehyde 3-phosphate dehydrogenase) 유전자 (정방향 프라이머: 5′- AATCCCATCACCATCTTCCA- 3' ; 역방향 프라이머: 5′-TGGACTCCACGACGTACTCA-3′). 중 합효소 연쇄 반응 프로토콜은 다음과 같다: 94 ℃에서 5 분간 최초 변성 단 계(initial denaturation step); 94 ℃에서 1 분간 변성, 55 ℃에서 1 분간 프라 이머 결합(annealing), 및 72 ℃에서 2 분간 신장(extension)을 30 회 반복하는 단계; 및 72 ℃에서 7 분간 최종 신장하는 단계. 4 μL의 초순수수(ultrapure water)에 1 ㎍의 cDNA를 첨가하고, 실시간 중합효소연쇄반응 (real-time polymerase chain reaction) (Qiagen, Tokyo, Japan) 수행 전에 5 μL의 SYBR Green real-time mixture (Takara, Tokyo, Japan)을 첨가하였다. 2-△△Ct method를 이용하여 각 유전자의 메신저 RNA(messenger RNA, mRNA) 수준을 정량화하고, 글리 세르알데하이드 3-인산 탈수소효소의 메신저 RNA로 정규화하였다.
실시예 8. 세포 및 조직 염색(cell and tissue staining)
8.1. 면역 세포 화학(immunocytochemistry)
7 개의 상 이한 세포주를 2D 염색하기 위해, 염색 전에 8-well chambered 커버 글라스 슬라이드에 24 시간동안 10,000개의 세포를 배양하였다. 3D 염색을 위해, 회전 타원체(spheroids)를 배양된 디쉬로부터 8-well chambered 커버글라스 슬라이 드로 옮겼다. 상기 배양된 세포는 cold phosphate buffered saline (PBS; Welgene, Gyeongsan, Republic of Korea)으로 세 번 세척한 후, 실온에서 15 분간 4% (w/v) paraformaldehyde로 고정하고, PBS로 세척했으며, 0.1% (v/v) Triton X-100 (Amresco, PA, USA)/PBS 로 10 분간 투과하고, 4℃ 에서 밤새도록 1% (w/v) bovine serum albumin (BSA; Millipore, MA, USA)/0.1% (v/v) Triton X-100/PBS에 서 primary antibody against EDB-FN (ab154210, 1:500 for 2D, 1:100 for 3D; Abcam)로 배양하였다. PBS로 세척한 후, 면역-표지된 단백질을 fluorescence- conjugated secondary antibodies를 실온에서 60 분간 처리하여 시각화하였다. 세 포는 PBS로 세척한 후 4',6-diamidino-2-phenylindole (DAPI) mounting medium (Vector laboratories, CA, USA)으로 봉입하고, 커버슬립(cover slips)으로 밀봉시 킨 후, 공초점 레이저 스캐닝 현미경(confocal laser scanning microscope) (LSM 700; Carl Zeiss, NY, USA)을 이용하여 검사하였다.
8.2. 파라핀 첨가된 조직 마이크로어레이 및 동물 샘플의 면역 조직 화 학(immunohistochemistry)
EDB-FN의 염색 정도는 환자 조직 샘플에 대해 조직 마이크로어레이를, 피하 이종이식 동물 조직 샘플에 대해 면역 조직 화학을 적용하여 분석하였다. 조직 마이크로 어레이 슬라이드를 55 ℃에서 30분간 가열하여 밀랍을 제거한 후, 5 분간 세 번 세척하고, 100, 95, and 80% (v/v) ethanol로 5 분간 세척하여 연속적으로 순수한 증류수가 되도록 재수화(rehydration)하였다. 10 mM sodium citrate (pH 6.0)에서 95 ℃, 30 분간 구간을 가열함으로써 항원 회수(antigen retrieval)하였 다. 3% (w/v) hydrogen peroxide에서 30 분간 배양함으로써 내생적인 퍼옥시데이스 활성(endogenous peroxidase activity)을 저해하였다. 실온에서 30 분간 universal blocking serum (Dako Diagnostics)을 이용하여 기본 반응성(background reactivity)를 제거하였다. 슬라이드에 EDB-FN에 특이적인 항체 (orb227981, 1:50; Biorbyt, Cambridge, UK)를 처리하여 1 시간동안 배양한 후, 비오틴-표지된 2차 항 체(biotin-labeled secondary antibody)를 처리하여 30 분간 배양하였다. Streptavidin-peroxidase (Dako Diagnostics)를 이용하고, 개발하였다. hematoxylin을 처리하여 약간의 대조염색(counterstaining) 후, 현미경 관찰을 위 해 슬라이드를 탈수하고, 커버슬립으로 봉입하였다.
실시예 9. 활성 EDB-FN 표적 마이셀 나노-DDS의 합성
9.1. APTEDB-conjugated PEG2000-DSPE의 합성
추가적인 시스테인 잔기를 포함하는(cysteinylated) EDB-FN-특이적 압타머 유사 펩타이드(aptamer-like peptide) (APTEDB, Anygen)를 dimethyl sulfoxide (Sigma-Aldrich)에 용해하고, Mal-PEG2000-DSPE를 클로로포름(chloroform) (Sigma- Aldrich)에 용해하였다. APTEDB:Mal-PEG2000-DSPE의 몰비율을 1:2로 하여 불활성 조건에서 주위 온도(ambient temperature)로12 시간동안 컨쥬게이션 (conjugation) 반응을 수행하였다. APTEDB-conjugated PEG2000-DSPE (APTEDB-DSPE)을 역위상 고성능 액체 크로마토그래피(reversed-phase high-performance liquid chromatography)로 정제 하고, 매트릭스 복조 레이저 탈착/이온화 비행 시간 질량 분광계(matrix-assisted laser desorption/ionization time-of-flight mass spectrometry)를 이용하여 컨쥬 게이션 효율을 결정하였다. 컨쥬게이션되지 않은 펩타이드를 제거하기 위해, dialysis membrane (Spectrum Chemical, NJ, USA)를 이용하여 분자량 3.5 kDa를 기 준으로 투석을 수행하였다. 48시간 후, 컨쥬게이트를 감압 하에 동결 건 조(lyophilize)하였다.
9.2. 다양한 중량 퍼센트의 APTEDB--DSPE를 처리한 마이셀 나노-DDS의 제조
