WO2021136521A1

WO2021136521A1 - Polypeptide and use thereof

Info

Publication number: WO2021136521A1
Application number: PCT/CN2020/142229
Authority: WO
Inventors: 李利佳; 古想娣; 吴都; 郭林峰; 李晓平; 胡育龙; 李宇晟; 李玉; 许玲华; 李静; 陈小锋; 李文佳
Original assignee: 东莞市东阳光生物药研发有限公司
Priority date: 2020-01-02
Filing date: 2020-12-31
Publication date: 2021-07-08
Also published as: CN112574286A

Abstract

Disclosed is a polypeptide. The polypeptide has a modification at the N-terminus compared with polypeptides having the following amino acid sequences: (1) a polypeptide having the amino acid sequences represented by SEQ ID NOs: 1 to 6; or (2) a polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity to (1); or (3) a polypeptide with substitution, deletion and/or addition of one or more amino acids compared with (1), wherein the modification comprises at least one modification selected from addition, methylation, formylation, carbamylation, succinylation, cyclization, lysine propionylation, hexadecanoylation, myristylation, and acetylation of N-terminal amino acids. The polypeptide not only maintains the activity of BefA proteins to promote the proliferation of beta-cells, but also has the characteristics of higher stability and difficult degradation. Furthermore, the polypeptide also has the potential to lower glucose, promote weight loss, and protect the liver.

Description

Peptides and their applications

Priority information

The present invention requests the priority of the Chinese patent application filed with the State Intellectual Property Office of China on January 2, 2020, with the patent application number CN202010003240.2 and the application name "polypeptide and its application", and the entire content of which is incorporated by reference this invention.

Technical field

The present invention relates to the field of biomedicine. Specifically, the present invention relates to polypeptides and their applications. More specifically, the present invention relates to polypeptides, methods for improving BefA protein stability or preparing BefA protein mutants, fusion proteins, nucleic acids, recombinant cells and drugs The composition and its application in the field of metabolic diseases such as diabetes.

Background technique

The lack of insulin secreting cells has always been considered as one of the causes of type I diabetes. In Type I diabetes, the immune system mistakenly attacks and destroys beta cells. In recent years, researchers have found that the lack of functional β cells is also an important cause of type II diabetes, and the function of pancreatic islets in patients with type II diabetes gradually declines in the late stage. Therefore, the development of drugs that can increase the number of healthy β-cells is very important for solving the late stage of type I diabetes or type II diabetes, and is the main focus of diabetes research. At the same time, diabetic patients are often accompanied by metabolic syndromes such as obesity, fatty liver, and liver function impairment. Therefore, it is very necessary to develop drugs with more clinical benefits, such as weight loss and liver function protection drugs. The current hypoglycemic biologic drugs on the market mainly include: insulin and its analogs, GLP-1 and GLP-1 analogs, such as liraglutide and dulaglutide. The mechanism of action of insulin and its analogues is a direct supplementation of insulin (or analogues) for type I diabetes to achieve the effect of insulin lowering blood sugar, but there is a risk of hypoglycemia, and it does not reduce the weight of type 2 diabetes patients and protect liver function The role of. GLP-1 and its analogues are receptor agonists of GLP-1, which exert a hypoglycemic effect by stimulating the receptor of GLP-1. The mode of action of GLP-1 is to increase the secretion of insulin, inhibit the secretion of glucagon, delay gastric emptying, and reduce food intake. However, these drugs have a short half-life and have adverse gastrointestinal reactions such as nausea and vomiting. Although the above drugs can reduce blood sugar, they cannot completely reverse the damaged pancreatic islets. Patients often need long-term medication, which increases medical expenditure and reduces the patient's medication experience. Long-term medication may also lead to drug tolerance.

In order to improve the therapeutic effect of the existing hypoglycemic drugs and reduce the side effects, the development of drugs capable of improving or reversing the damaged islet tissue, and fundamentally reversing the development of diabetes, appears to be particularly critical. Drugs for the treatment of diabetes still need to be further developed.

Jennifer Hampton Hill et al. studied the development of early zebrafish larvae and found that the normal expansion of pancreatic β-cell population requires intestinal microbiota, and specific bacteria can restore the number of β-cells to a normal level. Experimental screening revealed that these bacteria share a previously undescribed protein named BefA (β-cell proliferation factor A). BefA protein can promote the activity of β-cell proliferation during the development of zebrafish larvae, so BefA protein was studied.

Summary of the invention

This application is based on the inventor's discovery and understanding of the following facts and problems:

In the prior art, BefA protein expressed by prokaryotic cells in vitro has the activity of promoting β cell proliferation, but BefA is easily degraded, and it is difficult to obtain high-purity and complete molecular weight BefA protein, which greatly limits the in vivo and in vitro drug efficacy research and clinical application of BefA protein. application. During the development process of BefA protein drugs, the research and development personnel of the present application were surprised and pleasantly surprised to find that the N-terminus of BefA protein was modified, including adding amino acids at the N-terminus, or making the N-terminus amino acids methylated, formylated, or carbamoyl. Acylation, succinylation, cyclization, propionylation, hexadecanoylation, tetradecylation and acetylation can greatly improve the stability of BefA protein. After purification, the purity of BefA protein can reach more than 95% and obtain The BefA protein mutant of has the activity of promoting the proliferation of β cells.

