WO2021155634A1 - Anti-human-tslp antibody and use thereof - Google Patents

Abstract

Disclosed are an antibody binding to human TSLP or an antigen-binding moiety thereof, a nucleic acid molecule encoding the antibody or the antigen-binding moiety thereof, a vector containing the nucleic acid molecule, a host cell containing the nucleic acid molecule or the vector, a method for preparing and purifying the antibody, and the use of the antibody or the antigen-binding moiety thereof.

Description

Anti-human TSLP antibody and its use

Cross-references to related applications

This application claims the priority of Chinese Patent Application No. 202010080450.1 filed on February 5, 2020, the entire content of which is incorporated herein by reference in its entirety.

Technical field

This application generally relates to the field of genetic engineering and antibody drugs; specifically, to the field of anti-human TSLP antibodies and their uses. This application has developed a new anti-human TSLP antibody and provided the use of the antibody in the prevention or treatment of TSLP-mediated diseases.

Background technique

Thymic stromal lymphopoietin (TSLP), also known as IL-7-like cytokine ¹ , is a member of the IL-2 cytokine family. TSLP is mainly secreted by epithelial cells in the thymus, lung, intestine and ^skin2,3 , followed by some fibroblasts, airway smooth muscle endothelial cells, mast cells, monocytes, granulocytes, and DC ^cells4-14 . The expression of TSLP is regulated by some factors, such as allergens, pro-inflammatory factors (IL-1β, TNF-α, TGF-β, IL-4, IL-13), Th2 factors, trauma, mechanical damage, bacteria, etc. ^{15- 18} .

TSLP receptor (Thymic stromal lymphopoietin receptor, TSLPR) belongs to the hematopoietic factor receptor family and is a type I cytokine receptor protein. ¹⁹ is available with high affinity for IL-7 receptor comprising TSLPR α chain (IL-7Rα) and TSLP receptor α chain (TSLPRα), only the interaction receptor complex. TSLPR (the co-receptor of TSLP and IL-7) is mainly expressed on the surface of mature DC cells, mast cells and some activated T cells ²⁰ .

Asthma is a chronic disease characterized by airway inflammation. The clinical features are recurrent wheezing, shortness of breath, chest tightness, and coughing. ²¹ Worldwide, there are about 300 million people suffer from asthma ^22. In the past two decades, the global prevalence of asthma has been increasing at an annual rate of approximately 1%. Existing therapeutic drugs include bronchodilators, glucocorticoids, a combination of the two (seretide, Symbico), leukotriene modulators, and long-acting cholinergic receptor antagonists (tiotropium) , IgE antibodies, etc., can not control the condition of all asthma patients.

A large number of studies have shown that about two-thirds of severe asthma are manifested by the overexpression of Th2 cytokines, and TSLP is an important factor that causes the overexpression of Th2 cytokines. The role of TSLP-TSLPR is mainly accomplished through the JAK-STAT signaling pathway ² . Studies believe that the up-regulation of TSLP will combine with TSLPR on DC cells to cause JAK activation, recruit the transcription factor STAT5, cause downstream signal transduction, and ultimately lead to the activation of DC cells. The activation of DC cells shows up-regulation of the expression of costimulatory molecules (such as CD80, CD40, CD86) and the secretion of chemokines (TARC/CCL17, MDC/CCL22 and I-309/CCL1), thereby providing the opportunity for Th0 to differentiate into Th2 cells. Favorable microenvironment, guide Th2 cell-based inflammatory response, and release of accompanying factors (IL-4, IL-13, IL-5) ^11,12,23,24 . TSLP susceptible transgenic mice and specific antigen induce asthma, the symptoms mouse TSLP receptor knockout ²⁴ is significantly reduced. From the analysis of the mechanism of asthma and inflammation, anti-cytokine (IL-4, IL-13, IL-5) drugs only target specific inflammatory molecules that drive asthma inflammation, and are only suitable for certain types of severe asthma patients. Group of patients, such as eosinophilic asthma. TSLP is significantly different from IL4, IL5 and other targets. TSLP is active in the early upstream of the inflammatory cascade and may be suitable for a wide range of patients with severe uncontrolled asthma.

Researchers have conducted a lot of exploration and research on drugs that target TSLP. Anti-TSLP monoclonal antibody can effectively block the effects of TSLP/TSLPR in the mite dust-induced mouse asthma model, reverse airway inflammation, prevent tissue structure changes, and reduce airway hyperresponsiveness (AHR) and TGF-β1 levels ²⁵ . In a mouse asthma model induced by serum proteins, anti-TSLP monoclonal antibodies effectively reduced the expression of Th2 factors (IL-4, IL-5, etc.) ²⁶ . The safety of anti-TSLP monoclonal antibodies has also been fully confirmed in monkeys. Moreover, worldwide, the only anti-TSLP monoclonal antibodies in clinical research in the early show good clinical objective response rate, effectively alleviate the condition of the patient tested ^27.

Therefore, in view of the wide applicability of anti-TSLP antibodies, based on clinical needs, the exploration and development of anti-TSLP antibodies has important biological and medical significance.

Summary of the invention

In the first aspect, the present application provides an antibody that binds to human TSLP, which comprises a heavy chain variable region containing amino acid sequences of HCDR1, HCDR2 and HCDR3 and a light chain variable region containing amino acid sequences of LCDR1, LCDR2 and LCDR3, wherein

The HCDR1 amino acid sequence is shown in SEQ ID NO: 30, the HCDR2 amino acid sequence is shown in SEQ ID NO: 31 or SEQ ID NO: 36, and the HCDR3 amino acid sequence is shown in SEQ ID NO: 32. The LCDR1 amino acid sequence is shown in SEQ ID NO: 33, the LCDR2 amino acid sequence is shown in SEQ ID NO: 34, and the LCDR3 amino acid sequence is shown in SEQ ID NO: 35;

The amino acid sequences of HCDR and LCDR are defined by Kabat.

In some embodiments, the amino acid of the heavy chain variable region of the antibody is as shown in SEQ ID NO: 22 or 25.

In some embodiments, the amino acid of the light chain variable region of the antibody is as shown in SEQ ID NO: 23, 24, 26, 27, 28 or 29.

In some embodiments, the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 25, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 24; or

The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 25, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 26; or

The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 25, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 27; or

The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 25, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 28; or

The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 25, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 29.

In the second aspect, the present application provides an antibody that binds to human TSLP, wherein the amino acid sequence of the variable region of the heavy chain of the antibody has at least 90% homology with any one of SEQ ID NOs: 22 and 25, And the amino acid sequence of the light chain variable region of the antibody has at least 90% homology with any one of SEQ ID NO: 23, 24, 26, 27, 28 and 29.

In some embodiments of the first and second aspects, the antibody is capable of binding to recombinant human TSLP (SEQ ID NO: 1) and recombinant monkey TSLP (SEQ ID NO: 4).

In some embodiments of the first and second aspects, the antibody inhibits the binding of human TSLP to the human TSLP receptor.

In some embodiments of the first and second aspects, the antibody is a whole antibody, a Fab fragment, a F(ab') ₂ fragment, or a single chain Fv fragment (scFv).

In some embodiments of the first and second aspects, the antibody is a fully human antibody.

In some embodiments of the first and second aspects, the antibody is a monoclonal antibody.

In some embodiments of the first and second aspects, the antibody further comprises a heavy chain constant region selected from the group consisting of IgG1 subtype, IgG2 subtype, or IgG4 subtype.

In some embodiments of the first and second aspects, the antibody further comprises a light chain constant region selected from the group consisting of kappa subtype or lambda subtype.

In the third aspect, the application provides a nucleic acid molecule that encodes the antibody or antigen-binding portion thereof as described in the first or second aspect.

In a fourth aspect, this application provides a pharmaceutical composition comprising the antibody described in the first or second aspect and a pharmaceutically acceptable excipient, diluent or carrier.

In some embodiments, the pharmaceutical composition is used to prevent or treat TSLP-mediated diseases.

In some embodiments, the TSLP-mediated disease is an autoimmune disease or an inflammatory disease, such as asthma, scleroderma, systemic lupus erythematosus, rheumatoid arthritis, Churg-Strauss syndrome, Wegener's granulation Wegener's granulomatosis, pulmonary hemorrhage-nephritis syndrome, allergic pneumonia, atopic dermatitis, rhinitis, Crohn's disease, ankylosing spondylitis, rheumatic fever, fibromyalgia, psoriatic arthritis, chronic nephritis, Sjogren’s syndrome and multiple sclerosis.

In the fifth aspect, the application provides the use of the antibody described in the first or second aspect in the preparation of drugs for preventing or treating TSLP-mediated diseases.

In some embodiments of the fifth aspect, the TSLP-mediated disease is an autoimmune disease or an inflammatory disease, such as asthma, scleroderma, systemic lupus erythematosus, rheumatoid arthritis, Churg-Strauss syndrome, Wegener's granulomatosis, pulmonary hemorrhage-nephritis syndrome, allergic pneumonia, atopic dermatitis, rhinitis, Crohn's disease, ankylosing spondylitis, rheumatic fever, fibromyalgia, psoriatic arthritis , Chronic nephritis, Sjogren’s syndrome and multiple sclerosis.

