WO2021096763A1 - Methods and compositions for treating an angiotensinogen- (agt-) associated disorder - Google Patents

Methods and compositions for treating an angiotensinogen- (agt-) associated disorder Download PDF

Info

Publication number
WO2021096763A1
WO2021096763A1 PCT/US2020/059265 US2020059265W WO2021096763A1 WO 2021096763 A1 WO2021096763 A1 WO 2021096763A1 US 2020059265 W US2020059265 W US 2020059265W WO 2021096763 A1 WO2021096763 A1 WO 2021096763A1
Authority
WO
WIPO (PCT)
Prior art keywords
subject
nucleotide sequence
nucleotides
nucleotide
antisense strand
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/059265
Other languages
English (en)
French (fr)
Other versions
WO2021096763A8 (en
Inventor
Donald Foster
Sagar Agarwal
Stephen Albert HUANG
Jae Kim
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Alnylam Pharmaceuticals Inc
Original Assignee
Alnylam Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to BR112022009216A priority Critical patent/BR112022009216A2/pt
Priority to CA3161703A priority patent/CA3161703C/en
Priority to AU2020382478A priority patent/AU2020382478A1/en
Priority to PH1/2022/551158A priority patent/PH12022551158A1/en
Priority to JP2022527782A priority patent/JP7707164B2/ja
Priority to CN202080090823.1A priority patent/CN114981431A/zh
Priority to PE2022000781A priority patent/PE20230179A1/es
Priority to IL292865A priority patent/IL292865A/en
Priority to KR1020227019814A priority patent/KR20220115946A/ko
Application filed by Alnylam Pharmaceuticals Inc filed Critical Alnylam Pharmaceuticals Inc
Priority to MX2022005692A priority patent/MX2022005692A/es
Priority to EP20816344.4A priority patent/EP4058577A1/en
Publication of WO2021096763A1 publication Critical patent/WO2021096763A1/en
Publication of WO2021096763A8 publication Critical patent/WO2021096763A8/en
Priority to CONC2022/0006092A priority patent/CO2022006092A2/es
Priority to US17/743,498 priority patent/US20230002765A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/35Special therapeutic applications based on a specific dosage / administration regimen
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/50Methods for regulating/modulating their activity
    • C12N2320/52Methods for regulating/modulating their activity modulating the physical stability, e.g. GC-content

