WO2021165544A1 - Viral vector particle based on aav2 for gene therapy - Google Patents

Viral vector particle based on aav2 for gene therapy Download PDF

Info

Publication number
WO2021165544A1
WO2021165544A1 PCT/EP2021/054347 EP2021054347W WO2021165544A1 WO 2021165544 A1 WO2021165544 A1 WO 2021165544A1 EP 2021054347 W EP2021054347 W EP 2021054347W WO 2021165544 A1 WO2021165544 A1 WO 2021165544A1
Authority
WO
WIPO (PCT)
Prior art keywords
amino acid
aav2
viral vector
cap
vector particle
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2021/054347
Other languages
English (en)
French (fr)
Inventor
Thomas Thum
Hildegard BÜNING
Laura SANTER
Christian Bär
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Medizinische Hochschule Hannover
Original Assignee
Medizinische Hochschule Hannover
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medizinische Hochschule Hannover filed Critical Medizinische Hochschule Hannover
Priority to JP2022550865A priority Critical patent/JP7737385B2/ja
Priority to US17/800,338 priority patent/US20230074198A1/en
Priority to EP21706946.7A priority patent/EP4107257A1/en
Publication of WO2021165544A1 publication Critical patent/WO2021165544A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/33Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14145Special targeting system for viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14151Methods of production or purification of viral material
    • C12N2750/14152Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles

