WO2021146625A1 - Gene therapy for treatment of crx-autosomal dominant retinopathies - Google Patents
Gene therapy for treatment of crx-autosomal dominant retinopathies Download PDFInfo
- Publication number
- WO2021146625A1 WO2021146625A1 PCT/US2021/013733 US2021013733W WO2021146625A1 WO 2021146625 A1 WO2021146625 A1 WO 2021146625A1 US 2021013733 W US2021013733 W US 2021013733W WO 2021146625 A1 WO2021146625 A1 WO 2021146625A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- crx
- nucleic acid
- vector
- promoter
- aav
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
- A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
- A61K48/0041—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid the non-active part being polymeric
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/02—Ophthalmic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
Definitions
- This relates to the field of cone rod homeobox transcription factor (CRY) autosomal dominant retinopathies, specifically to the use of a nucleic acid molecule comprising a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein for treatment of these retinopathies.
- CRY cone rod homeobox transcription factor
- IRDs Inherited retinal diseases
- RP retinitis pigmentosa
- IRDs are currently the most diverse of the described hereditary conditions in humans.
- Leber congenital amaurosis (LCA) constitutes a group of early onset blinding diseases (in young children) with at least 25 causal genes that overlap with RP genes.
- IRDs are characterized by gradual loss of light sensing photoreceptor cells in the retina at the back of the eye leading to reduced light detection capacity and eventually blindness.
- the most common modes of inheritance are autosomal recessive, autosomal dominant and X-linked, but digenic and mitochondrial etiology have also been observed.
- patients with not only different mutations in the same gene but also with the exact same mutation demonstrate divergent clinical phenotypes, presenting a challenge to patient counseling and disease management.
- Many pathological mutations are found in genes that affect photoreceptor- specific functions within the retina (den Hollander et al., Prog Retin Eye Res, 27, 391-419; Wright et al.,
- Methods for treating a CRX autosomal dominant retinopathy in a subject. These methods include administering to the subject an effective amount of a nucleic acid molecule comprising a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein, thereby treating the CRX autosomal dominant retinopathy in the subject.
- compositions that include an effective amount of a nucleic acid molecule comprising a retinal specific promoter operably linked to a nucleic acid molecule encoding CRX protein, for use in treating a CRX autosomal dominant retinopathy in a subject.
- a promoter is disclosed that includes the nucleotide sequence of SEQ ID NO: 1. This promoter can be used in the disclosed methods.
- FIGs. 1A-1L Impaired photoreceptor maturation in CRX-LCA retinal organoids with c.413delT(p.I138fs48) mutation.
- A-B Schematic representations of CRX domain structure and the effect of pathological mutation (A) and the retinal organoid differentiation protocol (B).
- C Immunostaining for Recoverin, S Opsin and Rhodopsin at day 125. Scale bar 50 pm.
- D Quantification of the number of S Opsin+ cells per organoid area.
- E Quantification of average S Opsin fluorescence intensity in individual cells.
- F Histogram of maximal fluorescence intensity values for samples in (E).
- H Percentage of organoids showing discernible Rhodopsin immunostaining. Organoids in (D-H) all at day 125.
- II Wholemount immunostaining of Rhodopsin and L/M Opsin in control or CRX-I138fs patient organoids at day 230. Nuclei are counterstained with DAPI. Scale bar 200 pm.
- J Immunostaining for Peripherin2 and CTBP2 (Ribeye) at d200. Scale bar 20 pm.
- FIGs. 2A-2D Testing human CRX promoter elements for expression in human retinal organoid tissues.
- A-C AAV vectors encoding CMV promoter (A) or 631 bp human CRX promoter element (B, C) upstream of GFP reporter were used to transduce retinal organoids at day 120.
- Low 5xl0 10 viral genome/organoid (B) or high 10 11 vg/organoid (C) doses resulted in similar transduction of outer organoid layer where photoreceptor cells are present at day 220
- D Late stage organoid at day 220 showing widespread GFP reporter expression across the outer photoreceptor layer. Scale bar 100 pm.
- Figs. 3A-3H Rescue of Rhodopsin and M Opsin 4 weeks post treatment (first subject with CRX c.413delT(p.I138fs48 mutation).
- Retinal organoids from the frameshift CRX mutation patient c.413delT(p.I138fs48) were transduced with AAV-CRX vector at day 120 and analyzed 4 weeks later at day 150 by immunohistochemistry.
- Rhodopsin staining was present in control (A), but not CRX-I138fs patient samples (B).
- Treated organoids showed a fraction of cells with rescued expression (C).
- L/M Opsin was present in control (D), absent in patient (E) and partially restored following treatment (F). Quantification of the percentage of CRX-positive cells showing immunostaining for Rhodopsin (G) or L/M Opsin (H). 3 organoids per group, Student’s z-test, p values indicated.
- FIG. 4 AAV treatment rescues apical accumulation of Rhodopsin in c.413delT(p.I138fs48) patient retinal organoids.
- Rhodopsin accumulation in apical process is evident in cells with rescued expression of Rhodopsin.
- Figs. 5A-5D Significant restoration of Rhodopsin expression in c.413delT(p.I138fs48) CRX-LCA retinal organoids 8 weeks post AAV-CRX treatment.
- A Overview of treatment timeline.
- B-D Retinal organoids were cryosectioned and immunostained for Rhodopsin, nuclei were counterstained with DAPI.
- Untreated CRX-I138fs patient organoids (B) lack Rhodopsin immunostaining, whereas AAV-CRX treated organoids at low (lxlO 11 vg/organoid; C) and high dose (3xl0 n vg/organoid; D) show the restoration of Rhodopsin staining at dl80.
- FIGS. 6A-6C Quantification of Rhodopsin expression rescue following AAV-CRX treatment of c.413delT(p.I138fs48) patient retinal organoids.
- A Timeline of treatment.
- B Immunostaining of Rhodopsin in unaffected familial control as well as untreated and AAV-CRX treated patient organoids.
- C Quantification of Rhodopsin fluorescence intensity in relation to familial control sample. At least three organoids per group, Student’s t-test, p values indicated.
- Figs. 7A-7G Restoration of L/M Opsin expression following AAV-CRX treatment of c.413delT(p.I138fs48) patient retinal organoids.
- A Timeline of treatment.
- B-G Immunostaining for L/M Opsin in untreated (B,E), low AAV dose (lxlO 11 ; C,F) and high dose (3xl0 n ; D,G). Nuclei were visualized by counterstaining with DAPI.
- H Quantification of L/M Opsin fluorescence intensity in relation to familial control sample. At least three organoids per group, Student’s t-test, p values indicated.
- Fig. 8 Treatment of c.G264T(p.K88N) CRX-LCA patient (second subject) organoids.
- Organoids from the second CRX-LCA patient before and after AAV-CRX treatment were stained for a panel of markers including Rhodopsin (RHO), blue Opsin (OPN1S), red-green Opsin (OPN1ML) and rod arrestin (SAG), as in case of the first subject (shown in Figs. 4-8). Scale bar 20 pm. Nuclei were counterstained with DAPI.
- Figs. 9A-9I Altered gene expression patterns and AAV treatment effects in cone and rod photoreceptor subtypes of CRX-I138fs48 patient retinal organoids at d200.
- C Violin plot profiles of CRX expression levels in rods and cones. Note increased expression with AAV-CRX gene augmentation. Treatment effects in rod (D-F) and cone (G-I) photoreceptor subtypes.
- D,G UMAP plots showing the distribution of rod and cone cells by sample origin.
- F,I Opsin transcript reads in the different samples visualizing increased expression in patient-derived samples following treatment. Percentages of cells of each origin in which transcript reads were detected are indicated.
- Figs. 10A-10G Cell type diversity in CRX-LCA retinal organoids and gene augmentation effects revealed by single cell transcriptomics.
- A Number of single cell transcriptome profiles obtained from control (12496 cells), untreated (12126 cells) and AAV-treated CRX-I138fs (15550 cells) organoids at d200.
- B Cell type distributions across various conditions.
- C Heatmap of 3 top transcripts most significantly enriched in each assigned cell class in the combined data set. The molecular markers were used to define cell types across experimental conditions .
- A Representative karyograms of control and CRX-K88N iPSC lines.
- B Immunostaining using pluripotency and proliferation markers in control and CRX-K88N iPSC colonies.
- C Brightfield images of organoid retinal epithelia at d90. Scale bar, 200 pm.
- D Immunostaining for OTX2, CRX and Recoverin in control and CRX-K88N retinal organoids at d70 of differentiation. All three markers showed similar staining between the two genotypes.
- E Immunostaining for S Opsin and Calbindin in control and CRX-K88N retinal organoids. Note an increased Calbindin staining in patient organoids at d200. Scale bars in B,D,E, 100 pm.
- Figs. 12A-12G Disease phenotype and gene augmentation therapy of CRX-K88N patient retinal organoids.
- A Brightfield images of control and CRX-K88N patient organoids showing reduced outer segment (OS) apical ‘brush’ layer (arrowheads).
- C Immunostaining of organoids at d200 for CRX, Recoverin and Opsin proteins Rhodopsin and L/M Opsins. Note diminished Rhodopsin and L/M Opsin staining in patient-derived organoids.
- Figs. 13A-13B AAV treatment of CRX-K88N retinal organoids.
- A Immunoblot analysis of CRX protein in control, untreated and AAV-treated organoids at d200. a-tubulin was used as a loading control. Molecular mass of CRX is indicated on the left.
- nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
- sequence Listing is submitted as an ASCII text file [Sequence_Listing, January 15, 2021, 3.90 KB], which is incorporated by reference herein. In the accompanying sequence listing:
- SEQ ID NO: 1 is the nucleic acid sequence of a recombinant human CRX promoter.
- SEQ ID NO: 2 is an amino acid sequence of a human CRX protein.
- the CRX gene encodes a transcription regulatory protein that is essential for the development and function of retinal photoreceptors. Mutations in CRX cause dysfunction of photoreceptors resulting in distinct retinal disease phenotypes. Specific dominant mutations in CRX can lead to congenital blindness, whereas recessive mutations result in later onset photoreceptor dysfunction.
- a nucleic acid molecule including a recombinant CRX promoter operably linked to a nucleic acid sequence encoding a full-length human CRX protein was used to correct an autosomal dominant CRX retinopathy.
- the therapeutic potential of this construct was tested using human retinal organoid tissue differentiated from induced pluripotent stem cells derived from patients with two different dominant CRX mutations.
- the nucleic acid molecule was capable of transducing human stem cell-derived retinal tissues in vitro, and the administration restored patient photoreceptors including partial rescue of Rhodopsin and M/L Opsin expression, two proteins required for detection of light in human retina, in patients with autosomal dominant CRX retinopathy.
- iPSCs induced pluripotent stem cells
- Adeno-associated Virus AAV is a small vims that infects humans and some other primate species. AAV is not currently known to cause disease and consequently the virus causes a very mild immune response. AAV can infect both dividing and non-dividing cells and mainly exists as episomal forms in the host cell.
- the AAV genome is built of single-stranded deoxyribonucleic acid (ssDNA), either positive- or negative-sensed, which is about 4.7 kilobases (kb) long.
- the genome comprises inverted terminal repeats (ITRs) at both ends of the DNA strand, and two open reading frames (ORFs): rep and cap.
- Rep is composed of four overlapping genes encoding Rep proteins required for the AAV life cycle, and Cap contains overlapping nucleotide sequences of capsid proteins: VP1, VP2 and VP3, which interact together to form a capsid of an icosahedral symmetry.
- ITRs seem to be the only sequences required in cis next to the therapeutic gene: structural (cap) and packaging (rep) genes can be delivered in trans.
- Autosomal Dominant A pattern of inheritance in which an individual affected with a disease has one copy of a mutant gene and one normal gene on a pair of autosomal chromosomes.
- autosomal recessive diseases require that the individual have two copies of the mutant gene for the individual to be affected by the disease.
- a primary cell culture is a culture of cells, tissues or organs taken directly from an organism and before the first subculture. Cells are expanded in culture when they are placed in a growth medium under conditions that facilitate cell growth and/or division, resulting in a larger population of the cells.
- An “organoid” is an organ that is produced in vitro, such as from iPSCs.
- Cone-Rod Dystrophy The first signs and symptoms of cone-rod dystrophy, which often occur in childhood, are usually decreased sharpness of vision (visual acuity) and increased sensitivity to light (photophobia).
- cone dystrophy is characterized by progressive dysfunction of the photopic system, with preservation of scotopic function. Abnormal rod function may be part of the initial presentation, but rod involvement may be less severe, or occur later than the cone dysfunction.
- cone-rod dystrophy There are more than 30 types of cone-rod dystrophy, which are distinguished by their genetic cause and their pattern of inheritance: autosomal recessive, autosomal dominant, and X-linked. Mutations in more than 30 genes are known to cause cone-rod dystrophy. Approximately 20 of these genes are associated with the form of cone-rod dystrophy that is inherited in an autosomal recessive pattern. Mutations in the GUCY2D and CRX genes account for about half of the autosomal dominant form of this disease.
- Cone rod homeobox transcription factor (CRX) Retinopathy A retinopathy that results from a mutation in the CRX gene. These mutations have been identified in dystrophies ranging from severe early-onset Leber congenital amaurosis (LCA, LCA7, MIM #613829) through adult- onset cone-rod dystrophy (CORD2, MIM #120970), retinitis pigmentosa (RP, MIM #268000) to mild late-onset macular dystrophy. Approximately 50 likely pathological mutations that cause CRX retinopathy have been described, half of these co-segregate with the disease phenotype.
- CRX retinopathy can be autosomal dominant, autosomal recessive, or X-linked.
- Three main inherited retinal dystrophies associated with mutations in CRX are Leber congenital amaurosis (LCA), retinitis pigmentosa (RP) and cone-rod dystrophy (CORD).
- LCA Leber congenital amaurosis
- RP retinitis pigmentosa
- CORD cone-rod dystrophy
- a common feature in CRX retinopathies is macular atrophy.
- Dendrimer Synthetic three-dimensional macromolecules that are prepared in a step- wise fashion from simple branched monomer units, the nature and functionality of which can be easily controlled and varied. Dendrimers are synthesized from the repeated addition of building blocks to a multifunctional core (divergent approach to synthesis), or towards a multifunctional core (convergent approach to synthesis) and each addition of a three-dimensional shell of building blocks leads to the formation of a higher generation of the dendrimers. Dendrimers can be used for deliver of nucleic acid molecules.
- Downstream A relative position on a polynucleotide, wherein the “downstream” position is closer to the 3 ’ end of the polynucleotide than the reference point.
- orientation of 5’ and 3’ ends are based on the sense strand, as opposed to the antisense strand.
- Effective Amount A quantity of a specified pharmaceutical or therapeutic agent sufficient to achieve a desired effect in a subject, or in a cell, being treated with the agent.
- the effective amount of the agent such as a nucleic acid molecule, will be dependent on several factors, including, but not limited to the subject or cells being treated, and the manner of administration of the therapeutic composition.
- An effective amount can be the amount sufficient to treat a subject with a retinopathy.
- Expression Control Sequences Nucleic acid sequences that regulate the expression of a heterologous nucleic acid sequence to which it is operatively linked. Expression control sequences are operatively linked to a nucleic acid sequence when the expression control sequences control and regulate the transcription and, as appropriate, translation of the nucleic acid sequence.
- expression control sequences can include appropriate promoters, enhancers, transcription terminators, a start codon (i.e., ATG) in front of a protein-encoding gene, splicing signal for introns, maintenance of the correct reading frame of that gene to permit proper translation of mRNA, and stop codons.
- control sequences is intended to include, at a minimum, components whose presence can influence expression, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences. Expression control sequences can include a promoter.
- a heterologous sequence is a sequence that is not normally (in the wild- type sequence) found adjacent to a second sequence.
- the sequence is from a different genetic source, such as a virus or organism, than the second sequence.
- the heterologous sequence is a recombinant sequence that is not normally next to the wild-type sequence.
- Inhibiting or treating a disease Inhibiting the full development of a disease or condition, for example, in a subject who is at risk for a disease such as a autosomal dominant retinopathy, such as, but not limitmed to, an autosomal dominant CRX retinopathy, such as, but not limited to, LCA.
- Treatment refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop.