In the sixth aspect, the present application provides a method for preventing or treating TSLP-mediated diseases, including administering the antibody of the first aspect or the second aspect or the pharmaceutical composition of the fourth aspect to an individual in need.

In some embodiments of the sixth aspect, the TSLP-mediated disease is an autoimmune disease or an inflammatory disease, such as asthma, scleroderma, systemic lupus erythematosus, rheumatoid arthritis, Churg-Strauss syndrome, Wegener's granulomatosis, pulmonary hemorrhage-nephritis syndrome, allergic pneumonia, atopic dermatitis, rhinitis, Crohn's disease, ankylosing spondylitis, rheumatic fever, fibromyalgia, psoriatic arthritis , Chronic nephritis, Sjogren’s syndrome and multiple sclerosis.

Description of the drawings

Figure 1 shows the chemiluminescence method of cell viability assay to analyze the ability of anti-human TSLP monoclonal antibodies to inhibit the proliferation-promoting effect of TSLP on BAF3-TSLPR/IL-7Rα cells.

Figure 2 shows the ELISA analysis of different anti-human TSLP monoclonal antibodies to inhibit the ability of TSLP to stimulate PBMC to secrete TARC.

Figure 3 shows the chemiluminescence cell viability assay to analyze the ability of the anti-human TSLP light chain mutant S2B1VH-h1+L3E8 to inhibit the proliferation-promoting effect of TSLP on BAF3-TSLPR/IL-7Rα cells.

Figure 4 shows the ability of chemiluminescence cell viability assay to analyze the ability of anti-human TSLP de-DG and NG mutant H1A10+L3E8 to inhibit the proliferation-promoting effect of TSLP on BAF3-TSLPR/IL-7Rα cells.

Figure 5 shows the ability of the humanized anti-TSLP monoclonal antibody H1A10+L3E8-M1 to effectively block the binding of TSLP to TSLPR on the cell surface by flow cytometry.

Figure 6 shows the chemiluminescence method cell viability assay analysis of different anti-human TSLP L3E8 humanized mutants H1A10+L3E8-M1, H1A10+L3E8-M2, H1A10+L3E8-M3 and H1A10+L3E8-M4 inhibit TSLP on BAF3-TSLPR /IL-7Rα cell proliferation promoting ability.

Figure 7 shows the ELISA analysis of different anti-human TSLP L3E8 humanized mutants H1A10+L3E8-M1, H1A10+L3E8-M2, H1A10+L3E8-M3, and H1A10+L3E8-M4 to inhibit the ability of TSLP to stimulate PBMC to secrete TARC.

Figure 8 shows the ELISA analysis of the binding ability of recombinant anti-TSLP monoclonal antibodies to TSLP of different species.

Figure 9 shows the results of ELISA analysis of L3E8 humanized mutants and Tezepelumab binding to different epitopes of TSLP.

Sequence description

SEQ ID NO: 1 shows the amino acid sequence of the extracellular domain (hTSLP1) of the long version of human (homo sapiens) TSLP.

SEQ ID NO: 2 shows the amino acid sequence of the short version of human (homo sapiens) TSLP extracellular domain (hTSLP2).

SEQ ID NO: 3 shows the amino acid sequence of the extracellular domain of mouse (mus musculus) TSLP (mTSLP).

SEQ ID NO: 4 shows the amino acid sequence of the cynomolgus monkey (Macaca fascicularis) TSLP extracellular domain (mfTSLP).

SEQ ID NO: 5 shows the amino acid sequence of the hTSLP1 mutant with the furin recognition site deleted.

SEQ ID NO: 6 shows the amino acid sequence of the hTSLP2 mutant with the furin recognition site deleted.

SEQ ID NO: 7 shows the amino acid sequence of the mfTSLP mutant with the furin recognition site deleted.

SEQ ID NO: 8 shows the amino acid sequence of His tag (His).

SEQ ID NO: 9 shows the amino acid sequence of the Fc segment (hFc) of the human (homo sapiens) IgG1 antibody.

SEQ ID NO: 10 shows the amino acid sequence of the Fc segment (mFc) of the mouse (mus musculus) IgG2a antibody.

SEQ ID NO: 11 shows the amino acid sequence of the heavy chain constant region of human (homo sapiens) IgG1 subtype.

SEQ ID NO: 12 shows the amino acid sequence of the heavy chain constant region of human (homo sapiens) IgG2 subtype.

SEQ ID NO: 13 shows the amino acid sequence of the heavy chain constant region of human (homo sapiens) IgG4 subtype.

SEQ ID NO: 14 shows the amino acid sequence of the heavy chain constant region of the mouse (mus musculus) IgG1 subtype.

SEQ ID NO: 15 shows the amino acid sequence of the heavy chain constant region of the mouse (mus musculus) IgG2a subtype.

SEQ ID NO: 16 shows the amino acid sequence of the human (homo sapiens) kappa subtype light chain constant region.

SEQ ID NO: 17 shows the amino acid sequence of the light chain constant region of the human (homo sapiens) subtype lambda.

SEQ ID NO: 18 shows the amino acid sequence of the constant region of the mouse (musculus) kappa subtype light chain.

SEQ ID NO: 19 shows the amino acid sequence of the constant region of the murine (mus musculus) lambda subtype light chain.

SEQ ID NO: 20 shows the amino acid sequence of the light chain variable region of the anti-human TSLP control antibody Tezepelumab.

SEQ ID NO: 21 shows the amino acid sequence of the heavy chain variable region of the anti-human TSLP control antibody Tezepelumab.

SEQ ID NO: 22 shows the amino acid sequence of the heavy chain variable region (S2B1VH) of the anti-human TSLP antibody S2B1. The amino acid sequences of CDR1, CDR2, and CDR3 are as shown in SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO, respectively. :32 shown.

SEQ ID NO: 23 shows the amino acid sequence of the light chain variable region (S2B1VK) of the anti-human TSLP antibody S2B1. The amino acid sequences of CDR1, CDR2, and CDR3 are as shown in SEQ ID NO: 33, SEQ ID NO: 34 and SEQ ID NO, respectively. :35 shown.

SEQ ID NO: 24 shows the amino acid sequence of the light chain variable region mutant L3E8.

SEQ ID NO: 25 shows the amino acid sequence of the heavy chain variable region mutant H1A10, and the amino acid sequence of CDR2 is shown in SEQ ID NO: 36.

SEQ ID NO: 26 shows the amino acid sequence of the humanized mutant L3E8-M1 of the light chain L3E8.

SEQ ID NO: 27 shows the amino acid sequence of the light chain L3E8 humanized mutant L3E8-M2.

SEQ ID NO: 28 shows the amino acid sequence of the light chain L3E8 humanized mutant L3E8-M3.

SEQ ID NO: 29 shows the amino acid sequence of the light chain L3E8 humanized mutant L3E8-M4.

SEQ ID NO: 37 shows the nucleotide sequence of primer PmCGR.

SEQ ID NO: 38 shows the nucleotide sequence of primer PmCKR.

Detailed description of the invention

The inventor of the present application obtained a new anti-human TSLP antibody through antibody engineering technology. In various aspects of the present application, there are provided novel anti-human TSLP antibodies or antigen-binding fragments thereof, nucleic acid molecules encoding the antibodies or antigen-binding fragments thereof, vectors containing the nucleic acid molecules, and nucleic acid molecules or vectors containing the nucleic acid molecules or vectors. Host cells, methods for preparing and purifying the antibodies, and medical and biological applications of the antibodies or antigen-binding fragments thereof. According to the sequence of the variable region of the antibody provided in this application, a full-length antibody molecule can be constructed as a medicine for the treatment of clinically TSLP-mediated diseases.

Unless otherwise specified, the implementation of this application adopts molecular biology, microbiology, cell biology, biochemistry, and immunology techniques conventional in the art.

Unless otherwise specified, the terms used in this application have the meanings commonly understood by those skilled in the art.

definition

The term "antibody" as used herein refers to an immunoglobulin molecule capable of specifically binding to a target via at least one antigen recognition site located in the variable region of the immunoglobulin molecule. Targets include but are not limited to carbohydrates, polynucleotides, lipids, polypeptides and the like. As used herein, "antibody" not only includes intact (ie, full-length) antibodies, but also includes antigen-binding fragments (such as Fab, Fab', F(ab') ₂ , Fv), variants thereof, and antibody portions. Fusion proteins, humanized antibodies, chimeric antibodies, diabodies, linear antibodies, single-chain antibodies, multispecific antibodies (e.g. bispecific antibodies) and any other immunoglobulin containing antigen recognition sites of the desired specificity Modified configuration of protein molecules, including glycosylation variants of antibodies, amino acid sequence variants of antibodies, and covalently modified antibodies.