For this reason, in the first aspect of the present invention, the present invention proposes a polypeptide. According to an embodiment of the present invention, compared with the polypeptide having the following amino acid sequence, the N-terminal has a modification, and the modification includes an increase in the N-terminal amino acid, methylation, formylation, carbamylation, At least one of succinylation, cyclization, propionylation, hexadecanoylation, tetradecylation, and acetylation.

(1) A polypeptide having the amino acid sequence shown in SEQ ID NO: 1-6; or

(2) A polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity compared with (1); or

(3) Compared with (1), a polypeptide having one or more amino acid substitutions, deletions and/or additions.

The polypeptide according to the embodiment of the present invention maintains the activity of the BefA protein to promote β cell proliferation, and has higher stability than the polypeptide having the sequence (1), (2) or (3).

According to an embodiment of the present invention, the above-mentioned polypeptide may further include at least one of the following additional technical features:

According to an embodiment of the present invention, the increase of the N-terminal amino acid includes the addition of one or more amino acids at the N-terminal, and the added amino acid includes at least one of glycine, alanine, isoleucine, methionine, and valine. Acid, serine, threonine, glutamic acid, histidine or proline; preferably glycine, alanine, methionine, valine or isoleucine; more preferably glycine.

According to an embodiment of the present invention, the increase of the N-terminal amino acid is an increase of an amino acid at the N-terminal, and the amino acid is glycine, alanine, isoleucine, methionine, valine, serine, and threonine. Acid, glutamic acid, histidine or proline; preferably glycine, alanine, methionine, valine or isoleucine; more preferably glycine.

According to an embodiment of the present invention, the polypeptide has the amino acid sequence shown in SEQ ID NO:7.

The above-mentioned polypeptide having the amino acid sequence shown in SEQ ID NO: 7 according to the embodiment of the present invention has high stability, is not easy to be degraded, and the purity after purification can reach 99%.

In the second aspect of the present invention, the present invention proposes a method for improving the stability of BefA protein or preparing BefA protein mutants. According to an embodiment of the present invention, the N-terminus of the amino acid sequence of the BefA protein is modified, and the modification includes an increase in the N-terminus amino acid, methylation, formylation, carbamylation, succinylation, cyclization, At least one of propionylation, hexadecanoylation, tetradecylation and acetylation. The method according to the embodiment of the present invention greatly improves the stability of the BefA protein, and the prepared BefA protein mutant not only has high stability, but also maintains the activity of the BefA protein to significantly promote the proliferation of β cells.

According to an embodiment of the present invention, the above method may further include at least one of the following additional technical features:

According to an embodiment of the present invention, the BefA protein has an amino acid sequence shown in (1) SEQ ID NO: 1 to 6; or (2) compared with (1), it has at least 70%, at least 75%, at least 80%, At least 85%, at least 90%, at least 95%, or at least 99% identical; or (3) an amino acid sequence having one or more amino acid substitutions, deletions and/or additions compared to (1).

According to an embodiment of the present invention, adding one or more amino acids to the N-terminus of the BefA protein amino acid sequence can be achieved by gene cloning, so as to obtain BefA protein mutants. For example, those skilled in the art can pre-synthesize a nucleic acid capable of expressing a BefA protein mutant with one or more amino acids added to the N-terminus, and then introduce the nucleic acid into the recipient cell for expression, and obtain one or more amino acids added to the N-terminus. BefA protein mutants. According to another embodiment of the present invention, the BefA protein mutant can be further connected to a chaperone protein through a connecting peptide, and the connecting peptide is suitable for being cleaved by a protease, so as to form a free BefA protein mutant again. The BefA protein mutant is further connected to the chaperone protein through the connecting peptide, which can significantly increase the yield of the BefA protein mutant, but afterwards, the chaperone protein and the connecting peptide need to be completely excised under the action of a suitable protease to form a free one again. BefA protein mutant.

According to an embodiment of the present invention, adding one or more amino acids to the N-terminus of the BefA protein amino acid sequence can be achieved by gene cloning and restriction enzyme digestion, so as to obtain BefA protein mutants. For example, those skilled in the art can pre-synthesize nucleic acid capable of expressing the first BefA protein mutant with some amino acids at the N-terminus, and then introduce the nucleic acid into recipient cells for expression, to obtain the first protein mutant with some amino acids at the N-terminus. BefA protein mutant; the first BefA protein mutant is further connected to the chaperone protein through a connecting peptide. At this time, the chaperone protein and the connecting peptide need to be set at the N-terminus of the first BefA protein mutant, and the connecting peptide is suitable for protease Cleavage, and then under the action of suitable protease cleavage, the chaperone protein and part of the connecting peptide are excised, so as to retain some amino acids at the N-terminus of the first BefA protein mutant. At this time, the remaining part of the connecting peptide and The first part of the amino acids added by gene cloning together constitute the added amino acids at the N-terminus of BefA protein.