- the term “ameliorating,” with reference to a disease or pathological condition refers to any observable beneficial effect of the treatment.
- the beneficial effect can be evidenced, for example, by a delayed onset of clinical symptoms of the disease in a susceptible subject, a reduction in severity of some or all clinical symptoms of the disease, a slower progression of the disease, an improvement in the overall health or well-being of the subject, or by other parameters well known in the art that are specific to the particular disease, such as improved vision.
- Treatment may be assessed by objective or subjective parameters; including, but not limited to, the results of a physical examination, neurological examination, or vision test.
- a “prophylactic” treatment is a treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs for the purpose of decreasing the risk of developing pathology.
- Intraocular administration Administering agents locally, directly into the eye, for example by delivery into the vitreous or anterior chamber, or sub-retinally. Indirect intraocular delivery (for example by diffusion through the cornea) is not direct administration into the eye.
- Intravitreal administration Administering agents into the vitreous cavity.
- the vitreous cavity is the space that occupies most of the volume of the core of the eye with the lens and its suspension system (the zonules) as its anterior border and the retina and its coating as the peripheral border.
- Intravitreal administration can be accomplished by injection, pumping, or by implants.
- Isolated An “isolated” biological component has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, such as, other chromosomal and extrachromosomal DNA and RNA, and proteins.
- Nucleic acids, peptides and proteins that have been “isolated” thus include nucleic acids and proteins purified by standard purification methods.
- the term also embraces nucleic acids, peptides, and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.
- Leber congenital amaurosis A rare inherited eye disease that appears at birth or in the early stages of of life (infancy or early childhood) and primarily affects the retina. The presentation can vary because is it associated with multiple genes. However, it is characterized by characterized by nystagmus, photophobia, sluggish or absent pupillary response, and severe vision loss or blindness. The common modes of inheritance are autosomal recessive and autosomal dominant.
- the pupils which usually expand and contract in response to the amount of light entering the eye, do not react normally to light. Instead, they expand and contract more slowly than normal, or they may not respond to light at all. Additionally, the clear front covering of the eye (the cornea) may be cone-shaped and abnormally thin, a condition known as keratoconus.
- Franceschetti's oculo-digital sign is characteristic of Leber congenital amaurosis. This sign consists of poking, pressing, and rubbing the eyes with a knuckle or finger.
- Nanoparticle A particle between 1 and 100 nanometers (nm) in size with a surrounding interfacial layer.
- the interfacial layer is an integral part of nanoscale matter, fundamentally affecting all of its properties.
- the interfacial layer typically consists of ions, inorganic and/or organic molecules.
- Nucleic acid A polymer composed of nucleotide units (ribonucleotides, deoxyribonucleotides, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof) linked via phosphodiester bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof.
- nucleotide polymers in which the nucleotides and the linkages between them include non-naturally occurring synthetic analogs, such as, for example and without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs), and the like.
- oligonucleotide typically refers to short polynucleotides, generally no greater than about 50 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which “U” replaces “T.”
- nucleotide sequences the left-hand end of a single- stranded nucleotide sequence is the 5'-end; the left-hand direction of a double- stranded nucleotide sequence is referred to as the 5'-direction.
- the direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction.
- the DNA strand having the same sequence as an mRNA is referred to as the “coding strand;” sequences on the DNA strand having the same sequence as an mRNA transcribed from that DNA and which are located 5' to the 5'-end of the RNA transcript are referred to as “upstream sequences;” sequences on the DNA strand having the same sequence as the RNA and which are 3' to the 3' end of the coding RNA transcript are referred to as “downstream sequences.”
- cDNA refers to a DNA that is complementary or identical to an mRNA, in either single stranded or double stranded form.
- Encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom.
- a gene encodes a protein if transcription and translation of mRNA produced by that gene produces the protein in a cell or other biological system.
- coding strand the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings
- non-coding strand used as the template for transcription
- a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
- Recombinant nucleic acid refers to a nucleic acid having nucleotide sequences that are not naturally joined together. This includes nucleic acid vectors comprising an amplified or assembled nucleic acid which can be used to transform a suitable host cell. A host cell that comprises the recombinant nucleic acid is referred to as a “recombinant host cell.” The gene is then expressed in the recombinant host cell to produce, such as a “recombinant polypeptide.” A recombinant nucleic acid may serve a non-coding function (such as a promoter, origin of replication, ribosome-binding site, etc.) as well.
- a non-coding function such as a promoter, origin of replication, ribosome-binding site, etc.
- a first sequence is an “antisense” with respect to a second sequence if a polynucleotide whose sequence is the first sequence specifically hybridizes with a polynucleotide whose sequence is the second sequence.
- sequence relationships between two or more nucleotide sequences or amino acid sequences include “reference sequence,” “selected from,” “comparison window,” “identical,” “percentage of sequence identity,” “substantially identical,” “complementary,” and “substantially complementary.”
- sequence comparison For sequence comparison of nucleic acid sequences, typically one sequence acts as a reference sequence, to which test sequences are compared.
- test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters are used.
- Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482, 1981, by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443, 1970, by the search for similarity method of Pearson & Lipman, Proc. Nat’l. Acad. Sci.
- PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Evol. 35:351-360, 1987. The method used is similar to the method described by Higgins & Sharp, CABIOS 5:151-153, 1989.
- a reference sequence is compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted end gaps.
- PILEUP can be obtained from the GCG sequence analysis software package, such as version 7.0 (Devereaux et al., Nuc. Acids Res. 12:387- 395, 1984.
- BLAST Altschul et al., J. Mol. Biol. 215:403-410, 1990 and Altschul et al., Nucleic Acids Res. 25:3389- 3402, 1977.
- Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/).
- the BLASTP program (for amino acid sequences) uses as defaults a word length (W) of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915, 1989).
- a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
- a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
- operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.
- compositions and formulations suitable for pharmaceutical delivery of the fusion proteins herein disclosed are conventional. Remington’s Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the fusion proteins herein disclosed.
- parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like
- solid compositions e.g., powder, pill, tablet, or capsule forms
- conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch or magnesium stearate.
- compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- composition such as including a nucleic acid molecule, capable of inducing a desired therapeutic or prophylactic effect when properly administered to a subject or a cell.
- “Incubating” includes a sufficient amount of time for a drug to interact with a cell.
- “Contacting” includes incubating a drug in solid or in liquid form with a cell.
- Protein Three or more covalently attached amino acids. The term encompasses polypeptides, protein fragments, and protein domains.
- a “DNA-binding” polypeptide is a polypeptide with the ability to specifically bind DNA.
- protein and polypeptide are specifically intended to cover naturally occurring proteins, as well as those which are recombinantly or synthetically produced.
- functional fragments of a protein and “functional fragments of a polypeptide” refers to all fragments of a polypeptide that retain an activity of the polypeptide.
- Biologically functional fragments for example, can vary in size from a polypeptide fragment as small as an epitope capable of binding an antibody molecule to a large polypeptide capable of participating in the characteristic induction or programming of phenotypic changes within a cell.
- An “epitope” is a region of a polypeptide capable of binding an immunoglobulin generated in response to contact with an antigen. Thus, smaller peptides containing the biological activity of insulin, or conservative variants of the insulin, are thus included as being of use.
- the immunologic identity of the protein may be assessed by determining whether it is recognized by an antibody; a variant that is recognized by such an antibody is immunologically conserved.
- Any cDNA sequence variant will preferably introduce no more than twenty, and preferably fewer than ten amino acid substitutions into the encoded polypeptide.
- Variant amino acid sequences may, for example, be 80%, 90% or even 95% or 98% identical to the native amino acid sequence.
- a promoter is an array of nucleic acid control sequences which direct transcription of a nucleic acid.
- a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element.
- a promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription.
- a promoter can be a constitutively active promoter (i.e., a promoter that is constitutively in an active/"ON” state), an inducible promoter (i.e., a promoter whose state, active/"ON” or inactive/" OFF", is controlled by an external stimulus, e.g., the presence of a particular temperature, compound, or protein.), a spatially restricted promoter (e.g., tissue specific promoter, cell type specific promoter, etc.), or it may be a temporally restricted promoter (i.e., the promoter is in the "ON" state or "OFF” state during specific stages of embryonic development or during specific stages of a biological process).
- a constitutively active promoter i.e., a promoter that is constitutively in an active/"ON” state
- an inducible promoter i.e., a promoter whose state, active/"ON” or inactive/” OFF" is controlled by an external stimulus, e.g.
- a “retinal specific” promoter directs transcription of an operably linked nucleic acid in cells the retina, as compared to cells in different tissues.
- Inducible promoters can be regulated by molecules including, but not limited to, doxycycline; RNA polymerase, e.g., T7 RNA polymerase; an estrogen receptor; an estrogen receptor fusion; etc.
- purified does not require absolute purity; rather, it is intended as a relative term.
- a purified protein preparation is one in which the protein referred to is purer than the protein in its natural environment within a cell.
- a preparation of a protein is purified such that the protein represents at least 50% of the total protein content of the preparation.
- a purified nucleic acid molecule preparation is one in which the nucleic acid molecule is purer than in an environment including a complex mixture.
- a purified population of nucleic acids or proteins is greater than about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% pure, or free other nucleic acids or proteins, respectively.
- a recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.
- a recombinant protein is one coded for by a recombinant nucleic acid molecule.
- Retina The light (photon) sensitive portion of the eye, that contains the photoreceptors (cones and rods) for light. Rods and cones perform light perception through the use of light sensitive pigments.
- the light sensitive pigments are made of protein called Opsin and a chromophore called retinene, which the variant is of vitamin A.
- the rods contain Rhodopsin while the cones contain iodopsin.
- Rods and cones transmit signals through successive neurons that trigger a neural discharge in the output cells of the retina and the ganglion cells.
- the visual signals are conveyed by the optic nerve to the lateral geniculate bodies from where the visual signal is passed to the visual cortex (occipital lobe) and registered as a visual stimulus.
- Rods are photoreceptor cells in the retina of the eye that can function in less intense light than the other type of visual photoreceptor, cone cells. Rods are concentrated at the outer edges of the retina and are used in peripheral vision. Rods are a little longer and leaner than cones but have the same structural basis.
- the Opsin or pigment is on the outer side, lying on the retinal pigment epithelium, completing the cell's homeostasis. This epithelium end contains many stacked disks. Rods have a high area for visual pigment and thus substantial efficiency of light absorption.
- rod cells have a synaptic terminal, an inner segment, and an outer segment.
- the synaptic terminal forms a synapse with another neuron, for example a bipolar cell.
- the inner and outer segments are connected by a cilium, which lines the distal segment.
- the inner segment contains organelles and the cell's nucleus, while the rod outer segment, which is pointed toward the back of the eye, contains the light-absorbing materials.
- Activation of photopigments by light sends a signal by hyperpolarizing the rod cell, leading to the rod cell not sending its neurotransmitter, which leads to the bipolar cell then releasing its transmitter at the bipolar-ganglion synapse and exciting the synapse.
- Cone cells or “cones,” are responsible for color vision and function best in relatively bright light.
- Cone cells are densely packed in the fovea centralis, a 0.3 mm diameter rod-free area with very thin, densely packed cones which quickly reduce in number towards the periphery of the retina.
- Cones are less sensitive to light than the rod cells in the retina (which support vision at low light levels) but allow the perception of color. They are also able to perceive finer detail and more rapid changes in images, because their response times to stimuli are faster than those of rods.
- cones are normally one of the three types, each with different pigment, namely: S-cones, M-cones and L-cones.
- Each cone is therefore sensitive to visible wavelengths of light that correspond to short-wavelength, medium-wavelength and long-wavelength light.
- the three types have peak wavelengths near 420-440 nm, 534-545 nm and 564-580 nm, respectively, depending on the individual.
- Retinal Pigment Epithelium The pigmented layer of hexagonal cells, present in vivo in mammals, just outside of the neurosensory retinal that is attached to the underlying choroid. These cells are densely packed with pigment granules, and shield the retinal from incoming light.
- the retinal pigment epithelium also serves as the limiting transport factor that maintains the retinal environment by supplying small molecules such as amino acid, ascorbic acid and D-glucose while remaining a tight barrier to choroidal blood borne substances.
- Retinitis pigmentosa An inherited, degenerative eye disease that causes severe vision impairment due to the progressive degeneration of the rod photoreceptor cells in the retina. This form of retinal dystrophy manifests initial symptoms independent of age.
- the initial retinal degenerative symptoms of Retinitis pigmentosa are characterized by decreased night vision (nyctalopia) and the loss of the mid-peripheral visual field.
- the rod photoreceptor cells which are responsible for low-light vision and are orientated in the retinal periphery, are the retinal processes affected first during non-syndromic forms of this disease. Visual decline progresses relatively quickly to the far peripheral field, eventually extending into the central visual field as tunnel vision increases.
- Sequence identity The similarity between amino acid sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are. Homologs or variants of a FGF polypeptide will possess a relatively high degree of sequence identity when aligned using standard methods. Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in Smith and Waterman, Adv. Appl. Math. 2:482, 1981; Needleman and Wunsch, J. Mol. Biol. 48:443, 1970; Pearson and Lipman, Proc. Natl. Acad.
- NCBI Basic Local Alignment Search Tool (BLAST) (Altschul, et al., J. Mol. Biol. 215:403, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. A description of how to determine sequence identity using this program is available on the NCBI website on the internet.
- Homologs and variants of a polypeptide are typically characterized by possession of at least about 75%, for example at least about 80%, sequence identity counted over the full-length alignment with the amino acid sequence of the factor using the NCBI Blast 2.0, gapped blastp set to default parameters.
- the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters,
- Transactivator A factor that acts to increase gene expression from a promoter.
- a transactivator gene expresses a transcription regulatory protein (generally a transcription factor) that binds directly or through interaction with another protein to one or more specific promoter regions. By binding to the promoter region, the transcription regulatory factor enhances the expression of a sequence operably linked to the promoter. The expression of one transactivator can activate the expression of several proteins, as long as all are operably linked to the specific promoter region.
- Transgene An exogenous gene.
- Upstream A relative position on a polynucleotide, wherein the “upstream” position is closer to the 5’ end of the polynucleotide than the reference point.
- orientation of 5’ and 3’ ends are based on the sense strand, as opposed to the antisense strand.
- a vector may include nucleic acid sequences that permit it to replicate in the host cell, such as an origin of replication.
- a vector may also include one or more therapeutic genes and/or selectable marker genes and other genetic elements known in the art.
- a vector can transduce, transform or infect a cell, thereby causing the cell to express nucleic acids and/or proteins other than those native to the cell.
- a vector optionally includes materials to aid in achieving entry of the nucleic acid into the cell, such as a viral particle, liposome, protein coating or the like.
- Virus Microscopic infectious organism that reproduces inside living cells.
- a virus consists essentially of a core of a single nucleic acid surrounded by a protein coat and has the ability to replicate only inside a living cell. “Viral replication” is the production of additional virus by the occurrence of at least one viral life cycle.
- Viral vectors are known in the art, and include, for example, adenovirus, AAV, lentivirus and herpes vims.
- the delivery of a gene encoding a CRX protein to retinal cells can be used to treat CRX autosomal dominant retinopathies.
- the method disclosed herein include administering to a subject an effective amount of a nucleic acid molecule comprising a retinal specific promoter operably linked to a nucleic acid molecule encoding the CRX protein, thereby treating the CRX autosomal dominant retinopathy.
- the subject can be a human.
- the CRX autosomal dominant retinopathy is Leber congenital amaurosis (LCA), retinitis pigmentosa, or cone rod dystrophy.
- LCA Leber congenital amaurosis
- retinitis pigmentosa retinitis pigmentosa
- cone rod dystrophy retinitis pigmentosa
- the CRX autosomal dominant retinopathy is the LCA.
- the methods can include administering to the subject a viral vector comprising the retinal specific promoter operably linked to the nucleic acid molecule encoding a CRX protein.
- the vector can be a lentiviral vector or an adeno-associated vims (AAV) vector, such as an AAV2, AAV5, or AAV8 virus vector.
- the methods include administering to the subject a nanoparticle or a dendrimer comprising the nucleic acid molecule.
- the promoter is a human CRX promoter.
- the human CRX promoter comprises SEQ ID NO: 1.
