KR101782806B1 - Method and kit for NGS-based high efficiency, high resolution HLA typing - Google Patents

Method and kit for NGS-based high efficiency, high resolution HLA typing Download PDF

Info

Publication number
KR101782806B1
KR101782806B1 KR1020150020961A KR20150020961A KR101782806B1 KR 101782806 B1 KR101782806 B1 KR 101782806B1 KR 1020150020961 A KR1020150020961 A KR 1020150020961A KR 20150020961 A KR20150020961 A KR 20150020961A KR 101782806 B1 KR101782806 B1 KR 101782806B1
Authority
KR
South Korea
Prior art keywords
hla
dna
artificial sequence
primer
drb1
Prior art date
Application number
KR1020150020961A
Other languages
Korean (ko)
Other versions
KR20160098838A (en
Inventor
조대연
신인경
문서윤
최세림
Original Assignee
주식회사 랩 지노믹스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 랩 지노믹스 filed Critical 주식회사 랩 지노믹스
Priority to KR1020150020961A priority Critical patent/KR101782806B1/en
Priority to PCT/KR2015/006773 priority patent/WO2016129759A1/en
Publication of KR20160098838A publication Critical patent/KR20160098838A/en
Application granted granted Critical
Publication of KR101782806B1 publication Critical patent/KR101782806B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • G—PHYSICS
    • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
    • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
    • G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
    • G06F19/22—

Abstract

본 발명은 차세대염기서열분석기술 (Next Generation Sequencing,NGS)을 이용하여 HLA-A, B, DRB1 대립유전자 형별을 고해상도 분석으로 동시에 검사할 수 있는 방법 및 키트에 관한 것이다.The present invention relates to a method and a kit for simultaneously screening HLA-A, B, and DRB1 alleles by high-resolution analysis using Next Generation Sequencing (NGS).

Description

차세대염기서열분석기술 기반의 고효율, 고해상도 조직적합성 형별 분석 방법 및 키트{Method and kit for NGS-based high efficiency, high resolution HLA typing} [TECHNICAL FIELD] [0001] The present invention relates to a method and kit for high-throughput, high-resolution histocompatibility classification based on next-

본 발명은 차세대염기서열분석기술 (Next Generation Sequencing, NGS)을 이용하여 HLA-A, B, DRB1 대립유전자 형별을 고해상도 분석으로 동시에 검사할 수 있는 방법 및 키트에 관한 것이다. The present invention relates to a method and a kit for simultaneously screening HLA-A, B, and DRB1 alleles by high-resolution analysis using Next Generation Sequencing (NGS).

사람 백혈구 항원(Human Leukocyte Antigen, HLA)은 조혈모세포(골수) 및 장기 등의 이식 시 거부 반응을 일으키는 주요 인자를 생성하는 면역 반응 조절 유전자로, 조직적합항원으로도 알려져 있다. 타인의 골수 세포나 바이러스 등 외래 물질이 신체에 들어올 경우 사람의 신체는 자신을 보호하기 위하여 이를 제거하기 위한 행동을 취하게 되며, 이때, 그 물질이 자기 자신과 같은 것인지 여부의 판단에서 중요한 역할을 하는 것이 HLA이다. Human Leukocyte Antigen (HLA) is an immune response regulatory gene, which is known to be a histocompatibility antigen, which produces a major factor that causes rejection in transplantation of hematopoietic stem cells (bone marrow) and organs. When extraneous substances such as bone marrow cells or viruses of other people enter the body, the body of the person takes action to remove it to protect himself or herself and plays an important role in judging whether or not the substance is the same as itself It is HLA to do.

골수나 장기 이식 시 성공률을 높이기 위해서는 환자와 공여자의 HLA 형별이 일치되어야 하고, 만약 HLA가 불일치할 경우는 이식된 조혈모세포가 환자로부터 이물질로 간주되어 공격을 당하는 거부 반응이 일어나거나 또는 반대로 공여자의 T-림프구가 환자를 이물질로 간주하고 환자를 공격하는 이식편대숙주 질환이 발생하여 피부 질환, 설사, 간 기능 이상 등의 증상이 유발되고 심할 경우는 사망을 초래할 수 있다. 두 경우 모두 조혈모세포나 장기 이식을 실패로 만드는 요인이기 때문에 장기 및 조혈모세포 이식 전에 HLA 검사는 환자의 생명과도 직결되는 중요한 필수적인 검사로 시행되고 있다. In order to increase the success rate of bone marrow or organ transplantation, the HLA type of patient and donor should be matched. If the HLA is inconsistent, the transplanted hematopoietic stem cells are regarded as foreign matter from the patient and the rejection reaction occurs, or conversely, T-lymphocyte counts as a foreign body, and graft-versus-host disease that attacks the patient causes symptoms such as skin disease, diarrhea and liver dysfunction, and severe cases can lead to death. In both cases, hematopoietic stem cells or organ transplantation is a failure, making HLA testing an essential and important test that directly affects the patient's life before organs and hematopoietic stem cell transplantation.

현재 시행되고 있는 HLA 검사 방법으로는 검사의 해상도(resolution)에 따라 저해상도(low resolution), 중해상도(middle resolution), 고해상도(high resolution)로 분류된다. Currently, HLA testing methods are divided into low resolution, middle resolution and high resolution depending on the resolution of the test.

저해상도 분석인 혈청학적 방법은 고도의 숙련된 기술과 경험이 요구되며, DNA 검사법들과 비교하여 불일치하는 결과가 보고되면서, 점차 소규모 검사실에서도 쉽게 수행할 수 있는 DNA 검사법이 기존의 혈청학적 검사 방법을 급속히 대체하고 있다. A low-resolution serologic method requires highly skilled techniques and experience, and inconsistent results compared with DNA tests have been reported, and DNA tests that can be easily performed in small laboratories have been performed using conventional serological tests Rapidly replacing it.

중해상도 분석을 위해 이용되는 SSOP(sequence specific oligonucleotide probe) 방법은 PCR 증폭 후에 스트립에 고정된 프로브와의 혼성화 반응 양상을 토대로 결과를 판정하는 방법이다. SSOP 방법은 혈청학적 검사법에서 흔히 보이는 교차 반응 및 약한 반응성 등으로 인해 모호한 결과가 보이는 현상이 적어 판독이 다소 용이하다는 점과 많은 양의 검체를 동시에 처리할 수 있는 장점이 있으나, PCR 후에 혼성화 과정을 거치므로 시간이 다소 걸린다는 점과 양성 밴드 판정에 있어 애매한 경우가 간혹 발생한다는 단점이 있다.The SSOP (sequence specific oligonucleotide probe) method used for the resolution analysis is a method for determining the result based on the hybridization reaction pattern with the probe immobilized on the strip after PCR amplification. The SSOP method has a merit that it is easier to read and the large amount of specimens can be processed at the same time because there is no phenomenon that ambiguous results are seen due to cross reaction and weak reactivity which are common in serologic test method. However, There is a disadvantage in that it takes a little time and the ambiguity sometimes occurs in the determination of the positive band.

중해상도 분석을 위해 이용되는 PCR-SSP(Polymerase Chain Reaction-Sequence Specific Primer) 기법은 PCR 프라이머의 염기서열 차이를 이용하여 유전자를 선택적으로 증폭하며, PCR 프라이머 세트의 수를 조절하여 원하는 수준의 형별을 판정하는 기법이다. PCR-SSP 기법은 PCR 과정에서 특정 대립유전자군만 증폭하여 그 결과를 판정하기 때문에 PCR 이후 전기영동을 통해 바로 결과를 확인할 수 있다는 장점이 있는 반면 다수의 검체를 동시에 검사하기가 어렵다는 단점이 있다.The PCR-SSP (Polymerase Chain Reaction-Sequence Specific Primer) technique used for the resolution analysis selectively amplifies the gene using the difference in the base sequence of the PCR primer and adjusts the number of the PCR primer sets, . PCR-SSP method amplifies only specific alleles in PCR and judges the result. Therefore, there is an advantage that it is possible to confirm the results directly after electrophoresis after PCR, but it is difficult to simultaneously test a large number of specimens.

고해상도 방법으로 이용되는 SBT(sequence-based typing) 방법은 새로운 형별 분석을 위한 가장 우수한 방법이며, HLA 형별 수의 급격한 증가에 기여한 방법이기도 하다. 그러나, 대립유전자의 변이부분이 시스(cis)형인지 트랜스(trans)형인지를 구별하지 못하는 위상 모호성(phase ambiguity) 문제가 있고, 시간과 노동력, 비용이 많이 드는 단점이 있다.The SBT (sequence-based typing) method, which is used as a high-resolution method, is the best method for the new type analysis and contributes to the rapid increase of the number of HLA types. However, there is a problem of phase ambiguity which can not distinguish whether the mutated portion of the allele is cis or trans, and it is disadvantageous in that it takes time, labor, and cost.

저해상도 형별분석에 기반한 이식 성적이 좋지 않다는 보고가 누적되면서 고해상도 분석 필요성에 대한 공감대가 형성되고 있고, 비혈연 조혈모세포이식의 경우에는 혈청학적 수준에서 HLA 형별이 일치하여도 고해상도 수준에서 불일치하면 거부반응, 급성 이식편대숙주병, 사망률 등이 높아진다는 연구 결과가 보고되었다(N Engl J Med 1998;92:3515-20).There is a consensus on the necessity of high-resolution analysis due to the accumulation of reports of poor transplantation results based on the low-resolution type-based analysis. In the case of unrelated hematopoietic stem cell transplantation, rejection, Acute graft versus host disease, and mortality (N Engl J Med 1998; 92: 3515-20).

따라서, HLA 고해상도 분석법의 사용의 중요성이 증대되고 있고, 현재 국제 표준 HLA 고해상도 분석 기술인 SBT (sequence-based typing) 분석법의 이용이 요구되고 있다. 그러나, 높은 비용, 낮은 처리량, 내재적 한계인 위상 모호성 등의 단점이 있어서, 대량 HLA 분석 검출이 요구되는 조혈모세포 지원자 등록 데이터베이스를 위한 적용에는 한계가 있다. Thus, the use of HLA high resolution assays is increasing in importance and the use of sequence-based typing (SBT) assays, which are international standard HLA high resolution assays, is required. However, there are disadvantages such as high cost, low throughput, and phase ambiguity as an inherent limit, so there is a limit to the application for a hematopoietic stem cell candidate registration database which requires detection of mass HLA analysis.

2009년 이후 NGS 기기를 이용한 HLA 형별 분석에 대한 활발한 연구가 진행되고 있으며, 기존 고해상도 방법인 SBT(sequence-based typing)를 사용한 결과에 비해 현저히 모호성이 줄어든 결과가 보고되고 있다 (Proc Natl Acad Sci U S A. 2012 May 29;109(22):8676-81). 그러나, 아직까지는 NGS 기기를 이용한 서열분석(sequencing) 비용이 상대적으로 높기 때문에 서열분석 처리량과 비용 면에서 기존 SBT에 기초한 HLA 분석 방법에 비해 NGS 기반 방법이 현저히 우수한 것으로 인정될 수 없으며, 또한, 특정 NGS 기기에 의존적이라는 단점이 있다. HLA 고해상도 분석법의 내재적 한계인 위상 모호성의 문제를 근원적으로 해결하고 낮은 비용으로 대량 샘플 처리가 용이한 HLA 고해상도 검사법의 개발이 여전히 요구되고 있다.Since 2009, there has been active research on HLA typing using NGS devices, and it has been reported that the ambiguity is reduced compared to the result of using SBT (sequence-based typing), which is a high-resolution method (Proc Natl Acad Sci US A. May 29, 109 (22): 8676-81). However, since the cost of sequencing using NGS instruments is still relatively high, the NGS-based method can not be recognized as superior to the existing SBT-based HLA analysis method in terms of sequencing throughput and cost, There is a disadvantage that it is dependent on the NGS device. There is still a need to develop a high-resolution HLA assay that can fundamentally solve the problem of phase ambiguity, which is an inherent limitation of HLA high-resolution analysis, and can easily process mass samples at low cost.

이에, 본 발명자들은 NGS에 기반한 HLA 고해상도 분석방법을 이용하여, 다량의 샘플을 효율적으로 분석할 수 있는 방법에 대한 연구를 수행하여, 다중 PCR과 Fusion PCR의 조합에 의한 NGS용 라이브러리 제작을 통해 비용 및 시간을 단축하고, 특정 NGS 기기에 대한 의존성을 해소할 수 있다는 것을 발견하여 본 발명을 완성하였다. Therefore, the present inventors conducted a study on a method of efficiently analyzing a large amount of samples using HLA high-resolution analysis method based on NGS, and developed a library for NGS by a combination of multiplex PCR and fusion PCR, And shortening the time, and relieving the dependence on a specific NGS device, thereby completing the present invention.

본 발명은 차세대염기서열분석기술 (NGS)을 이용하여 HLA-A, B, 및 DRB1 대립유전자 형별을 고해상도 분석으로 동시에 검사할 수 있는 방법을 제공하는 것을 목적으로 한다.        It is an object of the present invention to provide a method for simultaneously screening HLA-A, B, and DRB1 alleles by high-resolution analysis using the next generation sequencing technology (NGS).

본 발명은 또한, NGS를 이용하여 HLA-A, B, 및 DRB1 대립유전자 형별을 고해상도 분석으로 동시에 검사하기 위해 이용될 수 있는 키트를 제공하는 것을 목적으로 한다. The present invention also aims to provide a kit that can be used to simultaneously examine HLA-A, B, and DRB1 allele types by high resolution analysis using NGS.

본 발명은 또한, NGS를 위한 라이브러리 제작을 위해 유용하게 이용될 수 있는 범용 프라이머를 제공하는 것을 목적으로 한다. The present invention also aims to provide a universal primer that can be usefully used for producing libraries for NGS.

상기 목적을 달성하기 위해, 본 발명의 일 양태는 차세대 염기서열분석(NGS)을 이용하여 고해상도 조직적합성(HLA) 형별 분석을 수행하는 방법으로서, In order to accomplish the above object, one aspect of the present invention is a method for performing high resolution histological conformity (HLA) type analysis using next generation nucleotide sequence analysis (NGS)

샘플 중 HLA-A, B, 및 DRB1의 엑손 영역을 증폭시켜 표적 PCR 산물을 수득하는 단계,Amplifying the exon regions of HLA-A, B, and DRB1 in the sample to obtain a target PCR product,

수득된 표적 PCR 산물을 주형으로 이용하고, 서열분석용 유니버설 프라이머 서열, 샘플 식별용 바코드 서열 및 어댑터 서열을 포함하는 바코딩 프라이머를 이용한 융합(Fusion) PCR을 수행하여 NGS용 어댑터 및 샘플 식별용 바코드가 결합된 바코딩된 PCR 산물을 수득하는 단계,Fusion PCR was performed using a bar coding primer including a universal primer sequence for sequence analysis, a bar code sequence for sample identification, and an adapter sequence, using the obtained target PCR product as a template, thereby obtaining an adapter for NGS and a bar code for sample identification To obtain a bar-coded PCR product,

바코딩된 PCR 산물을 대상으로 NGS를 수행하는 단계를 포함하는 것인 방법을 제공한다.And performing NGS on the barcoded PCR product.

본 명세서에서 사용되는 용어 "차세대염기서열분석(Next Generation Sequencing, NGS)"은 서열을 단편화하여 신속하고 정확하게 서열을 읽어내는 기술로서, Sanger 방식과 달리 대량의 병렬 데이터 생산을 통해 유전체 해독에 소요되는 비용과 시간을 획기적으로 줄이며, 현재 유전체 해독에 가장 많이 활용되고 있는 기술을 의미한다. NGS에서는 기종에 따라 약간의 차이는 있지만 기본적으로 DNA 서열을 증폭하고 그 후 형광 표식 등을 카메라로 찍어 이미지 처리를 하는 과정을 거쳐 염기를 읽어낸다. PCR 증폭 방식에 따라서 로슈 (Roche, 454)와 라이프 테크놀로지스 (Life Technologies)의 기종들은 emulsion PCR (emPCR) 방식으로, 일루미나 (Illumina)의 기종들은 solid-phase amplification을 사용하는 것으로 나눌 수 있다(Michael, L.. Metzker. (2010) Sequencing technologies-the next generation. Nature Reviews Genetics. 11, 31-46). As used herein, the term " Next Generation Sequencing (NGS) "is a technology for rapidly and precisely reading sequences by fragmenting the sequence. Unlike the Sanger method, It is a technique that dramatically reduces cost and time, and is currently the most used technique for genome detoxification. In NGS, basically DNA sequence is amplified and then fluorescent markers are photographed by camera to read bases, though there is a slight difference depending on the model. According to the PCR amplification method, Roche (454) and Life Technologies models can be divided into emulsion PCR (emPCR) and Illumina models use solid-phase amplification (Michael, L. Metzker. (2010) Sequencing technologies-the next generation, Nature Reviews Genetics 11, 31-46.

본 명세서에서 사용되는 용어 "고해상도 HLA 형별 분석"은 SBT(sequence based typing)에 의한 HLA 형별을 결정하는 방법, 보다 구체적으로, NGS에 기반한 HLA 형별 분석을 의미한다. 혈청학적 분석인 저해상도나 SSOP 또는 PCR-SSP에 의한 중해상도 분석에 비해 보다 구체적으로, HLA 유전자의 하위 분류군의 아형까지 HLA 형별을 결정할 수 있다. 예를 들면, 고해상도 HLA 형별은 HLA-A*02:06:01, HLA-A*26:02:01 등을 의미하고, 중해상도 HLA 형별은 HLA-A*02:06, HLA-A*26:02 등을 의미하며, 저해상도 HLA 형별은 HLA-A*01, HLA-A*02 등을 의미한다. As used herein, the term " high-resolution HLA typing analysis "refers to a method for determining HLA typing by sequence based typing (SBT), more specifically, HLA typing based on NGS. HLA typing can be determined to subspecies of the HLA gene subgroup in comparison with the resolution analysis, SSLA or PCR-SSP medium resolution analysis, which is a serological analysis. For example, HLA-A * 02: 06: 01, HLA-A * 26: 02: 01 and the like for the high resolution HLA type and HLA-A * : 02, and the low-resolution HLA type means HLA-A * 01, HLA-A * 02 and the like.

