WO2021115442A1

WO2021115442A1 - Targeted sirna for ptp1b and precursor thereof and application

Info

Publication number: WO2021115442A1
Application number: PCT/CN2020/135815
Authority: WO
Inventors: 陈熹; 余梦超; 张辰宇; 华诗雨
Original assignee: 南京大学
Priority date: 2019-12-13
Filing date: 2020-12-11
Publication date: 2021-06-17
Also published as: CN112980838A

Abstract

Provided is a targeted siRNA for PTP1B and a precursor thereof and an application, and specifically provided is a siRNA precursor sequence and siRNA produced therefrom. The siRNA and a precursor thereof can effectively: (a) prevent and/or treat obesity-related diseases; (b) prevent and/or treat cardiovascular-related diseases; and/or (c) prevent and/or treat metabolic disorder-related diseases.

Description

A targeted siRNA for PTP1B and its precursor and application

Technical field

The invention belongs to the field of biomedicine, and specifically relates to a targeted type of siRNA for PTP1B and its precursors and applications.

Background technique

With the development of society and the improvement of living conditions, obesity has gradually become a type of disease that plagues health problems. From 1975 to 2014, in the past 40 years, the total number of obese people in the world has increased rapidly: from 150 million in 1975 to 641 million in 2014, and China’s The number of obese people ranks first in the world. In the decades when obesity is high, the incidence of diabetes has also increased by 90%, and in most cases the two occur together. In addition, more and more studies have shown that obesity is closely related to the occurrence of a variety of cancers. Therefore, it is necessary to find a safe, effective and non-toxic and side-effect weight loss method.

PTP1B is an important drug target for obesity and type 2 diabetes. PTP1B ^-/- mice can resist weight gain induced by high fat, and at the same time show higher insulin sensitivity than normal mice; PTP1B in the nervous system plays a major role in metabolic regulation and can simultaneously regulate insulin signaling pathways and leptin The signal pathway has a good control effect on body weight and blood sugar. At present, the development of PTP1B inhibitory molecules is mainly divided into two categories, small molecule inhibitors and RNA interference drugs. Small molecule inhibitors have poor specificity, easily bind to other proteins homologous to PTP1B, and are difficult to pass through the blood-brain barrier, so their effect on obesity and type 2 diabetes is very limited; RNA interference drugs have good specificity, but are unstable and easy Degradation and high production cost, there is also the problem of not being able to pass the blood-brain barrier.

Therefore, there is an urgent need in the art to develop an siRNA that can regulate the activity or expression of PTP1B.

Summary of the invention

The present invention provides a siRNA capable of regulating the activity or expression of PTP1B.

The first aspect of the present invention provides a precursor sequence whose 5'to 3'ends have the structure shown in formula I:

B1 is the required first ribonucleic acid sequence, wherein the first ribonucleic acid sequence includes the PTP1B siRNA sense strand sequence;

B2 is a sequence that is substantially complementary or completely complementary to B1, and B2 and C are not complementary;

C is the sequence of stem-loop structure;

Wherein, the nucleotide sequence of the sense strand of the PTP1B siRNA is selected from the following group: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or a combination thereof.

In another preferred example, the precursor sequence is shown in SEQ ID NO.:5.

The second aspect of the present invention provides a polynucleotide which can be transcribed by a host to form the precursor sequence of the first aspect of the present invention.

The third aspect of the present invention provides an expression vector containing the precursor sequence according to the first aspect of the present invention or the polynucleotide according to the second aspect of the present invention.

In another preferred embodiment, the expression vector also contains a polynucleotide encoding a short peptide of rabies virus surface glycoprotein (RVG peptide).

In another preferred embodiment, the expression vector includes a viral vector and a non-viral vector.

In another preferred embodiment, the expression vector is a plasmid.

The fourth aspect of the present invention provides a pharmaceutical preparation, which contains:

(a) An expression vector for expressing siRNA that inhibits the expression of the PTP1B gene; and

(b) A pharmaceutically acceptable carrier;

Wherein, the expression vector contains the precursor sequence described in the first aspect of the present invention or the polynucleotide described in the second aspect of the present invention, or the precursor sequence described in the first aspect of the present invention.

In another preferred embodiment, the formulation is a liquid dosage form.

In another preferred embodiment, the preparation is an injection.

In another preferred embodiment, the expression vector includes a plasmid.

In another preferred embodiment, the expression vector or plasmid contains a promoter, an origin of replication and a marker gene.

In another preferred embodiment, the expression vector contains an expression cassette for expressing PTP1B siRNA.

In another preferred example, the expression cassette (ie polynucleotide) is double-stranded and has the following structure:

Promoter-attB1-optional RVG-optional tag protein (such as Lamp2b)-5' siRNA flanking region sequence-sequence shown in formula I-3' siRNA flanking region sequence-attB2.

In another preferred example, the formulation is a liposome or exosomal formulation.

The fifth aspect of the present invention provides an siRNA for inhibiting the expression of the PTP1B gene. The sense strand nucleotide sequence of the siRNA is selected from the group consisting of SEQ ID NO: 1, 2, 3, 4, or a combination thereof.

The sixth aspect of the present invention provides a pharmaceutical composition containing the precursor sequence according to the first aspect of the present invention, or the expression vector according to the third aspect of the present invention, and a pharmaceutically acceptable Carrier.

In another preferred embodiment, the pharmaceutical composition includes PTP1B siRNA plasmid.

In another preferred embodiment, the pharmaceutical composition is the expression vector of the third aspect of the present invention, preferably a plasmid containing the precursor sequence of the first aspect of the present invention.

In another preferred embodiment, the pharmaceutical composition also includes other (a) prevention and/or treatment of obesity-related diseases; (b) prevention and/or treatment of cardiovascular-related diseases; and/or (c) prevention and/or Or drugs to treat diseases related to metabolic abnormalities.