- the CRX protein includes an amino acid sequence at least 95% identical to SEQ ID NO: 2. In a specific non-limiting example, the CRX protein includes the amino acid sequence of SEQ ID NO: 2.
- the nucleic acid molecule is administered sub-retinally or to the retina of the subject.
- the method increases Rhodopsin expression in the retina of the subject.
- the disclosed methods can include selecting the subject of interest, such as a subject with a CRX autosomal dominant retinopathy.
- compositions for use in the disclosed methods are provided.
- a promoter comprising, or consisting of, the nucleotide sequence of SEQ ID NO: 1.
- the promoter can be operably linked to a heterologous nucleic acid encoding a polypeptide.
- Vectors are also disclosed that include the promoter, such as, but not limited to, viral vectors.
- the viral vector is an AAV vector.
- CRX is an OTX-family homeodomain transcription factor required for appropriate development of retinal photoreceptor cells (Chen et ah, Neuron, 19, 1017-1030 Furakawa et ah, Cell, 91, 531-541). In vivo, CRX is specifically expressed in the retina and the pineal gland. Its function is primarily related to regulating gene expression in retinal photoreceptor cells necessary for proper vision and pinealocytes involved in circadian rhythms.
- Loss of CRX in mice results in loss of visual function (Furakawa et al., Nature genetics, 23, 466-470.) as the photoreceptors don’t express necessary phototransduction genes and do not elaborate outer segments, specialized organelles containing visual pigments Opsins and phototransduction-related proteins.
- CRX gene (Gene ID: 1406; Ensembl:ENSG00000105392; MIM #602225, December 31, 2019, incorporated herein by reference) is located on chromosome 19ql3.33 and encodes a 299 amino-acid DNA binding protein.
- An exemplary amino acid sequence of human CRX is provided below, see UniProtKB No. 043186, as available on December 31,
- the CRX protein comprises the amino acid sequence set forth as SEQ ID NO: 2. In other embodiments, the CRX protein comprises an amino acid sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ I DNO: 2. In some non-limiting examples, the CRX protein is at least 95% identical to SEQ ID NO: 2. The CRX protein can function as a transactivator.
- CRX is a transcription factor that regulates the expression of a large number of rod and cone photoreceptor genes. Transactivation by CRX can be tested in vitro (using promoters that are CRX regulated to drive the expression of GFP or other reporter genes) or in vivo using models (including Crx-ko mice). This transcriptional activation function is needed for photoreceptor development and function.
- SEQ ID NO: 2 is 299 amino acids in length.
- the DNA binding domain is at the N terminus and comprises residues 39 to 108, whereas transcriptional activation domain of the protein is located towards the C terminus (from residues 113 to 284).
- a CRX protein of use is at least about 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2, and includes residues 39 to 108 of SEQ ID NO: 2.
- a CRX protein of use is at least about 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2, and includes amino acids, and includes residues 113 to 284 of SEQ ID NO: 2.
- a CRX protein of use is at least about 95% identical to SEQ ID NO: 2, and includes residues 39 to 108 and residues 113 to 284 of SEQ ID NO: 2. In more embodiments, a CRX protein of use is at least about 96%, 97%, 98% or 99% identical to SEQ ID NO: 2, and includes residues 39 to 108 and residues 113 to 284 of SEQ ID NO: 2. This CRX protein can funcation as a transactivator.
- the CRX protein includes the OTX tail, residues 284 to 299 of SEQ ID NO: 2.
- a CRX protein of use is at least about 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2, and and includes residues 284 to 299 of SEQ ID NO: 2.
- a CRX protein of use is at least about 95% identical to SEQ ID NO: 2, and includes residues 39 to 108, residues 113 to 284 of SEQ ID NO: 2 and residues 284 to 299 of SEQ ID NO:
- a CRX protein of use is at least about 96%, 97%, 98% or 99% identical to SEQ ID NO: 2, and includes residues 39 to 108 , residues 113 to 284, and residues 284 to 299 of SEQ ID NO: 2.
- This CRX protein can funcation as a trans activator.
- the CRX protein exhibits high sequence homology in primates (chimpanzee 99%, crab-eating macaque 100%, gorilla 100%, marmoset 98%) and in model organisms (cat 93%, chicken 57%, dog 97%, mouse 89%, rat 97%, zebrafish 57%).
- the CRX protein can include the corresponding amino acid from the CRX protein of another species. This CRX protein can funcation as a transactivator.
- Polynucleotides encoding a CRX protein are of use in the disclosed methods. These polynucleotides include DNA, cDNA, and RNA sequences that encode the CRX protein. Silent mutations in the coding sequence result from the degeneracy (/. ⁇ ? ., redundancy) of the genetic code, whereby more than one codon can encode the same amino acid residue.
- leucine can be encoded by CTT, CTC, CTA, CTG, TTA, or TTG; serine can be encoded by TCT, TCC, TCA, TCG, AGT, or AGC; asparagine can be encoded by AAT or AAC; aspartic acid can be encoded by GAT or GAC; cysteine can be encoded by TGT or TGC; alanine can be encoded by GCT, GCC, GCA, or GCG; glutamine can be encoded by CAA or CAG; tyrosine can be encoded by TAT or TAC; and isoleucine can be encoded by ATT, ATC, or ATA.
- Nucleic acid molecules encoding a CRX protein can readily be produced by one of skill in the art using the amino acid sequences provided herein and the genetic code.
- Nucleic acid sequences encoding the CRX protein can be prepared by any suitable method including, for example, cloning of appropriate sequences or by direct chemical synthesis by methods such as the phosphotriester method of Narang et al., Meth. Enzymol. 68:90-99, 1979; the phosphodiester method of Brown et al., Meth. Enzymol. 68:109-151, 1979; the diethylphosphoramidite method of Beaucage et al., Tetra. Lett.
- a nucleic acid molecule encoding a CRX protein can be cloned or amplified by in vitro methods, such as the polymerase chain reaction (PCR), the ligase chain reaction (LCR), the transcription-based amplification system (TAS), the self-sustained sequence replication system (3SR), and the z)b replicase amplification system (QB).
- PCR polymerase chain reaction
- LCR ligase chain reaction
- TAS transcription-based amplification system
- 3SR self-sustained sequence replication system
- QB z)b replicase amplification system
- a polynucleotide encoding the protein can be isolated by a polymerase chain reaction of cDNA using primers based on the DNA sequence of the molecule.
- a wide variety of cloning and in vitro amplification methodologies are well-known to persons skilled in the art. PCR methods are described in, for example, U.S. Patent No.
- Polynucleotides also can be isolated by screening genomic or cDNA libraries with probes selected from the sequences of the desired polynucleotide under stringent hybridization conditions.
- a polynucleotide sequence encoding a CRX protein is operably linked to transcriptional control sequences including, for example a promoter and a polyadenylation signal.
- Any promoter can be used that is a polynucleotide sequence recognized by the transcriptional machinery of the host cell (or introduced synthetic machinery) that is involved in the initiation of transcription.
- a polyadenylation signal is a polynucleotide sequence that directs the addition of a series of nucleotides on the end of the mRNA transcript for proper processing and trafficking of the transcript out of the nucleus into the cytoplasm for translation.
- promoters include viral promoters, such as cytomegalovirus immediate early gene promoter (“CMV”), herpes simplex virus thymidine kinase (“tk”), SV40 early transcription unit, polyoma, retroviruses, papilloma vims, hepatitis B vims, and human and simian immunodeficiency viruses.
- CMV cytomegalovirus immediate early gene promoter
- tk herpes simplex virus thymidine kinase
- SV40 early transcription unit polyoma
- retroviruses papilloma vims
- hepatitis B vims hepatitis B vims
- human and simian immunodeficiency viruses include cytomegalovirus immediate early gene promoter (“CMV”), herpes simplex virus thymidine kinase (“tk”), SV40 early transcription unit, polyoma, retroviruses, papill
- promoters include promoters isolated from mammalian genes, such as the immunoglobulin heavy chain, immunoglobulin light chain, T cell receptor, HLA DQ a and DQ b, b-interferon, interleukin-2, interleukin-2 receptor, MHC class II, HLA-DRa, b-actin, muscle creatine kinase, prealbumin (transthyretin), elastase I, metallothionein, collagenase, albumin, fetoprotein, b-globin, c-fos, c-HA-ras, neural cell adhesion molecule (NCAM), al- antitrypsin, H2B (TH2B) histone, type I collagen, glucose-regulated proteins (GRP94 and GRP78), rat growth hormone, human semm amyloid A (SAA), troponin I (TNI), platelet-derived growth factor, and dystrophin, as well as promoters specific for retinal cells.
- the promoter can be either inducible or constitutive.
- An inducible promoter is a promoter that is inactive or exhibits low activity except in the presence of an inducer substance. Additional examples of promoters include, but are not limited to, MT II, MMTV, collagenase, stromelysin, SV40, murine MX gene, a-2-macroglobulin, MHC class I gene h-2kb, HSP70, proliferin, tetracycline inducible, tumor necrosis factor, or thyroid stimulating hormone gene promoter.
- an inducible promoter is the interferon inducible ISG54 promoter (see Bluyssen et al., Proc. Natl Acad. Sci. 92: 5645-5649, 1995, herein incorporated by reference).
- the promoter is a constitutive promoter that results in high levels of transcription upon introduction into a host cell in the absence of additional factors.
- the promoter is a retinal specific promoter.
- exemplary retinal photoreceptor specific promoters are: Rhodopsin kinase, NRL, IRBP, cone Opsin or Rhodopsin promoters, and the CRX promoter.
- the promoter is a CRX promoter.
- the CRX promoters disclosed herein can be operably linked to a nucleotide molecule encoding any protein, to obtain expression of the protein in the retina.
- the CRX promoter is operably linked to a nucleic acid molecule encoding the CRX protein.
- the CRX 5 ’ untranslated region of human CRX is provided in NCBI Reference sequence NG_008605.1, as available on December 31, 2019, incorporated herein by reference.
- a CRX promoter includes, or consists of: CGTCGACGGGTCAGACGGCCCCTCCCTCTCTTGCTGTCATCCCTGGCTCTTCAAGCTAA TGAGACCTGTCCTGATTCCTCAGCCAGGCCTGTAGCCTTAATCTCCTAGCAGGGGGT TTGGGGGAGGAGGAGAAAGAAAGGGCCCCTTATGGCTGAGACACAATGACCCA GCCACAAGGAGGGATTACCGGGGAAGTGAAACAGACCCGTGTGGGACCCAGGAGCTC AGGGACATATTAATATCTAGAGAGACAGACGGTCGACAGACACCAGTTAGACCTAAG GAAGGACTTCCCTGAGGAGTAGGGGCTTATGGTCACCGGCAGGAGCTGGGGCCTCCCT TCCCCATCAGCCCTAATTGCCAAGATGTCATGGGGGGAAGAGGAGGATTAAGCAG ACGGGTGCCCCTCCCTCCCAGCCAATGTCACCTCCTGGTGCCCAGTCGAGTCCCA C
- NCBI Three fragments from the human CRX 5’ untranslated region (NCBI: NG_008605.1) were amplified from human genomic DNA and combined to produce 631 base pair length promoter element that specifically expresses the reporter gene in rod and cone photoreceptors.
- SEQ ID NO: 1 189 nucleotides correspond to positions 3085-3274 of NCBI Reference sequence NG_008605.1; 69 correspond to 3323-3392 of NCBI Reference sequence NG_008605.1, and 361 correspond to 4808-5169 of NCBI Reference sequence NG_008605.1.
- the NCBI Refemece Sequences are incorporated herein by reference as available on January 27, 2020. Note that 4999- 5169 is exon 1; therefore, this human CRX promoter element contains 1st exon of the human CRX gene.
- the promoter can be at least about 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1, wherein the promoter provides expression in cells of the retina.
- SEQ ID NO: 1 includes five CRX binding sites, which bind CRX, as follows:
- the CRX promoter is at least about 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 1, and includes at least 1, 2, 3, 4 or all 5 CRX binding sites. In more embodiments, the CRX promoter is at least about 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 1, and includes all 5 CRX binding sites. In some specific non- limiting examples, the CRX promoter is at least about 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 1 and includes nucleotides 96-104, 388-403 and 467-482 of SEQ ID NO: 1.
- the disclosed promoters include AP-2Beta, FOXOl, NRF2, PBX3, and ZIC1 binding sites.
- the promoter is at least about 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 1, and retains the AP-2Beta, FOXOl, NRF2, PBX3, and/or ZIC1 binding sites. In some embodiments, the promoter retains all of these binding sites.
- transcription control sequences include one or more enhancer elements, which are binding recognition sites for one or more transcription factors that increase transcription above that observed for the minimal promoter alone, and also be operably linked to the polynucleotide encoding the CRX promoter and/or the nucleic acid molecule encoding the CRX protein.
- enhancer elements are binding recognition sites for one or more transcription factors that increase transcription above that observed for the minimal promoter alone
- introns can also be included that help stabilize mRNA and increase expression.
- a nucleic acid sequence that encodes a CRX protein is incorporated into a vector capable of expression in a host cell, using established molecular biology procedures.
- nucleic acids, such as cDNAs that encode a CRX protein can be manipulated with standard procedures, such as restriction enzyme digestion, fill-in with DNA polymerase, deletion by exonuclease, extension by terminal deoxynucleotide transferase, ligation of synthetic or cloned DNA sequences, site-directed sequence-alteration via single-stranded bacteriophage intermediate, or use of specific oligonucleotides in combination with PCR or other in vitro amplification.
- These vectors can include a CRX promoter operably linked to a nucleic acid molecule encoding a CRX protein.
- Exemplary procedures sufficient to guide one of ordinary skill in the art through the production of a vector capable of expression in a host cell that includes a CRX promoter, and/or a polynucleotide sequence encoding a CRX protein can be found, for example, in Sambrook et al, Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, 1989; Sambrook et al, Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Press, 2001; Ausubel et al, Current Protocols in Molecular Biology, Greene Publishing Associates, 1992 (and Supplements to 2003); and Ausubel et al, Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 4th ed., Wiley & Sons, 1999.
- polyadenylation signal may be desirable to include a polyadenylation signal to effect proper termination and polyadenylation of the gene transcript.
- exemplary polyadenylation signals have been isolated from beta globin, bovine growth hormone, SV40, and the herpes simplex vims thymidine kinase genes.
- a nanodispersion system includes a biologically active agent and a dispersing agent (such as a polymer, copolymer, or low molecular weight surfactant).
- a dispersing agent such as a polymer, copolymer, or low molecular weight surfactant.
- Exemplary polymers or copolymers include polyvinylpyrrolidone (PVP), poly(D,L-lactic acid) (PLA), poly(D,L-lactic-co-glycolic acid (PLGA), poly(ethylene glycol).
- Exemplary low molecular weight surfactants include sodium dodecyl sulfate, hexadecyl pyridinium chloride, polysorbates, sorbitans, poly(oxyethylene) alkyl ethers, poly(oxyethylene) alkyl esters, and combinations thereof.
- the nanodispersion system includes PVP and ODP or a variant thereof (such as 80/20 w/w).
- the nanodispersion is prepared using the solvent evaporation method, see for example, Kanaze et al, Drug Dev. Indus. Pharm. 36:292-301, 2010; Kanaze et al., J. Appl. Polymer Sci. 102:460-471, 2006.
- Dendrimers are synthetic three-dimensional macromolecules that are prepared in a step wise fashion from simple branched monomer units, the nature and functionality of which can be easily controlled and varied. Dendrimers consist of an initiator core, surrounded by a layer of a selected polymer that is grafted to the core, forming a branched macromolecular complex. Dendrimers are typically produced using polymers such as poly(amidoamine) or poly(L-lysine).
- a dendrimer can be synthesized from the repeated addition of building blocks to a multifunctional core (divergent approach to synthesis), or towards a multifunctional core (convergent approach to synthesis) and each addition of a three-dimensional shell of building blocks leads to the formation of a higher generation of the dendrimers.
- Polypropylenimine dendrimers contain 100% protonable nitrogens and up to 64 terminal amino groups. Protonable groups are usually amine groups which are able to accept protons at neutral pH.