조혈모세포 이식 시 거부반응, 이식편대숙주 질환 등을 방지하기 위해서는 고해상도 HLA 형별 분석이 요구된다. High-resolution HLA typing analysis is required to prevent rejection, graft-versus-host disease, and the like in HSCT.

본 명세서에서 사용되는 용어 "서열분석용 유니버설 서열" 또는 "서열분석용 유니버설 프라이머 서열"은 NGS 기기의 종류에 관계없이 서열분석(sequencing)을 위해 범용적으로 이용되는 프라이머 서열을 의미한다. 예를 들면, SP1 및 SP2를 포함하나, 이에 한정되지 않는다. As used herein, the term " universal sequence for sequencing "or" universal primer sequence for sequencing "refers to a primer sequence commonly used for sequencing regardless of the type of NGS instrument. For example, but not limited to, SP1 and SP2.

본 명세서에서 사용되는 용어 "샘플 식별용 바코드(barcode)"는 다수의 샘플을 동시에 분석하는 경우, 각 샘플을 식별하기 위해 샘플에 연결 또는 결합시키는 서열로서, 필요에 따라 적절한 개수의 뉴클레오티드로 이루어진 길이일 수 있다. 바코드 서열을 샘플에 결합시키면, 샘플 간의 식별이 가능하므로 샘플을 통합(pool)하여 동시에 분석할 수 있어 시간과 비용, 및 노동을 단축할 수 있다. As used herein, the term " barcode for sample identification "refers to a sequence that, when analyzing a plurality of samples at the same time, connects or couples them to a sample in order to identify each sample and may include a length of a suitable number of nucleotides Lt; / RTI > By combining the bar code sequence with the sample, it is possible to identify the samples so that the samples can be pooled and analyzed at the same time, which can save time, money, and labor.

본 명세서에서 사용되는 용어 NGS용 "어댑터(adapter)"는 NGS 기기에서의 분석을 위해 서열결정용 칩이나 마이크로입자에 분석 대상 DNA를 고정 또는 결합시키는 서열 및 서열분석용 유니버설 서열을 포함한다. As used herein, the term " adapter " for NGS includes a sequence for sequencing or binding a DNA to be analyzed to a sequencing chip or microparticle for analysis in an NGS instrument, and a universal sequence for sequencing.

본 명세서에서 사용되는 용어 "바코딩(barcoding) 프라이머"는 샘플 식별용 바코드 서열을 포함하는 프라이머를 의미한다. 바코딩 프라이머는 샘플 식별용 바코드 서열 외에, 서열분석용 유니버설 프라이머 서열 및 사용할 NGS 기기에 적합한 어댑터 서열을 포함할 수 있다. As used herein, the term "barcoding primer" means a primer comprising a bar code sequence for sample identification. The bar coding primer may comprise, in addition to the bar code sequence for sample identification, a universal primer sequence for sequencing and an adapter sequence suitable for the NGS instrument to be used.

본 명세서에서 사용되는 용어 "어댑터 프라이머"는 NGS 기기에 적합한 어댑터를 NGS 분석 대상 DNA에 결합시키기 위해 이용되는 프라이머를 의미하며, 어댑터 서열과 유니버설 프라이머 서열로 구성된다. As used herein, the term "adapter primer " refers to a primer used to bind an adapter suitable for an NGS instrument to DNA for NGS analysis, and is composed of an adapter sequence and a universal primer sequence.

본 명세서에서 사용되는 용어, "표적(target) PCR"은 DNA 상의 표적으로 하는 영역에 특이적인 프라이머 쌍을 이용하여 표적 영역을 증폭시키는 PCR을 의미하며, NGS용 어댑터가 연결 가능한 유니버설 프라이머 서열을 포함한다.As used herein, the term "target PCR" means a PCR that amplifies a target region using a primer pair specific to a target region on DNA, and includes an universal primer sequence to which an adapter for NGS is connectable do.

본 명세서에서 사용되는 용어, "Fusion PCR" 또는 "융합 PCR"은 NGS용 어댑터 및 바코드 서열을 표적 영역을 증폭시켜 수득된 PCR 산물에 결합 또는 연결시키기 위해 수행되는 PCR을 의미한다. As used herein, the term "fusion PCR" or "fusion PCR" means an adapter for NGS and PCR performed to bind or ligate a barcode sequence to a PCR product obtained by amplifying a target region.

도 1은 본 발명의 일 구체예에 따른 고해상된 HLA 형별 분석에서 분석 대상인 HLA 클래스 I에 속하는 HLA-A 및 HLA-B와 클래스 II에 속하는 HLA-DRB1의 유전자의 개략도와 함께, PCR에 의해 증폭되는 표적 영역(target region)을 보여준다. FIG. 1 is a schematic diagram of HLA-A and HLA-B genes belonging to HLA class I and HLA-DRB1 genes belonging to class II, analyzed by high resolution HLA typing according to an embodiment of the present invention, The target region is shown.

HLA 유전자는 변이가 가장 많은 유전자 중 하나로 알려져 있으며, 자기와 비자기를 구별하는 중요한 기능 때문에 장기 및 조혈모이식에 있어서, HLA 형별 분석은 필수적이 검사로 시행되고 있다. 특히, 비혈연 조혈모세포나 장기 이식의 경우 고해상도 HLA 형별 분석이 요구된다. 현재까지 알려진 형별 수는 HLA-A가 2,946개, HLA-B가 3,693개, 및 DRB1은 1,582개로 매우 많다(2014년 10월 기준, IMGT/HLA Database, Release 3.18.0). 따라서, HLA 형별 분석을 위해 염기서열이 상이한 형별을 모두 증폭할 수 있고, 비 특이 증폭을 초래하지 않는 프라이머를 디자인하는 것이 중요하다. 또한, 다중 PCR을 수행할 수 있도록 프라이머 디자인시 어닐링 온도를 고려할 수 있다. The HLA gene is known to be one of the most mutated genes, and HLA typing analysis is an essential test for organ and hematopoietic stem cell transplantation because of its important function of distinguishing between magnetic and non - magnetic. In particular, high-resolution HLA typing is required for non-blood stem cell transplantation or organ transplantation. HLA-A, HLA-B, and DRB1 have been reported to date to be very high (as of October 2014, IMGT / HLA Database, Release 3.18.0), with 2,946 HLA-A, 3,693 HLA-B and 1,582 DRB1. Therefore, it is important to design primers that can amplify all of the different base sequences for HLA typing and do not result in non-specific amplification. In addition, the annealing temperature can be considered in the primer design so that multiple PCR can be performed.

본 발명의 일 구체예에서, 상기 HLA-A, HLA-B 및 HLA-DRB1의 엑손 영역을 증폭시켜 PCR 산물을 수득하는 단계는 다중 PCR로 수행될 수 있다. In one embodiment of the present invention, the step of amplifying the exon regions of HLA-A, HLA-B and HLA-DRB1 to obtain a PCR product can be performed by multiplex PCR.

본 발명의 일 구체예에서, 상기 HLA-A, HLA-B 및 HLA-DRB1의 엑손 영역을 증폭시켜 PCR 산물을 수득하는 단계는 서열번호 1 내지 6의 HLA-A 증폭용 프라이머, 서열번호 7 내지 12의 HLA-B 증폭용 프라이머, 및 서열번호 13 및 14의 HLA-DR 증폭용 프라이머로 구성된 군으로부터 선택된 프라이머의 조합을 이용하여 수행될 수 있다. In one embodiment of the present invention, the step of amplifying the exon region of HLA-A, HLA-B and HLA-DRB1 to obtain a PCR product comprises the steps of amplifying the HLA-A primer of SEQ ID NOS: 1-6, 12 primers for HLA-B amplification, and primers for HLA-DR amplification of SEQ ID NOs: 13 and 14.

상기 서열번호 1 내지 14의 프라이머는 HLA-A, HLA-B 및 HLA-DR의 표적 영역에 존재하는 모든 대립 형질을 증폭할 수 있도록 보존성이 높은 염기 서열 부위를 선택하고, 하나의 위치에 2개 이상의 염기를 갖는 축퇴성(degenerate) 부위를 갖도록 디자인된 것이다. 예를 들면, 서열번호 13은 6개의 축퇴성 부위를 갖는다. The primers of SEQ ID NOS: 1 to 14 were prepared by selecting highly conserved nucleotide sequences so as to amplify all the alleles present in the target regions of HLA-A, HLA-B and HLA-DR, Or more degenerate region with more than one base. For example, SEQ ID NO: 13 has six degenerate sites.

본 발명의 일 구체예에서, 상기 다중 PCR은 HLA-A의 엑손 2, 3, 4, HLA-B의 엑손 2, 3, 4, 및 HLA-DRB1의 엑손 2를 증폭시킬 수 있다. In one embodiment of the invention, the multiplex PCR can amplify exons 2, 3 and 4 of HLA-A, exons 2, 3 and 4 of HLA-B, and exon 2 of HLA-DRB1.

각각의 표적 영역, HLA-A 엑손 2, 엑손 3, 엑손 4, HLA-B 엑손 2, 엑손 3, 엑손 4 , 및 HLA-DRB1의 엑손 2를 개별적인 PCR로 증폭시킬 수 있으나, 시간 및 노동력을 줄이기 위해 이들을 다중 PCR로 증폭시킬 수 있다.Each of the target regions, HLA-A exon 2, exon 3, exon 4, HLA-B exon 2, exon 3, exon 4 and exon 2 of HLA-DRB1 can be amplified by individual PCR, They can be amplified by multiplex PCR.

본 발명의 일 구체예에서, 상기 다중 PCR은 HLA-A-엑손 4, HLA-B-엑손 2, HLA-B-엑손 4를 하나의 PCR 반응에서 증폭시키고, HLA-A-엑손 2, HLA-A-엑손 3, HLA-B 엑손 3, 및 HLA-DRB1-엑손 2를 하나의 PCR 반응에서 증폭시켜 2개의 다중 PCR 반응으로 수행할 수 있다. In one embodiment of the present invention, the multiplex PCR amplifies HLA-A-exon 4, HLA-B-exon 2 and HLA-B-exon 4 in one PCR reaction, A-exon 3, HLA-B exon 3, and HLA-DRB1-exon 2 can be amplified in one PCR reaction and performed in two multiplex PCR reactions.

다중 PCR 반응에서 특정한 표적에 편향되어 수행되지 않도록 하기 위해 각 표적에 대한 프라이머의 비율을 조정할 수 있다. The ratio of primers to each target can be adjusted so that it is not performed biased on a particular target in a multiplex PCR reaction.

본 발명의 일 구체예에서, 상기 HLA-A-엑손 4, HLA-B-엑손 2, HLA-B-엑손 4의 다중 PCR은 HLA-A-엑손 4, HLA-B-엑손 2, HLA-B-엑손 4의 프라이머를 3:3:1로 혼합한 조건에서 수행할 수 있다.In one embodiment of the present invention, the multiplex PCR of HLA-A-exon 4, HLA-B-exon 2 and HLA-B-exon 4 comprises HLA-A-exon 4, HLA- - exon 4 primer in a ratio of 3: 3: 1.

본 발명의 일 구체예에서, 상기 HLA-A-엑손 2, HLA-A-엑손 3, HLA-B-엑손 3, HLA-DRB1-엑손 2의 다중 PCR은 HLA-A-엑손 2, HLA-A-엑손 3, HLA-B-엑손 3, HLA-DRB1-엑손 2 프라이머를 1:1:1:1.5의 비율로 혼합한 조건에서 수행할 수 있다.In one embodiment of the present invention, the multiplex PCR of HLA-A-exon 2, HLA-A-exon 3, HLA-B-exon 3 and HLA-DRB1- Exon 3, HLA-B-exon 3 and HLA-DRB1-exon 2 primer in a ratio of 1: 1: 1: 1.5.

표적 PCR에서 증폭 산물이 동일한 비율로 생성되면, Fusion PCR 후 NGS 전에 정량 단계에서 각 산물의 양을 동일하게 맞춰주기 위한 희석 등이 간소화되거나 제거될 수 있다. If the amplification products are generated at the same rate in the target PCR, dilution to match the amount of each product in the quantification step before NGS after Fusion PCR can be simplified or eliminated.

본 발명의 일 구체예에서, 표적 PCR용 프라이머는 샘플 식별 바코드 염기서열이 포함된 어댑터가 연결 가능하도록 유니버설(universal) 서열을 공통적으로 포함할 수 있다. In one embodiment of the present invention, the primers for the target PCR may commonly include a universal sequence so that an adapter containing the sample identification bar code base sequence can be connected.

상기 샘플 식별용 바코드 서열 및 유니버설 서열은 NGS 기기 특성에 맞게 설계할 수 있다. The bar code sequence and the universal sequence for sample identification can be designed in accordance with NGS device characteristics.

본 발명의 일 구체예에서, 상기 샘플 식별용 바코드 서열은 서열번호 15 내지 110 중 하나일 수 있다. In one embodiment of the present invention, the barcode sequence for sample identification may be one of SEQ ID NOS: 15-110.

본 발명의 일 구체예에서, 상기 유니버설 서열은 서열번호 111 또는 112일 수 있다. In one embodiment of the invention, the universal sequence may be SEQ ID NO: 111 or SEQ ID NO: 112.

본 발명의 일 구체예에서, 표적 PCR 후 수득된 PCR 산물을 주형으로 이용하고, 서열분석용 유니버설 서열, 샘플 식별용 바코드 서열, 및 어댑터 서열을 포함하는 바코딩 프라이머를 이용한 PCR을 수행하여 NGS용 어댑터 및 샘플 식별용 바코드가 결합된 바코딩된 PCR 산물을 수득하는 단계는 서열번호 115 내지 210의 바코딩 프라이머로 이루어진 군으로부터 선택된 바코딩 프라이머와 서열번호 211의 어댑터 프라이머를 이용하여 수행될 수 있다. In one embodiment of the present invention, the PCR product obtained after the target PCR is used as a template and PCR is performed using a bar coding primer including a universal sequence for sequence analysis, a bar code sequence for sample identification, and an adapter sequence, The step of obtaining the barcoded PCR product with the adapter and the sample identification barcode can be performed using a bar coding primer selected from the group consisting of the bar coding primers of SEQ ID Nos. 115 to 210 and an adapter primer of SEQ ID NO: 211 .

NGS에 의한 샘플 분석을 위해, NGS용 어댑터 및 복수 샘플의 분석을 위한 샘플 식별용 바코드를 결합시켜 샘플을 준비한다.For sample analysis by NGS, a sample is prepared by combining an adapter for NGS and a barcode for sample identification for analysis of a plurality of samples.

바코드 서열은 각 샘플을 식별하는 표지로 작용하므로, 바코딩된 다수의 샘플을 통합하여 동시에 분석할 수 있다. Since the bar code sequence acts as a marker to identify each sample, a large number of bar-coded samples can be integrated and analyzed at the same time.

바코드 서열을 포함하는 어댑터를 샘플에 라이게이션하는 상업용 키트를 이용한 기존의 NGS용 바코딩 방법과 달리, 본 발명의 방법은 분석 대상 영역과 NGS 용 어댑터 서열이 연결가능한 유니버설 서열이 결합된 표적 PCR 산물을 수득한 후, 이 산물에 어댑터 서열 및 바코드 서열을 포함하는 바코딩 프라이머에 의한 Fusion PCR을 수행하여, 표적 PCR 산물에 NGS용 어댑터와 샘플 식별용 바코드를 결합시킨다. 현재 시판되는 NGS 기기별로 고유한 어댑터가 요구되나, 본 발명은 NGS 기기에서 요구되는 어댑터 서열을 표적 PCR 산물에 연결함으로써 사용하고자 하는 NGS 기기에 적합한 서열분석용 산물을 수득할 수 있다.Unlike the conventional bar coding method for NGS using a commercial kit for ligating an adapter containing a bar code sequence to a sample, the method of the present invention is characterized in that a target PCR product , Fusion PCR with a bar coding primer containing an adapter sequence and a bar code sequence is performed on this product to bind the adapter for NGS and the bar code for sample identification to the target PCR product. Although a unique adapter is required for each commercially available NGS device, the present invention can obtain a sequence analysis product suitable for the NGS device to be used by connecting the adapter sequence required in the NGS device to the target PCR product.

따라서 특정 NGS 기기나 이를 위한 키트에 의존하지 않으면서 필요에 따라 바코드 서열의 종류를 증가시켜 동시에 분석할 수 있는 샘플의 수를 증가시킬 수 있다.  Therefore, it is possible to increase the number of samples that can be simultaneously analyzed by increasing the kinds of bar code sequences as needed without depending on specific NGS devices or kits for them.

또한, Fusion PCR 에 의한 바코드 연결 방법은 라이게이션에 의한 바코드 연결 시 수행되어야 하는 타겟 산물 말단수복(end-repair) 과정, A-테일 생성(A-tailing 과정), 효소에 의한 바코드 라이게이션 과정, 정제 과정, 및 산물을 증폭하기 위한 PCR 과정이 생략될 수 있어서, 시간 및 비용을 절감하고, 단계가 적어 오류율이 낮다는 장점을 갖는다. In addition, the Fusion PCR-based bar code linking method can be used for end-repair process of the target product, A-tailing process, barcode ligation process by the enzyme, The purification process, and the PCR process for amplifying the product can be omitted, which saves time and money, and has the advantage that the error rate is low due to the small number of steps.