Definitions

  • the present invention relates to a viral vector particle which is based on adeno-associated virus serotype 2 (AAV2) for use in gene therapy, especially for use in the treatment of cardiac diseases including cardiac defects, e.g. for use in the genetic treatment of cardiac diseases including cardiac defects.
  • the cardiac disease or defect preferably is a disease or defect of cardiomyocytes.
  • the cardiac disease or defect is a medical condition which is e.g. associated with cardiac overload, or cardiac insufficiency, e.g. the viral vector particle is for use in the treatment of the following medical indications: delivery of a transgene which exhibits therapeutic effects in cardiomyocytes after myocardial infarctions, cardiac hypertrophy or for the treatment of heart failure.
  • the viral vector particle of the invention has the advantage of being more specific for cardiomyocytes and being less efficient in transducing non-target cells, e.g. liver cells, when compared to wild-type AAV serotype 2 and 9 (AAV2 and AAV9), and to allow for expression of a transgene encoded in the viral vector particle in cardiomyocytes.
  • AAV2 and AAV9 wild-type AAV serotype 2 and 9
  • Perabo et al., Molecular Therapy, Vol. 8, No. 1, 151-157 (2003) describe the insertion of a random sequence of 7 amino acids into capsid proteins at position 587 referred to the VP1 capsid protein of the AAV2 virion and selection of AAV2 mutants from the human megakaryocytic cell line M-07e or B-cell chronic lymphocytic leukemia cell line Mecl that was co-infected with adenovirus.
  • a sequence of the mutant capsid protein was identified that conferred receptor specificity, but not cell specificity, to the viral vector.
  • Ying et al., Gene Therapy 17, 980-990 (2010) describe three rounds of screening of an AAV2 display peptide library for selecting vectors having higher specificity for heart tissue by injecting the AAV2 library into a mouse, isolating heart tissue slices from the mouse 3 days afterwards, and in vitro super-infecting the heart tissue slices with Ad5 in cultivation conditions.
  • Two AAV2 variants were identified that showed increased specificity for heart tissue, but reporter gene expression from these variants was lower than expression from a wild-type AAV9 viral vector particle.
  • AAV AAV vector particles or AAV vectors
  • the ITRs of AAV serve for genome replication and as a packaging signal during vector production.
  • pRC'99 contains the open reading frames (ORFs) for the rep and cap proteins of AAV2 for use in cloning and generating AAV vector particles of capsid variants.
  • AAV9 shows the highest transgene expression in heart in mice after systemic injection.
  • the viral vector particle with good specificity for cardiomyocytes should allow expression of a nucleic acid coding sequence that is contained in the viral vector particle in cardiomyocytes.
  • the invention achieves the object by the features of the claims, and especially provides a viral vector particle based on AAV2, which in its capsid protein (CAP) C-terminally to amino acid No. 587, and/or C-terminally to amino acid No. 588, and/or C-terminally to amino acid No. 453 of the wild-type amino acid sequence of CAP contains an inserted amino acid section comprising or consisting of one of the following amino acid sequences selected from SEQ ID NO: 1 to SEQ ID NO: 53, preferably one of SEQ ID NO: 1 or SEQ ID NO: 11.
  • CAP capsid protein
  • the CAP of the invention from N-terminus to C-terminus comprises or consists of the N-terminal section of CAP, which comprises or consists of amino acids 1 to 587 of the wild-type CAP, optionally a linker sequence, the inserted amino acid section, optionally a linker sequence, and the C-terminal section of CAP, which for the insertion C-terminally to amino acid No.
  • the inserted amino acid section in one embodiment is inserted between amino acids N587 and R588 of the wild-type CAP amino acid sequence.
  • the inserted amino acid sequence is inserted between amino acids R588 and 589 of the wild-type CAP amino acid sequence, which alternative herein is also described by the insertion between N587 and R588 and/or described by the insertion between 1456 and amino acid 454 of the wild-type CAP amino acid sequence, and all features from the description and claims apply to both the insertion between N587 and R588 of the wild-type CAP amino acid sequence, and apply to the insertion between R588 and 589, and apply to the insertion between amino acids 1453 and 454, each amino acid numbering in respect of the wild-type CAP amino acid sequence. For each of these insertion sites, especially in the embodiment in which the inserted amino acid section is inserted between amino acids No.
  • the CAP amino acid sequence is additionally mutated to R585A (amino acid 585 Arg to Ala) and R588A (amino acid 588 Arg to Ala). These preferred additional mutations disturb the heparin sulfate proteoglycan binding site of wild-type CAP.
  • amino acid No. 587 of CAP, or amino acid 588 of CAP, or amino acid 453 of CAP, respectively, and the N-terminal amino acid of the inserted amino acid section no additional amino acid may be present so that the inserted amino acid sequence is directly adjacent to amino acid No. 587 of CAP, respectively adjacent to amino acid No.
  • a linker sequence of 1 to 5 amino acids may be arranged between amino acid No. 587 of CAP, respectively amino acid No. 588 of CAP, or respectively amino acid No. 454 of CAP, and the inserted amino acid section, and/or wherein between the C-terminus of the inserted amino acid section and the remaining C-terminal portion of CAP, no additional amino acid may be present so that the inserted amino acid sequence is directly adjacent to the amino acid of the C-terminal portion of CAP, and/or a linker sequence of 1 to 4 amino acids, e.g. of 1 to 3 amino acids may be arranged between the C-terminus of the inserted amino acid section and the N-terminal amino acid of the remaining C-terminal portion of CAP.
  • the N-terminal amino acid of the remaining C-terminal portion of CAP preferably is amino acid No. 588 of the wild-type CAP.
  • the C-terminal portion of CAP which is adjacent to the C-terminus of the inserted amino acid section, optionally with a linker sequence between the C-terminus of the inserted amino acid section and the C-terminal portion of CAP, has the amino acid sequence of amino acids No. 588 to No. 735 of SEQ ID NO: 56.
  • the N-terminal amino acid of the remaining C-terminal portion of CAP preferably is amino acid No. 589 of the wild-type CAP.
  • the C-terminal portion of CAP which is adjacent to the C-terminus of the inserted amino acid section, optionally with a linker sequence between the C-terminus of the inserted amino acid section and the C-terminal portion of CAP, has the amino acid sequence of amino acids No. 589 to No. 735 of SEQ ID NO: 56.
  • the N-terminal amino acid of the remaining C-terminal portion of CAP preferably is amino acid No. 455 of the wild-type CAP.
  • the C-terminal portion of CAP which is adjacent to the C-terminus of the inserted amino acid section, optionally with a linker sequence between the C-terminus of the inserted amino acid section and the C-terminal portion of CAP, has the amino acid sequence of amino acids No. 455 to No. 735 of SEQ ID NO: 56.
  • the inserted amino acid section can be directly adjacent to the C-terminus of amino acid No. 587, respectively directly adjacent to the C-terminus of amino acid No.
  • amino acid No. 588 or respectively directly adjacent to the C-terminus of amino acid No. 455 of the wild-type amino acid sequence of CAP, or a linker sequence, e.g. of 1 to 5 amino acids, preferably of 3 amino acids, can be arranged between amino acid No. 587, respectively amino acid No. 588, or respectively amino acid No. 453 of the wild-type amino acid sequence of CAP and the inserted amino acid section.
  • the inserted amino acid can be directly adjacent to the N- terminus of amino acid No. 588, respectively amino acid No. 589, or respectively amino acid No. 454 of the wild-type amino acid sequence of CAP, or a linker sequence, e.g.