According to an embodiment of the present invention, adding one or more amino acids to the N-terminus of the amino acid sequence of the BefA protein can also be achieved by introducing restriction enzymes. For example, those skilled in the art can directly construct a fusion protein of a chaperone protein and the BefA protein, a connecting peptide is arranged between the chaperone protein and the BefA protein, and the N-terminal of the connecting peptide is connected to the C of the chaperone protein. The C-terminus of the connecting peptide is connected to the N-terminus of the BefA protein. The connecting peptide is suitable for being cleaved by a protease to form a free target protein. The BefA protein has one or more amino acids added, and the free target protein is the BefA protein mutant. That is to say, the amino acids added to the N-terminus of the free target protein are at least part of the amino acids on the connecting peptide. In other words, a new amino acid was introduced at the N-terminus of the BefA protein by introducing a connecting peptide with a restriction site.

According to the above-mentioned method of adding one or more amino acids to the N-terminus of the BefA protein amino acid sequence according to the embodiment of the present invention, at least one amino acid is successfully connected to the N-terminus of BefA protein.

According to an embodiment of the present invention, the chaperone protein includes at least one selected from maltose binding protein, CBP, GST, SUMO, Trx, and NusA. Optionally, the chaperone protein contains or does not contain a His tag and a Flag tag.

According to an embodiment of the present invention, the protease is cysteine protease, enterokinase, thrombin, factor Xa protease, human rhinovirus 3C protease, SUMO enzyme or KEX-2 of tobacco etch virus.

According to an embodiment of the present invention, the fusion protein has the amino acid sequence shown in SEQ ID NO: 8.

In the third aspect of the present invention, the present invention proposes a fusion protein. According to an embodiment of the present invention, the fusion protein includes a chaperone protein, a connecting peptide, and a BefA protein, the N-terminus of the connecting peptide is connected to the C-terminus of the chaperone protein, and the C-terminus of the connecting peptide is connected to the BefA protein. The connecting peptide is suitable for being cleaved by a protease to form a free BefA protein mutant. Compared with the BefA protein, the N-terminus of the free BefA protein mutant has one or more amino acids added. The fusion protein according to the embodiment of the present invention has a high expression level, and under the action of a suitable digestive enzyme, a BefA protein mutant with at least one amino acid added to the N-terminal can be successfully obtained.

According to an embodiment of the present invention, the fusion protein may further include at least one of the following additional technical features:

In the fourth aspect of the present invention, the present invention provides a nucleic acid. According to an embodiment of the present invention, the nucleic acid encodes the aforementioned polypeptide or the aforementioned fusion protein.

According to an embodiment of the present invention, the nucleic acid may further include at least one of the following additional technical features:

According to an embodiment of the present invention, the nucleic acid has the nucleotide sequence shown in SEQ ID NO: 9 or the nucleotide sequence shown in SEQ ID NO: 10.

The nucleic acid with the nucleotide sequence shown in SEQ ID NO: 9 encodes a polypeptide with the amino acid sequence shown in SEQ ID NO: 7, and the nucleic acid encoding with the nucleotide sequence shown in SEQ ID NO: 10 has SEQ ID NO : A fusion protein of the amino acid sequence shown in 8.

In the fifth aspect of the present invention, the present invention proposes a recombinant cell. According to an embodiment of the present invention, the recombinant cell carries the aforementioned nucleic acid. The recombinant cell according to the embodiment of the present invention can express the aforementioned polypeptide or fusion protein.

According to an embodiment of the present invention, the aforementioned recombinant cell may further include at least one of the following additional technical features:

According to an embodiment of the present invention, the recombinant cell is Escherichia coli, yeast or mammalian cell.

In the sixth aspect of the present invention, the present invention proposes a pharmaceutical composition. According to an embodiment of the present invention, the pharmaceutical composition includes the aforementioned polypeptide. The pharmaceutical composition according to the embodiment of the present invention can be used for the treatment or prevention of diabetes.

According to an embodiment of the present invention, the above-mentioned pharmaceutical composition may further include at least one of the following additional technical features:

According to an embodiment of the present invention, the pharmaceutical composition further includes a pharmaceutically acceptable auxiliary agent. Furthermore, the pharmaceutical composition can be prepared into a specific pharmaceutical preparation and administered to a patient in a specific manner.

In the seventh aspect of the present invention, the present invention proposes the use of the aforementioned polypeptide or the aforementioned pharmaceutical composition in the preparation of a medicine, which is used to promote the proliferation of β cells.

