WO2021152586A1

WO2021152586A1 - Methods of analyzing microbiome, immunoglobulin profile and physiological state

Info

Publication number: WO2021152586A1
Application number: PCT/IL2021/050096
Authority: WO
Inventors: Eran Segal
Original assignee: Yeda Research And Development Co. Ltd.
Priority date: 2020-01-30
Filing date: 2021-01-28
Publication date: 2021-08-05

Abstract

A method of predicting a microbiome profile of a subject is provided. The method comprising: (a) providing a phage display library comprising phages displaying on their surface peptides of a microbiome of a mammalian host, wherein the phage display library comprises the peptides at a frequency above a predetermined threshold; (b) contacting the library with a biological sample of the subject, the biological sample comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides; (c) isolating immunecomplexes resultant of the immunocomplexation; and (d) identifying peptides in the immunocomplexes, the peptides being indicative of the microbiome of the subject.

Description

METHODS OF ANALYZING MICROBIOME, IMMUNOGLOBULIN PROFILE AND PHYSIOLOGICAL STATE

RELATED APPLICATION/S

This application claims the benefit of priority from U.S. Provisional Patent Application No. 62/967,611, filed on January 30, 2020, which is hereby incorporated by reference in its entirety.

SEQUENCE LISTING STATEMENT

The ASCII file, entitled 85622 Sequence Listing.txt, created on 27 January 2021, comprising 1,953 bytes, submitted concurrently with the filing of this application is incorporated herein by reference.

FIELD AND BACKGROUND OF THE INVENTION

The present invention, in some embodiments thereof, relates to methods of analyzing microbiome, immunoglobulin profile and physiological state.

Antigen array technologies enable large-scale profiling of the specificity of antibody responses against autoantigens, tumor antigens and microbial antigens including viral antigens. Antibody profiling provides insights into pathogenesis, and enables development of novel tests for diagnosis and guiding therapy in the clinic. Recent advances in the field include development of antigen array-based approaches to examine immune responses against antigens encoded in genetic libraries, post-translationally modified proteins, and other biomolecules such as lipids. A promising application is the use of antibody profiling to guide development and selection of antigen-specific therapies to treat autoimmune disease.

Profiling of antibodies against microbiota has thus far been neglected. The number of microorganisms on healthy individuals is equivalent to the number of body cells requiring an orchestrated immune response to maintain homeostasis. As major part of the adaptive immune system, humans produce over 2 g of antibodies per day vastly targeting gut microbiota. Despite significant progress in understanding microbiota driven immunity in animal models, it is vastly unknown which antibody repertoires humans possess, which antigens they are targeting, and how these responses affect health and disease.

Conventional antigen detection methods such as ELISAs and peptide arrays can cover hundreds to thousands of antigens. However, the microbiome represents a much greater space of potential antigens as humans bear hundreds to thousands of bacterial species (Pasolli et al., 2019) with each bacterium displaying several thousands of proteins in its genome resulting overall in millions of potential protein antigens.

Next generation sequencing has allowed to study the DNA sequences displaying B cell immune receptors in great depth (e.g. Briney et al., Soto et al., Bashford-Rogers et al., 2019). While these studies have provided valuable insights into immune cells’ clonality and diversity, the actual antigens recognized and the functional consequences of varying immune repertoires are unknown.

Hence there is a lack in understanding of, and ability, to study this ‘dark matter’ of the antigenic space of the microbiome and the functional consequences of human antibody repertoires.

Additional background art includes:

US Patent Application No. 20190055545.

SUMMARY OF THE INVENTION According to an aspect of some embodiments of the present invention there is provided a method of predicting a microbiome profile of a subject, the method comprising:

(a) providing a phage display library comprising phages displaying on their surface peptides of a microbiome of a mammalian host, wherein the phage display library comprises the peptides at a frequency above a predetermined threshold; (b) contacting the library with a biological sample of the subject, the biological sample comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides;

(c) isolating immunecomplexes resultant of the immunocomplexation; and

(d) identifying peptides in the immunocomplexes, the peptides being indicative of the microbiome of the subject.

According to an aspect of some embodiments of the present invention there is provided a method of predicting an immunoglobulin profile of a subject, the method comprising:

(a) providing a phage display library comprising phages displaying on their surface peptides of a microbiome of a mammalian host, wherein the phage display library comprises the peptides at a frequency above a predetermined threshold;

(b) contacting the library with a biological sample of the subject, the biological sample comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides;

(c) isolating immunecomplexes resultant of the immunocomplexation; and (d) identifying peptides in the immunocomplexes, the peptides being indicative of an immunoglobulin profile of the subject.

According to an aspect of some embodiments of the present invention there is provided a method of identifying a pathogenic microbe, the method comprising: (a) providing a phage display library comprising phages displaying on their surface peptides of a microbiome of a mammalian host, wherein the phage display library comprises the peptides at a frequency above a predetermined threshold;

(b) contacting a plurality of aliquots of the library with biological samples of a plurality subjects, the biological samples comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides;

(c) isolating immunecomplexes resultant of the immunocomplexation; and

(d) identifying peptides in the immunocomplexes, shared by at least a portion of the plurality of subjects, the peptides are of a putative pathogenic microbe. According to an aspect of some embodiments of the present invention there is provided a method of identifying a disease in a subject in need thereof, the method comprising:

(a) providing a phage display library comprising phages displaying on their surface peptides of a microbiome of a mammalian host and at least one additional class of peptides selected from the group consisting of: peptides of microbial or viral pathogens, peptides of allergens, peptides of autoantigens and peptides of disease-associated antigens, wherein the phage display library comprises the peptides of the microbiome of a mammalian host and/or the at least one additional class of peptides at a frequency above a predetermined threshold;

(c) isolating immunecomplexes resultant of the immunocomplexation; and

(d) identifying peptides in the immunocomplexes, the peptides being indicative of disease in the subject.

According to an aspect of some embodiments of the present invention there is provided a method of analyzing a physiological state of a subject, the method comprising:

(a) predicting a microbiome profile of the subject as described herein;

(b) providing a microbiome profile of a healthy subject generated as described herein, the healthy subject having known physiological parameters; and (c) comparing the microbiome profile of (a) and the microbiome profile of (b) wherein an alteration in the profile is indicative of a physiological state of the subject.

According to some embodiments of the invention, the physiological state comprises at least one of the physiological parameters selected from the group consisting of age, BMI and inflammation marker(s).

According to some embodiments of the invention, the phage display library display at least one additional class of peptides selected from the group consisting of: peptides of microbial pathogens, peptides of allergens, peptides of autoantigens and peptides of disease-associated antigens at a frequency above a predetermined threshold. According to some embodiments of the invention, the subject is a human subject.

According to some embodiments of the invention, the peptides in the immunocomplexes represent public epitopes.

According to some embodiments of the invention, the peptides in the immunocomplexes represent private epitopes. According to some embodiments of the invention, the immunoglobulins in the immunocomplexes are stable in the subject for at least 1.5 years.

According to some embodiments of the invention, the immunoglobulins in the immunocomplexes are indicative of an immunological memory.

According to some embodiments of the invention, the biological sample comprises serum. According to some embodiments of the invention, the immunoglobulins comprise predominantly of IgG.

According to some embodiments of the invention, the isolating comprises immunoprecipitati on .

According to some embodiments of the invention, the immunoprecipitation is effected with protein A/G/L.

According to some embodiments of the invention, the peptides are 50-80 amino acids long.

According to some embodiments of the invention, the identifying is effected by next generation sequencing. According to some embodiments of the invention, a size of the library is at least 100,000 peptides.

According to some embodiments of the invention, the predetermined threshold is at least 0.1 %, 1 %, 5 %, 10 % or more. Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)

Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

In the drawings:

FIGs. 1A-D (a) Antibody reactivities against microbiota epitopes are identified via high throughput phage display immuno-precipitation (IP) sequencing (b) The library of 244,000 epitopes is derived from a wide range of antigens including positive controls form the IEBD (immune epitope database), toxins from the virulence factor database (VFDB), probiotic strains, gut pathogens, IgA coated bacteria from the literature (Palm et al., 2014), as well as commensal gut microbiota (Zeevi et al., 2015). (c) Excellent enrichments and reproducibility between technical duplicates of a phage IP negative control without antibodies (left) and antibodies from a serum sample of a healthy human (right) (d) Specificity of the system. To check the signal to noise in the system, according to some embodiments of the invention, a reaction with serum addition (left) was compared to mock reaction without serum (right). While in the mock there are no significant enrichments, in the sample with serum hundreds variants passing the significant threshold of p-value including microbiota epitopes are detected.

FIGs. 2A-D show antibody binding against 244,000 microbiota epitopes in ca. 950 individuals (a) On average ca. 800 epitopes are significantly enriched per individual (b) Healthy individuals’ antibody repertoires recognize private (occurring only in single individuals) and public (occurring in several individuals) epitopes stemming from diverse groups of commensal, pathogenic and probiotic bacteria (c/d) A single individual’s antibody repertoire shows high stability over 1 week (c) and surprisingly also over 1.5 years (d). FIG. 3 is a general scheme of the approach for allergen-specific antibody profiling according to some embodiments of the invention (similar to Figure 1A but not restricted to microbiome antigens). Specifically, shown is an outline for high-throughput allergen detection using synthetic allergen libraries and phage display. The schematic was adapted from Weingarten-Gabbay et al. (Science, 2016).

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

The present invention, in some embodiments thereof, relates to methods of analyzing microbiome, immunoglobulin profile and physiological state. Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

Whilst conceiving embodiments of the invention, the present inventors combined the robustness of phage display libraries with next generation sequencing to identify microbiome profiles of as many as thousands of subjects allowing the elucidation of microbial epitopes, pathogenic microbes, the immune state of the subjects and physiological state in general by combining this tool with other known physiological parameters as well as correlation with disease state and prediction of disease onset.