Definitions

  • the renin-angiotensin-aldosterone system plays a crucial role in the regulation of blood pressure.
  • the RAAS cascade begins with the release of renin by the juxtaglomerular cells of the kidney into the circulation. Renin secretion is stimulated by several factors, including Na+ load in the distal tubule, b-sympathetic stimulation, or reduced renal perfusion. Active renin in the plasma cleaves angiotensinogen (produced by the liver) to angiotensin I, which is then converted by circulating and locally expressed angiotensin-converting enzyme (ACE) to angiotensin II.
  • ACE angiotensin-converting enzyme
  • ATiR angiotensin II type 1 receptors
  • ATiR stimulation leads to aldosterone release which, in turn, promotes Na+ and K+ excretion in the renal distal convoluted tubule.
  • Dysregulation of the RAAS leading to, for example, excessive angiotensin II production or ATiR stimulation results in hypertension which can lead to, e.g., increased oxidative stress, promotion of inflammation, hypertrophy, and fibrosis in the heart, kidneys, and arteries, and result in, e.g., left ventricular fibrosis, arterial remodeling, and glomerulosclerosis.
  • Hypertension is the most prevalent, controllable disease in developed countries, affecting 20-50% of adult populations. Hypertension is a major risk factor for various diseases, disorders and conditions such as, shortened life expectancy, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms (e.g. aortic aneurysm), peripheral artery disease, heart damage (e.g., heart enlargement or hypertrophy) and other cardiovascular related diseases, disorders, or conditions. In addition, hypertension has been shown to be an important risk factor for cardiovascular morbidity and mortality accounting for, or contributing to, 62% of all strokes and 49% of all cases of heart disease. In 2017, changes in the guidelines for diagnosis, prevention, and treatment of hypertension were developed providing goals for even lower blood pressure to further decrease risk of development of diseases and disorders associated with hypertension (see, e.g., Reboussin etal. Systematic Review for the 2017
  • the invention provides methods and compositions for inhibiting the expression of an angiotensinogen (AGT) gene, for treating a subject having a disorder that would benefit from reduction in AGT expression, for treating a subject having an AGT-associated disorder, and for decreasing blood pressure in a subject.
  • the methods include administering to the subject a fixed dose of an RNAi agent, e.g., a double stranded RNAi agent, targeting an AGT gene.
  • the present invention provides a method for inhibiting the expression of an angiotensinogen (AGT) gene in a subject.
  • the method includes administering to the subject a fixed dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg) of a double- stranded ribonucleic acid (RNAi) agent, or salt thereof, wherein the double-stranded RNAi
  • the present invention provides a method for treating a subject that would benefit from reduction in angiotensinogen (AGT) expression, e.g., a subject at risk of developing an AGT-associated disorder, e.g., hypertension.
  • the method includes administering to the subject a fixed dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg) of a double- strande
  • the present invention provides a method for treating a subject having an angiotensinogen- (AGT-) associated disorder, e.g., hypertension.
  • the method includes administering to the subject a fixed dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg) of a double-stranded ribonucleic acid (RNAi) agent, or salt thereof, wherein the double-
  • the present invention provides a method for decreasing blood pressure level in a subject, sich as a subject having an AGT-associated disorder,e.g., hypdertension.
  • the method includes administering to the subject a fixed dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg) of a double-stranded ribonucleic acid (RNAi) agent, or salt thereof, wherein
  • the fixed dose is administered to the subject at an interval of once a month. In other embodiments, the fixed dose is administered to the subject at an interval of once a quarter. In some embodiments, the fixed dose is administered to the subject at an interval of bianually. In some embodiments, the subject is administered a fixed dose of about 50 mg to about 200 mg. In other embodiments, the subject is administered a fixed dose of about 200 mg to about 400 mg. In some embodiments, the subject is administered a fixed dose of about 400 mg to about 800 mg. In some embodiments, the subject is administered a fixed dose of about 100 mg. In some embodiments, the subject is administered a fixed dose of about 200 mg. In some embodiments, the subject is administered a fixed dose of about 300 mg.
  • the subject is administered a fixed dose of about 400 mg. In some embodiments, the subject is administered a fixed dose of about 500 mg. In other embodiments, the subject is administered a fixed dose of about 600 mg. In some embodiments, the subject is administered a fixed dose of about 800 mg.
  • the double stranded RNAi agent, or salt thereof is administered to the subject subcutaneously or intravenously.
  • the subcutaneous administration is subcutaneous injection, e.g., subcutaneous self-administration. In other embodiments, the intravenous administration is intravenous injection.
  • the antisense strand comprises a nucleotide sequence comprising at least 20 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9) and the sense strand comprises a nucleotide sequence comprising at least 20 contiguous nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).
  • the antisense strand comprises a nucleotide sequence comprising at least 21 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9) and the sense strand comprises a nucleotide sequence comprising at least 20 contiguous nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).
  • the antisense strand comprises a nucleotide sequence comprising at least 22 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9) and the sense strand comprises a nucleotide sequence comprising at least 20 contiguous nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).
  • the antisense strand comprises the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9) and the sense strand comprises the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).
  • the antisense strand consists of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9) and the sense strand consists of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).
  • substantially all of the nucleotides of the sense strand are modified nucleotides. In other embodiments, substantially all of the nucleotides of the antisense strand are modified nucleotides.
  • all of the nucleotides of the sense strand are modified nucleotides. In some embodiments, all of the nucleotides of the antisense strand are modified nucleotides.
  • At least one of the nucleotide modifications is selected from the group consisting of a deoxy-nucleotide, a 3' -terminal deoxy -thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2' -amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, 2' -C-alkyl -modified nucleotide, 2' -hydroxly-modified nucleotide, a 2'-methoxyethyl modified nucleotide, a 2'-
  • At least one of the nucleotide modifications is selected from the group consisting of a deoxy-nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a glycol modified nucleotide (GNA), and a 2-O-(N-methylacetamide) modified nucleotide; and combinations thereof.
  • the double stranded region is 19-23 nucleotide pairs in length, 19- 21 nucleotide pairs in length, 21-23 nucleotide pairs in length, or 21 nucleotide pairs in length.
  • each strand is independently 19-23 nucleotides in length, 19-25 nucleotides in length, or 21-23 nucleotides in length.
  • the sense strand is 21 nucleotides in length
  • the antisense strand is 23 nucleotides in length.
  • At least one strand comprises a 3' overhang of at least 1 nucleotide or a 3' overhang of at least 2 nucleotides.
  • the double-stranded RNAi agent, or salt thereof further comprises at least one phosphorothioate or methylphosphonate intemucleotide linkage.
  • the phosphorothioate or methylphosphonate intemucleotide linkage is at the 3'-terminus of one strand.
  • the strand is the antisense strand. In other embodiments, the strand is the sense strand.
  • the phosphorothioate or methylphosphonate intemucleotide linkage is at the 5' -terminus of one strand.
  • the strand is the antisense strand. In other embodiments, the strand is the sense strand.
  • the phosphorothioate or methylphosphonate intemucleotide linkage is at the both the 5'- and 3' -terminus of one strand.
  • the strand is the antisense strand.
  • the present invention provides a method for inhibiting the expression of an angiotensinogen (AGT) gene in a subject.
  • the method includes administering to the subject a fixed dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg) of a double- stranded ribonucleic acid (RNAi) agent, or salt thereof, wherein the double -stranded RNAi
  • the present invention provides a method for treating a subject that would benefit from reduction in AGT expression, e.g., a subject at risk of developing an AGT-associated disorder, e.g., hypertension.
  • the method includes administering to the subject a fixed dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, e.g., about 50, 100, 150, 200, 250,
  • RNAi double-stranded ribonucleic acid
  • agent comprises a sense strand and an antisense strand forming a double stranded region
  • the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11)
  • the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12); wherein chemical modifiecations are defined as follows: a is 2'
  • the present invention provides a method for treating a subject having an AGT- associated disorder, e.g., hypertension.
  • the method includes administering to the subject a fixed dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, e.g., about 50, 100, 150,
  • a fixed dose of about 50 mg to about 800 mg e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about
  • RNAi double-stranded ribonucleic acid
  • the double-stranded RNAi agent, or salt thereof comprises a sense strand and an antisense strand forming a double stranded region
  • the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11)
  • the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12); wherein chemical modifiecations are defined as follows:
  • the present invention provides a method for decreasing blood pressure level in a subject.
  • the method includes administering to the subject a fixed dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg) of a double-stranded ribonucleic acid (RNAi) agent, or salt thereof, wherein the double-stranded RNAi agent, or salt thereof, comprises a sense strand and an
  • the fixed dose is administered to the subject at an interval of once a month. In other embodiments, the fixed dose is administered to the subject at an interval of once a quarter. In some embodiments, the fixed dose is administered to the subject at an interval of bianually.
  • the subject is administered a fixed dose of about 50 mg to about 200 mg. In other embodiments, the subject is administered a fixed dose of about 200 mg to about 400 mg. In some embodiments, the subject is administered a fixed dose of about 400 mg to about 800 mg.
  • the subject is administered a fixed dose of about 100 mg. In some embodiments, the subject is administered a fixed dose of about 200 mg. In some embodiments, the subject is administered a fixed dose of about 300 mg. In some embodiments, the subject is administered a fixed dose of about 400 mg. In some embodiments, the subject is administered a fixed dose of about 500 mg. In other embodiments, the subject is administered a fixed dose of about 600 mg. In some embodiments, the subject is administered a fixed dose of about 800 mg.
  • the double stranded RNAi agent, or salt thereof is administered to the subject subcutaneously or intravenously.
  • the subcutaneous administration is subcutaneous injection, e.g., subcutaneous self-administration.
  • the intravenous administration is intravenous injection.
  • the antisense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11) and the sense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).
  • the antisense strand comprises a modified nucleotide sequence comprising at least 21 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11) and the sense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).
  • the antisense strand comprises a modified nucleotide sequence comprising at least 22 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11) and the sense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).
  • the antisense strand comprises a modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11) and the sense strand comprises a modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).
  • the antisense strand consists of a modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11) and the sense strand consists of a modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).
  • the double stranded RNAi agent, or salt thereof further comprises a ligand.
  • the ligand is conjugated to the 3' end of the sense strand.
  • the ligand is an N-acetylgalactosamine (GalNAc) derivative.
  • the GalNAc derivative comprises one or more GalNAc derivatives attached through a monovalent, bivalent, or trivalent branched linker.
  • the ligand is and, wherein X is O or S.
  • the subject is a human. In some embodiments, the subject has a systolic blood pressure of at least 130 mm Hg or a diastolic blood pressure of at least 80 mm Hg. In other embodiments, the subject has a systolic blood pressure of at least 140 mm Hg or a diastolic blood pressure of at least 80 mm Hg.
  • the subject is part of a group susceptible to salt sensitivity, is overweight, is obese, is pregnant, is planning to become pregnant, has type 2 diabetes, has type 1 diabetes, or has reduced kidney function.
  • the disorder that would benefit from reduction in AGT expression is an AGT-associated disorder.
  • the AGT-associated disorder is hypertension.
  • the AGT -associated disorder is selected from the group consisting of high blood pressure, hypertension, borderline hypertension, primary hypertension, secondary hypertension isolated systolic or diastolic hypertension, pregnancy-associated hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vasculopathy, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiac myopathy, nocturnal hypotension, glomerulosclerosis, coarc
  • the AGT-associated disorder is hypertension.
  • the hypertension is selected from the group consisting of high blood pressure, hypertension, borderline hypertension, primary hypertension, secondary hypertension isolated systolic or diastolic hypertension, pregnancy-associated hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension; hypertensive heart disease, and hypertensive nephropathy.
  • the blood pressure comprises systolic blood pressure and/or diastolic blood pressure.
  • administering results in a decrease in AGT expression by at least 30%, 40% 50%, 60%, 70%, 80%, 90%, or 95%.
  • the AGT protein level in blood or serum sample of the subject is decreased by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%.
  • administering results in a decrease in systolic blood pressure and/or diastolic blood pressure.
  • the systolic blood pressure and/or diastolic blood pressure is decreased by at least 4 mmHg, 5 mmHg, 6 mmHg, 7 mmHg, 8 mmHg, 9 mmHg or 10 mmHg.
  • the methods further comprise administering to the subject an additional therapeutic agent for treatment of hypertension.
  • the additional therapeutic agent is selected from the group consisting of a diuretic, an angiotensin converting enzyme (ACE) inhibitor, an angiotensin II receptor antagonist, a beta-blocker, a vasodialator, a calcium channel blocker, an aldosterone antagonist, an alpha2-agonist, a renin inhibitor, an alpha- blocker, a peripheral acting adrenergic agent, a selective D1 receptor partial agonist, a nonselective alpha-adrenergic antagonist, a synthetic, a steroidal antimineralocorticoid agent; a combination of any of the foregoing; and a hypertension therapeutic agent formulated as a combination of agents.
  • ACE angiotensin converting enzyme
  • the additional therapeutic agent comprises an angiotensin II receptor antagonist.
  • the angiotensin II receptor antagonist is selected from the group consisting of losartan, valsartan, olmesartan, eprosartan, and azilsartan.
  • the RNAi agent is administered as a pharmarceutical composition.
  • the RNAi agent is administered in an unbuffered solution.
  • the unbuffered solution is saline or water.
  • the RNAi agent is administered with a buffer solution.
  • the buffer solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • the present invention also provides a kit for performing the methods of the invention, as described hererin.
  • the kit comprises a) the RNAi agent, and b) instructions for use, and c) optionally, means for administering the RNAi agent to the subject.
  • the present invention also provides a pharmaceutical composition for treating an AGT-associated disorder comprising a double stranded ribonucleic acid (RNAi) agent, or salt thereof, for inhibiting expression of angiotensinogen (AGT).
  • RNAi double stranded ribonucleic acid
  • AGT angiotensinogen
  • the pharmaceutical composition comprises a dsRNA agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence of UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9) and the sense strand comprises a nucleotide sequence comprising at least 19 contiguous nucleotides of the nucleotide sequence of GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10); wherein no more than five of the nucleotides do not comprise a modification; wherein at least one of the nucleotide modifications is a thermally destabilizing nucleotide modification; wherein the double stranded RNAi agent is administered at a dose of at least 50 mg/dose no more than once per month, e.g..
  • a dose of about 50 mg to about 800 mg about once per month (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg).
  • the antisense strand comprises a nucleotide sequence comprising at least 20 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9), In certain embodiments, the sense strand further comprises a nucleotide sequence comprising at least 20 contiguous nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).
  • the antisense strand comprises a nucleotide sequence comprising at least 21 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9). In certain embodiments, the sense strand further comprises the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).
  • the antisense strand a nucleotide sequence comprising comprises at least 22 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9), In certain embodiments, the sense strand further comprises the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10)
  • antisense strand comprises the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9). In certain embodiments, the sense strand further comprises the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10 ).
  • nucleotide sequence of the antisense strand consists of UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9). In certain embodiments, the nucleotide sequence of the sense strand further consists of GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).
  • all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand comprise a nucleotide modification.
  • At least one of the nucleotide modifications is selected from the group consisting of a deoxy-nucleotide, a 3' -terminal deoxy-thymine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2' -amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, 2' -C-alkyl -modified nucleotide, 2' -hydroxly-modified nucleotide, a 2'-methoxyethyl modified nucleotide, a
  • At least one of the nucleotide modifications is selected from the group consisting of a deoxy-nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy- modified nucleotide, a glycol modified nucleotide (GNA), and a 2-O-(N-methylacetamide) modified nucleotide; and combinations thereof.
  • the nucleotide modifications are selected from the group consisting of 2'-methoxyethyl, 2'-fluoro, a 2'-deoxy-modified nucleotide, and GNA; and combinations thereof.
  • the double stranded region is of a length selected from: 19-23 nucleotide pairs in length, 19- 21 nucleotide pairs in length, 21-23 nucleotide pairs in length, 21 nucleotide pairs in length, 19-30 nucleotide pairs in length, 19-25 nucleotide pairs in length, 23-27 nucleotide pairs in length.
  • the double stranded region has a length of 19-21 nucleotiede pairs in length.
  • each strand of the double stranded RNAi or salt thereof is independently of a length selected from 19-30 nucleotides in length 19-23 nucleotides in length, and 21-23 nucleotides in length. In certain embodiments, each strand is independently 21-23 nucleotides in length. In certain embodiments, the sense strand is 21 nucleotides in length, and the antisense strand is 23 nucleotides in length.
  • At least one strand comprises a 3' overhang of at least 1 nucleotide.
  • At least one strand comprises a 3' overhang of at least 2 nucleotides.
  • the agent further comprises at least one phosphorothioate or methylphosphonate intemucleotide linkage.
  • the phosphorothioate or methylphosphonate intemucleotide linkage is at the 3' -terminus of one strand.
  • the strand is the antisense strand.
  • the strand is the sense strand.
  • the phosphorothioate or methylphosphonate intemucleotide linkage is at the 5'-terminus of one strand.
  • the strand is the antisense strand.
  • the strand is the sense strand.
  • the phosphorothioate or methylphosphonate intemucleotide linkage is at the both the 5'- and 3' -terminus of one strand.
  • the strand is the antisense strand.
  • the invention provides a pharmaceutical composition for treating an AGT-associated disorder comprising a double stranded ribonucleic acid (RNAi) agent, or salt thereof, for inhibiting expression of angiotensinogen (AGT).
  • the pharmaceutical composition comprises a double stranded RNAi agent, or salt thereof, agent comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11) and the sense strand comprises a modified nucleotide sequence comprising at least 19 contiguous nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12); wherein chemical modifiecations
  • the antisense strand comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11).
  • the sense strand further comprises a modified nucleotide sequence comprising at least 20 contiguous nucleotides of the modified nucleotide sequence gsuscaucCfaCfAfAfiigagaguaca (SEQ ID NO: 12).
  • the antisense strand comprises a modified nucleotide sequence comprising at least 21 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11).
  • the sense strand further comprises the modified nucleotide sequence gsuscaucCfaCfAfAfiigagaguaca (SEQ ID NO: 12 ).
  • the antisense strand comprises a modified nucleotide sequence comprising at least 22 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11).
  • the sense strand further comprises the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).
  • the antisense strand comprises the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11). In certain embodiments, the sense strand further comprises the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).
  • the modified nucleotide sequence of the antisense strand consists of usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11). In certain embodiments, the modified nucleotide sequence of the sense strand consists of gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).
  • the double stranded RNAi agent, or salt thereof further comprises a ligand.
  • the ligand is conjugated to the 3' end of the sense strand.
  • the ligand is an N-acetylgalactosamine (GalNAc) derivative.
  • the GalNAc derivative comprises one or more GalNAc derivatives attached through a monovalent, bivalent, or trivalent branched linker.
  • ligand is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N
  • X is O or S. In certain embodiments, the X is O.
  • the sense strand comprises the nucleotide sequence gsuscaucCfaCfAfAfugagaguaca wherein the 3' end of the sense strand is conjugated to L96 (N- [tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol Hyp-(GalNAc-alkyl)3) and the antisense strand comprises the nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa; wherein chemical modifiecations are defined as follows: a is 2'-O-methyladenosine-3 ’-phosphate, c is 2'-O- methylcytidine-3 ’-phosphate, g is 2'-O-methylguanosine-3 ’ -phosphate, u is 2'-O-methyluridine-3'- phosphate, Af is 2 ’-fluoroadenosine
  • the double stranded RNAi agent, or salt thereof is administered at a dose of 50 mg to 500 mg per dose. In certain embodiments, the double stranded RNAi agent, or salt thereof, is administered at a dose of 50 to 400 mg per dose. In certain embodi double stranded RNAi ments, the double stranded RNAi agent, or salt thereof, is administered at a dose of 50 to 300 mg per dose.
  • the double stranded RNAi agent, or salt thereof is administered at fixed dose of about 50 mg to about 200 mg. In other embodiments, the double stranded RNAi agent, or salt thereof, is administered at a fixed dose of about 200 mg to about 400 mg. In some embodiments, the double stranded RNAi agent, or salt thereof, is administered at a fixed dose of about 400 mg to about 800 mg.
  • the double stranded RNAi agent, or salt thereof is administered at a fixed dose of about 100 mg. In some embodiments, the double stranded RNAi agent, or salt thereof, is administered at a fixed dose of about 200 mg. In some embodiments, the double stranded RNAi agent, or salt thereof, is administered at a fixed dose of about 300 mg. In some embodiments, the double stranded RNAi agent, or salt thereof, is administered at a fixed dose of about 400 mg. In some embodiments, the double stranded RNAi agent, or salt thereof, is administered at a fixed dose of about 500 mg. In other embodiments, the double stranded RNAi agent, or salt thereof, is administered at fixed dose of about 600 mg.
  • the double stranded RNAi agent, or salt thereof is administered ata fixed dose of about 800 mg.
  • the pharmaceutical composition is administered at a frequency of once per month to once per six months.
  • the pharamaceutical composition is administered at a frequency of once per month to once per three months.
  • the pharmaceutical composition is administered at a frequency of once per three months to once per six months.
  • the pharmaceutical composition is administered to the subject at an interval of once a month.
  • the pharmaceutical composition is administered to the subject at an interval of once a quarter.
  • the pharmaceutical composition is administered to the subject at an interval of bianually.
  • the double stranded RNAi agent is administered at a dose of 50 to 400 mg per dose at a frequency of once per month to once per six months.
  • the AGT lassociated disorder is selected from the group consisting of high blood pressure, hypertension, borderline hypertension, primary hypertension, secondary hypertension isolated systolic or diastolic hypertension, pregnancy-associated hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vasculopathy, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiac myopathy, nocturnal hypotension, glomerulos
  • the subject has a systolic blood pressure of at least 130 mm Hg or a diastolic blood pressure of at least 80 mm Hg. In certain embodiments, the subject has a systolic blood pressure of at least 140 mm Hg and a diastolic blood pressure of at least 80 mm Hg. In certain embodiments, the subject is part of a group susceptible to salt sensitivity, is overweight, is obese, is pregnant, is planning to become pregnant, has type 2 diabetes, or has type 1 diabetes. In certain embodiments, the subject has an AGT-associated disorder and is further part of a group susceptible to salt sensitivity, is overweight, is obese, is pregnant, is planning to become pregnant, has type 2 diabetes, or has type 1 diabetes.
  • subject has reduced kidney function.
  • subject has an AGT-associated disorder and is further has reduced kidney function.
  • pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
  • the pharmaceutical composition is for administration by subcutaneous or intravenous injection.
  • the invention further provides for the use of a pharmaceutical composition of any in a method of treating an AGT-associated disorder or for use in the method of preparation of a medicament for use in a method of treating an AGT-associated disorder.
  • Figure 1 is a graph showing percent change in serum AGT relative to AGT baseline at day 0 after a single placebo, 10 mg, 25 mg, 50 mg, 100 mg, or 200 mg subcutaneous dose of AD-85481.
  • Figure 2 is a graph showing changes in systolic blood pressure (SBP) and diastolic blood pressure (DBP) at Week 8 relative to baseline after a single placebo, 10 mg, 25 mg, 50 mg, 100 mg, or 200 mg subcutaneous dose of AD-85481. The number of subjects in each group are shown along the x axis.
  • SBP systolic blood pressure
  • DBP diastolic blood pressure
  • the present invention provides methods for inhibiting the expression of an angiotensinogen (AGT) gene.
  • AGT angiotensinogen
  • the present invention also provides methods for treating a subject having a disorder that would benefit from reduction in AGT expression, or treating an AGT-associated disorder in a subject.
  • the present invention provides methods for decreasing blood pressure level in a subject.
  • the methods include administering to the subject a fixed dose, e.g., about 50 mg to about 800 mg, of a double stranded RNAi agent, or salt thereof, targeting AGT, as described herein.
  • the following detailed description discloses methods for inhibiting the expression of an AGT gene, methods for treating subjects that would benefit from reduction of the expression of an AGT gene, e.g., subjects susceptible to or diagnosed with an AGT-associated disorder, e.g., hypertension, using an double stranded RNAi agent, or salt thereof, targeting AGT, and pharmaceutical compositions comprising fixed doses of such RNAi agents, or salt thereof, for inhibiting the expression of an AGT gene.
  • an element means one element or more than one element, e.g., a plurality of elements.
  • sense strand or antisense strand is understood as “sense strand or antisense strand or sense strand and antisense strand.”
  • the term “about” is used herein to mean within the typical ranges of tolerances in the art. For example, “about” can be understood as about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.
  • the term “at least” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer.
  • “at least 19 nucleotides of a 21 nucleotide nucleic acid molecule” means that 19, 20, or 21 nucleotides have the indicated property.
  • “at least” can modify each of the numbers in the series or range.
  • nucleotide overhang As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex with an overhang of “no more than 2 nucleotides” has a 2, 1 , or 0 nucleotide overhang. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range. As used herein, ranges include both the upper and lower limit.
  • nucleotide sequence recited in the specification takes precedence.
  • angiotensinogen used interchangeably with the term “AGT” refers to the well-known gene and polypeptide, also known in the art as Serpin Peptidase Inhibitor, Clade A, Member 8; Alpha- 1 Antiproteinase; Antitrypsin; SERPINA8; Angiotensin I; Serpin A8; Angiotensin II; Alpha-1 Antiproteinase angiotensinogen; antitrypsin; pre-angiotensinogen2; ANHU; Serine Proteinase Inhibitor; and Cysteine Proteinase Inhibitor.
  • AGT includes human AGT, the amino acid and complete coding sequence of which may be found in for example, GenBank Accession No. GI: 188595658 (NM_000029.3; SEQ ID NO: 1); Macaca fascicularis AGT, the amino acid and complete coding sequence of which may be found in for example, GenBank Accession No. GI: 90075391 (AB170313.1: SEQ ID NOG); mouse (MILS musculus) AGT, the amino acid and complete coding sequence of which may be found in for example, GenBank Accession No.
  • AGT RNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, OMIM, and the Macaca genome project web site.
  • GenBank e.g., GenBank
  • UniProt e.g., UniProt
  • OMIM e.g., UniProt
  • Macaca genome project web site e.g., GenBank, UniProt, OMIM
  • AGT also refers to naturally occurring DNA sequence variations of the AGT gene, such as a single nucleotide polymorphism (SNP) in the AGT gene.
  • SNPs single nucleotide polymorphism
  • Non-limiting examples of sequence variations within the AGT gene include, for example, those described in U.S. Patent No.
  • sequence variations within the AGT gene may include as a C ⁇ T at position -532 (relative to the transcription start site); a G ⁇ A at position -386; a G ⁇ A at position -218; a C ⁇ T at position -18; a G ⁇ A and a A ⁇ C at position -6 and -10; a C ⁇ T at position +10 (untanslated); a C ⁇ T at position +521 (T174M); a T ⁇ C at position +597 (P199P); a T ⁇ C at position +704 (M235T; also see, e.g., Reference SNP (refSNP) Cluster Report: rs699, available at www.ncbi.nlm.nih.gov/SNP); a A ⁇ G at position +743 (Y248C); a C ⁇ T at position +813 (N271N); a G ⁇ A at position +1017 (L
  • target sequence refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an AGT gene, including mRNA that is a product of RNA processing of a primary transcription product.
  • the target portion of the sequence will be at least long enough to serve as a substrate for iRNA-directed cleavage at or near that portion of the nucleotide sequence of an mRNA molecule formed during the transcription of an AGT gene.
  • the target sequence is within the protein coding region of AGT.
  • the target sequence may be from about 19-36 nucleotides in length, e.g., preferably about 19- 30 nucleotides in length.
  • the target sequence can be about 19-30 nucleotides, 19-30, 19- 29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.
  • strand comprising a sequence refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.
  • G,” “C,” “A,” “T,” and “U” each generally stand for a nucleotide that contains guanine, cytosine, adenine, thymidine, and uracil as a base, respectively.
  • ribonucleotide or “nucleotide” can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety (see, e.g., Table 2).
  • nucleotide comprising inosine as its base can base pair with nucleotides containing adenine, cytosine, or uracil.
  • nucleotides containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of dsRNA featured in the invention by a nucleotide containing, for example, inosine.
  • adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil, respectively to form G-U Wobble base pairing with the target mRNA. Sequences containing such replacement moieties are suitable for the compositions and methods featured in the invention.
  • RNAi agent refers to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway.
  • RISC RNA-induced silencing complex
  • iRNA directs the sequence -specific degradation of mRNA through a process known as RNA interference (RNAi).
  • RNAi RNA interference
  • the iRNA modulates, e.g., inhibits, the expression of an AGT gene in a cell, e.g., a cell within a subject, such as a mammalian subject, preferably a human subject.
  • an RNAi agent of the invention includes a single stranded RNA that interacts with a target RNA sequence, e.g., an AGT target mRNA sequence, to direct the cleavage of the target RNA.
  • a target RNA sequence e.g., an AGT target mRNA sequence
  • Dicer a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485).
  • Dicer a ribonuclease-III-like enzyme, processes the dsRNA into 19- 23 base pair short interfering RNAs with characteristic two base 3' overhangs (Bernstein, et al,
  • siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al, (2001) Cell 107:309).
  • RISC RNA-induced silencing complex
  • one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al, (2001) Genes Dev. 15:188).
  • the invention relates to a single stranded RNA (siRNA) generated within a cell and which promotes the formation of a RISC complex to effect silencing of the target gene, i.e., an AGT gene.
  • siRNA is also used herein to refer to an iRNA as described above.
  • the RNAi agent may be a single-stranded siRNA (ssRNAi) that is introduced into a cell or organism to inhibit a target mRNA.
  • Single-stranded RNAi agents bind to the RISC endonuclease, Argonaute 2, which then cleaves the target mRNA.
  • the single -stranded siRNAs are generally 15-30 nucleotides and are chemically modified. The design and testing of single- stranded siRNAs are described in U.S. Patent No. 8,101,348 and in Lima et al, (2012) Cell 150:883- 894, the entire contents of each of which are hereby incorporated herein by reference. Any of the antisense nucleotide sequences described herein may be used as a single -stranded siRNA as described herein or as chemically modified by the methods described in Lima et al, (2012) Cell 150:883-894.
  • an “iRNA” for use in the compositions, uses, and methods of the invention is a double stranded RNA and is referred to herein as a “double stranded RNA agent,” “double stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”.
  • dsRNA refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., an AGT gene.
  • a double stranded RNA triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene -silencing mechanism referred to herein as RNA interference or RNAi.
  • nucleotides of each strand of a dsRNA molecule are non- ribonucleotides, e.g., a deoxyribonucleotide or a modified nucleotide.
  • an “iRNA” may include ribonucleotides with chemical modifications; an iRNA may include substantial modifications at multiple nucleotides.