Generally, a complete or full-length antibody contains two heavy chains and two light chains. Each heavy chain contains a heavy chain variable region (VH) and first, second, and third constant regions (CH1, CH2, and CH3). Each light chain contains a variable region (VL) and a constant region (CL) of the light chain. The full-length antibody can be any kind of antibody, such as IgD, IgE, IgG, IgA, or IgM (or the above subclasses), but the antibody does not need to belong to any specific class. According to the antibody amino acid sequence of the constant domain of the heavy chain, immunoglobulins can be assigned to different classes. Generally, there are five main classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, and several of these classes can be further divided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2. The heavy chain constant domains corresponding to different immunoglobulin classes are called α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional structures of different classes of immunoglobulins are well known.

The term "antigen-binding fragment or antigen-binding portion" as used herein refers to a part or region of a complete antibody molecule that is responsible for binding an antigen. The antigen binding domain may comprise a heavy chain variable region (VH), a light chain variable region (VL), or both. Each of VH and VL usually contains three complementarity determining regions CDR1, CDR2, and CDR3.

Those skilled in the art know that the complementarity determining region (CDR, usually CDR1, CDR2, and CDR3) is the region in the variable region that has the greatest impact on the affinity and specificity of the antibody. There are two common ways to define the CDR sequence of VH or VL, namely Chothia definition and Kabat definition. (See, for example, Kabat, "Sequences of Proteins of Immunological Interest", National Institutes of Health, Bethesda, Md. (1991); A1-Lazikani et al., J. Mol. Biol. 273:927-948 (1997); and Martin Et al., Proc. Natl. Acad. Sci. USA 86: 9268-9272 (1989). For the variable region sequence of a given antibody, the CDR sequences in the VH and VL sequences can be determined according to the Chothia definition or the Kabat definition. In this article In the embodiment of the application, Chothia is used to define the CDR sequence.

For the variable region sequence of a given antibody, the CDR sequence in the variable region sequence can be analyzed in a variety of ways, for example, it can be determined using the online software Abysis (http://www.abysis.org/).

Examples of antigen-binding fragments include, but are not limited to: (1) Fab fragments, which can be monovalent fragments with VL-CL chains and VH-CH1 chains; (2) F(ab') ₂ fragments, which can have two A bivalent fragment of the Fab' fragment, the two Fab' fragments are connected by a disulfide bridge in the hinge region (ie, a dimer of Fab'); (3) Fv fragments with VL and VH domains with one arm of an antibody; ( 4) Single-chain Fv (scFv), which can be a single multi-peptide chain composed of a VH domain and a VL domain via a peptide linker; and (5)(scFv) ₂ , which can include two peptides connected The VH domain and the two VL domains connected by the symbol, the two VL domains are combined with the two VH domains via a disulfide bridge.

When describing the structure of an antibody herein, the description related to amino acid position numbering refers to the EU numbering definition of human IgG1 antibody, which is well known and easily found by those skilled in the art. In addition, when a mutation is described herein in conjunction with EU numbering position, it refers to a mutation generated relative to the natural antibody sequence.

The terms "Fc fragment", "Fc domain", "Fc portion" or similar terms as used herein refer to a part of the constant region of an antibody heavy chain, including the hinge region, the CH2 fragment and the CH3 fragment of the constant region. With reference to the EU numbering definition of human IgG1 antibody, the Fc fragment is the amino acid sequence of positions 216-447 in the constant region of the antibody.

The term "specific binding" as used herein refers to a non-random binding reaction between two molecules, such as the binding of an antibody to an epitope.

The term "monoclonal antibody" as used herein refers to an antibody obtained from a substantially homogeneous antibody population, that is, each antibody constituting the population is the same except that there may be naturally occurring mutations in a small number of individuals. The monoclonal antibodies described herein particularly include "chimeric" antibodies, in which a part of the heavy chain and/or light chain is the same or homologous to the corresponding sequence in an antibody derived from a specific species or belonging to a specific antibody class or subclass, and The remaining part of the chain and/or light chain is identical or homologous to the corresponding sequence in an antibody derived from another species or belonging to another antibody class or subclass, and also includes fragments of such antibodies, as long as they can exhibit the desired (US Patent No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA 81: 6851-6855 (1984).

As used herein, the term "homology" is defined as the percentage of identical residues in amino acid or nucleotide sequence variants after sequence alignment and introduction of gaps, and, if necessary, the maximum percentage of homology. Methods and computer programs for comparison are well known in the art.

As used herein, the term "autoimmune disease" refers to a disease caused by the body's immune response to self-antigens, resulting in damage to its own tissues, including but not limited to scleroderma, systemic lupus erythematosus, rheumatoid arthritis, Churg- Strauss syndrome, Wegener's granulomatosis (Wegener's granulomatosis) and pulmonary hemorrhage-nephritis syndrome.

The term "inflammatory disease" as used herein refers to a general term for diseases in which inflammation is the main destructive factor. Inflammation is the biological response of tissues to harmful stimuli. It is a kind of pathology and is accompanied by three events of tissue degradation, circulatory disturbances and fluid exudation, as well as hypertrophy. Examples of inflammatory diseases include acute and chronic diseases, including but not limited to asthma, allergic pneumonia, atopic dermatitis, rhinitis, Crohn's disease, ankylosing spondylitis, rheumatic fever, fibromyalgia, psoriatic arthritis , Chronic nephritis, Sjogren’s syndrome and multiple sclerosis.

In the first aspect, the present application provides an antibody that binds to human TSLP, which comprises a heavy chain variable region containing amino acid sequences of HCDR1, HCDR2 and HCDR3 and a light chain variable region containing amino acid sequences of LCDR1, LCDR2 and LCDR3, wherein

The HCDR1 amino acid sequence is shown in SEQ ID NO: 30, the HCDR2 amino acid sequence is shown in SEQ ID NO: 31 or SEQ ID NO: 36, and the HCDR3 amino acid sequence is shown in SEQ ID NO: 32. The LCDR1 amino acid sequence is shown in SEQ ID NO: 33, the LCDR2 amino acid sequence is shown in SEQ ID NO: 34, and the LCDR3 amino acid sequence is shown in SEQ ID NO: 35;

The amino acid sequences of HCDR and LCDR are defined by Kabat.

In some embodiments, the amino acid of the heavy chain variable region of the antibody is as shown in SEQ ID NO: 22 or 25.

In some embodiments, the amino acid of the light chain variable region of the antibody is as shown in SEQ ID NO: 23, 24, 26, 27, 28 or 29.

In some embodiments, the amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 25, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 24; or

The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 25, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 26; or

The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 25, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 27; or

The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 25, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 28; or

The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 25, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 29.

In the second aspect, the present application provides an antibody that binds to human TSLP, wherein the amino acid sequence of the variable region of the heavy chain of the antibody has at least 90% homology with any one of SEQ ID NOs: 22 and 25, And the amino acid sequence of the light chain variable region of the antibody has at least 90% homology with any one of SEQ ID NO: 23, 24, 26, 27, 28 and 29.

In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the antibody is at least 90%, 91%, 92%, 93%, 94% of SEQ ID NO: 22 and 25. , 95%, 96%, 97%, 98%, 99% or higher homology.

In some embodiments of the second aspect, the amino acid sequence of the light chain variable region of the antibody has at least 90%, 91%, 90%, 91%, 90%, 91%, 90%, 91%, 90%, 91%, 90%, 91%, 90%, 91%, 90%, 91%, 90%, 91%, 90%, 91%, 90%, 91%, 90%, 91%, 90%, 91%, 90%, 91%, 90, and 29 basis to any of SEQ ID NOs: 23, 24, 26, 27, 28, and 29. 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher homology.

In some embodiments of the first and second aspects, the antibody is capable of binding to recombinant human TSLP (SEQ ID NO: 1) and recombinant monkey TSLP (SEQ ID NO: 4).

In some embodiments of the first and second aspects, the antibody inhibits the binding of human TSLP to the human TSLP receptor.

In some embodiments of the first and second aspects, the antibody is a whole antibody, Fab fragment, F(ab') ₂ fragment, or single chain Fv fragment (scFv).

In some embodiments of the first and second aspects, the antibody is a fully human antibody.

In some embodiments of the first and second aspects, the antibody is a monoclonal antibody.

In some embodiments of the first and second aspects, the antibody further comprises a heavy chain constant region selected from the group consisting of IgG1 subtype, IgG2 subtype, or IgG4 subtype.

In some embodiments of the first and second aspects, the heavy chain constant region of the antibody may be of human IgG1 subtype, human IgG2 subtype, human IgG4 subtype, murine IgG1 subtype, or murine IgG2a subtype.

In some specific embodiments of the first and second aspects, the heavy chain constant region is of IgG4 subtype or IgG1 subtype.