- dendrimers can be formed from polyamidoamine and phosphorous containing compounds with a mixture of amine/ amide or N-P(C>2)S as the conjugating units. Dendrimers of use for delivery of nucleic acid molecules is disclosed, for example, in PCT Publication No. 2003/033027, imported herein by reference.
- the CRX promoter, and/or the polynucleotides encoding the CRX protein include a recombinant DNA which is incorporated into a vector in an autonomously replicating plasmid or virus or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (such as a cDNA) independent of other sequences.
- Viral vectors that include the CRX promoter, and/or the CRX protein can also be prepared. Numerous viral vectors are known in the art, including polyoma; SV40 (Madzak et ak, 1992, J. Gen.
- Baculovirus Autographa califomica multinuclear polyhedrosis virus; AcMNPV vectors are also known in the art and may be obtained from commercial sources (such as PharMingen, San Diego, Calif.; Protein Sciences Corp.,
- the CRX promoter, and/or the nucleic acid molecule encoding the CRX protein is included in a viral vector.
- Suitable vectors include retrovirus vectors, orthopox vectors, avipox vectors, fowlpox vectors, capripox vectors, suipox vectors, adenoviral vectors, herpes virus vectors, alpha vims vectors, baculovirus vectors, Sindbis vims vectors, vaccinia virus vectors, lentivims vectors and poliovirus vectors.
- poxvirus vectors such as vaccinia virus, fowlpox virus and a highly attenuated vaccinia vims (MV A), adenovirus, baculovirus, yeast, and the like.
- MV A highly attenuated vaccinia vims
- AAV Adeno-associated vims vectors
- compositions that include utilize one or more vectors, such as a viral vector, such as a retroviral vector or an adenoviral vector, or an AAV vector that includes a CRX promoter, optionally operably linked to a nucleic acid molecule including a CRX protein.
- a viral vector such as a retroviral vector or an adenoviral vector
- an AAV vector that includes a CRX promoter, optionally operably linked to a nucleic acid molecule including a CRX protein.
- Defective viruses that entirely or almost entirely lack viral genes, can be used. Use of defective viral vectors allows for administration to specific cells without concern that the vector can infect other cells.
- the adenovirus vectors of use include replication competent, replication deficient, gutless forms thereof.
- the AAV vectors of use are replication deficient.
- adenovirus vectors are known to exhibit strong expression in vitro, excellent titer, and the ability to transduce dividing and non-dividing cells in vivo (Hitt et ah, Adv in Vims Res 55:479-505, 2000). When used in vivo these vectors lead to strong but transient gene expression due to immune responses elicited to the vector backbone.
- a vector of use is an attenuated adenovirus vector, such as the vector described by Stratford-Perricaudet et al. ( J . Clin.
- Recombinant AAV vectors are characterized in that they are capable of directing the expression and the production of the selected transgenic products in targeted cells.
- the recombinant vectors comprise at least all of the sequences of AAV essential for encapsidation and the physical stmctures for infection of target cells.
- AAV belongs to the family Parvoviridae and the genus Dependovirus .
- AAV is a small, non-enveloped vims that packages a linear, single- stranded DNA genome. Both sense and antisense strands of AAV DNA are packaged into AAV capsids with equal frequency.
- the AAV DNA includes a nucleic acid including a recombinant CRX promoter, as disclosed herein, operably linked to a nucleic acid molecule encoding a CRX protein, such as a human CRX protein.
- recombinant vectors such as recombinant adenovirus vectors and recombinant adeno-associated virus (rAAV) vectors comprising a nucleic acid molecule(s) disclosed herein.
- the AAV is rAAV8, and/or AAV2.
- the AAV serotype can be any other suitable AAV serotype, such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV9, AAV10, AAV11 or AAV12, or a hybrid of two or more AAV serotypes.
- the AAV genome is characterized by two inverted terminal repeats (ITRs) that flank two open reading frames (ORFs).
- ITRs inverted terminal repeats
- ORFs open reading frames
- the first 125 nucleotides of the ITR are a palindrome, which folds upon itself to maximize base pairing and forms a T-shaped hairpin structure.
- the other 20 bases of the ITR called the D sequence, remain unpaired.
- the ITRs are cA-acting sequences important for AAV DNA replication; the ITR is the origin of replication and serves as a primer for second-strand synthesis by DNA polymerase.
- the double- stranded DNA formed during this synthesis which is called replicating-form monomer, is used for a second round of self-priming replication and forms a replicating-form dimer.
- These double- stranded intermediates are processed via a strand displacement mechanism, resulting in single- stranded DNA used for packaging and double-stranded DNA used for transcription.
- Located within the ITR are the Rep binding elements and a terminal resolution site (TRS). These features are used by the viral regulatory protein Rep during AAV replication to process the double- stranded intermediates.
- the ITR is also essential for AAV genome packaging, transcription, negative regulation under non-permissive conditions, and site- specific integration (Daya and Bems, Clin Microbiol Rev 21(4):583-593, 2008). In some embodiments, these elements are included in the AAV vector.
- the left ORF of AAV contains the Rep gene, which encodes four proteins - Rep78, Rep 68, Rep52 and Rep40.
- the right ORF contains the Cap gene, which produces three viral capsid proteins (VP1, VP2 and VP3).
- the AAV capsid contains 60 viral capsid proteins arranged into an icosahedral symmetry. VP1, VP2 and VP3 are present in a 1:1:10 molar ratio (Daya and Berns, Clin Microbiol Rev 21(4):583-593, 2008). In some embodiments, these elements are included in the AAV vector.
- AAV vectors can be used for gene therapy.
- Exemplary AAV of use are AAV2, AAV5, AAV6, AAV8 and AAV9.
- Adenovirus, AAV2 and AAV8 are capable of transducing cells in the retina.
- any of a rAAV2 or rAAV8 vector can be used in the methods disclosed herein.
- rAAV6 and rAAV9 vectors are also of use.
- AAV infects humans and some other primate species, it is not known to cause disease and elicits a very mild immune response.
- Gene therapy vectors that utilize AAV can infect both dividing and quiescent cells and persist in an extrachromosomal state without integrating into the genome of the host cell.
- AAV2 preferentially infects cells of the human retina. Because of the advantageous features of AAV, the present disclosure contemplates the use of an rAAV for the methods disclosed herein.
- AAV possesses several additional desirable features for therapy, including the ability to bind and enter target cells, enter the nucleus, the ability to be expressed in the nucleus for a prolonged period of time, and low toxicity.
- AAV can be used to transfect cells, and suitable vector are known in the art, see for example, U.S. Published Patent Application No. 2014/0037585, incorporated herein by reference.
- Methods for producing rAAV suitable for gene therapy are well known in the art (see, for example, U.S. Published Patent Application Nos. 2012/0100606; 2012/0135515; 2011/0229971; and 2013/0072548; and Ghosh et al, Gene Ther 13(4):321-329, 2006), and can be utilized with the methods disclosed herein.
- the vector is a rAAV8 vector, a rAAV2 vector, a rAAV9 vector.
- the vector is an AAV8 vector.
- AAV8 vectors are disclosed, for example, in U.S. Patent No. 8,692,332, which is incorporated by reference herein.
- the location and sequence of the capsid, rep 68/78, rep 40/52, VP1, VP2 and VP3 are disclosed in this U.S. Patent No. 8,692,332.
- the location and hypervariable regions of AAV8 are also provided.
- the vector is an AAV2 variant vector, such as AAV7m8.
- vectors of use in the methods disclosed herein can contain nucleic acid sequences encoding an intact AAV capsid which may be from a single AAV serotype (e.g., AAV2, AAV6, AAV8 or AAV9).
- vectors of use can also be recombinant, and thus can contain sequences encoding artificial capsids which contain one or more fragments of the AAV8 capsid fused to heterologous AAV or non-AAV capsid proteins (or fragments thereof).
- These artificial capsid proteins are selected from non-contiguous portions of the AAV2, AAV6, AAV8 or AAV9 capsid or from capsids of other AAV serotypes.
- a rAAV vector may have a capsid protein comprising one or more of the AAV8 capsid regions selected from the VP2 and/or VP3, or from VP1, or fragments thereof selected from amino acids 1 to 184, amino acids 199 to 259; amino acids 274 to 446; amino acids 603 to 659; amino acids 670 to 706; amino acids 724 to 738 of the AAV8 capsid, which is presented as SEQ ID NO: 2 in U.S. Patent No. 8,692,332.
- the rAAV may contain one or more of the AAV serotype 8 capsid protein hypervariable regions, for example aa 185- 198; aa 260-273; aa447-477; aa495-602; aa660- 669; and aa707-723 of the AAV8 capsid which is presented as SEQ ID NO: 2 in U.S. Patent No. 8,692,332.
- a recombinant adeno-associated virus is generated having an AAV serotype 2 capsid.
- a host cell which can be cultured that contains a nucleic acid sequence encoding an AAV serotype 2 capsid protein, or fragment thereof, as defined herein; a functional rep gene; a minigene composed of, at a minimum, AAV inverted terminal repeats (ITRs) and a transgene, such as encoding a CRX protein, optionally operably linked to a CRX promoter; and sufficient helper functions to permit packaging in the AAV2 capsid protein.
- ITRs AAV inverted terminal repeats
- the components required to be cultured in the host cell to package an AAV minigene in an AAV capsid may be provided to the host cell in trans.
- any one or more of the required components e.g., minigene, rep sequences, cap sequences, and/or helper functions
- a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art.
- a stable host cell will contain the required component(s) under the control of an inducible promoter or a tissue specific promoter. Similar methods can be used to generate a rAAV2, rAAV8 or rAAV9 vector and/or virion.
- a retinal specific promoter can be included in the AAV vectors.
- the promoter is a Rhodopsin Kinase (RK) promoter.
- the Rhodopsin kinase promoter directs expression in rod and cone cells. This promoter has been optimized for expression (see Khani et ak, Invest. Opthamol. Vis. Science, 48: 3954-3961, 2007, incorporated herein by reference). The sequence of this promoter is provided in Fig. 1 of this reference. Additional promoters include, but are not limited to, the NRL, CRX, IRBP, or Rhodopsin promoters.
- a CRX promoter as disclosed above, is operably linked to a nucleic acid molecule encoding the CRX protein and included in the AAV vector.
- component(s), such as, but not limited to, a transgene encoding a CRX protein can be under the control of a constitutive promoter.
- a constitutive promoter is the cytomegalovirus promoter. Additional non-limiting examples are the ubiquitin or a chicken b-actin promoter. Promoters of use are also disclosed in the section above. Additional promoters are disclosed above.
- a selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters, such as for the production of rAAV in a packaging host cell.
- a stable host cell may be generated which is derived from 293 cells (which contain El helper functions under the control of a constitutive promoter), but which contains the rep and/or cap proteins under the control of inducible promoters. Still other stable host cells may be generated by one of skill in the art.
- the minigene, rep sequences, cap sequences, and helper functions required for producing a rAAV can be delivered to the packaging host cell in the form of any genetic element which transfer the sequences carried thereon.
- the selected genetic element may be delivered by any suitable method, including those described herein.
- the methods used to construct vectors are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
- methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present invention. See, e.g., K.
- selected AAV components can be readily isolated using techniques available to those of skill in the art from an AAV serotype, including AAV8.
- AAV may be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, Va.).
- the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GENBANK®.
- Methods are disclosed herein for treating a CRX autosomal dominant retinopathy in a subject. These methods include administering to the subject an effective amount of a nucleic acid molecule comprising a retinal specific promoter, such as a CRX promoter, operably linked to a nucleic acid molecule encoding a CRX protein.
- a nucleic acid molecule comprising a retinal specific promoter, such as a CRX promoter, operably linked to a nucleic acid molecule encoding a CRX protein.
- the CRX autosomal dominant retinopathy is Leber congenital amaurosis (LCA), retinitis pigmentosa, or cone rod dystrophy.
- the CRX autosomal dominant retinopathy is LCA.
- the methods can include selecting a subject that has the CRX autosomal dominant retinopathy, such as a subject with LCA, retinitis pigmentosa, or cone rod dystrophy.
- the method includes selecting and treating a subject with LCA.
- the methods can include selecting a subject that does not have a CRX autosomal recessive retinopathy and/or a CRX X-linked retinopathy.
- the retinal specific promoter can be a CRX promoter, as disclosed above.
- the disclosed methods increase Rhodopsin and cone L/M Opsin expression in the retina of the subject.
- CRX is the only gene associated with all three of LCA, RP and CORD.
- a majority of mutations arise de novo and are present in heterozygous form, thereby showing autosomal dominant inheritance.
- Approximately 50 likely pathological mutations have been described to date, half of these co-segregate with the disease phenotype.
- Reported mutations are 39% missense, 4% nonsense, 37% deletion, 16% insertion and 4% indel (insertion and deletion) sequence changes. Classes of mutations are summarized in the table below:
- Any autosomal dominant mutation including those in mutation class I- IV, can be treated using the methods disclosed herein.
- a subject can be selected that has an autosomal dominant CRX mutation from one of Class I-IV.
- diagnosis can utilize tests which examine the fundus of the eye and/or evaluate the visual field. These include electroretinogram, fluorangiography, and visual examination.
- the fundus of the eye examination aims to evaluate the condition of the retina and to evaluate for the presence of the characteristic pigment spots on the retinal surface. Examination of the visual field makes possible to evaluate the sensitivity of the various parts of the retina to light stimuli.
- An electroretinogram (ERG) can be used, which records the electrical activity of the retina in response to particular light stimuli and allows distinct valuations of the functionality of the two different types of photoreceptors (i.e. cone cells and rod cells).
- the subject can be evaluated for response using any methods known in the art. These include, but are not limited to, ophthalmoscopy, perimetry, gonioscopy, pachymetry, or nerve fiber analysis. In some embodiments, retinal ganglion cell number and/or viability can be assessed.
- One of skill in the art can readily determine that the disclosed methods are effective. For example, it can be determined by whether the cup-to-disc ratio has stabilized. Scanning laser polarimetry or optical coherence tomography could be used, for example to perform retinal nerve fiber layer analysis. A visual field test could be used to monitor progression of glaucoma.
- therapeutic efficacy in treating a vision deficiency can as an alteration in the individual's vision.
- Measures of therapeutic efficacy will be applicable to the particular disease being modified and will recognize the appropriate detection methods to use to measure therapeutic efficacy.
- therapeutic efficacy can be observed by fundus photography or evaluation of the ERG response.
- the method can include comparing test results after administration of the subject composition to test results before administration of the subject composition.
- therapeutic efficacy in treating a progressive cone dysfunction may be observed as a reduction in the rate of progression of cone dysfunction, as a cessation in the progression of cone dysfunction, or as an improvement in cone function, effects which may be observed by, such as ERG and/or cERG; color vision tests; functional adaptive optics; and/or visual acuity tests, for example, by comparing test results after administration of the subject composition to test results before administration of the subject composition and detecting a change in cone viability and/or function.
- therapeutic efficacy in treating a vision deficiency can as an alteration in the individual's vision, such as in the perception of red wavelengths, in the perception of green wavelengths, in the perception of blue wavelengths, effects which may be observed by, cERG and color vision tests, for example, by comparing test results after administration of the subject composition to test results before administration of the subject composition and detecting a change in cone and rod viability and/or function.
- the method includes evaluation morphology and structure preservation and/or ERG.
- compositions that include a nucleic acid molecule including a retinal specific promoter, such as a CRX promoter, operably linked to a nucleic acid molecule encoding a CRX protein.
- the nucleic acid molecule including a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein is provided in a viral vector, such as, but not limited to, an AAV vector. Suitable promoters, nucleic acid molecules encoding CRX protein, and vectors are disclosed above.
- the pharmaceutical compositions can be formulated and administered in a variety of ways depending on the type of disease to be treated (see, e.g., U.S. Published Application No. 2005/0054567, which discloses pharmaceutical compositions as well as administration of such compositions and is incorporated herein by reference).
- the pharmaceutical compositions can include a nanoparticle or dendrimer. These pharmaceutical compositions are of use in the methods disclosed herein.
- compositions are provided that are formulated for local delivery to the eye.
- the disclosure includes within its scope pharmaceutical compositions comprising nucleic acid molecule including a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein.
- the pharmaceutical composition can include a viral vector including a nucleic acid molecule including a retinal specific promoter, such as a CRX promoter as disclosed herein, operably linked to a nucleic acid molecule encoding a CRX protein, for example an AAV vector.