모액(sto ck solution)으로부터 2 mg/mL PEG2000-DSPE의 음이온 지질 필 름(anionic lipid film)을 제조하였다. 형광 표지된 마이셀 나노-DDS를 제조하기 위해, PEG2000-DSPE solution에 0.5 wt% rhodamine B fluorophore로 표지된 Rh-DSPE 를 첨가하였다. 상기 제제에 1.0, 2.5, 또는 5.0 wt%의 농도로 APTEDB-DSPE를 첨가하였다. 예를 들어, 1.0 wt% APTEDB-DSPE의 활성 표적 APTEDB-DSPE 마이셀 나노-DDS (APTEDB-conjugated)을 형성하기 위해, 0.5 wt% Rh-DSPE를 포함하는 PEG2000-DS PE solution 2 mg/mL에 20 ㎍의 APTEDB-DSPE conjuga te를 첨가하였다. 음성 대조군으로서, 수동적인/비표적(passive/non targeting) PEG2000-DSPE 마이셀 나노-DDS (APTEDB- unconjugated)을 합성하였다. 모든 성분을 유리 바이알에 넣고, 진공 하 건조하고, 밤새도록 감압 후 동결건조하여 남아있는 클로로포름을 모두 제거하였다. 최종 2 mg/mL의 농도의 마이셀 용액을 수득하기 위해, 재수화동안 지질 필름에 1 mL의 초 순수수(Welgene)를 첨가하였다. 균일한 크기의 마이셀을 형성하기 위해, 분당 1,000 revolution의 일정한 교반 하에 재수화를 수행하였다. Amicon ® Ultra-15 centrifugal filter 3 kDa Units (Merck, Darmstadt, Germany)을 사용하여, 마이셀 이 용해된 용액을 PBS buffer로 바꾸었다. 초과-크기의 나노입자 또는 응집체를 제 거하기 위해, 상기 용액을 0.1-㎛ membrane (Millipore)으로 여과하고, 크기 배제 크로마토그래피(size exclusion chromatography) (CL-4B column; Merck)로 정제하 였다. 제조 후, PBS에서 모든 마이셀 제제의 크기 및 zeta potential을 동적 광산 란(dynamic light scattering, DLS) 및 zeta potential analysis로 분석하였다. 2 mg/mL 마이셀의 1 mL를 투명한 큐벳(transparent cuvette)에 옮기고, Zetasizer Nano ZS90 (Malvern Instruments, Malvern, UK)를 이용하여 각 마이셀의 유체역학 적 직경(hydrodynamic diameter) 및 zeta potential을 측정하였다.
9.3. DSPE-DTX 및 APT EDB--DSPE-DTX의 합성 및 개발
수동적인/비표적 DSPE-DTX (APTEDB-unconjugated) 및 활성 표적 APTEDB-DSPE- DTX (APTEDB-conjugated)는 종래 개시된 방법을 적용하여 개발하였다(Chong K et al., Chem Commun (Camb). 2013; 49: 11476-8). 먼저, APTEDB-DSPE lipid를 수득하기 위해, cysteinylated APTEDB을 PEG2000-DSPE lipid의 maleimide group과 컨쥬게 이션하였다. DTX를 로딩하기 위해, DTX를 클로로포름에 용해하고, 재 수화동안 최종 농도가 50 mg/mL가 되도록 마이셀 지질 필름에 첨가하 였다. 본 발명에서, DTX-로딩된 PEG2000-DSPE 마이셀 나노-DDS 및 APTEDB-DSPE 마이셀 나노-DDS를 각각, 'DSPE-DTX' 및 'APTEDB-DSPE-DTX'로 명명하였다. DSPE-DTX 및 APTEDB-DPSE-DTX를 0.1-㎛ membrane으로 여과하고, 크기 배제 크로마토그래피로 정제하였다.
실시예 10. APTEDB -컨쥬게이션된 마이셀 나노입자를 이용하여 악성 뇌교종의 치료 표적으로서 EDB-FN 검증
10.1. APT EDB-DSPE 마이셀 나노-DDS의 In vitro 세포 흡수(cellular uptake)
APTE DB-DSPE 마이셀 나노-DDS의 세포 흡수 효율은 EDB-FN-양성 U87MG 및 U251MG 세포에 각 마이셀 제제를 처리함으로써 결정하였다. U87MG 및 U251MG 세포 는 5,000 cells/well로 96-well plate에서 배양하였다. 세포를 살균된 커버슬립에 서 confluence로 배양한 후, 상기 세포를 APTEDB-DSPE를 1.0, 2.5, 또는 5.0 wt%의 농도로 처리하고, 100 ㎍/mL PEG2000-DS PE 마이셀 나노-DDSs 또는 APTEDB-DSPE 마이셀 나노-D DS와 함께 1 시간동안 37 ℃에서 배양하였다. 상기 세포를 PBS로 세척하 고, 4% (w/v) paraformaldehyde로 고정했으며, nuclear dye DAPI (Invitrogen, CA, USA)로 대조 염색한 후, glass slides로 봉입하고, 로다민 B(rhodamine B)-표지된 마이셀의 흡수율을 확인하기 위해 공초점 레이저 스캐닝 현미경으로 확인하였다.
10.2. 경쟁 분석(Competition assay)
EDB-FN 고발현 세포(U87MG 및 U251MG)와 EDB-FN 저발현 세포(MCF-7 및 B16F1)을 약 80% 회류점(confluence)에 도달할 때까지 글라스 커버슬립에 배양하였다. 상기 세포들을 다양한 농도(100 ㎍ /ml and 500 ㎍/ml)의 자유 APTEDB 펩타이드로 30 분 간 미리 처리하였다. 이후, 로다민-표지된 APTEDB-DSPE을 첨가하고, 상기 세 포들을 추가적으로 30 분간 배양하였다. 이후, 상기 세포들을 PBS로 세척하고, 4% (w/v) paraformaldehyde로 고정한 후, 공초점 현미경 하에서 보기 위해 현미경 슬 라이드로 봉입하였다.
10.3. siRNA(small interfering RNA)의 형질주입
EDB-FN 특이적 siRNA와 스크램블 대조군 siRNA(scrambled control siRNA)는 Bioneer (Daejeon, Republic of Korea)에서 구매하였다. RNA 간섭에 사용되는 EDB- FN siRNA의 타겟 서열은 하기와 같다; sense; ACAGUCCCAGAUCAUGGAG, antisense; CUCCAUGAUCUGGGACUGU. Lipofectamine 2000(Invitrogen, CA, USA)를 형질주입하기 위해, 세포를 밤새도록 성장시킨 후 60-70% 회류점(confluence)에서 96-well 또는 6-well 플레이트에서 배양하였다. 제조사의 설명에 따라 Lipofectamine-siRNA 복합 체를 제조하였다. 형질주입 효능은 48 시간 후에 분석하였다.
10.4. APTEDB-DSPE 마이셀 나노-DDS의 In vitro 세포 흡수(cellular uptake)
EDB-FN 발현량에 따른 세포내 흡수를 확인하기 위해, U87MG 세포에 상술한 대조군 siRNA 또는 EDB-FN siRNA를 형질주입하였다. 상기 형질주입된 세포에 100 ㎍/mL의 PEG2000-DSPE 마이셀 나노-DDS 또는 APTEDB-DSPE 마이셀 나노-DDS를 1 .0 wt% 농도로 처리하고 1 시간동안 37 ℃에서 배양하였다. APT EDB-DSPE는 EDB-FN에 대항하는 항체를 사용하여 면역 세포 화 학을 통해 염색하였고, DAPI-포함하는 봉입액(mounting solution)으 로 봉입하였다. 시간-의존적 세포 흡수를 확인하기 위해, U87MG 세포 에 1.0 wt% 농도의 APTEDB-DSPE로 100 ㎍/mL APTEDB-DSPE 마이셀 나노-DDS 를 5 분, 15 분, 30 분, 1 시간 및 4 시간동안 처리하였다.
10.5. U87MG 및 U251MG 세포에서 APTEDB-DSPE-DTX의 In vitro 세포 독 성(cytotoxicity)
악성 뇌교종의 분자적 표적으로서 E DB-FN의 유용성 및 가치를 결정하기 위해, 상술한 방법으로 DTX를 P EG2000-DSPE 및 APTEDB-DSPE 마이셀 나노-DDSs의 중심으 로 캡슐화하였다. 24 시간동안 각 나노-DDS 제형을 단계적으로 희석하며 세포와 공 배양하였다. 상기 제제를 제거한 후, 세포를 Alamar Blue assay (Bio-Rad, CA, USA) 전에 추가적으로 24 시간동안 배양하였다. 각 제형의 IC50 값은 ProBit analysis로 결정하였다.
10.6. 피하 이종이식 모델(subcutaneous xenograft model)에서 APTEDB-DSPE 마이셀 나노-DDS의 In vivo 흡수(uptake)