따라서, 본 발명의 일 구체예에 따른 방법은 어댑터 및 바코드 서열을 프라이머로 이용한 Fusion PCR에 의해 분석 대상 DNA에 결합시키는 것에 의해 라이게이션에 의한 방법에 비해 낮은 비용 및 높은 자유도로 고해상도 HLA 형별 분석을 수행할 수 있다. Therefore, the method according to one embodiment of the present invention is capable of analyzing the high-resolution HLA type with low cost and high freedom compared to the ligation method by binding to the analyte DNA by Fusion PCR using the adapter and the bar code sequence as a primer Can be performed.

본 발명의 일 구체예에서, NGS에 의한 서열 분석은 Illumina사의 MiSeq, NextSeq 500, Hiseq 2000, Hiseq 2500, Hiseq 3000, Hiseq 4000, Roche사의 454 FLX Titanium, GS Junior, Life Technologies 사의 Ion Torrent PGM, Ion Proton, SOLiD3, SOLiD4 등을 이용하여 수행될 수 있다. 각 NGS 장비에 적합한 어댑터 및 바코드를 포함하는 프라이머를 디자인하거나 선택하여 이용할 수 있다. In one embodiment of the present invention, the sequence analysis by NGS is performed by using MiSeq, NextSeq 500, Hiseq 2000, Hiseq 2500, Hiseq 3000, Hiseq 4000 from Illumina, 454 FLX Titanium from Roche, GS Junior, Ion Torrent PGM from Life Technologies, Ion Proton, SOLiD3, SOLiD4, and the like. Primers that include adapters and barcodes for each NGS device can be designed or selected for use.

본 발명의 일 구체예에서, 차세대 염기서열분석을 이용하여, 고해상도 조직접합성 형별 분석을 수행하는 방법은 NGS를 수행하여 서열을 결정한 후, 그에 근거하여 HLA 형별을 결정하는 단계를 더 포함할 수 있다. In one embodiment of the present invention, a method for performing high-resolution tissue junctional type analysis using the next generation nucleotide sequence analysis may further include a step of determining the sequence by performing NGS and then determining the type of HLA based on the sequence .

본 발명의 일 구체예에서, NGS에 의해 결정된 서열에 근거하여 HLA 형별을 결정하는 단계는 소프트웨어를 이용하여 수행될 수 있다(Omixon Target HLA Typing 프로그램: http://www.omixon.com/hla/). In one embodiment of the invention, the step of determining the HLA type based on the sequence determined by NGS can be performed using software (Omixon Target HLA Typing Program: http://www.omixon.com/hla/ ).

본 발명의 일 양태는 서열번호 1 내지 6의 HLA-A 증폭용 프라이머, 서열번호 7 내지 12의 HLA-B 증폭용 프라이머, 및 서열번호 13 및 14의 HLA-DRB1 증폭용 프라이머 및 서열번호 115 내지 210의 바코딩 프라이머와 서열번호 211의 어댑터 프라이머를 포함하는, NGS를 이용한 고해상도 조직적합성(HLA) 형별 분석용 키트를 제공한다. An embodiment of the present invention includes a primer for amplifying HLA-A of SEQ ID NOs: 1 to 6, a primer for amplifying HLA-B of SEQ ID NOs: 7 to 12, and a primer for amplifying HLA-DRB1 of SEQ ID NOs: (HLA) type assay using NGS, comprising a bar coding primer of SEQ ID NO: 210 and an adapter primer of SEQ ID NO: 211.

본 발명의 일 구체예에서, 상기 키트는 사용되는 NGS 기기에 적합한 어댑터를 바코드 서열과 결합한 바코딩 프라이머를 포함할 수 있다. In one embodiment of the present invention, the kit may comprise a bar coding primer in combination with a bar code sequence, with an adapter suitable for the NGS device used.

본 발명의 일 구체예에서, 상기 키트는 다수의 샘플을 대하여 고해상도 HLA 형별 분석을 동시에 수행하기 위해 이용될 수 있다. In one embodiment of the present invention, the kit can be used to simultaneously perform high resolution HLA typing analysis on a plurality of samples.

본 발명의 일 구체예에서, 상기 키트는 PCR을 수행하기 위해 필요한 시약들을 더 포함할 수 있다. In one embodiment of the present invention, the kit may further comprise reagents necessary for performing PCR.

본 발명의 일 양태는 서열분석용 유니버설 프라이머 서열과 샘플 식별용 바코드 서열을 포함하는, 차세대 염기서열분석(NGS)을 위한 라이브러리 제작에 이용되는 프라이머를 제공한다. One aspect of the present invention provides a primer used in the production of a library for next generation sequencing analysis (NGS), including a universal primer sequence for sequence analysis and a bar code sequence for sample identification.

상기 프라이머는 NGS 기기에 의한 제한 없이, NGS를 위한 라이브러리를 제작하기 위해, 샘플에 서열분석용 유니버설 프라이머 서열과 샘플 식별용 바코드 서열을 PCR에 의해 결합시키기 위해 이용될 수 있다. 상기 프라이머는 HLA 형별 분석 외에 target-resequencing 기법에도 이용될 수 있다. The primers can be used to PCR-bind a universal primer sequence for sequencing and a bar code sequence for sample identification to a sample, to produce a library for NGS, without restriction by an NGS instrument. In addition to HLA typing analysis, the primers can also be used in target-resequencing techniques.

본 발명의 일 구체예에서, 상기 서열분석용 유니버설 프라이머 서열은 서열번호 111 또는 112일 수 있으나, 이에 한정되지 않는다. 통상적으로 서열분석을 위해 이용되는 프라이머가 이용될 수 있다. In one embodiment of the present invention, the universal primer sequence for sequence analysis may be SEQ ID NO: 111 or 112, but is not limited thereto. Typically, primers used for sequencing can be used.

본 발명의 일 구체예에서, 상기 샘플 식별용 바코드 서열은 서열번호 15 내지 110 중 하나 이상일 수 있다. In one embodiment of the present invention, the barcode sequence for sample identification may be at least one of SEQ ID NOS: 15-110.

샘플 식별용 바코드 서열은 동시에 분석되어야 하는 샘플의 수를 고려하여 설계될 수 있고, 길이는 그 샘플 수에 따라, 4 내지 20 bp, 또는 그 이상일 수 있다. 바코딩에 의해 복수 개의 샘플, 예를 들면, 96개 또는 그 이상을 동시에 분석할 수 있다. The bar code sequence for sample identification may be designed considering the number of samples to be analyzed at the same time, and the length may be 4 to 20 bp or more, depending on the number of samples. A plurality of samples, for example 96 or more, can be simultaneously analyzed by bar coding.

본 발명의 일 구체예에서, 상기 프라이머는 사용되는 NGS 기기에 따른 어댑터 서열을 포함할 수 있다. In one embodiment of the invention, the primer may comprise an adapter sequence according to the NGS instrument used.

본 발명의 일 구체예에서, 어댑터 서열은 Miseq에 적합한 서열번호 113 또는 114일 수 있다.
In one embodiment of the invention, the adapter sequence may be SEQ ID NO: 113 or 114, which is suitable for Miseq.

이하에서 실시예를 통하여 본 발명을 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다. Hereinafter, the present invention will be described in more detail by way of examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

본 발명의 일 구체예에 따른 차세대염기서열분석기술 (NGS)을 이용한 고해상도 HLA-A, B, DRB1 대립유전자 형별 분석 방법은 기존 HLA 고해상도 분석 방법인 SBT(sequence-based typing)의 문제점을 해결하고, 기술적 편의성을 고려하여, 고해상도 및 저비용으로 위상 모호성(phase-ambiguity)이 없는 정확한 결과 분석을 가능하게 하므로, 이식 전 검사로 사용되기에 적합하며, 또한 대량 HLA 분석 검출이 요구되는 조혈모 세포 지원자 등록 데이터베이스를 위한 적용에도 가능하다.The method for analyzing high resolution HLA-A, B, DRB1 alleles using the next generation sequencing technology (NGS) according to one embodiment of the present invention solves the problem of sequence-based typing (SBT) which is a conventional HLA high resolution analysis method , It is possible to perform accurate result analysis without phase ambiguity at high resolution and low cost in view of technical convenience, and thus it is suitable for use as a pre-implantation test, and also, a hematopoietic stem cell candidate It is also possible for applications for registration databases.

도 1은 본 발명의 일 구체예에 따른 HLA 형별 분석을 위해 분석되는 HLA 클래스 I 및 클래스 II 유전자의 구조를 보여준다.
도 2는 본 발명의 일 구체예에 따른 HLA 형별 분석을 위한 표적 PCR 및 어댑터와 바코드를 결합시키는 PCR(fusion PCR)을 보여주는 개략도이다. 도 2a는 표적 서열의 양 말단에 바코드를 결합시키는 PCR, 도 2b는 표적 서열의 한쪽 말단에만 바코드를 결합시키는 PCR을 보여준다.
도 3은 본 발명의 일 구체예에 따른 HLA 형별 분석을 위한 표적 PCR 산물 및 어댑터와 바코드를 결합시키는 PCR(fusion PCR) 산물과 이를 위해 이용되는 프라이머의 구조를 보여주는 개략도이다.
도 4는 본 발명의 일 구체예에 따른 다중 표적 PCR에서 HLA-A의 엑손 2, 3, 4, HLA-B의 엑손 2, 3, 4, 및 HLA-DRB1의 엑손 2를 증폭한 결과를 보여준다.
도 5는 본 발명의 일 구체예에 따른 다중 표적 PCR의 산물을 풀링(pooling)한 후 수행된 Fusion PCR 결과를 보여준다. Figure 1 shows the structure of HLA class I and class II genes analyzed for HLA typing according to one embodiment of the present invention.
FIG. 2 is a schematic diagram showing a target PCR for analysis of HLA type according to an embodiment of the present invention and PCR (fusion PCR) combining an adapter and a bar code. FIG. 2A shows a PCR that binds a barcode to both ends of a target sequence, and FIG. 2B shows a PCR that binds a barcode to only one end of a target sequence.
FIG. 3 is a schematic diagram showing a structure of a target PCR product for analysis of HLA type according to one embodiment of the present invention, a PCR (fusion PCR) product for binding an adapter and a barcode, and a primer used for the product.
4 shows the results of amplification of exons 2, 3 and 4 of HLA-A, exons 2, 3 and 4 of HLA-B, and exon 2 of HLA-DRB1 in a multiple target PCR according to one embodiment of the present invention .
Figure 5 shows Fusion PCR results performed after pooling the products of multiple target PCR according to one embodiment of the present invention.

실시예Example 1.  One. HLAHLA -A, -A, HLAHLA -B, -B, HLAHLA -- DRB1DRB1 특이적  Specific 프라이머의Primer 제작 making

HLA 형별 분석을 위해 고안된 프라이머들은 IMGT/HLA Database, Release v.3.18.0 (http://www.ebi.ac.uk/imgt/hla/, October 2014) 염기서열을 기준으로, HLA class I에서 A, B를, HLA class II에서는 DRB1 부분의 형별 분석이 가능하고, 수천개의 형별(allele)의 증폭이 가능하도록 개발되었다.The primers designed for HLA typing were based on the base sequence of IMGT / HLA Database, Release v.3.18.0 (http://www.ebi.ac.uk/imgt/hla/, October 2014), HLA class I A and B, and in the HLA class II, the DRB1 part was able to be analyzed by type, and it was developed to amplify thousands of alleles.

도 1은 HLA 클래스 I 및 II의 유전자 구조 및 HLA 형별 분석을 위한 표적 영역을 도시한다. Figure 1 shows the gene structure of HLA classes I and II and the target region for HLA typing analysis.

현재까지 알려진 HLA 형별(allele)은 HLA-A가 2,946개, HLA-B가 3,693개, DRB1은 1,582개로 매우 다양하다(2014년 10월 기준).There are 2,946 HLA-A, 3,693 HLA-B, and 1,582 DRB1 allele variants known to date (as of October 2014).

따라서, 고해상도 HLA 형별 분석을 위해서는 염기서열이 상이한 형별 모두 증폭이 가능하며, 비 특이 증폭을 초래하지 않는 프라이머를 디자인하는 것이 중요하다. 모든 형별의 염기서열을 정렬(alignment)하여 염기 서열의 변이부분이 모두 적용되고, PCR 온도 조건을 일원화할 수 있도록 프라이머의 길이 및 Tm(Melting Temperature) 조건을 확립하였다. 또한, 모든 표적 증폭용 프라이머에는 샘플 식별용 바코드 염기 서열이 포함된 어댑터를 후속 PCR에서 연결 가능하도록 유니버설(universal) 염기 서열을 공통적으로 붙여주었다.Therefore, for high-resolution HLA typing analysis, it is important to design a primer that can amplify all of the different base sequences and does not cause nonspecific amplification. All of the nucleotide sequences were aligned and all the mutations in the nucleotide sequence were applied. The primer length and Tm (Melting temperature) conditions were established to unify the PCR temperature conditions. In addition, a universal base sequence was attached to all primers for target amplification so that adapters containing a bar code base sequence for sample identification could be linked by a subsequent PCR.

본 실시예는 Illumina Miseq 서열화 기술에 기초한 고해상도 HLA 형별 분석에 이용할 수 있는 프라이머를 제공하나, 개인식별 바코드 및 유니버설(universal) 염기서열을 기기 특성에 맞게 염기 서열이 수정 가능하도록 고안되어 기기에 한정되지 않는다.This example provides a primer that can be used for high resolution HLA typing based on the Illumina Miseq sequencing technology, but it is designed to be able to modify the sequence of an individual identification bar code and universal base sequence to match the device characteristics, Do not.

본 실시예에서 신규 고안된 프라이머들은 HLA-A, B 유전자의 엑손(Exon) 2, 3, 4, 및 HLA-DRB1 유전자의 엑손 2를 독립적으로 증폭시키며, 그의 PCR 생성물들의 길이는 550bp 미만(NGS 기기 특이적인 바코드 어댑터 염기서열 길이에 따라 줄어들 수 있음), 다중(multiplex) PCR이 가능하도록 프라이머들의 어닐링 온도를 고려하여 제작하였다. Primers designed in this example independently amplify the exons 2, 3 and 4 of the HLA-A, B genes, and exon 2 of the HLA-DRB1 gene, and their PCR products are less than 550 bp in length Specific barcode adapter base sequence length) and considering the annealing temperature of the primers to allow multiplex PCR.

HLA는 사람에게서 발견되는 가장 다형성이 큰 유전자이므로, HLA-A, B, DRB1 각각의 특이적인 증폭, 및 그들의 모든 형별, 즉, 대립 유전자의 증폭이 가능하도록 보존성이 높은 염기서열 부위를 선택하고, 하나의 위치에 2개 이상의 염기를 갖는 축퇴성(degenerate) 코돈을 이용하여 프라이머를 디자인하였다. Since HLA is the most highly polymorphic gene found in humans, a highly conserved nucleotide sequence region is selected so that specific amplification of HLA-A, B, and DRB1 and amplification of all types thereof, that is, alleles, A primer was designed using a degenerate codon having two or more bases in one position.

본 실시예에서 제작된 HLA-A, B의 엑손 2, 3, 4 및 HLA-DRB1의 엑손 2를 증폭하기 위한 프라이머 서열은 하기의 표 1에 표시된다.Primer sequences for amplifying exons 2, 3 and 4 of HLA-A and B produced in this Example and exon 2 of HLA-DRB1 are shown in Table 1 below.

서열 번호SEQ ID NO: 프라이머 명칭Name of the primer 프라이머 서열(5'말단 -> 3'말단)Primer sequences (5'-> 3'terminal) 프라이머
용도primer
Usage 생성물 길이Product length 1One HL-A-E2-FHL-A-E2-F ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTCTGYGGGGAGAAGCAA ACACTCTTTCCCTACACGACGCTCTTCCGATCT CTCTGYGGGGAGAAGCAA HLA-A 유전자의
엑손 2 증폭Of the HLA-A gene
Exon 2 amplification 524bp524bp 22 HL-A-E2-RHL-A-E2-R GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTCGGACCCGGAGACTG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT TCTCGGACCCGGAGACTG 33 HL-A-E3-FHL-A-E3-F ACACTCTTTCCCTACACGACGCTCTTCCGATCTACYGGGCTGACCKYGGG ACACTCTTTCCCTACACGACGCTCTTCCGATCT ACYGGGCTGACCKYGGG HLA-A 유전자의
엑손 3 증폭Of the HLA-A gene
Exon 3 amplification 414bp414 bp 44 HL-A-E3-RHL-A-E3-R GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGAYCTAYAGGCGATCAGG Gt ; 55 HL-A-E4-FHL-A-E4-F ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGCCTGAATKWTCTGACTCTTCC ACACTCTTTCCCTACACGACGCTCTTCCGATCT TGCCTGAATKWTCTGACTCTTCC HLA-A 유전자의
엑손 4 증폭Of the HLA-A gene
Exon 4 amplification 446bp446bp 66 HL-A-E4-RHL-A-E4-R GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCCCTGACCCTGCTAAAGGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GCCCTGACCCTGCTAAAGGT 77 HL-B-E2-FHL-B-E2-F ACACTCTTTCCCTACACGACGCTCTTCCGATCTGAGMRAGGGGACCGCAGG ACACTCTTTCCCTACACGACGCTCTTCCGATCT GAGMRAGGGGACCGCAGG HLA-B 유전자의
엑손 2 증폭Of the HLA-B gene
Exon 2 amplification 425bp425bp 88 HL-B-E2-RHL-B-E2-R GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGKCCTCGCTCTGGTTGTAGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT GKCCTCGCTCTGGTTGTAGT 99 HL-B-E3-FHL-B-E3-F ACACTCTTTCCCTACACGACGCTCTTCCGATCTKRGGCCAGGGTCTCACA ACACTCTTTCCCTACACGACGCTCTTCCGATCT KRGGCCAGGGTCTCACA HLA-B 유전자의
엑손 3 증폭Of the HLA-B gene
Exon 3 amplification 403bp403bp 1010 HL-B-E3-RHL-B-E3-R GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCATCCCSGGCGAYCTATAG GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CATCCCSGGCGAYCTATAG 1111 HL-B-E4-FHL-B-E4-F ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCGCCTGAATTTTCTGACTCTT ACACTCTTTCCCTACACGACGCTCTTCCGATCT GCGCCTGAATTTTCTGACTCTT HLA-B 유전자의
엑손 4 증폭Of the HLA-B gene
Exon 4 amplification 415bp415 bp 1212 HL-B-E4-RHL-B-E4-R GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGATATGACCCCTCATCCC GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT AGATATGACCCCTCATCCC 1313 HL-DR-E2-FHL-DR-E2-F ACACTCTTTCCCTACACGACGCTCTTCCGATCTCYGGATSSTTYKTGYCCCC ACACTCTTTCCCTACACGACGCTCTTCCGATCT CYGGATSSTTYKTGYCCCC HLA-DRB1 유전자의 엑손 2 증폭Exon 2 amplification of the HLA-DRB1 gene 356bp356 bp 1414 HL-DR-E2-RHL-DR-E2-R GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGCTGCACYGTGAAGCT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT CCGCTGCACYGTGAAGCT

프라이머 중 축퇴성(degenerate) 부위:R=A/G, Y=C/T, M=A/C, K=G/T, S=C/G, W=A/T, H=A/C/T, B=C/G/T, V=A/C/G, D=A/G/T, N=A/C/G/T. The degenerate part of the primer is R = A / G, Y = C / T, M = A / C, K = G / T, S = C / G, W = A / / T, B = C / G / T, V = A / C / G, D = A / G / T, N = A / C / G / T.