In another preferred embodiment, the other (a) prevention and/or treatment of obesity related diseases; (b) prevention and/or treatment of cardiovascular related diseases; and/or (c) prevention and/or treatment of metabolic abnormalities related diseases The drug is selected from the following group: Orris, metformin, captopril, carvedilol tablets, gliclazide, metformin, or a combination thereof. In another preferred example, the pharmaceutical composition is the expression vector of claim 3, preferably a plasmid containing the precursor sequence of claim 1.

In another preferred embodiment, the dosage form of the pharmaceutical composition includes:

Tablets, capsules, powders, pills, granules, syrups, solutions, suspensions, emulsions, suspensions, injections, or powder injections.

In another preferred embodiment, the dosage form of the pharmaceutical composition also includes spray, aerosol, powder mist, volatile liquid, topical solution, lotion, pouring lotion, liniment, cataplasm, Plasters, rubber ointments, ointments, plasters, pastes, eye drops, nose drops, ophthalmic ointments, gargles, sublingual tablets or suppositories.

In another preferred embodiment, the dosage form is injection, preferably intravenous injection or intraperitoneal injection.

In another preferred example, the administration method of the pharmaceutical composition includes oral, respiratory, injection, transdermal, mucosal or cavity administration; preferably, the administration method includes direct injection of plasmid.

The seventh aspect of the present invention provides the use of the siRNA of the sixth aspect of the present invention, the precursor sequence of the first aspect of the present invention, or the expression vector of the third aspect of the present invention, for preparing a composition or preparation. The composition or preparation is used for (a) prevention and/or treatment of obesity related diseases; (b) prevention and/or treatment of cardiovascular related diseases; and/or (c) prevention and/or treatment of metabolic disorders related diseases.

In another preferred embodiment, the obesity-related disease is selected from the group consisting of obesity, hyperlipidemia, or a combination thereof.

In another preferred embodiment, the cardiovascular-related disease is selected from the group consisting of hypertension, atherosclerosis, or a combination thereof.

In another preferred embodiment, the metabolic abnormality-related disease is selected from the group consisting of diabetes, fatty liver, or a combination thereof.

In another preferred example, the composition or preparation is also used for one or more purposes selected from the following group:

(i) Decrease the expression level of PTP1B in liver and hypothalamic tissues; and/or

(iii) Increase the basal metabolism level of mammals; and/or

(iii) Slow down the rate of weight gain of mammals; and/or

(iv) Improve the insulin sensitivity of mammals; and/or

(v) Increase the sensitivity of mammals to leptin; and/or

(vi) Reduce mammalian total cholesterol, triglyceride, and low-density lipoprotein levels; and/or

(vii) Increase the level of high-density lipoprotein in mammals; and/or

(viii) Reduce blood lipid accumulation; and/or

(ix) Reduce fat accumulation in the liver.

In another preferred embodiment, the mammal includes a human or non-human mammal.

In another preferred embodiment, the non-human mammals include rodents (such as rats and rabbits), primates (such as monkeys).

The eighth aspect of the present invention provides a method of (a) preventing and/or treating obesity-related diseases; (b) preventing and/or treating cardiovascular-related diseases; and/or (c) preventing and/or treating metabolic disorders-related diseases The method is to administer a safe and effective amount of the expression vector according to the third aspect of the present invention, the pharmaceutical preparation according to the fourth aspect of the present invention, or the pharmaceutical composition according to the sixth aspect of the present invention to a desired subject, thereby (a ) Prevention and/or treatment of obesity related diseases; (b) prevention and/or treatment of cardiovascular related diseases; and/or (c) prevention and/or treatment of metabolic disorders related diseases.

In another preferred example, the administered dose is 1-20 mg/kg, preferably, 5-10 mg/kg.

In another preferred example, the application frequency is 12 hours to 72 hours, preferably, 12 hours to 24 hours.

In another preferred embodiment, the administration includes: oral, respiratory, injection, transdermal, mucosal or cavity administration;

In another preferred embodiment, the administration includes injection of plasmids.

It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described in the following (such as the embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, I will not repeat them one by one here.

Description of the drawings

Figure 1 is a skeleton diagram of the plasmid of the present invention.

Figure 2 is the in vitro interference efficiency detection and cytotoxicity detection of plasmid molecules; according to the method shown in Figure 1, four plasmids with different interference sequences are constructed, and the plasmid molecules with the highest interference efficiency are screened by cell experiments and their cytotoxicity is detected. A: Different plasmid molecules were transfected into cells, and western was used to detect the expression level of PTP1B; B: Western quantitative map; C: CCK-8 experiment to detect the cytotoxicity of plasmids; where * means p<0.05, ** means p< 0.01, *** means p<0.005.

Figure 3 shows the distribution of siRNA expressed by plasmid molecules in different tissues and their inhibitory effects on PTP1B; A: 12 hours after plasmid injection, the results of in situ hybridization detection of siRNA in mouse liver tissue, blue fluorescence is DAPI, green Fluorescence is PTP1B siRNA, control refers to the control plasmid; B: 12 hours after injection of plasmid, in situ hybridization test results of siRNA in mouse hypothalamus, blue fluorescence is DAPI, green fluorescence is PTP1B siRNA; C: injected every two days Once the plasmid was injected seven times, the level of PTP1B in mouse liver and hypothalamus was detected by western.

Figure 4 shows the effect of plasmid molecules on the body weight, food intake, body length and fat content of obese mice induced by high fat. Among them, the high-fat-induced obese mice were divided into groups, and the control plasmid or PTP1B siRNA/RVG plasmid was injected every two days for a period of 3 weeks. After the end, the mice's body weight and other indicators were measured. A: Body weight change curve of obese mice during plasmid administration; B: Effect of plasmid administration on food intake of obese mice; C: Effect of plasmid administration on body length of obese mice; D: Plasmid administration on mice The influence of gonadal fat weight; among them, * means p<0.05, ** means p<0.01, and *** means p<0.005.