Thus according to an aspect of the invention there is provided a method of predicting a microbiome profile of a subject, the method comprising:

(b) contacting the library with a biological sample of the subject, the biological sample comprising immunoglobulins, wherein the contacting is performed under conditions which allow specific immunocomplexation between the immunoglobulins and the peptides; (c) isolating immunecomplexes resultant of the immunocomplexation; and

As used herein, the term “microbiome” refers to the totality of microbes (bacteria, fungae, protists), their genetic elements (e.g., genomes or expression products thereof) in a defined environment.

The microbiome can be of any body part including but not limited to the digestive tract, nose, mouth, lung, gut, genito-urinary tract, and skin.

As used herein “a microbiome profile” relates to the identity and/or relative occurrence of a microbe within a microbiome sample.

According to a particular embodiment, the microbiome is a gut microbiome (i.e. microbiota of the gastrointestinal (GI)). In one embodiment, the environment is the small intestine. In another embodiment the environment is the large intestine. The microbiome may be of the lumen or the mucosa of the small intestine or large intestine. In still another embodiment, the gut microbiome is a fecal microbiome.

According to some embodiments, the microbiome comprises commensal bacteria, gut pathogens, probiotic strains, bacteria known to be coated with antibodies and a combination of same.

As used herein “a biological sample” refers to a sample which comprises immunoglobulins.

Typically the biological sample comprise a blood sample, however other biological samples are contemplated herein, for example, e.g., whole blood, fractions thereof, serum, plasma.

In some embodiments, the biological sample is treated to remove cells or other biological particulates. Methods for removing cells from a blood or other biological sample are well known in the art and can include e.g., centrifugation, ultrafiltration, immune selection, or sedimentation etc. Immunoglobulins (antibodies) can be detected from a biological sample or a sample that has been treated as described above or as known to those of skill in the art. Some non-limiting examples of biological samples include a blood sample, a urine sample, a semen sample, a lymphatic fluid sample, a cerebrospinal fluid sample, a plasma sample, a serum sample, a pus sample, an amniotic fluid sample, a bodily fluid sample, a stool sample, a biopsy sample, a needle aspiration biopsy sample, a swab sample, a mouthwash sample, a cancer sample, a tumor sample, a tissue sample, a cell sample, a synovial fluid sample, or a combination of such samples. For the methods described herein, it is preferred that a biological sample is from whole blood, plasma, cerebral spinal fluid, serum, and/or urine.

As used herein the term “subject” refers to a mammalian subject (e.g. mouse, cow, dog, cat, horse, monkey, human), preferably human.

In one embodiment, the subject is a healthy subject.

In another embodiment, the subject is unhealthy.

Thus, in some embodiments, samples can be obtained from an individual with a disease or pathological condition. In one embodiment, the disease or pathological condition is one that is suspected of having an infectious disease, e.g., a common viral, bacterial or fungal origin. Some exemplary disease or pathological conditions include, but not limited to: a blood disorder, blood lipid disease, autoimmune disease, bone or joint disorder, a cardiovascular disorder, respiratory disease, endocrine disorder, immune disorder, infectious disease, muscle wasting and whole body wasting disorder, neurological disorders including neurodegenerative and/or neuropsychiatric diseases, skin disorder, kidney disease, scleroderma, stroke, hereditary hemorrhage telangiectasia, diabetes (e.g., Type I or Type II diabetes), disorders associated with diabetes (e.g., PVD), hypertension, Gaucher's disease, Kawasaki disease, Bell's palsy, Meniere's disease, juvenile idiopathic arthritis, chronic fatigue syndrome, Gulf War illness, Myasthenia Gravis, IgG4 disease, cystic fibrosis, sickle cell anemia, liver disease, pancreatic disease, eye, ear, nose and/or throat disease, diseases affecting the reproductive organs, gastrointestinal diseases (including diseases of the colon, diseases of the spleen, appendix, gall bladder, and others), metabolic syndrome, diabetes, obesity, NASH, NAFLD and the like. For further discussion of human diseases, see Mendelian Inheritance in Man: A Catalog of Human Genes and Genetic Disorders by Victor A. McKusick (12th Edition (3 volume set) June 1998, Johns Hopkins University Press, ISBN: 0801857422), the entirety of which is incorporated herein. Preferably, samples from a normal demographically matched individual and/or from a non disease sample from a patient having the disease are used in the analysis to provide controls. The samples can comprise a plurality of cells from individuals sharing a trait. For example, the trait shared can be gender, age, pathology, predisposition to a pathology, exposure to an infectious disease (e.g., HIV), kinship, death from the same disease, treatment with the same drug, exposure to chemotherapy, exposure to radiotherapy, exposure to hormone therapy, exposure to surgery, exposure to the same environmental condition (e.g., such as carcinogens, pollutants, asbestos, TCE, perchlorate, benzene, chloroform, nicotine and the like), the same genetic alteration or group of alterations, expression of the same gene or sets of genes (e.g., samples can be from individuals sharing a common haplotype, such as a particular set of HLA alleles), and the like.

According to a specific embodiment, the disease is an inflammatory bowel disease, i.e., Crohn’s disease or colitis.

In one embodiment, the subject is a single subject.

In another embodiment, the subject refers to a plurality of subjects, e.g., more than 10, 100, 1000 subjects, also termed as population. In which case the samples can be individually analyzed or pooled.

Duplicates, triplicates and the like can be used to improve the quality of detection.

Providing a phage display library displaying on their surface peptides of the microbiome of a mammalian host can be done using methods known in the art.

It will be appreciated that although phage display is detailed herein, other display libraries can be used, e.g., a yeast display library, a bacterial display library, a retroviral display library, a ribosome display library or an mRNA display library. It is within the skills of one of ordinary skill in the art to apply the methods and assays exemplified herein using a phage display library to the use of a different type of display library.

General methods for producing a phage display library are known to those of skill in the art and/or are described in e.g., Larman et al. (2011) Nature Biotechnology 29(6); 535-541, which is incorporated herein by reference in its entirety.

Contemplated herein are phage display libraries that comprise a plurality of peptides derived from a plurality of microbes, such as bacteria, fungi and other single cell organisms of the mammalian microbiome.

In one embodiment, it is contemplated herein that the plurality of peptides will represent a substantially complete set of peptides from a group of microbial organisms of a microbiome. In one embodiment, the phage display library comprises a substantially complete set of peptides a microbiome or a subgroup thereof. As used herein, the term "subgroup" refers to a related grouping of viruses, bacteria or fungi that would benefit from simultaneous testing. For example, one of skill in the art can generate a phage display library comprising a substantially complete set of peptides from a genus of microbes of a microbiome.

In some embodiments, the phage display library comprises at least 500, at least 1000, at least 5000, at least 10,000, at least 20,000, at least 30,000, at least 40,000, at least 50,000, at least 60,000, at least 70,000, at least 80,000, at least 100,000, at least 150,000, at least 200,000, peptide sequences or more. It will be appreciated by one of ordinary skill in the art that as the length of the individual peptide sequences increase, the total number of peptide sequences in the library can decrease without loss of any microbial sequences (and vice versa).

In some embodiments, the phage display library comprises peptides derived from at least 10 protein sequences (e.g., viral protein sequences), at least 20 protein sequences, at least 30 protein sequences, at least 40 protein sequences, at least 50 protein sequences, at least 60 protein sequences, at least 70 protein sequences, at least 80 protein sequences, at least 90 protein sequences, at least 100 protein sequences, at least 200 protein sequences, at least 300 protein sequences, at least 400 protein sequences, at least 500 protein sequences, at least 600 protein sequences, at least 700 protein sequences, at least 800 protein sequences, at least 900 protein sequences, at least 1000 protein sequences, at least 2000 protein sequences, at least 3000 protein sequences, at least 4000 protein sequences, at least 5000 protein sequences, at least 6000 protein sequences, at least 6500 protein sequences, at least 7000 protein sequences, at least 7500 protein sequences, at least 8000 protein sequences, at least 8500 protein sequences, at least 9000 protein sequences, at least 10,000 protein sequences or more.

In some embodiments, the phage display library comprises a plurality of proteins sequence that have less than 90% shared identity; in other embodiments the plurality of protein sequences have less than 85% shared identity, less than 80% shared identity, less than 75% shared identity, less than 70% shared identity, less than 65% shared identity, less than 60% shared identity, less than 55% shared identity, less than 50% shared identity or even less.

In some embodiments, the phage display library comprises protein sequences from at least 3 unique microbes or at least 5 unique microbes (e.g., 5 unique viruses, 5 unique bacteria, or 5 unique fungi); in other embodiments the library comprises protein sequences from at least 10, at least 20, at least 50, at least 75, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least, 5000, at least 10,000, at least 20,000 unique microbes up to and including protein sequences from all microbes of a microbiome of a human or other mammal.

In some embodiments, the protein sequences of the phage display library are at least 10 amino acids long; in other embodiments the protein sequences are at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450 amino acids or more in length.

In some embodiments, each peptide of the phage library overlaps at least one other peptide by at least 5 amino acids. In other embodiments, each peptide of the phage library overlaps at least one other peptide by at least 10, at least 15, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 32, at least 35, at least 40 amino acids or more.

In some embodiments, the display library comprises at least 2 peptides from a human microbiome databases. In other embodiments, the display library comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000 peptides or more as selected in any desired combination from a human microbiome database.

In some embodiments, the display library comprises peptides of a microbiome at a frequency above a predetermined threshold of at least, 0.1 %, 1 %, 5 %, 10 % or more.