  • modified nucleotide refers to a nucleotide having, independently, a modified sugar moiety, a modified intemucleotide linkage, or modified nucleobase, or any combination thereof.
  • modified nucleotide encompasses substitutions, additions, or removal of, e.g., a functional group or atom, to intemucleoside linkages, sugar moieties, or nucleobases.
  • modifications suitable for use in the agents of the invention include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by “iRNA” or “RNAi agent” for the purposes of this specification and claims.
  • the duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 19 to 36 base pairs in length, e.g., about 19-30 base pairs in length, for example, about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 base pairs in length, such as about 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19- 23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length.
  • the duplex region is 19-21 base pairs in length. Ranges and lengths intermediate to the above recited ranges and lengths are also contemplated to be part of the invention.
  • the two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3'-end of one strand and the 5' -end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a “hairpin loop.”
  • a hairpin loop can comprise at least one unpaired nucleotide. In some embodiments, the hairpin loop can comprise at least 4, 5, 6, 7, 8, 9, 10, 20, 23, or more unpaired nucleotides. In some embodiments, the hairpin loop can be 10 or fewer nucleotides.
  • the hairpin loop can be 8 or fewer unpaired nucleotides. In some embodiments, the hairpin loop can be 4-10 unpaired nucleotides. In some embodiments, the hairpin loop can be 4-8 nucleotides.
  • RNA molecules where the two substantially complementary strands of a dsRNA are comprised by separate RNA molecules, those molecules need not be, but can be covalently connected.
  • the connecting structure is referred to as a “linker.”
  • the RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex.
  • an RNAi may comprise one or more nucleotide overhangs.
  • an iRNA agent of the invention is a dsRNA, each strand of which comprises 19-23 nucleotides, that interacts with a target RNA sequence, e.g., an AGT gene, to direct cleavage of the target RNA.
  • a target RNA sequence e.g., an AGT gene
  • an iRNA of the invention is a dsRNA of 24-30 nucleotides that interacts with a target RNA sequence, e.g. , an AGT target mRNA sequence, to direct the cleavage of the target RNA.
  • nucleotide overhang refers to at least one unpaired nucleotide that protrudes from the duplex structure of a double stranded iRNA. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa, there is a nucleotide overhang.
  • a dsRNA can comprise an overhang of at least one nucleotide; alternatively, the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more.
  • a nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside.
  • the overhang(s) can be on the sense strand, the antisense strand, or any combination thereof.
  • the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end, or both ends of either an antisense or sense strand of a dsRNA.
  • the antisense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide, overhang at the 3'-end or the 5'-end.
  • the overhang on the sense strand or the antisense strand, or both can include extended lengths longer than 10 nucleotides, e.g., 1-30 nucleotides, 2-30 nucleotides, 10-30 nucleotides, 10-25 nucleotides, 10-20 nucleotides, or 10-15 nucleotides in length.
  • an extended overhang is on the sense strand of the duplex.
  • an extended overhang is present on the 3' end of the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 5'end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 3' end of the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 5' end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the extended overhang is replaced with a nucleoside thiophosphate. In certain embodiments, the overhang includes a self-complementary portion such that the overhang is capable of forming a hairpin structure that is stable under physiological conditions.
  • RNAi agents of the invention include RNAi agents with no nucleotide overhang at one end (/. e. , agents with one overhang and one blunt end) or with no nucleotide overhangs at either end. Most often such a molecule will be double-stranded over its entire length.
  • antisense strand or "guide strand” refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., an AGT mRNA.
  • region of complementarity refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., an AGT nucleotide sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g.
  • a double stranded RNA agent of the invention includes a nucleotide mismatch in the antisense strand.
  • a double stranded RNA agent of the invention includes a nucleotide mismatch in the sense strand.
  • the nucleotide mismatch is, for example, within 5, 4, 3 nucleotides from the 3' -end of the iRNA.
  • the nucleotide mismatch is, for example, in the 3' -terminal nucleotide of the iRNA.
  • sense strand or “passenger strand” as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.
  • nucleotides are modified are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides.
  • cleavage region refers to a region that is located immediately adjacent to the cleavage site.
  • the cleavage site is the site on the target at which cleavage occurs.
  • the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site.
  • the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site.
  • the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13.
  • Complementary sequences within an iRNA include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences.
  • Such sequences can be referred to as “fully complementary” with respect to each other herein.
  • first sequence is referred to as “substantially complementary” with respect to a second sequence herein
  • the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3, or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RISC pathway.
  • two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity.
  • a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein.
  • “Complementary” sequences can also include, or be formed entirely from, non-Watson-Crick base pairs or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled.
  • Such non-Watson- Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing.
  • a polynucleotide that is “substantially complementary to at least part of’ a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g. , an mRNA encoding an AGT gene).
  • mRNA messenger RNA
  • a polynucleotide is complementary to at least a part of an AGT mRNA if the sequence is substantially complementary to a non -interrupted portion of an mRNA encoding an AGT gene.
  • the sense strand polynucleotides and the antisense polynucleotides disclosed herein are fully complementary to the target AGT sequence.
  • the sense strand polynucleotides or the antisense polynucleotides disclosed herein are substantially complementary to the target AGT sequence and comprise a contiguous nucleotide sequence which is at least 80% complementary over its entire length to the equivalent region of the nucleotide sequence of any one of SEQ ID NOs: 1 and 2, or a fragment of any one of SEQ ID NOs: 1 and 2, such as at least 90%, or 95% complementary; or 100% complementary.
  • the antisense strand polynucleotides disclosed herein are fully complementary to the target AGT sequence.
  • the antisense strand polynucleotides disclosed herein are substantially complementary to the target AGT sequence and comprise a contiguous nucleotide sequence which is at least about 90% complementary over its entire length to the equivalent region of the nucleotide sequence of SEQ ID NO: 1, or a fragment of SEQ ID NO: 1, such as about 90%, or about 95%, complementary.
  • the fragment of SEQ ID NO: 1 is nucleotides 638-658 of SEQ ID NO: 1.
  • the nucleotide sequence of the antisense strand of an iRNA of the invention comprises at least 19 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9).
  • the iRNA of the invention further comprises a sense strand comprising at least 19 contiguous nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).
  • the nucleotide sequence of the antisense strand of an iRNA of the invention comprises the nucletodies sequence UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9).
  • the iRNA of the invention further comprises a sense strand comprising the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).
  • the nucleotide sequence of the antisense strand of an iRNA of the invention consists of UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 9).
  • the iRNA of the invention further comprises a sense strand wherein the nucleotide sequence of the strand consists of the nucleotide sequence GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 10).
  • the modified nucleotide sequence of the antisense strand of an iRNA of the invention comprises at least 19 contiguous nucleotides of the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11).
  • the iRNA of the invention further comprises a sense strand comprising a modified nucleotide sequence comprising at least 19 contiguous nucleotides of gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).
  • a is 2'-O-methyladenosine-3' -phosphate
  • c is 2'-O- methylcytidine-3'-phosphate
  • g is 2'-O-methylguanosine-3' -phosphate
  • u is 2'-O-methyluridine-3'- phosphate
  • Af is 2'-fluoroadenosine-3'-phosphate
  • Gf is 2'- fluoroguanosine-3'-phosphate
  • Uf is 2 , -fluorouridine-3'-phosphate
  • Tgn is thymidine-glycol nucleic acid (GNA) S-isomer
  • s is phosphorothioate linkage; and wherein the 3' end of the sense strand is optionally covalently linked to a ligand, e.g., an N-[tris(GalNAc-alkyl)
  • the modified nucleotide sequence of the antisense strand of an iRNA of the invention comprises the modified nucleotide sequence usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11).
  • the iRNA of the invention further comprises a sense strand comprising the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).
  • the modified nucleotide sequence of the antisense strand of an iRNA of the invention consists of usGfsuac(Tgn)cucauugUfgGfaugacsgsa (SEQ ID NO: 11).
  • the iRNA of the invention further comprises a sense strand wherein the modified nucleotide sequence of the sense strand consists of the modified nucleotide sequence gsuscaucCfaCfAfAfugagaguaca (SEQ ID NO: 12).
  • an “iRNA” includes ribonucleotides with chemical modifications. Such modifications may include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a dsRNA molecule, are encompassed by “iRNA” for the purposes of this specification and claims.
  • an agent for use in the methods and compositions of the invention is a single -stranded antisense oligonucleotide molecule that inhibits a target mRNA via an antisense inhibition mechanism.
  • the single -stranded antisense oligonucleotide molecule is complementary to a sequence within the target mRNA.
  • the single-stranded antisense oligonucleotides can inhibit translation in a stoichiometric manner by base pairing to the mRNA and physically obstructing the translation machinery, see Dias, N. et al, (2002) Mol Cancer Ther 1:347- 355.
  • the single-stranded antisense oligonucleotide molecule may be about 14 to about 30 nucleotides in length and have a sequence that is complementary to a target sequence.
  • the single- stranded antisense oligonucleotide molecule may comprise a sequence that is at least about 14, 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from any one of the antisense sequences described herein.
  • contacting a cell with an iRNA includes contacting a cell by any possible means.
  • Contacting a cell with an iRNA includes contacting a cell in vitro with the iRNA or contacting a cell in vivo with the iRNA.
  • the contacting may be done directly or indirectly.
  • the iRNA may be put into physical contact with the cell by the individual performing the method, or alternatively, the iRNA may be put into a situation that will permit or cause it to subsequently come into contact with the cell.
  • Contacting a cell in vitro may be done, for example, by incubating the cell with the iRNA.
  • Contacting a cell in vivo may be done, for example, by injecting the iRNA into or near the tissue where the cell is located, or by injecting the iRNA into another area, e.g. , the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located.
  • the iRNA may contain or be coupled to a ligand, e.g., GalNAc, that directs the iRNA to a site of interest, e.g. , the liver.
  • a ligand e.g., GalNAc
  • Combinations of in vitro and in vivo methods of contacting are also possible.
  • a cell may also be contacted in vitro with an iRNA and subsequently transplanted into a subject.
  • contacting a cell with an iRNA includes “introducing” or “delivering the iRNA into the cell” by facilitating or effecting uptake or absorption into the cell.
  • Absorption or uptake of an iRNA can occur through unaided diffusion or active cellular processes, or by auxiliary agents or devices.
  • Introducing an iRNA into a cell may be in vitro or in vivo.
  • iRNA can be injected into a tissue site or administered systemically.
  • In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection. Further approaches are described herein below or are known in the art.
  • lipid nanoparticle is a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, e.g., an iRNA or a plasmid from which an iRNA is transcribed.
  • a pharmaceutically active molecule such as a nucleic acid molecule, e.g., an iRNA or a plasmid from which an iRNA is transcribed.
  • LNPs are described in, for example, U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are hereby incorporated herein by reference.
  • a “subject” is an animal, such as a mammal, including a primate (such as a human, a non-human primate, e.g. , a monkey, and a chimpanzee), or a non-primate (such as a cow, a pig, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, or a mouse) that expresses the target gene, either endogenously or heterologously.
  • a primate such as a human, a non-human primate, e.g. , a monkey, and a chimpanzee
  • a non-primate such as a cow, a pig, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, or a mouse
  • the subject is a human, such as a human being treated or assessed for a disease or disorder that would benefit from reduction in AGT expression; a human at risk for a disease or disorder that would benefit from reduction in AGT expression; a human having a disease or disorder that would benefit from reduction in AGT expression; or human being treated for a disease or disorder that would benefit from reduction in AGT expression as described herein.
  • the diagnostic criteria for an AGT-associated disorder e.g., hypertension, are provided below.
  • the subject is a female human.
  • the subject is a male human.
  • the subject is part of a group susceptible to salt sensitivity, e.g. , black or an older adult (> 65 years of age).
  • the subject is overweight or obese, e.g., a subject that suffers from central obesity.
  • the subject is sedentary.
  • the subject is pregnant or planning to become pregnant.
  • the subject has redueced kidney function.
  • the subject has type 1 diabetes.
  • the subject has type 2 diabetes.
  • treating refers to a beneficial or desired result, such as reducing at least one sign or symptom of an AGT-associated disorder, e.g., hypertension in a subject.
  • Treatment also includes a reduction of one or more sign or symptoms associated with unwanted AGT expression, e.g., angiotensin II type 1 receptor activation (ATiR) (e.g., hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms, peripheral artery disease, heart disease, increased oxidative stress, e.g., increased superoxide formation, inflammation, vasoconstriction, sodium and water retention, potassium and magnesium loss, renin suppression, myocyte and smooth muscle hypertrophy, increased collagen sysnthesis, stimulation of vascular, myocardial and renal fibrosis, increased rate and force of cardiac contractions, altered heart rate, e.g., increased arrhythmia, stimulation of plasminogen activator inhibitor 1 (PAI1),
  • PAI1 plasminogen activ
  • ATiR activation e.g., hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms, peripheral artery disease, heart disease, increased oxidative stress, e.g., increased superoxide formation, inflammation, vasoconstriction, sodium and water retention, potassium and magnesium loss, renin suppression, myocyte and smooth muscle hypertrophy, increased collagen sysnthesis, stimulation of vascular, myocardial and renal fibrosis, increased rate and force of cardiac contractions, altered heart rate, e.g., increased arrhythmia, stimulation of plasminogen activator inhibitor 1 (PAI1), activation of the sympathetic nervous system, and increased endothelin secretion) whether detectable or undetectable.
  • unwanted ATiR activation e.g., hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms, peripheral artery disease, heart disease, increased oxidative stress, e.g., increased superoxide
  • AGT-associated disorders can also include obesity, liver steatosis/ fatty liver, e.g., non-alcoholic Steatohepatitis (NASH) and non-alcoholic fatty liver disease (NAFLD); glucose intolerance, type 2 diabetes, and metabolic syndrome. “Treatment” can also mean prolonging survival as compared to expected survival in the absence of treatment.
  • NASH non-alcoholic Steatohepatitis
  • NAFLD non-alcoholic fatty liver disease
  • glucose intolerance e.g., type 2 diabetes, and metabolic syndrome.
  • Treatment can also mean prolonging survival as compared to expected survival in the absence of treatment.
  • reduced kidney function can be diagnosed using any of a number of recognized criteria, e.g., glomerular filtration rate (GFR), albuminuria, creatinine, or BUN.
  • GFR glomerular filtration rate
  • albuminuria e.g., albuminuria
  • creatinine e.g., glomerular filtration rate (GFR)
  • BUN glomerular filtration rate
  • reduced kidney function can be transient or chronic.
  • a GFR of at least 60 is considered to be normal.
  • a GFR of 60 or less is indicative of reduced kidney function with a GFR of > 15-60 being indicative of kidney disease, and a GFR of less than 15 is indicative of kidney failure.
  • GFR is typically determined based on urine creatinine levels, with a higher level of creatinine indicative of lower kidney function.
  • the presence of albumin in the urine is also indicative of decreased kidney function.
  • the absolute level of albumin can be determined to diagnose decreased kidney function.
  • the ratio of albumin to creatinine can also be determined to assess kidney function.
  • a urine albumin to creatinine ratio of 30 mg/g or less is indicative of normal kidney function.
  • a urine albumin to creatinine ratio greater than 30 mg/g is indicative of reduced kiney function.
  • the term “lower” in the context of the level of AGT gene expression or agt protein production in a subject, or a disease marker or symptom refers to a statistically significant decrease in such level.
  • the decrease can be, for example, at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or below the level of detection for the detection method in a relevant cell or tissue, e.g., a liver cell, or other subject sample, e.g., blood or serum derived therefrom, urine.
  • “lower” is a reduction of AGT protein in the serum after administration of one or more doses of an iRNA agent provided herein relative to AGT protein level in serum prior to administration of any doses of an iRNA agent provided herein.
  • “prevention” or “preventing,” when used in reference to a disease or disorder, that would benefit from a reduction in expression of an AGT gene or production of agt protein e.g., in a subject susceptible to an AGT-associated disorder due to, e.g., aging, genetic factors, hormone changes, diet, and a sedentary lifestyle, wherein the subject does not yet meet the diagnostic criteria for the AGT-associated disorder.
  • prevention can be understood as administration of an agent to a subject who does not yet meet the diagnostic criteria for the AGT-associated disorder to delay or reduce the likelihood that the subject will develop the AGT-associated disorder.
  • agent is a pharmaceutical agent
  • administration typically would be under the direction of a health care professional capable of identifying a subject who does not yet meet the diagnostic criteria for an AGT-associated disorder as being susceptible to developing an AGT-associated disorder.
  • Diagnosic criteria for hypertension and risk factors for hypertension are provided below.
  • the disease or disorder is e.g., a symptom of unwanted ATiR activation, such as a hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms, peripheral artery disease, heart disease, increased oxidative stress, e.g., increased superoxide formation, inflammation, vasoconstriction, sodium and water retention, potassium and magnesium loss, renin suppression, myocyte and smooth muscle hypertrophy, increased collagen synthesis, stimulation of vascular, myocardial and renal fibrosis, increased rate and force of cardiac contractions, altered heart rate, e.g., increased arrhythmia, stimulation of plasminogen activator inhibitor 1 (PAI1), activation of the sympathetic nervous system, and increased endothelin secretion.
  • a symptom of unwanted ATiR activation such as a hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms, peripheral artery disease, heart disease, increased oxidative stress, e.
  • AGT-associated disorders can also include obesity, liver steatosis/ fatty liver, e.g., non-alcoholic Steatohepatitis (NASH) and non-alcoholic fatty liver disease (NAFLD); glucose intolerance, type 2 diabetes, and metabolic syndrome.
  • the likelihood of developing, e.g., hypertension is reduced, for example, when an individual having one or more risk factors for a hypertension either fails to develop hypertension or develops hypertension with less severity relative to a population having the same risk factors and not receiving treatment as described herein.
  • the failure to develop an AGT-associated disorder, e.g., hypertension or a delay in the time to develop hypertension by months or years is considered effective prevention. Prevention may require administration of more than one dose if the iRNA agent.
  • the iRNA agents provided herein can be used as pharmaceutical agents for or in methods of prevention of AGT-associated diseases. Risk factors for various AGT-associated diseases are discussed below.
  • angiotensinogen -associated disease or “AGT-associated disease,” is a disease or disorder that is caused by, or associated with, renin-angiotensin-aldosterone system (RAAS) activation, or a disease or disorder the symptoms of which or progression of which responds to RAAS inactivation.
  • RAAS renin-angiotensin-aldosterone system
  • angiotensinogen-associated disease includes a disease, disorder, or condition that would benefit from reduction in AGT expression. Such diseases are typically associated with high blood pressure.
  • Non -limiting examples of angiotensinogen-associated diseases include hypertension, e.g., borderline hypertension (also known as prehypertension), primary hypertension (also known as essential hypertension or idiopathic hypertension), secondary hypertension (also known as inessential hypertension), isolated systolic or diastolic hypertension, pregnancy-associated hypertension (e.g., preeclampsia, eclampsia, and post-partum preelampsia), diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension (also known as renal hypertension), Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venouss hypertension, systolic hypertension, labile hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vasculopathy (including peripheral vascular disease), diabetic n
  • AGT- associated disease includes intrauterine growth restriction (IUGR) or fetal growth restriction.
  • AGT-associated disorders can also include obesity, liver steatosis/ fatty liver, e.g., non-alcoholic Steatohepatitis (NASH) and non-alcoholic fatty liver disease (NAFLD); glucose intolerance, type 2 diabetes, and metabolic syndrome, and nocturnal hypotension.
  • NASH non-alcoholic Steatohepatitis
  • NAFLD non-alcoholic fatty liver disease
  • glucose intolerance e.g., type 2 diabetes, and metabolic syndrome, and nocturnal hypotension.
  • Thresholds for high blood pressure and stages of hypertension are discussed in detail below.
  • an angiotensinogen-associated disease is primary hypertension.
  • Primary hypertension is a result of environmental or genetic causes (e.g., a result of no obvious underlying medical cause).
  • an angiotensinogen-associated disease is secondary hypertension.
  • Secondary hypertension has an identifiable underlying disorder which can be of multiple etiologies, including renal, vascular, and endocrine causes, e.g., renal parenchymal disease (e.g., polycystic kidneys, glomerular or interstitial disease), renal vascular disease (e.g., renal artery stenosis, fibromuscular dysplasia), endocrine disorders (e.g., adrenocorticosteroid or mineralocorticoid excess, pheochromocytoma, hyperthyroidism or hypothyroidism, growth hormone excess, hyperparathyroidism), coarctation of the aorta, or oral contraceptive use.
  • renal parenchymal disease e.g., polycystic kidneys, glomerular or interstitial disease
  • renal vascular disease e.g., renal artery stenosis, fibromuscular dysplasi
  • an angiotensinogen-associated disease is pregnancy-associated hypertension, e.g., chronic hypertension of pregnancy, gestational hypertension, preeclampsia, eclampsia, preeclampsia superimposed on chronic hypertension, HELLP syndrome, and gestational hypertension (also known as transient hypertension of pregnancy, chronic hypertension identified in the latter half of pregnancy, and pregnancy-induced hypertension (PIH)). Diagnostic criteria for pregnancy-associated hypertension are provided below.
  • an angiotensinogen-associated disease is resistant hypertension.
  • “Resistant hypertension” is blood pressure that remains above goal (e.g., above 130 mm Hg systolic or above 90 diastolic) in spite of concurrent use of three antihypertensive agents of different classes, one of which is a thiazide diuretic. Subjects whose blood pressure is controlled with four or more medications are also considered to have resistant hypertension.
  • a "therapeutically-effective amount” or “prophylactically effective amount” also includes an amount of an RNAi agent that produces some desired effect at a reasonable benefit/risk ratio applicable to any treatment.
  • the iRNA employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.
  • phrases "pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human subjects and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • pharmaceutically-acceptable carrier means a pharmaceutically- acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
  • manufacturing aid e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid
  • solvent encapsulating material involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
  • Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated.
  • Pharmaceutically acceptable carriers include carriers for administration by injection.
  • sample includes a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject.
  • biological fluids include blood, serum and serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like.
  • Tissue samples may include samples from tissues, organs, or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be derived from the liver (e.g., whole liver or certain segments of liver or certain types of cells in the liver, such as, e.g., hepatocytes).
  • a “sample derived from a subject” refers to urine obtained from the subject.
  • a “sample derived from a subject” can refer to blood or blood derived serum or plasma from the subject.
  • the present invention provides methods for inhibiting the expression of an angiotensinogen (AGT) gene.
  • the present invention also provides methods for treating a subject that would benefit from reduction in AGT expression (such as a subject at risk of developing an AGT-associated disorder, e.g., hypertension), or treating an AGT-associated disorder, e.g., hypertension, in a subject.
  • the present invention provides methods for decreasing blood pressure level in a subject, such as a subject having an AGT-associate disorder, e.g., hypertension.
  • the methods include administering to the subject a fixed dose, e.g., about 50 mg to about 800 mg, of a double stranded RNAi agent targeting AGT, as described herein.
  • the present invention provides a methods of inhibiting the expression of an angiotensinogen (AGT) gene in a subject.
  • the method comprises administering to the subject a fixed dose of about 50 mg to about 800 mg, e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg, of a double-stranded ribonucleic acid (RNAi) agent that inhibits expression of AGT.
  • RNAi double-strande
  • inhibitor is used interchangeably with “reducing,” “silencing,” “downregulating”, “suppressing”, and other similar terms, and includes any level of inhibition.
  • the phrase “inhibiting expression of an AGT” is intended to refer to inhibition of expression of any AGT gene (such as, e.g., a mouse AGT gene, a rat AGT gene, a monkey AGT gene, or a human AGT gene) as well as variants or mutants of an AGTgene.
  • the AGT gene may be a wild-type AGT gene, a mutant AGT gene, or a transgenic AGT gene in the context of a genetically manipulated cell, group of cells, or organism.
  • “Inhibiting expression of an AGT gene” includes any level of inhibition of an AGT gene, e.g., at least partial suppression of the expression of an AGT gene.
  • the expression of the AGT gene may be assessed based on the level, or the change in the level, of any variable associated with AGT gene expression, e.g., AGT mRNA level or AGT protein level. This level may be assessed in an individual cell or in a group of cells, including, for example, a sample derived from a subject. It is understood that AGT is expressed predominantly in the liver, but also in the brain, gall bladder, heart, and kidney, and is present in circulation.
  • Inhibition may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with AGT expression compared with a control level.
  • the control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control).
  • expression of an AGT gene is inhibited by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to below the level of detection of the assay.
  • expression of an AGT gene is inhibited by at least 50%. It is further understood that inhibition of AGT expression in certain tissues, e.g., in liver, without a significant inhibition of expression in other tissues, e.g., brain, may be desirable.
  • expression level is determined using the assay method provided in Example 2 of PCT Application No. PCT/US2019/032150 with a 10 nM siRNA concentration in the appropriate species matched cell line.
  • inhibition of expression in vivo is determined by knockdown of the human gene in a rodent expressing the human gene, e.g., an AAV-infected mouse expressing the human target gene (i. e. , AGT), e.g. , when administered a single dose at 3 mg/kg at the nadir of RNA expression.
  • AGT human target gene
  • Knockdown of expression of an endogenous gene in a model animal system can also be determined, e.g. , after administration of a single dose at 3 mg/kg at the nadir of RNA expression.
  • RNA expression in liver is determined using the PCR methods provided in Example 2 of PCT Application No. PCT/US2019/032150.
  • Inhibition of the expression of an AGT gene may be manifested by a reduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which an AGT gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an iRNA of the invention, or by administering an iRNA of the invention to a subject in which the cells are or were present) such that the expression of an AGT gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s) not treated with an iRNA or not treated with an iRNA targeted to the gene of interest).
  • the inhibition is assessed by the method provided in Example 2 of PCT Application No. PCT/US2019/032150 using a 10nM siRNA concentration in the species matched cell line and expressing the level of mRNA in treated cells as a percentage of the level of mRNA in control cells, using the following formula: ( )
  • inhibition of the expression of an AGT gene may be assessed in terms of a reduction of a parameter that is functionally linked to AGT gene expression, e.g., AGT protein level in blood or serum from a subject.
  • AGT gene silencing may be determined in any cell expressing AGT, either endogenous or heterologous from an expression construct, and by any assay known in the art.
  • Inhibition of the expression of an AGT protein may be manifested by a reduction in the level of the AGT protein that is expressed by a cell or group of cells or in a subject sample (e.g., the level of protein in a blood sample derived from a subject).
  • the inhibition of protein expression levels in a treated cell or group of cells may similarly be expressed as a percentage of the level of protein in a control cell or group of cells, or the change in the level of protein in a subject sample, e.g., blood or serum derived therefrom.
  • a control cell, a group of cells, or subject sample that may be used to assess the inhibition of the expression of an AGT gene includes a cell, group of cells, or subject sample that has not yet been contacted with an RNAi agent of the invention.
  • the control cell, group of cells, or subject sample may be derived from an individual subject (e.g., a human or animal subject) prior to treatment of the subject with an RNAi agent or an appropriately matched population control.
  • the level of AGT mRNA that is expressed by a cell or group of cells may be determined using any method known in the art for assessing mRNA expression.
  • the level of expression of AGT in a sample is determined by detecting a transcribed polynucleotide, or portion thereof, e.g., mRNA of the AGT gene.
  • RNA may be extracted from cells using RNA extraction techniques including, for example, using acid phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy TM RNA preparation kits (Qiagen®) or PAXgene TM (PreAnalytix TM , Switzerland).
  • Typical assay formats utilizing ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays, northern blotting, in situ hybridization, and microarray analysis.
  • the level of expression of AGT is determined using a nucleic acid probe.
  • probe refers to any molecule that is capable of selectively binding to a specific AGT. Probes can be synthesized by one of skill in the art or derived from appropriate biological preparations. Probes may be specifically designed to be labeled. Examples of molecules that can be utilized as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.
  • Isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or northern analyses, polymerase chain reaction (PCR) analyses and probe arrays.
  • One method for the determination of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to AGT mRNA.
  • the mRNA is immobilized on a solid surface and contacted with a probe, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose.
  • the probe(s) are immobilized on a solid surface and the mRNA is contacted with the probe(s), for example, in an Affymetrix® gene chip array.
  • a skilled artisan can readily adapt known mRNA detection methods for use in determining the level of AGT mRNA.
  • An alternative method for determining the level of expression of AGT in a sample involves the process of nucleic acid amplification or reverse transcriptase (to prepare cDNA) of for example mRNA in the sample, e.g., by RT-PCR (the experimental embodiment set forth in Mullis, 1987, U.S. Patent No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self sustained sequence replication (Guatelli etal. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh etal. (1989 ) Proc. Natl. Acad. Sci.
  • the level of expression of AGT is determined by quantitative fluorogenic RT-PCR (i.e.. the TaqManTM System). In preferred embodiments, expression level is determined by the method provided in Example 2 of PCT Application No. PCT/US2019/032150 using a lOnM siRNA concentration in the species matched cell line.
  • the level of AGT protein expression may be determined using any method known in the art for the measurement of protein levels. Such methods include, for example, high performance liquid chromatography (HPLC), absorption spectroscopy, a colorimetric assays, spectrophotometric assays, flow cytometry, immunoelectrophoresis, western blotting, radioimmunoassay (RIA), enzyme -linked immunosorbent assays (ELISAs), immunofluorescent assays, electrochemiluminescence assays, and the like.
  • HPLC high performance liquid chromatography
  • absorption spectroscopy a colorimetric assays
  • spectrophotometric assays spectrophotometric assays
  • flow cytometry flow cytometry
  • immunoelectrophoresis western blotting
  • radioimmunoassay RIA
  • ELISAs enzyme -linked immunosorbent assays
  • immunofluorescent assays electrochemiluminescence assays, and the like.
  • a puncture liver biopsy sample serves as the tissue material for monitoring the reduction in the AGT gene or protein expression.
  • a blood sample serves as the subject sample for monitoring the reduction in the agt protein expression.
  • the iRNA is administered to a subject such that the iRNA is delivered to a specific site within the subject.
  • the inhibition of expression of AGT may be assessed using measurements of the level or change in the level of AGT mRNA or agt protein in a sample derived from fluid or tissue from the specific site within the subject (e.g., liver or blood).
  • the terms detecting or determining a level of an analyte are understood to mean performing the steps to determine if a material, e.g., protein, RNA, is present.