  • the inserted amino acid section together with a linker sequence at its N-terminus and a linker sequence at its C-terminus consists of 16 to 7 amino acids, e.g. 14 to 7 amino acids, more preferably of 12 amino acids.
  • the linker section in each case can comprise or consist of at least one of the amino acids selected from Ala, Thr, Pro, Gly, Leu, and/or Ser, which amino acids can be different from one another or all the same in each linker section.
  • the viral vector particles of the invention have the advantage of increased tropism, or specificity, for cardiomyocytes, e.g. in comparison to AAV2 and AAV9 having respective wild-type CAP, of reduced tropism for other cell-types than cardiomyocytes, especially reduced tropism for liver tissue, and of expression of the nucleic acid sequence that is contained in the viral vector particle in cardiomyocytes, e.g. transgene expression at a level comparable to the level of expression of the same transgene from AAV9 and much higher than the level of expression of the same transgene from AAV2 .
  • Cardiomyocytes are part of cardiac tissue, and the viral vector particle can be for medical use, e.g. for use in the treatment of cardiac diseases or cardiac defects, e.g. for administration to a human patient. Further, the viral vector particles have the advantage of allowing its production in cells at a high titer.
  • the viral vector particles according to the invention were neutralized to a significantly lower extent by human intravenous immunoglobulin (IVIG), which antibodies are present in the majority of persons, and which IVIG is known to neutralize wild- type AAV particles.
  • IVIG human intravenous immunoglobulin
  • Viral vector particles containing a CAP including one of the inserted amino acid sections of SEQ ID NO: 1 to SEQ ID NO: 53, inserted between amino acid No. 587 and amino acid No.
  • amino acid No. 453 and amino acid No. 454 of the wild-type CAP preferably one of SEQ ID NO: 1 or SEQ ID NO: 11, have a high tropism for cardiomyocytes, allow for expression of nucleic acid sequences contained in the particles in cardiomyocytes, and significantly less expression in liver tissue, e.g. than AAV9 viral vector particles containing the same nucleic acid sequences encoding a transgene.
  • the viral particles having a CAP containing one of the inserted amino acid sections have affinity to the same cardiomyocyte surface molecule which acts as a target molecule.
  • amino acid section inserted between amino acid No. 587 and amino acid No. 588 of the wild-type CAP, i.e. to the C-terminus of amino acid N. 587 of the wild-type CAP, for the preferred inserted amino acid section of SEQ ID NO: 1 is contained as an insert in the wild- type CAP in SEQ ID NO: 54, and the preferred inserted amino acid section of SEQ ID NO:
  • the linker 11 is contained as an insert in the wild-type CAP in SEQ ID NO: 55, wherein for each inserted amino acid section a linker sequence of amino acids ASA is arranged between the N- terminal section of the wild-type CAP, i.e. between amino acid No. 587, and a linker sequence of amino acids AA is arranged between the inserted amino acid section and the C- terminal section of CAP, i.e. between the inserted amino acid section and amino acid 588 of the wild-type CAP.
  • the wild-type CAP is encoded by the AAV2 cap ORF (coding sequence is SEQ ID NO: 56).
  • the linker arranged between the N-terminal section of the wild-type CAP, i.e. between amino acid No. 587 of wild-type CAP, and the inserted amino acid section the linker can have the amino acid sequence AAA.
  • the viral vector particles contain a nucleic acid construct, e.g. a sense strand or an antisense strand of single-stranded DNA, comprising or consisting of an effector sequence between terminal ITR sequences of AAV2.
  • the effector sequence can be an expression cassette encoding an effector molecule, e.g. encoding a functional non-coding RNA or a protein coding RNA, which can be expressed from the vector construct in cardiomyocytes and thereby exhibits a therapeutic beneficial function in cardiomyocytes and thus also for the whole heart.
  • transduction of cardiomyocytes is the introduction of nucleic acids by the viral vector particles into cardiomyocytes, which process can also be referred to as infection by the viral vector particles, especially for use of the viral vector particles in the treatment of cardiomyocytes.
  • the viral vector particles can be for use in the treatment of cardiomyocytes, in vivo or in vitro, e.g. for the treatment of genetic defects of cardiomyocytes, especially for transduction of cardiomyocytes.
  • An exemplary effector molecule can be selected from any wild-type sequence, e.g. for use in complementing a defective gene in the recipient of the viral vector particle.
  • Exemplary effector molecules are natural genes, including genes from any species, preferably human genes.
  • empty viral particles are provided, which do not contain a nucleic acid molecule.
  • These empty viral particles can e.g. be associated with a functional molecule for delivery of the functional molecule to heart tissue.
  • the functional molecule can e.g. be a therapeutic agent or an indicator compound, e.g. a dye or a pharmaceutically acceptable diagnostic contrast agent, or a combination of at least two of these.
  • Empty viral particles can be produced in HEK293 cells.
  • the process comprised the steps of transfecting the respective helper plasmid (containing the cap gene, if applicable with an inserted amino acid section, and the rep gene of wild-type AAV2) and an adenoviral helper plasmid (containing adenoviral helper functions required for AAV vector production) in HEK293 cells for AAV empty capsid production (no vector genome plasmid containing ITRs flanking the expression cassette is used in this specific case), with subsequent purification of empty capsid particles by iodixanol gradient centrifugation.
  • the process for producing AAV viral vector particles according to the invention can be by delivery, e.g. by plasmid transfection with or without helper virus co-infection, of all required components for AAV vector production, e.g. from a vector genome containing the transgene expression cassette flanked by ITRs, AAV rep and AAV cap genes as well as other viral helper genes necessary for AAV particle production, e.g. from adenovirus.
  • the process can be performed in a cultivated eukaryotic host cell, followed by cell lysis and removal of cellular components and plasmid DNA, e.g. by enzymatic digestion, filtration and/or centrifugation, and further purification, e.g.
  • the AAV viral vector particles obtained by the process comprise the capsid protein (CAP) which C-terminally to amino acid No. 587 of the wild-type amino acid sequence of CAP contains an inserted amino acid section comprising one of the amino acid sequences selected from SEQ ID NO: 1 to SEQ ID NO: 53.
  • CAP capsid protein
  • the viral vector particles can be formulated for injection, e.g. for direct injection into heart tissue, or for systemic injection, e.g. intravenous (i.v.) injection.
  • Fig. 1 a scheme of the selection process used for identifying CAPs with inserted amino acid sections of the invention
  • Fig. 2 shows copy numbers of viral vector particles present in different cell types of experimental animals after systemic injection
  • FIG. 3 shows transduction efficiency and specificity of viral vector particles according to the invention
  • Fig. 4A and B show results for measuring neutralisation of viral vector particles according to the invention by human intravenous immunoglobulin (IVIG).
  • IVIG human intravenous immunoglobulin
  • FIG. 5 A to D show results for measuring neutralisation of viral vector particles according to the invention by serum from mice which were previously injected with either AAV2, AAV9 or viral vector particles according to the invention.
  • - Fig. 6A and 6B show results of transduction efficiency by viral vectors in non- cardiomyocytes