In some specific embodiments of the first and second aspects, the heavy chain constant region of the antibody comprises the Fc segment sequence of the heavy chain constant region of human IgG1 subtype and the positions 234, 235 and 331 of the Fc sequence The amino acid sequences are F, E and S respectively, and the amino acid sequence of the antibody constant region is determined according to EU numbering.

In some embodiments of the first and second aspects, the antibody further comprises a light chain constant region selected from the group consisting of kappa subtype or lambda subtype.

In some embodiments of the first and second aspects, the light chain constant region of the antibody may be human kappa subtype, human lambda subtype, murine kappa subtype, or murine lambda subtype.

In the third aspect, the application provides a nucleic acid molecule that encodes the antibody or antigen-binding portion thereof as described in the first or second aspect.

In some embodiments, the nucleic acid molecule is operably linked to a regulatory sequence, which can be recognized by a host cell transformed with the vector.

In a fourth aspect, the present application provides a pharmaceutical composition comprising the antibody described in the first or second aspect and a pharmaceutically acceptable excipient, diluent or carrier.

In some embodiments, the pharmaceutical composition is used to prevent or treat TSLP-mediated diseases.

In some embodiments, the TSLP-mediated disease is an autoimmune disease or an inflammatory disease, such as asthma, scleroderma, systemic lupus erythematosus, rheumatoid arthritis, Churg-Strauss syndrome, Wegener's granulation Wegener's granulomatosis, pulmonary hemorrhage-nephritis syndrome, allergic pneumonia, atopic dermatitis, rhinitis, Crohn's disease, ankylosing spondylitis, rheumatic fever, fibromyalgia, psoriatic arthritis, chronic nephritis, Sjogren’s syndrome and multiple sclerosis.

In some embodiments, the pharmaceutical composition may further include one or more of the following: lubricants such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifiers; suspending agents; preservatives Agents, such as benzoic acid, sorbic acid and calcium propionate; sweeteners and/or flavoring agents, etc.

In some embodiments, the pharmaceutical composition in this application can be formulated in the form of tablets, pills, powders, lozenges, elixirs, suspensions, emulsions, solutions, syrups, suppositories, or capsules.

In some embodiments, any physiologically acceptable mode of administration may be used to deliver the pharmaceutical composition of the present application. These modes of administration include, but are not limited to: oral administration, parenteral administration, nasal administration, rectal administration Medicine, intraperitoneal administration, intravascular injection, subcutaneous administration, transdermal administration, inhalation administration, etc.

In some embodiments, a pharmaceutical composition for therapeutic use can be formulated in the form of a lyophilized preparation or an aqueous solution by mixing reagents with the required purity with pharmaceutically acceptable carriers, excipients, etc., as appropriate. storage.

In the fifth aspect, the application provides the use of the antibody described in the first or second aspect in the preparation of drugs for preventing or treating TSLP-mediated diseases.

In some embodiments, the TSLP-mediated disease is an autoimmune disease or an inflammatory disease, such as asthma, scleroderma, systemic lupus erythematosus, rheumatoid arthritis, Churg-Strauss syndrome, Wegener's granulation Wegener's granulomatosis, pulmonary hemorrhage-nephritis syndrome, allergic pneumonia, atopic dermatitis, rhinitis, Crohn's disease, ankylosing spondylitis, rheumatic fever, fibromyalgia, psoriatic arthritis, chronic nephritis, Sjogren’s syndrome and multiple sclerosis.

In the sixth aspect, the present application provides a method for preventing or treating TSLP-mediated diseases, including administering the antibody of the first or second aspect or the pharmaceutical composition of the fourth aspect to an individual in need.

In some embodiments, the TSLP-mediated disease is an autoimmune disease or an inflammatory disease, such as asthma, scleroderma, systemic lupus erythematosus, rheumatoid arthritis, Churg-Strauss syndrome, Wegener's granulation Wegener's granulomatosis, pulmonary hemorrhage-nephritis syndrome, allergic pneumonia, atopic dermatitis, rhinitis, Crohn's disease, ankylosing spondylitis, rheumatic fever, fibromyalgia, psoriatic arthritis, chronic nephritis, Sjogren’s syndrome and multiple sclerosis.

In other aspects, the application also provides an isolated nucleic acid molecule encoding the antibody of the present invention or its light or heavy chain, a vector containing the nucleic acid molecule, a host cell containing the vector, and a method for producing the antibody. In some embodiments, the nucleic acid molecule is operably linked to a regulatory amino acid sequence, and the regulatory amino acid sequence can be recognized by a host cell transformed with the vector. In some embodiments, methods of producing antibodies include culturing host cells to facilitate expression of nucleic acids. In some embodiments, the method of producing an antibody further includes recovering the antibody from the host cell culture medium.

In addition, the antibodies described herein that specifically bind to human TSLP can also be used to detect the presence of TSLP in biological samples. Antibody-based detection methods are well known in the art, and include, for example, ELISA, immunoblotting, radioimmunoassay, immunofluorescence, immunoprecipitation, and other related techniques.

It should be understood that the above detailed description is only to enable those skilled in the art to understand the content of the application more clearly, and is not intended to limit it in any respect. Those skilled in the art can make various modifications and changes to the described embodiments.

Example

The following examples are only for the purpose of illustration and not for limiting the scope of the present application.

Example 1: Preparation of recombinant protein

The preparation of anti-TSLP monoclonal antibodies requires a variety of different recombinant proteins, including the long version of human TSLP extracellular domain (hTSLP1, SEQ ID NO:1) and the short version of human TSLP extracellular domain (hTSLP2, SEQ ID NO:1). ID NO: 2), mouse TSLP extracellular domain (mTSLP, SEQ ID NO: 3), and cynomolgus TSLP extracellular domain (mfTSLP1, SEQ ID NO: 4). These proteins have a large number of post-translational modifications (such as glycosylation or disulfide bonds, etc.), so the use of mammalian cell expression systems will be more conducive to maintaining the structure and function of the recombinant protein. In addition, in order to avoid the influence of furin recognition sites in hTSLP1, hTSLP2, and mfTSLP1 on the activity of TSLP protein, hTSLP1 mutants (hTSLP1-m, SEQ ID NO: 5) and hTSLP2 with the furin recognition sites deleted were constructed respectively. Mutant (hTSLP2-m, SEQ ID NO: 6), mfTSLP1 mutant (mfTSLP1-m, SEQ ID NO: 7). At the same time, a His tag (His, SEQ ID NO: 8) or the Fc segment of human antibody IgG1 (hFc, SEQ ID NO: 9) or the Fc segment of mouse antibody IgG2a (mFc, SEQ ID) was added to the C-terminus of these recombinant proteins. NO: 10), will be more conducive to the purification of recombinant protein and the identification of monoclonal antibody function. The antibody heavy chain constant region can be of human IgG1 subtype (SEQ ID NO: 11), human IgG2 subtype (SEQ ID NO: 12), human IgG4 subtype (SEQ ID NO: 13) or mouse IgG1 subtype (SEQ ID NO: 14), mouse IgG2a subtype (SEQ ID NO: 15), the light chain constant region can be human κ subtype (SEQ ID NO: 16), human λ subtype (SEQ ID NO: 17) or mouse κ subtype Type (SEQ ID NO: 18), murine lambda subtype (SEQ ID NO: 19).

According to the amino acid sequences of various target recombinant proteins in the Uniprot database, the genes of the above-mentioned various recombinant proteins (including His tag or hFc, mFc coding genes) are designed and synthesized. Use conventional molecular biology techniques to clone the synthesized recombinant protein genes into appropriate eukaryotic expression vectors (such as pcDNA3.1 from Invitrogen, etc.), and then use liposomes (such as 293fectin from Invitrogen, etc.) or other cations Transfection reagents (such as PEI, etc.) transfect the prepared recombinant protein expression plasmid into HEK293 cells (such as HEK293F from Invitrogen), and culture for 3-4 days under serum-free suspension culture conditions. The culture supernatant is then harvested by centrifugation and other methods.

The recombinant protein expressed by His tag fusion uses a metal chelating affinity chromatography column (such as GE's HisTrap FF, etc.) to purify the recombinant protein in the culture supernatant in one step. The recombinant protein expressed by the fusion of hFc and mFc is purified by a ProteinA/G affinity chromatography column (such as Mabselect SURE from GE). Then use a desalting column (such as Hitrap desaulting from GE) to replace the recombinant protein storage buffer with PBS (pH 7.0) or other suitable buffers. If necessary, the antibody sample can be filtered and sterilized, and then aliquoted and stored at -20°C.

Example 2: Preparation of mouse anti-human TSLP monoclonal antibody

2.1 Preparation of mouse immunization and immune antibody library

BALB/c mice aged 6-8 weeks were taken for the first immunization, and each mouse was immunized with 50μg fusion protein hTSLP1-m-His plus Freund's complete adjuvant, and then boosted at two-week intervals, and each mouse was injected with 50μg fusion. The protein plus Freund's incomplete adjuvant was strengthened 4 times in total. In the last immunization, hTSLP1-m-His fusion protein without adjuvant was used as the immunogen. Each mouse was intraperitoneally injected with 50 μg of the fusion protein. The mice were sacrificed 3 days after the impulse immunization, and the spleen cells were collected.