  • methods of detecting or determining include detection or determination of an analyte level that is below the level of detection for the method used.
  • the present invention provides a method of treating a subject having an AGT-associated disorder, e.g., high blood pressure, e.g., hypertension.
  • the method comprises administering to the subject a fixed dose of about 50 mg to about 800 mg, e.g., about 50-200 mg, about 200-400 mg, about 400-800 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg, of a double-stranded ribonucleic acid (RNAi) agent that inhibits expression of AGT.
  • RNAi double-stranded ribonucleic acid
  • the AGT lassociated disorder is selected from the group consisting of high blood pressure, hypertension, borderline hypertension, primary hypertension, secondary hypertension isolated systolic or diastolic hypertension, pregnancy-associated hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vasculopathy, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiac myopathy, nocturnal hypotension, glomerulosclerosis, coarctation of the aorta, aortic aneurism, ventricular fibrosis, heart failure, myocardial infarction, angina
  • the AGT-associate disorder is hypertension.
  • the hypertension is borderline hypertension, primary hypertension, secondary hypertension isolated systolic or diastolic hypertension, pregnancy-associated hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, labile hypertension; hypertensive heart disease, or hypertensive nephropathy.
  • the present invention provides a method of treating a subject that would benefit from reduction in AGT expression.
  • the method comprises administering to the subject a fixed dose of about 50 mg to about 800 mg, e.g., about 50-200 mg, about 200-400 mg, about 400-800 mg, e.ghyroid about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg, of a double-stranded ribonucleic acid (RNAi) agent that inhibits expression of AGT.
  • RNAi double-stranded ribonucleic acid
  • the present invention provides a method of decreasing blood pressure level, e.g., systolic blood pressure and/or diastolic blood pressure, in a subject.
  • the method comprises administering to the subject a fixed dose of about 50 mg to about 800 mg, e.g., about 50-200 mg, about 200-400 mg, about 400-800 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500,
  • RNAi double -stranded ribonucleic acid
  • a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as subject having an AGT-associated disorder), may be contacted with the siRNA in vitro or in vivo, i. e.. the cell may be within a subject.
  • a subject such as a human subject (e.g., a subject in need thereof, such as subject having an AGT-associated disorder)
  • the siRNA in vitro or in vivo, i. e.. the cell may be within a subject.
  • a cell suitable for treatment using the methods of the invention may be any cell that expresses an AGT gene, e.g. , a liver cell, a brain cell, a gall bladder cell, a heart cell, or a kidney cell, but preferably a liver cell.
  • a cell suitable for use in the methods of the invention may be a mammalian cell, e.g., a primate cell (such as a human cell, including human cell in a chimeric non-human animal, or a non-human primate cell, e.g. , a monkey cell or a chimpanzee cell), or a non-primate cell.
  • the cell is a human cell, e.g., a human liver cell.
  • AGT expression is inhibited in the cell by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or to a level below the level of detection of the assay.
  • a dsRNA agent targeting AGT is administered to a subject such that AGT levels, e.g., in a cell, tissue, blood, urine or other tissue or fluid of the subject are reduced by at least about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 62%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 7
  • a dsRNA agent targeting AGT is administered to a subject such that the blood pressure levels, e.g., systolic blood pressure and/or diastolic blood pressure, of the subject are reduced by at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mmHg or more.
  • Administration of the dsRNA agent according to the methods and uses of the invention may result in a reduction of the severity, signs, symptoms, and/or markers of such diseases or disorders in a patient with primary hyperoxaluria.
  • reduction in this context is meant a statistically significant decrease in such level.
  • the reduction can be, for example, at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or about 100%.
  • Efficacy of treatment or prevention of disease can be assessed, for example by measuring disease progression, disease remission, symptom severity, reduction in pain, quality of life, dose of a medication required to sustain a treatment effect, level of a disease marker or any other measurable parameter appropriate for a given disease being treated or targeted for prevention. It is well within the ability of one skilled in the art to monitor efficacy of treatment or prevention by measuring any one of such parameters, or any combination of parameters.
  • efficacy of treatment of primary hyperoxaluria may be assessed, for example, by periodic monitoring of oxalate levels in the subject being treated. Comparisons of the later measurements with the initial measurements provide a physician an indication of whether the treatment is effective.
  • a favorable change of at least 10% in a measurable parameter of disease can be indicative of effective treatment.
  • Efficacy for a given dsRNA agent drug or formulation of that drug can also be judged using an experimental animal model for the given disease as known in the art.
  • efficacy of treatment is evidenced when a statistically significant reduction in a marker or symptom is observed. Any positive change resulting in e.g., lessening of severity of disease measured using the appropriate scale, represents adequate treatment using a dsRNA agent or dsRNA agent formulation as described herein.
  • the in vivo methods of the invention may include administering to a subject a composition containing an iRNA, where the iRNA includes a nucleotide sequence that is complementary to at least a part of an RNA transcript of the AGT gene of the mammal to which the RNAi agent is to be administered.
  • the composition can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration.
  • the compositions are administered by intravenous infusion or injection.
  • the compositions are administered by subcutaneous injection. In certain embodiments, the compositions are administered by intramuscular injection. In some embodiments, the administration is via a depot injection.
  • a depot injection may release the dsRNA agent in a consistent way over a prolonged time period. Thus, a depot injection may reduce the frequency of dosing needed to obtain a desired effect, e.g., a desired inhibition of AGT, or a therapeutic or prophylactic effect.
  • a depot injection may also provide more consistent serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the depot injection is a subcutaneous injection.
  • the administration is via a pump.
  • the pump may be an external pump or a surgically implanted pump.
  • the pump is a subcutaneously implanted osmotic pump.
  • the pump is an infusion pump.
  • An infusion pump may be used for intravenous, subcutaneous, arterial, or epidural infusions.
  • the infusion pump is a subcutaneous infusion pump.
  • the pump is a surgically implanted pump that delivers the dsRNA agent to the liver.
  • modes of administration include epidural, intracerebral, intracerebroventricular, nasal administration, intraarterial, intracardiac, intraosseous infusion, intrathecal, and intravitreal, and pulmonary.
  • the mode of administration may be chosen based upon whether local or systemic treatment is desired and based upon the area to be treated.
  • the route and site of administration may be chosen to enhance targeting.
  • the iRNA is preferably administered subcutaneously, i.e., by subcutaneous injection.
  • One or more injections may be used to deliver the desired dose of iRNA to a subject.
  • the injections may be repeated over a period of time.
  • the administration may be repeated on a regular basis.
  • the iRNA is administered about once per month to about once per quarter, i.e., about every three months, or about once per quarter to about twice per year, i.e., about once every six months.
  • the iRNA is administered once per month.
  • the iRNA is administered every three months, or once per quarter.
  • the iRNA is administered every six months or biannually.
  • a dsRNA agent of the invention may be administered in “naked” form, or as a “free dsRNA agent.”
  • a naked dsRNA agent is administered in the absence of a pharmaceutical composition.
  • the naked dsRNA agent may be in a suitable buffer solution.
  • the buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • the pH and osmolarity of the buffer solution containing the dsRNA agent can be adjusted such that it is suitable for administering to a subject.
  • an iRNA of the invention may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation.
  • the RNAi agent may be administered as a pharmaceutical composition in an unbffered solution.
  • the unbuffered solution may comprise saline or water.
  • the RNAi agent may be administered as a pharmaceutical composition in a buffer solution.
  • the buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS).
  • Subjects that would benefit from an inhibition of AGT gene expression are subjects susceptible to or diagnosed with an AGT-associated disease or disorder, e.g., high blood pressure, e.g., hypertension.
  • the subjects may have a systolic blood pressure of at least 130, 135, 140, 145, 150, 155 or 160 mmHg or a diastolic blood pressure of at least 80, 85, 90, 95, 100, 105, 110 mmHg.
  • the subject may be susceptible to salt sensitivity, overweight, obese, pregnant, or planning to become pregnant.
  • the subject may have type 2 diabetes, type 1 diabetes, or have reduced kidney function.
  • the method further comprises administering to the subject an additional therapeutic agent for treatment of hypertension.
  • Exemplary therapeutic agents for use as a combination therapy may include, but are not limited to, a diuretic, an angiotensin converting enzyme (ACE) inhibitor, an angiotensin II receptor antagonist, a beta-blocker, a vasodialator, a calcium channel blocker, an aldosterone antagonist, an alpha2-agonist, a renin inhibitor, an alpha-blocker, a peripheral acting adrenergic agent, a selective D1 receptor partial agonist, a nonselective alpha-adrenergic antagonist, a synthetic, a steroidal antimineralocorticoid agent; a combination of any of the foregoing; and a hypertension therapeutic agent formulated as a combination of agents.
  • ACE angiotensin converting enzyme
  • the additional therapeutic agent comprises an angiotensin II receptor antagonist, e.g., losartan, valsartan, olmesartan, eprosartan, and azilsartan.
  • Administration of the iRNA according to the methods of the invention may result prevention or treatment of an AGT associated disorder disorder, e.g., high blood pressure, e.g., hypertension. Diagnostic criteria for various types of high blood pressure are provided below. III. Diagnostic Criteria, Risk Factors, and Treatments for Hypertension Recently practice guidelines for prevention and treatment of hypertension were revised. Extensive reports were published by Reboussin et al.
  • Blood pressure can be categorized into 4 levels on the basis of average blood pressure measured in a healthcare setting (office pressures): normal, elevated, and stage 1 or 2 hypertension as shown in the table below (from Whelton et al, 2017).
  • Blood pressure indicates blood pressure based on an average of >2 careful readings obtained on >2 occasions. Best practices for obtaining careful blood pressure readings are detailed in Whelton el al, 2017 and are known in the art.
  • This categorization differs from that previously recommended in the JNC 7 report (Chobanian et al; the National High Blood Pressure Education Program Coordinating Committee. Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure. Hypertension. 2003 ;42: 1206-52) with stage 1 hypertension now defined as a systolic blood pressure (SBP) of 130-139 or a diastolic blood pressure (DBP) of 80-89 mm Hg, and with stage 2 hypertension in the present document corresponding to stages 1 and 2 in the JNC 7 report.
  • SBP systolic blood pressure
  • DBP diastolic blood pressure
  • stage 2 hypertension in the present document corresponding to stages 1 and 2 in the JNC 7 report.
  • the rationale for this categorization is based on observational data related to the association between SBP/DBP and cardiovascular disease risk, randomized clinical trials of lifestyle modification to lower blood pressure, and randomized clinical trials of treatment with antihypertens
  • Hypertension is a complex disease that results from a combination of factors including, but not limited to, genetics, lifestyle, diet, and secondary risk factors. Hypertension can also be associated with pregnancy. It is understood that due to the complex nature of hypertension, it is understood that multiple interventions may be required for treatment of hypertension. Moreover, non- pharmacological interventions, including modification of diet and lifestyle, can be useful for the prevention and treatment of hypertension. Further, an intervention may provide a clinical benefit without fully normalizing blood pressure in an individual.
  • Salt sensitivity may be a marker for increased cardiovascular disease and all-cause mortality, independent of blood pressure. Currently, techniques for recognition of salt sensitivity are impractical in a clinical setting. Therefore, salt sensitivity is best considered as a group characteristic.
  • Potassium intake is inversely related to blood pressure and stroke, and a higher level of potassium seems to blunt the effect of sodium on blood pressure.
  • a lower sodium -potassium ratio is associated with a lower blood pressure than that noted for corresponding levels of sodium or potassium on their own.
  • a similar observation has been made for risk of cardiovascular disease.
  • Alcohol consumption has long been associated with high blood pressure. In the US, it has been estimated that alcohol consumption accounts for about 10% of the population burden of hypertension, with the burden being greater in men than women. It is understood that changes in diet or alcohol consumption can be an aspect of prevention or treatment of hypertension. 3.
  • Physical activity There is a well-established inverse correlation between physical activity/ physical fitness and blood pressure levels. Even modest levels of physical activity have been demonstrated to be beneficial in decreasing hypertension. It is understood that an increase in physical activity can be an aspect of prevention or treatment of hypertension. 4.
  • Secondary hypertension can underlie severe elevation of blood pressure, pharmacologically resistant hypertension, sudden onset of hypertension, increased blood pressure in patients with hypertension previously controlled on drug therapy, onset of diastolic hypertension in older adults, and target organ damage disproportionate to the duration or severity of the hypertension.
  • Secondary hypertension should be suspected in younger patients ( ⁇ 30 years of age) with elevated blood pressure, it is not uncommon for primary hypertension to manifest at a younger age, especially in blacks, and some forms of secondary hypertension, such as renovascular disease, are more common at older age (> 65 years of age).
  • Many of the causes of secondary hypertension are strongly associated with clinical findings or groups of findings that suggest a specific disorder.
  • Pregnancy is a risk factor for high blood pressure, and high blood pressure during pregnancy is a risk factor for cardiovascular disease and hypertension later in life.
  • a Report on pregnancy associated hypertension was published in 2013 by the American College of Obstetrics and Gynecology (ACOG) (American College of Obstetricians and Gynecologists, Task Force on Hypertension in Pregnancy. Hypertension in pregnancy. Report of the American College of Obstetricians and Gynecologists' Task Force on Hypertension in Pregnancy. Obstet Gynecol. 2013;122:1122-31).
  • the Report should be understood as providing the knowledge of those of skill in the art regarding diagnostic and monitoring criteria and treatment for hypertension in pregnancy at the time of filing of this application and are incorporated herein by reference'p
  • the diagnostic criteria for preeclampsia are provided in the table below (from Table 1 of the ACOG report, 2013).
  • Blood Pressure management during pregnancy is complicated by the fact that many commonly used antihypertensive agents, including ACE inhibitors and ARBs, are contraindicated during pregnancy because of potential harm to the fetus.
  • the goal of antihypertensive treatment during pregnancy includes prevention of severe hypertension and the possibility of prolonging gestation to allow the fetus more time to mature before delivery.
  • a review of treatment for pregnancy- associated severe hypertension found insufficient evidence to recommend specific agents; rather, clinician experience was recommended in this setting (Duley L, Meher S, Jones L. Drugs for treatment of very high blood pressure during pregnancy. Cochrane Database Syst Rev. 2013;7:CD001449.).
  • an additive blood pressure lowering effect may be obtained.
  • Use of combination therapy may also improve adherence.
  • Several 2- and 3-fixed-dose drug combinations of antihypertensive drug therapy are available, with complementary mechanisms of action among the components. Table 18 from Whelton et al.2017 listing oral antihypertensive drugs is provided below. Classes of therapeutic agents for the treatment of high blood pressure and drugs that fall within those classes are provided. Dose ranges, frequencies, and comments are also provided.
  • ACE indicates angiotensin-converting enzyme
  • ARB angiotensin receptor blocker
  • BP blood pressure
  • BPH benign prostatic hyperplasia
  • CCB calcium channel blocker
  • CKD chronic kidney disease
  • CNS central nervous system
  • CVD cardiovascular disease
  • ER extended release
  • GFR glomerular filtration rate
  • HF heart failure
  • HFrEF heart failure with reduced ejection fraction
  • IHD ischemic heart disease
  • IR immediate release
  • LA long-acting
  • SR sustained release.
  • an iRNA agent to a cell e.g., a cell within a subject, such as a human subject (e.g., a subject in need thereof, such as a subject having an AGT-associated disorder, e.g., hypertension), for use in the methods of the invention, can be achieved in a number of different ways.
  • delivery may be performed by contacting a cell with an iRNA of the invention either in vitro or in vivo.
  • In vivo delivery may also be performed directly by administering a composition comprising an iRNA, e.g., a dsRNA, to a subject.
  • in vivo delivery may be performed indirectly by administering one or more vectors that encode and direct the expression of the iRNA.
  • any method of delivering a nucleic acid molecule can be adapted for use with an iRNA of the invention (see e.g., Akhtar S. and Julian RL. (1992) Trends Cell. Biol. 2(5): 139-144 and WO94/02595, which are incorporated herein by reference in their entireties).
  • factors to consider in order to deliver an iRNA molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue.
  • the non-specific effects of an iRNA can be minimized by local administration, for example, by direct injection or implantation into a tissue or topically administering the preparation.
  • VEGF dsRNA intraocular delivery of a VEGF dsRNA by intravitreal injection in cynomolgus monkeys (Tolentino, MJ., et al (2004) Retina 24:132-138) and subretinal injections in mice (Reich, SJ., et al (2003) Mol. Vis.
  • RNA interference has also shown success with local delivery to the CNS by direct injection (Dorn, G., et al.
  • the RNA can be modified or alternatively delivered using a drug delivery system; both methods act to prevent the rapid degradation of the dsRNA by endo- and exo-nucleases in vivo. Modification of the RNA or the pharmaceutical carrier can also permit targeting of the iRNA composition to the target tissue and avoid undesirable off-target effects.
  • iRNA molecules can be modified by chemical conjugation to lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation.
  • an iRNA directed against ApoB conjugated to a lipophilic cholesterol moiety was injected systemically into mice and resulted in knockdown of apoB mRNA in both the liver and jejunum (Soutschek, J., et al (2004) Nature 432:173- 178). Conjugation of an iRNA to an aptamer has been shown to inhibit tumor growth and mediate tumor regression in a mouse model of prostate cancer (McNamara, JO., et al (2006) Nat. Biotechnol. 24:1005-1015).
  • the iRNA can be delivered using drug delivery systems such as a nanoparticle, a dendrimer, a polymer, liposomes, or a cationic delivery system.
  • Positively charged cationic delivery systems facilitate binding of an iRNA molecule (negatively charged) and also enhance interactions at the negatively charged cell membrane to permit efficient uptake of an iRNA by the cell.
  • Cationic lipids, dendrimers, or polymers can either be bound to an iRNA, or induced to form a vesicle or micelle (see e.g., Kim SH., et al (2008) Journal of Controlled Release 129(2):107-116) that encases an iRNA.
  • vesicles or micelles further prevents degradation of the iRNA when administered systemically.
  • Methods for making and administering cationic- iRNA complexes are well within the abilities of one skilled in the art (see e.g., Sorensen, DR., et al (2003) J. Mol. Biol 327:761-766; Verma, UN., et al (2003) Clin. Cancer Res. 9:1291-1300; Arnold, AS et al (2007) J. Hypertens.25:197-205, which are incorporated herein by reference in their entirety).
  • DOTAP Disposon-based lipid particles
  • Oligofectamine "solid nucleic acid lipid particles”
  • cardiolipin Choen, PY., et al (2006) Cancer Gene Ther.12:321-328; Pal, A., et al (2005) Int J. Oncol.26:1087-1091
  • polyethyleneimine Bonnet ME., et al (2008) Pharm. Res. Aug 16 Epub ahead of print; Aigner, A. (2006) J. Biomed.
  • an iRNA forms a complex with cyclodextrin for systemic administration.
  • Methods for administration and pharmaceutical compositions of iRNAs and cyclodextrins can be found in U.S. Patent No.7,427,605, which is herein incorporated by reference in its entirety. A.
  • iRNA targeting the AGT gene can be expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A., et al., International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114, and Conrad, U.S. Pat. No.6,054,299). Expression can be transient (on the order of hours to weeks) or sustained (weeks to months or longer), depending upon the specific construct used and the target tissue or cell type.
  • transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector.
  • the transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).
  • the individual strand or strands of an iRNA can be transcribed from a promoter on an expression vector. Where two separate strands are to be expressed to generate, for example, a dsRNA, two separate expression vectors can be co-introduced (e.g., by transfection or infection) into a target cell.
  • each individual strand of a dsRNA can be transcribed by promoters both of which are located on the same expression plasmid.
  • a dsRNA is expressed as inverted repeat polynucleotides joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.
  • iRNA expression vectors are generally DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably those compatible with vertebrate cells, can be used to produce recombinant constructs for the expression of an iRNA as described herein. Eukaryotic cell expression vectors are well known in the art and are available from a number of commercial sources.
  • iRNA expression plasmids can be transfected into target cells as a complex with cationic lipid carriers (e.g., Oligofectamine) or non-cationic lipid-based carriers (e.g., Transit-TKO TM ).
  • cationic lipid carriers e.g., Oligofectamine
  • non-cationic lipid-based carriers e.g., Transit-TKO TM
  • lipid transfections for iRNA-mediated knockdowns targeting different regions of a target RNA over a period of a week or more are also contemplated by the invention.
  • Successful introduction of vectors into host cells can be monitored using various known methods.
  • transient transfection can be signaled with a reporter, such as a fluorescent marker, such as Green Fluorescent Protein (GFP).
  • GFP Green Fluorescent Protein
  • Stable transfection of cells ex vivo can be ensured using markers that provide the transfected cell with resistance to specific environmental factors (e.g., antibiotics and drugs), such as hygromycin B resistance.
  • Viral vector systems which can be utilized with the methods and compositions described herein include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors, including but not limited to lentiviral vectors, moloney murine leukemia virus, etc.; (c) adeno- associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picomavirus vectors; (i) pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g.
  • pox virus vectors such as an orthopox, e.g., vaccinia virus vectors or avipox, e.g.
  • the constructs can include viral sequences for transfection, if desired.
  • the construct can be incorporated into vectors capable of episomal replication, e.g. EPV and EBV vectors.
  • Constructs for the recombinant expression of an iRNA will generally require regulatory elements, e.g. , promoters, enhancers, etc., to ensure the expression of the iRNA in target cells. Other aspects to consider for vectors and constructs are further described below.
  • Vectors useful for the delivery of an iRNA will include regulatory elements (promoter, enhancer, etc) sufficient for expression of the iRNA in the desired target cell or tissue.
  • the regulatory elements can be chosen to provide either constitutive or regulated/inducible expression.
  • Expression of the iRNA can be precisely regulated, for example, by using an inducible regulatory sequence that is sensitive to certain physiological regulators, e.g., circulating glucose levels, or hormones (Docherty el al., 1994, FASEBJ. 8:20-24).
  • inducible expression systems suitable for the control of dsRNA expression in cells or in mammals include, for example, regulation by ecdysone, by estrogen, progesterone, tetracycline, chemical inducers of dimerization, and isopropyl -beta-Dl -thiogalactopyranoside (IPTG).
  • IPTG isopropyl -beta-Dl -thiogalactopyranoside
  • Viral vectors that contain nucleic acid sequences encoding an iRNA can be used.
  • aretroviral vector can be used (see Miller et al.,Meth. Enzymol. 217:581-599 (1993)).
  • retroviral vectors contain the components necessary for the correct packaging of the viral genome and integration into the host cell DNA.
  • the nucleic acid sequences encoding an iRNA are cloned into one or more vectors, which facilitate delivery of the nucleic acid into a patient. More detail about retroviral vectors can be found, for example, in Boesen et al. , Biotherapy 6:291-302 (1994), which describes the use of a retroviral vector to deliver the mdrl gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy.
  • Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al.,J. Clin. Invest.
  • Lentiviral vectors contemplated for use include, for example, the HIV based vectors described in U.S. Patent Nos. 6,143,520; 5,665,557; and 5,981,276, which are herein incorporated by reference.
  • Adenoviruses are also contemplated for use in delivery of iRNAs of the invention.
  • Adenoviruses are especially attractive vehicles, e.g., for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) present a review of adenovirus-based gene therapy.
  • a suitable AV vector for expressing an iRNA featured in the invention a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in Xia H et al. (2002), Nat. Biotech.20: 1006-1010.
  • Adeno-associated virus (AAV) vectors may also be used to delivery an iRNA of the invention (Walsh et al., Proc. Soc. Exp. Biol. Med.204:289-300 (1993); U.S. Pat. No.5,436,146).
  • the iRNA can be expressed as two separate, complementary single-stranded RNA molecules from a recombinant AAV vector having, for example, either the U6 or H1 RNA promoters, or the cytomegalovirus (CMV) promoter.
  • a recombinant AAV vector having, for example, either the U6 or H1 RNA promoters, or the cytomegalovirus (CMV) promoter.
  • Suitable AAV vectors for expressing the dsRNA featured in the invention, methods for constructing the recombinant AV vector, and methods for delivering the vectors into target cells are described in Samulski R et al. (1987), J. Virol.61: 3096-3101; Fisher K J et al. (1996), J. Virol, 70: 520-532; Samulski R et al. (1989), J. Virol.63: 3822-3826; U.S.
  • Another viral vector suitable for delivery of an iRNA of the invention is a pox virus such as a vaccinia virus, for example an attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC, an avipox such as fowl pox or canary pox.
  • a pox virus such as a vaccinia virus, for example an attenuated vaccinia such as Modified Virus Ankara (MVA) or NYVAC, an avipox such as fowl pox or canary pox.
  • the tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate.
  • lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like.
  • AAV vectors can be made to target different cells by engineering the vectors to express different capsid protein serotypes; see, e.g., Rabinowitz J E et al. (2002), J Virol 76:791-801, the entire disclosure of which is herein incorporated by reference.
  • the pharmaceutical preparation of a vector can include the vector in an acceptable diluent, or can include a slow release matrix in which the gene delivery vehicle is imbedded.
  • the pharmaceutical preparation can include one or more cells which produce the gene delivery system.
  • Suitable double-stranded RNAi agentes for use in the methods of the invention include an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of an AGT gene.
  • the region of complementarity is about 19-30 nucleotides in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, or 19 nucleotides in length).
  • the iRNA Upon contact with a cell expressing the AGT gene, the iRNA inhibits the expression of the AGT gene (e.g., a human, a primate, a non-primate, or a rat AGT gene) by at least 50% as assayed by, for example, a PCR or branched DNA (bDNA)-based method, or by a protein-based method, such as by immunofluorescence analysis, using, for example, western blotting or flow cytometric techniques.
  • inhibition of expression is determined by the qPCR method provided in the examples, especially in Example 2 of PCT Application No. PCT/US2019/032150 with the siRNA at a 10 nM concentration in an appropriate organism cell line provided therein.
  • inhibition of expression in vivo is determined by knockdown of the human gene in a rodent expressing the human gene, e.g., a mouse or an AAV-infected mouse expressing the human target gene, e.g., when administered a single dose at 3 mg/kg at the nadir of RNA expression.
  • RNA expression in liver is determined using the PCR methods provided in Example 2 of PCT Application No. PCT/US2019/032150.
  • a dsRNA includes two RNA strands that are complementary and hybridize to form a duplex structure under conditions in which the dsRNA will be used.
  • One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence.
  • the target sequence can be derived from the sequence of an mRNA formed during the expression of an AGT gene.
  • the other strand includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions.
  • the complementary sequences of a dsRNA can also be contained as self- complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides.
  • the duplex structure is 19 to 30 base pairs in length.
  • the region of complementarity to the target sequence is 19 to 30 nucleotides in length.
  • the dsRNA is about 19 to about 23 nucleotides in length, or about 25 to about 30 nucleotides in length.
  • the dsRNA is long enough to serve as a substrate for the Dicer enzyme.
  • dsRNAs longer than about 21-23 nucleotides in length may serve as substrates for Dicer.
  • the region of an RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule.
  • a “part” of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to allow it to be a substrate for RNAi -directed cleavage (i.e., cleavage through a RISC pathway).
  • the duplex region is a primary functional portion of a dsRNA, e.g. , a duplex region of about 19 to about 30 base pairs, e.g. , about 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20- 25, 20-24,20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs.
  • the duplex region is 19-21 base pairs.
  • an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs is a dsRNA.
  • a miRNA is a dsRNA.
  • a dsRNA is not a naturally occurring miRNA.
  • an iRNA agent useful to target AGT gene expression is not generated in the target cell by cleavage of a larger dsRNA.
  • a dsRNA as described herein can further include one or more single-stranded nucleotide overhangs e.g., 1-4, 2-4, 1-3, 2-3, 1, 2, 3, or 4 nucleotides. dsRNAs having at least one nucleotide overhang can have superior inhibitory properties relative to their blunt-ended counterparts.
  • a nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside.
  • the overhang(s) can be on the sense strand, the antisense strand, or any combination thereof.
  • the nucleotide(s) of an overhang can be present on the 5'-end, 3'- end, or both ends of an antisense or sense strand of a dsRNA.
  • the overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered.
  • the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.
  • the first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers.
  • the nucleotides in the overhang region of the RNAi agent can each independently be a modified or unmodified nucleotide including, but not limited to 2' -sugar modified, such as, 2-F, 2'-O-methyl, thymidine (T), 2 -O-methoxyethyl-5-methyluridine (Teo), 2' -O- methoxyethyladenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combinations thereof.
  • TT can be an overhang sequence for either end on either strand.
  • the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.
  • the 5'- or 3'- overhangs at the sense strand, antisense strand or both strands of the RNAi agent may be phosphorylated.
  • the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different.
  • the overhang is present at the 3' -end of the sense strand, antisense strand, or both strands. In one embodiment, this 3' -overhang is present in the antisense strand. In one embodiment, this 3' -overhang is present in the sense strand.
  • the RNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability.
  • the single-stranded overhang may be located at the 3'-terminal end of the sense strand or, alternatively, at the 3'-terminal end of the antisense strand.
  • the RNAi may also have a blunt end, located at the 5' -end of the antisense strand (or the 3' -end of the sense strand) or vice versa.
  • the antisense strand of the RNAi has a nucleotide overhang at the 3' -end, and the 5' -end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5' -end of the antisense strand and 3' -end overhang of the antisense strand favor the guide strand loading into RISC process.
  • the double-stranded RNAi agents for use in the methods of the present invention are unmodified.
  • the double-stranded RNAi agents for use in the methods of the present invention are modified, e.g., comprise chemical modifications capable of inhibiting the expression of a target gene (i.e., an AGT gene) in vivo, or enhancing stability or other beneficial characteristic of the agents.
  • the double -stranded RNAi agents comprises a thermally destabilizing nucleotide modification.
  • substantially all of the nucleotides of an iRNA of the invention are modified. In other embodiments of the invention, all of the nucleotides of an iRNA of the invention are modified. iRNAs of the invention in which “substantially all of the nucleotides are modified” are largely but not wholly modified and can include not more than 5, 4, 3, 2, or 1 unmodified nucleotides.
  • Double stranded RNAi compounds of the invention may be prepared using a two-step procedure. First, the individual strands of the double stranded RNA molecule are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA compound can be prepared using solution-phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide strands comprising unnatural or modified nucleotides can be easily prepared. Similarly, single- stranded oligonucleotides of the invention can be prepared using solution-phase or solid-phase organic synthesis or both.
  • the RNA of the iRNA of the invention e.g. , a dsRNA
  • a dsRNA is un- modified, and does not comprise, e.g., chemical modifications or conjugations known in the art and described herein.
  • the RNA of an iRNA of the invention e.g., a dsRNA
  • substantially all of the nucleotides of an iRNA of the invention are modified.
  • all of the nucleotides of an iRNA or substantially all of the nucleotides of an iRNA are modified, i.e., not more than 5, 4, 3, 2, or 1 unmodified nucleotides are present in a strand of the iRNA.
  • nucleic acids featured in the invention can be synthesized or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al. (Edrs.), lohn Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference.
  • Modifications include, for example, end modifications, e.g., 5' -end modifications (phosphorylation, conjugation, inverted linkages) or 3'-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.); base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g. , at the 2'-position or 4'- position) or replacement of the sugar; or backbone modifications, including modification or replacement of the phosphodiester linkages.