- the nucleic acid molecule including a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein can be administered ex vivo (such as into a stem cell to be implanted into the eye) or in vivo intraocularly to the subject, such as, but not limited to, sub-retinal or intravitreal administration.
- ex vivo such as into a stem cell to be implanted into the eye
- intraocularly such as, but not limited to, sub-retinal or intravitreal administration.
- preparation of a pharmaceutical composition entails preparing a pharmaceutical composition that is essentially free of pyrogens, as well as any other impurities that could be harmful to humans or animals.
- the pharmaceutical composition contains appropriate salts and buffers to render the components of the composition stable and allow for uptake of nucleic acids or virus by target cells.
- compositions can be formulated for injection, such as for intravitreal of subretinal administration.
- Such compositions are formulated generally by mixing a disclosed therapeutic agent at the desired degree of purity in a unit dosage injectable form (solution, suspension, or emulsion) with a pharmaceutically acceptable carrier, for example, one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
- Pharmaceutical compositions can include an effective amount of the nucleic acid molecule dispersed (for example, dissolved or suspended) in a pharmaceutically acceptable carrier or excipient.
- Pharmaceutically acceptable carriers and/or pharmaceutically acceptable excipients are known in the art and are described, for example, in Remington ’s Pharmaceutical Sciences by E. W.
- compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, pH buffering agents and the like, for example, sodium acetate or sorbitan monolaurate.
- a disclosed therapeutic agent can be suspended in an aqueous carrier, for example, in an isotonic or hypotonic buffer solution at a pH of about 3.0 to about 8.5, such as about 4.0 to about 8.0, about 6.5 to about 8.5, or about 7.4.
- Useful buffers include saline-buffered phosphate or an ionic boric acid buffer.
- the active ingredient, optionally together with excipients, can also be in the form of a lyophilisate and can be made into a solution prior to administration by the addition of suitable solvents.
- the pharmaceutically acceptable carriers include any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like.
- the use of such media and agents for pharmaceutically active substances is well-known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the pharmaceutical compositions is contemplated.
- Supplementary active ingredients also can be incorporated into the compositions.
- certain pharmaceutical compositions can include the vectors or viruses in water, mixed with a suitable surfactant, such as hydroxy-propylcellulose.
- Dispersions also can be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof as well as in oils.
- these preparations contain a preservative to prevent the growth of microorganisms.
- Pharmaceutically acceptable salts can be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.
- auxiliary substances such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles.
- the excipients confer a protective effect to a virus including the nucleic acid molecules, such as AAV virion, such that loss of AAV virions, as well as transduceability resulting from formulation procedures, packaging, storage, transport, and the like, is minimized.
- These excipient compositions are therefore considered “virion-stabilizing" in the sense that they provide higher AAV virion titers and higher transduceability levels than their non protected counterparts, as measured using standard assays, see, for example, Published U.S. Application No. 2012/0219528, incorporated herein by reference.
- These compositions therefore demonstrate "enhanced transduceability levels" as compared to compositions lacking the particular excipients described herein and are therefore more stable than their non-pro tected counterparts.
- Exemplary excipients that can used to protect the AAV virion from activity degradative conditions include, but are not limited to, detergents, proteins, e.g., ovalbumin and bovine serum albumin, amino acids, e.g., glycine, polyhydric and dihydric alcohols, such as but not limited to polyethylene glycols (PEG) of varying molecular weights, such as PEG-200, PEG-400, PEG-600, PEG- 1000, PEG- 1450, PEG-3350, PEG-6000, PEG-8000 and any molecular weights in between these values, with molecular weights of 1500 to 6000 preferred, propylene glycols (PG), sugar alcohols, such as a carbohydrate, preferably, sorbitol.
- PEG polyethylene glycols
- PG propylene glycols
- sugar alcohols such as a carbohydrate, preferably, sorbitol.
- the detergent when present, can be an anionic, a cationic, a zwitterionic or a nonionic detergent.
- An exemplary detergent is a nonionic detergent.
- One suitable type of nonionic detergent is a sorbitan ester, e.g., poly oxyethylenesorbi tan monolaurate (TWEEN®-20) polyoxyethylenesorbitan monopalmitate (TWEEN®-40), polyoxyethylenesorbitan monostearate (TWEEN®-60), polyoxyethylenesorbitan tristearate (TWEEN®-65), polyoxyethylenesorbitan monooleate (TWEEN®-80), polyoxyethylenesorbitan trioleate (TWEEN®-85), such as TWEEN®-20 and/or TWEEN®-80.
- These excipients are commercially available from a number of vendors, such as Sigma, St. Louis, Mo.
- a protein excipient such as BSA, if present, will can be present at a concentration of between 1.0 weight (wt.) % to about 20 wt. %, preferably 10 wt. %. If an amino acid such as glycine is used in the formulations, it can be present at a concentration of about 1 wt. % to about 5 wt. %.
- a carbohydrate, such as sorbitol, if present, can be present at a concentration of about 0.1 wt % to about 10 wt. %, such as between about 0.5 wt.
- polyethylene glycol it can generally be present on the order of about 2 wt. % to about 40 wt. %, such as about 10 wt. % top about 25 wt. %.
- propylene glycol it will typically be present at a concentration of about 2 wt. % to about 60 wt. %, such as about 5 wt. % to about 30 wt. %.
- I f a detergent such as a sorbitan ester (TWEEN®) is present, it can be present at a concentration of about 0.05 wt.
- an aqueous virion- stabilizing formulation comprises a carbohydrate, such as sorbitol, at a concentration of between 0.1 wt. % to about 10 wt. %, such as between about 1 wt. % to about 5 wt. %, and a detergent, such as a sorbitan ester (TWEEN®) at a concentration of between about 0.05 wt. % and about 5 wt. %, such as between about 0.1 wt. % and about 1 wt. %.
- Virions are generally present in the composition in an amount sufficient to provide a therapeutic effect when given in one or more doses, as defined above.
- compositions that include a nucleic acid molecule including a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein, such as a viral vector, will, in some embodiments, be formulated in unit dosage form, suitable for individual administration of precise dosages.
- the amount of active compound(s) administered will depend on the subject being treated, the severity of the affliction, and the manner of administration and is best left to the judgment of the prescribing clinician. Within these bounds, the formulation to be administered will contain a quantity of the active component(s) in amounts effective to achieve the desired effect in the subject being treated.
- the nucleic acid molecule including a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein, such as a viral vector can be included in an inert matrix for either topical application or injection into the eye.
- liposomes may be prepared from dipalmitoyl phosphatidylcholine (DPPC), such as egg phosphatidylcholine (PC). Liposomes, including cationic and anionic liposomes, can be made using standard procedures as known to one skilled in the art.
- liposomes that include a nucleic acid molecule including a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein can be injected intraocularly.
- the liposome capsule degrades due to cellular digestion.
- these formulations provide the advantages of a slow-release drug delivery system, exposing a subject to a substantially constant concentration nucleic acid molecule including a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein, such as in a viral vector, over time.
- the nucleic acid molecule including a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein, such as in a viral vector can be dissolved in an organic solvent, such as DMSO or alcohol, as previously described, and contain a polyanhydride, poly(glycolic) acid, poly(lactic) acid, or polycaprolactone polymer.
- the nucleic acid molecule such as in a viral vector, for example, an AAV vector, may be formulated to permit release over a specific period of time.
- a release system can include a matrix of a biodegradable material or a material which releases the incorporated components by diffusion. The components can be homogeneously or heterogeneously distributed within the release system.
- release systems may be useful, however, the choice of the appropriate system will depend upon rate of release required by a particular application. Both non-degradable and degradable release systems can be used. Suitable release systems include polymers and polymeric matrices, non-polymeric matrices, or inorganic and organic excipients and diluents such as, but not limited to, calcium carbonate and sugar (for example, trehalose). Release systems may be natural or synthetic. However, synthetic release systems are preferred because generally they are more reliable, more reproducible and produce more defined release profiles. The release system material can be selected so that components having different molecular weights are released by diffusion through or degradation of the material.
- Representative synthetic, biodegradable polymers include, for example: polyamides such as poly(amino acids) and poly (peptides); polyesters such as poly(lactic acid), poly(glycolic acid), poly(lactic-co-glycolic acid), and poly(caprolactone); poly (anhydrides); poly orthoesters; polycarbonates; and chemical derivatives thereof (substitutions, additions of chemical groups, for example, alkyl, alkylene, hydroxylations, oxidations, and other modifications routinely made by those skilled in the art), copolymers and mixtures thereof.
- polyamides such as poly(amino acids) and poly (peptides)
- polyesters such as poly(lactic acid), poly(glycolic acid), poly(lactic-co-glycolic acid), and poly(caprolactone)
- poly orthoesters polycarbonates
- chemical derivatives thereof substitutions, additions of chemical groups, for example, alkyl, alkylene, hydroxylations, oxidations, and other modifications routinely made by
- Representative synthetic, non-degradable polymers include, for example: polyethers such as poly(ethylene oxide), poly(ethylene glycol), and poly(tetramethylene oxide); vinyl polymers-polyacrylates and polymethacrylates such as methyl, ethyl, other alkyl, hydroxy ethyl methacrylate, acrylic and methacrylic acids, and others such as poly(vinyl alcohol), poly(vinyl pyrolidone), and poly(vinyl acetate); poly(urethanes); cellulose and its derivatives such as alkyl, hydroxyalkyl, ethers, esters, nitrocellulose, and various cellulose acetates; polysiloxanes; and any chemical derivatives thereof (substitutions, additions of chemical groups, for example, alkyl, alkylene, hydroxylations, oxidations, and other modifications routinely made by those skilled in the art), copolymers and mixtures thereof.
- polyethers such as poly(ethylene oxide), poly(ethylene glycol), and poly
- Poly(lactide-co-glycolide) microsphere can also be used for intraocular injection.
- the microspheres are composed of a polymer of lactic acid and glycolic acid, which are structured to form hollow spheres.
- the spheres can be approximately 15-30 microns in diameter and can be loaded with components described herein.
- the nucleic acid molecule including a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein can be included in a delivery system that can be implanted at various sites in the eye, depending on the size, shape, and formulation of the implant as well as the type of transplant procedure.
- the nucleic acid molecule including a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein can be used alone.
- At least one additional agent such as at least one agent that is disclosed below, can be included along with the nucleic acid molecule including a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein in the implant.
- the implant is then introduced into the eye. Suitable sites include but are not limited to the anterior chamber, anterior segment, posterior chamber, posterior segment, and vitreous cavity.
- the implants can be inserted into the eye by a variety of methods, including placement by forceps or by trocar following making an incision in the sclera (for example, a 2-3 mm incision) or another suitable site.
- the implant can be placed by trocar without making a separate incision, but instead by forming a hole directly into the eye with the trocar.
- the method of placement can influence the release kinetics. For example, implanting the device into the vitreous or the posterior chamber with a trocar may result in placement of the device deeper within the vitreous than placement by forceps, which may result in the implant being closer to the edge of the vitreous.
- the location of the implanted device may influence the concentration gradients of the nucleic acid molecule including a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein, such as in a viral vector, surrounding the device and, thus, influence the release rates (for example, a device placed closer to the edge of the vitreous may result in a slower release rate, see U.S. Patent No. 5,869,079 and U.S. Patent No. 6,699,493).
- an implant is formulated with the nucleic acid molecule including a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein associated with a bio-erodible polymer matrix.
- Other delivery methods can also be used, such as nanoparticles.
- the nucleic acid molecule including a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein is homogeneously distributed through the polymeric matrix, such that it is distributed evenly enough that no detrimental fluctuations in rate of release occur due to uneven distribution in the polymer matrix.
- the selection of the polymeric composition to be employed varies with the desired release kinetics, the location of the implant, patient tolerance, and the nature of the implant procedure.
- the polymer can be included as at least about 10 weight percent of the implant. In one example, the polymer is included as at least about 20 weight percent of the implant. In another embodiment, the implant comprises more than one polymer.
- Characteristics of the polymers generally include biodegradability at the site of implantation, compatibility with the agent of interest, ease of encapsulation, and water insolubility, amongst others. Generally, the polymeric matrix is not fully degraded until the drug load has been released.
- the chemical composition of suitable polymers is known in the art (for example, see U.S. Patent No. 6,699,493).
- the nucleic acid molecule including a retinal specific promoter operably linked to a nucleic acid molecule encoding a CRX protein, as disclosed herein can be formulated in an implantable form with other carriers and solvents. For example, buffering agents and preservatives can be employed.
- the implant sizes and shape can also be varied for use in particular regions of the eye (see U.S. Patent No. 5,869,079). In some embodiments, a nanoparticle or dendrimer is used.
- Local modes of administration include, by way of example, intraocular, intraorbital, intravitreal and subretinal routes.
- significantly smaller amounts of the components may exert an effect when administered locally (for example, intravitreally) compared to when administered systemically (for example, intravenously).
- Local modes of administration can reduce or eliminate the incidence of potential side effects.
- components described herein are delivered subretinally, e.g., by subretinal injection. Subretinal injections may be made directly into the macular, e.g., submacular injection.
- Exemplary methods include intraocular injection (e.g., retrobulbar, subretinal, submacular, intravitreal and intrachoroidal), iontophoresis, eye drops, and intraocular implantation (e.g., intravitreal, sub-Tenons and sub-conjunctival).
- intraocular injection e.g., retrobulbar, subretinal, submacular, intravitreal and intrachoroidal
- iontophoresis e.g., eye drops
- intraocular implantation e.g., intravitreal, sub-Tenons and sub-conjunctival.
- a composition as disclosed herein is delivered by intravitreal injection.
- Intravitreal injection has a relatively low risk of retinal detachment.
- Methods for administration of agents to the eye are known in the medical arts and can be used to administer components described herein.
- Administration may be provided as a single administration, a periodic bolus (for example, subretinally or intravitreally) or as continuous infusion from an internal reservoir (for example, from an implant disposed at an intra- or extra-ocular location (see, U.S. Pat. Nos. 5,443,505 and 5,766,242)) or from an external reservoir (for example, from an intravenous bag).
- Intravitreal injection or subretinal injection of a therapeutic agents can be performed once, or can be performed repeatedly, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times.
- Administration can be performed biweekly, weekly, every other week, monthly, or every 2, 3, 4, 5, or 6 months.
- Individual doses are typically not less than an amount required to produce a measurable effect on the subject and may be determined based on the pharmacokinetics and pharmacology of the subject composition or its by-products, and thus based on the disposition of the composition within the subject. This includes consideration of the route of administration as well as dosage amount, which can be adjusted for subretinal (applied directly to where action is desired for mainly a local effect), intravitreal (applied to the vitreous for a pan-retinal effect) applications. Effective amounts of dose and/or dose regimen can readily be determined empirically from preclinical assays, from safety and escalation and dose range trials, individual clinician-patient relationships, as well as in vitro and in vivo assays.
- Nucleic acid molecules can be delivered by microinjection, electroporation, lipid-mediated transfection, peptide-mediated delivery, nanoparticle mediated deliver, dendrimer mediated delivery, or other methods known in the art.
- An appropriate dose depends on the subject being treated (e.g., human or nonhuman primate or other mammal), age and general condition of the subject to be treated, the severity of the condition being treated, the mode of administration of the vector/virion, among other factors.
- An appropriate effective amount can be readily determined by one of skill in the art. Thus, a "therapeutically effective amount" will fall in a relatively broad range that can be determined through clinical trials.
- Components can be administered by continuous release for a particular period from a sustained release drug delivery device immobilized to an inner wall of the eye or via targeted transscleral controlled release into the choroid (see, for example, PCT Application No. PCT/USOO/00207, PCT/US02/14279, Ambati et al. (2000) Invest. Ophthalmol. Vis. Sci. 41:1181- 1185, and Ambati et al. (2000) Invest. Ophthalmol. Vis. Sci. 41:1186-1191).
- a variety of devices suitable for administering components locally to the inside of the eye are known in the art. See, for example, U.S. Patent Nos. 6,251,090; 6,299,895; 6,416,777, and 6,413,540
- a therapeutically effective dose will be on the order of from about 10 5 to 10 16 of the AAV virions, such as 10 8 to 10 14 AAV virions.