Figure 5 shows the effect of plasmid molecules on insulin sensitivity, glucose tolerance and leptin sensitivity in obese mice induced by high fat. Among them, the experimental mice were tested for ITT, GTT, and leptin sensitivity after the administration, and the mice's serum leptin content and serum insulin content were also tested. A: Effect of plasmid administration on mouse insulin sensitivity; B: Effect of plasmid administration on mouse glucose tolerance; C, D: Effect of plasmid administration on mouse leptin sensitivity, C is mouse body weight Change graph, D is the mouse food intake change graph; E: the effect of plasmid administration on mouse serum leptin content; F: the effect of plasmid administration on mouse serum insulin content; where * means p<0.05, ** Means p<0.01, *** means p<0.005.

Figure 6 is a metabolic cage detecting the effect of plasmid molecules on oxygen consumption, respiratory exchange ratio, activity volume, and caloric production in obese mice induced by high fat. Among them, AB: the effect of plasmid administration on oxygen consumption in mice, A: oxygen consumption line chart, B: oxygen consumption statistics chart; CD: the effect of plasmid administration on mouse respiratory exchange ratio, C: respiratory exchange ratio line chart , D: Respiratory exchange ratio statistical graph; EF: Effect of plasmid administration on the activity of mice, E: broken line graph of activity of mice, F: statistical graph of activity of mice. GH: The effect of plasmid administration on heat production in mice, G: Line chart of heat production in mice, H: Statistics chart of heat production in mice; where * means p<0.05, ** means p<0.01, *** means p<0.005.

Figure 7 shows the effects of plasmid molecules on the four blood lipids of obese mice induced by high fat. Among them, AD: the effect of plasmid administration on the blood lipid content of mice, A: total cholesterol content, B: triglyceride content, C: high-density lipoprotein content, D: low-density lipoprotein content; where * means p< 0.05, ** means p<0.01, *** means p<0.005.

Fig. 8 shows the improvement of the fatty liver of high-fat-induced obese mice by plasmid molecules.

Figure 9 is the in vivo safety test of plasmid molecules. Among them, A: the effect of plasmid administration on the serum level of alanine aminotransferase in high-fat-induced obese mice; B: the effect of plasmid administration on the serum level of aspartate aminotransferase in high-fat-induced obese mice.

Detailed ways

After extensive and in-depth research, the inventors screened a large number of nucleic acid sequences for the first time, and discovered for the first time that certain specific siRNAs have a very high inhibitory capacity for PTP1B.

In addition, the present invention prepares a precursor siRNA capable of efficiently expressing PTP1B siRNA for the first time. The precursor siRNA of the present invention can efficiently express the siRNA after being processed by the host cell, thereby effectively avoiding the interference effect of the reverse complementary sequence of the target sequence on the function of the target sequence. Experiments have proved that the precursor siRNA of the present invention can effectively express the PTP1B siRNA sequence in vivo, and has a more effective therapeutic effect on obesity-related diseases; cardiovascular-related diseases; and/or metabolic abnormalities-related diseases. On this basis, the inventor completed the present invention.

the term

In order to make the present disclosure easier to understand, first define certain terms. As used in this application, unless expressly stated otherwise herein, each of the following terms shall have the meaning given below. Other definitions are stated throughout the application.

The term "about" may refer to a value or composition within an acceptable error range of a particular value or composition determined by a person of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values between 99 and 101 (eg, 99.1, 99.2, 99.3, 99.4, etc.).

As used herein, the term "containing" or "including (including)" can be open, semi-closed, and closed. In other words, the term also includes "substantially consisting of" or "consisting of".

As used herein, the terms "host", "subject", and "desired subject" refer to any mammal or non-mammal. Mammals include, but are not limited to, humans, vertebrates such as rodents, non-human primates, such as cows, horses, dogs, cats, pigs, sheep, goats, camels, rats, mice, hares, and rabbits.

Rabies virus glycoprotein

Rabies virus glycoprotein (RVG) is a neurophilic protein that can bind to acetylcholine receptors expressed by nerve cells. Rabies virus is a single-stranded negative-stranded RNA virus of the Rhabdoviridae family and has an envelope. The virus mainly encodes glycoprotein G. The G protein is anchored on the surface of the virus envelope in the form of a trimer, and can bind to receptors on the cell surface to mediate membrane fusion and allow the virus to invade cells. At the same time, G protein is the main antigen protein of rabies virus, which stimulates the body to produce neutralizing antibodies. RVG peptide specifically binds to choline bodies expressed by neuronal cells, and RVG targets are expressed outside the cell membrane, guiding exosomes to pass through the blood-brain barrier and transport to nerve cells.

siRNA and its precursors

As used herein, the term "siRNA" refers to a class of RNA molecules that are processed from transcripts that can form siRNA precursors. Mature siRNA usually has 18-26 nucleotides (nt) (more specifically about 19-22 nt), and siRNA molecules with other numbers of nucleotides are not excluded. siRNA can usually be detected by Northern blotting.

Human-derived siRNA can be isolated from human cells. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, the polynucleotides and polypeptides in the natural state in living cells are not separated and purified, but the same polynucleotides or polypeptides are separated and purified from other substances that exist in the natural state. .

It is worth noting that siRNA is generally produced by simulating miRNA production mechanism, and such siRNA can be processed from precursor RNA (Precursor RNA, Pre-RNA). The precursor RNA can be folded into a stable stem-loop (hairpin) structure, and the length of the stem-loop structure is generally between 50-100 bp. The precursor RNA can be folded into a stable stem-loop structure, and both sides of the stem of the stem-loop structure contain two substantially complementary sequences. The precursor RNA can be natural or artificially synthesized.

In the present invention, the precursor siRNA is an artificially synthesized precursor siRNA, and the precursor siRNA has a structure shown in formula I:

As a representative example, B1 is the PTP1B siRNA sense strand sequence;

B2 is a sequence complementary to B1 (including substantially complementary and complete complementary);

C is the stem-loop structure;

Among them, the shown precursor siRNA can be processed in the host to form PTP1B siRNA.

In the present invention, the precursor miRNA forming the PTP1B siRNA can be spliced to generate the siRNA that regulates the PTP1B gene, that is, PTP1B siRNA (for example, SEQ ID NO.: 1, 2, 3, 4).