In the eighth aspect of the present invention, the present invention proposes the use of the aforementioned polypeptide or the aforementioned pharmaceutical composition in the preparation of medicines for treating or preventing diabetes or protecting liver function.

The BefA protein in the present invention refers to Beta Cell Expansion Factor A (Beta Cell Expansion Factor A, BefA).

Description of the drawings

Figure 1 is a schematic diagram of a recombinant expression plasmid pET28a-BefA according to an embodiment of the present invention;

Figure 2 is a schematic diagram of PCR identification of pET28a-BefA positive clones according to an embodiment of the present invention;

Figure 3 is a schematic diagram of a recombinant expression plasmid pET28a-MBP-BefA according to an embodiment of the present invention;

Figure 4 is a schematic diagram of PCR identification of pET28a-MBP-BefA positive clones according to an embodiment of the present invention;

Figure 5A is an SDS-PAGE profile of a BefA nickel column affinity chromatography sample according to an embodiment of the present invention;

Fig. 5B is a mass spectrometry test result of a BefA nickel column affinity chromatography sample according to an embodiment of the present invention;

Fig. 5C is an SDS-PAGE chart of a BefA ion exchange chromatography sample according to an embodiment of the present invention;

Fig. 6A is a schematic diagram of SDS-PAGE of BefA mutant according to an embodiment of the present invention;

Fig. 6B is a mass spectrometric detection result of BefA mutant according to an embodiment of the present invention;

Fig. 7 is a schematic diagram of BefA protein promoting the proliferation of INS-1 cells according to an embodiment of the present invention;

Fig. 8 is a schematic diagram of BefA mutant promoting the proliferation of INS-1 cells according to an embodiment of the present invention;

Fig. 9 is a curve of random blood glucose change in ob/ob mice after injection of BefA protein according to an embodiment of the present invention;

Fig. 10 is a curve of weight change of ob/ob mice after injection of BefA protein according to an embodiment of the present invention;

11 is a schematic diagram of the absolute weight of ob/ob mouse liver after injection of BefA protein according to an embodiment of the present invention;

Figure 12 is a schematic diagram of aspartate aminotransferase (AST) activity in ob/ob mice after injection of BefA protein according to an embodiment of the present invention;

Figure 13 is a schematic diagram of alanine aminotransferase (ALT) activity in ob/ob mice after injection of BefA protein according to an embodiment of the present invention;

14 is a schematic diagram of a random blood glucose change curve in db/db mice after injection of BefA protein mutant according to an embodiment of the present invention;

Fig. 15 is a curve of body weight change of db/db mice after injection of BefA protein mutant according to an embodiment of the present invention;

16 is a schematic diagram of the absolute weight of the liver of db/db mice after injection of BefA protein mutants according to an embodiment of the present invention;

Figure 17 is a schematic diagram of alanine aminotransferase (ALT) activity in db/db mice after injection of BefA protein mutants according to an embodiment of the present invention;

Figure 18 is a schematic diagram of the aspartate aminotransferase (AST) activity of db/db mice after injection of BefA protein mutants according to an embodiment of the present invention.

Detailed ways

The embodiments of the present invention are described in detail below, and examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary, and are intended to explain the present invention, but should not be construed as limiting the present invention.

It should be noted that, unless otherwise specified, the "peptide bond" in this application refers to the chemical bond between each amino acid when the amino acids are connected to form a protein, which is called a peptide bond. In other words, a peptide The bond is a chemical bond (-NH-CO-) formed by connecting the carboxyl group (-COOH) of one amino acid and the amino group (-NH _{2) of another amino acid when two amino acids are connected.} The end of a polypeptide that ends with a carboxyl group is called the C-terminus, and the end that ends with an amino group is called the N-terminus.

The "connection" or "connection" between the polypeptide and the polypeptide described in this application can be either a direct connection or an indirect connection. For example, when an indirect connection is used, the polypeptide and the polypeptide can be connected by short peptides or amino acids.

According to the amino acid sequence of the literature (Jennifer Hampton Hill, A conserved bacterial protein induces pancreatic beta cell expansion during zebrafish development, elifesciences, Dec. 2016), the BefA protein obtained by the recombinant engineering bacteria after inducing expression and purification is severely degraded.

The invention overcomes the above-mentioned problems of easy degradation of BefA protein and small application research range, and provides a method for preparing high-purity BefA protein. That is, by constructing a BefA fusion protein and designing a protease cleavage site in the fusion protein, it has a gene sequence shaped like an ABC structure, where A is the chaperone MBP (maltose binding protein) protein gene, and B is the encoding containing TEV (tobacco etch virus). The nucleotide sequence of the cysteine protease enzyme cleavage site and the connecting peptide, C is the BefA protein gene. After the recombinant engineered bacteria is induced to express, the fusion protein is purified and cleaved with TEV protease to obtain a BefA mutant with a glycine (G) at the N-terminal. The purified protein has a purity of more than 95% and is tested to have biological activity.