In some embodiments, the display library comprises peptides of a microbiome at a frequency above a predetermined threshold of 50 %, 60 %, 70 %, 80 %, 90 % or more 95 % or even 100 %, meaning that all the peptides in the library are derived from a microbiome.

In certain embodiments, the display library can comprise peptides from at least 1 family or sub-family (e.g., Bacillus) of related viruses. In other embodiments, the display library can comprise peptides from at least 2 families, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 peptides from at least 1 family or sub-family.

According to a specific embodiment, the peptides are of microbiota antigens (interchangeably used with “the peptides”).

Oligonucleotides library synthesis can be done using methods which are well known in the art.

One approach is to develop a library according to Larman, H. Benjamin, et al. "Autoantigen discovery with a synthetic human peptidome." Nature Biotechnology 29: 535-541 (2011).

Thus, a sample comprising the display library, for example, and optionally additional buffers, salts, osmotic agents, etc. to facilitate the formation of immunecomplexes between the peptides in the phage display library when the reaction sample is contacted with a biological sample comprising the immunoglobulins.

As used herein “immunocomplexation” refers to the formation of antibody-antigen complexes based on antibody-epitope recognitions, which is mediated by the complementary determining regions (CDRs) of the antibody. Following sufficient time of incubation the peptides in the immunocomplexes are recovered.

In some embodiments, the methods and assays described herein comprise a step of contacting the phage display library as described herein with a biological sample that comprises, or is suspected of comprising, at least one antibody. To separate the bacteriophage(s) bound to an antibody in the biological sample from any free bacteriophage(s) that are not bound to an antibody in the sample, antibodies from the reaction sample are immobilized on a solid support to permit one to separate out the unbound phage. Antibody immobilization can be achieved using methods routine to those of ordinary skill in the art. Essentially any method that permits one to specifically immobilize IgM, IgA, or IgG subclasses (e.g., IgG4) can be used to immobilize antibodies from the sample, including antibodies that are complexed to one or more bacteriophage. In some embodiments, Protein A, Protein G or a combination thereof is/are used to immobilize the antibody to permit removal of unbound phage. Such methods are known to those of ordinary skill in the art and as such are not described in detail herein.

In some embodiments, the peptide or protein used to immobilize antibodies from the reaction mixture can be attached to a solid support, such as, for example, magnetic beads (e.g., micron-sized magnetic beads), Sepharose beads, agarose beads, a nitrocellulose membrane, a nylon membrane, a column chromatography matrix, a high performance liquid chromatography (HPLC) matrix or a fast performance liquid chromatography (FPLC) matrix for purification. This step is also referred to herein as immunoprecipitation. For example, the reaction mixture comprising the library and antibodies can be contacted with magnetic beads coated with Protein A and/or Protein G. The Protein A and G will bind to antibodies in the mixture and immobilize them on the beads. This process also immobilizes any phage particles bound by the antibodies. In one embodiment, a magnet can be used to separate the immobilized phage from unbound phage. Magneitc beads systems are widely available e.g., DYNABEADS™, BIOMAG™ Streptavidin, MPG7 Streptavidin, Streptavidin MAGNESPHERE™, Streptavidin Magnetic Particles, AFFINITIP™, any of the MAGA™ line of magnetizable particles, BIOMAG™. Superparamagnetic Particles, or any other magnetic bead to which a molecule (e.g., an oligonucleotide primer) may be attached or immobilized.

Following a step to remove any unbound phage, the peptides in the bound phage/antibody complexes can be identified using methods which are well known in the art. Although not necessary, the bound phage/antibody complexes can first be released from the solid support using appropriate conditions e.g., temperature, pH, etc. In some embodiments, the sample is subjected to conditions that will permit lysis of the phage (e.g., heat denaturation). In one embodiment, the nucleic acids from the lysed phage is subjected to an amplification reaction, such as a PCR reaction. In one embodiment, the nucleic acids encoding a phage- displayed peptide comprise a common adapter sequence for PCR amplification. In such embodiments, a PCR primer is designed to bind to the common adapter sequence for amplification of the DNA corresponding to a phage-displayed peptide.

In some embodiments, a detectable label is used in the amplification reaction to permit detection of different amplification products. As used herein, "label" or "detectable label" refers to any atom or molecule which can be used to provide a detectable (preferably quantifiable) signal, and which can be operatively linked to a polynucleotide, such as a PCR primer. Labels may provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, mass spectrometry, binding affinity, hybridization radiofrequency, nanocrystals and the like. A primer of the present invention may be labeled so that the amplification reaction product may be "detected" by "detecting" the detectable label. "Qualitative or quantitative" detection refers to visual or automated assessments based upon the magnitude (strength) or number of signals generated by the label. A labeled polynucleotide (e.g., an oligonucleotide primer) according to the methods of the invention can be labeled at the 5' end, the 3' end, or both ends, or internally. The label can be "direct", e.g., a dye, or "indirect", e.g., biotin, digoxin, alkaline phosphatase (AP), horse radish peroxidase (HRP). For detection of "indirect labels" it is necessary to add additional components such as labeled antibodies, or enzyme substrates to visualize the captured, released, labeled polynucleotide fragment. In a preferred embodiment, an oligonucleotide primer is labeled with a fluorescent label. Suitable fluorescent labels include fluorochromes such as rhodamine and derivatives (such as Texas Red), fluorescein and derivatives (such as 5-bromomethyl fluorescein), Lucifer Yellow, IAEDANS, 7-Me.sub.2N-coumarin-4-acetate, 7-OH-4-CH. sub.3 -coumarin-3 -acetate, 7- NH. sub.2-4-CH3-coumarin-3 -acetate (AMCA), monobromobimane, pyrene tri sulfonates, such as Cascade Blue, and monobromorimethyl-ammoniobimane (see for example, DeLuca, Immunofluorescence Analysis, in Antibody As a Tool, Marchalonis, et ah, eds., John Wiley & Sons, Ltd., (1982), which is incorporated herein by reference).

The methods described herein can benefit from the use of labels including, e.g., fluorescent labels. In one aspect, the fluorescent label can be a label or dye that intercalates into or otherwise associates with amplified (usually double-stranded) nucleic acid molecules to give a signal. One stain useful in such embodiments is SYBR Green (e.g., SYBR Green I or II, commercially available from Molecular Probes Inc., Eugene, Oreg.). Others known to those of skill in the art can also be employed in the methods described herein. An advantage of this approach is reduced cost relative to the use of, for example, labeled nucleotides.

As used herein, the term "amplified product" refers to polynucleotides which are copies of a portion of a particular polynucleotide sequence and/or its complementary sequence, which correspond in nucleotide sequence to the template polynucleotide sequence and its complementary sequence. An "amplified product," can be DNA or RNA, and it may be double- stranded or single-stranded.

In an exemplary embodiment, the phage are lysed by heat denaturation and PCR is used to amplify the DNA region corresponding to the displayed peptide sequence. One of the PCR primers contains a common adaptor sequence which can be amplified in a second PCR reaction by another set of primers to prepare the DNA for ILLUMINA™ high throughput sequence. Unique barcoded oligonucleotides in the second PCR reaction are used to amplify different samples and pool them together in one sequencing run to e.g., reduce cost and/or permit simultaneous detection of multiple phage-displayed peptides.

In certain embodiments, the detection of a phage-displayed peptide comprises high throughput detection of a plurality of peptides simultaneously, or near simultaneously. In some embodiments, the high-throughput systems use methods similar to DNA sequencing techniques.

A number of DNA sequencing techniques are known in the art, including fluorescence- based sequencing methodologies (See, e.g., Birren et ah, Genome Analysis: Analyzing DNA, 1, Cold Spring Harbor, N.Y.). In some embodiments, automated sequencing techniques understood in the art are utilized. In some embodiments, the high-throughput systems described herein use methods that provide parallel sequencing of partitioned amplicons (e.g., W02006084132). In some embodiments, DNA sequencing is achieved by parallel oligonucleotide extension (See, e.g., U.S. Pat. No. 5,750,341, and U.S. Pat. No. 6,306,597). Additional examples of sequencing techniques include the Church polony technology (Mitra et ah, 2003, Analytical Biochemistry 320, 55-65; Shendure et ah, 2005 Science 309, 1728-1732; U.S. Pat. No. 6,432,360, U.S. Pat. No. 6,485,944, U.S. Pat. No. 6,511,803), the 454 picotiter pyrosequencing technology (Margulies et ah, 2005 Nature 437, 376-380; US 20050130173), the Solexa single base addition technology (Bennett et ah, 2005, Pharmacogenomics, 6, 373-382; U.S. Pat. No. 6,787,308; U.S. Pat. No. 6,833,246), the Lynx massively parallel signature sequencing technology (Brenner et al. (2000). Nat. Biotechnol. 18:630-634; U.S. Pat. No. 5,695,934; U.S. Pat. No. 5,714,330), and the Adessi PCR colony technology (Adessi et al. (2000). Nucleic Acid Res. 28, E87; WO 00018957). Next-generation sequencing (NGS) methods share the common feature of massively parallel, high-throughput strategies, with the goal of lower costs in comparison to older sequencing methods (see, e.g., Voelkerding et al., Clinical Chem., 55: 641-658, 2009; MacLean et al., Nature Rev. Microbiol., 7:287-296). NGS methods can be broadly divided into those that typically use template amplification and those that do not. Amplification-requiring methods include pyrosequencing commercialized by Roche as the 454 technology platforms (e.g., GS 20 and GS FLX), the Solexa platform commercialized by ILLUMINA™, and the Supported Oligonucleotide Ligation and Detection™ (SOLiD) platform commercialized by APPLIED BIOSYSTEMS™. Non-amplification approaches, also known as single-molecule sequencing, are exemplified by the HELISCOPE™ platform commercialized by HELICOS BIOSYSTEMS™, and emerging platforms commercialized by VISIGEN™, OXFORD NANOPORE TECHNOLOGIES LTD., and PACIFIC BIOSCIENCES™, respectively. In pyrosequencing (Voelkerding et al, Clinical Chem., 55: 641-658, 2009; MacLean et al., Nature Rev. Microbial., 7:287-296; U.S. Pat. No. 6,210,891; U.S. Pat. No. 6,258,568), template DNA is fragmented, end-repaired, ligated to adaptors, and clonally amplified in-situ by capturing single template molecules with beads bearing oligonucleotides complementary to the adaptors. Each bead bearing a single template type is compartmentalized into a water-in-oil microvesicle, and the template is clonally amplified using a technique referred to as emulsion PCR. The emulsion is disrupted after amplification and beads are deposited into individual wells of a picotitre plate functioning as a flow cell during the sequencing reactions. Ordered, iterative introduction of each of the four dNTP reagents occurs in the flow cell in the presence of sequencing enzymes and luminescent reporter such as luciferase. In the event that an appropriate dNTP is added to the 3' end of the sequencing primer, the resulting production of ATP causes a burst of luminescence within the well, which is recorded using a CCD camera. It is possible to achieve read lengths greater than or equal to 400 bases, and 10. sup.6 sequence reads can be achieved, resulting in up to 500 million base pairs (Mb) of sequence.