SEQ ID NO.: 1ACAUGUGUUUGGUAAAGGGCC

SEQ ID NO.: 2: GAUUAGUGUCAACUUCAAACC

SEQ ID NO.: 3UCUUGUCCAUCAGUAAGAGGC

SEQ ID NO.: 4CUAACUUCAGUGUCUGGACUC.

The precursor RNA can be sheared to generate siRNA, and the siRNA can be substantially complementary to at least a part of the sequence of the mRNA encoding the gene. In formula I, B2 and B1 are basically complementary. As used herein, "substantially complementary" means that the sequence of nucleotides is sufficiently complementary to interact in a predictable manner, such as forming a secondary structure (such as a stem-loop structure). Generally, two "substantially complementary" nucleotide sequences have at least 70% of the nucleotides complementary to each other; preferably, at least 80% of the nucleotides are complementary; more preferably, at least 90% of the nucleotides are complementary; more preferably, at least 95% of the nucleotides are complementary; such as 98%, 99% or 100%. Generally, two sufficiently complementary molecules can have up to 40 unmatched nucleotides; preferably, up to 30 unmatched nucleotides; more preferably, up to 20 unmatched nucleosides Acid; More preferably, there are at most 10 unmatched nucleotides, such as 1, 2, 3, 4, 5, 8, 11 unmatched nucleotides.

In a preferred embodiment, the precursor sequence of the present invention is shown in SEQ ID NO.: 5:

SEQ ID NO.5: GCTAACTTCAGTGTCTGGACTCGTTTTGGCCACTGACTGACGAGTCCAGACTGAAGTTAGC.

As used in this application, the "stem-loop" structure is also referred to as the "hairpin" structure, which refers to a nucleotide molecule that can form a secondary structure including a double-stranded region (stem). The double-stranded region is formed by two regions (located on the same molecule) of the nucleotide molecule, the two regions are arranged on both sides of the double-stranded part; it also includes at least one "loop" structure, including non-complementary nucleotides Molecules, that is, single-stranded regions. Even if the two regions of the nucleotide molecule are not completely complementary, the double-stranded portion of the nucleotide can maintain the double-stranded state. For example, insertions, deletions, substitutions, etc. can lead to non-complementarity in a small region or the small region itself forms a stem-loop structure or other forms of secondary structure. However, the two regions can still be substantially complementary, and in the foreseeable Interaction occurs in the way to form the double-stranded region of the stem-loop structure. The stem-loop structure is well-known to those skilled in the art. Usually, after obtaining a nucleic acid with a nucleotide sequence with a primary structure, those skilled in the art can determine whether the nucleic acid can form a stem-loop structure.

In the present invention, the "stem-loop structure" may exist at the end of the precursor siRNA shown in formula I. For example, after B1 and B2 are substantially complementary, C will form a fixed terminal stem-loop structure; the "stem-loop structure" "It can also exist inside the precursor siRNA of formula I. For example, because B1 and B2 are not completely complementary, the bases of B1 or B2 that are not complementary bound will form an internal loop.

The siRNA of the present invention refers to the microRNA of the siRNA family that inhibits PTP1B, and the microRNA of the siRNA family that inhibits PTP1B includes: siRNA that inhibits PTP1B or a modified siRNA derivative that inhibits PTP1B.

In a preferred embodiment of the present invention, the nucleotide sequence of the siRNA that inhibits PTP1B is shown in SEQ ID NO.: 1-4, corresponding to si-1, si-2, si-3, and si-4, respectively. Particularly preferred is SEQ ID NO.: 4.

The invention also includes siRNA variants and derivatives. In addition, siRNA derivatives in a broad sense can also include siRNA variants. Those of ordinary skill in the art can use general methods to modify siRNAs that inhibit tyrosine kinases. Modification methods include (but are not limited to): methylation modification, hydrocarbyl modification, glycosylation modification (such as 2-methoxy -Glycosyl modification, hydrocarbyl-glycosyl modification, sugar ring modification, etc.), nucleic acid modification, peptide modification, lipid modification, halogen modification, nucleic acid modification (such as "TT" modification), etc.

Polynucleotide construct

According to the siRNA sequence provided by the present invention, a polynucleotide construct that can be processed into siRNA that can affect the expression of the corresponding mRNA after being introduced can be designed, that is, the polynucleotide construct can up-regulate the corresponding The amount of siRNA. Therefore, the present invention provides an isolated polynucleotide (construction), which can be transcribed into precursor RNA by human cells, and the precursor RNA can be sheared by human cells And expressed as the siRNA.

As a preferred mode of the present invention, the polynucleotide construct contains one or more structural units represented by formula II:

Seq _forward- X-Seq _reverse

Formula II

In formula II,

Seq _forward is a nucleotide sequence that can be expressed in cells as the siRNA that inhibits PTP1B, Seq _reverse is a nucleotide sequence that is substantially complementary to Seq _forward ; or, Seq _reverse is a nucleotide sequence that can be expressed in cells Expressed as the nucleotide sequence of the siRNA, the Seq _forward is a nucleotide sequence that is substantially complementary to the _{Seq forward} ; X is the spacer sequence between the _{Seq forward} and the Seq _{reverse, and the spacer sequence} It is not complementary _{to Seq forward} and Seq _reverse;

Among them, each structural unit can express the same or different siRNA;

After the structure shown in formula II is transferred into the cell, the secondary structure shown in formula III is formed:

Formula III

In formula III, Seq _forward , Seq _reverse and X are defined as above;

|| represents the base complementary pairing relationship formed between _{Seq forward} and Seq _reverse.

Generally, the polynucleotide construct is located on an expression vector. Therefore, the present invention also includes a vector containing the siRNA or the polynucleotide construct. The expression vector usually also contains a promoter, an origin of replication, and/or a marker gene. Methods well known to those skilled in the art can be used to construct the expression vector required by the present invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology. The expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as calamycin, gentamicin, hygromycin, and ampicillin resistance.