  • end modifications e.g., 5' -end modifications (phosphorylation, conjugation, inverted linkages) or 3'-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.
  • base modifications e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nu
  • RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone.
  • modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • a modified iRNA will have a phosphorus atom in its internucleoside backbone.
  • Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'.
  • Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patent Nos.5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.
  • RNA mimetics are contemplated for use in iRNAs provided herein, in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
  • the base units are maintained for hybridization with an appropriate nucleic acid target compound.
  • One such oligomeric compound in which an RNA mimetic that has been shown to have excellent hybridization properties is referred to as a peptide nucleic acid (PNA).
  • PNA peptide nucleic acid
  • the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
  • the nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are hereby incorporated herein by reference. Additional PNA compounds suitable for use in the iRNAs of the invention are described in, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.
  • RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones and in particular -- CH 2 -- NH-- CH 2 -, --CH 2 -- N(CH 3 )-- O-- CH 2 -- [known as a methylene (methylimino) or MMI backbone], -- CH 2 -- O-- N(CH 3 )-- CH 2 --, -- CH 2 -- N(CH 3 )-- N(CH 3 )-- CH 2 -- and -- N(CH 3 )-- CH 2 -- CH 2 -- [wherein the native phosphodiester backbone is represented as -- O-- P-- O-- CH 2 -- ] of the above-referenced U.S.
  • Patent No. 5,489,677 and the amide backbones of the above-referenced U.S. Patent No. 5,602,240.
  • the RNAs featured herein have morpholino backbone structures of the above -referenced U.S. Patent No. 5,034,506.
  • Modified RNAs can also contain one or more substituted sugar moieties.
  • the iRNAs, e.g. , dsRNAs, featured herein can include one of the following at the 2'-position: OH; F; O-, S-, orN-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl -O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C 1 to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl.
  • Exemplary suitable modifications include O[(CH 2 ) n O] m CH 3 , O(CH 2 ). n OCH 3 , O(CH 2 ) n NH 2 , O(CH 2 ) nCH 3 , O(CH 2 ) n ONH 2 , and O(CH 2 ) n ON[(CH 2 ) n CH 3 )] 2 , where n and m are from 1 to about 10.
  • dsRNAs include one of the following at the 2' position: C 1 to C 10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an iRNA, or a group for improving the pharmacodynamic properties of an iRNA, and other substituents having similar properties.
  • the modification includes a 2'-methoxyethoxy (2'-O-- CH 2 CH 2 OCH 3 , also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group.
  • Another exemplary modification is 2'- dimethylaminooxyethoxy, i.e., a O(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O- dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-- CH 2 --O --CH 2 -- N(CH 2 ) 2 .
  • modifications include : 5'-Me-2'-F nucleotides, 5'-Me-2'-OMe nucleotides, 5'-Me-2'- deoxynucleotides, (both R and S isomers in these three families); 2'-alkoxyalkyl; and 2'-NMA (N- methylacetamide) .
  • Other modifications include 2'-methoxy (2'-OCH 3 ), 2'-aminopropoxy (2'-OCH 2 CH 2 CH 2 NH 2 ) and 2'-fluoro (2'-F).
  • RNA of an iRNA can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
  • An iRNA can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
  • nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
  • Modified nucleobases include other synthetic and natural nucleobases such as deoxy- thymine (dT), 5-methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo,
  • nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008; those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch etal., Angewandte Chemie, International Edition, 1991,
  • nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the invention.
  • These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5- methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.
  • RNA of an iRNA can also be modified to include one or more locked nucleic acids (LNA).
  • LNA locked nucleic acids
  • a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons. This structure effectively "locks" the ribose in the 3'-endo structural conformation.
  • the addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al. , (2005) Nucleic Acids Research 33(l):439-447; Mook, OR. etal., (2007) Mol Canc Ther 6(3): 833- 843; Grunweller, A. etal. , (2003) Nucleic Acids Research 31 (12):3185-3193).
  • U.S. Patents that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: U.S. Patent Nos. 6,268,490; 6,670,461; 6,794,499; 6,998,484; 7,053,207; 7,084,125; and 7,399,845, the entire contents of each of which are hereby incorporated herein by reference.
  • RNA of an iRNA can also be modified to include one or more bicyclic sugar moieties.
  • a “biyclic sugar” is a furanosyl ring modified by the bridging of two atoms.
  • a “bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system.
  • the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring.
  • an agent of the invention may include one or more locked nucleic acids (LNA).
  • LNA locked nucleic acids
  • a locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons.
  • an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4'-CH 2 -O-2' bridge.
  • This structure effectively "locks" the ribose in the 3'-endo structural conformation.
  • the addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. etal. , (2005) Nucleic Acids Research 33(l):439-447; Mook, OR. et al, (2007 )Mol Cane Ther 6(3):833-843; Grunweller, A. etal, (2003) Nucleic Acids Research 31(12):3185-3193).
  • bicyclic nucleosides for use in the polynucleotides of the invention include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms.
  • the antisense polynucleotide agents of the invention include one or more bicyclic nucleosides comprising a 4' to 2' bridge.
  • 4' to 2' bridged bicyclic nucleosides include but are not limited to 4'-(CH 2 )— O-2' (LNA); 4'-(CH 2 )— S-2'; 4'-(CH 2 ) 2— O-2' (ENA); 4'-CH(CH 3 )— 0-2' (also referred to as “constrained ethyl” or “cEt”) and 4'-CH(CH 2 OCH 3 ) — 0-2' (and analogs thereof; see, e.g., U.S. Patent No. 7,399,845); 4'-C(CH 3 )(CH 3 ) — O-2' (and analogs thereof; see e.g, U.S. Patent No.
  • bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example ⁇ -L-ribofuranose and ⁇ -D-ribofuranose (see WO 99/14226).
  • RNA of an iRNA can also be modified to include one or more constrained ethyl nucleotides.
  • a "constrained ethyl nucleotide” or “cEt” is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4'-CH(CH 3 )-O-2' bridge.
  • a constrained ethyl nucleotide is in the S conformation referred to herein as “S-cEt.”
  • An iRNA of the invention may also include one or more “conformationally restricted nucleotides” (“CRN”).
  • CRN are nucleotide analogs with a linker connecting the C2'and C4' carbons of ribose or the C3 and -C5' carbons of ribose. CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to mRNA.
  • the linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.
  • an iRNA of the invention comprises one or more monomers that are UNA (unlocked nucleic acid) nucleotides.
  • UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue.
  • UNA also encompasses monomer with bonds between C1'-C4' have been removed (i.e. the covalent carbon- oxygen-carbon bond between the C1' and C4' carbons).
  • the C2'-C3' bond i.e. the covalent carbon -carbon bond between the C2' and C3' carbons
  • the sugar has been removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et aI.,MoI. Biosyst., 2009, 10, 1039 hereby incorporated by reference).
  • RNA molecules can include N- (acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N-(acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-0-deoxythymidine (ether), N- (aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3"- phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in PCT Publication No. WO 2011/005861.
  • nucleotides of an iRNA of the invention include a 5' phosphate or 5' phosphate mimic, e.g., a 5' -terminal phosphate or phosphate mimic on the antisense strand of an iRNA.
  • Suitable phosphate mimics are disclosed in, for example U.S. Patent Publication No. 2012/0157511, the entire contents of which are incorporated herein by reference.
  • the double stranded RNA agents of the invention include agents with chemical modifications as disclosed, for example, in WO2013/075035, the entire contents of each of which are incorporated herein by reference.
  • WO2013/075035 provides motifs of three identical modifications on three consecutive nucleotides into a sense strand or antisense strand of a dsRNAi agent, particularly at or near the cleavage site.
  • the sense strand and antisense strand of the dsRNAi agent may otherwise be completely modified. The introduction of these motifs interrupts the modification pattern, if present, of the sense or antisense strand.
  • the dsRNAi agent may be optionally conjugated with a GalNAc derivative ligand, for instance on the sense strand.
  • the sense strand and antisense strand of the double stranded RNA agent are completely modified to have one or more motifs of three identical modifications on three consecutive nucleotides at or near the cleavage site of at least one strand of a dsRNAi agent, the gene silencing activity of the dsRNAi agent was observed.
  • the invention provides double stranded RNA agents capable of inhibiting the expression of a target gene (i.e., AGT gene) in vivo.
  • the RNAi agent comprises a sense strand and an antisense strand.
  • Each strand of the RNAi agent may be, for example, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length.
  • the sense strand and antisense strand typically form a duplex double stranded RNA (“dsRNA”), also referred to herein as “dsRNAi agent.”
  • dsRNA duplex double stranded RNA
  • the duplex region of a dsRNAi agent may be, for example, the duplex region can be 27-30 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19- 21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21 -23 nucleotide pairs in length.
  • the duplex region is selected from 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.
  • the dsRNAi agent may contain one or more overhang regions or capping groups at the 3'-end, 5'-end, or both ends of one or both strands.
  • the overhang can be, independently, 1 -6 nucleotides in length, for instance 2-6 nucleotides in length, 1 -5 nucleotides in length, 2-5 nucleotides in length, 1 -4 nucleotides in length, 2-4 nucleotides in length, 1 -3 nucleotides in length, 2-3 nucleotides in length, or 1 -2 nucleotides in length.
  • the overhang regions can include extended overhang regions as provided above.
  • the overhangs can be the result of one strand being longer than the other, or the result of two strands of the same length being staggered.
  • the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.
  • the first and second strands can also be joined, e.g., by additional bases to form a hairpin, or by other non-base linkers.
  • the nucleotides in the overhang region of the dsRNAi agent can each independently be a modified or unmodified nucleotide including, but no limited to 2' -sugar modified, such as, 2'-F, 2'-O-methyl, thymidine (T), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O- methoxyethyladenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combinations thereof.
  • TT can be an overhang sequence for either end on either strand.
  • the overhang can form a mismatch with the target mRNA or it can be complementary to the gene sequences being targeted or can be another sequence.
  • the 5'- or 3'- overhangs at the sense strand, antisense strand, or both strands of the dsRNAi agent may be phosphorylated.
  • the overhang region(s) contains two nucleotides having a phosphorothioate between the two nucleotides, where the two nucleotides can be the same or different.
  • the overhang is present at the 3' -end of the sense strand, antisense strand, or both strands. In some embodiments, this 3' -overhang is present in the antisense strand. In some embodiments, this 3' -overhang is present in the sense strand.
  • the dsRNAi agent may contain only a single overhang, which can strengthen the interference activity of the RNAi, without affecting its overall stability.
  • the single-stranded overhang may be located at the 3'- end of the sense strand or, alternatively, at the 3'-end of the antisense strand.
  • the RNAi may also have a blunt end, located at the 5' -end of the antisense strand (or the 3' -end of the sense strand) or vice versa.
  • the antisense strand of the dsRNAi agent has a nucleotide overhang at the 3' -end, and the 5' -end is blunt. While not wishing to be bound by theory, the asymmetric blunt end at the 5' -end of the antisense strand and 3' -end overhang of the antisense strand favor the guide strand loading into RISC process.
  • the dsRNAi agent is a double ended bluntmer of 19 nucleotides in length, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 7, 8, 9 from the 5' end.
  • the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5' end.
  • the dsRNAi agent is a double ended bluntmer of 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 8, 9, 10 from the 5' end.
  • the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5' end.
  • the dsRNAi agent is a double ended bluntmer of 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5' end.
  • the antisense strand contains at least one motif of three 2'-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5' end.
  • the dsRNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2'-F modifications on three consecutive nucleotides at positions 9, 10, 11 from the 5' end; the antisense strand contains at least one motif of three 2' -O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5' end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang.
  • the 2 nucleotide overhang is at the 3'-end of the antisense strand.
  • the RNAi agent additionally has two phosphorothioate intemucleotide linkages between the terminal three nucleotides at both the 5' -end of the sense strand and at the 5'-end of the antisense strand.
  • every nucleotide in the sense strand and the antisense strand of the dsRNAi agent, including the nucleotides that are part of the motifs are modified nucleotides.
  • each residue is independently modified with a 2'-O- methyl or 3'-fluoro, e.g., in an alternating motif.
  • the dsRNAi agent further comprises a ligand (preferably GalNAc3).
  • the dsRNAi agent comprises a sense and an antisense strand, wherein the sense strand is 25-30 nucleotide residues in length, wherein starting from the 5' terminal nucleotide (position 1) positions 1 to 23 of the first strand comprise at least 8 ribonucleotides; the antisense strand is 36-66 nucleotide residues in length and, starting from the 3' terminal nucleotide, comprises at least 8 ribonucleotides in the positions paired with positions 1- 23 of sense strand to form a duplex; wherein at least the 3 ' terminal nucleotide of antisense strand is unpaired with sense strand, and up to 6 consecutive 3' terminal nucleotides are unpaired with sense strand, thereby forming a 3' single stranded overhang of 1-6 nucleotides; wherein the 5' terminus of antisense strand comprises from 10-30 consecutive nucleotides which are unpaired with sense strand, thereby forming
  • the dsRNAi agent comprises sense and antisense strands, wherein the dsRNAi agent comprises a first strand having a length which is at least 25 and at most 29 nucleotides and a second strand having a length which is at most 30 nucleotides with at least one motif of three 2' -O-methyl modifications on three consecutive nucleotides at position 11, 12, 13 from the 5' end; wherein the 3' end of the first strand and the 5' end of the second strand form a blunt end and the second strand is 1-4 nucleotides longer at its 3' end than the first strand, wherein the duplex region which is at least 25 nucleotides in length, and the second strand is sufficiently complementary to a target mRNA along at least 19 nucleotide of the second strand length to reduce target gene expression when the RNAi agent is introduced into a mammalian cell, and wherein Dicer cleavage of the dsRNAi agent preferentially results in an si
  • the sense strand of the dsRNAi agent contains at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at the cleavage site in the sense strand.
  • the antisense strand of the dsRNAi agent can also contain at least one motif of three identical modifications on three consecutive nucleotides, where one of the motifs occurs at or near the cleavage site in the antisense strand.
  • the cleavage site of the antisense strand is typically around the 10, 11, and 12 positions from the 5'-end.
  • the motifs of three identical modifications may occur at the 9, 10, 11 positions; the 10, 11, 12 positions; the 11, 12, 13 positions; the 12, 13, 14 positions; or the 13, 14, 15 positions of the antisense strand, the count starting from the first nucleotide from the 5' -end of the antisense strand, or, the count starting from the first paired nucleotide within the duplex region from the 5'- end of the antisense strand.
  • the cleavage site in the antisense strand may also change according to the length of the duplex region of the dsRNAi agent from the 5' -end.
  • the sense strand of the dsRNAi agent may contain at least one motif of three identical modifications on three consecutive nucleotides at the cleavage site of the strand; and the antisense strand may have at least one motif of three identical modifications on three consecutive nucleotides at or near the cleavage site of the strand.
  • the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand can be so aligned that one motif of the three nucleotides on the sense strand and one motif of the three nucleotides on the antisense strand have at least one nucleotide overlap, i.e.
  • At least one of the three nucleotides of the motif in the sense strand forms a base pair with at least one of the three nucleotides of the motif in the antisense strand.
  • at least two nucleotides may overlap, or all three nucleotides may overlap.
  • the sense strand of the dsRNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides.
  • the first motif may occur at or near the cleavage site of the strand and the other motifs may be a wing modification.
  • the term “wing modification” herein refers to a motif occurring at another portion of the strand that is separated from the motif at or near the cleavage site of the same strand.
  • the wing modification is either adjacent to the first motif or is separated by at least one or more nucleotides.
  • the motifs are immediately adjacent to each other then the chemistries of the motifs are distinct from each other, and when the motifs are separated by one or more nucleotide than the chemistries can be the same or different.
  • Two or more wing modifications may be present. For instance, when two wing modifications are present, each wing modification may occur at one end relative to the first motif which is at or near cleavage site or on either side of the lead motif.
  • the antisense strand of the dsRNAi agent may contain more than one motif of three identical modifications on three consecutive nucleotides, with at least one of the motifs occurring at or near the cleavage site of the strand.
  • This antisense strand may also contain one or more wing modifications in an alignment similar to the wing modifications that may be present on the sense strand.
  • the wing modification on the sense strand or antisense strand of the dsRNAi agent typically does not include the first one or two terminal nucleotides at the 3' -end, 5'- end, or both ends of the strand.
  • the wing modification on the sense strand or antisense strand of the dsRNAi agent typically does not include the first one or two paired nucleotides within the duplex region at the 3'-end, 5'-end, or both ends of the strand.
  • the wing modifications may fall on the same end of the duplex region, and have an overlap of one, two, or three nucleotides.
  • the sense strand and the antisense strand of the dsRNAi agent each contain at least two wing modifications
  • the sense strand and the antisense strand can be so aligned that two modifications each from one strand fall on one end of the duplex region, having an overlap of one, two, or three nucleotides; two modifications each from one strand fall on the other end of the duplex region, having an overlap of one, two or three nucleotides; two modifications one strand fall on each side of the lead motif, having an overlap of one, two or three nucleotides in the duplex region.
  • every nucleotide in the sense strand and antisense strand of the dsRNAi agent may be modified.
  • Each nucleotide may be modified with the same or different modification which can include one or more alteration of one or both of the non-linking phosphate oxygens or of one or more of the linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g. , of the 2'-hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose -phosphate backbone.
  • nucleic acids are polymers of subunits
  • many of the modifications occur at a position which is repeated within a nucleic acid, e.g. , a modification of a base, or a phosphate moiety, or a non-linking O of a phosphate moiety.
  • the modification will occur at all of the subject positions in the nucleic acid but in many cases it will not.
  • a modification may only occur at a 3'- or 5' terminal position, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand.
  • a modification may occur in a double strand region, a single strand region, or in both.
  • a modification may occur only in the double strand region of an RNA or may only occur in a single strand region of a RNA.
  • a phosphorothioate modification at a non-linking O position may only occur at one or both termini, may only occur in a terminal region, e.g., at a position on a terminal nucleotide or in the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in double strand and single strand regions, particularly at termini.
  • the 5'-end or ends can be phosphorylated.
  • each residue of the sense strand and antisense strand is independently modified with LNA, CRN, cET, UNA, HNA, CeNA, 2'-methoxyethyl, 2'- O-methyl, 2'-O-allyl, 2'- C- allyl, 2'-deoxy, 2'-hydroxyl, or 2'-fluoro.
  • the strands can contain more than one modification.
  • each residue of the sense strand and antisense strand is independently modified with 2'- O-methyl or 2'-fluoro.
  • At least two different modifications are typically present on the sense strand and antisense strand. Those two modifications may be the 2'- O-methyl or 2'-fluoro modifications, or others.
  • the N a or N b comprise modifications of an alternating pattern.
  • alternating motif refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of one strand.
  • the alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern.
  • the alternating motif can be “ABABABABABAB.. “AABBAABBAABB.. “AAB AABAAB AAB .. “AAABAAABAAAB ... “AAABBBAAABBB ... or “ABCABCABCABC.. etc.
  • the type of modifications contained in the alternating motif may be the same or different.
  • the alternating pattern i.e.. modifications on every other nucleotide
  • each of the sense strand or antisense strand can be selected from several possibilities of modifications within the alternating motif such as “ABABAB.. “ACACAC.. “BDBDBD.. or “CDCDCD... etc.
  • the dsRNAi agent of the invention comprises the modification pattern for the alternating motif on the sense strand relative to the modification pattern for the alternating motif on the antisense strand is shifted.
  • the shift may be such that the modified group of nucleotides of the sense strand corresponds to a differently modified group of nucleotides of the antisense strand and vice versa.
  • the sense strand when paired with the antisense strand in the dsRNA duplex the alternating motif in the sense strand may start with “ABABAB” from 5'to 3' of the strand and the alternating motif in the antisense strand may start with “BAB ABA” from 5' to 3' of the strand within the duplex region.
  • the alternating motif in the sense strand may start with “AABBAABB” from 5' to 3' of the strand and the alternating motif in the antisense strand may start with “BBAABBAA” from 5' to 3' of the strand within the duplex region, so that there is a complete or partial shift of the modification patterns between the sense strand and the antisense strand.
  • the dsRNAi agent comprises the pattern of the alternating motif of 2'- O-methyl modification and 2'-F modification on the sense strand initially has a shift relative to the pattern of the alternating motif of 2'-O-methyl modification and 2'-F modification on the antisense strand initially, i.e. , the 2'-O-methyl modified nucleotide on the sense strand base pairs with a 2'-F modified nucleotide on the antisense strand and vice versa.
  • the 1 position of the sense strand may start with the 2'-F modification
  • the 1 position of the antisense strand may start with the 2'- O- methyl modification.
  • the introduction of one or more motifs of three identical modifications on three consecutive nucleotides to the sense strand or antisense strand interrupts the initial modification pattern present in the sense strand or antisense strand.
  • This interruption of the modification pattern of the sense or antisense strand by introducing one or more motifs of three identical modifications on three consecutive nucleotides to the sense or antisense strand may enhance the gene silencing activity against the target gene.
  • the modification of the nucleotide next to the motif is a different modification than the modification of the motif.
  • the portion of the sequence containing the motif is ..N a YYYN b .. where “Y” represents the modification of the motif of three identical modifications on three consecutive nucleotides, and “N a ” and “N b ” represent a modification to the nucleotide next to the motif “YYY” that is different than the modification of Y, and where N a and N b can be the same or different modifications.
  • N a or N b may be present or absent when there is a wing modification present.
  • the iRNA may further comprise at least one phosphorothioate or methylphosphonate intemucleotide linkage.
  • the phosphorothioate or methylphosphonate intemucleotide linkage modification may occur on any nucleotide of the sense strand, antisense strand, or both strands in any position of the strand.
  • the intemucleotide linkage modification may occur on every nucleotide on the sense strand or antisense strand; each intemucleotide linkage modification may occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand may contain both intemucleotide linkage modifications in an alternating pattern.
  • the alternating pattern of the intemucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the intemucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the intemucleotide linkage modification on the antisense strand.
  • a double-stranded RNAi agent comprises 6-8 phosphorothioate intemucleotide linkages.
  • the antisense strand comprises two phosphorothioate intemucleotide linkages at the 5' -end and two phosphorothioate intemucleotide linkages at the 3' -end, and the sense strand comprises at least two phosphorothioate intemucleotide linkages at either the 5'-end or the 3'-end.
  • the dsRNAi agent comprises a phosphorothioate or methylphosphonate intemucleotide linkage modification in the overhang region.
  • the overhang region may contain two nucleotides having a phosphorothioate or methylphosphonate intemucleotide linkage between the two nucleotides.
  • Intemucleotide linkage modifications also may be made to link the overhang nucleotides with the terminal paired nucleotides within the duplex region.
  • the overhang nucleotides may be linked through phosphorothioate or methylphosphonate intemucleotide linkage, and optionally, there may be additional phosphorothioate or methylphosphonate intemucleotide linkages linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide.
  • These terminal three nucleotides may be at the 3' -end of the antisense strand, the 3' -end of the sense strand, the 5' -end of the antisense strand, or the 5' end of the antisense strand.
  • the 2-nucleotide overhang is at the 3' -end of the antisense strand, and there are two phosphorothioate intemucleotide linkages between the terminal three nucleotides, wherein two of the three nucleotides are the overhang nucleotides, and the third nucleotide is a paired nucleotide next to the overhang nucleotide.
  • the dsRNAi agent may additionally have two phosphorothioate intemucleotide linkages between the terminal three nucleotides at both the 5' -end of the sense strand and at the 5' -end of the antisense strand.
  • the dsRNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof.
  • the mismatch may occur in the overhang region or the duplex region.
  • the base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used).
  • A:U is preferred over G:C
  • G:U is preferred over G:C
  • Mismatches e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings.
  • the dsRNAi agent comprises at least one of the first 1, 2, 3, 4, or 5 base pairs within the duplex regions from the 5' -end of the antisense strand independently selected from the group of: A:U, G:U, I:C, and mismatched pairs, e.g., non-canonical or other than canonical pairings or pairings which include a universal base, to promote the dissociation of the antisense strand at the 5' -end of the duplex.
  • the nucleotide at the 1 position within the duplex region from the 5'- end in the antisense strand is selected from A, dA, dU, U, and dT.
  • at least one of the first 1, 2, or 3 base pair within the duplex region from the 5'- end of the antisense strand is an AU base pair.
  • the first base pair within the duplex region from the 5' -end of the antisense strand is an AU base pair.
  • the nucleotide at the 3' -end of the sense strand is deoxy-thymine (dT) or the nucleotide at the 3'-end of the antisense strand is deoxy-thymine (dT).
  • dT deoxy-thymine
  • dT deoxy-thymine
  • there is a short sequence of deoxy-thymine nucleotides for example, two dT nucleotides on the 3' -end of the sense, antisense strand, or both strands.
  • the sense strand sequence may be represented by formula (I):
  • i and j are each independently 0 or 1 ; p and q are each independently 0-6; each N a independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each N b independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; each n p and n q independently represent an overhang nucleotide; wherein Nb and Y do not have the same modification; and
  • XXX, YYY, and ZZZ each independently represent one motif of three identical modifications on three consecutive nucleotides.
  • YYY is all 2'-F modified nucleotides.
  • the N a or N b comprises modifications of alternating pattern.
  • the YYY motif occurs at or near the cleavage site of the sense strand.
  • the YYY motif can occur at or the vicinity of the cleavage site (e.g. : can occur at positions 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11,12; or 11, 12, 13) of the sense strand, the count starting from the first nucleotide, from the 5'-end; or optionally, the count starting at the first paired nucleotide within the duplex region, from the 5' -end.
  • i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 1.
  • the sense strand can therefore be represented by the following formulas:
  • N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides.
  • Each N a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • N b represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides.
  • Each N a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • each N b independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides.
  • N b is 0, 1, 2, 3, 4, 5, or 6
  • Each N a can independently represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • Each of X, Y and Z may be the same or different from each other.
  • each N a independently can represent an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • the antisense strand sequence of the RNAi may be represented by formula (II): 5' n q ,-N a ' -(Z'Z'Z') k -N b '-Y'Y'Y'-N b '-(X'X'X')i-N' a -n p ' 3' (II) wherein: k and 1 are each independently 0 or 1; p' and q' are each independently 0-6; each N a ' independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each N b ' independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; each n p ' and n q ' independently represent an overhang nucleotide; wherein N b ' and Y’ do not have the same modification; and
  • X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
  • the N a ' or N b ' comprises modifications of alternating pattern.
  • the Y'Y'Y' motif occurs at or near the cleavage site of the antisense strand.
  • the Y'Y'Y' motif can occur at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense strand, with the count starting from the first nucleotide, from the 5' -end; or optionally, the count starting at the first paired nucleotide within the duplex region, from the 5' -end.
  • the U ⁇ ' motif occurs at positions 11, 12, 13.
  • U ⁇ ' motif is all 2'-OMe modified nucleotides.
  • k is 1 and 1 is 0, or k is 0 and 1 is 1, or both k and 1 are 1.
  • the antisense strand can therefore be represented by the following formulas: 5' n q’ -N a ''-Z'Z'Z'-N b '-Y'Y'Y'-N a ''-n p’ 3' (lIb); 5' n q ,-N a ''-Y'Y'Y'-N b '-X'X'X'-n p , 3' (IIc); or 5' n q ,-N a ''- Z'Z'Z'-N b '-Y'Y'Y'-N b '- X'X'-N a ''-n p , 3' (lId).
  • N b ' represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides.
  • Each N a '’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • N b ' represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides.
  • Each N a '’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • each N b ' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides.
  • Each N a '' independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • N b is 0, 1, 2, 3, 4, 5, or 6.
  • k is 0 and 1 is 0 and the antisense strand may be represented by the formula:
  • each N a '’ independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • Each of X', Y' and Z' may be the same or different from each other.
  • Each nucleotide of the sense strand and antisense strand may be independently modified with LNA, CRN, UNA, cEt, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C- allyl, 2'- hydroxyl, or 2'-fluoro.
  • each nucleotide of the sense strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.
  • Each X, Y, Z, X', Y', and Z' in particular, may represent a 2'-O-methyl modification or a 2'-fluoro modification.
  • the sense strand of the dsRNAi agent may contain YYY motif occurring at 9, 10, and 11 positions of the strand when the duplex region is 21 nt, the count starting from the first nucleotide from the 5' -end, or optionally, the count starting at the first paired nucleotide within the duplex region, from the 5'- end; and Y represents 2'-F modification.
  • the sense strand may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2'-OMe modification or 2'-F modification.
  • the antisense strand may contain U ⁇ ' motif occurring at positions 11, 12, 13 of the strand, the count starting from the first nucleotide from the 5' -end, or optionally, the count starting at the first paired nucleotide within the duplex region, from the 5'- end; and Y' represents 2'-O-methyl modification.
  • the antisense strand may additionally contain X'X'X' motif or Z'Z'Z' motifs as wing modifications at the opposite end of the duplex region; and X'X'X' and Z'Z'Z' each independently represents a 2'-OMe modification or 2'-F modification.
  • the sense strand represented by any one of the above formulas (la), (lb), (Ic), and (Id) forms a duplex with a antisense strand being represented by any one of formulas (IIa), (lIb), (IIc), and (lId), respectively.
  • the dsRNAi agents for use in the methods of the invention may comprise a sense strand and an antisense strand, each strand having 14 to 30 nucleotides, the iRNA duplex represented by formula (III): sense : antisense:
  • each N a and N a '' independently represents an oligonucleotide sequence comprising 0-25 modified nucleotides, each sequence comprising at least two differently modified nucleotides; each N b and N b ' independently represents an oligonucleotide sequence comprising 0-10 modified nucleotides; wherein each n p ', n p , n q ', and n q , each of which may or may not be present, independently represents an overhang nucleotide; and
  • XXX, YYY, ZZZ, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.
  • i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1; or both i and j are 0; or both i and j are 1.
  • k is 0 and 1 is 0; or k is 1 and 1 is 0; k is 0 and 1 is 1; or both k and 1 are 0; or both k and 1 are 1.
  • Exemplary combinations of the sense strand and antisense strand forming an iRNA duplex include the formulas below: 5' n p -N a -X X X -N b -Y Y Y -N b -Z Z Z -N a -n q 3'
  • each N a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • each N b independently represents an oligonucleotide sequence comprising 1-10, 1-7, 1-5, or 1-4 modified nucleotides.
  • Each N a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • each N b , N b ' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides.
  • Each N a independently represents an oligonucleotide sequence comprising 2-20, 2-15, or 2-10 modified nucleotides.
  • each N b , N b ' independently represents an oligonucleotide sequence comprising 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 modified nucleotides.