in vivo 이종이식 모델에서, APTEDB -DPSE 마이셀나노-DDS의 흡수를 평가하기 위해, BALB/c nude 마우스 (n = 3 mice per group)의 오른쪽 옆구리에 5 X 106 cells/mouse로 U87MG 세포를 주입하였다. 3주 후, 종양 성장을 측정했으며, 이 때, 종양 부피는 80-120 mm 3이었다. 이후, 200 ㎍의 PEG2000-DSPE 마이셀 나노-DDS in PBS 또는 APTEDB-DSPE 마이셀 나노-DDS in PBS를 각 마우스에 주입하고, 미리 지정된 시간(15, 30, 60, 및 120 분)에, IVIS in vivo imaging system (PerkinElmer, MA, USA)을 이용하여 로다민 B-표지된 마이셀의 종양 흡수를 비교하였다.
10.7. APTEDB-DSPE의 In vivo 흡수 및 독성
APTEDB-DPSE 마 이셀 나노-DDS in vivo 조직 흡수를 평가하기 위해, U87MG 세 포를 5 X 106 cells/mouse로 BALB/c nude 마우스의 오른쪽 옆구리에 주입하였다(n = 3 mice per group). 3주 후, 종양 성장을 측정하였고, 종양 부피는 80-120 mm3로결 정되었다. 이후, 200 ㎍의 PEG2000-DSPE 마이셀 나노-DDS 또는 APTEDB-DSPE 마 이셀 나노-DDS를 각 마우스에 주입하였고, 미리 지정된 시간(6, 12, 24, 및 48 시간)에, IVIS in vivo 이미징 시스템(PerkinElme r, MA, USA)을 이용하여 로다민 B-표지된 마이셀의 종양 흡수를 비교 하였다.
APTEDB-DSPE의 안전성을 검증하기 위해, 실험 전 후 마우스의 체중을 확인하 였다. 실험 막바지에, H&E 염색을 위해 주요 기관(심장, 폐, 비장, 폐, 및 신장)을 수집하기 위해 마우스를 안락사하였다.
10.8. 피하 이종이식 모델의 동결 샘플의 면역 조직 화학(Immunohistochemistry)
슬라이드 글라스에 부착된 피하 이종이식 모델의 뇌 슬라이스를 차가운 PBS로 두 번 세 척하고, 블로킹한 후, 블로킹 버퍼(blocking buffer) (PBS containing 0.3% Triton X-100 and 2% BSA)로 1 시간동안 투과할 수 있도록 하였다. EDB-FN에 특이적인 주요 항체(ab154210 Abcam, MA, USA)를 블로킹 버퍼에서 1:100로 희석하 고, 조직과 함께 4 ℃에서 밤새도록 배양하였다. PBS로 세척한 후, 블로킹 버퍼에 서 1:200으로 희석된 Alexa Fluor 488 컨쥬게이션된 2차 항체(A11001; Invitrogen, CA, USA)를 처리하여 실온에서 1 시간동안 배양하였다. 상기 조직을 4',6- diamidino-2-phenylindole (DAPI, Invitrogen, NY, USA)로 대조 염색하고, 커버 슬 라이드로 덮은 후, 공초점 레이저 스캐닝 현미경 및 슬라이드 스캐너(Axio Scan.Z1; Carl Zeiss, NY, USA)를 이용하여 분석하였다.
10.9. APTEDB-DSPE-DTX의 In vivo 항암 효능
옆구리 피하 이종이식 마우스 모 델을 제작하기 위해, BALB/c nude 마우스의 오른쪽 옆구리에 5 X 106 cells/mouse로 U87MG 세포를 주입하였다. 종양 부피가 80- 120 mm3가 되면, 마우스에 염분을 5 mg/kg의 DTX 농도로 (대표적인 종양 조직 적출 을 위한 n = 1 mouse per group을 포함하여, n = 5 mice per group) DPSE-DTX in PBS, 또는 APTEDB-DSPE-DTX in PBS를 정맥주사하였다. 이전 연구 프로토콜에 기초하 여, 각 제제를 이틀마다 세 번씩 정맥 주사하였다. 종양 크기는 적출할 때까지 사 흘에 한 번씩 측정하였다. 하기의 식을 이용하여 종양 부피를 계산하였다: (길 이(length) x 너비(width) x 높이(height)) x 0.5. 하기의 식을 이용하여 종양 억 제율을 계산하였다: [1 - { (TDayE - TDay1) / TDay1 X CDay1 / (CDay E - CDay1) }] X 100 (TDayE = 실험군의 최종 종양 부피; T Day1 = 실험군의 최초(Day 1) 종양 부피; CDayE = 대조군의 최종 종양 부피; CDay1 = 대조군의 최초 종양 부피).
동소 이종이식 마우스 모델 (orthotopic xenograft mouse models)을 제작하기 위해, BALB/c nud e 마우스의 머리를 주촉성 장치(stereotactic device)로 고정하고, Ozawa 및 James의 방법에 따라 정수리점(bregma)으로부터 2 mm 측면 및 관상 봉합(coronal suture)으로부터 1 mm 전면에 고속 드릴로 소형 버르홀(burr hole)을 시술하였다. 22-gauge needle (Hamilton Company, NV, USA)을 이용하여 3 X 105 cells/mouse로 두개골의 내부 치밀골(inner c ortical bone)으로부터 3 mm의 깊이로 U87MG 세포를 주입하였다. 7일 후, 마우스에 한 번 염분, 10 mg/kg DTX의 농도로 DSPE-DTX, 또는 A PTEDB-DSPE-DTX를 한 번 정맥주사하였다(n = 4 mice per group). 이 식 후 21일 째에 종양 크기 분석을 위해 마우스를 희생하였다. 10% (v/v) formalin (Sigma-Aldrich)를 살포한 후, 각 뇌를 제거하고 optimal cutting temperature compound (Sakura Finetek, Tokyo, Japan)에 끼워 넣었다. 상기 뇌 샘플을 동결하 고, cryostat sectioning을 이용하여 20 ㎛로 슬라이스하였다. 상기 뇌 슬라이스 를 hematoxylin and eosin (H&E) staining kit (ScyTek, UT, USA)를 이용하여 염색 하고, 하기의 식을 이용하여 종양 부피를 계산하였다: (길이 x 너비 x 너비) x 0.5. 가장 긴 치수를 길이로 설정하고, 가장 긴 수직 직경을 너비로 설정하였다.
실시예 11. 이미징 및 통계학적 분석
Ima geJ software (http://rsb.info.nih.gov/ij/)을 이용하여 이미지 프로세 싱 및 데이터 분석을 수행하였다. 모든 데이터는 GraphPad Prism 7 software (GraphPad, La Jolla, CA, USA)을 이용하여 분석하였고, means ± standard errors (std. errors)로 나타내는 IC50 값을 제외하고, means ± standard deviations (std. devs.)로 나타내었다. 군 간의 비교는 주로 정규 분포 데이터의 경우 unpaired two-tailed t test with Welch's correction (Welch's t test), 비정규 분포 데이터의 경우 Mann-Whitney test를 수행하였다. P values of < 0.05는 통계 적으로 유의한 것으로 보며, 하기와 같이 표시하였다: p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), and p < 0.0001 (****).
실시예 12. 윤리적 승인(Ethi cal approval)
동물실험을 위해 모든 적용가능한 국제, 국내, 및/또는 기관의 가이드라인을 준수하였다. 본 발명에서 동물에 관한 모든 실험은 KAIST 동물실험윤리위원 회(KAIST Institutional Animal Care and Use Committee) 및 고려대학교 의과대 학(Korea University College of Medicine) (IACUC No. KA2013-13 및 KOREA-2019- 0123)의 윤리적 기준에 부합한다. 환자 샘플 연구는 고려대학교 구로병원 기관감사 위원회(Korea University Guro Hospital Institutional Review Board) (IRB No. 2017GR0330)에서 승인받은 가이드라인 및 프로토콜을 준수하였다.