Mouse spleen lymphocytes were separated using mouse lymphocyte separation solution (Daktronics Biotechnology Co., Ltd., CAT#DKW33-R0100), and total cell RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., CAT#) was used to isolate mouse spleen lymphocytes. DP430) extract total RNA from lymphocytes. Using the extracted total RNA as a template, the first-strand cDNA synthesis kit (Thermo scientific, CAT#K1621) was used to synthesize the variable region of the heavy chain and the variable region of the light chain respectively. The reverse transcription primers were gene-specific primers, and the primers were paired. The regions are respectively located in the constant region of the antibody heavy chain and the constant region of the antibody light chain. The specific sequences are respectively PmCGR: TGCATTTGAACTCCTTGCC (SEQ ID NO: 37) and PmCKR: CCATCAATCTTCCACTTGAC (SEQ ID NO: 38). The synthesized cDNA was immediately stored at -70°C for later use. Then use the cDNA obtained by reverse transcription as the template, and refer to the literature (Krebber, A., et al. "Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display of 20 Immunological 1.1(Methods)." 1997): 35-55), the entire contents of the above-mentioned documents are incorporated herein by reference) to synthesize primers, and use PCR to amplify murine antibody VH and VK genes, and then use overlap extension PCR technology to construct single-chain antibodies (scFv )Gene. Finally, the prepared mouse single-chain antibody gene was cloned into the vector pADSCFV-S (for the experimental technology flow, please refer to Example 1 of Chinese Patent Application No. 201510097117.0, and the entire content of the above-mentioned patent application is incorporated herein by reference) to construct scFv Library. The storage capacity of the antibody library reaches 1×10E8, and the accuracy rate is 50%.

2.2 Screening of anti-human TSLP monoclonal antibodies

Using the recombinant human TSLP1-m-his prepared in Example 1 as the antigen, using a solid-phase screening strategy (refer to the experimental protocol for phage display: General Experimental Guide / (United States) Clarkson (Clackson, T.), (United States) Loman ( Lowman, HB) edited; Ma Lan et al. Chemical Industry Press, 2008.5) Screening of the phage library constructed in 2.1 above for displaying mouse single-chain antibodies was carried out through binding, elution, neutralization, infection, and amplification. After three rounds of screening, multiple single-chain antibodies with different sequences but capable of binding to human and monkey TSLP were finally obtained, including clones S2B1, S1A3, S1B3, S2A10, S2B9, S2D10, S2E4 and S2G2.

Example 3: Identification of Mouse Anti-Human TSLP Monoclonal Antibodies

Using conventional molecular biology methods, the nucleic acid molecules encoding the light chain and heavy chain of the eight molecules of S2B1, S1A3, S1B3, S2A10, S2B9, S2D10, S2E4 and S2G2 were cloned into eukaryotic expression vectors to prepare recombinant human IgG4-κ Form of mouse-human chimeric antibody. At the same time, refer to US patent US9284372B2 to prepare human anti-TSLP monoclonal antibody Tezepelumab (AMG 157, MEDI9929) (light chain amino acid sequence is shown in SEQ ID NO: 20; heavy chain amino acid sequence is shown in SEQ ID NO: 21; patent pending The clone number is A5) as a positive control antibody.

3.1 Affinity analysis of recombinant mouse anti-TSLP monoclonal antibody

The affinities of anti-TSLP antibodies (S2B1, S1A3, S1B3, S2A10, S2B9, S2D10, S2E4, S2G2 and Tezepelumab) were determined by surface plasmon resonance technology using Biacore X100. Amino coupling kit (BR-1000-50), human antibody capture kit (BR-1008-39), CM5 chip (BR100012) and pH7.4 10×HBS-EP (BR100669) and other related reagents and consumables are available Purchased from GE healthcare. According to the kit instructions, use 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride, EDC) and N-hydroxyl Succinimide (N-Hydroxysuccinimide, NHS) activates the surface of the carboxylated CM5 chip. The anti-human IgG (Fc) antibody (capture antibody) is diluted with 10mM pH5.0 sodium acetate to 25μg/mL, and then the flow rate is 10μL/ min injection to achieve a coupling amount of approximately 10,000 response units (RU). After the capture antibody was injected, 1M ethanolamine was injected to block unreacted groups. For kinetic measurement, dilute the anti-TSLP antibody to 0.5-1 μg/mL and inject 10 μL/min to ensure that about 100RU of the antibody is captured by the anti-human Fc antibody. Then set hTSLP1-m-his to a series of concentration gradients (for example, 0.625nM, 1.25nM, 2.5nM, 5nM, 10nM), and inject from low concentration to high concentration at 30μL/min at 25°C, with a binding time of 120s. The dissociation time was 3600s, and the surface of the chip was regenerated by _{injecting 3M MgCl 2 solution at 10μL/min for 30s. Using Biacore X100 evaluation software version 2.0.1, the association rate (K on} ) and the dissociation rate (K _off ) were calculated by fitting the association and dissociation sensorgrams with a 1:1 association model. The dissociation equilibrium constant (KD) is calculated with the ratio K _off /K _on. The fitting results are shown in Table 1.

Table 1. The affinity constants of recombinant mouse anti-TSLP monoclonal antibodies for binding to hTSLP

To	K on	K off	KD
S2B1-IgG4	2.377E+6	2.188E-5	9.204E-12
S2G2-IgG4	1.353E+6	1.348E-5	9.967E-12
S2A10-IgG4	1.625E+6	2.374E-5	1.461E-11
S1A3-IgG4	4.695E+6	6.565E-5	1.398E-11
S1B3-IgG4	2.338E+6	2.737E-4	1.171E-10
S2E4-IgG4	1.636E+7	4.191E-3	2.563E-10
S2B9-IgG4	1.291E+6	1.437E-5	1.113E-11
Tezepelumab	1.27E+7	2.565E-5	2.019E-12

3.2 Recombinant mouse anti-TSLP monoclonal antibody inhibits the proliferation-promoting effect of TSLP on BAF3-TSLPR/IL-7Rα cells

BAF3-TSLPR/IL-7Rα is a stable transgenic cell line with high TSLPR expression, and it depends on mIL-3 for proliferation. In the absence of mIL-3, TSLP can effectively promote the proliferation of BA/F3-TSLPR/IL-7Rα cells. This method can effectively evaluate the inhibitory effect of anti-TSLP monoclonal antibodies on TSLP. In the experiment, BAF3-TSLPR/IL-7Rα cells were pre-cultured for two days with complete medium without mIL-3. On the day of the experiment, resuspend the cells by centrifugation to 1×10 ⁶ cells/mL, and add 50 μL/well to a 96-well flat-bottom cell culture plate; recombinant anti-TSLP monoclonal antibodies (S2B1, S1A3, S1B3, S2A10, S2B9, S2D10, S2E4, and S2G2) ) And the positive control antibody (Tezepelumab) both start with a final concentration of 60μg/mL, the second concentration is 30μg/mL, and the next 8 points are all 5-fold serial dilutions. The diluted anti-TSLP monoclonal antibody and the final concentration are 0.35ng/mL hTSLP-m-his was premixed in equal volume for 30min, and then mixed with BAF3-TSLPR/IL-7Rα cells and incubated with a total volume of 150μL/well. After 48h, use

Chemiluminescence cell viability assay kit (Promega, Cat#G7570), using multifunctional microplate reader

Detect cell proliferation. The results of chemiluminescence readings were used for fitting analysis. The results (Figure 1) showed that all recombinant anti-TSLP monoclonal antibodies and positive control antibody Tezepelumab can effectively inhibit the effects of TSLP.

3.3 Recombinant mouse anti-TSLP monoclonal antibody inhibits the secretion of TARC from PBMC by TSLP

The blood of normal volunteers (50 mL each) was collected. The blood collected was provided by the inventor and his colleagues as volunteers, and all volunteers had signed an informed consent form. The inclusion criteria for volunteers are:

1. Age over 18 years old;

2. No HIV or HBV infection;

3. Routine blood test is normal;

4. Non-pregnant or breastfeeding women.

The Ficoll density gradient centrifugation method was used to separate human peripheral blood mononuclear cells (PBMC) from healthy human peripheral blood.