In the SOLEXA/ILLUMINA platform (Voelkerding et al., Clinical Chem., 55. 641-658, 2009; MacLean et al., Nature Rev. Microbial., 7:287-296; U.S. Pat. No. 6,833,246; U.S. Pat. No. 7,115,400; U.S. Pat. No. 6,969,488), sequencing data are produced in the form of shorter-1 ength reads. In this method, single-stranded fragmented DNA is end-repaired to generate 5'- phosphorylated blunt ends, followed by K1 enow-mediated addition of a single A base to the 3' end of the fragments. A-addition facilitates addition of T-overhang adaptor oligonucleotides, which are subsequently used to capture the template-adaptor molecules on the surface of a flow cell that is studded with oligonucleotide anchors. The anchor is used as a PCR primer, but because of the length of the template and its proximity to other nearby anchor oligonucleotides, extension by PCR results in the "arching over" of the molecule to hybridize with an adjacent anchor oligonucleotide to form a bridge structure on the surface of the flow cell. These loops of DNA are denatured and cleaved. Forward strands are then sequenced with reversible dye terminators. The sequence of incorporated nucleotides is determined by detection of post incorporation fluorescence, with each fluor and block removed prior to the next cycle of dNTP addition. Sequence read length ranges from 36 nucleotides to over 50 nucleotides, with overall output exceeding 1 billion nucleotide pairs per analytical run.

Sequencing nucleic acid molecules using SOLID™ technology (Voelkerding et ah, Clinical Chem., 55: 641-658, 2009; MacLean et ah, Nature Rev. Microbial., 7:287-296; U.S. Pat. No. 5,912,148; U.S. Pat. No. 6,130,073) also involves fragmentation of the template, ligation to oligonucleotide adaptors, attachment to beads, and clonal amplification by emulsion PCR. Following this, beads bearing template are immobilized on a derivatized surface of a glass flow- cell, and a primer complementary to the adaptor oligonucleotide is annealed. However, rather than utilizing this primer for 3' extension, it is instead used to provide a 5' phosphate group for ligation to interrogation probes containing two probe-specific bases followed by 6 degenerate bases and one of four fluorescent labels. In the SOLID™ system, interrogation probes have 16 possible combinations of the two bases at the 3' end of each probe, and one of four fluors at the 5' end. Fluor color, and thus identity of each probe, corresponds to specified color-space coding schemes. Multiple rounds (usually 7) of probe annealing, ligation, and fluor detection are followed by denaturation, and then a second round of sequencing using a primer that is offset by one base relative to the initial primer. In this manner, the template sequence can be computationally re-constructed, and template bases are interrogated twice, resulting in increased accuracy. Sequence read length averages 35 nucleotides, and overall output exceeds 4 billion bases per sequencing run.

In certain embodiments, nanopore sequencing is employed (see, e.g., Astier et ak, J. Am. Chem. Soc. 2006 Feb. 8; 128(5)1705-10). The theory behind nanopore sequencing has to do with what occurs when a nanopore is immersed in a conducting fluid and a potential (voltage) is applied across it. Under these conditions a slight electric current due to conduction of ions through the nanopore can be observed, and the amount of current is exceedingly sensitive to the size of the nanopore. As each base of a nucleic acid passes through the nanopore, this causes a change in the magnitude of the current through the nanopore that is distinct for each of the four bases, thereby allowing the sequence of the DNA molecule to be determined. In certain embodiments, HELISCOPE™ by HELICOS BIOSCIENCES™ is employed (Voelkerding et al., Clinical Chem., 55. 641-658, 2009; MacLean et al., Nature Rev. Microbial, 7:287-296; U.S. Pat. No. 7,169,560; U.S. Pat. No. 7,282,337; U.S. Pat. No. 7,482,120; U.S. Pat. No. 7,501,245; U.S. Pat. No. 6,818,395; U.S. Pat. No. 6,911,345; U.S. Pat. No. 7,501,245). Template DNA is fragmented and polyadenylated at the 3' end, with the final adenosine bearing a fluorescent label. Denatured polyadenylated template fragments are ligated to poly(dT) oligonucleotides on the surface of a flow cell. Initial physical locations of captured template molecules are recorded by a CCD camera, and then label is cleaved and washed away. Sequencing is achieved by addition of polymerase and serial addition of fluorescently-labeled dNTP reagents. Incorporation events result in fluor signal corresponding to the dNTP, and signal is captured by a CCD camera before each round of dNTP addition. Sequence read length ranges from 25-50 nucleotides, with overall output exceeding 1 billion nucleotide pairs per analytical run.

The Ion Torrent technology is a method of DNA sequencing based on the detection of hydrogen ions that are released during the polymerization of DNA (see, e.g., Science 327(5970); 1190 (2010); U.S. Pat. Appl. Pub. Nos. 20090026082, 20090127589, 20100301398, 20100197507, 20100188073, and 20100137143). A microwell contains a template DNA strand to be sequenced. Beneath the layer of microwells is a hypersensitive ISFET ion sensor. All layers are contained within a CMOS semiconductor chip, similar to that used in the electronics industry. When a dNTP is incorporated into the growing complementary strand a hydrogen ion is released, which triggers a hypersensitive ion sensor. If homopolymer repeats are present in the template sequence, multiple dNTP molecules will be incorporated in a single cycle. This leads to a corresponding number of released hydrogens and a proportionally higher electronic signal. This technology differs from other sequencing technologies in that no modified nucleotides or optics are used. The per base accuracy of the Ion Torrent sequencer is .about.99.6% for 50 base reads, with .about.100 Mb generated per run. The read-length is 100 base pairs. The accuracy for homopolymer repeats of 5 repeats in length is about 98%.

Another exemplary nucleic acid sequencing approach that CAN be adapted for use with the methods described herein was developed by STRATOS GENOMICS, Inc, and involves the use of XPANDOMERS™. This sequencing process typically includes providing a daughter strand produced by a template-directed synthesis. The daughter strand generally includes a plurality of subunits coupled in a sequence corresponding to a contiguous nucleotide sequence of all or a portion of a target nucleic acid in which the individual subunits comprise a tether, at least one probe or nucleobase residue, and at least one selectively cleavable bond. The selectively cleavable bond(s) is/are cleaved to yield an XPANDOMER™ of a length longer than the plurality of the subunits of the daughter strand. The XPANDOMER™ typically includes the tethers and reporter elements for parsing genetic information in a sequence corresponding to the contiguous nucleotide sequence of all or a portion of the target nucleic acid. Reporter elements of the XPANDOMER™ are then detected. Additional details relating to XPANDOMER™- based approaches are described in, for example, U.S. Pat. Pub No. 20090035777, entitled "HIGH THROUGHPUT NUCLEIC ACID SEQUENCING BY EXPANSION," filed Jun. 19, 2008, which is incorporated herein in its entirety.

Other emerging single molecule sequencing methods include real-time sequencing by synthesis using a VISIGEN™ platform (Voelkerding et al., Clinical Chem., 55: 641-58, 2009; U.S. Pat. No. 7,329,492; U.S. patent application Ser. No. 11/671,956; U.S. patent application Ser. No. 11/781,166) in which immobilized, primed DNA template is subjected to strand extension using a fluorescently-modified polymerase and florescent acceptor molecules, resulting in detectable fluorescence resonance energy transfer (FRET) upon nucleotide addition. Another real-time single molecule sequencing system developed by PACIFIC

BIOSCIENCES™ (Voelkerding et al., Clinical Chem., 55. 641-658, 2009; MacLean et al., Nature Rev. Microbiol., 7:287-296; U.S. Pat. No. 7,170,050; U.S. Pat. No. 7,302,146; U.S. Pat. No. 7,313,308; U.S. Pat. No. 7,476,503) utilizes reaction wells 50-100 nm in diameter and encompassing a reaction volume of approximately 20 zeptoliters (10. sup. -21 L). Sequencing reactions are performed using immobilized template, modified phi29 DNA polymerase, and high local concentrations of fluorescently labeled dNTPs. High local concentrations and continuous reaction conditions allow incorporation events to be captured in real time by fluor signal detection using laser excitation, an optical waveguide, and a CCD camera.