실험결과
본 발명자들은 EDB-FN이 다양한 암에 대해 마커이자 표적으로 실현가능한지 평가하기 위해 정규화된 빅데이터 및 EDB-FN 발현 수준의 환자 조직 샘플을 분석하 였다. 또한, 정상세포 대비 암세포에서 EDB-FN의 발현율이 가장 높은 암 중 하나인 악성 뇌교종의 진단 마커이자 약물 전달 표적으로서 EDB-FN의 유용성을 검증하였 다.
실험결과 1. 암 세포주에서 EDB-FN 발현
다양한 인간 암 세포주에서 EDB-FN 발 현 수준을 결정하기 위해 스크리닝을 하였다. 유방암 세포주 MCF7, 전립선암 세포주 PC3, 흑색종 세포주 B16F1 및 B16F10, 및 악성 뇌교 종 세포주 U373MG, U87MG, 및 U251MG이 실험에 사용되었다. EDB-FN 단백질의 발현 패턴은 2D 단일층 배양(two-dimensional monolayer culture) 동안 정량적 분석으로 확인하였다(도 1A). PC3 세포주 및 U373MG 세포주에서는 EDB-FN 발현이 약한 것으로 탐지되었으나, U87MG 세포주에서는 뚜렷한 발현이 관찰 되었다. 또한, EDB-FN 발현의 정량적 분석을 위해 mRNA를 추출함으로써 qRT-PCR을 수행하였다(도 1B). 그 결과(MCF7, 47.8 ± 7.9; PC3, 12.1 ± 2.1; B16F1, 0.6 ± 0.5; B16F10, 23.3 ± 1.4; U373MG, 2.6 ± 0.8; U251MG, 643.0 ± 31.0; U87MG, 1430.3 ± 61.4), U251MG 세포주에서 통계학적으로 상당한 과발현이 관찰되었으 며(p < 0.001, 다른 모든 세포주 대비, Welch's t test), 가장 높은 발현은 U87MG 세포주에서 관찰되었다(p < 0.001, 다른 모든 세포주 대비, Welch's t test). 상기 결과를 통해, 다른 암에 비해 악성 뇌교종에서 EDB-FN이 과발현되었다는 점을 확인 하였다.
종양 미세환경(tumor microenvironment)을 조성하기 위해, 3D에서 악성 뇌교 종세포주를 배양하고, 악성 뇌교종 옆구리 이종이식 동물 모델을 제작하였다. 면역 염색을 이용한 EDB-FN 발현의 정량적 분석 결과, 3D 배양동안 U87MG 세포주에서 U251MG 및 U373MG 세포주에서보다 EDB-FN이 더 과발현되었다(도 1C). 이종이식 마 우스 모델에서, U251MG 및 U87MG 세포주가 U373MG 세포주보다 상대적으로 높은 발 현 패턴을 보였다(도 1D). mRNA qRT-PCR를 통한 정량적 분석 결과(도 1E), 2D 배양 된 U373MG 세포주와 비교하여 U87MG 세포주에서 EDB-FN이 상당히 발현되었다(p < 0.01, Welch's t test). 상기 결과와 비교하여, 종양 미세환경을 모방한 3D 배양된 U87MG 세포주에서 더 높은 EDB-FN 발현을 나타내었으며(p < 0.001, 2D 배양된 U87MG 세포주와 비교하여, Welch's t test), 이종이식 동물모델에서 가장 높은 EDB-FN 발현을 나타내었다(p < 0.0001, 3D 배양된 U87MG 세포주와 비교하여, Welch's t test). 상기 결과는 악성 뇌교종에서 EDB-FN 발현과 종양 미세환경 유사 성간의 선형 상관관계를 시사하며, 이는 EDB-FN을 악성 뇌교종의 바이오마커로 사 용가능함을 나타낸다.
최종적으로, 악성 뇌교종 세포에서 다른 암 세포보다 EDB-FN이 더 과발현하였으며, 악성 뇌교종 세포주 중에 느 리게 증식하는 U373MG 세포에서 EDB-FN이 상대적으로 낮은 발현을 나 타내었다. 적극적으로 증식하는 것으로 알려진 U87MG 세포주는 가장 높은 EDB-FN 발현 수준을 나타냈으며, 다형성교모세포종 줄기세포 같은 특 징을 가진 U251MG 세포주가 그 다음에 해당했다, 상기 결과를 기반으로, 후술할 연 구에서는 U87MG 및 U251MG 세포주를 사용하였다.
실험결과 2. 합성 APTEDB--DSPE 마이셀 나노-DDS의 특성 분석(characteristic analysis)
마이셀의 동적광산란(DLS) 분석 결과, 11.5 ± 1.9 nm for the PEG2000 -DSPE 마이셀 나노-DDS에 대해 11.5 ± 1.9 nm의 직경, 1.0, 2.5, 및 5.0 wt% 농도의 APTEDB-DSPE를 처리한 APTEDB -DSPE 마이셀 나노-DDS에 대해 각각 8.2 ± 1.3 nm, 10.5 ± 1.9 nm, 및 10.3 ± 1.3 nm의 직경을 나타내었다(도 2A 및 B). PEG2000-DSPE 마이 셀 나노-DDS와 비교하여 APTEDB-DSPE 마이셀 나노-DDS의 DLS-측정 크기가 감소한 점 과, 1.0 wt% 농도에서 동일한 DDS와 비교하여 2.5 및 5.0 wt% 농도의 APTEDB-DSPE에 서 APTEDB-DSPE 마이셀 나노-DDS의 측정된 크기가 증가한 점은 마이셀의 외부 표면에 APTEDB의 존재가 마이셀 나노-DDS에서 형태학적 변화에 영향을 준다는 점을 나타내었 다. 각 나노-DDS의 zeta potential(나노입자의 표면 전하를 추론할 수 있음)을 측 정하였다; PEG2000-DSPE 마이셀 나노-DDS의 zeta potential은 -9.3 ± 1.1 mV였으며, 1.0, 2.5, 및 5.0 wt% 농도의 APTEDB-DSPE를 처리한 APTEDB-DSPE 마이셀 나노-DDS의 zeta potential은 각각 -9.5 ± 0.7 mV, -10.4 ± 1.3 mV, 및 -12.1 ± 0.7 mV이었 다(도 2C).
실험결과 3. APTEDB-DSPE 밀도에 따른 세포 흡수
최적화된 표적 리간드 밀도를 결 정하기 위해, 지질 필름 형성 이전에, 1.0, 2.5, 및 5.0 wt% 농도에 서 PEG2000-DSPE를 혼합한 Rh-DSPE의 클로로포름 용액에 APTEDB-DSPE를 첨가하였다. 모든 조건 하에서, 암 세포에서 활성 표적 APTEDB-D SPE 마이셀 나노-DDS의 흡수 효능(uptake efficacy)은 소극적인/비표 적 PEG2000-DSPE 마이셀 나노-DDS의 흡수 효능보다 높 았다(도 4A). 흥미롭게도, 2.5 wt% 농도의 APTEDB-DSP E를 처리한 APTEDB-DSPE 마이셀 나노-DDS는 U251MG 세포에서 가장 높은 세포 흡수 를 나타내었다(PEG2000-DSPE, 44.5 ± 9.6; 1.0% APTEDB-DSPE, 76.4 ± 8.1; 2. 5% APTEDB-DSPE, 128.8 ± 12.1; 5.0% APTEDB -DSPE, 53.4 ± 5.1), 반면에 1.0 wt% 농도의 APTEDB- DSPE를 처리한 APTEDB-DSPE 마이셀 나노-DDS는 U87MG 세포에서 가장 높은 세포 흡수를 나타내었다(PEG2000-DSPE, 6.8 ± 5.1; 1.0% APTEDB-DSPE, 165.7 ± 3.7; 2.5% APTEDB-DSPE, 93.2 ± 6.7; 5.0% APT EDB-DSPE, 56.7 ± 7.9). APTEBD-DSPE의 농도가 증가함에 따라 더 음의 방향인 바(도 2C), 5.0 wt% 농도의 APTEDB-DSPE를 처리한 APTEDB-DSPE 마이셀 나노-DDS의 감소된 세포 흡수는 나노-DDS에서 음전하를 통해 부 분적으로 설명 가능하다. 그러나, U87MG 및 U251MG 세포가 모두 악성 뇌교종 세포 이고, 동일 표적 리간드가 사용되었음에도 불구하고, 가장 높은 세포 흡수 효능을 가지는 APTEDB-DSPE 농도가 각 세포주마다 달랐다. 따라서, 리간드 밀도는 세포주 및 세포형에 따라 다르며, 그에 따라 세포 흡수도 다르다는 점을 알 수 있었다.