  • Each N a , N a ' independently represents an oligonucleotide sequence comprising 2-20, 2- 15, or 2-10 modified nucleotides.
  • Each of N a , N a ', N b. and N b independently comprises modifications of alternating pattern.
  • Each of X, Y, and Z in formulas (III), (IlIa), (Illb), (IIIc), and (IIId) may be the same or different from each other.
  • the dsRNAi agent is represented by formula (III), (IlIa), (Illb), (IIIc), and (IIId)
  • at least one of the Y nucleotides may form a base pair with one of the Y' nucleotides.
  • at least two of the Y nucleotides form base pairs with the corresponding Y' nucleotides; or all three of the Y nucleotides all form base pairs with the corresponding Y' nucleotides.
  • At least one of the Z nucleotides may form a base pair with one of the Z' nucleotides.
  • at least two of the Z nucleotides form base pairs with the corresponding Z' nucleotides; or all three of the Z nucleotides all form base pairs with the corresponding Z' nucleotides.
  • the dsRNAi agent is represented as formula (IIIc) or (IIId)
  • at least one of the X nucleotides may form a base pair with one of the X' nucleotides.
  • at least two of the X nucleotides form base pairs with the corresponding X' nucleotides; or all three of the X nucleotides all form base pairs with the corresponding X' nucleotides.
  • the modification on the Y nucleotide is different than the modification on the Y’ nucleotide
  • the modification on the Z nucleotide is different than the modification on the Z’ nucleotide
  • the modification on the X nucleotide is different than the modification on the X' nucleotide.
  • the N a modifications are 2'-O-methyl or 2'-fluoro modifications. In other embodiments, when the RNAi agent is represented by formula (IIId), the N a modifications are 2'-O-methyl or 2'-fluoro modifications and n p ' >0 and at least one n p ' is linked to a neighboring nucleotide a via phosphorothioate linkage.
  • the N a modifications are 2'-O-methyl or 2'-fluoro modifications , n p ' >0 and at least one n p ' is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker (described below).
  • the N a modifications are 2'-O- methyl or 2'-fluoro modifications , n p ' >0 and at least one n p ' is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
  • the N a modifications are 2'-O-methyl or 2'-fluoro modifications , n p ' >0 and at least one n p ' is linked to a neighboring nucleotide via phosphorothioate linkage, the sense strand comprises at least one phosphorothioate linkage, and the sense strand is conjugated to one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
  • the dsRNAi agent is a multimer containing at least two duplexes represented by formula (III), (IlIa), (Illb), (IIIc), and (IIId), wherein the duplexes are connected by a linker.
  • the linker can be cleavable or non-cleavable.
  • the multimer further comprises a ligand.
  • Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
  • the dsRNAi agent is a multimer containing three, four, five, six, or more duplexes represented by formula (III), (IlIa), (Illb), (IIIc), and (IIId), wherein the duplexes are connected by a linker.
  • the linker can be cleavable or non-cleavable.
  • the multimer further comprises a ligand.
  • Each of the duplexes can target the same gene or two different genes; or each of the duplexes can target same gene at two different target sites.
  • two dsRNAi agents represented by at least one of formulas (III), (IlIa), (Illb), (IIIc), and (IIId) are linked to each other at the 5' end, and one or both of the 3' ends, and are optionally conjugated to a ligand.
  • Each of the agents can target the same gene or two different genes; or each of the agents can target same gene at two different target sites.
  • an RNAi agent of the invention may contain a low number of nucleotides containing a 2'-fluoro modification, e.g., 10 or fewer nucleotides with 2'-fluoro modification.
  • the RNAi agent may contain 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 or 0 nucleotides with a 2'-fluoro modification.
  • the RNAi agent of the invention contains 10 nucleotides with a 2'-fluoro modification, e.g., 4 nucleotides with a 2'-fluoro modification in the sense strand and 6 nucleotides with a 2'-fluoro modification in the antisense strand.
  • the RNAi agent of the invention contains 6 nucleotides with a 2'-fluoro modification, e.g., 4 nucleotides with a 2'-fluoro modification in the sense strand and 2 nucleotides with a 2'-fluoro modification in the antisense strand.
  • an RNAi agent of the invention may contain an ultra low number of nucleotides containing a 2'-fluoro modification, e.g., 2 or fewer nucleotides containing a 2'-fluoro modification.
  • the RNAi agent may contain 2, 1 of 0 nucleotides with a 2'-fluoro modification.
  • the RNAi agent may contain 2 nucleotides with a 2'-fluoro modification, e.g., 0 nucleotides with a 2-fluoro modification in the sense strand and 2 nucleotides with a 2'-fluoro modification in the antisense strand.
  • the iRNA that contains conjugations of one or more carbohydrate moieties to an iRNA can optimize one or more properties of the iRNA.
  • the carbohydrate moiety will be attached to a modified subunit of the iRNA.
  • the ribose sugar of one or more ribonucleotide subunits of a iRNA can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand.
  • a ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS).
  • RRMS ribose replacement modification subunit
  • a cyclic carrier may be a carbocyclic ring system, i. e. , all ring atoms are carbon atoms, or a heterocyclic ring system, i. e. , one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulfur.
  • the cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings.
  • the cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.
  • the ligand may be attached to the polynucleotide via a carrier.
  • the carriers include (i) at least one “backbone attachment point,” preferably two “backbone attachment points” and (ii) at least one “tethering attachment point.”
  • a “backbone attachment point” as used herein refers to a functional group, e.g. a hydroxyl group, or generally, a bond available for, and that is suitable for incorporation of the carrier into the backbone, e.g., the phosphate, or modified phosphate, e.g., sulfur containing, backbone, of a ribonucleic acid.
  • a “tethering attachment point” in some embodiments refers to a constituent ring atom of the cyclic carrier, e.g., a carbon atom or a heteroatom (distinct from an atom which provides a backbone attachment point), that connects a selected moiety.
  • the moiety can be, e.g., a carbohydrate, e.g. monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide.
  • the selected moiety is connected by an intervening tether to the cyclic carrier.
  • the cyclic carrier will often include a functional group, e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g. , a ligand to the constituent ring.
  • a functional group e.g., an amino group, or generally, provide a bond, that is suitable for incorporation or tethering of another chemical entity, e.g. , a ligand to the constituent ring.
  • the iRNA may be conjugated to a ligand via a carrier, wherein the carrier can be cyclic group or acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [l,3]dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl, and decalin; preferably, the acyclic group is a serinol backbone or diethanolamine backbone.
  • an iRNA agent comprises a sense strand and an antisense strand, each strand having 14 to 40 nucleotides.
  • the RNAi agent may be represented by formula (L): (L),
  • B1, B2, B3, B1', B2', B3', and B4' each are independently a nucleotide containing a modification selected from the group consisting of 2'-O-alkyl, 2 ’-substituted alkoxy, 2 ’-substituted alkyl, 2'-halo, ENA, and BNA/LNA.
  • B1, B2, B3, B1', B2', B3', and B4' each contain 2'-OMe modifications.
  • B1, B2, B3, B1', B2', B3', and B4' each contain 2'-OMe or 2'-F modifications.
  • at least one of B1, B2, B3, B1', B2', B3', and B4' contain 2'-O-N-methylacetamido (2'-O-NMA) modification.
  • Cl is a thermally destabilizing nucleotide placed at a site opposite to the seed region of the antisense strand (i.e., at positions 2-8 of the 5'-end of the antisense strand).
  • Cl is at a position of the sense strand that pairs with a nucleotide at positions 2-8 of the 5'-end of the antisense strand.
  • Cl is at position 15 from the 5'-end of the sense strand.
  • Cl nucleotide bears the thermally destabilizing modification which can include abasic modification; mismatch with the opposing nucleotide in the duplex; and sugar modification such as 2'-deoxy modification or acyclic nucleotide e.g., unlocked nucleic acids (UNA) or glycerol nucleic acid (GNA).
  • NUA unlocked nucleic acids
  • GAA glycerol nucleic acid
  • Cl has thermally destabilizing modification selected from the group consisting of: i) mismatch with the opposing nucleotide in the antisense strand; ii) abasic modification selected from the group consisting of: ; and iii) sugar modification selected from the group consisting of: , , and , wherein B is a modified or unmodified nucleobase, R 1 and R 2 independently are
  • the thermally destabilizing modification in Cl is a mismatch selected from the group consisting of G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, and U:T; and optionally, at least one nucleobase in the mismatch pair is a 2'-deoxy nucleobase.
  • the thermally destabilizing modification in C 1 is GNA or
  • T1, T1', T2', and T3' each independently represent a nucleotide comprising a modification providing the nucleotide a steric bulk that is less or equal to the steric bulk of a 2'-OMe modification.
  • a steric bulk refers to the sum of steric effects of a modification. Methods for determining steric effects of a modification of a nucleotide are known to one skilled in the art.
  • the modification can be at the 2' position of a ribose sugar of the nucleotide, or a modification to a non-ribose nucleotide, acyclic nucleotide, or the backbone of the nucleotide that is similar or equivalent to the 2' position of the ribose sugar, and provides the nucleotide a steric bulk that is less than or equal to the steric bulk of a 2'-OMe modification.
  • T1, T1', T2', and T3' are each independently selected from DNA, RNA, LNA, 2'-F, and 2' -F-5' -methyl.
  • T1 is DNA.
  • T1' is DNA, RNA or LNA.
  • T2' is DNA or RNA.
  • T3' is DNA or RNA.
  • n 1 , n 3 , and q 1 are independently 4 to 15 nucleotides in length.
  • n 5 , q 3 , and q 7 are independently 1-6 nucleotide(s) in length.
  • n 4 , q 2 , and q 6 are independently 1-3 nucleotide(s) in length; alternatively, n 4 is 0.
  • q 5 is independently 0-10 nucleotide(s) in length.
  • n 2 and q 4 are independently 0-3 nucleotide(s) in length.
  • n 4 is 0-3 nucleotide(s) in length.
  • n 4 can be 0. In one example, n 4 is 0, and q 2 and q 6 are 1. In another example, n 4 is 0, and q 2 and q 6 are 1, with two phosphorothioate intemucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' -end of the antisense strand).
  • n 4 , q 2 , and q 6 are each 1.
  • n 2 , n 4 , q 2 , q 4 , and q 6 are each 1.
  • Cl is at position 14-17 of the 5' -end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n 4 is 1. In one embodiment, Cl is at position 15 of the 5'- end of the sense strand
  • T3' starts at position 2 from the 5' end of the antisense strand. In one example, T3' is at position 2 from the 5' end of the antisense strand and q 6 is equal to 1.
  • T1' starts at position 14 from the 5' end of the antisense strand. In one example, T1 ’ is at position 14 from the 5' end of the antisense strand and q 2 is equal to 1. In an exemplary embodiment, T3' starts from position 2 from the 5' end of the antisense strand and T1' starts from position 14 from the 5' end of the antisense strand. In one example, T3' starts from position 2 from the 5' end of the antisense strand and q 6 is equal to 1 and T1' starts from position 14 from the 5' end of the antisense strand and q 2 is equal to 1.
  • T1' and T3' are separated by 11 nucleotides in length (i.e. not counting the T1' and T3' nucleotides).
  • T1' is at position 14 from the 5' end of the antisense strand. In one example, T1' is at position 14 from the 5' end of the antisense strand and q 2 is equal to 1, and the modification at the 2' position or positions in a non-ribose, acyclic or backbone that provide less steric bulk than a 2'-OMe ribose.
  • T3' is at position 2 from the 5' end of the antisense strand. In one example, T3' is at position 2 from the 5' end of the antisense strand and q 6 is equal to 1, and the modification at the 2' position or positions in a non-ribose, acyclic or backbone that provide less than or equal to steric bulk than a 2'-OMe ribose.
  • T1 is at the cleavage site of the sense strand. In one example, T1 is at position 11 from the 5' end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n 2 is 1. In an exemplary embodiment, T1 is at the cleavage site of the sense strand at position 11 from the 5' end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n 2 is 1,
  • T2' starts at position 6 from the 5' end of the antisense strand. In one example, T2' is at positions 6-10 from the 5' end of the antisense strand, and q 4 is 1.
  • T1 is at the cleavage site of the sense strand, for instance, at position 11 from the 5' end of the sense strand, when the sense strand is 19-22 nucleotides in length, and n 2 is 1 ; T1' is at position 14 from the 5' end of the antisense strand, and q 2 is equal to 1 , and the modification to T1' is at the 2' position of a ribose sugar or at positions in a non-ribose, acyclic or backbone that provide less steric bulk than a 2'-OMe ribose; T2' is at positions 6-10 from the 5' end of the antisense strand, and q 4 is 1; and T3' is at position 2 from the 5' end of the antisense strand, and q 6 is equal to 1, and the modification to T3' is at the 2' position or at positions in a non-ribose, acyclic or backbone that provide less than or equal to ster
  • T2' starts at position 8 from the 5' end of the antisense strand. In one example, T2' starts at position 8 from the 5' end of the antisense strand, and q 4 is 2.
  • T2' starts at position 9 from the 5' end of the antisense strand. In one example, T2' is at position 9 from the 5' end of the antisense strand, and q 4 is 1.
  • B1' is 2'-OMe or 2'-F
  • q 1 is 9
  • T1' is 2'-F
  • q 2 is 1
  • B2' is 2'-OMe or 2'-F
  • q 3 is 4,
  • T2' is 2'-F
  • q 4 is 1
  • B3' is 2'-OMe or 2'-F
  • q 5 is 6
  • T3' is 2'-F
  • q 6 is 1
  • B4' is 2'-OMe
  • q 7 is 1 ; with two phosphorothioate intemucleotide linkage modifications within positions 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' -end of the antisense strand
  • n 4 is 0, B3 is 2'-OMe, n 5 is 3, B1' is 2'-OMe or 2'-F, q 1 is 9, T1' is 2'-F, q 2 is 1, B2' is 2'-OMe or 2'-F, q 3 is 4, T2' is 2'-F, q 4 is 1, B3' is 2'-OMe or 2'-F, q 5 is 6, T3' is 2'-F, q 6 is 1, B4' is 2'-OMe, and q 7 is 1; with two phosphorothioate intemucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate intemucleotide linkage modifications within positions 18-23 of the antisense strand (counting from the 5' -end of the antis
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 is 0,
  • B3 is 2'OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, T2' is 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F, q 5 is 5, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe, and q 7 is 1
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F, q 5 is 5, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe, and q 7 is 1; with two phosphorothioate intemucleotide linkage modifications within positions 1 -5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleotide
  • B1 is 2'-OMe or 2'-F
  • n 1 6
  • T1 is 2' F
  • n 2 3
  • B2 is 2'-OMe
  • B3 is 2'OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 7
  • T1' 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4
  • T2' is 2'-F
  • q 4 2
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1
  • B1 is 2'-OMe or 2'-F
  • n 1 6
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 7
  • T1' 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' is 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F, q 5 is 5, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within positions 1 -5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleotide link
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 is 0,
  • B3 is 2'OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, T2' is 2'-F
  • q 4 1, B3' is 2'-OMe or 2'-F
  • q 5 6
  • T3' 2'-F
  • q 7 1
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' is 2'-F
  • q 4 1, B3' is 2'-OMe or 2'-F
  • q 5 6
  • T3' 2'-F
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within positions 1 -5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucle
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 0,
  • B3 is 2'OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 is 5
  • T2' 2'-F
  • q 4 is 1, B3' is 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 is 1; optionally with at least 2 additional TT at the 3' -end of the antisense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 is 5
  • T2' 2'-F
  • q 4 is 1, B3' is 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1; optionally with at least 2 additional TT at the 3'-end of the antisense strand; with two phosphorothioate intemucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' is 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7
  • T3' 2'-F
  • q 7 1
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' -end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate intem
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 is 0,
  • B3 is 2'OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' is 2'-F
  • q 4 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 6 1
  • B4' is 2'-F
  • q 7 1
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 0,
  • B3 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' is 2'-F
  • q 4 2, B3' 's 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within positions 1 -5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucle
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' is 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0,
  • B3' 2'-OMe or 2'-F
  • q 5 7
  • T3' 2'-F
  • q 7 1
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-F
  • q 7 is 1; with two phosphorothioate intemucleotide linkage modifications within positions 1-5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phospho
  • the RNAi agent can comprise a phosphorus-containing group at the 5'-end of the sense strand or antisense strand.
  • the 5'-end phosphorus-containing group can be 5'-end phosphate (5'-P), 5'-end phosphorothioate (5'-PS), 5'-end phosphorodithioate (5'-PS 2 ), 5'-end vinylphosphonate (5'-
  • the 5'-VP can be either 5'-E-VP isomer (i.e., trans -vinylphosphate , , 5'-Z-VP isomer (i.e., cis- vinylphosphate, ), or mixtures thereof.
  • the RNAi agent comprises a phosphorus-containing group at the 5'-end of the sense strand. In one embodiment, the RNAi agent comprises a phosphorus-containing group at the 5'- end of the antisense strand.
  • the RNAi agent comprises a 5'-P. In one embodiment, the RNAi agent comprises a 5'-P in the antisense strand.
  • the RNAi agent comprises a 5'-PS. In one embodiment, the RNAi agent comprises a 5'-PS in the antisense strand.
  • the RNAi agent comprises a 5'-VP. In one embodiment, the RNAi agent comprises a 5'-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5'-E-VP in the antisense strand. In one embodiment, the RNAi agent comprises a 5'-Z-VP in the antisense strand.
  • the RNAi agent comprises a 5'-PS 2 . In one embodiment, the RNAi agent comprises a 5'-PS 2 in the antisense strand.
  • the RNAi agent comprises a 5'-PS 2 . In one embodiment, the RNAi agent comprises a 5'-deoxy-5'-C-malonyl in the antisense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 is 0,
  • B3 is 2'OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, T2' is 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F, q 5 is 5, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe, and q 7 is 1.
  • the RNAi agent also comprises a 5'-PS.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 is 0,
  • B3 is 2'OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' is 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 6 1
  • B4' is 2'-OMe
  • q 7 1
  • the RNAi agent also comprises a 5'-P.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, T2' is 2'-F, q 4 is 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1.
  • the RNAi agent also comprises a 5' -VP.
  • the 5' -VP may be 5' -E-VP, 5'-Z-VP, or combination thereof.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 is 0,
  • B3 is 2'OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, T2' is 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F, q 5 is 5, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe, and q 7 is 1.
  • the RNAi agent also comprises a 5'- PS2.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 is 0,
  • B3 is 2'OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' is 2'-F
  • q 4 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1
  • the RNAi agent also comprises a 5'-deoxy-5'-C-malonyl.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F, q 5 is 5, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1 ; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleotide link
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F, q 5 is 5, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1 ; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleotide link
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F, q 5 is 5, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1 ; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleotide link
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleot
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' is 2'-F
  • q 4 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleo
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7
  • T3' 2'-F
  • q 7 1
  • the RNAi agent also comprises a 5'-P.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7
  • T3' 2'-F
  • q 7 1
  • the dsRNA agent also comprises a 5' -PS.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7
  • T3' 2'-F
  • q 7 1
  • the RNAi agent also comprises a 5' -VP.
  • the 5' -VP may be 5' -/i- VP, 5'-Z-VP, or combination thereof.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' is 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0,
  • B3' 2'-OMe or 2'-F
  • q 5 7
  • T3' 2'-F
  • q 7 1
  • the RNAi agent also comprises a 5'- PS2.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7
  • T3' 2'-F
  • q 7 1
  • the RNAi agent also comprises a 5'-deoxy-5'-C-malonyl.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate in
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate in
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate in
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate in
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate in
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 is 0,
  • B3 is 2'OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, T2' is 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F, q 5 is 5, T3' is 2'-F
  • q 6 1, B4' is 2'-F
  • q 7 1
  • the RNAi agent also comprises a 5'- P.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 is 0,
  • B3 is 2'OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' is 2'-F
  • q 4 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 6 1
  • B4' is 2'-F
  • q 7 1
  • the RNAi agent also comprises a 5'- PS.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, T2' is 2'-F, q 4 is 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1
  • the RNAi agent also comprises a 5'-VP.
  • the 5'-VP may be 5'-E'-VP, 5'-Z-VP, or combination thereof.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 is 0,
  • B3 is 2'OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' is 2'-F
  • q 4 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1
  • the dsRNAi RNA agent also comprises a 5'- PS2.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 is 0,
  • B3 is 2'OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' is 2'-F
  • q 4 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1
  • the RNAi agent also comprises a 5'-deoxy-5'-C-malonyl.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleot
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleot
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleot
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleot
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleot
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7
  • T3' 2'-F
  • q 7 1
  • the RNAi agent also comprises a 5'- P.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7
  • T3' 2'-F
  • q 7 1
  • the RNAi agent also comprises a 5'- PS.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7
  • T3' 2'-F
  • q 7 1
  • the RNAi agent also comprises a 5'- VP.
  • the 5' -VP may be 5'-.E-VP, 5'-Z-VP, or combination thereof.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' is 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0,
  • B3' 2'-OMe or 2'-F
  • q 5 7
  • T3' 2'-F
  • q 7 1
  • the RNAi agent also comprises a 5'- PS2.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7
  • T3' 2'-F
  • q 7 1
  • the RNAi agent also comprises a 5'-deoxy-5'-C-malonyl.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-F
  • q 7 is 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorot
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-F
  • q 7 is 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorot
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-F
  • q 7 is 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorot
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-F
  • q 7 is 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorot
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-F
  • q 7 is 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorot
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1 ’ is 2'-OMe or 2'-F
  • q 1 9
  • T1 ’ is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4
  • T2' 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucle
  • the RNAi agent also comprises a 5' -P and a targeting ligand.
  • the 5' -P is at the 5' -end of the antisense strand
  • the targeting ligand is at the 3' -end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F, q 5 is 5, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1 ; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleotide link
  • the RNAi agent also comprises a 5'-PS and a targeting ligand.
  • the 5'- PS is at the 5' -end of the antisense strand
  • the targeting ligand is at the 3' -end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F, q 5 is 5, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1 ; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleotide link
  • the 5' -VP is at the 5' -end of the antisense strand
  • the targeting ligand is at the 3'-end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F, q 5 is 5, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1 ; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleotide link
  • the RNAi agent also comprises a 5'- PS2 and a targeting ligand.
  • the 5'- PS2 is at the 5'-end of the antisense strand
  • the targeting ligand is at the 3'-end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F, q 5 is 5, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe, and q 7 is 1 ; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleot
  • the RNAi agent also comprises a 5'-deoxy-5'-C-malonyl and a targeting ligand.
  • the 5'-deoxy-5'-C-malonyl is at the 5' -end of the antisense strand
  • the targeting ligand is at the 3' -end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate in
  • the RNAi agent also comprises a 5'-P and a targeting ligand.
  • the 5'-P is at the 5' -end of the antisense strand
  • the targeting ligand is at the 3' -end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate in
  • the RNAi agent also comprises a 5' -PS and a targeting ligand.
  • the 5'-PS is at the 5'-end of the antisense strand
  • the targeting ligand is at the 3' -end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate in
  • the RNAi agent also comprises a 5'-VP (e.g., a 5'-/'-VP, 5'-Z-VP, or combination thereof) and a targeting ligand.
  • a 5'-VP e.g., a 5'-/'-VP, 5'-Z-VP, or combination thereof
  • a targeting ligand is at the 3'-end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate in
  • the RNAi agent also comprises a 5'-PS 2 and a targeting ligand.
  • the 5'-PS 2 is at the 5'-end of the antisense strand
  • the targeting ligand is at the 3' -end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-OMe
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorothioate in
  • the RNAi agent also comprises a 5'-deoxy-5'- C-malonyl and a targeting ligand.
  • the 5'-deoxy-5'-C-malonyl is at the 5' -end of the antisense strand
  • the targeting ligand is at the 3' -end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleot
  • the RNAi agent also comprises a 5'-P and a targeting ligand.
  • the 5'-P is at the 5'-end of the antisense strand
  • the targeting ligand is at the 3'-end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2, B3' is 2'-OMe or 2'-F, q 5 is 5, T3' is 2'-F
  • q 6 1, B4' is 2'-F
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1-5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleotide linkage modifications at
  • the RNAi agent also comprises a 5'-PS and a targeting ligand.
  • the 5'- PS is at the 5' -end of the antisense strand
  • the targeting ligand is at the 3' -end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleot
  • the RNAi agent also comprises a 5'-VP (e.g., a 5’-E'-VP, 5'-Z-VP, or combination thereof) and a targeting ligand.
  • a 5'-VP e.g., a 5’-E'-VP, 5'-Z-VP, or combination thereof
  • the 5' -VP is at the 5' -end of the antisense strand
  • the targeting ligand is at the 3' -end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleot
  • the RNAi agent also comprises a 5'-PS 2 and a targeting ligand.
  • the 5'- PS2 is at the 5'-end of the antisense strand
  • the targeting ligand is at the 3'-end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8
  • T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7
  • n 4 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4,
  • T2' 2'-F
  • q 4 2,
  • B3' 2'-OMe or 2'-F
  • q 5 5
  • T3' 2'-F
  • q 7 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5'-end of the sense strand), and two phosphorothioate intemucleot
  • the RNAi agent also comprises a 5'-deoxy-5'-C-malonyl and a targeting ligand.
  • the 5'-deoxy-5'-C-malonyl is at the 5' -end of the antisense strand
  • the targeting ligand is at the 3' -end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-F
  • q 7 is 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorot
  • the RNAi agent also comprises a 5'-P and a targeting ligand.
  • the 5'-P is at the 5' -end of the antisense strand
  • the targeting ligand is at the 3' -end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-F
  • q 7 is 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorot
  • the RNAi agent also comprises a 5'- PS and a targeting ligand.
  • the 5' -PS is at the 5'- end of the antisense strand
  • the targeting ligand is at the 3' -end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-F
  • q 7 is 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorot
  • the RNAi agent also comprises a 5'- VP (e.g., a 5' -E-VP, 5'-Z-VP, or combination thereof) and a targeting ligand.
  • a 5'-VP e.g., a 5' -E-VP, 5'-Z-VP, or combination thereof
  • a targeting ligand is at the 3' -end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-F
  • q 7 is 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorot
  • the RNAi agent also comprises a 5'- PS2 and a targeting ligand.
  • the 5'-PS 2 is at the 5'-end of the antisense strand
  • the targeting ligand is at the 3'-end of the sense strand.
  • B1 is 2'-OMe or 2'-F
  • n 1 8 T1 is 2'F
  • n 2 3
  • B2 is 2'-OMe
  • n 3 7, n 4 is 0,
  • B3 is 2'-OMe
  • n 5 3
  • B1' 2'-OMe or 2'-F
  • q 1 9
  • T1' is 2'-F
  • q 2 1, B2' is 2'-OMe or 2'-F
  • q 3 4, q 4 is 0, B3' is 2'-OMe or 2'-F
  • q 5 7, T3' is 2'-F
  • q 6 1, B4' is 2'-F
  • q 7 is 1; with two phosphorothioate intemucleotide linkage modifications within position 1 -5 of the sense strand (counting from the 5' -end of the sense strand), and two phosphorothioate intemucleotide linkage modifications at positions 1 and 2 and two phosphorot
  • the RNAi agent also comprises a 5'-deoxy-5'-C-malonyl and a targeting ligand.
  • the 5'-deoxy-5'-C-malonyl is at the 5'-end of the antisense strand
  • the targeting ligand is at the 3'-end of the sense strand.
  • an RNAi agent of the present invention comprises:
  • an ASGPR ligand attached to the 3'-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • an RNAi agent of the present invention comprises:
  • an ASGPR ligand attached to the 3'-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • RNAi agents have a two nucleotide overhang at the 3' -end of the antisense strand, and a blunt end at the 5' -end of the antisense strand.
  • RNAi agent of the present invention comprises:
  • an ASGPR ligand attached to the 3'-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • RNAi agents have a two nucleotide overhang at the 3' -end of the antisense strand, and a blunt end at the 5' -end of the antisense strand.
  • RNAi agent of the present invention comprises:
  • an ASGPR ligand attached to the 3'-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • RNAi agents have a two nucleotide overhang at the 3' -end of the antisense strand, and a blunt end at the 5' -end of the antisense strand.
  • RNAi agent of the present invention comprises:
  • an ASGPR ligand attached to the 3' -end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • RNAi agents have a two nucleotide overhang at the 3' -end of the antisense strand, and a blunt end at the 5' -end of the antisense strand.
  • RNAi agent of the present invention comprises:
  • an ASGPR ligand attached to the 3' -end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • RNAi agents have a two nucleotide overhang at the 3' -end of the antisense strand, and a blunt end at the 5' -end of the antisense strand.
  • RNAi agent of the present invention comprises:
  • an ASGPR ligand attached to the 3'-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • RNAi agents have a four nucleotide overhang at the 3' -end of the antisense strand, and a blunt end at the 5' -end of the antisense strand.
  • RNAi agent of the present invention comprises:
  • an ASGPR ligand attached to the 3'-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • RNAi agents have a two nucleotide overhang at the 3' -end of the antisense strand, and a blunt end at the 5' -end of the antisense strand.
  • RNAi agent of the present invention comprises:
  • an ASGPR ligand attached to the 3'-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • RNAi agent of the present invention comprises:
  • an ASGPR ligand attached to the 3'-end wherein said ASGPR ligand comprises three GalNAc derivatives attached through a trivalent branched linker;
  • RNAi agents have a two nucleotide overhang at the 3' -end of the antisense strand, and a blunt end at the 5' -end of the antisense strand.
  • the iRNA for use in the methods of the invention is an agent selected from agents listed in Table 3, Table 5, or Table 6. These agents may further comprise a ligand.
  • the double-stranded RNAi gents for use in the methods of the invention may optionally be conjugated to one or more ligands, moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the iRNA e.g., into a cell.
  • the ligand can be attached to the sense strand, antisense strand or both strands, at the 3'-end, 5'-end or both ends.
  • the ligand may be conjugated to the sense strand.
  • the ligand is conjugated to the 3' -end of the sense strand.
  • Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556).
  • the ligand is cholic acid (Manoharan et al, Biorg. Med. Chem. Let., 1994, 4: 1053-1060), athioether, e.g., beryl- S-tritylthiol (Manoharan et aI.,Ahh. NY. Acad. Sci., 1992, 660:306-309; Manoharan et al, Biorg. Med. Chem.
  • a phospholipid e.g., di-hexadecyl-rac -glycerol or triethyl -ammonium l,2-di-O-hexadecyl-rac-glycero-3-phosphonate
  • a polyamine or a polyethylene glycol chain Manoharan et al.
  • the ligand is a GalNAc ligand.
  • the ligand is GalNAc3.
  • the ligands are coupled, preferably covalently, either directly or indirectly via an intervening tether.
  • a ligand alters the distribution, targeting, or lifetime of an iRNA agent into which it is incorporated.
  • a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand.
  • Preferred ligands do not take part in duplex pairing in a duplexed nucleic acid.
  • Ligands can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine, or hyaluronic acid); or a lipid.
  • the ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid.
  • polyamino acids examples include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2- hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N-isopropylacrylamide polymers, or polyphosphazine.
  • PLL polylysine
  • poly L-aspartic acid poly L-glutamic acid
  • styrene-maleic acid anhydride copolymer poly(L-lactide-co-glycolied) copolymer
  • divinyl ether-maleic anhydride copolymer divinyl ether
  • polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.
  • Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell.
  • a targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl- glucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic.
  • the ligand is a multivalent galactose, e.g., an N-acetyl-galactosamine.
  • ligands include dyes, intercalating agents (e.g. acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g.
  • EDTA lipophilic molecules, e.g., cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid,O3- (oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine)and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG] 2 , polyamino, alkyl,