표 1에서 밑줄 친 부분은 서열분석용 유니버설 서열을 나타낸다.
The underlined part in Table 1 represents a universal sequence for sequencing.

실시예Example 2. 다중  2. Multiple PCRPCR (( multiplexmultiplex PCRPCR )을 이용한 ) HLAHLA -A, -A, HLAHLA -B, -B, HLAHLA -- DRB1DRB1 유전자 증폭  Gene amplification

고해상도 HLA 형별 분석을 위해 HLA-A, B, 및 DRB1의 모든 가능한 형별을 증폭시킬 수 있도록 실시예 1에서 설계된 프라이머를 이용하여 표적 PCR를 수행했다. PCR은 각각의 표적 영역별로 별개로 수행될 수 있으나, 본 실시예에서는 분석 시간 단축, 비용 절감 및 분석의 용이성을 위해 복수의 표적을 동시에 증폭시키는 다중 PCR 방법을 이용했다. 실시예 1에서 제작된 각 표적 영역의 증폭을 위한 프라이머는 어닐링 온도 및 PCR 조건을 통합할 수 있도록 설계되었으므로, 다중 PCR을 수행할 수 있다. Target PCR was performed using the primers designed in Example 1 so as to amplify all possible types of HLA-A, B, and DRB1 for high-resolution HLA typing analysis. PCR can be performed separately for each target region, but in this embodiment, a multiplex PCR method is used in which a plurality of targets are simultaneously amplified for shortening analysis time, cost reduction, and ease of analysis. The primers for amplification of each target region prepared in Example 1 were designed to integrate the annealing temperature and the PCR conditions, so that multiplex PCR can be performed.

96개의 혈액 샘플에서 DNA를 추출하고 각각의 샘플을 바코드 01 내지 96으로 명명하였다. 표적 PCR 반응은 총 2개의 96 웰 플레이트, 플레이트 1 및 2에서 수행하고, 각각의 96 플레이트에는 HLA-A, B의 엑손 2, 엑손 3, 엑손 4 및 DRB1의 엑손 2가 증폭 가능하도록 혼합된 프라이머를 주입하였다.DNA was extracted from 96 blood samples and each sample was designated as Barcode 01-96. The target PCR reaction was performed in two 96-well plates, Plates 1 and 2 in total, and HLA-A, B, Exon 2, Exon 3, Exon 4 and Exon 2 of DRB1 were amplified so that they could be amplified. .

96 웰 플레이트 1에는 HLA-A-엑손 4, HLA-B-엑손 2, HLA-B-엑손 4의 프라이머 10 μM을 3:3:1로 혼합된 비율로 주입하고, 96 웰 플레이트 2에는 HLA-A-엑손 2, HLA-A-엑손 3, HLA-B-엑손 3, HLA-DRB1-엑손 2 프라이머 비율이 1:1:1:1.5의 비율로 혼합하여 주입하였다. In 96-well plate 1, 10 μM of primers of HLA-A-exon 4, HLA-B-exon 2 and HLA-B-exon 4 were injected in a ratio of 3: 3: A-exon 2, HLA-A-exon 3, HLA-B-exon 3 and HLA-DRB1-exon 2 primers were mixed at a ratio of 1: 1: 1: 1.5.

표적 영역을 증폭시키는 PCR에 의해 수득된 산물에 NGS 용 어댑터 및 샘플 식별용 바코드 서열을 결합시키는 PCR을 통해 NGS를 위한 라이브러리를 제작하고, 그 후, NGS에 의해 서열을 분석한다. NGS를 위한 라이브러리 제작시, 표적 영역의 양은 동일하거나 유사해야 모든 표적 영역에 대한 NGS 결과를 동일한 정확도로 얻을 수 있으므로 각 표적 영역의 정량이 요구된다. 이러한 정량 단계의 단순화를 위해, 모든 표적 영역, 즉, HLA-A-엑손 4(AE4), HLA-B-엑손 2(BE2), HLA-B-엑손 4(BE4), HLA-A-엑손 2(AE2), HLA-A-엑손 3(AE3), HLA-B-엑손 3(BE3), HLA-DRB1-엑손 2(DRB1E2)의 증폭 산물의 비율이 거의 동일하도록 하기 위해, 표적 영역의 증폭을 위한 PCR에서 프라이머 쌍의 비율을 조정했다. A library for NGS is prepared by PCR, which binds the adapter for NGS and the bar code sequence for sample identification to the product obtained by PCR amplifying the target region, and then the sequence is analyzed by NGS. In the production of a library for NGS, quantification of each target area is required since the amount of target area should be the same or similar so that NGS results for all target areas can be obtained with the same accuracy. In order to simplify this quantification step, all target regions, i.e., HLA-A-exon 4 (AE4), HLA-B-exon 2 (BE2), HLA- (AE2), HLA-A-exon 3 (AE3), HLA-B-exon 3 (BE3) and HLA-DRB1-exon 2 (DRB1E2) The ratio of primer pairs in the PCR was adjusted.

2개의 96 웰 플레이트에 중합반응 완충용액, DNA 중합 효소를 주입하고, 프라이머 1.5 ㎕및 샘플 DNA 1 ㎕를 각각의 96 웰 플레이트 해당 위치에 넣어 중합효소연쇄반응 기기를 이용한 증폭 과정을 수행하였다. The polymerization reaction buffer and DNA polymerase were injected into two 96-well plates, and 1.5 μl of the primer and 1 μl of the sample DNA were placed in the corresponding 96-well plate, and amplification was performed using a polymerase chain reaction device.

dNTP 0.2 mM, 베타인 0.3M, 1X Phusion buffer를 포함하는 중합반응 완충용액을 사용하고, DNA 중합효소로 Phusion Hot Start Ⅱ High-Fidelity DNA polymerase 0.2 unit (Themo Scientific)을 사용하였다.0.2 mM dNTP, 0.3 M beta-phosphate buffer, and 1X Phusion buffer. Phusion Hot Start II High-Fidelity DNA polymerase 0.2 unit (Themo Scientific) was used as a DNA polymerase.

중합 효소 연쇄반응 조건은 98℃에서 30초간 1회, 98℃에서 1분, 60℃에서 30초, 및 72℃에서 30초로 이루어진 사이클을 총 20회 실시한 후, 마지막으로, 72℃에서 5분간 1회 실시였고, PCR 기기는 Bio-Rad의 C1000을 사용하였다. 도 4는 HLA 표적 다중 PCR의 전기영동 및 Bioanalyzer 확인 결과를 보여준다.
The polymerase chain reaction was performed 20 times in total at 98 ° C for 30 seconds, at 98 ° C for 1 minute, at 60 ° C for 30 seconds, and at 72 ° C for 30 seconds, and finally at 72 ° C for 5 minutes for 1 minute And C1000 of Bio-Rad was used as a PCR instrument. Figure 4 shows the results of electrophoresis and bioanalyzer confirmation of HLA target multiplex PCR.

실시예Example 3. 샘플 식별  3. Sample Identification 바코딩을Bar coding 위한  for FusionFusion PCRPCR

실시예 2에서 수득된 HLA 표적 PCR 산물에 샘플 식별용 바코드 서열 및 어댑터를 연결하는 Fusion PCR을 수행하였다. 이 방법은 고가의 NGS 라이브러리 제조 키트(library preparation kit)을 사용하지 않고 PCR을 통해 어댑터와 바코드를 결합시키는 방법으로, 시간과 비용의 절감 효과가 있으며, 또한 HLA 검사 외에 target-resequencing 기법에도 적용 가능하다.Fusion PCR was performed in which the HLA-target PCR product obtained in Example 2 was connected to a bar code sequence for sample identification and an adapter. This method combines the adapter and the bar code by PCR without using expensive NGS library preparation kit. This method saves time and cost. It is applicable to target-resequencing method besides HLA test. Do.

표적 PCR에서 증폭된 96 웰 플레이트 1 과 96 플레이트 2 증폭 산물을 하나의 플레이트에 같은 샘플별로 통합(pool)하여, 96 종류의 NGS-Miseq 식별용 바코드가 연결된 프라이머를 이용하여 Fusion PCR을 수행하였다.The 96-well plate 1 and the 96-plate 2 amplification products amplified in the target PCR were pooled on one plate by the same sample, and Fusion PCR was performed using primers to which 96 kinds of NGS-Miseq identification bar codes were connected.

96 종류의 NGS-Miseq 식별 바코딩 프라이머를 96 웰 플레이트 3에 5 μM 농도로 주입하였다. 96 웰 플레이트 3에 중합반응 완충용액, 중합반응 효소를 주입하고, 샘플별로 통합된 PCR 산물 1 ㎕를 각각의 96 웰 플레이트 해당 위치에 넣어 중합효소연쇄반응 기기를 이용한 증폭 과정을 수행하였다. 이때 사용된 중합반응 완층용액은 dNTP 0.2 mM, 베타인 0.3M, 1X Phusion buffer를 포함했고, DNA 중합효소는 Phusion Hot Start Ⅱ High-Fidelity DNA polymerase 0.4 unit (Themo Scientific) 사용하였다.96 kinds of NGS-Miseq identification bar coding primers were injected into 96 well plate 3 at a concentration of 5 μM. A polymerization reaction buffer and a polymerization reaction solution were injected into a 96-well plate 3, and 1 μl of the integrated PCR product was added to each 96-well plate to perform amplification using a polymerase chain reaction device. The PCR solution used was 0.2 mM dNTP, 0.3 M beta-phosphate buffer, and 1X Phusion buffer. The DNA polymerase was Phusion Hot Start II High-Fidelity DNA polymerase 0.4 unit (Themo Scientific).

이때 중합 효소 연쇄반응 조건은 98℃에서 30초간 1회, 98℃에서 15초, 60℃에서 30초, 및 72℃에서 30초로 이루어진 사이클을 총 23회 실시한 후, 마지막으로, 72℃에서 5분간 1회 실시였고, PCR 기기는 Bio-Rad의 C1000을 사용하였다.The polymerase chain reaction was carried out 23 times at 98 ° C for 30 seconds, at 98 ° C for 15 seconds, at 60 ° C for 30 seconds, and at 72 ° C for 30 seconds, and finally at 72 ° C for 5 minutes And PCR instrument C1000 of Bio-Rad was used.

도 2a 및 2b는 HLA의 표적 증폭 PCR 및 뒤이은 Fusion PCR을 수행하는 방법을 개략적으로 표시한다. 또한, 도 3은 표적 증폭 PCR과 Fusion PCR에서 사용되는 프라이머와 PCR 산물의 구조를 보여준다. Figures 2A and 2B schematically illustrate a method of performing a target amplification PCR of HLA followed by Fusion PCR. Figure 3 also shows the structure of the primers and PCR products used in the target amplification PCR and Fusion PCR.

샘플 식별용 바코드 및 어댑터를 포함하는 바코딩 프라이머는 표적 PCR 증폭 산물에 상보적으로 결합가능한 유니버설 프라이머를 포함한다. 식별 바코드 프라이머 서열은 어댑터 서열-바코드 서열-유니버설 프라이머 서열의 구조로 이루어진다. 본 실시예에서 제작하여 사용한 96 종류의 NGS-Miseq 식별 바코딩 프라이머 서열 중 어댑터 서열과 유니버설 프라이머 서열 및 바코드 서열이 각각 하기의 표 2 및 표 3에 표시된다. 또한, Fusion PCR에서 바코딩 프라이머와 쌍으로 이용되는 어댑터 프라이머 중 어댑터 서열 및 유니버설 프라이머 서열이 하기 표 4에 기재한다. A bar coding primer comprising a sample identification bar code and an adapter includes a universal primer that is complementarily bindable to the target PCR amplification product. The identification bar code primer sequence consists of the adapter sequence-bar code sequence-universal primer sequence structure. Among the 96 types of NGS-Miseq identification bar coding primer sequences prepared and used in this example, the adapter sequence, the universal primer sequence and the bar code sequence are shown in Tables 2 and 3 below, respectively. In addition, adapter and universal primer sequences among the adapter primers used in pairs with the bar coding primer in Fusion PCR are shown in Table 4 below.

웰 LineWell Line 웰 No.Well No. 명칭designation 어댑터adapter 유니버설 프라이머Universal primer A - HA - H 01~9601 ~ 96 Mi-HL-RMi-HL-R CAAGCAGAAGACGGCATACGAGATCAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTT

웰 LineWell Line 웰 No.Well No. 명칭designation 바코드barcode AA 01  01 Mi-HL-R-01Mi-HL-R-01 ACGACGATACACGACGATAC BB 01  01 Mi-HL-R-02Mi-HL-R-02 ACGCATACACACGCATACAC CC 01  01 Mi-HL-R-03Mi-HL-R-03 ACTACGAGCAACTACGAGCA DD 01  01 Mi-HL-R-04Mi-HL-R-04 AGACGACGACAGACGACGAC EE 01  01 Mi-HL-R-05Mi-HL-R-05 ACACACGCACACACACGCAC FF 01  01 Mi-HL-R-06Mi-HL-R-06 TACACGACGCTACACGACGC GG 01  01 Mi-HL-R-07Mi-HL-R-07 AGTACACGACAGTACACGAC HH 01  01 Mi-HL-R-08Mi-HL-R-08 ACGCTACATCACGCTACATC AA 0202 Mi-HL-R-09Mi-HL-R-09 ACGATCACTCACGATCACTC BB 0202 Mi-HL-R-10Mi-HL-R-10 ACTGATAGCGACTGATAGCG CC 0202 Mi-HL-R-11Mi-HL-R-11 GACTACAGCGGACTACAGCG DD 0202 Mi-HL-R-12Mi-HL-R-12 ACTCACTAGCACTCACTAGC EE 0202 Mi-HL-R-13Mi-HL-R-13 TCACTAGCTCTCACTAGCTC FF 0202 Mi-HL-R-14Mi-HL-R-14 TGACAGCACGTGACAGCACG GG 0202 Mi-HL-R-15Mi-HL-R-15 AGAGACGATCAGAGACGATC HH 0202 Mi-HL-R-16Mi-HL-R-16 ACGACAGCACACGACAGCAC AA 0303 Mi-HL-R-17Mi-HL-R-17 AGCACGCTCAAGCACGCTCA BB 0303 Mi-HL-R-18Mi-HL-R-18 TGACGACATGTGACGACATG CC 0303 Mi-HL-R-19Mi-HL-R-19 GAGACACTGAGAGACACTGA DD 0303 Mi-HL-R-20Mi-HL-R-20 ACATGAGCACACATGAGCAC EE 0303 Mi-HL-R-21Mi-HL-R-21 TCGAGATACGTCGAGATACG FF 0303 Mi-HL-R-22Mi-HL-R-22 GACGCATGACGACGCATGAC GG 0303 Mi-HL-R-23Mi-HL-R-23 GATCGCATAGGATCGCATAG HH 0303 Mi-HL-R-24Mi-HL-R-24 CAGCATAGCACAGCATAGCA AA 0404 Mi-HL-R-25Mi-HL-R-25 CATGCACACACATGCACACA BB 0404 Mi-HL-R-26Mi-HL-R-26 AGTGACACTCAGTGACACTC CC 0404 Mi-HL-R-27Mi-HL-R-27 ACGAGACTAGACGAGACTAG DD 0404 Mi-HL-R-28Mi-HL-R-28 AGATGCACTCAGATGCACTC EE 0404 Mi-HL-R-29Mi-HL-R-29 CGACTACGCACGACTACGCA FF 0404 Mi-HL-R-30Mi-HL-R-30 GACGACACAGGACGACACAG GG 0505 Mi-HL-R-31Mi-HL-R-31 CGCACTACAGCGCACTACAG HH 0606 Mi-HL-R-32Mi-HL-R-32 ACTAGCGCACACTAGCGCAC AA 0505 Mi-HL-R-33Mi-HL-R-33 TGCGAGCACATGCGAGCACA BB 0505 Mi-HL-R-34Mi-HL-R-34 AGCTCGCATCAGCTCGCATC CC 0505 Mi-HL-R-35Mi-HL-R-35 TCACGTACAGTCACGTACAG DD 0505 Mi-HL-R-36Mi-HL-R-36 TCATCATCGCTCATCATCGC EE 0505 Mi-HL-R-37Mi-HL-R-37 TGACTCGACATGACTCGACA FF 0505 Mi-HL-R-38Mi-HL-R-38 GACAGTAGACGACAGTAGAC GG 0505 Mi-HL-R-39Mi-HL-R-39 ACTCTGACTGACTCTGACTG HH 0505 Mi-HL-R-40Mi-HL-R-40 ATAGACTGCGATAGACTGCG AA 0606 Mi-HL-R-41Mi-HL-R-41 GTGCTCATACGTGCTCATAC BB 0606 Mi-HL-R-42Mi-HL-R-42 ACAGCACTCGACAGCACTCG CC 0606 Mi-HL-R-43Mi-HL-R-43 GCGTGCTATAGCGTGCTATA DD 0606 Mi-HL-R-44Mi-HL-R-44 TCGCGCATGATCGCGCATGA EE 0606 Mi-HL-R-45Mi-HL-R-45 GCAGCGCATAGCAGCGCATA FF 0606 Mi-HL-R-46Mi-HL-R-46 TGCACAGAGATGCACAGAGA GG 0606 Mi-HL-R-47Mi-HL-R-47 CACGCGATAGCACGCGATAG HH 0606 Mi-HL-R-48Mi-HL-R-48 CAGCAGCGTACAGCAGCGTA AA 0707 Mi-HL-R-49Mi-HL-R-49 GATCATGCAGGATCATGCAG BB 0707 Mi-HL-R-50Mi-HL-R-50 ATGATACGCGATGATACGCG CC 0707 Mi-HL-R-51Mi-HL-R-51 CGAGAGATACCGAGAGATAC DD 0707 Mi-HL-R-52Mi-HL-R-52 GCATATGAGCGCATATGAGC EE 0707 Mi-HL-R-53Mi-HL-R-53 CGACATAGTGCGACATAGTG FF 0707 Mi-HL-R-54Mi-HL-R-54 CTACGCGCTACTACGCGCTA GG 0707 Mi-HL-R-55Mi-HL-R-55 TACTGTGACGTACTGTGACG HH 0707 Mi-HL-R-56Mi-HL-R-56 TCTCACGCGATCTCACGCGA AA 0808 Mi-HL-R-57Mi-HL-R-57 CAGCGATGTACAGCGATGTA BB 0808 Mi-HL-R-58Mi-HL-R-58 TGTCTCTCACTGTCTCTCAC CC 0808 Mi-HL-R-59Mi-HL-R-59 ACGTACAGTCACGTACAGTC DD 0808 Mi-HL-R-60Mi-HL-R-60 AGCTACGTGCAGCTACGTGC EE 0808 Mi-HL-R-61Mi-HL-R-61 CATAGCGTGACATAGCGTGA FF 0808 Mi-HL-R-62Mi-HL-R-62 ACGTAGTACGACGTAGTACG GG 0808 Mi-HL-R-63Mi-HL-R-63 TACTCAGCTGTACTCAGCTG HH 0808 Mi-HL-R-64Mi-HL-R-64 GACTGATCTCGACTGATCTC AA 0909 Mi-HL-R-65Mi-HL-R-65 CAGCTCAGTACAGCTCAGTA BB 0909 Mi-HL-R-66Mi-HL-R-66 CGCGCTACTACGCGCTACTA CC 0909 Mi-HL-R-67Mi-HL-R-67 AGCAGACGTCAGCAGACGTC DD 0909 Mi-HL-R-68Mi-HL-R-68 TCGCGAGTACTCGCGAGTAC EE 0909 Mi-HL-R-69Mi-HL-R-69 TGCGCTCAGATGCGCTCAGA FF 0909 Mi-HL-R-70Mi-HL-R-70 AGCACGTCTAAGCACGTCTA GG 0909 Mi-HL-R-71Mi-HL-R-71 GACGAGTCACGACGAGTCAC HH 0909 Mi-HL-R-72Mi-HL-R-72 CGCTACTCGACGCTACTCGA AA 1010 Mi-HL-R-73Mi-HL-R-73 ACATCATACGACATCATACG BB 1010 Mi-HL-R-74Mi-HL-R-74 TGACAGACTATGACAGACTA CC 1010 Mi-HL-R-75Mi-HL-R-75 GATAGAGACAGATAGAGACA DD 1010 Mi-HL-R-76Mi-HL-R-76 GATACTCTAGGATACTCTAG EE 1010 Mi-HL-R-77Mi-HL-R-77 GCACATGATAGCACATGATA FF 1010 Mi-HL-R-78Mi-HL-R-78 TACACTCATGTACACTCATG GG 1010 Mi-HL-R-79Mi-HL-R-79 TATGACGACATATGACGACA HH 1010 Mi-HL-R-80Mi-HL-R-80 GCATGAGATAGCATGAGATA AA 1111 Mi-HL-R-81Mi-HL-R-81 TAGTGACACATAGTGACACA BB 1111 Mi-HL-R-82Mi-HL-R-82 AGCATCGATAAGCATCGATA CC 1111 Mi-HL-R-83Mi-HL-R-83 ACAGACTCTAACAGACTCTA DD 1111 Mi-HL-R-84Mi-HL-R-84 ATGATGCATGATGATGCATG EE 1111 Mi-HL-R-85Mi-HL-R-85 TGACTGATCATGACTGATCA FF 1111 Mi-HL-R-86Mi-HL-R-86 ATCATAGACGATCATAGACG GG 1111 Mi-HL-R-87Mi-HL-R-87 TCAGTATCACTCAGTATCAC HH 1111 Mi-HL-R-88Mi-HL-R-88 TCAGATCTAGTCAGATCTAG AA 1212 Mi-HL-R-89Mi-HL-R-89 CAGACTGATACAGACTGATA BB 1212 Mi-HL-R-90Mi-HL-R-90 TAGCATCTGATAGCATCTGA CC 1212 Mi-HL-R-91Mi-HL-R-91 CACGTACATACACGTACATA DD 1212 Mi-HL-R-92Mi-HL-R-92 CACTGTATAGCACTGTATAG EE 1212 Mi-HL-R-93Mi-HL-R-93 CAGAGTATCACAGAGTATCA FF 1212 Mi-HL-R-94Mi-HL-R-94 ATATCGCTGAATATCGCTGA GG 1212 Mi-HL-R-95Mi-HL-R-95 TCATCAGTAGTCATCAGTAG HH 1212 Mi-HL-R-96Mi-HL-R-96 TGTGTACTACTGTGTACTAC

웰 LineWell Line 웰 No.Well No. 명칭designation 어댑터adapter 유니버설 프라이머Universal primer A ~ HA to H 01-9601-96 Mi-HL-FMi-HL-F AATGATACGGCGACCACCGAGATCTAATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

실시예Example 4.  4. NGSNGS 를 이용한 서열분석 및 ≪ / RTI > HLAHLA 형별Type 결정 decision

실시예 3에서 수득된 Fusion PCR 생성물을 정제하고 정량하였다. The Fusion PCR product obtained in Example 3 was purified and quantified.

먼저, 96 웰 각각으로부터 채취한 5㎕의 PCT 생성물을 1개의 1.5 ml 튜브에 혼합하여 100 ㎕ 를 수득하고, Agencourt AMPure XP bead 100 ㎕를 섞어 마그네틱 비드에 붙여 프라이머 및 dNTP 잔여물을 제거하고, 80% 에탄올로 비드를 세척한 후, Qiagen Elution buffer 50 ㎕로 PCR 산물을 녹였다.First, 5 μl of the PCT product collected from each of the 96 wells was mixed into one 1.5 ml tube to obtain 100 μl. 100 μl of Agencourt AMPure XP bead was added to the magnetic beads to remove the primer and dNTP residues, After washing the beads with ethanol, the PCR product was dissolved in 50 μl of Qiagen Elution buffer.

이후 QuantusTM Fluorometer(Promega,USA)기기를 이용하여 정제된 혼합 바코드 샘플 시료를 정량 하였다. 측정을 위해, Quant-iTTM PicoGreen® dsDNA Reagent Kit의 Quant-iTTM PicoGreen® dsDNA reagent 시약 1.5 ㎕를 1X TE 시약 298.5 ㎕에 희석시켜 준비했다. Blank시약 200 ㎕ (1X TE 시약 100 ㎕에 희석된 Quant-iTTM PicoGreen○R dsDNA Reagen시약 100㎕), 표준시약 200 ㎕(1X TE 시약 98 ㎕에 Lambda DNA standard 시약 2 ㎕와 희석된 Quant-iTTM PicoGreen® dsDNA Reagen시약 100 ㎕), 샘플시약 200 ㎕(1X TE 시약 99㎕에 샘플시료 1 ㎕ 와 희석된 Quant-iTTM PicoGreen® dsDNA Reagen 시약 100 ㎕)를 0.5ml 튜브에 넣어 준비한 후, 차례로 QuantusTM Fluorometer 에 넣어 측정하였다. 바코드 01 내지 96으로 명명된 최종 혼합 샘플을 QuantusTM Fluorometer로 측정한 결과 약 30-50 nM로 결정되었다.The purified mixed bar code sample was quantified using a Quantus TM fluorometer (Promega, USA). For the measurement, 1.5 占 퐇 of Quant-iT 占 PicoGreen 占 dsDNA reagent reagent of Quant-iT 占 PicoGreen 占 dsDNA Reagent Kit was diluted in 298.5 占 of 1 占 TE reagent. 200 μl of blank reagent (100 μl of Quant-iT ™ PicoGreen® R dsDNA Reagent reagent diluted in 100 μl of 1 × TE reagent), 200 μl of standard reagent (2 μl of Lambda DNA standard reagent and 98 μl of Quant- after the TM PicoGreen ® dsDNA Reagen reagent ㎕ 100), the Quant-iT TM PicoGreen ® dsDNA Reagen reagent 100 ㎕) diluted reagent to the sample 200 ㎕ (sample 1 sample ㎕ in 1X TE reagent prepared 99㎕ placed in 0.5ml tubes, then Quantus TM Fluorometer. The final mixed sample labeled barcode 01-96 was determined to be about 30-50 nM by Quantus TM Fluorometer.

Miseq 샘플 준비 설명서에 따라, 10 nM로 준비된 Miseq 라이브러리 산물을 150 pM 최종 농도로 희석하여 540 ㎕를 취득하고, 12.5 pM Phix library 60 ㎕를 더해, 총 600 ㎕의 최종 산물을 준비하였다. 이후 Illumina Miseq 프로그램에 의하여 각 샘플의 서열을 결정하였다. 요약하면, Illumina Miseq 프로그램에 의하여 결정된 서열은 fastq 파일 형태의 데이터로 출력되며 이후, N base, GC content, Q30 base fraction 등 결정된 서열의 품질을 확인한 후 결정된 서열에 근거하여 소프트웨어 (Omixon Target HLA Typing 프로그램: http://www.omixon.com/hla/)를 이용, 각 샘플의 HLA 형별을 결정하였다. According to the Miseq sample preparation instructions, the Miseq library product prepared at 10 nM was diluted to a final concentration of 150 pM to obtain 540 μl, and 60 μl of a 12.5 pM Phix library was added to prepare a total of 600 μl of final product. The sequence of each sample was then determined by the Illumina Miseq program. In summary, the sequences determined by the Illumina Miseq program are output as fastq file data, and then the quality of determined sequences such as N base, GC content, and Q30 base fraction is checked and then the software (Omixon Target HLA Typing Program : http://www.omixon.com/hla/), the HLA type of each sample was determined.

상기 NGS에 의해 수득된 결과를 동일한 샘플에 대한 중해상도 분석 방법인 SSOP에 의한 결과와 비교하였다. The results obtained by the NGS were compared with those by SSOP which is a medium resolution analysis method for the same sample.

하기 표 5 내지 7은 각각 HLA-A, HLA-B, 및 HLA-DRB1에 대한 결과를 보여준다.Tables 5 to 7 below show the results for HLA-A, HLA-B, and HLA-DRB1, respectively.

SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode1_1.fastqBarcode1_1.fastq Allele 1Allele 1 HLA-A*02:06GHLA-A * 02: 06G HLA-A*02:06:01HLA-A * 02: 06: 01 Allele 2Allele 2 HLA-A*26:02GHLA-A * 26: 02G HLA-A*26:02:01HLA-A * 26: 02: 01 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode5_1.fastqBarcode5_1.fastq Allele 1Allele 1 HLA-A*02:06GHLA-A * 02: 06G HLA-A*02:06:01HLA-A * 02: 06: 01 Allele 2Allele 2 HLA-A*26:02GHLA-A * 26: 02G HLA-A*26:02:01HLA-A * 26: 02: 01 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode6_1.fastqBarcode6_1.fastq Allele 1Allele 1 HLA-A*02:07GHLA-A * 02: 07G HLA-A*02:07:01HLA-A * 02: 07: 01 Allele 2Allele 2 HLA-A*31:01GHLA-A * 31: 01G HLA-A*31:01:02HLA-A * 31: 01: 02 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode13_1.fastqBarcode13_1.fastq Allele 1Allele 1 HLA-A*02:07GHLA-A * 02: 07G HLA-A*02:07:01HLA-A * 02: 07: 01 Allele 2Allele 2 HLA-A*33:03GHLA-A * 33: 03G HLA-A*33:03:01HLA-A * 33: 03: 01 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode19_1.fastqBarcode19_1.fastq Allele 1Allele 1 HLA-A*02:01GHLA-A * 02: 01G HLA-A*02:01:01HLA-A * 02: 01: 01 Allele 2Allele 2 HLA-A*33:03GHLA-A * 33: 03G HLA-A*33:03:01HLA-A * 33: 03: 01 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode24_1.fastqBarcode24_1.fastq Allele 1Allele 1 HLA-A*02:06GHLA-A * 02: 06G HLA-A*02:06:01HLA-A * 02: 06: 01 Allele 2Allele 2 HLA-A*33:03GHLA-A * 33: 03G HLA-A*33:03:01HLA-A * 33: 03: 01 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode33_1.fastqBarcode33_1.fastq Allele 1Allele 1 HLA-A*24:02GHLA-A * 24: 02G HLA-A*24:02:011 HLA-A * 24: 02: 01 1 　 HLA-A*24:02:40HLA-A * 24: 02: 40 Allele 2Allele 2 __ HLA-A*24:02:01HLA-A * 24: 02: 01 　 HLA-A*24:02:40HLA-A * 24: 02: 40 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode34_1.fastqBarcode34_1.fastq Allele 1Allele 1 HLA-A*33:03GHLA-A * 33: 03G HLA-A*33:03:01HLA-A * 33: 03: 01 Allele 2Allele 2 __ __ SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode37_1.fastqBarcode37_1.fastq Allele 1Allele 1 HLA-A*02:01GHLA-A * 02: 01G HLA-A*02:01:01HLA-A * 02: 01: 01 Allele 2Allele 2 __ __ SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode49_1.fastqBarcode49_1.fastq Allele 1Allele 1 HLA-A*11:01GHLA-A * 11: 01G HLA-A*11:01:01HLA-A * 11: 01: 01 Allele 2Allele 2 HLA-A*24:02GHLA-A * 24: 02G HLA-A*24:02:01HLA-A * 24: 02: 01 　 HLA-A*24:02:40HLA-A * 24: 02: 40 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode66_1.fastqBarcode66_1.fastq Allele 1Allele 1 HLA-A*24:02GHLA-A * 24: 02G HLA-A*24:02:011 HLA-A * 24: 02: 01 1 　 HLA-A*24:02:40HLA-A * 24: 02: 40 Allele 2Allele 2 __ HLA-A*24:02:01HLA-A * 24: 02: 01 　 HLA-A*24:02:40HLA-A * 24: 02: 40 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode77_1.fastqBarcode77_1.fastq Allele 1Allele 1 HLA-A*24:02GHLA-A * 24: 02G HLA-A*24:02:011 HLA-A * 24: 02: 01 1 　 HLA-A*24:02:40HLA-A * 24: 02: 40 Allele 2Allele 2 __ HLA-A*24:02:01HLA-A * 24: 02: 01 　 HLA-A*24:02:40HLA-A * 24: 02: 40 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode81_1.fastqBarcode81_1.fastq Allele 1Allele 1 HLA-A*33:03GHLA-A * 33: 03G HLA-A*33:03:01HLA-A * 33: 03: 01 Allele 2Allele 2 __ __

1. SSOP 결과: homozygote 이나, NGS 결과로 heterozygote 가능성을 보여 주고 있음.1. SSOP results: showing homozygote or heterozygote potential as a result of NGS.

SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode19Barcode19 _1._One. fastqfastq AlleleAllele 1 One HLAHLA -B*13:01G-B * 13: 01G HLAHLA -B*13:01:01-B * 13: 01: 01 　 HLAHLA -B*13:01:05-B * 13: 01: 05 AlleleAllele 2 2 HLAHLA -B*58:01G-B * 58: 01G HLAHLA -B*58:01:01-B * 58: 01: 01 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode24Barcode24 _1._One. fastqfastq AlleleAllele 1 One HLAHLA -B*27:05G-B * 27: 05G HLAHLA -B*27:05:04-B * 27: 05: 04 　 HLAHLA -B*27:13-B * 27: 13 　 HLAHLA -B*27:05:02-B * 27: 05: 02 AlleleAllele 2 2 HLAHLA -B*44:03G-B * 44: 03G HLAHLA -B*44:03:01-B * 44: 03: 01 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode33Barcode33 _1._One. fastqfastq AlleleAllele 1 One HLAHLA -B*40:01G-B * 40: 01G HLAHLA -B*40:01:01-B * 40: 01: 01 　 HLAHLA -B*40:01:02-B * 40: 01: 02 AlleleAllele 2 2 HLAHLA -B*51:01G-B * 51: 01G HLAHLA -B*51:01:01-B * 51: 01: 01 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode34Barcode34 _1._One. fastqfastq AlleleAllele 1 One HLAHLA -B*44:03G-B * 44: 03G HLAHLA -B*44:03:02-B * 44: 03: 02 AlleleAllele 2 2 HLAHLA -B*51:01G-B * 51: 01G HLAHLA -B*51:76-B * 51: 76 　 HLAHLA -B*51:01:01-B * 51: 01: 01 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode37Barcode37 _1._One. fastqfastq AlleleAllele 1 One HLAHLA -B*15:01G-B * 15: 01G HLAHLA -B*15:212-B * 15: 212 　 HLAHLA -B*15:01:01-B * 15: 01: 01 AlleleAllele 2 2 HLAHLA -B*40:01G-B * 40: 01G HLAHLA -B*40:21-B * 40: 21 　 HLAHLA -B*40:01:01-B * 40: 01: 01 　 HLAHLA -B*40:01:02-B * 40: 01: 02 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode49Barcode49 _1._One. fastqfastq AlleleAllele 1 One HLAHLA -B*54:01G-B * 54: 01G HLAHLA -B*54:01:01-B * 54: 01: 01 　 HLAHLA -B*35:60-B * 35: 60 　 HLAHLA -B*35:57-B * 35: 57 　 HLAHLA -B*35:01:01-B * 35: 01: 01 　 HLAHLA -B*35:01:23-B * 35: 01: 23 　 HLAHLA -B*35:42:01-B * 35: 42: 01 　 HLAHLA -B*35:178-B * 35: 178 　 HLAHLA -B*35:101:02-B * 35: 101: 02 　 HLAHLA -B*35:101:01-B * 35: 101: 01 AlleleAllele 2 2 HLAHLA -B*35:01G-B * 35: 01G HLAHLA -B*54:01:01-B * 54: 01: 01 　 HLAHLA -B*35:60-B * 35: 60 　 HLAHLA -B*35:57-B * 35: 57 　 HLAHLA -B*35:01:01-B * 35: 01: 01 　 HLAHLA -B*35:01:23-B * 35: 01: 23 　 HLAHLA -B*35:42:01-B * 35: 42: 01 　 HLAHLA -B*35:178-B * 35: 178 　 HLAHLA -B*35:101:02-B * 35: 101: 02 　 HLAHLA -B*35:101:01-B * 35: 101: 01 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode66Barcode66 _1._One. fastqfastq AlleleAllele 1 One HLAHLA -B*15:02G-B * 15: 02G HLAHLA -B*15:02:01-B * 15: 02: 01 AlleleAllele 2 2 HLAHLA -B*35:01G-B * 35: 01G HLAHLA -B*35:01:01-B * 35: 01: 01 　 HLAHLA -B*35:01:23-B * 35: 01: 23 　 HLAHLA -B*35:42:01-B * 35: 42: 01 　 HLAHLA -B*35:101:02-B * 35: 101: 02 　 HLAHLA -B*35:101:01-B * 35: 101: 01 　 HLAHLA -B*35:178-B * 35: 178 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode77Barcode77 _1._One. fastqfastq AlleleAllele 1 One HLAHLA -B*54:01G-B * 54: 01G HLAHLA -B*54:01:01-B * 54: 01: 01 AlleleAllele 2 2 __ __ SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode81Barcode81 _1._One. fastqfastq AlleleAllele 1 One HLAHLA -B*44:03G-B * 44: 03G HLAHLA -B*44:03:01-B * 44: 03: 01 AlleleAllele 2 2 __ __

SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode1_1.fastqBarcode1_1.fastq Allele 1Allele 1 HLA-DRB1*04:06GHLA-DRB1 * 04: 06G HLA-DRB1*04:06:01HLA-DRB1 * 04: 06: 01 　 HLA-DRB1*04:06:02HLA-DRB1 * 04: 06: 02 Allele 2Allele 2 HLA-DRB1*09:01GHLA-DRB1 * 09: 01G HLA-DRB1*09:01:02HLA-DRB1 * 09: 01: 02 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode5_1.fastqBarcode5_1.fastq Allele 1Allele 1 HLA-DRB1*04:06GHLA-DRB1 * 04: 06G HLA-DRB1*04:06:01HLA-DRB1 * 04: 06: 01 　 HLA-DRB1*04:06:02HLA-DRB1 * 04: 06: 02 Allele 2Allele 2 HLA-DRB1*09:01GHLA-DRB1 * 09: 01G HLA-DRB1*09:01:02HLA-DRB1 * 09: 01: 02 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode6_1.fastqBarcode6_1.fastq Allele 1Allele 1 HLA-DRB1*08:02GHLA-DRB1 * 08: 02G HLA-DRB1*08:02:02HLA-DRB1 * 08: 02: 02 Allele 2Allele 2 HLA-DRB1*08:03GHLA-DRB1 * 08: 03G HLA-DRB1*08:03:02HLA-DRB1 * 08: 03: 02 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode13_1.fastqBarcode13_1.fastq Allele 1Allele 1 HLA-DRB1*07:01GHLA-DRB1 * 07: 01G HLA-DRB1*07:01:01HLA-DRB1 * 07: 01: 01 Allele 2Allele 2 HLA-DRB1*08:03GHLA-DRB1 * 08: 03G HLA-DRB1*08:03:02HLA-DRB1 * 08: 03: 02 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode19_1.fastqBarcode19_1.fastq Allele 1Allele 1 HLA-DRB1*12:02GHLA-DRB1 * 12: 02G HLA-DRB1*12:02:01HLA-DRB1 * 12: 02: 01 Allele 2Allele 2 HLA-DRB1*13:02GHLA-DRB1 * 13: 02G HLA-DRB1*13:02:01HLA-DRB1 * 13: 02: 01 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode24_1.fastqBarcode24_1.fastq Allele 1Allele 1 HLA-DRB1*01:01GHLA-DRB1 * 01: 01G HLA-DRB1*01:50HLA-DRB1 * 01: 50 　 HLA-DRB1*01:01:01HLA-DRB1 * 01: 01: 01 Allele 2Allele 2 HLA-DRB1*13:02GHLA-DRB1 * 13: 02G HLA-DRB1*13:02:01HLA-DRB1 * 13: 02: 01 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode33_1.fastqBarcode33_1.fastq Allele 1Allele 1 HLA-DRB1*04:05GHLA-DRB1 * 04: 05G HLA-DRB1*04:05:04HLA-DRB1 * 04: 05: 04 　 HLA-DRB1*04:05:01HLA-DRB1 * 04: 05: 01 Allele 2Allele 2 　 HLA-DRB1*04:05:04HLA-DRB1 * 04: 05: 04 HLA-DRB1*09:01GHLA-DRB1 * 09: 01G HLA-DRB1*09:01:02HLA-DRB1 * 09: 01: 02 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode34_1.fastqBarcode34_1.fastq Allele 1Allele 1 HLA-DRB1*07:01GHLA-DRB1 * 07: 01G HLA-DRB1*07:01:01HLA-DRB1 * 07: 01: 01 Allele 2Allele 2 HLA-DRB1*13:01GHLA-DRB1 * 13: 01G HLA-DRB1*13:01:01HLA-DRB1 * 13: 01: 01 　 HLA-DRB1*13:117HLA-DRB1 * 13: 117 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode37_1.fastqBarcode37_1.fastq Allele 1Allele 1 HLA-DRB1*14:05GHLA-DRB1 * 14: 05G HLA-DRB1*14:05:01HLA-DRB1 * 14: 05: 01 Allele 2Allele 2 HLA-DRB1*15:01GHLA-DRB1 * 15: 01G HLA-DRB1*15:01:17HLA-DRB1 * 15: 01: 17 　 HLA-DRB1*15:01:01HLA-DRB1 * 15: 01: 01 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode49_1.fastqBarcode49_1.fastq Allele 1Allele 1 HLA-DRB1*11:01GHLA-DRB1 * 11: 01G HLA-DRB1*11:01:01HLA-DRB1 * 11: 01: 01 　 HLA-DRB1*11:01:08HLA-DRB1 * 11: 01: 08 　 HLA-DRB1*11:97HLA-DRB1 * 11: 97 Allele 2Allele 2 HLA-DRB1*12:01GHLA-DRB1 * 12: 01G HLA-DRB1*12:01:01HLA-DRB1 * 12: 01: 01 　 HLA-DRB1*12:10HLA-DRB1 * 12: 10 　 HLA-DRB1*12:06HLA-DRB1 * 12: 06 　 HLA-DRB1*12:17HLA-DRB1 * 12: 17 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode66_1.fastqBarcode66_1.fastq Allele 1Allele 1 HLA-DRB1*09:01GHLA-DRB1 * 09: 01G HLA-DRB1*09:01:02HLA-DRB1 * 09: 01: 02 Allele 2Allele 2 HLA-DRB1*12:02GHLA-DRB1 * 12: 02G HLA-DRB1*12:02:01HLA-DRB1 * 12: 02: 01 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode77_1.fastqBarcode77_1.fastq Allele 1Allele 1 HLA-DRB1*08:03GHLA-DRB1 * 08: 03G HLA-DRB1*08:03:021 HLA-DRB1 * 08: 03: 02 1 Allele 2Allele 2 __ HLA-DRB1*08:03:03HLA-DRB1 * 08: 03: 03 SampleSample AlleleAllele SSOPSSOP NGSNGS Barcode81_1.fastqBarcode81_1.fastq Allele 1Allele 1 HLA-DRB1*13:02GHLA-DRB1 * 13: 02G HLA-DRB1*13:02:01HLA-DRB1 * 13: 02: 01 Allele 2Allele 2 __ __

1: SSOP 결과: homozygote 이나, NGS 결과로 heterozygote 결과를 보여 주고 있음.
1: SSOP result: homozygote or heterozygote results as NGS results.

SSOP와의 비교 결과는 NGS에 의한 분석이 보다 정확하고 고해상도의 HLA 형별 결정을 가능하게 한다는 것을 보여준다. The comparison with SSOP shows that the analysis by NGS enables more accurate and high resolution HLA typing.