APTEDB-DSPE 마이셀 나노-DDS의 EDB-FN을 표적하는 능력을 입증하기 위해, EDB-F N 고발현 및 저발현 세포를 EDB-FN를 표적하는 앱타이드(targeting aptide)와 APTEDB-DSPE 마이셀 나노-DDS로 동시에 처리함으로써. 경쟁 분석을 수행하였다. EDB- FN 고발현 세포인 U87MG 및 U251MG에서 APTEDB-DSPE 마이셀 나노-DDS의 흡수는 EDB- FN를 표적하는 앱타이드의 농도가 증가함에 따라 감소하였다. APTEDB-DSPE의 흡수가 최소였음에도 불구하고, EDB-FN 저발현 세포인 MCF-7 및 B16F1에서도 EDB-FN 방해 효과가 나타났다(도 3A 및 B).
활성 표적 APTEDB-DSPE 마이셀 나노-DDS가 EDB-FN 발현에 의존적인지 확인하기 위해 U87MG 세포에서 EDB-FN을 녹다운(knock d own)하였다. U87MG 세포에서 EDB-FN 발현은 EDB-FN-siRNA 처리 후에 상당히 감소하였다; 반면에 대조군 siRNA(control siRNA, 1.00 ± 0 .08; EDB-FN siRNA, 0.45 ± 0.01; p < 0.01, Welch's t test)를 처리한 세포의 EDB-FN 발현은 일정하였다(도 4A). 상기 siRNA를 처리한 후, APTEDB-DSPE 마이셀 나노-DDS 잔여량의 흡수도 변화가 없었다. 그러나, EDB-FN 발현이 억제된 세포에서, 활성 표적 APTEDB-DSPE 마이셀 나노-DDS의 흡수는 감소하였다(도 4B). 더욱이, U87 세포에서 APTEDB-DSPE 마이셀 나노-DDS의 시간-의존 적 흡수 또한 4 시간동안 관찰하였다. 5 분간 처리 후, 세포 내 APTEDB-DSPE 마이셀 나노-DDS 농도를 점진적으로 증가시켰으며, 1 시간 내지 4 시간 내에 포화에 이르 렀다(도 4C).
상기 결과는 APTEDB-DSPE 마이셀 나노-DDS는 EDB-FN 발현-의존적 및 시간- 의존적으로 세포에 의해 흡수된다는 점을 시사하며, 보다 명확하게 표적 리간드 밀도가 사실 나노입자의 세포 흡수에 중요하다는 점을 나타낸다.
실험결과 4. EDB-FN를 표적함에 따른 암 표적 및 항암 효능 향상
4.1. APTEDB--DSPE-DTX의 In vitro 독성
EDB-FN의 악성 뇌교종의 분자적 표적 으로서 가치 및 유용성을 결정하기 위해, PEG2000-DSP E 및 APTEDB-DSPE 마이셀 나노-DDS의 중심으로 DTX를 캡슐화하였다. 각 마이셀 나노-DDS의 로딩 능력은 10 wt%, 캡슐화 효능은 약 95%로 계산하였다. 세포 생존능(cell viability)은 DSPE-DTX 및 APTEDB-DSPE-DTX를 사용하여 평가하였 다(도 5B). DSPE-DTX 및 APTEDB-DSPE-DTX 시스템에서 DTX가 U251MG 및 U87MG 세포의 생존능을 저해함에도 불구하고, 저해의 정도는 상이했다. U87MG 세포에서 IC50 값은 DSPE-DTX의 경우 87.38 ± 6.87 nM, APTEDB-DSPE-DTX의 경우 23.15 ± 1.67 nM로서, APTEDB-DSPE-DTX이 DSPE-DTX 보다 약 3.8배 낮았다(p < 0.0001, Welch's t tes t). U251MG 세포에서 IC50 값은 DSPE-DTX의 경우 43.1 6 ± 7.05 nM, APTEDB-DSPE-DTX의 경우 26.20 ± 1.53 nM로서, APTEDB-DSPE-DTX가 DSPE-DTX보다 약 1.6배 낮았다(p < 0.05, Welch's t test) (도 5C). U87MG 및 U251MG 세포에서 in vitro 세포 독성 데 이터는 우수한 암 표적 능력을 암시하며, 약물 흡수의 증가는 소극적인/비표적에 비해 EDB-FN 활성 표적을 통해 달성할 수 있을 것으로 생각된다. DSPE-DTX 및 APTEDB-DSPE-DTX의 IC50 값의 상당한 차이가 U87MG 세포에서 관찰되었는 바, U8 7MG 세포를 in vivo 모델링 및 악성 뇌교종의 분자적 표적으 로서 EDB-FN을 평가하는데 사용하는 것으로 선별하였다.
4.2. APTEDB--DSPE 마이셀 나노-DDS의 In vivo 흡수
U87MG 옆구리 이종이식 마 우스 모델에서 실시간 IVIS 이미징 연구 결과, APTEDB -DSPE 마이셀 나노-DDS는 소극적인/비표적 PEG2000-DSPE 마이셀 나노-DDS와 비 교하여 종양 현지화(tumor localization)의 상당한 증가를 보였다: 상기 종양 현지 화의 증가는 15 분에서 120 분동안 지속적으로 관찰되었다(도 6A). 15 분에서, 최 소의 나노입자 축적이 관찰되었다. 30 분 후, APTEDB-DSPE 마이셀 나노-DDS군에서 더 높은 축적이 시작되었다. 60 분 후, APTEDB-DSPE 마이셀 나노-DDS군은 PEG2000- DSPE 마이셀 나노-DDS군보다 종양 부위에서 더 많은 축적이 나타났다 . 또한, DDS가 종양보다 다른 기관에 영향을 미치는지 결정하기 위해 , 마이셀 나노-DDS의 조직 흡수를 48 시간동안 측정하였다(도 7A). 소극적인/비표적 PEG2000-DSPE 마이셀 나노-DDS는 점진 적으로 48 시간 내에 체내 전반에 확산되었다. 그러나, APTEDB-DSPE 마이셀 나노 -DDS은 안정적이고, 제한된 종양 부위로 남아있었다. 상기 결과는 APTEDB-DSPE 마이 셀 나노-DDS의 안정성 및 높은 악성 뇌교종-표적 능력을 나타낸다. APTEDB-DSPE이 높 은 EDB-FN 표적 능력을 가지는 바, 높은 친화성으로 EDB-FN에 결합함으로써 악성 뇌교종에서 상당히 증가된 APTEDB-DSPE 마이셀 나노-DDS의 보유시간(retention time) 을 보였으며, 그에 따라, 증가된 종양에서 약물의 생물학적 이용가능성을 가졌다.
4.3. APT EDB--DSPE-DTX의 In vivo 항암 효능
in vivo 항암 효능은 U87MG 피하 이종이식 동물 모델에서 검증하였다. 상기 효능은 시간에 따른 대조 군, DSPE-DTX, 및 APTEDB-DSPE-DTX군에서 종양 성장의 경향 을 비교함으로써 평가되었다(도 6B). 대조군에서 종양 부피는 16 일 내(day 17)에 첫 날(day 1)보다 약 5.9 배 증가하였다(Day 1: 91.5 ± 7.4 mm3 vs. Day 17: 538.0 ± 115.9 mm3; p < 0.01, Welch's t test). DSPE-DTX 또는 APTEDB -DSPE-DTX를 처리함으로써 종양 성장을 상당히 저해하였다. 상술한 바와 같이 종양 저해의 퍼센트를 계산한 결과, DSPE-DTX가 종양 성장 을 약 54.8% 억제한(Day 1: 87.9 ± 12.6 mm3 vs. D ay 17: 281.7 ± 29.4 mm3; p < 0.001, Welch's t test) 반면, APTEDB -DSPE-DTX는 종양 성장을 약 97.6%로 상당히 억제함을 확인하 였다(Day 1: 87.5 ± 12.6 mm3 vs. Day 17: 97.8 ± 2.6 mm3; p < 0.20, Welch's t test). 첫 날, 종양 부피는 군 간에 상당한 차이가 없었다. 그러나, 나노-DDS를 3 회 복용한 2 일째, 4 일째, 및 6 일째에, 군 간의 종양 부피 차이는 시간이 흐를수록 상당해졌다(도 6C 및 D). APTEDB-DSPE-DTX 군은 대조군에 비해 7 일째부터 상당한 종양 억제를 보였으며(p < 0.001, Welch's t test), DSPE-DTX 군과 비교했을 때 17 일째부터 차이가 있었다(p < 0.01, Welch's t test).