  • - Fig. 6C shows results of transduction efficiency by viral vectors in presence or absence of heparin
  • FIG. 6E show cardiomyocyte transduction by viral vectors
  • Fig. 7A shows a scheme of the experimental treatment
  • Fig. F shows heart to tibia length rations
  • Fig. G shows expression levels of HI 9 and (H-I) vector copy number of HI 9 in heart and liver tissue of sham- and TAC-operated mice of in vivo effects of viral vectors of the invention and of comparative vectors.
  • nucleic acid constructs from 5 ' to 3 ' encoded inserted amino acid sequences consisting of the coding sequence for AAA as a linker sequence, a random 7-mer as the inserted amino acid sequence, and the coding sequence for AA as a linker sequence, resulting in the arrangement of the respective encoded amino acid sequences from N-terminus to C-terminus.
  • mice Male C57BL/6N, 6 to 8 weeks old
  • cardiac pressure overload was artificially induced as described by Rockman et ak, PNAS 88: 8277-8281 (1991), which mice are also referred to as TAC-operated mice, using a 26-gauge needle.
  • Aortic stenosis by the resultant transverse aortic constriction (TAC) was confirmed by echocardiography prior to injection of viral/vector particles.
  • Mice were once treated by tail vein injection with 0.66 x 10 11 to 1 x 10 11 viral/vector particles.
  • TAC-operated mice in the in vivo selection process supported the identification of capsid-mutant viral vector particles of AAV2 which in the CAP contained an inserted amino acid section which results in an increased tropism especially for hypertrophic cardiomyocytes. Accordingly, the viral vector particles are suitable for use in treatment of cardiac tissue, especially for targeting cardiomyocytes in the hypertrophy disease stage.
  • the in vivo selection in mice allows to identify capsid-mutant AAV particles which have a reduced tropism for liver and thus results in more efficient cardiomyocyte-specific transgene delivery and transgene expression, e.g. increased in comparison to wild-type AAV9.
  • Rep and Cap genes were used, in the further selection process, Rep coding sequence was replaced by expression cassette for EGFP DNA.
  • EGFP enhanced green fluorescent protein
  • the AAV library of viral vector particles was produced from a plasmid pool by calcium phosphate transfection of HEK293 cells followed by iodixanol gradient purification of viral vector particles.
  • Vector particle titers were determined by quantitative PCR using cap-specific or EGFP-specific primers.
  • the in vivo selection process consisted of three consecutive selection steps.
  • the initial library of viral particles was injected into mice 53 d after TAC surgery. 3 d later, cardiac tissue was fractionated to isolate cardiomyocytes.
  • mice were anaesthetized in an inhalation chamber with 4% isoflurane in oxygen.
  • the animals were fixed in the supine position on a hot plate (at 37°C) and anesthesia was maintained with a respiratory mask (2% isoflurane in oxygen).
  • the skin was incised and an incision was made between two tracheal trabeculae, through which a cannula was inserted.
  • the tube was then fixed with a thread and connected to an artificial ventilation system.
  • the skin was cut along a length of 2-3 cm parallel to the rib arch, the abdomen and thorax were opened and any bleeding was dabbed.
  • the aorta was localized, lifted and gently cut. A blunt cannula was inserted through the hole and fixed with a thread.
  • the heart was immediately retrograde perfused with pre-warmed perfusion buffer (113 mM NaCl,
  • the obtained cell suspension was filtered through a 100 pm cell strainer and the filter was washed with 1-2 ml with AMCF medium (10.8 g/1 MEM HBS with NEAA (Bioconcept), 4.2 mM NaHCCb, 2ng/ml vitamin B 12, 1% penicillin/streptomycin (100 U/ml; 100 pg/ml), 10% FBS, pH 7.3).
  • AMCF medium 10.8 g/1 MEM HBS with NEAA (Bioconcept), 4.2 mM NaHCCb, 2ng/ml vitamin B 12, 1% penicillin/streptomycin (100 U/ml; 100 pg/ml), 10% FBS, pH 7.3.
  • the appearance of rod-shaped cardiomyocytes was assessed under the microscope. Cardiomyocytes were sedimented for 10 min at room temperature (RT).
  • the cardiomyocyte sedimentation pellet (- CMC fraction) was washed in phosphate buffered saline (PBS), centrifuged for 5 min at 900 x g at 4°C, frozen in liquid nitrogen and stored at -80°C. The remaining supernatant was centrifuged for 3 min at 30 x g at RT to remove residual cardiomyocytes. The cell pellet containing the residual cardiomyocytes was discarded and the supernatant containing the remaining other cardiac cell types was further processed.
  • PBS phosphate buffered saline
  • the cell pellet containing the non myocyte fraction was instead dissolved in AMCF medium (10.8 g/1 MEM HBS with NEAA (Bioconcept), 4.2 M NaHCCh, 2 ng/ml vitamin B12, 1% penicillin/streptomycin (100 U/ml; 100 pg/ml), 10% FBS, pH 7.3) and pre-plated on a 10 cm petri dish in a 1% C0 2 incubator for 1 h.
  • AMCF medium 10.8 g/1 MEM HBS with NEAA (Bioconcept), 4.2 M NaHCCh, 2 ng/ml vitamin B12, 1% penicillin/streptomycin (100 U/ml; 100 pg/ml), 10% FBS, pH 7.3
  • the attached cells (- cardiac fibroblasts) were washed with PBS twice, then 2 ml PBS were added to the dish and cells were harvested with a cell scraper, centrifuged at 900 x g for 5 min at 4°C. The pellet was frozen in liquid nitrogen and stored at -80°C. The supernatant of the pre-plating step, containing the non-myocyte, non-fibroblast fraction, was next centrifuged at 430 x g for 5 min at 4°C.
  • the resulting cell pellet was resuspended in 80 m ⁇ MACS buffer (MACS bovine serum albumin stock solution diluted 1:20 in auto-MACS rinsing solution, both from Miltenyi Biotec) mixed with 20 m ⁇ CD146 MACS beads (Miltenyi Biotec) and incubated for 15 min at 4°C. Afterwards, 2 ml of MACS buffer was added, the cell suspension was mixed thoroughly and centrifuged for 5 min at 430 x g at 4°C. The cell pellet was resuspended in MACS buffer and transferred to a pre-washed MACS separating column. After three washing steps with MACS buffer, the separation columns were removed from the magnetic field. The EC fraction was collected by rinsing the column three times with 500 m ⁇ MACS buffer and centrifuged at 900 x g for 5 min at 4°C. Pellet was frozen in liquid nitrogen and stored at -80°C.
  • MACS buffer MCS bovine serum albumin stock solution diluted
  • DNA was isolated from the cell fractions using the DNeasy Blood and Tissue kit (obtained from Qiagen, Hilden, Germany) according to the manufacturer's instructions.
  • Viral vector DNA was amplified by PCR using primers that flank the coding sequence of the inserted amino acid sequence (forward primer SEQ ID NO: 57, reverse primer SEQ ID NO: 58) for re cloning the inserted amino acid sequences of the CAP gene of the viral particles that were accumulated in cardiomyocytes, and a secondary library of viral vector particles was generated from these re-cloned CAP gene sequences.
  • the rep gene was replaced by an expression cassette encoding EGFP, and during the production of the viral vector particles of the secondary library, the rep protein-coding sequence was supplied in trans by plasmid transfection.
  • the rep encoding nucleotide sequence was provided on a separate plasmid which was additionally used during transfection for AAV vector production.
  • the vector genome of the secondary library was flanked by inverted terminal repeats (ITRs) of AAV2.
  • the viral vector particles of the secondary library were injected 42 d after TAC surgery, and cardiomyocytes and non-myocyte cells were collected two weeks later, followed by subsequent amplification of DNA for re-cloning the nucleic acid sequences encoding the inserted amino acid sequences which were further accumulated in cardiomyocytes.
  • the re cloned amino acid sequences were used to generate a tertiary library which was selected the same way as the previous second selection round.