<110> Lab Genomics <120> Method and kit for NGS-based high efficiency, high resolution HLA typing <130> PN107739 <160> 211 <170> KopatentIn 2.0 <210> 1 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> HL-A-E2-F <400> 1 acactctttc cctacacgac gctcttccga tctctctgyg gggagaagca a 51 <210> 2 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> HL-A-E2-R <400> 2 gtgactggag ttcagacgtg tgctcttccg atcttctcgg acccggagac tg 52 <210> 3 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> HL-A-E3-F <400> 3 acactctttc cctacacgac gctcttccga tctacygggc tgacckyggg 50 <210> 4 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> HL-A-E3-R <400> 4 gtgactggag ttcagacgtg tgctcttccg atctagayct ayaggcgatc agg 53 <210> 5 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> HL-A-E4-F <400> 5 acactctttc cctacacgac gctcttccga tcttgcctga atkwtctgac tcttcc 56 <210> 6 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> HL-A-E4-R <400> 6 gtgactggag ttcagacgtg tgctcttccg atctgccctg accctgctaa aggt 54 <210> 7 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> HL-B-E2-F <400> 7 acactctttc cctacacgac gctcttccga tctgagmrag gggaccgcag g 51 <210> 8 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> HL-B-E2-R <400> 8 acactctttc cctacacgac gctcttccga tctgagmrag gggaccgcag g 51 <210> 9 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> HL-B-E3-F <400> 9 acactctttc cctacacgac gctcttccga tctkrggcca gggtctcaca 50 <210> 10 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> HL-B-E3-R <400> 10 gtgactggag ttcagacgtg tgctcttccg atctcatccc sggcgaycta tag 53 <210> 11 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> HL-B-E4-F <400> 11 acactctttc cctacacgac gctcttccga tctgcgcctg aattttctga ctctt 55 <210> 12 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> HL-B-E4-R <400> 12 gtgactggag ttcagacgtg tgctcttccg atctagatat gacccctcat ccc 53 <210> 13 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> HL-DR-E2-F <400> 13 acactctttc cctacacgac gctcttccga tctcyggats sttyktgycc cc 52 <210> 14 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> HL-DR-E2-R <400> 14 gtgactggag ttcagacgtg tgctcttccg atctccgctg cacygtgaag ct 52 <210> 15 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 1 <400> 15 acgacgatac 10 <210> 16 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 2 <400> 16 acgcatacac 10 <210> 17 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 3 <400> 17 actacgagca 10 <210> 18 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 4 <400> 18 agacgacgac 10 <210> 19 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 5 <400> 19 acacacgcac 10 <210> 20 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 6 <400> 20 tacacgacgc 10 <210> 21 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 7 <400> 21 agtacacgac 10 <210> 22 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 8 <400> 22 acgctacatc 10 <210> 23 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 9 <400> 23 acgatcactc 10 <210> 24 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 10 <400> 24 actgatagcg 10 <210> 25 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 11 <400> 25 gactacagcg 10 <210> 26 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 12 <400> 26 actcactagc 10 <210> 27 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 13 <400> 27 tcactagctc 10 <210> 28 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 14 <400> 28 tgacagcacg 10 <210> 29 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 15 <400> 29 agagacgatc 10 <210> 30 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 16 <400> 30 acgacagcac 10 <210> 31 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 17 <400> 31 agcacgctca 10 <210> 32 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 18 <400> 32 tgacgacatg 10 <210> 33 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 19 <400> 33 gagacactga 10 <210> 34 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 20 <400> 34 acatgagcac 10 <210> 35 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 21 <400> 35 tcgagatacg 10 <210> 36 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 22 <400> 36 gacgcatgac 10 <210> 37 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 23 <400> 37 gatcgcatag 10 <210> 38 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 24 <400> 38 cagcatagca 10 <210> 39 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 25 <400> 39 catgcacaca 10 <210> 40 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 26 <400> 40 agtgacactc 10 <210> 41 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 27 <400> 41 acgagactag 10 <210> 42 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 28 <400> 42 agatgcactc 10 <210> 43 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 29 <400> 43 cgactacgca 10 <210> 44 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 30 <400> 44 gacgacacag 10 <210> 45 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 31 <400> 45 cgcactacag 10 <210> 46 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 32 <400> 46 actagcgcac 10 <210> 47 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 33 <400> 47 tgcgagcaca 10 <210> 48 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 34 <400> 48 agctcgcatc 10 <210> 49 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 35 <400> 49 tcacgtacag 10 <210> 50 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 36 <400> 50 tcatcatcgc 10 <210> 51 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 37 <400> 51 tgactcgaca 10 <210> 52 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 38 <400> 52 gacagtagac 10 <210> 53 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 39 <400> 53 actctgactg 10 <210> 54 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 40 <400> 54 atagactgcg 10 <210> 55 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 41 <400> 55 gtgctcatac 10 <210> 56 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 42 <400> 56 acagcactcg 10 <210> 57 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 43 <400> 57 gcgtgctata 10 <210> 58 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 44 <400> 58 tcgcgcatga 10 <210> 59 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 45 <400> 59 gcagcgcata 10 <210> 60 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 46 <400> 60 tgcacagaga 10 <210> 61 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 47 <400> 61 cacgcgatag 10 <210> 62 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 48 <400> 62 cagcagcgta 10 <210> 63 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 49 <400> 63 gatcatgcag 10 <210> 64 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 50 <400> 64 atgatacgcg 10 <210> 65 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 51 <400> 65 cgagagatac 10 <210> 66 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 52 <400> 66 gcatatgagc 10 <210> 67 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 53 <400> 67 cgacatagtg 10 <210> 68 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 54 <400> 68 ctacgcgcta 10 <210> 69 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 55 <400> 69 tactgtgacg 10 <210> 70 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 56 <400> 70 tctcacgcga 10 <210> 71 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 57 <400> 71 cagcgatgta 10 <210> 72 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 58 <400> 72 tgtctctcac 10 <210> 73 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 59 <400> 73 acgtacagtc 10 <210> 74 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 60 <400> 74 agctacgtgc 10 <210> 75 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 61 <400> 75 catagcgtga 10 <210> 76 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 62 <400> 76 acgtagtacg 10 <210> 77 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 63 <400> 77 tactcagctg 10 <210> 78 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 64 <400> 78 gactgatctc 10 <210> 79 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 65 <400> 79 cagctcagta 10 <210> 80 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 66 <400> 80 cgcgctacta 10 <210> 81 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 67 <400> 81 agcagacgtc 10 <210> 82 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 68 <400> 82 tcgcgagtac 10 <210> 83 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 69 <400> 83 tgcgctcaga 10 <210> 84 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 70 <400> 84 agcacgtcta 10 <210> 85 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 71 <400> 85 gacgagtcac 10 <210> 86 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 72 <400> 86 cgctactcga 10 <210> 87 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 73 <400> 87 acatcatacg 10 <210> 88 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 74 <400> 88 tgacagacta 10 <210> 89 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 75 <400> 89 gatagagaca 10 <210> 90 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 76 <400> 90 gatactctag 10 <210> 91 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 77 <400> 91 gcacatgata 10 <210> 92 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 78 <400> 92 tacactcatg 10 <210> 93 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 79 <400> 93 tatgacgaca 10 <210> 94 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 80 <400> 94 gcatgagata 10 <210> 95 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 81 <400> 95 tagtgacaca 10 <210> 96 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 82 <400> 96 agcatcgata 10 <210> 97 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 83 <400> 97 acagactcta 10 <210> 98 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 84 <400> 98 atgatgcatg 10 <210> 99 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 85 <400> 99 tgactgatca 10 <210> 100 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 86 <400> 100 atcatagacg 10 <210> 101 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 87 <400> 101 tcagtatcac 10 <210> 102 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 88 <400> 102 tcagatctag 10 <210> 103 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 89 <400> 103 cagactgata 10 <210> 104 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 90 <400> 104 tagcatctga 10 <210> 105 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 91 <400> 105 cacgtacata 10 <210> 106 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 92 <400> 106 cactgtatag 10 <210> 107 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 93 <400> 107 cagagtatca 10 <210> 108 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 94 <400> 108 atatcgctga 10 <210> 109 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 95 <400> 109 tcatcagtag 10 <210> 110 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 96 <400> 110 tgtgtactac 10 <210> 111 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Universal Primer in Mi-HL-F <400> 111 acactctttc cctacacgac gctcttccga tct 33 <210> 112 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Universal primer in Mi-HL-R <400> 112 gtgactggag ttcagacgtg tgctcttccg atct 34 <210> 113 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Adapter in Mi-HL-F <400> 113 aatgatacgg cgaccaccga gatct 25 <210> 114 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Adapter in Mi-HL-R <400> 114 caagcagaag acggcatacg agat 24 <210> 115 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 1 <400> 115 caagcagaag acggcatacg agatacgacg atacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 116 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 2 <400> 116 caagcagaag acggcatacg agatacgcat acacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 117 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 3 <400> 117 caagcagaag acggcatacg agatactacg agcagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 118 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 4 <400> 118 caagcagaag acggcatacg agatagacga cgacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 119 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 5 <400> 119 caagcagaag acggcatacg agatacacac gcacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 120 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 6 <400> 120 caagcagaag acggcatacg agattacacg acgcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 121 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 7 <400> 121 caagcagaag acggcatacg agatagtaca cgacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 122 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 8 <400> 122 caagcagaag acggcatacg agatacgcta catcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 123 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 9 <400> 123 caagcagaag acggcatacg agatacgatc actcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 124 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 10 <400> 124 caagcagaag acggcatacg agatactgat agcggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 125 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 11 <400> 125 caagcagaag acggcatacg agatgactac agcggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 126 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 12 <400> 126 caagcagaag acggcatacg agatactcac tagcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 127 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 13 <400> 127 caagcagaag acggcatacg agattcacta gctcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 128 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 14 <400> 128 caagcagaag acggcatacg agattgacag cacggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 129 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 15 <400> 129 caagcagaag acggcatacg agatagagac gatcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 130 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 16 <400> 130 caagcagaag acggcatacg agatacgaca gcacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 131 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 17 <400> 131 caagcagaag acggcatacg agatagcacg ctcagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 132 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 18 <400> 132 caagcagaag acggcatacg agattgacga catggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 133 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 19 <400> 133 caagcagaag acggcatacg agatgagaca ctgagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 134 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 20 <400> 134 caagcagaag acggcatacg agatacatga gcacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 135 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 21 <400> 135 caagcagaag acggcatacg agattcgaga tacggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 136 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 22 <400> 136 caagcagaag acggcatacg agatgacgca tgacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 137 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 23 <400> 137 caagcagaag acggcatacg agatgatcgc ataggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 138 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 24 <400> 138 caagcagaag acggcatacg agatcagcat agcagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 139 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 25 <400> 139 caagcagaag acggcatacg agatcatgca cacagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 140 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 26 <400> 140 caagcagaag acggcatacg agatagtgac actcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 141 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 27 <400> 141 caagcagaag acggcatacg agatacgaga ctaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 142 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 28 <400> 142 caagcagaag acggcatacg agatagatgc actcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 143 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 29 <400> 143 caagcagaag acggcatacg agatcgacta cgcagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 144 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 30 <400> 144 caagcagaag acggcatacg agatgacgac acaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 145 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 31 <400> 145 caagcagaag acggcatacg agatcgcact acaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 146 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 32 <400> 146 caagcagaag acggcatacg agatactagc gcacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 147 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 33 <400> 147 caagcagaag acggcatacg agattgcgag cacagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 148 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 34 <400> 148 caagcagaag acggcatacg agatagctcg catcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 149 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 35 <400> 149 caagcagaag acggcatacg agattcacgt acaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 150 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 36 <400> 150 caagcagaag acggcatacg agattcatca tcgcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 151 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 37 <400> 151 caagcagaag acggcatacg agattgactc gacagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 152 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 38 <400> 152 caagcagaag acggcatacg agatgacagt agacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 153 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 39 <400> 153 caagcagaag acggcatacg agatactctg actggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 154 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 40 <400> 154 caagcagaag acggcatacg agatatagac tgcggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 155 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 41 <400> 155 caagcagaag acggcatacg agatgtgctc atacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 156 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 42 <400> 156 caagcagaag acggcatacg agatacagca ctcggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 157 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 43 <400> 157 caagcagaag acggcatacg agatgcgtgc tatagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 158 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 44 <400> 158 caagcagaag acggcatacg agattcgcgc atgagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 159 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 45 <400> 159 caagcagaag acggcatacg agatgcagcg catagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 160 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 46 <400> 160 caagcagaag acggcatacg agattgcaca gagagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 161 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 47 <400> 161 caagcagaag acggcatacg agatcacgcg ataggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 162 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 48 <400> 162 caagcagaag acggcatacg agatcagcag cgtagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 163 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 49 <400> 163 caagcagaag acggcatacg agatgatcat gcaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 164 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 50 <400> 164 caagcagaag acggcatacg agatatgata cgcggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 165 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 51 <400> 165 caagcagaag acggcatacg agatcgagag atacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 166 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 52 <400> 166 caagcagaag acggcatacg agatgcatat gagcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 167 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 53 <400> 167 caagcagaag acggcatacg agatcgacat agtggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 168 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 54 <400> 168 caagcagaag acggcatacg agatctacgc gctagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 169 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 55 <400> 169 caagcagaag acggcatacg agattactgt gacggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 170 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 56 <400> 170 caagcagaag acggcatacg agattctcac gcgagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 171 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 57 <400> 171 caagcagaag acggcatacg agatcagcga tgtagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 172 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 58 <400> 172 caagcagaag acggcatacg agattgtctc tcacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 173 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 59 <400> 173 caagcagaag acggcatacg agatacgtac agtcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 174 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 60 <400> 174 caagcagaag acggcatacg agatagctac gtgcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 175 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 61 <400> 175 caagcagaag acggcatacg agatcatagc gtgagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 176 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 62 <400> 176 caagcagaag acggcatacg agatacgtag tacggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 177 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 63 <400> 177 caagcagaag acggcatacg agattactca gctggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 178 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 64 <400> 178 caagcagaag acggcatacg agatgactga tctcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 179 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 65 <400> 179 caagcagaag acggcatacg agatcagctc agtagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 180 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 66 <400> 180 caagcagaag acggcatacg agatcgcgct actagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 181 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 67 <400> 181 caagcagaag acggcatacg agatagcaga cgtcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 182 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 68 <400> 182 caagcagaag acggcatacg agattcgcga gtacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 183 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 69 <400> 183 caagcagaag acggcatacg agattgcgct cagagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 184 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 70 <400> 184 caagcagaag acggcatacg agatagcacg tctagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 185 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 71 <400> 185 caagcagaag acggcatacg agatgacgag tcacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 186 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 72 <400> 186 caagcagaag acggcatacg agatcgctac tcgagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 187 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 73 <400> 187 caagcagaag acggcatacg agatacatca tacggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 188 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 74 <400> 188 caagcagaag acggcatacg agattgacag actagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 189 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 75 <400> 189 caagcagaag acggcatacg agatgataga gacagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 190 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 76 <400> 190 caagcagaag acggcatacg agatgatact ctaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 191 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 77 <400> 191 caagcagaag acggcatacg agatgcacat gatagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 192 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 78 <400> 192 caagcagaag acggcatacg agattacact catggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 193 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 79 <400> 193 caagcagaag acggcatacg agattatgac gacagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 194 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 80 <400> 194 caagcagaag acggcatacg agatgcatga gatagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 195 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 81 <400> 195 caagcagaag acggcatacg agattagtga cacagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 196 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 82 <400> 196 caagcagaag acggcatacg agatagcatc gatagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 197 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 83 <400> 197 caagcagaag acggcatacg agatacagac tctagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 198 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 84 <400> 198 caagcagaag acggcatacg agatatgatg catggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 199 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 85 <400> 199 caagcagaag acggcatacg agattgactg atcagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 200 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 86 <400> 200 caagcagaag acggcatacg agatatcata gacggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 201 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 87 <400> 201 caagcagaag acggcatacg agattcagta tcacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 202 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 88 <400> 202 caagcagaag acggcatacg agattcagat ctaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 203 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 89 <400> 203 caagcagaag acggcatacg agatcagact gatagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 204 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 90 <400> 204 caagcagaag acggcatacg agattagcat ctgagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 205 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 91 <400> 205 caagcagaag acggcatacg agatcacgta catagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 206 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 92 <400> 206 caagcagaag acggcatacg agatcactgt ataggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 207 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 93 <400> 207 caagcagaag acggcatacg agatcagagt atcagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 208 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 94 <400> 208 caagcagaag acggcatacg agatatatcg ctgagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 209 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 95 <400> 209 caagcagaag acggcatacg agattcatca gtaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 210 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 96 <400> 210 caagcagaag acggcatacg agattgtgta ctacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 211 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Adapter primer <400> 211 aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatct 58 <110> Lab Genomics <120> Method and kit for NGS-based high efficiency, high resolution HLA          typing <130> PN107739 <160> 211 <170> Kopatentin 2.0 <210> 1 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> HL-A-E2-F <400> 1 acctctttc cctacacgac gctcttccga tctctctgyg gggagaagca a 51 <210> 2 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> HL-A-E2-R <400> 2 gtgactggag ttcagacgtg tgctcttccg atcttctcgg acccggagac tg 52 <210> 3 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> HL-A-E3-F <400> 3 acctctttc cctacacgac gctcttccga tctacygggc tgacckyggg 50 <210> 4 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> HL-A-E3-R <400> 4 gtgactggag ttcagacgtg tgctcttccg atctagayct ayaggcgatc agg 53 <210> 5 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> HL-A-E4-F <400> 5 acctctttc cctacacgac gctcttccga tcttgcctga atkwtctgac tcttcc 56 <210> 6 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> HL-A-E4-R <400> 6 gtgactggag ttcagacgtg tgctcttccg atctgccctg accctgctaa aggt 54 <210> 7 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> HL-B-E2-F <400> 7 acctctttc cctacacgac gctcttccga tctgagmrag gggaccgcag g 51 <210> 8 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> HL-B-E2-R <400> 8 acctctttc cctacacgac gctcttccga tctgagmrag gggaccgcag g 51 <210> 9 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> HL-B-E3-F <400> 9 acactctttc cctacacgac gctcttccga tctkrggcca gggtctcaca 50 <210> 10 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> HL-B-E3-R <400> 10 gtgactggag ttcagacgtg tgctcttccg atctcatccc sggcgaycta tag 53 <210> 11 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> HL-B-E4-F <400> 11 acctctttc cctacacgac gctcttccga tctgcgcctg aattttctga ctctt 55 <210> 12 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> HL-B-E4-R <400> 12 gtgactggag ttcagacgtg tgctcttccg atctagatat gacccctcat ccc 53 <210> 13 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> HL-DR-E2-F <400> 13 acctctttc cctacacgac gctcttccga tctcyggats sttyktgycc cc 52 <210> 14 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> HL-DR-E2-R <400> 14 gtgactggag ttcagacgtg tgctcttccg atctccgctg cacygtgaag ct 52 <210> 15 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 1 <400> 15 acgacgatac 10 <210> 16 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 2 <400> 16 acgcatacac 10 <210> 17 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 3 <400> 17 actacgagca 10 <210> 18 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 4 <400> 18 agacgacgac 10 <210> 19 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 5 <400> 19 acacacgcac 10 <210> 20 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 6 <400> 20 tacacgacgc 10 <210> 21 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 7 <400> 21 agtacacgac 10 <210> 22 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 8 <400> 22 acgctacatc 10 <210> 23 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 9 <400> 23 acgatcactc 10 <210> 24 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 10 <400> 24 actgatagcg 10 <210> 25 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 11 <400> 25 gactacagcg 10 <210> 26 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 12 <400> 26 actcactagc 10 <210> 27 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 13 <400> 27 tcactagctc 10 <210> 28 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 14 <400> 28 tgacagcacg 10 <210> 29 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 15 <400> 29 agagacgatc 10 <210> 30 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 16 <400> 30 acgacagcac 10 <210> 31 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 17 <400> 31 agcacgctca 10 <210> 32 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 18 <400> 32 tgacgacatg 10 <210> 33 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 19 <400> 33 gagacactga 10 <210> 34 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 20 <400> 34 acatgagcac 10 <210> 35 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 21 <400> 35 tcgagatacg 10 <210> 36 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 22 <400> 36 gacgcatgac 10 <210> 37 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 23 <400> 37 gatcgcatag 10 <210> 38 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 24 <400> 38 cagcatagca 10 <210> 39 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 25 <400> 39 catgcacaca 10 <210> 40 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 26 <400> 40 agtgacactc 10 <210> 41 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 27 <400> 41 acgagactag 10 <210> 42 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 28 <400> 42 agatgcactc 10 <210> 43 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 29 <400> 43 cgactacgca 10 <210> 44 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 30 <400> 44 gacgacacag 10 <210> 45 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 31 <400> 45 cgcactacag 10 <210> 46 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 32 <400> 46 actagcgcac 10 <210> 47 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 33 <400> 47 tgcgagcaca 10 <210> 48 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 34 <400> 48 agctcgcatc 10 <210> 49 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 35 <400> 49 tcacgtacag 10 <210> 50 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 36 <400> 50 tcatcatcgc 10 <210> 51 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 37 <400> 51 tgactcgaca 10 <210> 52 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 38 <400> 52 gacagtagac 10 <210> 53 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 39 <400> 53 actctgactg 10 <210> 54 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 40 <400> 54 atagactgcg 10 <210> 55 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 41 <400> 55 gtgctcatac 10 <210> 56 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 42 <400> 56 acagcactcg 10 <210> 57 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 43 <400> 57 gcgtgctata 10 <210> 58 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 44 <400> 58 tcgcgcatga 10 <210> 59 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 45 <400> 59 gcagcgcata 10 <210> 60 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 46 <400> 60 tgcacagaga 10 <210> 61 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 47 <400> 61 cacgcgatag 10 <210> 62 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 48 <400> 62 cagcagcgta 10 <210> 63 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 49 <400> 63 gatcatgcag 10 <210> 64 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 50 <400> 64 atgatacgcg 10 <210> 65 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 51 <400> 65 cgagagatac 10 <210> 66 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 52 <400> 66 gcatatgagc 10 <210> 67 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 53 <400> 67 cgacatagtg 10 <210> 68 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 54 <400> 68 ctacgcgcta 10 <210> 69 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 55 <400> 69 tactgtgacg 10 <210> 70 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 56 <400> 70 tctcacgcga 10 <210> 71 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 57 <400> 71 cagcgatgta 10 <210> 72 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 58 <400> 72 tgtctctcac 10 <210> 73 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 59 <400> 73 acgtacagtc 10 <210> 74 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 60 <400> 74 agctacgtgc 10 <210> 75 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 61 <400> 75 catagcgtga 10 <210> 76 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 62 <400> 76 acgtagtacg 10 <210> 77 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 63 <400> 77 tactcagctg 10 <210> 78 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 64 <400> 78 gactgatctc 10 <210> 79 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 65 <400> 79 cagctcagta 10 <210> 80 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 66 <400> 80 cgcgctacta 10 <210> 81 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 67 <400> 81 agcagacgtc 10 <210> 82 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 68 <400> 82 tcgcgagtac 10 <210> 83 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 69 <400> 83 tgcgctcaga 10 <210> 84 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 70 <400> 84 agcacgtcta 10 <210> 85 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 71 <400> 85 gacgagtcac 10 <210> 86 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 72 <400> 86 cgctactcga 10 <210> 87 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 73 <400> 87 acatcatacg 10 <210> 88 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 74 <400> 88 tgacagacta 10 <210> 89 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 75 <400> 89 gill <210> 90 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 76 <400> 90 gatactctag 10 <210> 91 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 77 <400> 91 gcacatgata 10 <210> 92 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 78 <400> 92 tacactcatg 10 <210> 93 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 79 <400> 93 tatgacgaca 10 <210> 94 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 80 <400> 94 gcatgagata 10 <210> 95 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 81 <400> 95 tagtgacaca 10 <210> 96 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 82 <400> 96 agcatcgata 10 <210> 97 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 83 <400> 97 acagactcta 10 <210> 98 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 84 <400> 98 atgatgcatg 10 <210> 99 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 85 <400> 99 tgactgatca 10 <210> 100 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 86 <400> 100 atcatagacg 10 <210> 101 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 87 <400> 101 tcagtatcac 10 <210> 102 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 88 <400> 102 tcagatctag 10 <210> 103 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 89 <400> 103 cagactgata 10 <210> 104 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 90 <400> 104 tagcatctga 10 <210> 105 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 91 <400> 105 cacgtacata 10 <210> 106 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 92 <400> 106 cactgtatag 10 <210> 107 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 93 <400> 107 cagagtatca 10 <210> 108 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 94 <400> 108 atatcgctga 10 <210> 109 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 95 <400> 109 tcatcagtag 10 <210> 110 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Barcode 96 <400> 110 tgtgtactac 10 <210> 111 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Universal Primer in Mi-HL-F <400> 111 acctctttc cctacacgac gctcttccga tct 33 <210> 112 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Universal primer in Mi-HL-R <400> 112 gtgactggag ttcagacgtg tgctcttccg atct 34 <210> 113 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Adapter in Mi-HL-F <400> 113 aatgatacgg cgaccaccga gatct 25 <210> 114 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Adapter in Mi-HL-R <400> 114 caagcagaag acggcatacg agat 24 <210> 115 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 1 <400> 115 caagcagaag acggcatacg agatacgacg atacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 116 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 2 <400> 116 caagcagaag acggcatacg agatacgcat acacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 117 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 3 <400> 117 caagcagaag acggcatacg agatactacg agcagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 118 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 4 <400> 118 caagcagaag acggcatacg agatagacga cgacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 119 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 5 <400> 119 caagcagaag acggcatacg agatacacac gcacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 120 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 6 <400> 120 caagcagaag acggcatacg agattacacg acgcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 121 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 7 <400> 121 caagcagaag acggcatacg agatagtaca cgacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 122 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 8 <400> 122 caagcagaag acggcatacg agatacgcta catcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 123 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 9 <400> 123 caagcagaag acggcatacg agatacgatc actcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 124 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 10 <400> 124 caagcagaag acggcatacg agatactgat agcggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 125 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 11 <400> 125 caagcagaag acggcatacg agatgactac agcggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 126 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 12 <400> 126 caagcagaag acggcatacg agatactcac tagcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 127 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 13 <400> 127 caagcagaag acggcatacg agattcacta gctcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 128 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 14 <400> 128 caagcagaag acggcatacg agattgacag cacggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 129 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 15 <400> 129 caagcagaag acggcatacg agatagagac gatcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 130 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 16 <400> 130 caagcagaag acggcatacg agatacgaca gcacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 131 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 17 <400> 131 caagcagaag acggcatacg agatagcacg ctcagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 132 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 18 <400> 132 caagcagaag acggcatacg agattgacga catggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 133 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 19 <400> 133 caagcagaag acggcatacg agatgagaca ctgagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 134 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 20 <400> 134 caagcagaag acggcatacg agatacatga gcacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 135 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 21 <400> 135 caagcagaag acggcatacg agattcgaga tacggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 136 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 22 <400> 136 caagcagaag acggcatacg agatgacgca tgacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 137 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 23 <400> 137 caagcagaag acggcatacg agatgatcgc ataggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 138 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 24 <400> 138 caagcagaag acggcatacg agatcagcat agcagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 139 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 25 <400> 139 caagcagaag acggcatacg agatcatgca cacagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 140 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 26 <400> 140 caagcagaag acggcatacg agatagtgac actcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 141 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 27 <400> 141 caagcagaag acggcatacg agatacgaga ctaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 142 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 28 <400> 142 caagcagaag acggcatacg agatagatgc actcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 143 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 29 <400> 143 caagcagaag acggcatacg agatcgacta cgcagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 144 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 30 <400> 144 caagcagaag acggcatacg agatgacgac acaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 145 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 31 <400> 145 caagcagaag acggcatacg agatcgcact acaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 146 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 32 <400> 146 caagcagaag acggcatacg agatactagc gcacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 147 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 33 <400> 147 caagcagaag acggcatacg agattgcgag cacagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 148 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 34 <400> 148 caagcagaag acggcatacg agatagctcg catcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 149 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 35 <400> 149 caagcagaag acggcatacg agattcacgt acaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 150 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 36 <400> 150 caagcagaag acggcatacg agattcatca tcgcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 151 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 37 <400> 151 caagcagaag acggcatacg agattgactc gacagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 152 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 38 <400> 152 caagcagaag acggcatacg agatgacagt agacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 153 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 39 <400> 153 caagcagaag acggcatacg agatactctg actggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 154 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 40 <400> 154 caagcagaag acggcatacg agatatagac tgcggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 155 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 41 <400> 155 caagcagaag acggcatacg agatgtgctc atacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 156 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 42 <400> 156 caagcagaag acggcatacg agatacagca ctcggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 157 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 43 <400> 157 caagcagaag acggcatacg agatgcgtgc tatagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 158 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 44 <400> 158 caagcagaag acggcatacg agattcgcgc atgagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 159 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 45 <400> 159 caagcagaag acggcatacg agatgcagcg catagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 160 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 46 <400> 160 caagcagaag acggcatacg agattgcaca gagagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 161 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 47 <400> 161 caagcagaag acggcatacg agatcacgcg ataggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 162 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 48 <400> 162 caagcagaag acggcatacg agatcagcag cgtagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 163 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 49 <400> 163 caagcagaag acggcatacg agatgatcat gcaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 164 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 50 <400> 164 caagcagaag acggcatacg agatatgata cgcggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 165 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 51 <400> 165 caagcagaag acggcatacg agatcgagag atacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 166 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 52 <400> 166 caagcagaag acggcatacg agatgcatat gagcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 167 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 53 <400> 167 caagcagaag acggcatacg agatcgacat agtggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 168 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 54 <400> 168 caagcagaag acggcatacg agatctacgc gctagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 169 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 55 <400> 169 caagcagaag acggcatacg agattactgt gacggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 170 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 56 <400> 170 caagcagaag acggcatacg agattctcac gcgagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 171 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 57 <400> 171 caagcagaag acggcatacg agatcagcga tgtagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 172 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 58 <400> 172 caagcagaag acggcatacg agattgtctc tcacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 173 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 59 <400> 173 caagcagaag acggcatacg agatacgtac agtcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 174 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 60 <400> 174 caagcagaag acggcatacg agatagctac gtgcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 175 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 61 <400> 175 caagcagaag acggcatacg agatcatagc gtgagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 176 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 62 <400> 176 caagcagaag acggcatacg agatacgtag tacggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 177 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 63 <400> 177 caagcagaag acggcatacg agattactca gctggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 178 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 64 <400> 178 caagcagaag acggcatacg agatgactga tctcgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 179 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 65 <400> 179 caagcagaag acggcatacg agatcagctc agtagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 180 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 66 <400> 180 caagcagaag acggcatacg agatcgcgct actagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 181 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 67 <400> 181 cgtcgtgct tccgatct 68 <210> 182 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 68 <400> 182 caagcagaag acggcatacg agattcgcga gtacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 183 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 69 <400> 183 caagcagaag acggcatacg agattgcgct cagagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 184 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 70 <400> 184 caagcagaag acggcatacg agatagcacg tctagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 185 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 71 <400> 185 caagcagaag acggcatacg agatgacgag tcacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 186 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 72 <400> 186 caagcagaag acggcatacg agatcgctac tcgagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 187 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 73 <400> 187 caagcagaag acggcatacg agatacatca tacggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 188 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 74 <400> 188 caagcagaag acggcatacg agattgacag actagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 189 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 75 <400> 189 caagcagaag acggcatacg agatgataga gacagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 190 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 76 <400> 190 caagcagaag acggcatacg agatgatact ctaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 191 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 77 <400> 191 caagcagaag acggcatacg agatgcacat gatagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 192 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 78 <400> 192 caagcagaag acggcatacg agattacact catggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 193 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 79 <400> 193 caagcagaag acggcatacg agattatgac gacagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 194 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 80 <400> 194 caagcagaag acggcatacg agatgcatga gatagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 195 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 81 <400> 195 cagtagag tccgatct 68 <210> 196 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 82 <400> 196 caagcagaag acggcatacg agatagcatc gatagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 197 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 83 <400> 197 caagcagaag acggcatacg agatacagac tctagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 198 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 84 <400> 198 caagcagaag acggcatacg agatatgatg catggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 199 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 85 <400> 199 caagcagaag acggcatacg agattgactg atcagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 200 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 86 <400> 200 caagcagaag acggcatacg agatatcata gacggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 201 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 87 <400> 201 caagcagaag acggcatacg agattcagta tcacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 202 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 88 <400> 202 caagcagaag acggcatacg agattcagat ctaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 203 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 89 <400> 203 caagcagaag acggcatacg agatcagact gatagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 204 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 90 <400> 204 caagcagaag acggcatacg agattagcat ctgagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 205 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 91 <400> 205 caagcagaag acggcatacg agatcacgta catagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 206 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 92 <400> 206 caagcagaag acggcatacg agatcactgt ataggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 207 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 93 <400> 207 caagcagaag acggcatacg agatcagagt atcagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 208 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 94 <400> 208 caagcagaag acggcatacg agatatatcg ctgagtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 209 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 95 <400> 209 caagcagaag acggcatacg agattcatca gtaggtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 210 <211> 68 <212> DNA <213> Artificial Sequence <220> <223> Barcoding primer 96 <400> 210 caagcagaag acggcatacg agattgtgta ctacgtgact ggagttcaga cgtgtgctct 60 tccgatct 68 <210> 211 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Adapter primer <400> 211 aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatct 58