In certain embodiments, the single molecule real time (SMRT) DNA sequencing methods using zero-mode waveguides (ZMWs) developed by Pacific Biosciences, or similar methods, are employed. With this technology, DNA sequencing is performed on SMRT chips, each containing thousands of zero-mode waveguides (ZMWs). A ZMW is a hole, tens of nanometers in diameter, fabricated in a 100 nm metal film deposited on a silicon dioxide substrate. Each ZMW becomes a nanophotonic visualization chamber providing a detection volume of just 20 zeptoliters (10. sup. -21 L). At this volume, the activity of a single molecule can be detected amongst a background of thousands of labeled nucleotides. The ZMW provides a window for watching DNA polymerase as it performs sequencing by synthesis. Within each chamber, a single DNA polymerase molecule is attached to the bottom surface such that it permanently resides within the detection volume. Phospholinked nucleotides, each type labeled with a different colored fluorophore, are then introduced into the reaction solution at high concentrations which promote enzyme speed, accuracy, and processivity. Due to the small size of the ZMW, even at these high, biologically relevant concentrations, the detection volume is occupied by nucleotides only a small fraction of the time. In addition, visits to the detection volume are fast, lasting only a few microseconds, due to the very small distance that diffusion has to carry the nucleotides. The result is a very low background.

Processes and systems for such real time sequencing that can be adapted for use with the methods described herein include, for example, U.S. Pat. No. 7,405,281, U.S. Pat. No. 7,315,019, U.S. Pat. No. 7,313,308, U.S. Pat. No. 7,302,146, U.S. Pat. No. 7,170,050, U.S. Pat. Pub. Nos. 20080212960, 20080206764, 20080199932, 20080176769, 20080176316,

20080176241, 20080165346, 20080160531, 20080157005, 20080153100, 20080153095,

20080152281, 20080152280, 20080145278, 20080128627, 20080108082, 20080095488,

20080080059, 20080050747, 20080032301, 20080030628, 20080009007, 20070238679,

20070231804, 20070206187, 20070196846, 20070188750, 20070161017, 20070141598,

20070134128, 20070128133, 20070077564, 20070072196, 20070036511, and Korlach et al. (2008) PNAS 105(4); 1176-81, all of which are herein incorporated by reference in their entireties.

Subsequently, in some embodiments, the data produced comprises sequence data from multiple barcoded DNAs. Using the known association between the barcode and the source of the DNA, the data can be deconvoluted to assign sequences to the source subjects, samples, organisms, etc. The sequences are mapped, in some embodiments, to a reference DNA sequence (e.g., a chromosome) and genotypes are assigned to the source subjects, samples, organisms, etc., e.g., by modeling, e.g., by a Hidden Markov Model.

Some embodiments provide a processor, data storage, data transfer, and software comprising instructions to assign genotypes. Some embodiments of the technology provided herein further comprise functionalities for collecting, storing, and/or analyzing data. For example, some embodiments comprise the use of a processor, a memory, and/or a database for, e.g., storing and executing instructions, analyzing data, performing calculations using the data, transforming the data, and storing the data. In some embodiments, the processor is configured to calculate a function of data derived from the sequences and/or genotypes determined. In some embodiments, the processor performs instructions in software configured for medical or clinical results reporting and in some embodiments the processor performs instructions in software to support non-clinical results reporting. In some embodiments, the detection of a phage-displayed peptide comprises PCR with barcoded oligonucleotides. As used herein, the term "barcode" refers to a unique oligonucleotide sequence that allows a corresponding nucleic acid base and/or nucleic acid sequence to be identified. In certain aspects, the nucleic acid base and/or nucleic acid sequence is located at a specific position on a larger polynucleotide sequence (e.g., a polynucleotide covalently attached to a bead). In certain embodiments, barcodes can each have a length within a range of from 4 to 36 nucleotides, or from 6 to 30 nucleotides, or from 8 to 20 nucleotides. In certain aspects, the melting temperatures of barcodes within a set are within 10 °C of one another, within 5 °C of one another, or within 2 °C of one another. In other aspects, barcodes are members of a minimally cross-hybridizing set. That is, the nucleotide sequence of each member of such a set is sufficiently different from that of every other member of the set that no member can form a stable duplex with the complement of any other member under stringent hybridization conditions. In one aspect, the nucleotide sequence of each member of a minimally cross- hybridizing set differs from those of every other member by at least two nucleotides. Barcode technologies are known in the art and are described in e.g., Winzeler et al. (1999) Science 285:901; Brenner (2000) Genome Biol. 1:1 Kumar et al. (2001) Nature Rev. 2:302; Giaever et al. (2004) Proc. Natl. Acad. Sci. USA 101:793; Eason et al. (2004) Proc. Natl. Acad. Sci. USA 101:11046; and Brenner (2004) Genome Biol. 5:240.

Aligning the peptide information gleaned from the analysis with microbiome databases allows the determination of the microbiome profile of the subject.

Thus, according to another aspect of the invention there is provided a method of predicting an immunoglobulin profile of a subject, the method comprising:

(c) isolating immunecomplexes resultant of the immunocomplexation; and

(d) identifying peptides in the immunocomplexes, the peptides being indicative of an immunoglobulin profile of the subject.

It is also possible to analyze the antibody repertoire in terms of isotypes and their frequency, indicating past or current infection as well as allergy, inflammation and other physiological conditions which are associated with antibodies serotypes. Hence, using a complex tool which combines display libraries together with robust sequencing one can identify the immunoglobulin profile (identity and/or level or representation).

According to another aspect of the invention there is provided a method of identifying a pathogenic microbe, the method comprising: (a) providing a phage display library comprising phages displaying on their surface peptides of a microbiome of a mammalian host, wherein the phage display library comprises the peptides at a frequency above a predetermined threshold;

(c) isolating immunecomplexes resultant of the immunocomplexation; and

(d) identifying peptides in the immunocomplexes, shared by at least a portion of the plurality of subjects, the peptides are of a putative pathogenic microbe. This is because a shared epitope is likely to be of a pathogenic microbe.

As used herein “a pathogenic microbe” refers to a microbe which presence or level causes a disease.

According to a specific embodiment, the peptides in the immunocomplexes represent public epitopes. According to a specific embodiment, the peptides in the immunocomplexes represent private epitopes.

Epitopes that are present on a single HLA are referred to as private epitopes or shared by multiple antigens are termed public epitopes.

According to a specific embodiment, the immunoglobulins in the immunocomplexes are stable in the subject for at least 1.5 years.

Comparing the overlaps of antibody repertoires between the nearly 1,000 individuals (Figure 2B), it was found that there are private and public epitopes. For example, ten thousands of epitopes appear in single individuals (a few hundred per individual), and about 1,000 public epitopes are recurrent in more than 10 % of the population. These antigens originate from various biological sources including positive controls form the IEBD (immune epitope database), toxins from the virulence factor database (VFDB), probiotic strains, gut pathogens, IgA coated bacteria from the literature (Palm et al., 2014), as well as commensal gut microbiota (Zeevi el al., 2015). Antigens from the VFDB show a higher signal density, suggesting that previous infections (or vaccinations) of e.g. Streptococcus, Staphylococci, and Haemophilus strains can be measured, indicating that the present approach is sensitive enough to detect immunological memory. Also demonstrated is that these antibody repertoires show a high temporal stability with surprisingly small changes even up to 1.5 years (Figs. 2 C-D).

With this powerful technology readily available, it is possible to associate these antibody repertoires with human health (clinical parameters such as age, BMI, inflammation markers) as well as microbiome DNA sequencing of these ca. 1,000 individuals.

According to some embodiments, the immunoglobulins in the immunocomplexes are indicative of an immunological memory (e.g., predominantly by IgG).

The present teachings can be harnessed towards the elucidation of other clinically relevant parameters.

Thus, according to an aspect of the invention there is provided a method of identifying a disease in a subject in need thereof, the method comprising:

(c) isolating immunecomplexes resultant of the immunocomplexation; and

(d) identifying peptides in the immunocomplexes, the peptides being indicative of disease in the subject. The Examples section below outlines the importance of analyzing allergic determinants and immunoglobulin responses associated with allergy.

According to an additional aspect there is provided a method of analyzing a physiological state of a subject, the method comprising:

(a) predicting a microbiome profile of the subject as described herein; (b) providing a microbiome profile of a healthy subject generated as described herein, the healthy subject having known physiological parameters; and

(c) comparing the microbiome profile of (a) and the microbiome profile of (b) wherein an alteration in the profile is indicative of a physiological state of the subject. According to specific embodiments, the physiological state comprises at least one of the physiological parameters selected from the group consisting of age, BMI and inflammation marker(s).

To get further information, the phage display library comprises least one additional class of peptides selected from the group consisting of peptides of microbial pathogens, peptides of allergens, peptides of autoantigens and peptides of disease-associated antigens at a frequency above a predetermined threshold, as long as the peptides of the microbiome in the library are retained at their predetermined frequency described above. It will be appreciated that the sample may be subjected (by aliquoting for instance) to other libraries with the aforementioned peptides as described herein.

As used herein the term “about” refers to ± 10 %.

The terms "comprises", "comprising", "includes", "including", “having” and their conjugates mean "including but not limited to".

The term “consisting of’ means “including and limited to”. The term "consisting essentially of' means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.

As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.

Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging/ranges between” a first indicate number and a second indicate number and “ranging/ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

As used herein, the term “treating” includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.

It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

EXAMPLES

Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non-limiting fashion.

Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et ah, (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et ah, "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et ah, "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); “Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R. L, ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1- 317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

EXAMPLE 1 Experimental Procedures

Here, the present inventors leverage a novel high throughput assay to identify the antibody reactivities against 244,000 microbial epitopes in ca. 1,000 individuals (Zeevi et al. 2015), thereby extending current technologies by two orders of magnitude. By following a multidisciplinary approach combining synthetic oligo libraries, phage display with next generation sequencing (Xu et al., 2015; Mina et al., 2019), and data science (machine learning) it is possible to profile human, functional antibody repertoires against the microbiome at unprecedented depth (Figures 1 A-D).

Population wide antibody repertoires

Figures 2A-D demonstrate that the assay is indeed capable of detecting a vast array of antibody responses against the microbiome. On average it is possible to detect ca. 800 epitopes per healthy individuals and in some cases even up to 2,000 epitopes (Figure 2A). Comparing the overlaps of antibody repertoires between the nearly 1,000 individuals (Figure 2B), it was found that there are private and public epitopes. For example, ten thousands of epitopes appear in single individuals (a few hundred per individual), and about 1,000 public epitopes are recurrent in more than 10 % of the population. These antigens originate from various biological sources including positive controls form the IEBD (immune epitope database), toxins from the virulence factor database (VFDB), probiotic strains, gut pathogens, IgA coated bacteria from the literature (Palm et al., 2014), as well as commensal gut microbiota (Zeevi et al., 2015). Antigens from the VFDB show a higher signal density, suggesting that previous infections (or vaccinations) of e.g. Streptococcus, Staphylococci, and Haemophilus strains can be measured, indicating that the present approach is sensitive enough to detect immunological memory. Also demonstrated is that these antibody repertoires show a high temporal stability with surprisingly small changes even up to 1.5 years (Figs. 2 C-D).

Specific experimental procedures:

Serum samples, clinical data, and metagenomics

1,060 serum samples of 1,012 individuals had been collected in Israel in 2013/2014 for previous studies along with clinical and metagenomics data. Various phenotypes and blood test results were available for most (>900 for phenotype/blood test) individuals, with results of few tests missing in some individuals. The present inventors focused most of the antibody repertoire analysis on baseline samples (1^st sample collected per individual). For five individuals, samples did not achieve sufficient sequencing depth for analyses. Ten samples did not pass the threshold of >200 peptides significantly bound and were excluded from analyses (see section ‘Data analysis’ below), leaving data of 997 individuals for the analysis. The 213 longitudinal serum samples and 112 stool samples for metagenomics sequencing had been obtained from participants of one of the previous studies after ca. five years in 2019/2020. For the Crohn’s disease cohort, 50 serum samples of Dutch patients were processed alongside an equal number of Dutch age/gender matched plasma samples.

Research with these samples has been approved by the Tel Aviv Sourasky Medical Center (#0658-12-TLV) and the Weizmann Institute of Science’s institutional review board (#1079-1 and #868-1). Design and cloning of the phage library

The final list of proteins were cut to peptides of 64 amino acids (aa) with 20 aa overlaps (to cover all possible epitopes of the maximal length of linear epitope [depending on the definition between five to nine up to 20 aa (54-56)]) between adjacent peptides. The peptide aa sequences were reverse translated to DNA using the Escherichia coli codon usage (of highly expressed proteins), aiming to preserve the original codon usage frequencies, excluding restriction sites for cloning (EcoRI and Hindlll) within the coding sequence (CDS). The coding was re-performed, if needed, so that two possible barcodes were formed in the CDS, by the 44/75 nt at the 3’ end of each oligo. Every such barcode is a unique sequence at Hamming distance three (with a 44 nt read, or five with a 75 nt read) from all prior sequences in the library, which allows for correcting of a single read error in sequencing the barcode with a 44 nt read (reading 75 nt continuously would allow to correct two read errors). Eventually, the present inventors used the 44 nt read option and sequenced also a section of the 5’ end (see below). For similar peptide sequences, alternative codons were used following E. coli codon usage, to achieve discrimination. Including the sequencing barcode as part of the CDS, rather than a separate barcode, allowed the use of the entire oligo for encoding a peptide (and as opposed to completely omitting a barcode, it did not require sequencing the complete CDS). For encoding peptides shorter than 64 aa, a random sequence was added after the stop codon with addition of the restriction site Swa\ (allowing to remove short peptides by restriction enzyme digestion on the oligo level in case they would take over the signal [which was eventually not observed and digestion hence not required]). After finalizing the peptide sequence, the EcoRI and Hindlll restriction sites, stop codon, and annealing sequences for library amplification were added and ordered from Agilent Technologies as 230mer pool (library amplification primers, fwd: GATGCGCCGTGGGAATTCT (SEQ ID NO: 1), rev: GTCGGGTGGCAAGCTTTCA(SEQ ID NO: 2)) and cloned into T7 phages following the manufacturers recommendations (Merck, T7Select®10-3 Cloning Kit, product number 70550-3).

Immunoprecipitation and sequencing

The PhIP-Seq experiments were performed as outlined in a published protocol ( 16) with the following modifications: PCR plates for the transfer of beads and washing were blocked with 150 pL BSA (30 g/L in DPBS buffer, incubation overnight at 4°C) and BSA was added to diluted phage/buffer mixtures for immunoprecipitations (IPs) to 2 g/L. Phage wash buffer for IPs was prepared as outlined (16) with 0.1% (w/v) IPEGAL CA 630 (Sigma-Aldrich cat. # 13021). After optimizing phage and antibody amounts for IPs, 3 pg of serum IgG antibodies (measured by ELISA) were mixed with the phage library (4,000-fold coverage of phages per library variant). As technical replicates of the same sample were in excellent agreement (average Pearson R²=0.96, n=191), measurements were performed in single reactions. The microbiota library was mixed in a 2: 1 ratio with a 200mer 100,000 variant pool (manuscript in preparation).

The phage library and antibody mixtures were incubated in 96 deep well plates at 4°C with overhead mixing on a rotator. Forty microliters of a 1:1 mixture of protein A and G magnetic beads (Thermo Fisher Scientific, catalog numbers 10008D and 10009D, washed according to the manufacturers recommendations) were added after overnight incubation and incubated on a rotator for at 4°C. After four hours, the beads were transferred to PCR plates and washed twice as previously reported (16) using a Tecan Freedom Evo liquid handling robot with filter tips. The following PCR amplifications for pooled Illumina amplicon sequencing were performed with Q5 polymerase (New England Biolabs, catalog number M0493L) according to the manufacturers recommendations (primer pairs PCR1: tcgtcggcagcgtcagatgtgtataagagacagGTTACTCGAGTGCGGCCGCAAGC (SEQ ID NO: 3), and gtctcgtgggctcggagatgtgtataagagacagATGCTCGGGGATCCGAATTC (SEQ ID NO: 4), PCR2: Illumina Nextera combinatorial dual index primers, PCR3 [of PCR2 pools]: AATGATACGGCGACCACCGA (SEQ ID NO: 5) and C A AGC AGA AGAC GGC AT AC GA (SEQ ID NO: 6)) PCR3 products were cut from agarose gel and purified twice (lx QIAquick Gel Extraction Kit, lx QIAquick PCR purification kit; Qiagen catalog numbers 28704/28104) and sequenced on an Illumina NextSeq machine (custom primers for R1 : ttactcgagtgcggccgcaagctttca (SEQ ID NO: 7), and for R2: tgtgtataagagacagatgctcggggatccgaattct (SEQ ID NO: 8), R1/R2 44/31 nts). Paired end reads were processed as described below.

Data analysis

DNA sequencing (performed on the Illumina NextSeq platform) reads of IPs were down- sampled to 1.25 million IDable reads per sample, i.e. reads with a barcode within one error of the set of possible barcodes of the two mixed libraries for which the paired end matched the IDed oligo. When not enough reads were obtained, a minimal threshold of 750,000 reads was enforced for data analysis. Enriched peptides were calculated by comparing the number of reads per oligo to that of input coverage (library sequencing of phages before IPs). Scoring was done assuming each input level creates an output level distribution which is a Generalized Poisson distribution. Parameters for this Generalized Poisson distribution were estimated for each input level of each sample separately, and then fitted to three parameters for the whole samples, extrapolated for each input level and scored (17). Derived p-values were subject to Bonferroni correction (p- value 0.05) for multiple hypothesis testing, and log-fold-change (number of reads of bound peptides vs. baseline sequencing of phages not undergoing IPs) was computed for all peptides which passed the threshold p-value, all other peptides were given a log-fold-change value of 0. Samples, for which less than 200 peptides significantly bound, were excluded from analyses. The input sequencing of the phage library was before IPs was performed at >100-fold coverage. For the calculation fold changes, input reads were set to a minimum of 25 reads.

Library Content

Bacterial species and databases

About 60% (147,061 oligoes) of the library content was dedicated in an unbiased manner to potential antigens from the microbiome of healthy individuals. For this, the present inventors used gene and species abundances from metagenomics data of 953 stool samples of the same cohort (personalized nutrition project, PNP (23)) on whom the present inventors eventually performed the antibody repertoire profiling. Another 25% (61,250 oligoes) were dedicated to pathogenic bacteria, probiotic bacteria, and gut microbiota previously reported to be coated by antibodies (5). The present inventors also included the entire virulence factor database (VFDB, (24)) making up 10% (24,164 oligoes) of the library and left 5% (11,525 oligoes) of the library for various controls (such as infectious disease and auto-immune human proteins from the immune epitope database [IEDB] and technical controls).

Metagenomics data of the cohort: Selection of genes and species (MetaPhlAn2)

Metagenomics data from shotgun sequencing of healthy individuals of the cohort was processed in two ways to select antigens: First, mapping to the IGC database and the calculation of the relative abundance of each gene was performed as previously described. The genes data of the PNP cohort contained approximately 4*10⁶ different genes that were mapped to the IGC. Fifty percent of the library content was filled with peptides derived from the proteins encoded by these genes (see below for the exact selection criteria).