In the present invention, the expression vector is not particularly limited, and includes commercially available or conventionally prepared expression vectors. Representative examples include (but are not limited to): pcDNATM6.2-GW / miR, pcDNA3, pMIR-REPORT miRNA, pAdTrack-CMV, pCMVp-NEO-BAN, pSV2, CMV4 expression vectors, pmiR-RB-Report ^TM, pshOK-basic, mmu-mir 300-399 miRNASelect ^™ , pshRNA-copGFP Lentivector, GV317, GV309, GV253, GV250, GV249, GV234, GV233, GV232, GV201, GV159 or other GV series eukaryotic expression vectors. In another preferred example, in the expression vector, the promoter operatively connected to the expression of the precursor siRNA polynucleotide includes a constitutive promoter or a tissue-specific promoter, preferably a Pcmv promoter. In other words, these promoters are used to drive the expression of precursor siRNA.

Representative promoters include (but are not limited to): Pcmv promoter, U6, H1, CD43 promoter, CD45 (LCA) promoter, CD68 promoter, Endoglin (CD105) promoter, Fibronectin promoter, Flt-1 (VEGFR-1) promoter, GFAP promoter, GPIlb (IntegrinαIIb) promoter, ICAM-2 (CD102) promoter, MB (Myoglobin) promoter, NphsI (Nephrin) promoter, SPB promoter, SV40/hAlb promoter Promoter, SYN1 promoter, WASP promoter, or a combination thereof.

Pharmaceutical composition and method of administration

As used herein, the term "effective amount" or "effective dose" refers to an amount that can produce function or activity on humans and/or animals and can be accepted by humans and/or animals.

As used herein, the term "pharmaceutically acceptable" ingredients are suitable for humans and/or mammals without excessive adverse side effects (such as toxicity, irritation and allergic reactions), that is, substances with a reasonable benefit/risk ratio . The term "pharmaceutically acceptable carrier" refers to a carrier used for the administration of a therapeutic agent, and includes various excipients and diluents.

The pharmaceutical composition of the present invention contains a safe and effective amount of the active ingredient of the present invention and a pharmaceutically acceptable carrier. Such carriers include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. Generally, the pharmaceutical preparation should match the administration mode. The dosage form of the pharmaceutical composition of the present invention is injection, oral preparation (tablet, capsule, oral liquid), transdermal agent, and sustained-release agent. For example, it can be prepared by conventional methods with physiological saline or an aqueous solution containing glucose and other adjuvants. The pharmaceutical composition should be manufactured under aseptic conditions.

The effective amount of the active ingredient of the present invention can vary with the mode of administration and the severity of the disease to be treated. The selection of the preferred effective amount can be determined by a person of ordinary skill in the art based on various factors (for example, through clinical trials). The factors include, but are not limited to: the pharmacokinetic parameters of the active ingredients such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated by the patient, the patient's weight, the patient's immune status, and administration The way and so on. Generally, when the active ingredient of the present invention is administered at a dose of about 0.00001 mg-50 mg/kg animal body weight (preferably 0.0001 mg-10 mg/kg animal body weight), satisfactory effects can be obtained. For example, due to the urgent need to treat the condition, several divided doses can be given every day, or the dose can be reduced proportionally.

The pharmaceutically acceptable carriers of the present invention include (but are not limited to): water, saline, liposomes, lipids, microparticles, microvesicles, exosomes, and exosomes. Shedding vesicles, nanocapsules (Nanocapsules/Nanoparticles), β-cyclodextriniclusion compound proteins, protein-antibody conjugates, peptide substances, cellulose, nanogels, or combinations thereof. The choice of carrier should match the mode of administration, which are well known to those of ordinary skill in the art.

In the present invention, the expression vector can be directly administered to a subject, or the expression vector and a pharmaceutically acceptable carrier can be prepared into a drug combination before administration. Said administration includes intravenous injection.

treatment method

The present invention also provides a method of (a) preventing and/or treating obesity-related diseases; (b) preventing and/or treating cardiovascular-related diseases; and/or (c) preventing and/or treating diseases related to metabolic abnormalities, That is, a safe and effective amount of the expression vector or pharmaceutical composition of the present invention is administered to a desired subject, thereby (a) preventing and/or treating obesity-related diseases; (b) preventing and/or treating cardiovascular-related diseases; and/or (c) Preventing and/or treating diseases related to metabolic abnormalities.

The main advantages of the present invention include:

(a) The present invention first developed a siRNA sequence specifically designed for PTP1B, which can effectively inhibit the expression of PTP1B in the liver and hypothalamus, and can also (a) prevent and/or treat obesity-related diseases; (b) prevent and/or Treat cardiovascular-related diseases; and/or (c) prevent and/or treat metabolic disorders-related diseases.

(b) The precursor siRNA of the present invention can effectively avoid overexpression of the target sequence while also overexpressing the reverse complementary sequence of the target sequence, thereby effectively avoiding the interference effect of the reverse complementary sequence of the target sequence on the function of the target sequence.

(c) The present invention combines the precursor PTP1B siRNA with the RVG polypeptide to more effectively (a) prevent and/or treat obesity-related diseases; (b) prevent and/or treat cardiovascular-related diseases; and/or (c ) Prevent and/or treat diseases related to metabolic abnormalities.

The present invention will be further explained below in conjunction with specific implementations. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples usually follow conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to manufacturing The conditions suggested by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight. The raw materials or instruments used in the embodiments of the present invention, unless otherwise specified, are commercially available.

General method

1. The cell proliferation experiment uses CCK-8 reagent to detect. Plant the cells into a six-well plate according to the passage ratio, and perform nucleic acid transfection when the cell density is appropriate. When the cells are changed, the cells are digested and counted. Resuspend the cells in 2% DMEM at a ratio of 5000-10000 cells according to 100 μL of suspension per well, set 6 replicates for each sample, and plant 5 96-well plates according to time points. At the 12th, 24th, 36th, 48th, and 60th hours after laying the slabs, one board was taken out. Aspirate the culture solution, add 100 μL of diluted CCK-8 reagent (the ratio of cck-8 reagent to 2% DMEM culture solution is 1:9), and then put it back into the incubator for incubation. Take it out for 2 hours, and measure the OD value at 450nm with a microplate reader. Each sample uses the 12-hour average OD value as the base point to draw a value-added curve.