Claims (10)

차세대 염기서열분석(NGS)을 이용하여 고해상도 조직적합성(HLA) 형별 분석을 수행하는 방법으로서,
샘플 중 HLA-A, HLA-B, 및 HLA-DRB1의 엑손 영역을 증폭시켜 표적 PCR 산물을 수득하는 단계,
수득된 표적 PCR 산물을 주형으로 이용하고, 서열분석용 유니버설 프라이머 서열, 샘플 식별용 바코드 서열, 및 어댑터 서열을 포함하는 바코딩 프라이머와 어댑터 프라이머를 이용한 융합(Fusion) PCR을 수행하여 NGS용 어댑터 및 샘플 식별용 바코드가 결합된 바코딩된 PCR 산물을 수득하는 단계,
바코딩된 PCR 산물을 대상으로 NGS를 수행하는 단계를 포함하는 것인 방법으로서,
상기 HLA-A, HLA-B, 및 HLA-DRB1의 엑손 영역을 증폭시켜 표적 PCR 산물을 수득하는 단계는 다중 PCR로 수행되는 것이고,
상기 HLA-A, B 및 DRB1의 엑손 영역을 증폭시켜 표적 PCR 산물을 수득하는 단계는 서열번호 1 내지 6의 HLA-A 증폭용 프라이머, 서열번호 7 내지 12의 HLA-B 증폭용 프라이머, 및 서열번호 13 및 14의 HLA-DRB1 증폭용 프라이머로 구성된 프라이머의 조합을 이용하여 수행되는 것인 방법. A method for performing high resolution histological conformance (HLA) type analysis using next generation nucleotide sequence analysis (NGS)
Amplifying the exon regions of HLA-A, HLA-B, and HLA-DRB1 in the sample to obtain a target PCR product,
Fusion PCR using a bar coding primer and an adapter primer including a universal primer sequence for sequence analysis, a bar code sequence for sample identification, and an adapter sequence was performed using the obtained target PCR product as a template, Obtaining a bar-coded PCR product having a sample identification bar code attached thereto,
Performing NGS on the bar-coded PCR product,
The step of amplifying the exon regions of HLA-A, HLA-B, and HLA-DRB1 to obtain a target PCR product is performed by multiplex PCR,
The step of amplifying the exon regions of HLA-A, B and DRB1 to obtain a target PCR product comprises the step of amplifying the HLA-A primer of SEQ ID NOs: 1 to 6, the primer of amplifying HLA-B of SEQ ID NOs: 7 to 12, Lt; RTI ID = 0.0 &gt; HLA-DRB1 &lt; / RTI &gt; amplification of SEQ ID NOs: 13 and 14, respectively. 삭제delete 삭제delete 청구항 1에 있어서, 상기 다중 PCR은 HLA-A의 엑손 2, 3, 4, HLA-B의 엑손 2, 3, 4, 및 HLA-DRB1의 엑손 2를 증폭시키는 것인 방법.2. The method of claim 1, wherein said multiplex PCR amplifies exons 2, 3 and 4 of HLA-A, exons 2, 3 and 4 of HLA-B, and exon 2 of HLA-DRB1. 청구항 1에 있어서, 상기 바코딩된 PCR 산물을 수득하는 단계는 서열번호 115 내지 210의 바코딩 프라이머로 구성된 군으로부터 선택된 프라이머와 서열번호 211의 어댑터 프라이머를 이용하여 수행되는 것인 방법.The method of claim 1, wherein obtaining the barcoded PCR product is performed using a primer selected from the group consisting of the bar coding primers of SEQ ID Nos. 115 to 210 and an adapter primer of SEQ ID NO: 211. 서열번호 1 내지 6의 HLA-A 증폭용 프라이머, 서열번호 7 내지 12의 HLA-B 증폭용 프라이머, 및 서열번호 13 및 14의 HLA-DRB1 증폭용 프라이머 및 서열번호 115 내지 210의 바코딩 프라이머와 서열번호 211의 어댑터 프라이머를 포함하는, 고해상도 조직적합성(HLA) 형별 분석용 키트.A primer for amplifying HLA-A of SEQ ID NOs: 1 to 6, a primer for amplifying HLA-B of SEQ ID NOs: 7 to 12, and a primer for amplifying HLA-DRB1 of SEQ ID NOs: 13 and 14 and a bar coding primer of SEQ ID NOs: A kit for high resolution histocompatibility (HLA) type analysis, comprising the adapter primer of SEQ ID NO: 211. 삭제delete 삭제delete 삭제delete 삭제delete
KR1020150020961A 2015-02-11 2015-02-11 Method and kit for NGS-based high efficiency, high resolution HLA typing KR101782806B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020150020961A KR101782806B1 (en) 2015-02-11 2015-02-11 Method and kit for NGS-based high efficiency, high resolution HLA typing
PCT/KR2015/006773 WO2016129759A1 (en) 2015-02-11 2015-07-01 Next generation sequencing technique-based high-efficiency, high-resolution histocompatibility typing analysis method and kit

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020150020961A KR101782806B1 (en) 2015-02-11 2015-02-11 Method and kit for NGS-based high efficiency, high resolution HLA typing

Publications (2)

Publication Number Publication Date
KR20160098838A KR20160098838A (en) 2016-08-19
KR101782806B1 true KR101782806B1 (en) 2017-09-28

Family

ID=56615360

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020150020961A KR101782806B1 (en) 2015-02-11 2015-02-11 Method and kit for NGS-based high efficiency, high resolution HLA typing

Country Status (2)

Country Link
KR (1) KR101782806B1 (en)
WO (1) WO2016129759A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200002164A (en) 2018-06-29 2020-01-08 경북대학교 산학협력단 Novel Analysis Strategy for Human Leukocyte Antigen Typing using Sequence-Specific Oligonucleotide Probe Method

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2203567B1 (en) * 2007-10-16 2011-05-11 Roche Diagnostics GmbH High resolution, high throughput hla genotyping by clonal sequencing
JPWO2013011734A1 (en) * 2011-07-21 2015-02-23 ジェノダイブファーマ株式会社 HLA gene DNA typing method and kit
KR101406720B1 (en) * 2012-06-19 2014-06-13 (주)지노첵 Method for designing fusion primer used in next generation sequencing, and method for analyzing genotype of target gene using next generation sequencing and fusion primer

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BMC Genomics. Vol. 15, 63, pp. 1-11 (2014)*

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200002164A (en) 2018-06-29 2020-01-08 경북대학교 산학협력단 Novel Analysis Strategy for Human Leukocyte Antigen Typing using Sequence-Specific Oligonucleotide Probe Method

Also Published As

Publication number Publication date
WO2016129759A1 (en) 2016-08-18
KR20160098838A (en) 2016-08-19

Similar Documents

Publication Publication Date Title
US20210001302A1 (en) Methods of sequencing the immune repertoire
US20230049314A1 (en) Methods for Identifying Multiple Epitopes in Selected Sub-Populations of Cells
US9920370B2 (en) Haplotying of HLA loci with ultra-deep shotgun sequencing
US20130324422A1 (en) Detecting disease-correlated clonotypes from fixed samples
US11047011B2 (en) Immunorepertoire normality assessment method and its use
JP2018531044A6 (en) Method for assessing normality of immune repertoire and use thereof
WO2018147438A1 (en) Pcr primer set for hla gene, and sequencing method using same
CN110863056A (en) Method, reagent and application for accurately typing human DNA
US20090143245A1 (en) Microarrays for genotyping and methods of use
JP2022002539A (en) Major histocompatibility complex single nucleotide polymorphisms
KR101782806B1 (en) Method and kit for NGS-based high efficiency, high resolution HLA typing
CN114875118B (en) Methods, kits and devices for determining cell lineage
CN112292600A (en) System for identifying antigens recognized by T cell receptors expressed on tumor infiltrating lymphocytes
KR101967879B1 (en) Method for measuring integrity of unique identifier in sequencing
RU2769300C1 (en) Test system for pre-implantation genetic testing of type 1 spinocerebellar ataxia
RU2799797C2 (en) Method of obtaining molecular str markers of the human y chromosome for identifying an unknown individual and determining biological relationship by multiplex amplification, and a kit of oligonucleotides for implementing the method
EP3696279A1 (en) Methods for noninvasive prenatal testing of fetal abnormalities
CN116970707A (en) Composite amplification kit for detecting human Y chromosome locus based on NGS technology
US20230091944A1 (en) Lymphatic fluid for diagnostics
US20230123183A1 (en) Lymphatic fluid for diagnostics
KR20190021734A (en) Primer set for diagnosing seoul virus infection, kit and method for diagnosing comprising the same
CN114525328A (en) Kit for detecting HLA-I/II gene expression typing and expression quantity at single cell level and use method thereof
KR20140079665A (en) Primer and method thereof

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E90F Notification of reason for final refusal
GRNT Written decision to grant