The combination of TSLP and TSLPR on dendritic cells will cause the activation of dendritic cells. The activation of dendritic cells shows the secretion of chemokines (such as TARC, also known as CCL17). The detection of TARC can effectively evaluate the inhibitory effect of recombinant anti-TSLP antibody on TSLP. ^{Resuspend PBMC to 2.5×10 6} cells/mL in R1640 medium containing 10% (inactivated) serum, and add to a 96-well flat-bottom cell culture plate (50 μL/well). Recombinant anti-TSLP monoclonal antibodies (S2B1, S2A10, S2B9, and S2G2) and positive control antibodies (Tezepelumab) were all started with a final concentration of 1 nM, and were diluted 5-fold (a total of 8 concentration gradients). The diluted recombinant anti-TSLP monoclonal antibody is premixed with the final concentration of 0.08ng/mL hTSLP-m-his in equal volume for 30min, then added to the cells and mixed, the total volume is 200μL/well, at 37℃, 5% CO ₂ conditions Incubate for 24h. Then the supernatant was taken, and TARC was ^{detected with the human CCL17 (TARC) ELISA MAX TM} Deluxe kit (Biolegend, cat#441104), and the OD ₄₅₀ optical density value was determined with a microplate reader (Biotek, Cat#ELX800). Fitting analysis was performed based on the reading results, and the results (Figure 2) showed that both the recombinant anti-TSLP monoclonal antibody and the control antibody Tezepelumab can effectively inhibit the effect of TSLP.

Example 4: Humanized modification of mouse anti-TSLP monoclonal antibody

4.1 Humanization of mouse monoclonal antibodies

The mouse antibody S2B1 (the amino acid sequence of the heavy chain variable region is SEQ ID NO: 22; the amino acid sequence of the light chain variable region SEQ ID NO: 23) was humanized to reduce its immunogenicity. Compare the nucleic acid molecules encoding the heavy chain variable region (VH) and light chain variable region (VL) of S2B1 with the human antibody germline gene sequence in the IMGT database, and select the appropriate germline gene sequence to provide the coding antibody Select the appropriate J region gene sequence to provide the gene sequence encoding framework region 4 (FR4). This template can be selected based on a variety of factors, such as: the relative total length of the antibody, the size of the CDR region, the amino acid residues located at the junction between the antibody framework region (FR) and the hypervariable region (CDR), and the overall identity of the sequence. Origin and so on. The selected template can be a chimeric version of multiple sequences or can be a shared template, in order to maintain the proper conformation of the parental complementarity determining region (CDR) as much as possible. Two humanized versions of S2B1VH-h1 and S2B1VH-h2 were obtained by CDR grafting of the heavy chain variable region of S2B1; two humanized versions of S2B1VK-h1 and S2B1VK-h2 were obtained by CDR grafting of the light chain variable region of S2B1. According to the amino acid sequence of the humanized antibody, the antibody variable region gene is designed and synthesized, and cloned into the eukaryotic expression vector. S2B1VK-h1 and S2B1VK-h2 are combined with S2B1VH-h1 and S2B1VH-h2 to express human IgG4 full antibodies.

4.2 Humanized anti-TSLP monoclonal antibody affinity determination

With reference to Example 3.1, the affinity analysis of the S2B1 humanized monoclonal antibody was performed with Biacore X100, and the results are shown in Table 2.

Table 2. Affinity constants of S2B1 humanized monoclonal antibodies for binding to hTSLP

To	K on	K off	KD
S2B1	2.646E+6	3.179E-5	1.201E-11
S2B1VH-h1+S2B1VK-h2	1.394E+6	2.199E-4	1.577E-10

S2B1VH-h2+S2B1VK-h2	9.374E+5	2.011E-4	2.146E-10
S2B1VH-h1+S2B1VK-h1	3.895E+5	4.611E-3	1.183E-8
S2B1VH-h2+S2B1VK-h1	2.2E+5	5.672E-3	2.578E-8

Example 5: S2B1VK-h2 affinity maturation

5.1 S2B1VK-h2 affinity maturation transformation

In order to maintain the affinity of the parent antibody S2B1 and reduce the decrease in the affinity of the antibody to TSLP due to the FR transplantation of S2B1VK-h2, the humanized version of the S2B1VK-h2 sequence was used as a template to introduce parent amino acid back mutations at key positions in the framework region. . The purpose is to restore the affinity as much as possible while reducing the immunogenicity that may be caused by the mouse-derived amino acid. The S2B1VK-h2 back mutation library design scheme is shown in Table 3. Conventional molecular biology methods are used to construct an affinity maturation mutation library based on S2B1VK-h2, and the size of the library is 1.4×10E8. Based on the dual-vector presentation system (refer to Example 5 in Chinese Patent Application No. 201510097117.0 for the experimental technology process), based on the humanized version of the heavy chain S2B1VH-h1, through the method of solid phase screening, using hTSLP1-m-His A total of 3 rounds of screening were performed on the constructed S2B1VK-h2 backmutation library with antigen. Finally, affinity mature light chain variable region mutants L3E8 (SEQ ID NO: 24), L3F8 and L5E11 were obtained. The test results showed that the affinity of S2B1VH-h1+L3E8 was KD=7.458E-12.

Table 3. S2B1VK-h2 back mutation library design scheme

5.2 Identification of S2B1VK-h2 mutants

Expression S2B1VH-h1+L3E8, S2B1VH-h1+L3F8, S2B1VH-h1+L5E11. Refer to Example 3.2, use

Chemiluminescence cell viability assay kit (Promega, Cat#G7570) to detect cell proliferation, using a multifunctional microplate reader

Read the value. The results (Figure 3) showed that the affinity matured light chain mutant S2B1VH-h1+L3E8 could effectively inhibit the proliferation-promoting effect of TSLP on BAF3-TSLPR/IL-7Rα cells.

Example 6: De-DG and NG modification of S2B1VH-h1

6.1 Transformation of S2B1VH-h1 to DG and NG

In order to increase the degree of humanization of the humanized version of S2B1VH, S2B1VH-h1, and reduce the possible heterogeneity due to the deamination site, a mutation was designed in the CDR2 region of S2B1VH-h1, and the physicochemical properties and degree of humanization were both improved. For the S2B1VH-h1 mutant, the mutation library design scheme is shown in Table 4. Based on the dual-vector presentation system (refer to Example 5 in Chinese Patent Application No. 201510097117.0 for the experimental technology process), based on the affinity-matured light chain L3E8, through the method of solid phase screening, the hTSLP1-m-His antigen pair is used to construct The S2B1VH-h2-CDR2 mutation library was screened for a total of 3 rounds. Finally, the humanized mutants H1A10 (SEQ ID NO: 25), H1C8, H1D8 and H1E7 with increased humanization degree without NG and DG were obtained. The test results showed that the affinity KD of H1A10+L3E8 was 8.999E-12.

Table 4. S2B1VH-h1 mutation library design scheme

Original amino acid (Kabat numbering)	Design mutation	Degenerate codon
G53	GS	RGT
D54	DGSNATIV	RNC
G55	GSAT	RSC
N60	NASDTG	RVC
G61	GSATQ	RST/CAG
K64	KQ	MAG

6.2 Identification of de-DG and NG mutants of S2B1VH-h1

Express H1A10+L3E8, H1C8+L3E8, H1D8+L3E8, H1E7+L3E8. Refer to Example 3.2, use

Chemiluminescence cell viability assay kit (Promega, Cat#G7570) to detect cell proliferation, using a multifunctional microplate reader

Read the value. The results (Figure 4) showed that the anti-TSLP monoclonal antibody H1A10+L3E8 modified by de-DG and NG can effectively inhibit the proliferation of TSLP on BAF3-TSLPR/IL-7Rα cells.

Example 7: Construction of a mutant with increased humanization of the L3E8 light chain

7.1 Improve the degree of humanization

In order to improve the degree of humanization of the L3E8 light chain sequence, and to clarify the key amino acids that cause the affinity of S2B1VK-h2 to decrease during the FR transplantation process, humanized mutations were set in the L3E8 light chain framework region. The mutation positions were determined to be amino acids 21, 22, 45, 46, 47, 72, 78, 79, and 83 according to the chothia number. A total of 4 mutants were designed, namely L3E8-M1 (SEQ ID NO: 26), L3E8 -M2 (SEQ ID NO: 27), L3E8-M3 (SEQ ID NO: 28) and L3E8-M4 (SEQ ID NO: 29). Using conventional molecular biology methods, using L3E8 as template, introducing design mutations in the primer region, amplifying 4 mutants by overlap extension PCR method and cloning them into eukaryotic expression vector, with H1A10 heavy chain to express IgG4 version full antibody, human origin The degree of transformation is shown in Table 5.

Table 5. Analysis of the degree of humanization

7.2 Identification of L3E8 humanized mutants

7.2.1 Mutant affinity identification

Biacore S200 measures the binding affinity of different anti-TSLP antibodies to hTSLP. Use the amino coupling kit (BR-1000-50) to couple different anti-TSLP antibodies (H1A10+L3E8-M1, H1A10+L3E8-M2, H1A10+L3E8-M3, H1A10+L3E8-M4 and Tezepelumab) to the CM5 chip On the surface, the coupling amount is controlled at 500-550RU. The hTSLP1-m-his concentration gradients were 25nM, 12.5nM, 6.25nM, 3.125nM, 1.563nM, 0.781nM, 0.39nM, 0.195nM, 0.098nM, respectively. The binding time is 240s, and the dissociation time is 2400s. The surface of the chip was regenerated by injecting pH2.0 and 10mM glycine at 10μL/min for 30s. The fitting results are shown in Table 6.