- the dose depends on the efficiency of transduction, promoter strength, the stability of the message and the protein encoded thereby, and clinical factors. Effective dosages can be readily established by one of ordinary skill in the art through routine trials establishing dose response curves.
- an effective amount to achieve a change will be about 1 X10 8 vector genomes or more, in some cases about 1 X 10 9 , about 1 X 10 10 , about 1 X 10 11 , about 1 X 10 12 , or about 1 X 10 13 vector genomes or more, in certain instances, about 1 X 10 14 vector genomes or more, and usually no more than about 1 X 10 15 vector genomes.
- the amount of vector that is delivered is about 1 X 10 14 vectors or less, for example about 1 X 10 13 , about 1 X 10 12 , about 1 X 10 11 , about 1 X 10 10 , or about 1 X 10 9 vectors or less, in certain instances about 1 X 10 8 vectors, and typically no less than 1 X 10 8 vectors.
- the amount of vector genomes that is delivered is about 1 X 10 10 to about 1 X 10 11 vectors.
- the amount of vector that is delivered is about 1 X 10 10 to about 1 X 10 12 vector genomes.
- the amount of pharmaceutical composition to be administered may be measured using multiplicity of infection (MOI).
- MOI refers to the ratio, or multiple of vector or viral genomes to the cells to which the nucleic may be delivered.
- the MOI may be about 1 X 10 6 .
- the MOI can be about 1 X 10 5 to about 1 X 10 7 .
- the MOI may be about 1 X 10 4 to about 1 X 10 8 .
- recombinant viruses of the disclosure are at least about 1 X 10 1 , about 1 X 10 2 , about 1 X 10 3 , about 1 X 10 4 , about 1 X 10 5 , about 1 X 10 6 , about 1 X 10 7 , about 1 X 10 8 , about 1 X 10 9 , about 1 X 10 10 , about 1 X 10 11 , about 1 X 10 12 , about 1 X 10 13 , about 1 X 10 14 , about 1 X 10 15 , about 1 X 10 16 , about 1 X 10 17 , and about 1 X 10 18 MOI. In some cases, recombinant viruses of this disclosure are about 1 X 10 8 to 1 X 10 14 MOI.
- the amount of pharmaceutical composition delivered comprises about 1 X 10 8 to about 1 X 10 15 particles of recombinant viruses, about 1 X 10 9 to about 1 X 10 14 particles of recombinant viruses, about 1 X 10 10 to about 1 X 10 13 particles of recombinant viruses, or about 1 X 10 11 to about 1 X lO.s 12 particles of recombinant viruses (see U.S. Published Patent Application No. 2015/0259395, incorporated herein by reference).
- Dosage treatment may be a single dose schedule or a multiple dose schedule to ultimately deliver the amount specified above.
- the subject may be administered as many doses as appropriate.
- the subject may be given, e.g., 10 5 to 10 16 AAV virions in a single dose, or two, four, five, six or more doses that collectively result in delivery of, e.g., 10 5 to 10 16 AAV virions.
- One of skill in the art can readily determine an appropriate number of doses to administer.
- an AAV is administered at a dose of about 1 x 10 11 to about 1 x 10 14 viral particles (vp)/kg. In some examples, the AAV is administered at a dose of about 1 x 10 12 to about 8 x 10 13 vp/kg. In other examples, the AAV is administered at a dose of about 1 x 10 13 to about 6 x 10 13 vp/kg.
- the AAV is administered at a dose of at least about 1 x 10 11 , at least about 5 x 10 11 , at least about 1 x 10 12 , at least about 5 x 10 12 , at least about 1 x 10 13 , at least about 5 x 10 13 , or at least about 1 x 10 14 vp/kg.
- the rAAV is administered at a dose of no more than about 5 x 10 11 , no more than about 1 x 10 12 , no more than about 5 x 10 12 , no more than about 1 x 10 13 , no more than about 5 x 10 13 , or no more than about 1 x 10 14 vp/kg.
- the AAV is administered at a dose of about 1 x 10 12 vp/kg.
- the AAV can be administered in a single dose, or in multiple doses (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) as needed for the desired therapeutic results.
- a general method for intravitreal injection may be illustrated by the following brief outline. This example is merely meant to illustrate certain features of the method, and is in no way meant to be limiting. Procedures for intravitreal injection are known in the art (see, for example Peyman, et al. (2009) Retina 29(7):875-912 and Fagan and Al-Qureshi, (2013) Clin. Experiment. Ophthalmol. 41(5):500-7). Other methods of intraocular administration are known in the art and include subretinal administration ⁇
- a subject for intravitreal injection may be prepared for the procedure by pupillary dilation, sterilization of the eye, and administration of anesthetic.
- Any suitable mydriatic agent known in the art may be used for pupillary dilation. Adequate pupillary dilation may be confirmed before treatment.
- Sterilization may be achieved by applying a sterilizing eye treatment, e.g., an iodide-containing solution such as povidone-iodine (BETADINE®).
- BETADINE® povidone-iodine
- a similar solution may also be used to clean the eyelid, eyelashes, and any other nearby tissues (e.g., skin).
- Any suitable anesthetic may be used, such as lidocaine or proparacaine, at any suitable concentration.
- Anesthetic may be administered by any method known in the art, including without limitation topical drops, gels or jellies, and subconjunctival application of anesthetic.
- a sterilized eyelid speculum may be used to clear the eyelashes from the area.
- the site of the injection may be marked with a syringe.
- the site of the injection may be chosen based on the lens of the patient.
- the injection site may be 3-3.5 mm from the limus in pseudophakic or aphakic patients, and 3.5-4 mm from the limbus in phakic patients.
- the patient may look in a direction opposite the injection site.
- the needle can be inserted perpendicular to the sclera and pointed to the center of the eye.
- the needle can be inserted such that the tip ends in the vitreous, rather than the subretinal space. Any suitable volume known in the art for injection may be used.
- the eye can be treated with a sterilizing agent such as an antibiotic.
- the eye can also be rinsed to remove excess sterilizing agent.
- the subject can be administered additional therapeutic agents.
- Additional agents that can be administered to the subject include antibacterial and antifungal antibiotics, as well as non steroidal anti-inflammatory agents to reduce risk of infection and inflammation. Additional agents can be administered by any route.
- the additional agents can be formulated separately, or in the same composition.
- antibiotics such as minoglycosides (for example, amikacin, apramycin, arbekacin, bambermycins, butirosin, dibekacin, dihydrostreptomycin, fortimicin(s), gentamicin, isepamicin, kanamycin, micronomicin, neomycin, neomycin undecylenate, netilmicin, paromomycin, ribostamycin, sisomicin, spectinomycin, streptomycin, tobramycin, trospectomycin), amphenicols (for example, azidamfenicol, chloramphenicol, florfenicol, thiamphenicol), ansamycins (for example, rifamide, rifampin, rifamycin sv, rifapentine, rifaximin), b-lactams (for example, carbacephems (e.g., lora),
- Agents of use also include synthetic antibacterials, such as 2,4-Diaminopyrimidines (for example, brodimoprim, tetroxoprim, trimethoprim), nitrofurans (for example, furaltadone, furazolium chloride, nifuradene, nifuratel, nifurfoline, nifurpirinol, nifurprazine, nifurtoinol, nitrofurantoin), quinolones and analogs (for example, cinoxacin, ciprofloxacin, clinafloxacin, difloxacin, enoxacin, fleroxacin, flumequine, grepafloxacin, lomefloxacin, miloxacin, nadifloxacin, nalidixic acid, norfloxacin, ofloxacin, oxolinic acid, pazufloxacin, pefloxacin, pipemidic acid,
- antifungal antibiotics such as polyenes (for example, amphotericin B, candicidin, beostatin, filipin, fungichromin, hachimycin, hamycin, lucensomycin, mepartricin, natamycin, nystatin, pecilocin, perimycin), others (for example, azaserine, griseofulvin, oligomycins, neomycin undecylenate, pyrrolnitrin, siccanin, tubercidin, viridin) allylamines (for example, butenafine, naftifine, terbinafine), imidazoles (for example, bifonazole, butoconazole, chlordantoin, chlormiidazole, cloconazole, clotrimazole, econazole, enilconazole, fenticonazole, flutrimazole, isoconazole, ketoconazoles (for example
- Antineoplastic agents can also be of use including (1) antibiotics and analogs (for example, aclacinomycins, actinomycin, anthramycin, azaserine, bleomycins, cactinomycin, carubicin, carzinophilin, chromomycins, dactinomycin, daunorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin, epirubicin, idarubicin, menogaril, mitomycins, mycophenolic acid, nogalamycin, olivomycines, peplomycin, pirarubicin, plicamycin, porfiromycin, puromycin, streptonigrin, streptozocin, tubercidin, zinostatin, zorubicin), (2) anti metabolites such as folic acid analogs (for example, denopterin, edatrexate, methotrexate, piritrexim, p
- Steroidal anti-inflammatory agents can also be used such as 21-acetoxypregnenolone, alclometasone, algestone, amcinonide, beclomethasone, betamethasone, budesonide, chloroprednisone, clobetasol, clobetasone, clocortolone, cloprednol, corticosterone, cortisone, cortivazol, cyclosporine, deflazacort, desonide, desoximetasone, dexamethasone, diflorasone, diflucortolone, difluprednate, enoxolone, fluazacort, flucloronide, flumethasone, flunisolide, fluocinolone acetonide, fluocinonide, fluocortin butyl, fluocortolone, fluorometholone, fluperolone acetate, fluprednidene acetate, flupre
- non-steroidal anti-inflammatory agents can be used. These include aminoarylcarboxylic acid derivatives (for example, enfenamic acid, etofenamate, flufenamic acid, isonixin, meclofenamic acid, mefenamic acid, niflumic acid, talniflumate, terofenamate, tolfenamic acid), arylacetic acid derivatives (for example, aceclofenac, acemetacin, alclofenac, amfenac, amtolmetin guacil, bromfenac, bufexamac, cinmetacin, clopirac, diclofenac sodium, etodolac, felbinac, fenclozic acid, fentiazac, glucametacin, ibufenac, indomethacin, isofezolac, isoxepac, lonazolac, metiazinic acid, mof
- a particularly challenging area for retinal gene therapy is the treatment of autosomal dominant mutations. Up to 30% of retinitis pigmentosa cases might be caused by autosomal dominant mutations. Most frequently detected are mutations in Rhodopsin gene ( RHO ) with common P23H and P347S mutations.
- IPSCs maintenance and retinal differentiation IPSCs were maintained in E8 medium on Matrigel-coated plates. Non-enzymatic passaging using EDTA was performed. For differentiation cells were lifted using EDTA and transferred to ultra-low attachment dishes to form embryoid bodies. Differentiation was performed as previously described (Zhong et al., Nat Commun, 5, 4047; Kaya et al., Molecular vision, 25, 663-678) with minor modifications, namely supplementation with 20 ng/ml IGF- 1 following dissection of optic domains and use of 9 -cis retinaldehyde instead of all -/ran. s retinoic acid from day 90.
- ROCK inhibitor (Y-27632 dihydrochloride, Tocris) stock 10 mM, final concentration 10 mM, dilution 1:1000.
- Taurine Sigma- Aldrich stock 100 mM, final concentration 100 mM, dilution 1:1000.
- IGF-1 (Gibco) stock 10 mg/ml, final 20 ng/ml, dilution 1:500
- Retinal organoids were collected using wide-bore pipette tips, washed with PBS then fixed with 4% PFA (Neuro Technologies) for at least 1 hr. Organoids were then washed 3x with PBS and transferred into 15% sucrose (w/v) solution until they sank into the bottom of the tube. Then the tissue was transferred into 30% sucrose solution (w/v). Following these dehydration steps the organoids were placed in Ml embedding matrix and snap frozen in an ethanol/dry ice bath. Blocks were cryosectioned at 18 mhi onto Superfrost Plus (Fisher Scientific) glass slides. A Thermo Scientific MICROM HM550 cryostat (Thermo Fisher Scientific).
- Sectioned were dried before storage at -20°C. For staining slides were rehydrated in PBS for 15 min. and then blocked in 5% donkey serum, 1% BSA (Sigma- Aldrich), 0.1% Triton X-100 (Sigma-Aldrich) solution in PBS for at least 1 hr. Both primary and secondary antibodies were added in 1% BSA (Sigma-Aldrich),
- Triton X-100 (Sigma-Aldrich) solution in PBS. Sections were incubated with primary antibodies overnight. Slides were washes with PBS 5x before secondary antibodies were added for 2 hr. Slides were washed 3x with PBS then incubated with DAPI before addition of Fluoromount- G mounting medium (SouthemBiotech) and covering with a microscopy cover glass (VWR). Samples were imaged on Zeiss 700 confocal microscope (Zeiss) or Leica SP-8 confocal microscope (Leica Microsystems). Images were processed with ZEN Black, ZEN Blue (Zeiss), LAS X (Leica Microsystems) and ImageJ software. Quantifications and fluorescence intensity measurements were performed using ImageJ software. At least three sections from three independent organoids were used for quantification.
- Sequences derived from human CRX 5’ untranslated region were amplified from human genomic DNA and combined to produce a promoter of 631 base pairs. Specifically, first 189 nucleotides correspond to positions 3085-3274 of the reference sequence; the next 69 correspond to 3323-3392 of the reference and the next 361 correspond to 4808-5169 of the reference sequence. Note that 4999-5169 is exon 1; therefore, this human CRX promoter element contains the 1st exon of human CRX gene.
- HEK293 cells were transfected with vector plasmid and pHLP19-AAV2 and pLAdeno5 helper plasmids using CaCh method.
- Cell pellet was homogenized with a microfluidizer to release AAV particles.
- Cell debris were eliminated by centrifugation and free DNA removed by 1 hr of lOOU/ml bezonase treatment.
- AAV particles were then precipitated in 8% PEG on ice for 2 hr.
- AAV particles pellet was collected by centrifugation and treated with RNaseA for 30 min. at 37°C. Purification of AAV was subsequently conducted using a series of ultracentrifugation steps on CsCl density gradient and dialysis. Titration was performed by qPCR.
- GraphPad Prism version 8.0 software was used to plot data and perform statistical analysis. For two group comparisons 2-tailed, type 3 Student’s t test was used. For multiple groups ANOVA analysis was used with either Dunnett’s or Tukey’s post hoc tests.
- iPSCs induced pluripotent stem cells
- Neural induction was performed on floating EBs for 7 days, after which they were plated on Matrigel. Eye field/optic vesicle domains were manually dissected at around 4 weeks from the adherent cultures and subsequently cultured in suspension as retinal organoids. Both patient and control cell lines formed morphologically similar retinal neural epithelia.
- Photoreceptors are the primary cells expressing CRX in the retina.
- retinal organoids at week 9 were stained with OTX2, a marker of photoreceptor precursors upstream of CRX in photoreceptor specification pathway.
- the proportion of cells expressing OTX2 was equivalent in both patient and control organoids.
- Recoverin+ photoreceptor precursors started accumulating at the apical aspect of the organoids.
- Rhodopsin The second Opsin expressed in retinal development is the rod cell visual pigment Rhodopsin. At dl25 Rhodopsin became expressed in patches of prospective rod photoreceptors in control organoids (Fig. 1C). In contrast, CRX- LCA retinal organoids lacked robust Rhodopsin immunoreactivity measured by fluorescence intensity on organoid sections (Fig. 1G). Loss of Rhodopsin was consistent across 10 organoids examined (Fig. 1H). Qualitatively, separation of the photoreceptor layer was less advanced in patient-derived organoids (Fig. 1C). Cone cell L/M Opsin is the final Opsin to be expressed in humans.
- CRX mutations lead to several types of retinopathies with varying severity (den Hollander et ak, Prog Retin Eye Res, 27, 391-419; Hull et ak, Investigative ophthalmology & visual science, 55, 6934-6944).
- Animal models indicate multiple disease mechanisms depending on the nature of the mutation (Tran et ak, PLoS Genet, 10, el004111; Roger et ak, J Clin Invest, 124, 631-643).
- human subjects clear correlations between mutation type or its location within the gene’s functional domains and phenotype severity or manifestation are not evident (Hull et ak, Investigative ophthalmology & visual science, 55, 6934-6944).