Both BefA protein and BefA mutant can promote the proliferation of INS-1 (rat insulinoma cells) to a certain extent in vitro. BefA protein can improve the liver function of ob/ob mice, and BefA mutant can improve db/db Liver function of mice.

Example 1 Construction of recombinant expression plasmid pET28a-BefA, pET28a-MBP-B

1. Full gene synthesis of β cell proliferation factor A (BefA), MBP chaperone protein

According to the literature (Jennifer Hampton Hill, A conserved bacterial protein induces pancreatic beta cell expansion during zebrafish development, elifesciences, Dec. 2016), the amino acid sequence of BefA secreted by the enterococcus gallinaru strain of human intestines (258aa in total), according to E. coli (BL21) (DE3)) optimize the nucleic acid sequence. At the same time, the restriction site in the sequence is strictly limited. A stop codon (TAA) is added to the 3'end of the sequence to obtain the coding gene BefA, which is finally handed over to the gene synthesis company for full gene synthesis (pUC57-BefA).

The MBP chaperone gene and encoding contain TEV (Cysteine Protease of Tobacco Etch Virus) restriction site and connecting peptide (425aa in total). The nucleic acid sequence is optimized according to the optimization principle of Escherichia coli (BL21(DE3)), Obtain the coding gene MBP, and finally give it to the gene synthesis company for full gene synthesis (pET28a-MBP).

2. Construction of recombinant pET28a-BefA expression strain

Using the synthetic plasmid pUC57-BefA as a template, the upstream primer F1: GCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGAAGATCCGTTTTCTGG, containing the XbaI restriction site; the downstream primer R1: CCGCTCGAGTT AATGGTGATGATGATGATGAC, containing the XhoI Hi restriction tag site and 6×His restriction site. Add other reaction solution for PCR, and amplify fragment A (844bp) containing BefA. Fragment A was digested with XhoI and XbaI to obtain fragment B (792bp). Fragment B was ligated with the vector fragment (5236bp) recovered from pET28a plasmid by XhoI and XbaI digestion to obtain plasmid pET28a-BefA, as shown in Figure 1. The plasmid pET28a-BefA was transformed into E. coli BL21 (DE3) by chemical transformation method. The clones were screened for resistance on the Kana antibiotic plate, and the selected clones were amplified by PCR using primers F1 and R1 as templates to obtain a DNA fragment consistent with the theoretical size (792bp), as shown in Figure 2. Using the two ends of the BefA gene fragment to design primers for sequencing, the sequencing results showed that the cloned gene fragment was consistent with the theory.

3. Construction of recombinant pET28a-MBP-BefA expression strain

Using the synthetic plasmid pET28a-MBP as a template, the upstream primer F2: CATGCCATGGAAATAAAAACAGGTGCACG, containing the NcoI restriction site; the downstream primer R2: GCTTTCACTTTTGCCCAATCTCCCTGAAAATACAGGTTTT. Add other reaction solution for PCR, and amplify fragment B (1301bp) containing MBP, using synthetic plasmid pUC57-BefA as template, using upstream primer F3: AAAACCTGTATTTTCAGGGAGATTGGGCAAAAGTGAAAGC, downstream primer R3: CCGCTCGAGTTAACGGGTCAGATCTTTAT, containing XhoI restriction site. Add other reaction solution for PCR, and amplify fragment C (743bp) containing BefA. Using the fragment B and fragment C obtained by PCR amplification as templates, the upstream primer F2, the downstream primer R3 are added to other reaction solutions to perform Overlap PCR, and a fragment (about 2000 bp) containing MBP-BefA is amplified. Fragment MBP-BefA is ligated with the vector fragment (5231bp) recovered by double digestion with NcoI and XhoI from pET28a plasmid to obtain plasmid pET28a-MBP-BefA, as shown in Figure 3. The plasmid pET28a-MBP-BefA was transformed into E. coli BL21(DE3) by chemical transformation method, and the clones were screened for resistance on the Kana antibiotic plate. The selected clones were amplified by PCR with primers F2 and R3 as templates, and The DNA fragments of the theoretical size are shown in Figure 4. The two ends of the MBP-BefA gene fragment were used to design primers for sequencing. The sequencing results showed that the cloned gene fragment was consistent with the theory.

Example 2 Expression and production of BefA/BefA mutants by engineered cells

1. Shake bottle fermentation of BefA/MBP-BefA protein

Inoculate the glycerol tube of positive strains obtained by screening and identification into 5mL LB liquid medium containing 50μg/mL kanamycin at 0.2% inoculum, and activate overnight at 37°C at 250rpm; inoculate with 2% inoculum to contain 50μg/mL In a 2000mL Erlenmeyer flask of Kanamycin LB liquid medium, the volume of 20%, 37℃250rpm culture to OD ₆₀₀ =0.6～0.8, add IPTG to a final concentration of 1mM, 37℃250rpm to induce expression for 4～6h; The fermentation broth was centrifuged (8000rpm 10min), and the bacteria were collected. After the cells are resuspended in purified water, the cells are crushed (ultrasonic or homogenized), and the crushed liquid is centrifuged at low temperature and high speed (12000 rpm, 30 min, 4° C.), and the supernatant is obtained for purification.