Second, in addition to this gene database, the present inventors dedicated another 10% of the library to abundant strains identified by MetaPhlAn2 (MPA), a computational tool for profiling the phylogenetic composition of microbial communities from metagenomic shotgun sequencing data. The present inventors included this strain-based approach, to mimic the selection process of pathogenic, probiotic and antibody coated strains described below. After sorting for the ten most abundant bacterial strains using MetaPhlAn2, the fasta files of the bacteria’s proteins were downloaded from the NCBI and processed as outlined below to select potential antigens. Pathogenic, probiotic, and antibody coated bacterial species

In addition to commensal bacteria of healthy individuals, the present inventors added three more groups of bacterial species: gut pathogens, probiotic strains, and bacteria reported to be coated with IgA in previous studies accounting together for 25% of the library content.

Seventeen bacterial species known to be (gut) pathogens were chosen based on their likelihood to have been encountered by the Israeli cohort. The present inventors focused on gut pathogens and chose the most prevalent ones (e.g. Campylobacter , Shigella and Salmonella ) according to a report of the central laboratories of the Israeli ministry of health from 2015. In addition, the present inventors added also Listeria which can cause serious illness in pregnant women, newborns, adults with weakened immune systems and the elderly.

Probiotic strains were chosen based on a recent review by Lebeer et al. dentification of probiotic effector molecules: present state and future perspectives. Curr. Opin. Biotechnol. 49, 217-223 (2018).

Bacterial species coated by antibodies were chosen based on the work of Palm et al. mmunoglobulin A coating identifies colitogenic bacteria in inflammatory bowel disease. Cell. 158, 1000-1010 (2014), who examined the microbiota coated by IgA in healthy individuals, Crohn's disease (CD) and ulcerative colitis (UC) patients. Bacteria passing the threshold of relative abundance of greater than 10⁶ and IgA coating index >10 in at least three patients were chosen. All together, nine such bacterial species were selected, five species that were abundantly bound in healthy individuals, two from CD patients and two from UC patients.

All the genomes, from pathogenic, probiotic and IgA coated bacteria, were downloaded from the NCBI.

Virulence factor database

In addition to these bacterial species, the present inventors included the virulence factor database (VFDB) to represent pathogenic species at greater depth, accounting for 10% of the library. The proliferation of pathogenic bacteria in their host depends on their ability to deploy virulence factors (VFs) to establish infections, survive in the hostile host environment and as a result cause disease. The present inventors included the entire ‘set A’ of the VFDB, which covers genes associated with experimentally verified virulence factors representing 2,624 gene sequences.

Positive/negative controls

The present inventors benchmarked and validated the antibody reactivities against microbiota proteins (described above) with several control antigens. The present inventors therefore included 12,025 oligoes covering proteins from the following groups: 1.) proteins of various infectious diseases 2.) human proteins known as targets in autoimmune diseases and 3.) technical controls (such as identical amino acid sequences coded by differently codon optimized DNA sequences and random amino acid sequences).

Positive and negative controls of infectious diseases and human proteins.

The present inventors have included subsets of B cell antigens from the IEDB (the immune epitope database), the most comprehensive repository covering various antigens reported in the literature. As positive controls, the present inventors have selected all antigen epitopes from B cell assays labelled as infectious diseases (excluding parasites) with human host. These 290 proteins have been reported in the literature to be targets of antibody responses and were covered with 4,250 oligoes.

As negative controls, antigens from B cell assays of human autoimmune diseases were included (as these proteins should not lead to a strong response in the healthy cohort) representing 430 proteins and 7,700 oligoes. Not only the exact epitopes reported in the IEDB, but the full-length protein sequences (obtained from UniProt by the accession numbers listed in the IEDB) were used and divided into overlapping oligoes as described below.

In addition to these IEDB positive/negative controls, the present inventors have included additional control antigens. The present inventors have added viral proteins, that have previously been reported to elicit recurrent antibody responses in 47.9 to 97.2% of humans using a similar phage display approach. The present inventors included negative controls that should not have been encountered by the cohort and hence not elicit antibody responses, such as several Ebola proteins. In addition to human proteins from the IEDB (with known auto-reactivities), the present inventors have also included several other abundant human proteins that should not evoke antibody reactivities in healthy individuals (such as serum albumin, histone proteins, glycolysis enzymes and ribosomal proteins). These sequences are represented by 300 oligos.

Technical controls

In addition to these biological positive and negative controls with expectation towards antibody binding, the present inventors also included 450 control oligoes to assess technical aspects of the experimental system, and 100 oligos encoding random amino acid sequences (without internal stop codons), that should not be recognized by antibodies.

Furthermore, the present inventors included codon optimization replicate controls (350 oligoes) to test for biases of representing the same amino acid sequence with different DNA sequences. Oligoes from both the microbiota library and the positive and negative controls were chosen and encoded by three different codon optimized sequences coding for the same amino acid sequence. Additionally, 50 oligoes representing short peptides (<45 aa) were included to test for additional effects of varying the random sequence at the 3’ end (see detailed explanation below).

Selection of microbiota protein targets

The pool of microbiota genes derived from metagenomics (ca. four million) and all proteins of the selected pathogenic, probiotic, and antibody coated exceeded the library size of 244,000 variants. Hence, the present inventors enriched the library for proteins expected to elicit more frequent binding (such as highly abundant genes, and bacterial genes identified as flagella, membrane or secreted proteins that are more likely to be exposed to antibody binding than intracellular proteins). Selection by abundance and annotation

Using the metagenomics data of relative abundance of genes, subsets of sequences were chosen solely based on abundances in the cohort, starting with a cut-off of 10⁶ relative abundance (RA) as criterion for presence in the cohort. Three percent of the library was dedicated to the most abundant genes occurring in >95% of the cohort (highly abundant), 3% of the library was dedicated to genes that appear in half of the cohort (moderately abundant) and 3% was dedicated to genes that appear in less than 1 percent of the cohort (rarely abundant).

Another set of genes was selected based on annotations and cellular localization predictions focusing on proteins that have higher chance to be exposed to the host’s immune system. The present inventors started with genes that were present in more than 20% of the cohort resulting in a list of ca. 140k genes. The present inventors focused on three groups: membrane proteins, secreted proteins and motility proteins/flagella, as these proteins are surface exposed and have previously been reported to be bound by antibodies in small scale studies.

To assign these functionalities/localizations to gene sequences (to select membrane/secreted/motility proteins), the present inventors applied Blast2GO, a bioinformatics platform for the high-throughput and automatic functional annotation of DNA or protein sequences based on the Gene Ontology database (63). The BLAST step was done locally against the NCBI non redundant protein database with up to 10 hits per sequence. The analysis of the GO was done locally (Database that was updated to 01.2017) using the 2.8 version of Blast2GO. Proteins that were assigned GO terms of membrane localization or extracellular localization or secretion or motility were filtered out. This step resulted a list of ca. 34,000 membrane proteins, 461 secreted proteins and ca. 100 motility proteins.

Membrane protein selection

Membrane proteins contain three distinct parts: transmembrane domains, extracellular domains, and intracellular domains. The present inventors have focused on the extracellular domains as they are more likely to be bound by antibodies and the present inventors have avoided hydrophobic transmembrane domains. The present inventors used TopGraph for the prediction of intracellular, membrane, and extracellular sequences of the membrane proteins. Extracellular domains with a length of >20 amino acids were included in the library (alongside a control set of full-length membrane proteins representing ca. 600 proteins).

Secreted protein selection

In addition to the Blast2GO approach, SignalP 4.0 was used for the prediction of signal peptides (SPs). The 140K genes (appearing in >20% of the cohort) were analyzed by SignalP 4.0 for both gram-positive and gram-negative signal peptides. The sequences that were predicted to have SPs were filtered out and the mature sequences (without SPs) included in the library (ca. 7,000 proteins).

Not all secretory proteins carry signal peptides. Some proteins, including various virulence factors, enter a non-classical secretory pathway without any currently known sequence motif. In Gram-negative bacteria, type I, III, IV and VI secretion systems function without signal peptides. As another approach to select for secreted proteins, the present inventors used DIAMOND which is an alignment algorithm potentially more than 20,000 times faster than BLASTX while maintaining a similar sensitivity. First, reference databases were created by searching the UniProt website (www(dot)uniprot(dot)org/) for bacterial toxins, and flagella proteins (only reviewed sequences were chosen). Then the present inventors searched for hits between the entire IGC database of human gut microbiome genes and these well characterized reference databases of bacterial toxins and flagella using DIAMOND. Genes in the IGC with at least one match with an E value <10⁶ were filtered out. This approach resulted in additional 324 predicted toxins and 1,265 predicted flagella proteins.

The same approaches for selecting membrane and secreted proteins applied to the metagenomics data, were also applied to the pathogenic, probiotic, and antibody coated strains etc. to enrich for proteins potentially targeted by antibodies.

Clustering by CDhit

In order to avoid redundancy due to sequences that are highly similar in the library the present inventors used CDhit for clustering (68). All the metagenomics data (genes and strains) were concatenated in two groups, TopGraph sequences (membrane proteins) and the rest. Sequences of pathogenic, probiotic, and antibody coated strains were treated in the same manner. Each group was clustered to 70% homology and the cluster representatives were chosen for the next step. Membrane and secreted proteins from metagenomics data were selected based on the original abundances of the genes. All predicted secreted proteins from the genomes of selected bacteria were included, but membrane protein sequences were randomly selected from a subset of the strains.