- Prominent rescue of Rhodopsin expression in AAV-treated CRX- LCA retinal organoids identifies this approach as a treatment strategy.
- Retinal organoids were used as a platform to assess gene therapy in a patient with CRX- LCA retinal dystrophy, an experimental strategy which can be applied to other autosomal dominant conditions of the retina.
- Patient iPSC-derived organoids have been used to provide proof-of- concept for AAV-mediated gene therapy of recessive X-linked retinitis pigmentosa caused by mutations in RP2 (Lane et al., Stem Cell Reports, 2020).
- AAV2 capsid serotypes AAV2 and AAV8 with CMV promoter driving a GFP reporter.
- AAV2 capsid showed much higher proportion of cells expressing both GFP and CRX in organoids at dl50, 10 days post vector addition at dl40.
- Human CRX promoter sequences were then tested for driving transcription in retinal cells that normally express the CRX gene.
- NG_008605.1 Different sequence regions derived from the upstream region of the human CRX gene (NCBI Reference Sequence: NG_008605.1) were amplified using human genomic DNA and assembled to produce a 631 base pair length promoter element.
- 189 nucleotides correspond to positions 3085-3274, 69 correspond to 3323-3392, and 361 correspond to 4808-5169 of the reference.
- This promoter element contains 1st exon of the human CRX gene (nucleotides 4999-5169). These sequences were included based on the binding sites of several transcription factors expressed during human retinal development.
- nt nucleotide (nt) composite promoter was cloned upstream of a GFP reporter in an AAV vector construct. This vector was used alongside a CMV promoter vector for transduction of retinal organoids dl90 of differentiation. Four weeks following vector addition (d220), the organoids were collected, cryosectioned, and stained for GFP (Figs. 2A-2D). The reporter expression was present throughout the organoid with CMV promoter vector (Fig. 2A).
- CRX composite promoter showed localization to a distinct cell layer at the apical region of the organoids, consistent with the location of photoreceptors (Fig. 2B-2D).
- a dose of 5xl0 10 viral genomes (vg) per organoid was sufficient for significant transduction of the photoreceptor layer (Fig. 2B), and the transduction was widespread across the organoid with a dose of 10 11 vg per organoid (Fig. 2D).
- a gene therapy vector containing 631 nt CRX composite promoter that guided the expression of CRX coding sequence for treatment was used in retinal organoids at day 120 of differentiation.
- the organoids were harvested at day 150 (after 4 weeks) and analyzed by histology (Figs. 3A-3H).
- Immunostaining using anti-Rhodopsin antibody revealed a robust staining in healthy control organoids (Fig. 3A).
- Rhodopsin in the patient-derived organoids with AAV-CRX gene therapy treatment group Fig.
- Rhodopsin expression is its localization with high concentration in apical outer segment structures in photoreceptor cells. It was therefore examined whether treatment with AAV-CRX gene therapy could rescue this apical enrichment. Importantly, Rhodopsin immunostaining in treated patient organoids was highly concentrated in apical structures of photoreceptor cells showing rescue of expression (Fig. 4).
- Rhodopsin expression was examined at day 180, 2 months after AAV transduction that was performed at day 120 (Fig. 5A). At this stage, Rhodopsin expression was still not detected in patient organoids (Fig. 5B) but was evident across multiple treated organoids, both at a lower dose of lx 10 11 vg per organoid (Fig. 5C) as well as higher dose of 3x 10 11 vg of AAV- CRX gene therapy vector per organoid (Fig. 5D). The intensity of Rhodopsin immunostaining was quantified in these samples (Fig. 6A, 6B).
- scRNA-seq single cell RNA sequencing
- Control, untreated CRX-I138fs and AAV-treated organoids were dissociated using a papain-based method (Fadl et al., Molecular Vision 26, 705-717, 2020) at d200 yielding 40,712 single cell transcriptional profiles.
- Data processing using Seurat package identified cell clusters, which were assigned to known retinal cell types and visualized using UMAP dimension reduction (Fig. 9A; Fig. 10A-C).
- Fig. 9A major retinal cell classes (apart from ganglion cells) emerge from centrally located undifferentiated cells (Fig. 9A).
- Cell type distribution was similar across the three sample origins (Fig. 9A; Fig. 10B).
- Rods and cones formed well-defined differentiation trajectories in this manifold and were identified by expression of both common (CRX, RCVRN) and subtype-specific markers (rod: GNGT1, GNA T 1 ; cone: ARR3, PDE6H; Fig. 9B).
- CRX transcripts increased in photoreceptors after AAV-CRX transduction (Fig. 9C).
- Rod and cone expression profiles could be clearly separated based on control or patient sample origin, whereas AAV-treated cells occupied the space in between (Fig.
- CABP4 a retinal disease gene and direct transcriptional target of CRX (Assawachananont et ak, 2018) showed a similar trend (Fig. 10F, 10G).
- Fig. 10F, 10G single cell analysis confirmed treatment effect of AAV-mediated overexpression of normal CRX.
- organoids were examined with the CRX K88N mutation.
- the frameshift mutation no differences in morphology and expression of key retinal markers were evident at stage 1 or 2 of organoid differentiation (Fig. 1 lC-1 IE).
- outer segment-like structures were less developed at stage 3 in patient stem cell-derived organoids compared to the control (Fig. 12A, 12B).
- Immunostaining showed the presence of CRX and Recoverin, but severely diminished Rhodopsin and L/M Opsin staining in CRX-K88N organoids (Fig. 12C).
- CRX-K88N organoids showed a similar phenotype to CRX- I138fs, and AAV gene therapy was able to restore expression of CRX target genes.
- the disclosed methods of treatment can be tested in animal models of autosomal domain retinopathies.
- High conservation of CRX led to study of model organisms as a means of elucidating its roles in humans.
- Drosophila a single homologue otd functions similarly to OTX2 and CRX in development of fly photoreceptors.
- OTX2 as well as CRX expression can rescue specific defects in otd mutant flies suggesting overlapping yet distinct compensation of the fly gene product.
- CRX mutants identified at NIH did not rescue the mutant phenotype (Terrell et al., Dev Dyn, 241, 215-228), instead showed strong detrimental effect on fly photoreceptor development demonstrating conserved antimorphic activity of this mutant CRX protein.
- Several mouse models and one cat model of CRX retinopathies have been developed and characterized. The first model was a deletion of Crx coding sequence in Crx knockout mice. These animals lack CRX expression completely and therefore model loss of CRX function in the retina.
- AAV5 vector-mediated expression of Crx driven by 2kb mouse Crx promoter element improved histological abnormalities and partially restored light-evoked visual responses measured for cone photoreceptors (Watanabe et al., PloS one, 8, e54146). Transplantation of stem-cell derived developing photoreceptors was tested in this model with some positive results, although the extent of rescue was relatively small with this approach (Homma et al., Stem Cells, 31, 1149-1159; Lamba et al., Cell Stem Cell, 4, 73-79).
- E168d2 mouse knock-in contains a two base-pair deletion resulting in a truncation of CRX trans activation domain (Tran et al., PLoS Genet, 10, el004111). Heterozygous E168d2 mice show functional impairments and show a significant reduction in numbers of cone photoreceptors at 1 month of age. Rod degeneration occurs later with majority of these cells lost by 6 months of age. Gene expression analysis revealed significant alterations in expression patterns of genes associated with phototransduction. Another model of severe autosomal dominant CRX- LCA is the Crx Rip mouse mutant (Roger et al., J Clin Invest, 124, 631-643).
- This mouse strain carries a frameshift deletion G255dl leading to a 133 amino-acid non-homologous stretch of residues at the C terminus of the protein.
- Crx ⁇ protein does not bind to DNA and disrupts activation of Nrl expression by Otx2.
- Crx Rip mutant mice As a consequence, there are major gene expression changes in Crx Rip mutant mice and their developmental phenotype is more severe than that of Crx knockout mice.
- Visual function is absent from birth as measured by electroretinogram in Crx ⁇ heterozygous mice, mimicking human autosomal dominant CRX- LCA clinical phenotype.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Biophysics (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Epidemiology (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Ophthalmology & Optometry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2022540642A JP7703543B2 (ja) | 2020-01-17 | 2021-01-15 | Crx常染色体優性網膜症の処置のための遺伝子治療 |
| US17/789,729 US20230066585A1 (en) | 2020-01-17 | 2021-01-15 | Gene therapy for treatment of crx-autosomal dominant retinopathies |
| CA3165922A CA3165922A1 (en) | 2020-01-17 | 2021-01-15 | Gene therapy for treatment of crx-autosomal dominant retinopathies |
| EP21705324.8A EP4090381A1 (en) | 2020-01-17 | 2021-01-15 | <smallcaps/>? ? ?crx-? ? ? ? ?gene therapy for treatment ofautosomal dominant retinopathies |
| AU2021208631A AU2021208631A1 (en) | 2020-01-17 | 2021-01-15 | Gene therapy for treatment of CRX-autosomal dominant retinopathies |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202062962732P | 2020-01-17 | 2020-01-17 | |
| US62/962,732 | 2020-01-17 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2021146625A1 true WO2021146625A1 (en) | 2021-07-22 |
Family
ID=74595396
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2021/013733 Ceased WO2021146625A1 (en) | 2020-01-17 | 2021-01-15 | Gene therapy for treatment of crx-autosomal dominant retinopathies |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US20230066585A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4090381A1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP7703543B2 (cg-RX-API-DMAC7.html) |
| AU (1) | AU2021208631A1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA3165922A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2021146625A1 (cg-RX-API-DMAC7.html) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023199036A1 (en) * | 2022-04-11 | 2023-10-19 | Mogrify Limited | Cell conversion |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022217142A1 (en) * | 2021-04-09 | 2022-10-13 | Washington University | Compositions and methods for treatment of crx-linked retinopathies |
Citations (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4458066A (en) | 1980-02-29 | 1984-07-03 | University Patents, Inc. | Process for preparing polynucleotides |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US5091309A (en) | 1986-01-16 | 1992-02-25 | Washington University | Sindbis virus vectors |
| US5217879A (en) | 1989-01-12 | 1993-06-08 | Washington University | Infectious Sindbis virus vectors |
| US5443505A (en) | 1993-11-15 | 1995-08-22 | Oculex Pharmaceuticals, Inc. | Biocompatible ocular implants |
| US5478745A (en) | 1992-12-04 | 1995-12-26 | University Of Pittsburgh | Recombinant viral vector system |
| US5869079A (en) | 1995-06-02 | 1999-02-09 | Oculex Pharmaceuticals, Inc. | Formulation for controlled release of drugs by combining hydrophilic and hydrophobic agents |
| US6251090B1 (en) | 1994-12-12 | 2001-06-26 | Robert Logan Avery | Intravitreal medicine delivery |
| US6299895B1 (en) | 1997-03-24 | 2001-10-09 | Neurotech S.A. | Device and method for treating ophthalmic diseases |
| US6413540B1 (en) | 1999-10-21 | 2002-07-02 | Alcon Universal Ltd. | Drug delivery device |
| US6416777B1 (en) | 1999-10-21 | 2002-07-09 | Alcon Universal Ltd. | Ophthalmic drug delivery device |
| WO2003033027A2 (en) | 2001-10-19 | 2003-04-24 | University Of Strathclyde | Dendrimers for use in targeted delivery |
| US6699493B2 (en) | 2000-11-29 | 2004-03-02 | Oculex Pharmaceuticals, Inc. | Method for reducing or preventing transplant rejection in the eye and intraocular implants for use therefor |
| US6780324B2 (en) | 2002-03-18 | 2004-08-24 | Labopharm, Inc. | Preparation of sterile stabilized nanodispersions |
| US20050054567A1 (en) | 2001-11-06 | 2005-03-10 | Rowlinson Scott William | Use of il-19,il-22 and il-24 to treat hematopoietic disorders |
| US20090175953A1 (en) | 2006-07-13 | 2009-07-09 | Doris Angus | Nanodispersions |
| WO2011034947A2 (en) * | 2009-09-15 | 2011-03-24 | University Of Washington | Reagents and methods for modulating cone photoreceptor activity |
| US20110229971A1 (en) | 2008-01-29 | 2011-09-22 | Applied Genetic Technologies Corporation | Recombinant virus production using mammalian cells in suspension |
| US20120100606A1 (en) | 2009-04-02 | 2012-04-26 | Sergei Zolotukhin | Inducible System for Highly Efficient Production of Recombinant Adeno-Associated Virus (rAAV) Vectors |
| US20120135515A1 (en) | 2003-05-21 | 2012-05-31 | Guang Qu | Methods for producing preparations of recombinant aav virions substantially free of empty capsids |
| US20120219528A1 (en) | 1998-12-03 | 2012-08-30 | Sista Hema S | Excipients for use in adeno-associated virus pharmaceutical formulations, and pharmaceutical formulations made therewith |
| US20130072548A1 (en) | 2010-01-28 | 2013-03-21 | John Fraser Wright | Scalable Manufacturing Platform for Viral Vector Purification and Viral Vectors So Purified for Use in Gene Therapy |
| US20140037585A1 (en) | 2011-02-14 | 2014-02-06 | The Children's Hospital Of Philadelphia | AAV8 Vector with Enhanced Functional Activity and Methods of Use Thereof |
| US8692332B2 (en) | 2010-01-14 | 2014-04-08 | United Microelectronics Corp. | Strained-silicon transistor and method of making the same |
| US20150259395A1 (en) | 2014-03-17 | 2015-09-17 | Avalanche Biotechnologies, Inc. | Compositions and methods for enhanced gene expression in cone cells |
| WO2018172961A1 (en) * | 2017-03-21 | 2018-09-27 | Ludwig-Maximilians-Universität München | Gene therapy for the treatment of cngb1-linked retinitis pigmentosa |
| WO2019122425A1 (en) * | 2017-12-21 | 2019-06-27 | Fondazione Telethon | Ectopically expressed transcription factors and uses thereof |
| WO2020182722A1 (en) * | 2019-03-08 | 2020-09-17 | Universite Paris-Saclay | Improved therapeutic method for rare ocular diseases by gene replacement |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002082904A2 (en) * | 2001-04-13 | 2002-10-24 | The Trustees Of The University Of Pennsylvania | Method of treating or retarding the development of blindness |