  • biotin e.g., aspirin, vitamin E, folic acid
  • transport/absorption facilitators e.g., aspirin, vitamin E, folic acid
  • synthetic ribonucleases e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine- imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, or AP.
  • Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a hepatic cell.
  • Ligands can also include hormones and hormone receptors. They can also include non- peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fiicose.
  • the ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-KB.
  • the ligand can be a substance, e.g., a drug, which can increase the uptake of the iRNA agent into the cell, for example, by disrupting the cell’s cytoskeleton, e.g., by disrupting the cell’s microtubules, microfilaments, or intermediate filaments.
  • the drug can be, for example, taxol, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin.
  • a ligand attached to an iRNA as described herein acts as a pharmacokinetic modulator (PK modulator).
  • PK modulators include lipophiles, bile acids, steroids, phospholipid analogues, peptides, protein binding agents, PEG, vitamins, etc.
  • Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkylglycerides, diacylglyceride, phospholipids, sphingolipids, naproxen, ibuprofen, vitamin E, biotin.
  • Oligonucleotides that comprise a number of phosphorothioate linkages are also known to bind to serum protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases, comprising multiple of phosphorothioate linkages in the backbone are also amenable to the present invention as ligands (e.g. as PK modulating ligands).
  • ligands e.g. as PK modulating ligands
  • aptamers that bind serum components are also suitable for use as PK modulating ligands in the embodiments described herein.
  • Ligand-conjugated iRNAs of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below).
  • This reactive oligonucleotide may be reacted directly with commercially-available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto.
  • oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis.
  • the oligonucleotides and oligonucleosides may be assembled on a suitable DNA synthesizer utilizing standard nucleotide or nucleoside precursors, or nucleotide or nucleoside conjugate precursors that already bear the linking moiety, ligand-nucleotide or nucleoside- conjugate precursors that already bear the ligand molecule, or non-nucleoside ligand-bearing building blocks.
  • the oligonucleotides or linked nucleosides of the present invention are synthesized by an automated synthesizer using phosphoramidites derived from ligand-nucleoside conjugates in addition to the standard phosphoramidites and non-standard phosphoramidites that are commercially available and routinely used in oligonucleotide synthesis.
  • the ligand or conjugate is a lipid or lipid-based molecule.
  • a lipid or lipid-based molecule preferably binds a serum protein, e.g., human serum albumin (HSA).
  • HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body.
  • the target tissue can be the liver, including parenchymal cells of the liver.
  • Other molecules that can bind HSA can also be used as ligands. For example, naproxen or aspirin can be used.
  • a lipid or lipid-based ligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, or (c) can be used to adjust binding to a serum protein, e.g., HSA.
  • a lipid based ligand can be used to inhibit, e.g., control the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney.
  • the lipid based ligand binds HSA. Preferably, it binds HSA with a sufficient affinity such that the conjugate will be preferably distributed to a non-kidney tissue. However, it is preferred that the affinity not be so strong that the HSA-ligand binding cannot be reversed. In other embodiments, the lipid based ligand binds HSA weakly or not at all, such that the conjugate will be preferably distributed to the kidney. Other moieties that target to kidney cells can also be used in place of, or in addition to, the lipid based ligand.
  • the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell.
  • a target cell e.g., a proliferating cell.
  • vitamins include vitamin A, E, and K.
  • Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by target cells such as liver cells. Also included are HSA and low density lipoprotein (LDL).
  • B low density lipoprotein
  • the ligand is a cell-permeation agent, preferably a helical cell-permeation agent.
  • the agent is amphipathic.
  • An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids.
  • the helical agent is preferably an alpha-helical agent, which preferably has a lipophilic and a lipophobic phase.
  • the ligand can be a peptide or peptidomimetic.
  • a peptidomimetic also referred to herein as an oligopeptidomimetic is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide.
  • the attachment of peptide and peptidomimetics to iRNA agents can affect pharmacokinetic distribution of the iRNA, such as by enhancing cellular recognition and absorption.
  • the peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
  • a peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g., consisting primarily of Tyr, Trp, or Phe).
  • the peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide.
  • the peptide moiety can include a hydrophobic membrane translocation sequence (MTS).
  • An exemplary hydrophobic MTS-containing peptide is RFGF having the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 13).
  • An RFGF analogue e.g., amino acid sequence AALLPVLLAAP (SEQ ID NO: 14) containing a hydrophobic MTS can also be a targeting moiety.
  • the peptide moiety can be a “delivery” peptide, which can carry large polar molecules including peptides, oligonucleotides, and protein across cell membranes.
  • sequences from the HIV Tat protein GRKKRRQRRRPPQ (SEQ ID NO: 15) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 16) have been found to be capable of functioning as delivery peptides.
  • a peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one-compound (OBOC) combinatorial library (Lam et al, Nature, 354:82-84, 1991).
  • OBOC one-bead-one-compound
  • Examples ofapeptide or peptidomimetic tethered to a dsRNA agent via an incorporated monomer unit for cell targeting purposes is an arginine -glycine -aspartic acid (RGD)-peptide, or RGD mimic.
  • a peptide moiety can range in length from about 5 amino acids to about 40 amino acids.
  • the peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.
  • RGD peptide for use in the compositions and methods of the invention may be linear or cyclic, and may be modified, e.g., glycosylated or methylated, to facilitate targeting to a specific tissue(s).
  • RGD -containing peptides and peptidiomimemtics may include D-amino acids, as well as synthetic RGD mimics.
  • a “cell permeation peptide” is capable of permeating a cell, e.g., a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell.
  • a microbial cell -permeating peptide can be, for example, an ⁇ -helical linear peptide (e.g., LL-37 or Ceropin PI), a disulfide bond- containing peptide (e.g. , a -defensin, b-defensin or bactenecin), or a peptide containing only one or two dominating amino acids (e.g, PR-39 or indolicidin).
  • a cell permeation peptide can also include a nuclear localization signal (NLS).
  • NLS nuclear localization signal
  • a cell permeation peptide can be a bipartite amphipathic peptide, such as MPG, which is derived from the fusion peptide domain of HIV- 1 gp41 and the NLS of SV40 large T antigen (Simeoni et al, Nucl. Acids Res. 31:2717-2724, 2003).
  • MPG nuclear localization signal
  • an iRNA further comprises a carbohydrate.
  • the carbohydrate conjugated iRNA is advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein.
  • “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom.
  • Representative carbohydrates include the sugars (mono-, di-, tri-, and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums.
  • Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).
  • a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide.
  • a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of: Formula II,
  • a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide.
  • the monosaccharide is an N- acetylgalactosamine, such as
  • a suitable ligand is a ligand disclosed in WO 2019/055633, the entire contents of which are incorporated herein by reference.
  • the ligand comprises the structure below:
  • the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a monovalent linker.
  • the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a bivalent linker.
  • the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a trivalent linker.
  • the double stranded RNAi agents of the invention comprise one GalNAc or GalNAc derivative attached to the iRNA agent, e.g., the 5'end of the sense strand of a dsRNA agent, or the 5' end of one or both sense strands of a dual targeting RNAi agent as described herein.
  • the double stranded RNAi agents of the invention comprise a plurality (e.g.,
  • GalNAc or GalNAc derivatives each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.
  • each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker.
  • the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator or a cell permeation peptide.
  • Additional carbohydrate conjugates and linkers suitable for use in the present invention include those described in PCT Publication Nos. WO 2014/179620 and WO 2014/179627, the entire contents of each of which are incorporated herein by reference.
  • the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable.
  • linker or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound.
  • Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(O)NH, SO, SO 2 , SO 2 NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alky
  • the linker is about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18, 7-17, 8-17, 6-16, 7-17, or 8-16 atoms.
  • a cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together.
  • the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or more, or at least 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).
  • Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential, or the presence of degradative molecules.
  • cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood.
  • degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.
  • redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group
  • a cleavable linkage group such as a disulfide bond can be susceptible to pH.
  • the pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0.
  • Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.
  • a linker can include a cleavable linking group that is cleavable by a particular enzyme.
  • cleavable linking group incorporated into a linker can depend on the cell to be targeted.
  • a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group.
  • Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich.
  • Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.
  • Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.
  • the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue.
  • a degradative agent or condition
  • the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue.
  • the evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals.
  • useful candidate compounds are cleaved at least about 2,
  • a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation.
  • An example of reductively cleavable linking group is a disulphide linking group (-S-S-).
  • a candidate cleavable linking group is a suitable “reductively cleavable linking group,” or for example is suitable for use with a particular iRNA moiety and particular targeting agent one can look to methods described herein.
  • a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell.
  • the candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions.
  • candidate compounds are cleaved by at most about 10% in the blood.
  • useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions).
  • the rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.
  • a cleavable linker comprises a phosphate-based cleavable linking group.
  • a phosphate-based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group.
  • An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells.
  • phosphate-based linking groups are -O-P(0)(0Rk)-O-, -O- P(S)(ORk)-O-, -O-P(S)(SRk)-O-, -S-P(0)(0Rk)-O-, -O-P(0)(0Rk)-S-, -S-P(0)(ORk)-S-, -O- P(S)(ORk)-S-, -S-P(S)(ORk)-O-, -O-P(0)(Rk)-O-, -O-P(S)(Rk)-O-, -S-P(0)(Rk)-O-, -S-P(0)(Rk)(Rk)-O-, -S-P(0)(Rk)-O-, -S-P(0)(Rk)-S-, -O-P(S)( Rk)-S-.
  • Preferred embodiments are -O-P(0)(0H)-O-, -O-P(S)(0H)-O-, -O- P(S)(SH)-O-, -S-P(0)(0H)-O-, -O-P(0)(0H)-S-, -S-P(0)(OH)-S-, -O-P(S)(OH)-S-, -S-P(S)(OH)-O-, -O-P(0)(H)-O-, -O-P(S)(H)-O-, -S-P(0)(H)-0, -S-P(S)(H)-O-, -S-P(0)(H)-S-, and -O-P(S)(H)-S-.
  • a preferred embodiment is -O-P(0)(0H)-O-.
  • a cleavable linker comprises an acid cleavable linking group.
  • An acid cleavable linking group is a linking group that is cleaved under acidic conditions.
  • acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower (e.g., about 6.0, 5.5, 5.0, or lower), or by agents such as enzymes that can act as a general acid.
  • specific low pH organelles such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups.
  • acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids.
  • a preferred embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above.
  • Ester-based linking groups In other embodiments, a cleavable linker comprises an ester-based cleavable linking group.
  • ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells.
  • ester-based cleavable linking groups include, but are not limited to, esters of alkylene, alkenylene and alkynylene groups.
  • Ester cleavable linking groups have the general formula -C(O)O-, or -OC(O)-. These candidates can be evaluated using methods analogous to those described above.
  • a cleavable linker comprises a peptide-based cleavable linking group.
  • a peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells.
  • Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides.
  • Peptide-based cleavable groups do not include the amide group (-C(O)NH-).
  • the amide group can be formed between any alkylene, alkenylene or alkynelene.
  • a peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins.
  • the peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group.
  • Peptide-based cleavable linking groups have the general formula l NHCHRAC(O)NHCHRBC(O)-, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above.
  • an iRNA of the invention is conjugated to a carbohydrate through a linker.
  • Non-limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to, (Formula XXXVII), (Formula XXXVIII), (Formula XXXIX), (Formula XL), (Formula XLI), (Formula XLII),
  • a ligand is one or more “GalNAc” (N -acetylgalactosamine) derivatives attached through a bivalent or trivalent branched linker.
  • a dsRNA of the invention is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XLV) - (XL VI):
  • Formula XLVII Formula XLVIII wherein: q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different; P 2A , P 2B , P 3A , P 3B , P 4A , P 4B , P 5A , P 5B , P 5C , T 2A , T 2B , T 3A , T 3B , T 4A , T 4B , T 4A , T 5B , T 5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), CH 2 , CH 2 NH or CH 2 O; Q 2A , Q 2B , Q 3A , Q 3B , Q 4A , Q 4B , Q 5A , Q 5B , Q 5C
  • Trivalent conjugating GalNAc derivatives are particularly useful for use with RNAi agents for inhibiting the expression of a target gene, such as those of formula (XLIX): Formula XLIX , wherein L 5A , L 5B and L 5C represent a monosaccharide, such as GalNAc derivative.
  • Suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures recited above as formulas II, VII, XI, X, and XIII.
  • Representative U.S. Patents that teach the preparation of RNA conjugates include, but are not limited to, U.S.
  • the present invention also includes iRNA compounds that are chimeric compounds.
  • iRNA compounds or “chimeras,” in the context of this invention are iRNA compounds, preferably dsRNAi agents, that contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e. , a nucleotide in the case of a dsRNA compound. These iRNAs typically contain at least one region wherein the RNA is modified so as to confer upon the iRNA increased resistance to nuclease degradation, increased cellular uptake, or increased binding affinity for the target nucleic acid. An additional region of the iRNA can serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
  • RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of iRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter iRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxy dsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.
  • the RNA of an iRNA can be modified by a non-ligand group.
  • non-ligand molecules have been conjugated to iRNAs in order to enhance the activity, cellular distribution or cellular uptake of the iRNA, and procedures for performing such conjugations are available in the scientific literature.
  • Such non-ligand moieties have included lipid moieties, such as cholesterol (Kubo, T. etal, Biochem. Biophys. Res. Comm., 2007, 365( 1): 54-61 ; Letsinger et al. Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al, Bioorg. Med. Chem.
  • athioether e.g., hexyl-S-tritylthiol (Manoharan etal., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al, Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al, Nucl.
  • Acids Res., 1990, 18:3777 a polyamine or a polyethylene glycol chain (Manoharan et al, Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al, Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al. , Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923).
  • RNA conjugates having an aminolinker at one or more positions of the sequence.
  • the amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents.
  • the conjugation reaction can be performed either with the RNA still bound to the solid support or following cleavage of the RNA, in solution phase. Purification of the RNA conjugate by HPLC typically affords the pure conjugate.
  • Pharmaceutical Compositions of the Invention also includes pharmaceutical compositions and formulations which include the iRNAs for use in the methods of the invention.
  • compositions containing an iRNA as described herein, and a pharmaceutically acceptable carrier.
  • the pharmaceutical compositions containing the iRNA are useful for preventing or treating an AGT associateed disorder, e.g., hypertension.
  • Such pharmaceutical compositions are formulated based on the mode of delivery.
  • the pharmaceutical compositions comprising RNAi agents of the invention may be, for example, solutions with or without a buffer, or compositions containing pharmaceutically acceptable carriers.
  • Such compositions include, for example, aqueous or crystalline compositions, liposomal formulations, micellar formulations, emulsions, and gene therapy vectors.
  • the RNAi agent may be administered in a solution.
  • a free RNAi agent may be administered in an unbuffered solution, e.g., in saline or in water.
  • the free siRNA may also be administered in a suitable buffer solution.
  • the buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof.
  • the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the RNAi agent can be adjusted such that it is suitable for administering to a subject.
  • the buffer solution further comprises an agent for controlling the osmolarity of the solution, such that the osmolarity is kept at a desired value, e.g., at the physiologic values of the human plasma.
  • Solutes which can be added to the buffer solution to control the osmolarity include, but are not limited to, proteins, peptides, amino acids, non-metabolized polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts.
  • the agent for controlling the osmolarity of the solution is a salt.
  • the agent for controlling the osmolarity of the solution is sodium chloride or potassium chloride.
  • the pharmaceutical compositions of the invention are pyrogen free or non-pyrogenic.
  • the pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be topical (e.g., by a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral.
  • Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, e.g., via an implanted device; or intracranial, e.g., by intraparenchymal, intrathecal or intraventricular, administration.
  • compositions that are formulated for systemic administration via parenteral delivery e.g., by subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery.
  • the pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of an AGT gene.
  • the pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of an AGT gene.
  • a fixed dose of about 50 mg to about 800 mg (e.g., about 50 to about 200 mg, about 50 mg to about 500 mg, about 100 mg to about 800 mg, about 100 mg to about 500 mg, about 100 mg to about 300 mg, about 200 mg to about 300 mg, about 200 mg to about 400 mg, about 200 mg to about 500 mg, about 200 mg to about 800 mg, about 300 mg to about 800 mg, about 300 mg to about 500 mg, about 300 mg to about 4000 mg, about 400 mg to about 800 mg, about 400 mg to about 500 mg, e.g., about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or about 800 mg) of the iRNA agents are administered to the subject.
  • a repeat-dose regimen may include administration of a therapeutic amount of iRNA on a regular basis, such as every month, every two months, every three months, every four months, every five months, every six months, once every 3-6 months, or once a year.
  • the iRNA is administered about once per month to about once per quarter to about once per six months.
  • the treatments can be administered on a less frequent basis. Duration of treatment can be determined based on the severity of disease.
  • a single dose of the pharmaceutical compositions can be long lasting, such that doses are administered at not more than 1, 2, 3, 4, 5 or 6 month intervals.
  • a single dose of the pharmaceutical compositions of the invention is administered about once per month.
  • a single dose of the pharmaceutical compositions of the invention is administered quarterly (i.e., about every three months). In other embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered twice per year (i.e., about once every six months).
  • treatment of a subject with a prophylactically or therapeutically effective amount, as appropriate, of a composition can include a single treatment or a series of treatments.
  • compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semisolids. Formulations include those that target the liver.
  • the pharmaceutical formulations of the present invention which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s).
  • kits for performing any of the methods of the invention include one or more double stranded RNAi agent(s) and instructions for use, e.g., instructions for administering a fixed dose of a double stranded RNAi agent(s).
  • the double stranded RNAi agent may be in a vial or a pre-filled syringe.
  • kits may optionally further comprise means for administering the double stranded RNAi agent (e.g., an injection device, such as a pre-filled syringe), or means for measuring the inhibition of AGT (e.g., means for measuring the inhibition of AGT mRNA, AGT protein, and/or AGT activity).
  • means for measuring the inhibition of AGT may comprise a means for obtaining a sample from a subject, such as, e.g., a plasma sample.
  • the kits of the invention may optionally further comprise means for determining the therapeutically effective or prophylactically effective amount. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
  • nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5'-3'- phosphodiester bonds unless otherwise indicated.
  • a multicenter, randomized, double-blind, active comparator single dose and multiple dose clinical trial was designed to evaluate the safety, tolerability, pharmacokinetic (PK), and pharmacodynamic (PD) effects of subcutaneous administration of (SC) AD-85481 to patients with hypertension.
  • PK pharmacokinetic
  • PD pharmacodynamic
  • Part A single ascending dose (SAD) phase in hypertensive patients
  • Part B Single dose (SD) in hypertensive patients with controlled salt intake;
  • Part C Multiple dose (MD) phase in hypertensive patients.
  • Part D Multiple dose (MD) phase in hypertensive patients who are obese.
  • SBP sitting systolic blood pressure
  • DBP sitting diastolic blood pressure
  • AD-85481 a chemically modified, N'-accty lgal actosam i nc (GalNAc)-conjugated small interfering RNA (si RNA) designed to suppress production of angiotensinogen (AGT) as a strategy to lower blood pressure in individuals with hypertension, was administered either as a single subcutaneous injection (Parts A and B) or 2 subcutaneous injections administered once at Week 1 and once at Week 12 (Parts C and D).
  • GalNAc N'-accty lgal actosam i nc
  • si RNA small interfering RNA
  • a is 2'-O-methyladenosine-3' -phosphate
  • c is 2'-O-methylcytidine-3' -phosphate
  • g is 2'-O-methylguanosine-3' -phosphate
  • u is 2'-O- methyluridine -3' -phosphate
  • Af is 2'-fluoroadenosine-3'-phosphate
  • Cf is 2'-fluorocytidine-3'- phosphate
  • Gf is 2' -fluoroguanosine -3' -phosphate
  • (Ggn) is guanosine-glycol nucleic acid (GNA)
  • s is phosphorothioate linkage.
  • the 3' end of the sense strand is covalently linked to an N-[tris(GalNAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinol (also referred to as Hyp-(GalNAc-alkyl)3 or L96) ligand.
  • the control drug for AD-85481 was a placebo (normal saline 0.9% for subcutaneous administration).
  • the dummy treatment for AD-85481 is normal saline 0.9% for subcutaneous administration.
  • the dummy treatment for irbesartan is an inert dummy tablet that matches the appearance of irbesartan.
  • Active Comparator Control, Dose, and Mode of Administration In Parts C and D of this study, once daily oral (PO) doses of 150 mg irbesartan is used as the active comparator. Duration of Treatment and Study Participation A single subcutaneous dose of AD-85481 was administered in Parts A and B. In Parts C and D, 2 subcutaneous doses of study drug are administered over 12 weeks. Statistical Methods The sample size was based on practical considerations and is consistent with this type of early phase study. The Full Analysis Set (FAS) included all patients who received any amount of study drug grouped according to the treatment to which they were randomized.
  • FAS Full Analysis Set
  • the PK Analysis Set included all patients who received at least 1 dose of study drug and have at least 1 post-dose blood sample for determination of AD-85481 concentrations and have evaluable PK data.
  • the PD Analysis Set included all patients who received at least 1 dose of study drug and who had at least 1 post-dose blood sample for the determination of serum AGT.
  • AD-85481 activity was analyzed using the FAS.
  • the PK and PD Analysis Sets were used to conduct PK and PD analyses, respectively.
  • Statistical analyses are primarily descriptive in nature. Descriptive statistics (e.g., mean, standard deviation, median, minimum, and maximum) are presented for continuous variables. Frequencies and percentages are presented for categorical and ordinal variables.
  • Downstream effectors of AGT may also be measured in blood and urine specimens as exploratory biomarkers.
  • Pharmacokinentic (PK) of AD-85481 PK parameters of AD-85481 were assessed by determinatuion of plasma and urine levels of AD-85481 and potential metabolites, e.g., by qPCR.
  • Blood pressure reduction This study enrolled patients with hypertension (initially corresponding to Grade 1 per ESC/ESH criteria) to enable the assessment of therapeutic blood pressure reduction. Single dose phases (Parts A and B) are of short duration and use an inert placebo group.
  • Parts C and D use an established angiotensin II-receptor blocker (ARB) (irbesartan) as an active comparator to AD-85481 treatment.
  • ARB angiotensin II-receptor blocker
  • Exploratory assessments of AD-85481 include change from baseline in SBP and DBP assessed by 24 hour ambulatory blood pressure monitoring (ABPM) and the change from baseline in SBP and DBP assessed by oscillometric automated office blood pressure (AOBP) and by oscillometric home blood pressure monitoring (HBPM).
  • AOBP oscillometric automated office blood pressure
  • HBPM oscillometric home blood pressure monitoring
  • patients discontinue prior antihypertensive medications for approximately 3-4 weeks prior to study drug administration and blood pressure was monitored with both automated office blood pressure (AOBP) measurements and by outpatient 24- hour ambulatory blood pressure monitoring (ABPM).
  • the latter method assesses peak-to-trough blood pressure ratios and circadian rhythms (including potential restoration of the normal nocturnal blood pressure dipping pattern that is lost in 24-35% of hypertensive patients). More frequent (daily) measurements are collected through a third method, oscillometric home blood pressure monitoring (HBPM), to characterize gradual PD effects and to provide close safety monitoring for potential hypotension while not in the clinic.
  • HBPM oscillometric home blood pressure monitoring
  • Part B study 1 cohort of patients with controlled salt intake are studied to evaluate potential for augmented pharmacology and safety in a low-salt state (1.15 g sodium per day), which has been demonstrated previously with other RAAS-inhibiting drugs.
  • Part B patients complete a 2-week dietary subprotocol that varies sodium consumption to directly test for salt-sensitive blood pressure responses.
  • food is prepared in research/metabolic kitchens according to a common protocol and provided to patients.
  • Patients are inpatient for the first week of the 2-week subprotocol to promote compliance with a low-salt diet and to enhance monitoring for potential augmented AD-85481 pharmacology upon the introduction of salt deprivation.
  • AGT lowering and salt deprivation the blood pressure response to high salt intake alone is characterized.
  • AD-85481 Exploratory endpoints on the effects of AD-85481 include determination of change from baseline in SBP and DBP assessed by ABPM and AOBP under low vs high salt conditions
  • Obesity The majority of patients with hypertension are expected to be overweight or obese. Additionally, increased adiposity is likely to be causally associated with hypertension. Part D studies 1 cohort of patients with body mass index (BMI) in the Class I to III obesity range to evaluate the impact of weight on PK and PD parameters.
  • BMI body mass index
  • AGT hepatic steatosis via mechanisms that may be distinct from classic RAAS pathways
  • weight loss is evaluated as an exploratory endpoint.
  • Anthropometries tilt circumference, waist-to-hip ratio
  • a radiographic assessment of body composition dual -energy x-ray absorptiometry; DEXA
  • DEXA dual -energy x-ray absorptiometry
  • Parts A, B, and C enroll patients in the normal to overweight, and mild (Class I) obesity range (BMI >18 kg/m 2 and ⁇ 35 kg/m 2 ).
  • the single cohort in Part D is restricted to obese patients (BMI >30 kg/m 2 and ⁇ 50 kg/m 2 ).
  • Exploratory endpoints on the effects of AD-85481 include determination of change from baseline in body weight, waist circumference, waist-to-hip ratio, and body composition (as assessed by dual -energy x-ray absorptiometry (DEXA)) in obese patients.
  • Further exploratory objectives of the study overall include assessment of the effect of ALN- AD-85481 on metabolic syndrome parameters by determining the change from baseline in HbAlc, fasting plasma glucose, and serum lipid profile; and assessment of the effect of AD-85481 on exploratory biomarkers of the RAAS by determining the change from baseline in plasma renin concentration, plasma renin activity, angiotensin I, angiotensin II, and aldosterone .
  • Doses for Part A are 10 mg, 25 mg, 50 mg, 100 mg, 200 mg, and ⁇ 400 mg. There were 12 patients in each of the 6 cohorts (with 3 optional cohorts for evaluation of interim dose levels, lower dose levels, or expansions of previous cohorts may be enrolled in Part A to better characterize the dose response or safety and tolerability) with a 2:1 randomization of AD-85481:placebo. The lowest dose is not expected to have an effect on blood pressure lowering. Blood pressure lowering activy was expected to be first observed at the 50 mg dose with a lowering of serum AGT of at least 80%. Phase I – Part A Lowering of serum AGT from baseline in Part A. Subjects meeting inclusion and exclusion criteria were administered a single dose of AD-85481 or placebo on Day 1.
  • Blood samples were collected prior to administration of AD-85481 or placebo, weekly for 6 weeks after administration, at week 8 and week 12 post treatment, and then every 3 months during the follow-up period.
  • Serum AGT level was determined by solid phase sandwich ELISA and lowering of AGT from baseline was determined at each of the time points.
  • the demographics and baseline characteristics of subjects participating in Part A are presented in the table below.
  • Safety profile in Part A The primary objective for the study was to evaluate the safety and tolerability of single doses of AD-85481 in patients with hypertension. As demonstrated in the table below, the safety profile of AD-85481 was acceptable with no safety concerns.
  • a mean maximum AGT lowering of 54% was observed at 10 mg dose with a mean lowering at 4 weeks of 52% at the 10 mg single dose.
  • a mean maximum AGT lowering of 69% was observed at the 25 mg dose with a mean lowering at 4 weeks of 69% at the 25 mg single dose.
  • a mean maximum AGT lowering of 74% was observed at the 50 mg dose with a mean lowering at 4 weeks of 68% at the 50 mg single dose.
  • a mean maximum AGT lowering of 94% was observed at the 100 mg dose with a mean lowering at 4 weeks of 92% at the 100 mg single dose.
  • a mean maximum AGT lowering of 96% was observed at the 200 mg dose with a mean lowering at 4 weeks of 95% at the 200 mg single dose.
  • AD-85481 demonstrated a durable dose-dependent reduction of serum AGT after treatment with a single dose of AD-85481.
  • a greater than 90% reduction in serum AGT levels was observed in subjects receiving higher single doses of AD-85481, and the reduction in AGT persisted for greater than 3 months, e.g., demonstrating that a chronic dosing administration interval of at least once quarterly would be effective.
  • Assessments of AD-85481 included change from baseline in SBP and DBP assessed by 24 hour ambulatory blood pressure monitoring (ABPM) and the change from baseline in SBP and DBP assessed by oscillometric automated office blood pressure (AOBP) and by oscillometric home blood pressure monitoring (HBPM).
  • a single 100 mg dose of AD-85481 reduced systolic and diastolic blood pressures by about 10.1 mmHg and about 5.5 mmHg, respectively, at Week 8 when compared to placebo as determined by 24 hour ambulatory blood pressure measurements (ABPM).
  • ABPM 24 hour ambulatory blood pressure measurements
  • AD-85481 e.g. 100 mg or 200 mg.
  • this single ascending dose study characterized the maximum effect of AD-85481 and demonstrated the durability of AD-85481 treatment for a period of over 3 months.
  • AGT reductions of greater than 90% were observed after higher single doses of AD-85481 that persisted U ⁇ a j, ⁇ ]cWb& demonstrating that an infrequent dosing interval is required.
  • Blood pressure reductions mirrored AGT knockdown following administration of a single fixed dose of AD-85481, with >10 mm Hg reduction in 24 hour SBP observed at 8 weeks after single doses of 100 mg or higher.
  • these data further demonstrate that liver-specific silencing of AGT is effective and, thus, provide improved renal safety.
  • AD-85481 is further superior to current therapeutics in that it may provide a consistent and durable blood pressure response, blunting of diurnal BP variation, and enhanced adherence since infrequent dosing is required and there is a reduction in overall pill burden.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2020/059265 2019-11-13 2020-11-06 Methods and compositions for treating an angiotensinogen- (agt-) associated disorder Ceased WO2021096763A1 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
KR1020227019814A KR20220115946A (ko) 2019-11-13 2020-11-06 안지오텐시노겐 (agt) 관련 장애를 치료하기 위한 방법 및 조성물
AU2020382478A AU2020382478A1 (en) 2019-11-13 2020-11-06 Methods and compositions for treating an angiotensinogen- (AGT-) associated disorder
PH1/2022/551158A PH12022551158A1 (en) 2019-11-13 2020-11-06 Methods and compositions for treating an angiotensinogen- (agt-) associated disorder
JP2022527782A JP7707164B2 (ja) 2019-11-13 2020-11-06 アンギオテンシノーゲン(agt)関連障害を処置するための方法および組成物
CN202080090823.1A CN114981431A (zh) 2019-11-13 2020-11-06 用于治疗血管紧张素原(agt)相关病症的方法和组合物
PE2022000781A PE20230179A1 (es) 2019-11-13 2020-11-06 Metodos y composiciones para el tratamiento de un trastorno asociado con angiotensinogeno (agt)
IL292865A IL292865A (en) 2019-11-13 2020-11-06 Methods and preparations for the treatment of angiotensinogen-related disorder - (agt)
BR112022009216A BR112022009216A2 (pt) 2019-11-13 2020-11-06 Métodos e composições para tratar um distúrbio associado a angiotensinogênio (agt)
MX2022005692A MX2022005692A (es) 2019-11-13 2020-11-06 Metodos y composiciones para el tratamiento de un trastorno asociado con angiotensinogeno (agt).
CA3161703A CA3161703C (en) 2019-11-13 2020-11-06 Methods and compositions for treating an angiotensinogen- (agt-) associated disorder
EP20816344.4A EP4058577A1 (en) 2019-11-13 2020-11-06 Methods and compositions for treating an angiotensinogen- (agt-) associated disorder
CONC2022/0006092A CO2022006092A2 (es) 2019-11-13 2022-05-11 Métodos y composiciones para el tratamiento de un trastorno asociado con angiotensinógeno (agt)
US17/743,498 US20230002765A1 (en) 2019-11-13 2022-05-13 Methods and compositions for treating an angiotensinogen- (agt-) associated disorder