EXAMPLE 2 Profiling antibody repertoires to allergens

Over the last 50 years, allergies have become a major health issue, affecting approximately 20% of adults and more than 30% of children in developed countries. Up to 10% of children experience asthma and/or allergic rhinitis and up to 8% are allergic to foods. Notably, the incidence of food allergies is increasing worldwide, for example, in China from 3.2 to 7.7%. Allergies impair the life quality of affected individuals and diagnosis/treatment is costly for health care systems. In the EU, the avoidable indirect costs of patients insufficiently treated for allergy is estimated to range between 55 and 151 billion Euro per year, and in the U.S., the annual costs associated with food allergies are estimated at 24.8 billion USD. If undiagnosed, certain food allergies can represent a life threating risk by causing an anaphylactic shock. In a study of more than 38,000 U.S. children (<18 years), ca. 40% of individuals with food allergies have suffered from life-threatening allergic reactions. Similar to the general increase of food allergies, their severity, indicated by the prevalence of anaphylactic shocks, has also risen, exemplified by an increase of 9.7% per year of food allergy anaphylaxis-related deaths in Australia (between 1997 and 2013). Due to substantial improvements in therapeutic options, once diagnosed, allergies have become well manageable by providing antihistamines for moderate symptoms, (sublingual) immunotherapy, epinephrine auto-injectors to treat anaphylaxis and changing patients’ diets in the case of food allergies.

However, the diagnosis of allergies is still limited by expensive, low-throughput methods that require substantial amounts of the allergy eliciting substances (allergens) and are often performed directly on the patient. Most commonly, patients are subjected to skin prick testing, where allergens are directly applied to punctured skin on their forearms. The severity of the allergy can be estimated qualitatively by the nature and size of the skin’s reaction. More sophisticated blood tests, such as enzyme-linked immunosorbent assays (ELISAs) or radioallergosorbent tests (RASTs), allow to directly assess antibodies, which are the mediators of allergies. Allergies are typically caused by an overreaction of the immune system and misguided generation of mostly IgE antibodies against harmless substances. Measuring IgE concentrations against a certain allergen hence provides a quantitative readout for the severity of an allergy, surpassing the diagnostic value of skin prick tests. Concomitantly, only small quantities of blood are needed for ELIS As and RASTs and they cause little discomfort to patients. On the downside, ELISAs/RASTs need to be performed separately for each allergen, making them costly and typically only available for a few dozens of allergens. Yet, several thousands of allergens have been reported in the literature (including more than 170 food allergens) and cost-effective methods for testing hundreds or even thousands of allergens are highly sought after.

Here, the present inventors propose a novel high-throughput method that enables to test thousands of allergens in parallel within a single test (Figure 3), relying on the ERC-funded technology. Instead of cumbersomely purifying protein allergens from natural sources, the present inventors apply synthetic libraries to produce allergens using expression systems commonly applied in biotechnology, ‘phage display’. As synthesizing such large numbers of allergen proteins chemically is not feasible, the present inventors rely on DNA libraries that are translated into recombinant proteins.

Likewise, the library concept, paired with a potent phage display screening system, is ideal for capturing the large diversity of the more than 3000 known protein allergens. In detail, the present inventors synthesized all currently known allergens from several allergen databases (Allergome, AllergenOnline, SDAP [Structural Database of Allergenic Proteins], IEDB [Immune Epitope Database] and AllFam) as DNA and cloned them into a T7 phage expression system (Figure 3). T7 phages are frequently used molecular tools in biotechnology and have been widely used for high-throughput bio-panning and antigen presentation. The allergens were cloned in such a way that they are fused to a coat protein of the phages and hence covalently linked to their surface. This phage library presenting the allergens is then mixed with blood (serum) samples of allergic individuals. The antibodies that cause an allergic reaction in the patients by binding the allergen also bind to the allergen presented on the phages. The recognized allergens are easily separated by washing away the unbound phages (selection step via immunoprecipitation in Figure 3). Finally, the allergens are identified by DNA sequencing of the genomes of the bound phages: The antibodies bind the allergen proteins on the surface of the phages and the bound phages contain the DNA coding for these proteins on their inside. Next generation sequencing (NGS) allows to reliably assign bound antigens based on the phages’ DNA content, as previously demonstrated. The signal strength provides a semi-quantitative (relative) output of the amounts of antibodies present and hence a proxy for the severity of the allergy against a certain protein.

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, any priority document(s) of this application is/are hereby incorporated herein by reference in its/their entirety.

REFERENCES

1. Bashford-Rogers et al., (2019). Commonality despite exceptional diversity in the baseline human antibody repertoire. Nature 566, 393-397.

2. Briney et al. (2019). Commonality despite exceptional diversity in the baseline human antibody repertoire. Nature 566, 393-397.

3. Mina et al. (2019). Measles virus infection diminishes preexisting antibodies that offer protection from other pathogens. Science 366, 599-606.

4. Palm et al. Immunoglobulin A coating identifies colitogenic bacteria in inflammatory bowel disease. Cell 158, 1000-1010.

5. Pasolli et al., (2019). Extensive Unexplored Human Microbiome Diversity Revealed by Over 150,000 Genomes from Metagenomes Spanning Age, Geography, and Lifestyle. Cell 2019;176:649-662

6. Soto et al. (2019). High frequency of shared clonotypes in human B cell receptor repertoires. Nature 566, 398-402.

7. Xu et al. (2015). Viral immunology. Comprehensive serological profiling of human populations using a synthetic human virome. Science 348, aaa0698.

8. Zeevi et al. (2015). Personalized Nutrition by Prediction of Glycemic Responses. Cell 163, 1079-1094.

Claims

WHAT IS CLAIMED IS:

1. A method of predicting a microbiome profile of a subject, the method comprising:

(a) providing a phage display library comprising phages displaying on their surface peptides of a microbiome of a mammalian host, wherein said phage display library comprises said peptides at a frequency above a predetermined threshold;

(b) contacting said library with a biological sample of the subject, said biological sample comprising immunoglobulins, wherein said contacting is performed under conditions which allow specific immunocomplexation between said immunoglobulins and said peptides;

(c) isolating immunecomplexes resultant of said immunocomplexation; and

(d) identifying peptides in said immunocomplexes, said peptides being indicative of the microbiome of the subject.

2. A method of predicting an immunoglobulin profile of a subject, the method comprising:

(c) isolating immunecomplexes resultant of said immunocomplexation; and

(d) identifying peptides in said immunocomplexes, said peptides being indicative of an immunoglobulin profile of the subject.

3. A method of identifying a pathogenic microbe, the method comprising

(b) contacting a plurality of aliquots of said library with biological samples of a plurality subjects, said biological samples comprising immunoglobulins, wherein said contacting is performed under conditions which allow specific immunocomplexation between said immunoglobulins and said peptides;

(c) isolating immunecomplexes resultant of said immunocomplexation; and (d) identifying peptides in said immunocomplexes, shared by at least a portion of said plurality of subjects, said peptides are of a putative pathogenic microbe.

4. A method of identifying a disease in a subject in need thereof, the method comprising:

(a) providing a phage display library comprising phages displaying on their surface peptides of a microbiome of a mammalian host and at least one additional class of peptides selected from the group consisting of: peptides of microbial or viral pathogens, peptides of allergens, peptides of autoantigens and peptides of disease-associated antigens, wherein said phage display library comprises said peptides of said microbiome of a mammalian host and/or said at least one additional class of peptides at a frequency above a predetermined threshold;

(c) isolating immunecomplexes resultant of said immunocomplexation; and

(d) identifying peptides in said immunocomplexes, said peptides being indicative of disease in the subject.

5. A method of analyzing a physiological state of a subject, the method comprising:

(a) predicting a microbiome profile of the subject according to claim 1;

(b) providing a microbiome profile of a healthy subject generated according to claim 1, said healthy subject having known physiological parameters; and

(c) comparing said microbiome profile of (a) and said microbiome profile of (b) wherein an alteration in said profile is indicative of a physiological state of the subject.

6. The method of claim 5, wherein said physiological state comprises at least one of said physiological parameters selected from the group consisting of age, BMI and inflammation marker(s).

7. The method of claim 2, wherein said phage display library display at least one additional class of peptides selected from the group consisting of: peptides of microbial pathogens, peptides of allergens, peptides of autoantigens and peptides of disease-associated antigens at a frequency above a predetermined threshold.

8 The method of any one of claims 1-5, wherein said subject is a human subject.

9. The method of any one of claims 1-8, wherein said peptides in said immunocomplexes represent public epitopes.

10. The method of any one of claims 1-8, wherein said peptides in said immunocomplexes represent private epitopes.

11. The method of any one of claims 1-10, wherein said immunoglobulins in said immunocomplexes are stable in the subject for at least 1.5 years.

12. The method of any one of claims 1-10, wherein said immunoglobulins in said immunocomplexes are indicative of an immunological memory.

13. The method of any one of claims 1-12, wherein said biological sample comprises serum.

14. The method of any one of claims 1-13, wherein said immunoglobulins comprise predominantly of IgG.

15. The method of any one of claims 1-14, wherein said isolating comprises immunoprecipitati on .

16. The method of claim 15, wherein said immunoprecipitation is effected with protein A/G/L.

17. The method of any one of claims 1-16, wherein said peptides are 50-80 amino acids long.

18. The method of any one of claims 1-17, wherein said identifying is effected by next generation sequencing.

19. The method of any one of claims 1-18, wherein a size of said library is at least 100,000 peptides.

20. The method of any one of claims 1-18, wherein said predetermined threshold is at least 0.1 %, 1 %, 5 %, 10 % or more.

(up to 10 epitopes) y p tation

Microbiota antigens on phages

qu g y antigen binding events Immunoprecipitation Selection step

Negative control (no antibodies) Human serum antibodies

Magnified

3/4