| MX367100B (es) * | 2012-02-17 | 2019-08-05 | The Children´S Hospital Of Philadelphia | Composiciones del vector aav y metodos para su transferencia genetica a celulas, organos y tejidos. |
| US20190345516A1 (en) * | 2018-03-12 | 2019-11-14 | Musc Foundation For Research Development | Methods for treating eye disease |
-
2021
- 2021-01-15 JP JP2022540642A patent/JP7703543B2/ja active Active
- 2021-01-15 US US17/789,729 patent/US20230066585A1/en active Pending
- 2021-01-15 AU AU2021208631A patent/AU2021208631A1/en active Pending
- 2021-01-15 WO PCT/US2021/013733 patent/WO2021146625A1/en not_active Ceased
- 2021-01-15 EP EP21705324.8A patent/EP4090381A1/en active Pending
- 2021-01-15 CA CA3165922A patent/CA3165922A1/en active Pending
Patent Citations (30)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4458066A (en) | 1980-02-29 | 1984-07-03 | University Patents, Inc. | Process for preparing polynucleotides |
| US5091309A (en) | 1986-01-16 | 1992-02-25 | Washington University | Sindbis virus vectors |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US4683195B1 (cg-RX-API-DMAC7.html) | 1986-01-30 | 1990-11-27 | Cetus Corp | |
| US5217879A (en) | 1989-01-12 | 1993-06-08 | Washington University | Infectious Sindbis virus vectors |
| US5478745A (en) | 1992-12-04 | 1995-12-26 | University Of Pittsburgh | Recombinant viral vector system |
| US5443505A (en) | 1993-11-15 | 1995-08-22 | Oculex Pharmaceuticals, Inc. | Biocompatible ocular implants |
| US5766242A (en) | 1993-11-15 | 1998-06-16 | Oculex Pharmaceuticals, Inc. | Biocompatible ocular implants |
| US6251090B1 (en) | 1994-12-12 | 2001-06-26 | Robert Logan Avery | Intravitreal medicine delivery |
| US5869079A (en) | 1995-06-02 | 1999-02-09 | Oculex Pharmaceuticals, Inc. | Formulation for controlled release of drugs by combining hydrophilic and hydrophobic agents |
| US6299895B1 (en) | 1997-03-24 | 2001-10-09 | Neurotech S.A. | Device and method for treating ophthalmic diseases |
| US20120219528A1 (en) | 1998-12-03 | 2012-08-30 | Sista Hema S | Excipients for use in adeno-associated virus pharmaceutical formulations, and pharmaceutical formulations made therewith |
| US6413540B1 (en) | 1999-10-21 | 2002-07-02 | Alcon Universal Ltd. | Drug delivery device |
| US6416777B1 (en) | 1999-10-21 | 2002-07-09 | Alcon Universal Ltd. | Ophthalmic drug delivery device |
| US6699493B2 (en) | 2000-11-29 | 2004-03-02 | Oculex Pharmaceuticals, Inc. | Method for reducing or preventing transplant rejection in the eye and intraocular implants for use therefor |
| WO2003033027A2 (en) | 2001-10-19 | 2003-04-24 | University Of Strathclyde | Dendrimers for use in targeted delivery |
| US20050054567A1 (en) | 2001-11-06 | 2005-03-10 | Rowlinson Scott William | Use of il-19,il-22 and il-24 to treat hematopoietic disorders |
| US6780324B2 (en) | 2002-03-18 | 2004-08-24 | Labopharm, Inc. | Preparation of sterile stabilized nanodispersions |
| US20120135515A1 (en) | 2003-05-21 | 2012-05-31 | Guang Qu | Methods for producing preparations of recombinant aav virions substantially free of empty capsids |
| US20090175953A1 (en) | 2006-07-13 | 2009-07-09 | Doris Angus | Nanodispersions |
| US20110229971A1 (en) | 2008-01-29 | 2011-09-22 | Applied Genetic Technologies Corporation | Recombinant virus production using mammalian cells in suspension |
| US20120100606A1 (en) | 2009-04-02 | 2012-04-26 | Sergei Zolotukhin | Inducible System for Highly Efficient Production of Recombinant Adeno-Associated Virus (rAAV) Vectors |
| WO2011034947A2 (en) * | 2009-09-15 | 2011-03-24 | University Of Washington | Reagents and methods for modulating cone photoreceptor activity |
| US8692332B2 (en) | 2010-01-14 | 2014-04-08 | United Microelectronics Corp. | Strained-silicon transistor and method of making the same |
| US20130072548A1 (en) | 2010-01-28 | 2013-03-21 | John Fraser Wright | Scalable Manufacturing Platform for Viral Vector Purification and Viral Vectors So Purified for Use in Gene Therapy |
| US20140037585A1 (en) | 2011-02-14 | 2014-02-06 | The Children's Hospital Of Philadelphia | AAV8 Vector with Enhanced Functional Activity and Methods of Use Thereof |
| US20150259395A1 (en) | 2014-03-17 | 2015-09-17 | Avalanche Biotechnologies, Inc. | Compositions and methods for enhanced gene expression in cone cells |
| WO2018172961A1 (en) * | 2017-03-21 | 2018-09-27 | Ludwig-Maximilians-Universität München | Gene therapy for the treatment of cngb1-linked retinitis pigmentosa |
| WO2019122425A1 (en) * | 2017-12-21 | 2019-06-27 | Fondazione Telethon | Ectopically expressed transcription factors and uses thereof |
| WO2020182722A1 (en) * | 2019-03-08 | 2020-09-17 | Universite Paris-Saclay | Improved therapeutic method for rare ocular diseases by gene replacement |
Non-Patent Citations (91)
| Title |
|---|
| "NCBI", Database accession no. NG_008605.1 |
| "Wisconsin Genetics Software Package", GENETICS COMPUTER GROUP, article "GAP, BESTFIT, FASTA, and TFASTA" |
| ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410 |
| ALTSCHUL ET AL., NATURE GENET., vol. 6, 1994, pages 119 |
| ALTSCHUL ET AL., NUCLEIC ACIDS RES, vol. 25, 1977, pages 3389 - 3402 |
| AMBATI ET AL., INVEST. OPHTHALMOL. VIS. SCI., vol. 41, 2000, pages 1186 - 1191 |
| ASSAWACHANANONT ET AL., HUMAN MOLECULAR GENETICS, vol. 27, pages 3555 - 3567 |
| AUSUBEL ET AL.: "Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology", 1999, WILEY & SONS |
| BEAUCAGE ET AL., TETRA. LETT., vol. 22, 1981, pages 1859 - 1862 |
| BEAUCAGECARUTHERS, TETRA. LETTS., vol. 22, no. 20, 1981, pages 1859 - 1862 |
| BERKNER, CUR. TOP. MICROBIOL. IMMUNOL., vol. 158, 1992, pages 39 - 6 |
| BERLINER ET AL., BIO TECHNIQUES, vol. 6, 1988, pages 616 - 629 |
| BLUYSSEN ET AL., PROC. NATL ACAD. SCI., vol. 92, 1995, pages 5645 - 5649 |
| BRANDYOPADHYAY ET AL., MOL. CELL BIOL., vol. 4, 1984, pages 1730 - 1737 |
| BREAKFIELD ET AL., MOL. NEUROBIOL., vol. 1, 1987, pages 337 - 371 |
| BUCHSCHALCHER ET AL., J. VIROL., vol. 66, 1992, pages 29522965 - 2739 |
| CHADDERTON ET AL., MOLECULAR THERAPY: THE JOURNAL OF THE AMERICAN SOCIETY OF GENE THERAPY, vol. 17, pages 593 - 599 |
| CORPET ET AL., NUCLEIC ACIDS RESEARCH, vol. 16, 1988, pages 10881 |
| DATABASE EMBL [online] 24 October 2002 (2002-10-24), "Homo sapiens cone rod homeobox protein (CRX) gene, promoter region and exon 1A.", XP055798359, retrieved from EBI accession no. EM_STD:AF335246 Database accession no. AF335246 * |
| DATABASE EMBL [online] 9 December 1997 (1997-12-09), "Homo sapiens cone rod homeobox protein (CRX) gene, complete cds.", XP055798347, retrieved from EBI accession no. EMBL:AF024711 Database accession no. AF024711 * |
| DAYABERNS, CLIN MICROBIOL REV, vol. 21, no. 4, 2008, pages 583 - 593 |
| DEN HOLLANDER ET AL., PROG RETIN EYE RES, vol. 27, pages 391 - 419 |
| DEVEREAUX ET AL., NUC. ACIDS RES., vol. 12, 1984, pages 387 - 395 |
| E. W. MARTIN: "Remington's Pharmaceutical Sciences", 1995, MACK PUBLISHING CO. |
| FADL ET AL., MOLECULAR VISION, vol. 26, 2020, pages 705 - 717 |
| FAGANAL-QURESHI, CLIN. EXPERIMENT. OPHTHALMOL., vol. 41, no. 5, 2013, pages 500 - 7 |
| FENGDOOLITTLE, J. MOL. EVOL., vol. 35, 1987, pages 351 - 360 |
| FINK ET AL., HUM. GENE THER., vol. 3, 1992, pages 11 - 19 |
| FRESSE ET AL., BIOCHEM. PHARMACOL., vol. 40, pages 2189 - 2199 |
| FREUND ET AL., CELL, vol. 91, 1997, pages 543 - 553 |
| FURAKAWA ET AL., NATURE GENETICS, vol. 18, 1998, pages 311 - 312 |
| FURUKAWA ET AL., CELL, vol. 91, pages 531 - 541 |
| FURUKAWA ET AL., NATURE GENETICS, vol. 23, pages 466 - 470 |
| GHOSH ET AL., GENE THER, vol. 13, no. 4, 2006, pages 321 - 329 |
| H. HERWEIJER ET AL., HUMAN GENE THERAPY, vol. 6, 1995, pages 1161 - 1167 |
| HENIKOFFHENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1989, pages 10915 |
| HIGGINSSHARP, CABIOS, vol. 5, 1989, pages 151 - 153 |
| HIGGINSSHARP, GENE, vol. 73, 1988, pages 237 |
| HITT ET AL., ADV IN VIRUS RES, vol. 55, 2000, pages 479 - 505 |
| HOMMA ET AL., STEM CELLS, vol. 31, pages 1149 - 1159 |
| HUANG ET AL., BIOCHEM BIOPHYS RES COMMUN, vol. 426, 2012, pages 498 - 503 |
| I. FROLOV ET AL., PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 11371 - 11377 |
| K. FISHER ET AL., J. VIROL., vol. 70, 1993, pages 520 - 532 |
| KANAZE ET AL., DRUG DEV. INDUS. PHARM., vol. 36, 2010, pages 292 - 301 |
| KANAZE ET AL., J. APPL. POLYMER SCI., vol. 102, 2006, pages 460 - 471 |
| KAYA ET AL., MOLECULAR VISION, vol. 25, pages 663 - 678 |
| KHANI ET AL., INVEST. OPTHAMOL. VIS. SCIENCE, vol. 48, 2007, pages 3954 - 3961 |
| KRUCZEK KAMIL ET AL: "Gene Therapy of Dominant CRX-Leber Congenital Amaurosis using Patient Stem Cell-Derived Retinal Organoids", STEM CELL REPORTS, vol. 16, no. 2, 28 January 2021 (2021-01-28), United States, pages 252 - 263, XP055797853, ISSN: 2213-6711, Retrieved from the Internet <URL:https://ars.els-cdn.com/content/image/1-s2.0-S2213671120305130-mmc4.pdf> DOI: 10.1016/j.stemcr.2020.12.018 * |
| LA SALLE ET AL., SCIENCE, vol. 259, 1993, pages 988 - 990 |
| LAMBA ET AL., CELL STEM CELL, vol. 4, pages 73 - 79 |
| LANE ET AL., STEM CELL REPORTS, 2020 |
| LEBKOWSKI ET AL., MOL. CELL. BIOL., vol. 8, 1988, pages 3988 - 3996 |
| LEWIN ET AL., NAT MED, vol. 4, pages 967 - 971 |
| MACKETT ET AL., BIOTECHNOLOGY, vol. 24, 1992, pages 495 - 499 |
| MADZAK ET AL., J. GEN. VIROL., vol. 73, 1992, pages 15331536 |
| MANN ET AL., J. VIROL., vol. 54, 1985, pages 401 - 407 |
| MARGOLSKEE, CURR. TOP. MICROBIOL. IMMUNOL., vol. 158, 1992, pages 67 - 123 |
| MILLER ET AL., MOL. CELL BIOL., vol. 5, 1985, pages 431 - 437 |
| MORROW ET AL., BMC NEUROSCI, vol. 6, pages 5 |
| MULLIS ET AL., COLD SPRING HARBOR SYMP. QUANT. BIOL., vol. 51, 1987, pages 263 |
| NARANG ET AL., METH. ENZYMOL., vol. 68, 1979, pages 109 - 151 |
| NEEDHAM-VANDEVANTER ET AL., NUCL. ACIDS RES., vol. 12, 1984, pages 6159 - 6168 |
| NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 |
| NICHOLS ET AL., HUM MUTAT, vol. 31, pages E1472 - 1483 |
| OCCELLI ET AL., INVESTIGATIVE OPHTHALMOLOGY & VISUAL SCIENCE, vol. 57, pages 3780 - 3792 |
| ON ET AL., GENE, vol. 89, 1990, pages 279 - 282 |
| O'REILLY ET AL., AMERICAN JOURNAL OF HUMAN GENETICS, vol. 81, pages 127 - 135 |
| PAGE ET AL., J. VIROL., vol. 64, 1990, pages 5370 - 5276 |
| PEARSONLIPMAN, PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444 |
| PEARSONLIPMAN, PROC. NAT'L. ACAD. SCI. USA, vol. 85, 1988, pages 2444 |
| PEYMAN ET AL., RETINA, vol. 29, no. 7, 2009, pages 875 - 912 |
| QUANTIN ET AL., PROC. NAD. ACAD. SCI. USA, vol. 89, 1992, pages 2581 - 2584 |
| ROGER ET AL., J CLIN INVEST, vol. 124, pages 631 - 643 |
| ROSENFELD ET AL., CELL, vol. 68, 1992, pages 143 - 155 |
| RUZYCKI ET AL., GENOME BIOLOGY, vol. 16, pages 171 |
| S. SCHLESINGER, TRENDS BIOTECHNOL, vol. 11, 1993, pages 18 - 22 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS |
| SAMULSKI ET AL., J. VIROL., vol. 61, 1987, pages 3096 - 3101 |
| SAMULSKI ET AL., J. VIROL., vol. 63, 1989, pages 3822 - 3828 |
| SATOSHI WATANABE ET AL: "Tropisms of AAV for Subretinal Delivery to the Neonatal Mouse Retina and Its Application for In Vivo Rescue of Developmental Photoreceptor Disorders", PLOS ONE, vol. 8, no. 1, 15 January 2013 (2013-01-15), pages e54146, XP055073336, DOI: 10.1371/journal.pone.0054146 * |
| SMITHWATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 |
| STRATFORD-PERRICAUDET ET AL., HUM. GENE THER., vol. 1, 1990, pages 241 - 256 |
| STRATFORD-PERRICAUDET ET AL., J. CLIN. INVEST., vol. 90, 1992, pages 626 - 630 |
| SWAIN ET AL., NEURON, vol. 19, 1997, pages 1329 - 1336 |
| TERRELL ET AL., DEV DYN, vol. 243, pages 1153 - 1166 |
| TESSITORE ET AL., MOLECULAR THERAPY : THE JOURNAL OF THE AMERICAN SOCIETY OF GENE THERAPY, vol. 14, pages 692 - 699 |
| TRAN ET AL., PLOS GENET, vol. 10, pages e1004111 |
| WATANABE ET AL., PLOS ONE, vol. 8, pages e54146 |
| WILKINSON ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 2233 - 2239 |
| WRIGHT ET AL., NAT REV GENET, vol. 11, pages 273 - 284 |
| ZHONG ET AL., NAT COMMUN, vol. 5, pages 4047 |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023199036A1 (en) * | 2022-04-11 | 2023-10-19 | Mogrify Limited | Cell conversion |
Also Published As
| Publication number | Publication date |
|---|---|
| US20230066585A1 (en) | 2023-03-02 |
| JP7703543B2 (ja) | 2025-07-07 |
| JP2023510186A (ja) | 2023-03-13 |
| AU2021208631A1 (en) | 2022-07-07 |
| EP4090381A1 (en) | 2022-11-23 |
| CA3165922A1 (en) | 2021-07-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11806369B2 (en) | Exosomes and miRNA to treat glaucoma | |
| EP3618841B1 (en) | Ocular applications of matrix bound vesicles (mbvs) | |
| JP2018506980A5 (cg-RX-API-DMAC7.html) | ||
| AU2017312499B2 (en) | Selective estrogen-receptor modulators (SERMs) confer protection against photoreceptor degeneration | |
| JP7703543B2 (ja) | Crx常染色体優性網膜症の処置のための遺伝子治療 | |
| MXPA06012915A (es) | Metodos y composiciones para el tratamiento de uveitis. | |
| EP3758736B1 (en) | Il-34 for use in a method of treating retinal inflammation and neurodegeneration | |
| US10512671B2 (en) | IL-24 to treat inflammatory diseases | |
| WO2025080770A1 (en) | Ocular applications of combination therapy using statins and matrix bound vesicles (mbvs) | |
| US20240207449A1 (en) | Compositions and methods for treatment of crx-mediated retinopathies | |
| US9731014B2 (en) | Use of SLURP1 as an imunomodulatory molecule in the ocular surface | |
| US20250001009A1 (en) | Therapy for programmed cell death in a subject transplanted with a donor liver carrying the pnpla3 rs738409:g variant | |
| WO2025221795A1 (en) | Growth and differentiation factor 15 for treatment of posterior capsular opacification | |
| HK40015124A (en) | Ocular applications of matrix bound vesicles (mbvs) | |
| HK40015124B (en) | Ocular applications of matrix bound vesicles (mbvs) | |
| EP4479097A1 (en) | Methods and pharmaceutical compositions for modulating tear film composition to treat corneal defects |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 21705324 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3165922 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2022540642 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2021208631 Country of ref document: AU Date of ref document: 20210115 Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2021705324 Country of ref document: EP Effective date: 20220817 |