  • Fig. 1 The selection process is depicted in Fig. 1, wherein the target cells are cardiomyocytes, and liver tissue was analysed as the main off-target tissue of AAV vectors for evaluating specificity for cardiomyocytes.
  • the sub-library was isolated from the cardiomyocyte fraction, from the non-myocyte cardiac fraction, and from the liver tissue.
  • the DNA of this sub-library after three selection rounds was analysed by next-generation sequencing on the 454-pyrosequencing platform (GS Junior, Roche Diagnostics), using a cap-specific primer (forward primer of SEQ ID NO: 57).
  • Sequencing data identified coding sequences of cardiomyocyte-enriched variants that in the cap gene encoded inserted amino acid sequences of SEQ ID NO: 1 to SEQ ID NO: 53.
  • oligonucleotides encoding the inserted amino acid sequences and flanking portions were used to individually generate viral vector particles having a cap protein containing one of the inserted amino acid sequences.
  • the oligonucleotides for individual cap genes encoding one of the inserted amino acid sequences were cloned into the helper plasmid pRC'99 as described by Zhang et al.,
  • the viral vector particles according to the invention which contained CAP with an inserted amino acid section of SEQ ID NO: 1 had a CAP of SEQ ID NO: 54, and the CAP with an inserted amino acid section of SEQ ID NO: 11 had a CAP of SEQ ID NO: 55.
  • AAV viral vector particles both wild-type and the capsid-modified variants including a CAP with an inserted amino acid section according to the invention, and also wild-type AAV9 particles, were produced by calcium phosphate transfection of HEK293 cells, with subsequent purification of viral vector particles by iodixanol gradient purification.
  • the individual viral vectors each containing one of the inserted amino acid sequences were produced as viral vectors encoding for EGFP under the control of the CMV promoter in a self-complementary genome conformation (scEGFP).
  • the process comprised the steps of transfecting the vector genome plasmid (CMV promoter and EGFP coding sequence, flanked by AAV2 ITRs), the respective helper plasmid (containing the cap gene, if applicable with an inserted amino acid section, and the rep gene of wild-type AAV2) and an adenoviral helper plasmid (containing adenoviral helper functions required for AAV vector production) in HEK293 cells for AAV vector production, with subsequent purification of vector particles by iodixanol gradient centrifugation.
  • CMV promoter and EGFP coding sequence flanked by AAV2 ITRs
  • the respective helper plasmid containing the cap gene, if applicable with an inserted amino acid section, and the rep gene of wild-type AAV2
  • an adenoviral helper plasmid containing adenoviral helper functions required for AAV vector production
  • Genomic titers of vector productions were determined by quantitative PCR using primers specific for the EGFP encoding sequence.
  • the copy numbers of viral vector particles present in different tissues of experimental animals on the example of CAP containing inserted amino acid section of SEQ ID NO: 1 or SEQ ID NO: 11 show that the viral vector particles containing a CAP according to the invention have higher specificity for cardiac myocytes, e.g. compared to wild-type AAV9, specifically in relation to liver cells.
  • AAV vector copy number analysis was performed by determining the absolute gene copy number of Ptbp2 (polypyrimidine tract binding protein 2; two copies per diploid genome) and EGFP via qPCR in cardiac cell samples and organ tissue, respectively, using the absolute standard curve method.
  • TaqMan probe based qPCR detection was performed in a 384-well format using the TaqMan Fast Advance Master Mix (Thermo Fisher Scientific), the TaqMan Copy Number Assay for EGFP (Thermo Fisher Scientific; F AM-fluorescent labeled), Ptbp2 primer (forward: TCTCCATTCCCTATGTTCATGC (SEQ ID NO: 59), reverse: GTTCCCGC AGAATGGT GAGGT G (SEQ ID NO: 60)) and a JOE-fluorescent labeled Ptbp2 probe (5’ [ J OE] - ATGTTCCTCGGACC AACTTG-[BHQ 1 ] 3’ (SEQ ID NO: 61)).
  • Each qPCR reaction contained a final concentration of lx TaqMan Fast Advance Master Mix, lx EGFP TaqMan Copy Number Assay, 150 nM Ptbp2 TaqMan probe, 330 nM primer (forward and reverse) and 2 m ⁇ of DNA sample in a total volume of 10 m ⁇ .
  • DNA samples comprehended either linearized plasmid DNA (containing one copy of Ptbp2 and EGFP per plasmid) for an absolute copy number standard curve (5x10 s , 5xl0 4 ’ 5xl0 3 ’ 5xl0 2 , 5x1o 1 molecules/m ⁇ ) or pre-diluted DNA with concentrations of 15 ng/m ⁇ .
  • the qPCR was run on a QuantStudio Real-Time PCR System (ThermoFisher Scientific) using the following protocol: initial activation at 50°C for 2 min and 95°C for 20 sec, followed by 40 cycles of denaturation at 95°C for 5 sec, primer/probe annealing and elongation at 56°C for 20 sec and detection of the fluorescence signal at 65°C for 20 sec.
  • the vector copy number (VCN) in diploid cells was calculated by the following formula:
  • V CN quantity(/'Xr7 /- , )/quantity(/-7/>/ 2)x2.
  • the expression levels of EGFP, representing an effector gene, show that the viral vector particles according to the invention have high specificity of expression of the effector gene in cardiomyocytes.
  • the level of transgene expression is comparable to the expression level of the same transgene delivered by wild-type AAV9.
  • the vector particles according to the invention show reduced expression in liver tissue, which is the main off-target.
  • the expression of the exemplary transgene EGFP was analysed by quantitative reverse transcription PCR (qrtPCR) in cardiac cell types that were obtained by heart fractionation and in liver tissue which were collected 2 weeks after injection of the viral vectors.
  • the results were generally normalized to the RNA input in relation to the transcripts of the TATA-box binding protein (Tbp).
  • Reverse transcription of 65-500 ng total RNA was performed using the Biozym cDNA Synthesis Kit (Biozym) according to the manufacturer' s instruction.
  • RNA samples In case of organ tissue samples, a second DNase digestion was performed directly prior reverse transcription by incubating 500 ng total RNA with 0.684 m ⁇ DNase (1:10 dilution, RNase-Free DNase Set (Qiagen)), 1.15 m ⁇ RDD buffer (RNase-Free DNase Set (Qiagen)) and 0.144 m ⁇ RNasin Ribocluclease Inhibitor (Promega) in a total volume of 11.5 m ⁇ for 30 min at 37°C. The reaction was stopped by adding 0.23 m ⁇ 62.5 mM EDTA and incubation for 5 min at 65°C.
  • RNA dilutions of 11.5-11.73 m ⁇ containing 65-500 ng RNA were reverse transcribed using 4 m ⁇ 5x cDNA synthesis buffer, 2 m ⁇ dNTP Mix (10 mM each), 1 m ⁇ hexamer primer (25 mM), 0.5 m ⁇ RNase inhibitor (40 U/mI) and 1 m ⁇ reverse transcriptase.
  • the reaction mix was incubated at 30°C for 10 minutes, followed by 60 min at 55°C, and finally, the enzyme was heat inactivated at 99°C for 5 min.
  • cDNA samples Prior to qPCR, cDNA samples were diluted with two volumes of nuclease-free FEO (1 :3 dilution) and stored at -20°C. qPCR measurements were performed in a 384-well format using the iQ SYBR Green Supermix (Biorad) according to the manufacturer's instructions.
  • the reaction mix composed of 5 m ⁇ iQ SYBR Green Supermix, 0.05 m ⁇ of a ROX Reference Dye 1:50 dilution (Thermo Scientific), 0.025 m ⁇ Precision BlueTM Real-Time PCR Dye (BioRad), 0.5 m ⁇ of pre-mixed primer (10 mM forward and 10 mM reverse primer), 2.45 m ⁇ nuclease-free FEO and 2 m ⁇ of cDNA (1:3 dilution after cDNA synthesis) was mixed and the qPCR protocol was run on a ViiaTM 7 Real-Time PCR System (ThermoFisher Scientific) using the following protocol: initial activation at 95°C for 3 min, 45 cycles of denaturation at 95 °C for 15 seconds, primer annealing at 60°C for 30 seconds, elongation at 72 °C for 40 seconds, followed by the generation of a melting curve with fluorescence detection very 0.5 °C from 95 °C to 55 °C for 10 seconds
  • Fig. 2 shows average copy numbers (VCN) of viral vector particles in cells and organs, respectively, isolated from experimental animals, namely in cardiomyocytes (CMC), liver, skeletal muscle (sk. muscle), in kidney and spleen.