Referring to Example 3.1, Biacore X100 was used to detect the binding affinity of humanized mutants of L3E8 (H1A10+L3E8-M1, H1A10+L3E8-M2, H1A10+L3E8-M3, H1A10+L3E8-M4 and Tezepelumab) to mfTSLP, and the fitting results As shown in Table 7.

Table 6. Humanized mutants of L3E8 bind hTSLP affinity constants

To	K on	K off	KD
Tezepelumab	4.901E+6	1.338E-5	2.832E-12
H1A10+L3E8-M1	1.001E+7	5.473E-5	5.466E-12
H1A10+L3E8-M2	5.185E+6	2.461E-5	4.747E-12
H1A10+L3E8-M3	3.243E+6	2.113E-5	6.515E-12
H1A10+L3E8-M4	3.334E+6	1.176E-5	3.528E-12

Table 7. Humanized mutants of L3E8 bind mfTSLP affinity constants

To	K on	K off	KD
Tezepelumab	1.211E+7	9.882E-5	8.163E-12
H1A10+L3E8-M1	4.074E+6	1.083E-2	2.658E-9
H1A10+L3E8-M2	3.719E+6	9.626E-3	2.588E-9
H1A10+L3E8-M3	4.4E+6	1.042E-2	2.369E-9
H1A10+L3E8-M4	4.027E+6	1.06E-2	2.632E-9

7.2.2 L3E8 humanized mutant inhibits the binding of TSLP to TSLPR on the cell surface

Add BAF3-TSLPR/IL-7Rα cells to ^{a V-bottom 96-well plate at 2×10 5} cells/well. Anti-TSLP monoclonal antibodies (H1A10+L3E8-M1 and S2B1) start at a final concentration of 400 nM, and are diluted 3 times. (10 concentration gradients, 100 μL/well), the diluent is PBS buffer containing 0.1 μg/mL hTSLP1-m-His, incubated at 4°C for 1 hour, and washed three times in PBS buffer. Will be anti 6×His tag

Antibody (FITC, abcam, cat#ab1206) was diluted 1:400 with PBS buffer, 100μL/well, incubated for 30min in the dark, washed with PBS buffer twice, and then 100μL/well was resuspended. Cells were resuspended using flow cytometer (Novocyte, 2060R) Detection of FL-1 fluorescence pathway. The results (Figure 5) showed that the humanized anti-TSLP monoclonal antibody can effectively block the combination of TSLP and TSLPR on the cell surface by fitting the analysis data with the average fluorescence intensity readings.

7.2.3 L3E8 humanized mutant inhibits TSLP's proliferation promotion effect on BAF3-TSLPR/IL-7Rα cells

Refer to Example 3.2, use

Chemiluminescence cell viability assay kit (Promega, Cat#G7570) to detect cell proliferation, using a multifunctional microplate reader

Read the value. The results (Figure 6) show that humanized mutants of L3E8 (H1A10+L3E8-M1, H1A10+L3E8-M2, H1A10+L3E8-M3 and H1A10+L3E8-M4) can effectively inhibit the effect of TSLP on BAF3-TSLPR/IL-7Rα Promoting cell proliferation.

7.2.4 L3E8 humanized mutant inhibits TSLP to stimulate PBMC to secrete TARC

Refer to Example 3.3, use the human CCL17 (TARC) ELISA MAX ^TM Deluxe kit (Biolegend, cat#441104) for TARC detection, use a microplate reader (Biotek, Cat#ELX800) to determine the OD ₄₅₀ optical density value, and fit the analysis data . The results (Figure 7) showed that the humanized mutants of L3E8 (H1A10+L3E8-M1, H1A10+L3E8-M2, H1A10+L3E8-M3 and H1A10+L3E8-M4) effectively inhibited TSLP's stimulation of PBMC secretion of TARC.

7.2.5 Combination of L3E8 humanized mutant with TSLP of different species

The prepared human TSLP (hTSLP1-m-mFc), cyno TSLP (mfTSLP1-m-mFc) and mouse TSLP (mTSLP-mFc) were respectively coated on a 96-well ELISA plate (1μg/mL, 100μL/well) , Coated overnight at 4°C. After blocking with blocking solution PBS-0.1% Tween20-3% milk at 37°C for 1 hour, each recombinant anti-TSLP monoclonal antibody (S2B1VH-h1+L3E8, H1A10+L3E8, H1A10+L3E8-M1, H1A10+L3E8- M2, H1A10+L3E8-M3, H1A10+L3E8-M4 and Tezepelumab), combined at 37°C for 1 hour. Wash the ELISA plate with PBST buffer, add HRP mouse anti-human IgG (bioss, bsm-0297M-HRP), and bind at 37°C for 1 hour. Wash the ELISA plate with PBST buffer, add OPD substrate color development solution, _{stop the color development with 1M H 2} SO ₄ after 5-10 minutes, and measure the 492nm/630nm dual-wavelength optical density value with a microplate reader. The ELISA analysis results (Figure 8) showed that all antibody molecules recognized hTSLP1, and all cross-recognized mfTSLP, but none of them recognized mTSLP.

7.2.6 Epitope comparison between L3E8 humanized mutant and Tezepelumab

The recombinant protein hTSLP1-m-his was coated on a 96-well plate (1 μg/mL, 100 μL/well), and coated overnight at 4°C. Then use fixed concentrations (0.05μg/ml) of human version antibodies (including Tezepelumab-IgG4 and four L3E8 humanized mutant antibody proteins (H1A10+L3E8-M1-IgG1m3, H1A10+L3E8-M2-IgG1m3, H1A10+ L3E8-M3-IgG1m3, H1A10+L3E8-M4-IgG1m3) were used to perform a serial dilution of Tezepelumab-mIgG2a (mouse constant region version). The initial concentration of the antibody Tezepelumab-mIgG2a was 200μg/mL, and the 3-fold dilution was performed in a total of 10 concentrations. Gradient. Then HRP mouse anti-human IgG (bioss, bsm-0297M-HRP) was used to detect the binding signals of Tezepelumab-IgG4 and L3E8 humanized mutants (IgG1m3 version) and TSLP. ELISA results (Figure 9) showed that Tezepelumab-mIgG2a The (mouse constant region version) can block Tezepelumab-IgG4 from binding to TSLP, but cannot effectively block the four humanized L3E8 mutants from binding to TSLP. Therefore, the four humanized L3E8 mutants bind to TSLP with different epitopes from Tezepelumab.

The exemplary embodiments of the various inventions of the present application are described above. However, without departing from the essence and scope of the present application, those skilled in the art can modify or improve the exemplary embodiments described in the present application. The resulting variants or equivalent solutions also belong to the scope of this application.

references

1. Leonard, W.J. (2002) TSLP is now revealed to be an important regulator of DC-mediated control of TH2-based human allergic responses, identifying a potential new species-specific function for this cytokine. Nat Immunol. 3,605

2.Liu, Y.J., Soumelis, V., Watanabe, N., et al. (2007) TSLP: an epithelial cell cytokine that regulates T cell differentiation by conditioning dendritic cell maturation. Annual Review of Immunology 25, 93-219.

3. Ziegler, S.F., Artis, D. (2010) Sensing the outside world: TSLP regulates barrier immunity. Nat Immunol 11,289-293.

4.Allakhverdi,Z.,Comeau,M.R.,Jessup,H.K.,et al. (2009)Thymic stromal lymphopoietin as a mediator of crosstalk between bronchial smooth muscle and mast cells.Journal of Allergy-960

5.Allakhverdi, Z., Comeau, MR, Jessup, HK, et al. (2007) Thymic stromal lymphopoietin is released by human epithelial cells in response to microbes, trauma, or inflammation and potentially most activated 204, 253-cells. J 258.

6. Lee, H.C., Ziegler, S.F. (2007) Inducible expression of the proallergic cytokine thymic stromal lymphopoietin in airway epithelial cells is controlled by NFκB. Proceedings of the 104, National Academy of Sciences.

7.Ying,S.,O"Connor,B.,Ratoff,J.,et al.(2005)Expression and cellularprovenanceofthymicstromallymphopoietin andchemokinesinpatientswithsevereasthmaandchronic obstructivepulmonaryofdisease.Journal Clinical Immunology 115, S9.

8. Gounni, A.S. (2007) Constitutive and inducible thymic stromal lymphopoietin expression in human airway smooth muscle cells: role in chronic obstructive pulse disease. American Journal of Physiology Lung-Celliular & Molecular 293, 375-Physiology

9.Ying,S.,O"Connor,B.,Ratoff,J.,et al.(2005).Thymic stromal lymphopoietin expression is increased in asthmatic airways and correlates with expression of th2-attractingchemokines and disease.Journal of Immunology 174,8183-8190.