도 7B에서 도시한 바와 같이, 마이셀 나노-DDS를 체내 투여한 결과, 심장, 간, 비장, 폐, 및 신장과 같은 주요 기관에서 아무런 부작용이 관찰되지 않았으며, 실험이 끝날 때까지 마우스의 체중에는 큰 변화 가 없었다(Day 1, control = 20.4 ± 0.6 g, DSPE-DTX = 21.4 ± 0. 2 g, APTEDB-DSPE-DTX = 18.9 ± 0.6 g; Day 17, cont rol = 19.8 ± 1.6 g, DSPE-DTX = 20.7 ± 1.2 g, APTEDB-DSPE-DTX = 19.5 ± 0.9 g) (도 7C). 이는 APTEDB-DSPE 마이셀 나노-DDS가 독성을 거의 갖지 않아 생체적 합성을 가진다는 점을 나타낸다.
4.4. 동소 뇌 종양 마우스 모델에서 APTEDB--DSP E-DTX의 항암 효능
뇌 종양의 치료 표적으로서 이의 실현가능성을 평가하기 위해, U87MG 동소 이종이식 동물 모델을 제작하였다. 도 6E에 도시된 바와 같이, 염분(saline)을 대 조군으로, DSPE-DTX 및 APTEDB-DSPE-DTX을 세포 이식 후 7 일간 정맥 주사를 통해 주 입하였다(n = 4 mice per group). 2주 후, 뇌를 추출하고, 각 군의 종양 부피를 비 교하였다. H&E 염색을 사용하여 슬라이스된 뇌 조직의 정상 및 종양 부위의 현지 화(tumor localization)를 수행하였고, 각 모델에서 가장 큰 종양의 슬라이스를 기 반으로 종양의 크기를 측정하였다(도 6F 및 G). 그 결과, EDB-FN 표적 마이셀 나노 -DDS 처리에 의해 종양 성장이 상당히 저해된다는 점을 알 수 있었다. 대조군과 비 교하여(116.9 ± 21.0 mm3), DSPE-DTX(86.7 ± 28.7 mm3) 및 APTEDB -DSPE-DTX(46.5 ± 27.0 mm3)군은 각각 25.8%(p < 0.15, Welch's t test) 및 60.2%(p < 0.01, Welch' s t test) 종양 성장을 억제했다. 통계학적으로 큰 차이가 보이지 않았지만, APTEDB-DSPE-DTX군은 DSPE-DTX 군(p < 0.09, Welch's t test)보다 약 34.4% 더 높은 종양 성장 억제를 보였다. 실험 동안 모든 군에서 상당한 체중 변화가 관찰되지는 않았다(Day 1, control = 22.7 ± 1.3 g, DSPE-D TX = 23.3 ± 2.5 g, APTEDB-DSPE-DTX = 23.3 ± 1.6 g; Day 21, control = 24.5 ± 1.3 g, DSPE-DTX = 25.1 ± 1.7 g, A PTEDB-DSPE-DTX = 25.5 ± 1.5 g) (도 8C). 상기 결과는 본 발명의 EDB-FN-표적 마이셀 나노-DDS가 악성 뇌교종을 치료하는데 잠재력을 가지고 있으며, EDB-FN이 약물 치료를 위한 유용한 표적이라는 점을 나타낸다.
악성 뇌교종 동소 마우스 모델에서 이식된 U87MG 세포가 EDB-FN을 과발현한다는 점을 확인하기 위해, 모든 군에서 종 양을 포함한 마우스 뇌 슬라이스를 이용한 면역 조직 화학 분석이 수 행되었다. 마우스 뇌조직의 정상 부위와 비교하여, 모든 군의 종양 부위에서 EDB-FN가 더 높게 발현되었다(도 8A). 흥미롭게도, 종양에 서 EDB-FN 발현은 대조군 및 DSPE-DTX군과 비교하여 APTEDB-DSPE-DTX군에서 살짝 감 소하였으며(도 8B), 이는 APTEDB-DSPE-DTX가 종양에서 EDB-FN 발현 수준에 영향을 미 칠 가능성이 있음을 시사한다.
고찰
본 발명은 암 세포의 표면 및 세포 외 기질 내에 위치한 EDB-FN에 관한 것이 다. 보다 구체적으로 상기 표면과 세포 외 기질 내의 단백질은 약물전달체(drug delivery systems, DDSs)을 위한 유용한 표적뿐 아니라, 암 진단 바이오마커로서 활용될 수 있다.
상기 결과들을 고려할 때, 본 발명자들은 검증을 위해 피하 이종이식 동물 모델 실험을 포함한 in vitro 및 in vivo 실험을 수행하였다. 세균 등의 중추신경 계 침입을 방지하기 위해 발달된 BBB가 적용된 BBTB는 12 nm보다 작은 극미한 생리 학적 구멍 크기를 가지므로, 훨씬 작은 크기의 나노-DDS를 사용하는 것이 BBTB를 통한 용이한 투과를 보장할 수 있다. 따라서, 본 발명자는 약물 전달을 향상시키기 위해 DSPE 고분자를 사용하여 초소형 마이셀(~12 nm)을 개발하고, 마이셀의 표면에 APTEDB를 부착함으로써, 악성 뇌교종의 진단 및 치료에 사용할 수 있는 시스템을 제 작하였다. 종래에는 약물전달체가 약 115 ± 13 nm 크기의 리포좀 또는 34 nm 크기 의 초상자성 산화철 나노입자(superparamagnetic iron oxide nanoparticles)를 포 함하여 매우 큰 편이었으나, 본 발명은 소형의 12 nm 마이셀로 매우 감소시켰다(도 2).
본 발명자들은 EDB-FN 발현 수준과 환자의 예후간 상관관계를 정량적으로 비 교하였고(도 2) 악성 뇌교종에서 EDB-FN 표적의 유용성을 검증하였다(도 5 및 6). EDB-FN의 과발현 및 EDB-FN 표적 DDS에 의한 향상된 약물 전달은 단일층 세포 배양 뿐 아니라 동소 이종이식 모델에서도 확인되었으며, 이는 EDB-FN이 악성 뇌교종 세 포 및 조직에서 발현되며, 나노-DDS가 EDB-FN 표적을 통해 악성 뇌교종과 연결되거 나 기반을 두고 있다는 점을 시사한다(도 9). 동소 이종이식 동물 모델을 위한 DTX 복용량이 DTX의 신경독성을 고려하여 옆구리 이종이식 동물 모델을 위한 15 mg/kg 보다 33% 적은 총 10 mg/kg으로 결정되었음에도 불구하고, 이종이식 모델에서 옆구 리 모델에서 나타난 상당한 항암 효능이 나타났다. BBTB의 한계에도 불구하고, 제 조된 EDB-FN 표적 마이셀 나노-DDS는 통계학적으로 상당한 항암 효능이 없는 비표 적 마이셀 나노-DDS와 비교하여 상당한 치료 효과를 보였다. APTEDB의 악성 뇌교종 세포에 대한 특이적인 결합은 APTEDB-DSPE 마이셀 나노-DDS의 종양 보유 시간을 효율 적으로 증가시켜, 우수한 항암 효능을 나타내었다. EDB-FN은 악성 뇌교종 조직에서 특이적으로 높은 발현을 나타냈으나, 인접한 정상 조직 및 정상 뇌 조직에서는 최 소한으로 발현하였다. 상기 특성은 악성 뇌교종 치료를 위한 표적 리간드로서 EDB- FN 사용에 있어 실현가능성을 높이는데 도움을 줄 것이다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통 상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시 양태 일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
본 발명은 PEG2000-DSPE 중합지질 및 APTEDB-PEG2000-DSPE 중합체를 포함하는 마이셀 구조의 약물전달체에 관한 것으로서, 상기 약물전달체는 뇌 종양(brain tumor)에서 과발현되는 섬유결합소 엑스트라도메인 B(extradomain B of fibronectin, EDB-FN)를 표적하는 바, 뇌혈관장벽(BBB) 또는 뇌혈관 종양 장벽(BBTB)를 통과하여 뇌 종양 세포 특이적으로 약물을 전달할 수 있다. 따라서 조영제, 항암제 등의 약물이 로딩된 본 발명의 약물전달체를 유효성분으로 포함하는 조성물은 뇌 종양 내부에 축적되고 종양 세포 내부로 함입될 수 있는 바, 뇌 종양 진단 및 치료 분야에서 유용하게 이용이 가능하다.