  • CMC cardiomyocytes
  • sk. muscle skeletal muscle
  • spleen The viral vector particles indicated from top to bottom are shown in the graph from left to right.
  • the animals are indicated as sham- operated (sham) or with surgically induced transverse aortic constriction (TAC).
  • CAP with an inserted amino acid section having sequence LPSRPSL (SEQ ID NO: 62, comparative) has a lower copy number in cardiomyocytes and a higher copy number in liver, indicating a lower tropism for cardiomyocytes.
  • the transduction efficiency and transduction specificity of viral vector particles according to the invention were analysed by introducing viral vectors having a CAP with an inserted amino acid section of SEQ ID NO: 1 (CAP of SEQ ID NO: 54) or SEQ ID NO: 11(CAP of SEQ ID NO: 55), and for comparison wild-type AAV2 or wild-type AAV9 or a CAP containing inserted amino acid section of SEQ ID NO: 62.
  • the viral vector particles contained the expression cassette for EGFP.
  • the viral vector particles were injected into sham-operated mice or TAC-operated mice (each 2 to 4 animals) 6 weeks after surgery.
  • Fig. 3 A schematically depicts the analytical process.
  • Fig. 3 B shows the results of detecting expression of EGFP, normalized to expression of Tbp (relative expression (EGFP/Tbp), for the sham-operated mice (sham) or TAC-operated mice (TAC) separately for each vector: wild-type AAV2 (AAV2), wild-type AAV9 (AAV9), viral vector particle with CAP containing inserted amino acid section of SEQ ID NO: 1 (AAV2-THGTPAD), viral vector particle with CAP containing inserted amino acid section of SEQ ID NO: 11 (AAV2- NLPGSGD), or comparative vector particle with CAP containing inserted amino acid section of SEQ ID NO: 62 (AAV2-LPSRPSL).
  • Fig. 3C shows the expression of EGFP, normalized to expression of Tbp, in cardiac myocytes (CMC) relative to expression in liver, combined for the results from sham-operated animals and TAC-operated animals for the vectors AAV2, AAV9, AAV2-THGTPAC and AAV2- NLPGSGD, and separate for sham and TAC for the CAP containing comparative inserted amino acid section SEQ ID NO: 62 (AAV2-LPSRPSL).
  • AAV2 and AAV9 wild type capsids
  • viral vector particles with CAP containing inserted amino acid section of SEQ ID NO: 1 AAV2-THGTPAD
  • vector with CAP containing inserted amino acid section of SEQ ID NO: 11 AAV2-NLPGSGD
  • comparative vector SEQ ID NO: 62.
  • the viral vector particles on the basis of AAV2 containing CAP with an inserted amino acid section according to the invention results in significantly increased expression specificity of the effector molecule encoded by the viral vector particle in cardiac myocytes, e.g. significantly increased in comparison to wild-types AAV2 and AAV9, and in comparison to comparative CAP including inserted amino acid section of SEQ ID NO: 62.
  • IVIG intravenous immunoglobulin
  • Viral vector particles containing CAP according to the invention as well as vector particles of the wild-type serotype AAV2 were incubated with different dilutions of the IVIG serum in 1 mL DMEM cell culture medium (supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin).
  • the viral vector particles were used at a concentration which in the absence of IVIG, i.e. in the cell culture medium only, transfects 30 to 40% of cells to express EGFP (30 to 40% of cells EGFP positive), which was also used as a positive control.
  • the viral vector particles were incubated in the cell culture medium in mixture with or without IVIG serum for 1 h at room temperature and then added to HEK293 cells cultivated in 12-well plates. After an incubation of 48 hours under cell culture conditions, the HEK293 cells were analysed by fluorescence activated cell sorting (FACS) to determine the percentage of EGFP-positive cells.
  • FACS fluorescence activated cell sorting
  • Fig. 4B shows a graph of the IC50 values derived from the data of Fig. 4A.
  • viral vector particles according to the invention was performed as described herein for the expression and vector copy number analysis in mouse tissue.
  • AAV9 wild-type AAV9
  • AAV9 and the viral vector particles of the invention remain their ability to transduce cell.
  • serum of mice previously injected with AAV-NLP shows poor neutralisation capacity, resulting in neutralisation of AAV2 and the viral vector particles of the invention only at low serum dilutions.
  • serum of mice previously injected with AAV-THG shows poor neutralisation capacity, resulting in weak neutralisation of only wild-type AAV2 at low serum dilutions.
  • FIG. 6A show the transduction efficiency of AAV2 viral vectors of the invention AAV2-THGTPAD (containing the inserted amino acid section of SEQ ID NO: 1) and AAV2-NLPGSGD (containing the inserted amino acid section of SEQ ID NO: 11) and, as a comparison, wild-type AAV2 and AAV2-LPSRPSL (containing the comparative inserted amino acid section of SEQ ID NO: 62).
  • Fig. 6B shows the calculated ratio of infectious particles (on Hek293 cells) per vector genome, wherein genomic titer was determined by qPCR (quantitative PCR). The results show that in these cells, the comparative vector AAV2-LPSRPSL shows a lower infectivity than wild-type AAV2, and that vectors according to the invention show a severely reduced infectivity in these non-target cells.
  • Fig. 6C shows the result of a heparin competition assay, wherein heparin forms a soluble analogue of HSPG, which is a putative receptor for viral vectors.
  • AAV vectors and the wild- type AAV2 were pre-incubated with heparin prior transduction of Hek293 cells in order to investigate heparin sulfate proteoglycan (HSPG) dependent cell entry.
  • the thermal stability of AAV vector particles was assayed by subjecting the vector particles to different temperatures for 15 min followed by dot blotting using an A20 antibody for detection, which is specific for detection of assembled capsid proteins of intact AAV vector particles.
  • the result is shown in Fig. 6D, showing that the stability of the capsid is lower for both the comparative vector AAV2-LPSRPSL and viral vectors of the invention than for the wild-type AAV2.
  • comparative vector AAV2-LPSRPSL was the least stable variant, showing partial degradation at 57.9 °C, while vectors of the invention showed a very similar stability with a partial capsid degradation starting at 60.7 °C, and initiation of degradation of the variant capsid initiated only at 63.4 °C.
  • Fig. 6E shows the result of assaying cross-species activity.
  • Human induced pluripotent stem cell derived cardiomyocytes iPSC-CMCs
  • AAV vectors expressing scEGFP with a vector particle-to-cell-ratio of 2xl0 3 .
  • mice 4 weeks after induction of TAC were injected.
  • the data show that due to the improved cardiomyocyte tropism low viral vector doses suffice for transduction, as only 3.55 x 10 10 viral genomes (vg) /mouse were injected.
  • HI 9 expression analysis after heart explanation showed the expected reduction of HI 9 in cardiac hypertrophy which was only partially rescued in AAV2-THGTPAD-H19, AAV2-NLPGSGD- H19 and AAV9-H19 treated mice (Fig.7G, presumably owing to the low vector dose in conjunction with dilution effects of non-cardiomyocytes). Nevertheless, HI 9 copy number analysis showed a strong increase for all variants compared to AAV9-empty controls (Fig. 7H). Strikingly, while AAV9-H19 strongly accumulated in the liver, HI 9 copy numbers in AAV2-THGTPAD-H19, AAV2-NLPGSGD-H19 treated mice were comparable to the sham and AAV9-empty control groups (Fig. 71).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/EP2021/054347 2020-02-20 2021-02-22 Viral vector particle based on aav2 for gene therapy Ceased WO2021165544A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2022550865A JP7737385B2 (ja) 2020-02-20 2021-02-22 遺伝子療法のためのaav2をベースとするウイルスベクター粒子
US17/800,338 US20230074198A1 (en) 2020-02-20 2021-02-22 Viral vector particle based on AA V2 for gene therapy
EP21706946.7A EP4107257A1 (en) 2020-02-20 2021-02-22 Viral vector particle based on aav2 for gene therapy