2. Purification of BefA protein

The BefA protein uses nickel column affinity chromatography and ion exchange chromatography, and the BefA protein has been degraded, and no high purity BefA protein can be obtained.

Method 1: The specific purification steps of BefA crushing liquid supernatant nickel column affinity chromatography are as follows:

HisTrap FF column (GE) uses 5 column volumes of 20mM～50mM Tris, pH7.0～8.5, 100mM～200mM NaCl buffer to wash the column, and transfer the supernatant of the broken solution to the column, use 20mM～50mM Tris, pH7.0～ 8.5, 100mM～200mM NaCl, 30mM imidazole buffer to wash away unbound impurities, and then use 20mM～50mM Tris, pH7.0～8.5, 0～200mM NaCl, 50mM～500mM imidazole buffer to elute the target protein.

The samples obtained by affinity chromatography on the nickel column were subjected to SDS-PAGE detection and MS analysis. The results are shown in Figure 5A and Figure 5B and Table 1 below. According to the results of SDS-PAGE in Figure 5A, it can be seen that in addition to the main band (26KD), the purified sample has some miscellaneous bands. According to Figure 5B, it can be seen that the molecular weight of the main peak is 26489, which is consistent with the theoretical molecular weight of BefA protein, indicating the purification. The main component of the obtained sample is BefA protein. According to Table 1, it can be seen that the BefA protein in the purified sample accounts for about 66%, and most of the rest are BefA protein degradation products. It shows that the use of nickel column affinity chromatography failed to obtain high-purity BefA protein.

Table 1:

Method 2: The specific purification steps of BefA crushed liquid supernatant cation exchange chromatography are as follows:

SP550C (Borgron) uses 5 column volumes of 20mM-50mM acetic acid-sodium acetate, pH3.0-5.0 buffer to wash the column, and the cell is resuspended in 20mM-50mM acetic acid-sodium acetate, pH3.0-5.0 buffer After crushing, the supernatant of the crushed solution was applied to the column, and the unbound impurities were washed away with 20mM-50mM acetic acid-sodium acetate, pH3.0-5.0, 100mM-500mM NaCl buffer, imidazole buffer, and 20mM-50mM acetic acid-sodium acetate , PH3.0～5.0, 500mM～1M NaCl buffer to elute the target protein. The sample obtained by ion exchange chromatography was tested by SDS-PAGE, and the result is shown in Figure 5C.

According to Figure 5C, it can be seen that in addition to the main band (about 25KD), there are more miscellaneous bands in the sample obtained by ion exchange chromatography, indicating that the purity of the purified BefA protein is low, which cannot be obtained by ion exchange chromatography. High purity BefA protein. It shows that BefA protein has poor stability.

3. Purification of MBP-BefA protein mutants

The supernatant of the MBP-BefA crushed liquid was subjected to affinity chromatography-enzyme digestion-affinity chromatography-two-ion exchange chromatography to obtain BefA mutants. The results are shown in Figure 6. The specific purification steps are as follows:

(1) Affinity chromatography one

HisTrap FF column (GE) uses 5 column volumes of 20mM-50mM Tris, pH 7.0-8.5, 0-200mM NaCl buffer to wash the column, and transfer the MBP-BefA crushing liquid supernatant to the column, use 20mM-50mM Tris, pH7 .0～8.5, 0～200mM NaCl, 10～100mM imidazole buffer to wash away unbound impurities, and then use 20mM～50mM Tris, pH7.0～8.5, 0～200mM NaCl, 200mM～500mM imidazole buffer to remove the target protein MBP-BefA eluted. The MBP-BefA protein was dialyzed and changed to 20mM-50mM Tris, pH7.4-8.5 buffer.

(2) TEV enzyme digestion

1mg recombinant TEV protease can completely cleave 100mg MBP-BefA fusion protein at 4℃～30℃, 20mM～50mM Tris, pH7.0～8.5, 0～0.5mM EDTA, 0～1M DTT for 4～15h.

(3) Nickel column affinity chromatography 2

HisTrap FF column (GE) uses 5 column volumes of 20 mM-50 mM Tris, pH 7.0-8.5 buffer to wash the column, apply MBP-BefA digestion sample to the column, and collect the penetrating solution for ion exchange chromatography.

(4) Ion exchange chromatography

Q Sepharose FF (Borgron) uses 5 column volumes of 20mM-50mM Tris, pH7.0-8.5 buffer to wash the column, put the affinity chromatography two penetrating solution on the column, and collect the penetrating solution to obtain BefA mutant . The results of SDS-PAGE detection and MS analysis of the purified sample are shown in Figures 6A and 6B and Table 2.