2. ITT (Insulin Sensitivity) Experiment 1. Before starting the experiment, the mice must be fasted for 6 hours; Note: All the litter, trough, and drinking water of the mice must be replaced during fasting to prevent the experiment results from being affected. 2. When fasting for about 5.5 hours, weigh all the mice to be tested and calculate the insulin dosage; Note: The insulin dosage of normal mice, high-fat mice, and ob/ob mice are: 0.75U/kg, 1U respectively /kg, 1U/kg 3. Separate the mice to be tested, do not confuse them, and then cut the tail tip to measure the blood glucose value in sequence after 6 hours, and record the data. At this time, the data is 0min. 4. Insulin was administered intraperitoneally according to body weight, and all mice were injected at a uniform rate within 15 minutes; 5. Time was calculated from the end of the insulin injection of the first mouse, and the mice were measured at 15 minutes, 30 minutes, 45 minutes, 60 minutes, 90 minutes, and 120 minutes. Blood glucose was recorded and recorded; 6. After the experiment, the mice were returned to the cage and feed was added. 7. Each mouse uses its own blood glucose at 0 min as 100%, and calculates the percentage of blood glucose at each other time point. The percentages of each group of mice at the same time point are averaged to draw the ITT blood glucose curve.

3. GTT (Glucose Tolerance) Experiment 1. The mice to be tested were fasted overnight at around nine o'clock in the evening before the experiment, and replaced with new litter, trough, and drinking water; 2. Around nine o'clock in the morning the next day, Weigh all the mice to be tested and calculate the glucose dosage. The glucose dosage of all mice is 1g/kg; 3. Separate the mice to be tested, do not get confused, cut the tail tip in order to measure the blood glucose value, and record the data , At this time it is 0min data. 4. Give glucose into the abdominal cavity according to body weight, and all mice will be injected at a constant rate within 15 minutes; 5. Calculate the time from the end of the first mouse's glucose injection, measure and record the blood glucose of the mice at 15 minutes, 30 minutes, 60 minutes, and 90 minutes respectively; 6. After the experiment is over, put the mice back into the cage and add feed. 7. Convert the blood glucose value obtained from the data into a value in mg/dl, (measurement data unit is mmol/L) at the same time point in the group to draw the GTT curve of different groups.

4. Leptin sensitivity experiment 1. Place the mice to be tested separately, 1 in each cage, add quantitative feed, and adapt for 2 days; 2. Start two days before the formal experiment, measure the weight of each mouse at 8:30 every morning And appetite. 3. The body weight and food intake were measured at 8:30 on the day of the formal experiment (day 0) and on the first day. Each mouse was intraperitoneally injected with diluted leptin at a dose of 0.5 mg/kg at 9:00 am and 7:00 pm, respectively. 4. No more leptin was given from day 2 to day 5, and weight and food intake were only measured at 8:30 in the morning. 5. Take the average body weight and food intake of the first two days of the experiment as 100%, and then take the percentages for each day's data, and draw the curve for the average percentage of mice in the group.

5. Serum insulin enzyme-linked immunosorbent assay (enzyme linked immunosorbent assay, elisa) 1. Half an hour before the start of the experiment, take out the kit and return to room temperature 2. According to the number of experimental samples, take an appropriate amount of 10×Wash Buffer and dilute to 1 with double distilled water ×; 3. Calculate the sample amount (including standard products and quality inspection holes), take out the required slats, install them on the supporting microplate rack, and put the remaining unused slats back into the tin foil bag, 4-8℃ save. Wash each sample well with 300μL diluted wash buffer three times, discard the excess liquid, and pat dry on absorbent paper; 4. Add 10μL Assay Buffer to each blank well and sample well; 5. In the blank well and standard Add 10μL of Matrix Solution to each empty well and control well; 6. Add 10μL of different concentration standards to each empty in the order of the standard well; 7. Add 10μL of the corresponding quality control solution to each of the quality inspection holes 1 and 2 8. Add 10μL of sample to the sample hole; Note: Depending on the source of the sample, it may be necessary to dilute the sample. In this experiment, the normal mouse serum sample does not need to be diluted. The high-fat mouse is diluted 2-5 times, ob/ob is small Dilute the mouse by 5-10 times; 9. Add 80μL of detection antibody to each well to be tested, seal the plate with a sealing film, and incubate at room temperature with a shaker for 2 hours; after 10 or 2 hours, discard the liquid and use the diluted wash Wash the buffer three times, discard the remaining liquid each time, and pat dry on absorbent paper; 11. Add 100 μL Enzyme Solution to the well, seal the plate, and incubate on a shaker for 30 minutes; after 12 or 30 minutes, discard the liquid and dilute with it. Wash the wash buffer six times, discard the remaining liquid each time and pat dry on absorbent paper; 13. Add 100 μL of Substrate Solution to each well, seal the plate, and incubate on a shaker for 20 minutes; 14. Add 100 μL of Stop Solution to each well, slightly Mix well, do not produce bubbles, at 450nm and 590nm