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP20158633.6 2020-02-20
EP20158633.6A EP3868875A1 (en) 2020-02-20 2020-02-20 Viral vector particle based on aav2 for gene therapy

Publications (1)

Publication Number Publication Date
WO2021165544A1 true WO2021165544A1 (en) 2021-08-26

Family

ID=69804442

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2021/054347 Ceased WO2021165544A1 (en) 2020-02-20 2021-02-22 Viral vector particle based on aav2 for gene therapy

Country Status (4)

Country Link
US (1) US20230074198A1 (enExample)
EP (2) EP3868875A1 (enExample)
JP (1) JP7737385B2 (enExample)
WO (1) WO2021165544A1 (enExample)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024126762A2 (en) 2022-12-14 2024-06-20 Aavigen Gmbh Recombinant adeno-associated virus gene therapy vectors with reduced liver tropism and enhanced transduction of cardiac cells for the therapy of heart diseases and diseases associated with heart dysfunction
WO2024191778A1 (en) 2023-03-10 2024-09-19 Dyno Therapeutics, Inc. Capsid polypeptides and methods of use thereof
US12116385B2 (en) 2021-10-08 2024-10-15 Dyno Therapeutics, Inc. Capsid variants and methods of using the same
WO2025049993A1 (en) 2023-08-31 2025-03-06 Dyno Therapeutics, Inc. Capsid polypeptides and methods of use thereof
WO2025171227A1 (en) 2024-02-08 2025-08-14 Dyno Therapeutics, Inc. Capsid polypeptides and methods of use thereof
WO2026064442A2 (en) 2024-09-18 2026-03-26 Dyno Therapeutics, Inc. Capsid polypeptides and methods of use thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004083441A2 (en) * 2003-03-19 2004-09-30 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Random peptide library displayed on aav vectors
WO2019076856A1 (en) * 2017-10-16 2019-04-25 Vigeneron Gmbh AAV VECTORS