According to the results of SDS-PAGE in Figure 6A, it can be seen that the purified sample (about 25KD) has only one band, indicating that the purity of the protein obtained is very high; according to Figure 6B, it can be seen that the molecular weight of the purified sample is 25724, which is similar to the BefA mutation. The theoretical molecular weight is consistent, indicating that the purified sample is a BefA mutant; according to Table 2, it can be seen that the purified BefA mutant has a purity of about 99%.

Conclusion: Compared with BefA protein, the purified BefA protein mutant has less degradation and higher protein purity. It shows that the BefA protein mutant has better stability.

Table 2:

Example 3 Activity detection of BefA and BefA mutants

1. INS-1 cell proliferation experiment

INS-1 (rat islet cell tumor cells) cells were ^{plated at 3*10 4} to 6*10 ⁴ cells/mL at 100 μL/well to a 96-well plate, and _{cultured at 37°C, 5% CO 2 for} 48 hours. Change the medium to sugar-free 1640+0.1% BSA, starve for 24h. The starvation medium was discarded, and the BefA protein (or BefA modification of BefA mutant BefA modification) ^{diluted to 10 -9} M to 10 ^-7 M was added with 1640+1% FBS medium to stimulate, 100 μL/well. Incubate at 37°C with 5% CO _{2 for} 72 hours. After adding CCK8 reagent, 10μL/well, 37°C, 5% CO ₂ incubator for 2 hours, the OD _{450 was} detected. The results are shown in Figure 7-8. Both BefA protein and BefA mutant can significantly promote the proliferation of INS-1 cells.

2. Mice efficacy experiment

(1) Pharmacodynamic experiment of BefA protein ob/ob mice

Ob/ob mice were divided into 2 groups, 8 animals in each group, and 30 mg/kg BefA protein and PBS buffer were injected subcutaneously once a day for 4 weeks. Oral sugar was administered on the 7th day of administration. Tolerance OGTT test, that is, animals are fasted for 16h, and glucose 2g/kg is given by gavage at the same time of D7 administration. The blood glucose level of animals is measured before glucose administration and 15min, 30min, 1h and 2h after glucose administration. During the experiment, the change of animal body weight was monitored. On the day of the end of the experiment, blood was collected from the animal to prepare plasma to detect the plasma ALT/AST level, and the animal was dissected and its liver was weighed. The effect of BefA protein on the glucose tolerance, body weight, liver weight, liver index ALT and AST of ob/ob mice is shown in Figure 9-13. The results in Figure 9 show that the test results show that BefA protein can significantly reduce the blood glucose level after glucose administration and improve glucose tolerance; the results of Figures 10-11 show that BefA protein has a significant effect on reducing the body weight of ob/ob mice on different days. And it also has a significant reduction effect on the absolute weight of the liver; the results of Figures 12-13 show that the BefA protein significantly reduces the liver function indexes ALT and AST of ob/ob mice.

(2) Pharmacodynamic experiment of BefA mutant db/db mice

Spontaneously diabetic db/db mice were divided into 2 groups, 8 animals in each group, were injected subcutaneously with 30 mg/kg of BefA mutant and the control group were injected with PBS buffer subcutaneously for 4 weeks, of which the administration was tested on the first day of the experiment Random blood glucose before and 1, 2, 4, 6, 8 and 24h after administration. During the experiment, the change of animal body weight was monitored. On the day of the end of the experiment, blood was collected from the animal to prepare plasma to detect the plasma ALT/AST level. See Figure 14-18. The results in Figure 14 show that the BefA mutant can significantly reduce the animal's random blood glucose levels 4-6h after the administration on the first day of administration; the results in Figures 15-16 show that the BefA mutant has a certain reduction in the body weight of db/db mice Trend, has a significant reduction effect on the absolute weight of the liver; Figure 17-18 results show: BefA mutants have a significant reduction in the liver function indexes ALT and AST of db/db mice.

Conclusion: Both BefA protein and BefA mutants can significantly promote the proliferation of INS-1 cells, significantly reduce blood sugar or improve glucose tolerance; BefA protein and BefA mutants can reduce body weight or have a tendency to reduce weight; BefA protein and BefA mutants are both It can lower the absolute liver of animals and lower the level of liver ALT/AST. Both BefA protein and BefA mutants can lower blood sugar, reduce body weight and have liver function protection functions, that is, BefA mutants retain the pharmacological activity of BefA protein.

In the description of this specification, descriptions with reference to the terms "one embodiment", "some embodiments", "examples", "specific examples", or "some examples" etc. mean specific features described in conjunction with the embodiment or example , Structures, materials or features are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the described specific features, structures, materials or characteristics can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine the different embodiments or examples and the features of the different embodiments or examples described in this specification without contradicting each other.

Although the embodiments of the present invention have been shown and described above, it can be understood that the above-mentioned embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can comment on the above-mentioned embodiments within the scope of the present invention. The embodiment undergoes changes, modifications, substitutions, and modifications.