6. Serum leptin enzyme-linked immunosorbent assay 1. Reagent preparation: before the test, take out all reagents and return to room temperature; take an appropriate amount of 20× concentrated lotion, dilute with distilled water to 1× lotion, mix well and take an appropriate amount of 10× concentrated for detection Buffer, dilute with distilled water to 1× detection buffer, mix according to the total number of samples (samples and standards), dilute and concentrate the antibody with 1× detection buffer at a ratio of 1:100, and use within 30 min. According to the total number of samples, use 1 ×The detection buffer should be diluted according to the horseradish peroxidase-labeled streptavidin provided in the 1:100 dilution kit, and samples from different sources must be used within 30 minutes. The measurement needs to be diluted with 1× detection buffer. The normal mice and high-fat induced mice used in the experiment were diluted 10-20 times when detecting the serum leptin content. After centrifugation, the mouse leptin standard is diluted with a certain amount of distilled water to form a 8000pg/mL standard. After standing for 20 minutes, it is diluted with the standard diluent at a 2-fold ratio to form 0, 62.5, 125, 250, 500, 1000, Standard product gradients of 2000, 4000, pg/mL; 2. Remove the unused slats, put them back in the aluminum foil bag and re-seal the seal; 3. Add 300 μL of diluted 1× lotion, place for 30 seconds and discard Washing solution, try to pat dry the water in the well plate on absorbent paper. In order to prevent the measurement error caused by the drying of the well plate, use it immediately after washing the plate; 4. Add the standard to the well according to the gradient, 100μL per well; 5. Mix the sample with 1× detection buffer in a ratio of 1:9, and add 100 μL of the mixed solution to the sample well; 6. Add 50 μL of diluted detection antibody to each well to ensure that the 4-6 steps are continuous and complete within 15 minutes; 7. Seal the plate and incubate on a shaker at room temperature for 2 hours; 8. Discard the liquid in the well plate, add about 300 μL of washing solution to each well to wash the plate, then pat dry on absorbent paper, and repeat the washing 6 times. 9. Add 100 μL of diluted horseradish peroxidase-labeled streptavidin to each well; 10. Seal the plate and incubate on a shaker for 45 minutes at room temperature; 11. Repeat step 8; 12. Add 100 μL to each well Chromogenic substrate TMB, incubate in the dark for 20 minutes at room temperature; 13. Add 100 μL stop solution to each well. Tap the frame and mix thoroughly; 14. Immediately use the microplate reader for dual-wavelength detection, and determine the OD values at 450nm and 570nm;

7. Determination of serum total cholesterol/triglyceride content

The procedure for the determination of serum total cholesterol and triglycerides is the same, just use the reagents in the respective kits.

8. Determination of serum high-density lipoprotein/low-density lipoprotein content

The procedure for the determination of serum high-density lipoprotein and low-density lipoprotein is the same, just use each kit.

Example 1 Construction of PTP1B siRNA/RVG plasmid and detection of interference efficiency and safety

Treat the control plasmid with restriction endonucleases, and recover the linear vector, then use T4 ligase to ligate the RVG-PTP1B siRNA combination fragment with the vector; the resulting ligation product is subjected to transformation experiments and coated on the resistant plate; second Pick a single clone every day, and sequence to confirm the correctness of the plasmid sequence. According to this method, four fragments containing different combinations of PTP1B are connected to the vector to form a plasmid molecule, named PTP1B si-1, PTP1B si-2, PTP1B si-3, PTP1B si-4 (Figure 1) .

The four plasmid molecules were respectively transfected into the mouse liver cancer cell line Hepa1-6 with a confluence of 60-70%. After 30 hours, the expression level of PTP1B in the cells was detected by a western experiment. The results show that PTP1B si-4 has the highest interference efficiency with PTP1B protein (Figure 2A-B).

The plasmid with the highest interference efficiency and the control plasmid were transfected into Hepa1-6 with a confluency of 60-70%, and the cells were digested 6-8 hours later and counted. Resuspend the cells in 2% DMEM at a ratio of 5,000 cells in 100 μL of suspension per well, set 6 replicates for each sample, and plant 4 96-well plates according to time points. At 0, 12, 24, and 36 hours, one plate was taken out. Aspirate the culture solution, add 100 μL of diluted CCK-8 reagent (the ratio of cck-8 reagent to 2% DMEM culture solution is 1:9), and then put it back into the incubator for incubation. Take it out for 2 hours, and measure the OD value at 450nm with a microplate reader. For each sample, the 12-hour average OD value was used as the base point to draw a value-added curve (Figure 2C). The results show that the interference plasmid has no toxic effect on cell growth and proliferation.

Example 2 Distribution of plasmid-expressed siRNA in vivo and its inhibitory effect on PTP1B

The control plasmid and PTP1B siRNA-4/RVG plasmid were injected into the tail vein of normal mice at a dose of 10 mg/kg; 12 hours later, the mice were sacrificed, and the liver tissue and hypothalamus tissue of the mice were taken for in situ hybridization experiments. . In this group of experiments, the sequence that is completely complementary to the PTP1B siRNA-4 sequence is added with green fluorescent modification as a detection probe to indicate the distribution of siRNA-4 in tissue sections; the results show that in the liver tissue of mice There is a large number of siRNA-4 distribution (Figure 3A), and siRNA-4 can also be detected in hypothalamic tissues, proving that PTP1B siRNA-4/RVG plasmid does have a brain-targeting effect (Figure 3B).

In order to prove whether these distributed siRNAs can effectively inhibit the expression of PTP1B in vivo, we also injected the control plasmid and PTP1B siRNA-4/RVG plasmid into the tail vein of mice at a dose of 10 mg/kg, once every two days. A total of 7 injections, the mice were sacrificed 24 hours after the last injection, and the liver tissue and hypothalamus tissue of the mice were also taken for western experiments. The results showed that plasmid molecules can effectively reduce the expression level of PTP1B in liver and hypothalamic tissues in vivo (Figure 3C).

Example 3 Metabolism improvement effect of PTP1B siRNA-4/RVG plasmid on high-fat-induced obese mice

In order to further confirm the therapeutic effect of PTP1B siRNA-4/RVG plasmid in vivo, a high-fat-induced obesity mouse model was used as the experimental object to confirm the improvement effect of PTP1B siRNA-4/RVG plasmid on metabolic abnormalities.

The high-fat-induced obese mice were equally divided into two groups according to their body weight, and the control plasmid and PTP1B siRNA-4/RVG plasmid were injected at a dose of 10 mg/kg respectively. The injection is once every two days for a total of three weeks. During the injection, the body weight and food intake were measured every two days, and other metabolic related indicators were tested after the end of the administration.