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004083441A2 (en) * 2003-03-19 2004-09-30 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Random peptide library displayed on aav vectors
WO2019076856A1 (en) * 2017-10-16 2019-04-25 Vigeneron Gmbh AAV VECTORS

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
HAJJARISHIKAWA, CIRCULATION RES, vol. 120, no. 1, 2017, pages 33 - 35
L. YANG ET AL: "A myocardium tropic adeno-associated virus (AAV) evolved by DNA shuffling and in vivo selection", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 106, no. 10, 10 March 2009 (2009-03-10), pages 3946 - 3951, XP055165570, ISSN: 0027-8424, DOI: 10.1073/pnas.0813207106 *
PERABO ET AL., MOLECULAR THERAPY, vol. 8, no. 1, 2003, pages 151 - 157
ROCKMAN ET AL., PNAS, vol. 88, 1991, pages 8277 - 8281
WANG ET AL., NATURE REVIEWS DRUG DISCOVERY, 2019, pages 358 - 378
Y YING ET AL: "Heart-targeted adeno-associated viral vectors selected by in vivo biopanning of a random viral display peptide library", GENE THERAPY, vol. 17, no. 8, 15 April 2010 (2010-04-15), pages 980 - 990, XP055147105, ISSN: 0969-7128, DOI: 10.1038/gt.2010.44 *
YING ET AL., GENE THERAPY, vol. 17, 2010, pages 980 - 990
ZHANG ET AL., HUM. GENE THER., 2019, pages 1284 - 1296
ZINCARELLI ET AL., MOLECULAR THERAPY, vol. 16, no. 6, 2008, pages 1073 - 1080

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12116385B2 (en) 2021-10-08 2024-10-15 Dyno Therapeutics, Inc. Capsid variants and methods of using the same
US12331082B2 (en) 2021-10-08 2025-06-17 Dyno Therapeutics, Inc. Capsid variants and methods of using the same
US12331081B2 (en) 2021-10-08 2025-06-17 Dyno Therapeutics, Inc. Capsid variants and methods of using the same
US12528841B2 (en) 2021-10-08 2026-01-20 Dyno Therapeutics, Inc. Capsid variants and methods of using the same
WO2024126762A2 (en) 2022-12-14 2024-06-20 Aavigen Gmbh Recombinant adeno-associated virus gene therapy vectors with reduced liver tropism and enhanced transduction of cardiac cells for the therapy of heart diseases and diseases associated with heart dysfunction
WO2024126762A3 (en) * 2022-12-14 2024-08-08 Aavigen Gmbh Recombinant adeno-associated virus gene therapy vectors with reduced liver tropism and enhanced transduction of cardiac cells for the therapy of heart diseases and diseases associated with heart dysfunction
WO2024191778A1 (en) 2023-03-10 2024-09-19 Dyno Therapeutics, Inc. Capsid polypeptides and methods of use thereof
WO2025049993A1 (en) 2023-08-31 2025-03-06 Dyno Therapeutics, Inc. Capsid polypeptides and methods of use thereof
WO2025171227A1 (en) 2024-02-08 2025-08-14 Dyno Therapeutics, Inc. Capsid polypeptides and methods of use thereof
WO2026064442A2 (en) 2024-09-18 2026-03-26 Dyno Therapeutics, Inc. Capsid polypeptides and methods of use thereof

Also Published As

Publication number Publication date
EP4107257A1 (en) 2022-12-28
JP2023514446A (ja) 2023-04-05
US20230074198A1 (en) 2023-03-09
JP7737385B2 (ja) 2025-09-10
EP3868875A1 (en) 2021-08-25

Similar Documents

Publication Publication Date Title
US20230074198A1 (en) Viral vector particle based on AA V2 for gene therapy
TWI791433B (zh) 治療a型血友病之基因治療
AU2018261790B2 (en) Compositions and methods of treating amyotrophic lateral sclerosis (ALS)
US8476418B2 (en) Modified AAV capsid polypeptides
KR20220038362A (ko) 재조합 ad35 벡터 및 관련 유전자 요법 개선
US20230181683A1 (en) Peptides having specificity for the lungs
KR20100105630A (ko) 유인원 아과 c 아데노바이러스 sadv-40, -31, 및 -34 및 그것의 사용
CN113755524B (zh) 用于治疗脊髓性肌萎缩的腺相关病毒载体及其用途
KR20220128632A (ko) 개선된 aav-abcd1 구축물 및 부신백질이영양증 (ald) 및/또는 부신척수신경병증 (amn)의 치료 또는 예방을 위한 용도
US10391144B2 (en) Atherosclerosis inhibition via modulation of monocyte-macrophage phenotype using Apo A-I Milano gene transfer
JP4863874B2 (ja) 関節リウマチのインビボ遺伝子治療のためのaavベクター
JP7750581B2 (ja) アデノ随伴ウイルスカプシドタンパク質の突然変異体
EP4410988A1 (en) An aav2-vector variant for targeted transfer of genes
CN113913463B (zh) 抑制sost基因表达的重组质粒及其骨靶向重组腺相关病毒与应用
CN115068632A (zh) Ago2在制备治疗心衰的药物方面的用途及其蛋白、基因、转化体、药物与制备方法
WO2009071679A1 (en) Novel aav vector and uses thereof
EP4516805A1 (en) Viral vector for fibroblast transfection
EP4570260A1 (en) Viral vector for transduction of adipocytes
CN115838725B (zh) 在哺乳动物心脏中特异性启动基因的启动子序列及其应用
WO2024199478A1 (en) Variant aav9 capsid proteins and uses thereof
CN121653188A (zh) 靶向递送vegf-c的重组腺相关病毒载体及其在促进心内膜分化治疗冠心病中的应用
WO2026084593A1 (en) Directed evolution of aav9 for efficient gene expression in cardiomyocytes
WO2024160770A1 (en) An aav9 capsid variant for targeted gene transfer
HK40014345A (en) Peptides having specificity for the lungs
HK40030612A (en) Viral vector for the targeted transfer of genes in the brain and spinal cord

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21706946

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022550865

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021706946

Country of ref document: EP

Effective date: 20220920