Claims

A polypeptide characterized in that, compared with a polypeptide having the following amino acid sequence, the N-terminal has a modification, and the modification includes an increase in N-terminal amino acid, methylation, formylation, carbamoyl At least one of succinylation, cyclization, propionylation, hexadecanoylation, tetradecylation and acetylation,

(1) A polypeptide having the amino acid sequence shown in SEQ ID NO: 1-6; or

(2) A polypeptide having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity compared with (1); or

(3) Compared with (1), a polypeptide having one or more amino acid substitutions, deletions and/or additions.
The polypeptide according to claim 1, wherein the increase of the N-terminal amino acid includes the addition of one or more amino acids at the N-terminal, and the added amino acid includes at least one of glycine, alanine, isoleucine, and methyl. Thionine, valine, serine, threonine, glutamic acid, histidine or proline; preferably glycine, alanine, methionine, valine or isoleucine; more preferably glycine .
The polypeptide according to claim 1 or 2, wherein the increase in the N-terminal amino acid is an increase in the N-terminal amino acid, and the amino acid is glycine, alanine, isoleucine, methionine, Valine, serine, threonine, glutamic acid, histidine or proline; preferably glycine, alanine, methionine, valine or isoleucine; more preferably glycine.
The polypeptide according to any one of claims 1-3, wherein the polypeptide has the amino acid sequence shown in SEQ ID NO:7.
A method for improving the stability of BefA protein or preparing BefA protein mutants, characterized in that the N-terminus of the amino acid sequence of BefA protein is modified, and the modification includes an increase in N-terminus amino acid, methylation, and formylation. , At least one of carbamylation, succinylation, cyclization, propionylation, hexadecanoylation, tetradecylation and acetylation.
The method of claim 5, wherein the BefA protein has

(1) SEQ ID NO: the amino acid sequence shown in 1-6; or

(2) A sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% identity compared with (1); or

(3) Compared with (1), an amino acid sequence having one or more amino acid substitutions, deletions and/or additions.
The method according to claim 5, wherein the increase of the N-terminal amino acid comprises the addition of one or more amino acids at the N-terminal, and the added amino acid includes at least one of glycine, alanine, isoleucine, and methyl. Thionine, valine, serine, threonine, glutamic acid, histidine or proline; preferably glycine, alanine, methionine, valine or isoleucine; more preferably glycine .
The method according to claim 7, wherein the increase of the N-terminal amino acid is an increase of an amino acid at the N-terminal, and the amino acid is glycine, alanine, isoleucine, methionine, and valine. Acid, serine, threonine, glutamic acid, histidine or proline; preferably glycine, alanine, methionine, valine or isoleucine; more preferably glycine.
A fusion protein, characterized in that the fusion protein comprises a chaperone protein, a connecting peptide and a BefA protein, the N-terminus of the connecting peptide is connected to the C-terminus of the chaperone protein, and the C-terminus of the connecting peptide is connected to the C-terminus of the chaperone protein. The N-terminus of the BefA protein is connected, and the connecting peptide is suitable for being cleaved by a protease to form a free BefA protein mutant. Compared with the BefA protein, the N-terminus of the free BefA protein mutant is increased by one or more amino acids. .
The fusion protein of claim 9, wherein the chaperone protein comprises at least one selected from the group consisting of maltose binding protein, CBP, GST, SUMO, Trx, and NusA, optionally, the chaperone protein contains or does not Contains His tag and Flag tag;

Optionally, the protease is cysteine protease of tobacco etch virus, enterokinase, thrombin, factor Xa protease, human rhinovirus 3C protease, SUMO enzyme or KEX-2;

Optionally, the fusion protein has the amino acid sequence shown in SEQ ID NO: 8.
A nucleic acid characterized in that it encodes the polypeptide according to any one of claims 1 to 4 or the fusion protein according to any one of claims 9 to 10.
The nucleic acid according to claim 11, wherein the nucleic acid has the nucleotide sequence shown in SEQ ID NO: 9 or the nucleotide sequence shown in SEQ ID NO: 10.
A recombinant cell characterized by carrying the nucleic acid according to claim 11 or 12.
The recombinant cell according to claim 13, wherein the recombinant cell is Escherichia coli, yeast or mammalian cell.
A pharmaceutical composition characterized by comprising the polypeptide of any one of claims 1 to 4.
The pharmaceutical composition according to claim 15, characterized in that it further comprises a pharmaceutically acceptable adjuvant.
The use of the polypeptide according to claims 1 to 4 or the pharmaceutical composition according to claim 15 or 16 in the preparation of a medicine, which is used to promote the proliferation of β cells.
The use of the polypeptide according to claims 1 to 4 or the pharmaceutical composition according to claim 15 or 16 in the preparation of medicines for the treatment or prevention of diabetes, obesity or protection of liver function.