Claims (20)

  1. PEG2000-DSPE 중합지질 및 APTEDB-PEG2000-DSPE 중합체를 포함하는 마이셀 구조의 약물전달체로서,
    상기 APTEDB는 섬유결합소 엑스트라도메인 B(extradomain B of fibronectin, EDB-FN) 유전자(Entrez Gene ID: 2335)에 특이적 결합력을 나타내는 앱타이드인, 약물전달체.
  2. 제1항에 있어서,
    상기 약물전달체는 PEG2000-DSPE 중합지질 100 중량부 기준으로 APTEDB- PEG2000-DSPE 중합체를 1 내지 2.5 중량부 포함하는 것인, 약물전달체.
  3. 제1항에 있어서,
    상기 약물전달체의 직경은 5.0 내지 12.0 nm이고,
    zeta potential은 -8.0 내지 -11.0인,
    약물전달체.
  4. 제1항에 있어서,
    상기 약물전달체는 뇌혈관장벽(blood-brain barrier, BBB) 또는 뇌혈관 종양 장벽(blood-brain tumor barrier, BBTB)을 통과하여 뇌 종양 세포 특이적으로 약물을 전달하는 것인, 약물전달체.
  5. 약물이 로딩된 제1항의 약물전달체를 유효성분으로 포함하는 뇌 종양 예방 또는 치료용 약학적 조성물.
  6. 제5항에 있어서,
    상기 약물은 조영제 또는 항암제이고,
    상기 항암제는 도세탁셀(Docetaxel), 할라벤(Halaven), 빈크리스틴(Vincristine), 시스플라틴(cisplatin), 빈블라스틴(Vinblastine), 비노렐빈(Vinorelvine), 파클리탁셀(Paclitaxel), 에토포사이드(Etoposide), 토포테칸(Topotecan), 이리노테칸(Irinotecan), 닥티노마이신(Dactinomycin), 독소루비신(Doxorubicin), 다우노루비신(Daunorubicin), 미토마이신(Mitomycin), 글리벡(gleevec), 카보플라틴(carboplatin), 발루비신(valrubicin), 플로타미드(flutamide), 젬시타빈(gemcitabine), 블레오마이신(Bleomycin), 테모졸로마이드(Temozolomide), 프로카바진(Procarbazine), 로무스틴(Lomustine, CCNU; 1-(2-chloroethyl)-3-cyclohexyl-1-nitrosourea), 빈크리스틴(Vincristine) 및 카르무스틴(Carmustine, BCNU)으로 이루어진 군으로부터 선택되는 어느 하나 이상인 것을 특징으로 하는, 약학적 조성물.
  7. 제5항에 있어서,
    상기 뇌 종양은 성상세포종(astrocytoma), 다형성교모세포종(glioblastoma multiforme), 핍지신경교종(oligodendroglioma), 핍지교성상세포종(oligoastrocytoma), 상의세포종(ependymoma), 수모세포종(medulloblastoma), 혈관모세포종(hemangioblastoma), 뇌수막종(meningioma), 뇌하수체선종(pituitary adenoma), 두개인두종(craniopharyngioma), 및 맥락총유두종(choroid plexus papilloma)으로 이루어진 군으로부터 선택되는 어느 하나 이상인 것을 특징으로 하는, 약학적 조성물.
  8. 약물이 로딩된 제1항의 약물전달체를 개체에 투여하는 단계를 포함하는 뇌 종양 진단 또는 치료방법.
  9. 제8항에 있어서,
    상기 약물은 조영제 또는 항암제이고,
    상기 항암제는 도세탁셀(Docetaxel), 할라벤(Halaven), 빈크리스틴(Vincristine), 시스플라틴(cisplatin), 빈블라스틴(Vinblastine), 비노렐빈(Vinorelvine), 파클리탁셀(Paclitaxel), 에토포사이드(Etoposide), 토포테칸(Topotecan), 이리노테칸(Irinotecan), 닥티노마이신(Dactinomycin), 독소루비신(Doxorubicin), 다우노루비신(Daunorubicin), 미토마이신(Mitomycin), 글리벡(gleevec), 카보플라틴(carboplatin), 발루비신(valrubicin), 플로타미드(flutamide), 젬시타빈(gemcitabine), 블레오마이신(Bleomycin), 테모졸로마이드(Temozolomide), 프로카바진(Procarbazine), 로무스틴(Lomustine, CCNU; 1-(2-chloroethyl)-3-cyclohexyl-1-nitrosourea), 빈크리스틴(Vincristine) 및 카르무스틴(Carmustine, BCNU)으로 이루어진 군으로부터 선택되는 어느 하나 이상인 것을 특징으로 하는, 뇌 종양 진단 또는 치료방법.
  10. 제8항에 있어서,
    상기 뇌 종양은 성상세포종(astrocytoma), 다형성교모세포종(glioblastoma multiforme), 핍지신경교종(oligodendroglioma), 핍지교성상세포종(oligoastrocytoma), 상의세포종(ependymoma), 수모세포종(medulloblastoma), 혈관모세포종(hemangioblastoma), 뇌수막종(meningioma), 뇌하수체선종(pituitary adenoma), 두개인두종(craniopharyngioma), 및 맥락총유두종(choroid plexus papilloma)으로 이루어진 군으로부터 선택되는 어느 하나 이상인 것을 특징으로 하는, 뇌 종양 진단 또는 치료방법.
  11. (1) 시스테인 잔기를 포함하는 APTEDB 및 Mal-PEG2000-DSPE을 유기용매에 1:2 몰비율로 혼합하고 중합반응을 유도하는 단계;
    (2) 상기 (1) 단계의 혼합 용액에서 APTEDB-PEG2000-DSPE 중합체를 수득하는 단계;
    (3) 물, PBS, HBS 및 HBG로 이루어지는 군으로부터 1 종 이상 선택되는 용매에 상기 APTEDB-PEG2000-DSPE 중합체와 PEG2000-DSPE 중합지질을 혼합하여 마이셀 구조체 형성을 유도하는 단계; 및
    (4) 상기 (3) 단계의 혼합 용액을 여과하고 마이셀 구조체를 정제하는 단계;를 포함하는 뇌 종양 특이적 약물전달체의 제조방법으로서,
    상기 (1) 단계의 APTEDB는 섬유결합소 엑스트라도메인 B(extradomain B of fibronectin, EDB-FN) 유전자(Entrez Gene ID: 2335)에 특이적 결합력을 나타내는 앱타이드인, 제조방법.
  12. 제11항에 있어서,
    상기 (1) 단계의 유기용매는 클로로포름, 다이메틸설폭사이드, 다이메틸포름아마이드, 에탄올, 메탄올, 테트라하이드로퓨란, 톨루엔, 자일렌 및 헥산으로 이루어진 군으로부터 선택되는 1종 이상인 것을 특징으로 하는, 뇌 종양 특이적 약물전달체의 제조방법.
  13. 제11항에 있어서,
    상기 (1) 단계는 상온에서 12시간 동안 불활성 조건 유지하에 수행되는 것을 특징으로 하는, 뇌 종양 특이적 약물전달체의 제조방법.
  14. 제11항에 있어서,
    상기 (2) 단계는 액체 크로마토그래피(liquid chromatography)를 이용하여 혼합 용액에서 APTEDB-PEG2000-DSPE 중합체를 수득하는 것을 특징으로 하는, 뇌 종양 특이적 약물전달체의 제조방법.
  15. 제11항에 있어서,
    상기 (3) 단계는 APTEDB-PEG2000-DSPE 중합체와 PEG2000-DSPE 중합지질을 용매에 혼합하고 음파 파쇄를 수행하여 수화시켜 마이셀 구조체 형성을 유도하는 것을 특징으로 하는, 뇌 종양 특이적 약물전달체의 제조방법.
  16. 제11항에 있어서,
    상기 (4) 단계는 0.025~0.1 ㎛ membrane으로 혼합 용액을 여과하고, 크기 배제 크로마토그래피(size exclusion chromatography)를 통해 마이셀 구조체를 정제하는 것을 특징으로 하는, 뇌 종양 특이적 약물전달체의 제조방법.
  17. 제11항의 방법으로 제조된 뇌 종양 특이적 약물전달체로서,
    상기 약물 전달체는 5.0 내지 12.0 nm 직경을 갖고, -8.0 내지 -11.0의 zeta potenital인 마이셀 구조체인 것을 특징으로 하는, 약물전달체.
  18. 제11항의 (1) 내지 (4) 단계를 포함하되,
    상기 (3) 단계는 APTEDB-PEG2000-DSPE 중합체 및 PEG2000-DSPE 중합지질이 용해된 용액에 항암제를 추가로 혼합하여 마이셀 구조체 형성을 유도하는 것인, 뇌 종양 치료용 약제의 제조방법.
  19. 제18항에 있어서,
    상기 항암제를 최종 농도가 50 mg/mL가 되도록 혼합하는 것을 특징으로 하는, 뇌 종양 치료용 약제의 제조방법.
  20. 제18항의 방법으로 제조된 뇌 종양 치료용 약제로서,
    상기 약제는 뇌혈관장벽(blood-brain barrier, BBB) 또는 뇌혈관 종양 장벽(blood-brain tumor barrier, BBTB)을 통과하여 뇌 종양(brain tumor) 내부에 축적되고 종양 세포 내부로 함입되는 것을 특징으로 하는, 약제.
PCT/KR2021/002008 2020-02-19 2021-02-17 암 및/또는 뇌질환 바이오마커인 edb-fn 및 이를 표적하는 나노약물전달체 WO2021167339A1 (ko)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP21757874.9A EP4109104A1 (en) 2020-02-19 2021-02-17 Edb-fn as biomarker of cancer and/or brain disease and nanodrug delivery system targeting same
JP2022547050A JP7460782B2 (ja) 2020-02-19 2021-02-17 癌及び／又は脳疾患バイオマーカーであるｅｄｂ－ｆｎ及びこれを標的とするナノ薬物伝達体
US17/800,202 US20230109491A1 (en) 2020-02-19 2021-02-17 Edb-fn as biomarker of cancer and/or brain disease and nanodrug delivery system targeting same