The results showed that during the three-week treatment, the weight gain of mice injected with PTP1B siRNA-4/RVG plasmid was significantly lower than that of mice injected with control plasmid (Figure 4A), and the weight of gonadal fat was also significantly reduced (Figure 4D); There was no significant difference in food intake and body length between the two groups of mice (Figure 4B-C), indicating that the regulatory effect of PTP1B on the weight of mice does not depend on the reduction in food intake.

High-fat-induced obesity models usually show insulin resistance and leptin resistance. Improving the sensitivity of both is of great significance for improving the metabolic disorders caused by obesity. The insulin sensitivity of the two groups of mice was tested, and it was found that the mice injected with PTP1B siRNA-4/RVG plasmid responded more rapidly and violently to insulin stimulation, which was manifested as a faster drop in blood sugar (Figure 5A); at the same time, they responded more to glucose stimulation. Relief, manifested by a slower rise in blood sugar (Figure 5B). In the leptin sensitivity experiment, PTP1B siRNA-4/RVG injected mice stimulated exogenous leptin, both in food intake and body weight, compared to the control group (Figure 5C-D). Another important manifestation of insulin resistance and leptin resistance is the compensatory increase in serum insulin and leptin content, which will decrease after improvement. The detection of the serum insulin content and leptin content of the two groups of mice found that the levels of the two levels in the serum of the mice injected with the PTP1B siRNA-4/RVG plasmid decreased significantly, indicating that the body's sensitivity to the two increased (Figure 5E- F).

Since PTP1B's regulation of body weight does not depend on reducing food intake, it is speculated that it may increase energy metabolism. Therefore, the metabolic cage was used to detect the basal metabolism, activity level and thermogenesis of mice. The results showed that PTP1B siRNA-4/RVG plasmid-injected mice had significantly increased oxygen consumption compared with control mice (Figure 6A-B), while respiratory quotient decreased significantly (Figure 6C-D), indicating that this group Under normal physiological conditions, mice have a higher basal metabolic rate and are more inclined to use fat as their energy source than control mice. Not only that, the activity level (Figure 6E-F) and caloric production (Figure 6G-H) of mice injected with PTP1B siRNA-4/RVG plasmid also increased. This set of results well explained the reason for the low growth rate of body weight of mice injected with PTP1B siRNA-4/RVG plasmid.

Hyperlipidemia is also an important sign of obesity. The four items of blood lipids in mice were tested, and it was found that the total cholesterol, triglycerides, and low-density lipoprotein of mice injected with PTP1B siRNA-4/RVG plasmid decreased significantly (Figure 7A-B, D), while the "scavenger" high density The lipoprotein content increased to a certain extent (Figure 7C). This result indicates that the metabolism of glucose and lipids in mice is improved, and the accumulation of blood lipids is reduced.

Obesity mice induced by high fat intake caused a large amount of body fat to accumulate due to excessive fat intake, and there would be vacuoles caused by steatosis in the HE stained sections of the liver. However, vacuoles in liver tissue sections of mice injected with PTP1B siRNA-4/RVG plasmid were significantly reduced, indicating that fat accumulation in the liver was reduced and fatty liver was improved (Figure 8).

In order to test the safety of this treatment, we also tested the serum levels of transaminase in untreated high-fat mice, control mice and experimental mice. The results showed that there was no significant difference in the contents of alanine aminotransferase and aspartate aminotransferase in the three groups of mice, indicating that tail vein injection of plasmids does not cause liver damage and is a safer way of administration (Figure 9A-B).

In the present invention, injection of PTP1B siRNA-1/RVG plasmid, PTP1B siRNA-2/RVG plasmid, PTP1B siRNA-3/RVG plasmid can also obtain the similar effect of PTP1B siRNA-4/RVG plasmid.

All documents mentioned in the present invention are cited as references in this application, as if each document was individually cited as a reference. In addition, it should be understood that after reading the above teaching content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims

A precursor sequence whose 5'to 3'ends have the structure shown in formula I:

B1 is the required first ribonucleic acid sequence, wherein the first ribonucleic acid sequence includes the PTP1B siRNA sense strand sequence;

B2 is a sequence that is substantially complementary or completely complementary to B1, and B2 and C are not complementary;

C is the sequence of stem-loop structure;

Wherein, the nucleotide sequence of the sense strand of the PTP1B siRNA is selected from the following group: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or a combination thereof.
The precursor sequence of claim 1, wherein the precursor sequence is shown in SEQ ID NO.:5.
A polynucleotide characterized in that the polynucleotide can be transcribed by a host to form the precursor sequence of claim 1.
An expression vector, characterized in that the expression vector contains the precursor sequence of claim 1 or the polynucleotide of claim 3.
The expression vector according to claim 4, wherein the expression vector further contains a polynucleotide encoding a short peptide of rabies virus surface glycoprotein (RVG peptide).
A pharmaceutical preparation, characterized in that the preparation contains:

(a) An expression vector for expressing siRNA that inhibits the expression of the PTP1B gene; and

(b) A pharmaceutically acceptable carrier;

Wherein, the expression vector contains the precursor sequence described in claim 1 or the polynucleotide described in claim 3, or the precursor sequence described in claim 1 is expressed.
The pharmaceutical preparation according to claim 6, wherein the expression vector further contains a polynucleotide encoding a short peptide of rabies virus surface glycoprotein (RVG peptide).
An siRNA for inhibiting the expression of PTP1B gene, characterized in that the nucleotide sequence of the sense strand of the siRNA is selected from the following group: SEQ ID NO: 1, 2, 3, 4, or a combination thereof.
A pharmaceutical composition, characterized in that the pharmaceutical composition contains the precursor sequence of claim 1 or the expression vector of claim 4, and a pharmaceutically acceptable carrier.
The use of the siRNA according to claim 8, the precursor sequence according to claim 1, or the expression vector according to claim 4, characterized in that it is used to prepare a composition or preparation, and the composition or preparation is used for (a) Prevent and/or treat obesity-related diseases; (b) prevent and/or treat cardiovascular-related diseases; and/or (c) prevent and/or treat diseases related to metabolic abnormalities.