10.Kashyap, M., Rochman, Y., Spolski, R., Samsel, L., et al. (2011) Thymic stromal lymphopoietin is produced by dendritic cells. The Journal of Immunology 187(3), 13-24.

11.Soumelis, V., Reche, P.A., Kanzler, H., et al. (2002) Human epithelial cells trigger dendritic cell mediator allergic inflammation by producing TSLP. Nat Immunol 3,673-680.

12. Watanabe, N., Hanabuchi, S., Soumelis, V., et al. (2004) Human thymic stromal lymphopoietin promotion dendritic cell-mediated CD4+T cell homeostatic expansion. Nat Immunol 5,426-434.

13.Moon,P.D.,Choi,I.H.,Kim,H.M.(2011) Naringenin suppresses the production of thymic stromal lymphopoietin through the blockade of RIP2 and caspase-1 signal cascade in mast-Pharmacology cells.128

14.Barton, G.M., Farr, A.G., et al. (2008) A mechanism for the initiation of allergen-induced T helper type 2 responses. Nature Immunology 9(3), 310-318.

15.He R, Geha, R.S. (2010) Thymic stromal Lymphopoietin.Ann NY Acad Sci 1183, 13-24.

16.Oyoshi, MK, Larson, RP, Ziegler, SF, et al. (2010) Mechanical injury polarizes skin dendritic cells to elicit a T(H) 2 response by inducing stromacutaneous thymic al lymphopoietin expression. Journal of 126, Immunology & 976 -984; e975.

17. Haiyan Tu, Xin Chen, Jing Li. (2007) Signal transduction in respiratory syncytial virus infection-induced thymic stromal lymphopoietin expression in human epithelial cells. Journal of Southern Medical University 27(10), 1581-1583.

18.Medoff,B.D.,Landry,A.L.,Wittbold,K.A.,et al.(2009)CARMA3 mediates lysophoshatidic acid-stimulated cytokine secretion by bronchial epithelial cells.American Journal of RespiratoryCell and 286

19.Park, LS, Martin, U., Garka, K., et al. (2000) Cloning of the Murine thymic stromal Lymphopoietin (TSLP) receptor: formation of a functional heteromeric complex requires interleukin 7 receptor. The Journal of Medicine Experiment 192,659–670.

20.He,S.H.,Liu,Z.Q.,Chen,X.,et al. (2011) IL-9+IL-10+T cells link immediate allergic response to late phase reaction. Clinical and experimental immunology 165, 29-37.

21.GINA Report, Global Strategy for Asthma Management and Prevention.Available from: http://www.ginasthma.com.

22. von Bülow, Anna, Kriegbaum, M., Backer, V., et al. (2014) The prevalence of severe asthma and low asthma control and Danish adults. The Journal of Allergy and Clinical Immunology: In Practice 2(6) , 759-673.

23. Reche, P.A., Soumelis, V.M., Gorman.D.M., et al. (2001) Human thyroid stromal lymphopoietin preferentially stimulates myeloid cells. The Journal of Immunology 167,336-343.

24. Zhou, B., Comeau, M.R., De, S.T., et al. (2005) Thymic stromal lymphopoietin as a key initiator of allergic airway inflammation in mice. Nat Immunol 6, 1047-1053.

25.Zhuang gui Chen, Tian tuo Zhang, Hong Tao Li, et al. (2013) Neutralization of TSLP inhibitors airway remodeling in a Murine model of allergic asthma induced by chronic exposure to house, e51 One.PLoS 268.

26.He,R.,Oyoshi,M.K.,Garibyan,L.,et al. (2008).TSLP acts on infiltrating effector T cells to drive allergic skin infection.Proc Natl Acad Sci USA 105(33), 11875-11880.

27.Corren,J.,Parnes,J.R.,Wang,L.,et al. (2017) Tezepelumab in Adults with Uncontrolled Asthma.New England Journal of Medicine 377(10),936-946.

Claims (12)

1. An antibody that binds to human TSLP, comprising a heavy chain variable region containing amino acid sequences of HCDR1, HCDR2 and HCDR3 and a light chain variable region containing amino acid sequences of LCDR1, LCDR2 and LCDR3, wherein

   The HCDR1 amino acid sequence is shown in SEQ ID NO: 30, the HCDR2 amino acid sequence is shown in SEQ ID NO: 31 or SEQ ID NO: 36, and the HCDR3 amino acid sequence is shown in SEQ ID NO: 32. The LCDR1 amino acid sequence is shown in SEQ ID NO: 33, the LCDR2 amino acid sequence is shown in SEQ ID NO: 34, and the LCDR3 amino acid sequence is shown in SEQ ID NO: 35;

   The amino acid sequences of HCDR and LCDR are defined by Kabat.
2. The antibody according to claim 1, wherein the amino acid sequence of the variable region of the heavy chain of the antibody is shown in SEQ ID NO: 22 or 25.
3. The antibody according to claim 1, wherein the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 23, 24, 26, 27, 28 or 29.
4. The antibody of claim 1, wherein

   The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 25, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 24; or

   The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 25, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 26; or

   The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 25, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 27; or

   The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 25, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 28; or

   The amino acid sequence of the heavy chain variable region of the antibody is shown in SEQ ID NO: 25, and the amino acid sequence of the light chain variable region of the antibody is shown in SEQ ID NO: 29.
5. An antibody that binds to human TSLP, wherein the amino acid sequence of the variable region of the heavy chain of the antibody has at least 90% homology with any one of SEQ ID NOs: 22 and 25, and the light chain of the antibody is The amino acid sequence of the variable region has at least 90% homology with any one of SEQ ID NO: 23, 24, 26, 27, 28 and 29.
6. The antibody of any one of claims 1-5, wherein

   The antibody can bind to recombinant human TSLP (SEQ ID NO: 1) and recombinant monkey TSLP (SEQ ID NO: 4); and/or

   The antibody inhibits the binding of human TSLP to the human TSLP receptor.
7. The antibody of any one of claims 1-6, wherein

   The antibody is a whole antibody, Fab fragment, F(ab') ₂ fragment or single chain Fv fragment (scFv), preferably, the antibody is a fully human antibody; and/or

   The antibody is a monoclonal antibody; and/or

   The antibody also includes a heavy chain constant region selected from the group consisting of IgG1 subtype, IgG2 subtype or IgG4 subtype; preferably, the heavy chain constant region includes the Fc segment sequence of a human IgG1 subtype heavy chain constant region and the Fc The amino acid sequences at positions 234, 235, and 331 of the sequence are F, E, and S respectively, and the sequence of the amino acid sequence of the antibody constant region is determined according to EU numbering; and/or

   The antibody also comprises a light chain constant region selected from the group consisting of κ subtype or λ subtype.
8. A nucleic acid molecule that encodes the antibody or antigen-binding portion thereof according to any one of claims 1-7.
9. A pharmaceutical composition comprising the antibody of any one of claims 1-7 and a pharmaceutically acceptable excipient, diluent or carrier.
10. The pharmaceutical composition according to claim 9, which is used to prevent or treat TSLP-mediated diseases; preferably, the TSLP-mediated diseases are autoimmune diseases or inflammatory diseases, such as asthma, scleroderma, Systemic lupus erythematosus, rheumatoid arthritis, Churg-Strauss syndrome, Wegener's granulomatosis, pulmonary hemorrhage-nephritis syndrome, allergic pneumonia, atopic dermatitis, rhinitis, Crohn's disease, ankylosing spondylitis , Rheumatic fever, fibromyalgia, psoriatic arthritis, chronic nephritis, Sjogren’s syndrome and multiple sclerosis.
11. Use of the antibody according to any one of claims 1-7 or the pharmaceutical composition according to claim 9 or 10 in the preparation of a medicament for the prevention or treatment of TSLP-mediated diseases; preferably, the TSLP Mediated diseases are autoimmune diseases or inflammatory diseases, such as asthma, scleroderma, systemic lupus erythematosus, rheumatoid arthritis, Churg-Strauss syndrome, Wegener's granulomatosis, pulmonary hemorrhage-nephritis syndrome , Allergic pneumonia, atopic dermatitis, rhinitis, Crohn's disease, ankylosing spondylitis, rheumatic fever, fibromyalgia, psoriatic arthritis, chronic nephritis, Sjogren's syndrome, multiple sclerosis, etc. .
12. A method for preventing or treating TSLP-mediated diseases, which comprises administering the antibody according to any one of claims 1-7 or the pharmaceutical composition according to claim 9 or 10 to an individual in need; preferably, the The TSLP-mediated diseases are autoimmune diseases or inflammatory diseases, such as asthma, scleroderma, systemic lupus erythematosus, rheumatoid arthritis, Churg-Strauss syndrome, Wegener’s granulomatosis, pulmonary hemorrhage-nephritis Syndrome, allergic pneumonia, atopic dermatitis, rhinitis, Crohn’s disease, ankylosing spondylitis, rheumatic fever, fibromyalgia, psoriatic arthritis, chronic nephritis, Sjogren’s syndrome, and multiple Hardening etc.

Images