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2020-0020537 2020-02-19
KR20200020537 2020-02-19
KR1020210018153A KR102499961B1 (ko) 2020-02-19 2021-02-09 암 및/또는 뇌질환 바이오마커인 edb-fn 및 이를 표적하는 나노약물전달체
KR10-2021-0018153 2021-02-09

Publications (1)

Publication Number Publication Date
WO2021167339A1 true WO2021167339A1 (ko) 2021-08-26

Family

ID=77391457

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/002008 WO2021167339A1 (ko) 2020-02-19 2021-02-17 암 및/또는 뇌질환 바이오마커인 edb-fn 및 이를 표적하는 나노약물전달체

Country Status (4)

Country Link
US (1) US20230109491A1 (ko)
EP (1) EP4109104A1 (ko)
JP (1) JP7460782B2 (ko)
WO (1) WO2021167339A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009006311A2 (en) * 2007-06-29 2009-01-08 Wisconsin Alumni Research Foundation Structuring effect of cholesterol in peg-phospholipid micelles, drug delivery of amphotericin b, and combination antifungals
KR20150059444A (ko) * 2013-11-22 2015-06-01 한국과학기술원 암 질환의 진단 또는 치료용 마이셀 구조의 나노 제제 및 이의 제조방법
KR20190099827A (ko) * 2018-02-20 2019-08-28 한국과학기술원 세포투과성 물질이 융합된 앱타이드가 포집된 지질 나노 입자 복합체 및 이의 용도

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009006311A2 (en) * 2007-06-29 2009-01-08 Wisconsin Alumni Research Foundation Structuring effect of cholesterol in peg-phospholipid micelles, drug delivery of amphotericin b, and combination antifungals
KR20150059444A (ko) * 2013-11-22 2015-06-01 한국과학기술원 암 질환의 진단 또는 치료용 마이셀 구조의 나노 제제 및 이의 제조방법
KR20190099827A (ko) * 2018-02-20 2019-08-28 한국과학기술원 세포투과성 물질이 융합된 앱타이드가 포집된 지질 나노 입자 복합체 및 이의 용도

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHONG K ET AL., CHEM COMMUN (CAMB, vol. 49, 2013, pages 11476 - 8
Q YANG, MOULDER K R, COHEN MS, CAI S, FORREST LM.: "Cabozantinib Loaded DSPE-PEG2000 Micelles as Delivery System: Formulation, Characterization and Cytotoxicity Evaluation.", BAOJ PHARM SCI, 5 January 2015 (2015-01-05), pages 1 - 20, XP055495902, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/pubmed/25688382> [retrieved on 20180727] *
SAW PHEI ER, KIM SUNGHYUN, LEE IN-HYUN, PARK JINHO, YU MIKYUNG, LEE JINJU, KIM JAE-IL, JON SANGYONG: "Aptide-conjugated liposome targeting tumor-associated fibronectin for glioma therapy", JOURNAL OF MATERIALS CHEMISTRY. B, ROYAL SOCIETY OF CHEMISTRY, GB, vol. 1, no. 37, 1 January 2013 (2013-01-01), GB, pages 4723 - 4726, XP055838794, ISSN: 2050-750X, DOI: 10.1039/c3tb20815j *
SAW PHEI ER, PARK JINHO, LEE EUNBEOL, AHN SUKYUNG, LEE JINJU, KIM HYUNGJUN, KIM JINJOO, CHOI MINSUK, FAROKHZAD OMID C., JON SANGYO: "Effect of PEG Pairing on the Efficiency of Cancer-Targeting Liposomes", THERANOSTICS, IVYSPRING INTERNATIONAL PUBLISHER, AU, vol. 5, no. 7, 1 January 2015 (2015-01-01), AU, pages 746 - 754, XP055838807, ISSN: 1838-7640, DOI: 10.7150/thno.10732 *

Also Published As

Publication number Publication date
US20230109491A1 (en) 2023-04-06
JP7460782B2 (ja) 2024-04-02
JP2023514118A (ja) 2023-04-05
EP4109104A1 (en) 2022-12-28

Similar Documents

Publication Publication Date Title
Bhattacharjee et al. Tumor restriction by type I collagen opposes tumor-promoting effects of cancer-associated fibroblasts
Li et al. Remodeling tumor immune microenvironment via targeted blockade of PI3K-γ and CSF-1/CSF-1R pathways in tumor associated macrophages for pancreatic cancer therapy
Chew et al. Endocytosis inhibition in humans to improve responses to ADCC-mediating antibodies
Kinoh et al. Translational nanomedicine boosts anti-PD1 therapy to eradicate orthotopic PTEN-negative glioblastoma
Conti et al. L-Ferritin targets breast cancer stem cells and delivers therapeutic and imaging agents
Liu et al. Hyperbaric oxygen boosts PD‐1 antibody delivery and T cell infiltration for augmented immune responses against solid tumors
Bai et al. Arginine modified PAMAM dendrimer for interferon beta gene delivery to malignant glioma
Li et al. Local targeting of NAD+ salvage pathway alters the immune tumor microenvironment and enhances checkpoint immunotherapy in glioblastoma
Zeng et al. Protective effects of sonic hedgehog against ischemia/reperfusion injury in mouse skeletal muscle via AKT/mTOR/p70S6K signaling
US8669239B2 (en) Methods of inhibiting tumor cell aggressiveness using the microenvironment of human embryonic stem cells
CN109563130A (zh) 用于治疗神经退行性疾病的tdp-43线粒体定位抑制剂
Lee et al. Zfra activates memory Hyal-2+ CD3− CD19− spleen cells to block cancer growth, stemness, and metastasis in vivo
Mao et al. Critical involvement of lysyl oxidase in seizure-induced neuronal damage through ERK-Alox5-dependent ferroptosis and its therapeutic implications
Anita et al. Pericyte-derived extracellular vesicle-mimetic nanovesicles ameliorate erectile dysfunction via lipocalin 2 in diabetic mice
US9168307B2 (en) Mitochondrial-targeted cationic nanoparticles comprising CaMKII inhibitors and uses thereof for treating and preventing diseases and disorders associated with CaMKII activity
Nanou et al. Endothelial Tpl2 regulates vascular barrier function via JNK-mediated degradation of claudin-5 promoting neuroinflammation or tumor metastasis
US20190388413A1 (en) Compositions and methods for treating endometriosis
Garrity et al. Fibroblast-derived PI16 sustains inflammatory pain via regulation of CD206+ myeloid cells
WO2021167339A1 (ko) 암 및/또는 뇌질환 바이오마커인 edb-fn 및 이를 표적하는 나노약물전달체
KR102499961B1 (ko) 암 및/또는 뇌질환 바이오마커인 edb-fn 및 이를 표적하는 나노약물전달체
US20230372529A1 (en) Mitochondria comprising anticancer drug and use thereof
KR20230140614A (ko) 혈관신생과 관련된 병리학적 증상을 치료하기 위한ido1-의존성 혈관화 세포를 이용한 방법 및 조성물
JP2006117536A (ja) 内耳の有毛細胞を誘導するための医薬
CA3192884A1 (en) Nucleic acid-derivatized therapeutics
Hagerty et al. Novel humanized mesothelin-expressing genetically engineered mouse models underscore challenges in delivery of complex therapeutics to pancreatic cancers

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21757874

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022547050

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021757874

Country of ref document: EP

Effective date: 20220919