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201962934695P 2019-11-13 2019-11-13
US62/934,695 2019-11-13
US202063017854P 2020-04-30 2020-04-30
US63/017,854 2020-04-30

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US17/743,498 Continuation US20230002765A1 (en) 2019-11-13 2022-05-13 Methods and compositions for treating an angiotensinogen- (agt-) associated disorder

Publications (2)

Publication Number Publication Date
WO2021096763A1 true WO2021096763A1 (en) 2021-05-20
WO2021096763A8 WO2021096763A8 (en) 2021-06-24

Family

ID=73643353

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/059265 Ceased WO2021096763A1 (en) 2019-11-13 2020-11-06 Methods and compositions for treating an angiotensinogen- (agt-) associated disorder

Country Status (15)

Country Link
US (1) US20230002765A1 (cg-RX-API-DMAC7.html)
EP (1) EP4058577A1 (cg-RX-API-DMAC7.html)
JP (1) JP7707164B2 (cg-RX-API-DMAC7.html)
KR (1) KR20220115946A (cg-RX-API-DMAC7.html)
CN (1) CN114981431A (cg-RX-API-DMAC7.html)
AU (1) AU2020382478A1 (cg-RX-API-DMAC7.html)
BR (1) BR112022009216A2 (cg-RX-API-DMAC7.html)
CL (1) CL2022001256A1 (cg-RX-API-DMAC7.html)
CO (1) CO2022006092A2 (cg-RX-API-DMAC7.html)
IL (1) IL292865A (cg-RX-API-DMAC7.html)
MX (1) MX2022005692A (cg-RX-API-DMAC7.html)
PE (1) PE20230179A1 (cg-RX-API-DMAC7.html)
PH (1) PH12022551158A1 (cg-RX-API-DMAC7.html)
TW (2) TWI877247B (cg-RX-API-DMAC7.html)
WO (1) WO2021096763A1 (cg-RX-API-DMAC7.html)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023278576A1 (en) * 2021-06-30 2023-01-05 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating an angiotensinogen- (agt-) associated disorder
WO2023088427A1 (zh) * 2021-11-19 2023-05-25 上海拓界生物医药科技有限公司 靶向血管紧张素原的siRNA及其医药用途
WO2023138663A1 (zh) * 2022-01-20 2023-07-27 上海拓界生物医药科技有限公司 一种dsRNA、其应用及制备方法
US11834661B2 (en) 2018-05-14 2023-12-05 Alnylam Pharmaceuticals, Inc. Angiotensinogen (AGT) iRNA compositions and methods of use thereof
WO2024032679A1 (zh) * 2022-08-11 2024-02-15 益杰立科(上海)生物科技有限公司 一种表观编辑靶点的方法及用途
TWI853550B (zh) * 2022-04-29 2024-08-21 大陸商默化(無錫)生物科技有限公司 一類含核苷酸類似物的雙鏈RNAi類似物的綴合物
WO2024234831A1 (zh) * 2023-05-15 2024-11-21 苏州时安生物技术有限公司 一种用于调节血管紧张素原基因表达的双链rna、其缀合物、药物组合物及用途
WO2025128614A1 (en) * 2023-12-12 2025-06-19 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating an angiotensinogen- (agt-) associated disorder
CN120272480A (zh) * 2021-09-30 2025-07-08 北京安龙生物医药有限公司 用于治疗与pcsk9相关疾病的靶向寡核苷酸
US12534726B2 (en) 2021-11-16 2026-01-27 Shanghai Argo Biopharmaceutical Co., Ltd. Composition and method for inhibiting angiotensinogen (AGT) protein expression
WO2026050125A1 (en) * 2024-08-28 2026-03-05 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating an angiotensinogen- (agt-) associated disorder

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117568350B (zh) * 2024-01-15 2024-04-30 苏州时安生物技术有限公司 一种用于调节血管紧张素原基因表达的双链rna、其缀合物、药物组合物及用途
WO2025007961A1 (zh) * 2023-07-06 2025-01-09 大睿生物 调控AGT表达的dsRNA分子
CN119585433A (zh) * 2023-07-06 2025-03-07 石药集团中奇制药技术(石家庄)有限公司 一种抑制AGT基因表达的RNAi剂及其应用
TW202509216A (zh) * 2023-07-14 2025-03-01 大陸商北京安龍生物醫藥有限公司 靶向血管收縮素原的寡核苷酸及其用途

Citations (196)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US564562A (en) 1896-07-21 Joseph p
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
US4587044A (en) 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US4605735A (en) 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4667025A (en) 1982-08-09 1987-05-19 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4762779A (en) 1985-06-13 1988-08-09 Amgen Inc. Compositions and methods for functionalizing nucleic acids
US4824941A (en) 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US4828979A (en) 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US4835263A (en) 1983-01-27 1989-05-30 Centre National De La Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
US4845205A (en) 1985-01-08 1989-07-04 Institut Pasteur 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites
US4876335A (en) 1986-06-30 1989-10-24 Wakunaga Seiyaku Kabushiki Kaisha Poly-labelled oligonucleotide derivative
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US4948882A (en) 1983-02-22 1990-08-14 Syngene, Inc. Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
US4958013A (en) 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5082830A (en) 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5109124A (en) 1988-06-01 1992-04-28 Biogen, Inc. Nucleic acid probe linked to a label having a terminal cysteine
US5112963A (en) 1987-11-12 1992-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Modified oligonucleotides
US5118802A (en) 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5139941A (en) 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5177195A (en) 1991-01-08 1993-01-05 Imperial Chemical Industries Plc Disazo dyes
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5218105A (en) 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5245022A (en) 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
US5252479A (en) 1991-11-08 1993-10-12 Research Corporation Technologies, Inc. Safe vector for gene therapy
US5254469A (en) 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5258506A (en) 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US5262536A (en) 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
WO1993024641A2 (en) 1992-06-02 1993-12-09 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Adeno-associated virus with inverted terminal repeat sequences as promoter
US5272250A (en) 1992-07-10 1993-12-21 Spielvogel Bernard F Boronated phosphoramidate compounds
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
WO1994002595A1 (en) 1992-07-17 1994-02-03 Ribozyme Pharmaceuticals, Inc. Method and reagent for treatment of animal diseases
US5292873A (en) 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5317098A (en) 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
WO1994012649A2 (en) 1992-12-03 1994-06-09 Genzyme Corporation Gene therapy for cystic fibrosis
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
WO1994013788A1 (en) 1992-12-04 1994-06-23 University Of Pittsburgh Recombinant viral vector system
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
US5371241A (en) 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5391723A (en) 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5405939A (en) 1987-10-22 1995-04-11 Temple University Of The Commonwealth System Of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5414077A (en) 1990-02-20 1995-05-09 Gilead Sciences Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
US5436146A (en) 1989-09-07 1995-07-25 The Trustees Of Princeton University Helper-free stocks of recombinant adeno-associated virus vectors
US5451463A (en) 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5455233A (en) 1989-11-30 1995-10-03 University Of North Carolina Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5466677A (en) 1993-03-06 1995-11-14 Ciba-Geigy Corporation Dinucleoside phosphinates and their pharmaceutical compositions
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US5486603A (en) 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5510475A (en) 1990-11-08 1996-04-23 Hybridon, Inc. Oligonucleotide multiple reporter precursors
US5512439A (en) 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US5512667A (en) 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5519126A (en) 1988-03-25 1996-05-21 University Of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
US5525465A (en) 1987-10-28 1996-06-11 Howard Florey Institute Of Experimental Physiology And Medicine Oligonucleotide-polyamide conjugates and methods of production and applications of the same
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5541316A (en) 1992-02-11 1996-07-30 Henkel Kommanditgesellschaft Auf Aktien Process for the production of polysaccharide-based polycarboxylates
US5545730A (en) 1984-10-16 1996-08-13 Chiron Corporation Multifunctional nucleic acid monomer
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
US5552540A (en) 1987-06-24 1996-09-03 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
US5565552A (en) 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
US5574142A (en) 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
US5578718A (en) 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5580731A (en) 1994-08-25 1996-12-03 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5587371A (en) 1992-01-21 1996-12-24 Pharmacyclics, Inc. Texaphyrin-oligonucleotide conjugates
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5589584A (en) 1992-09-30 1996-12-31 University Of Utah Research Foundation Angiotensinogen gene variants and predisposition to hypertension
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5595726A (en) 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5596086A (en) 1990-09-20 1997-01-21 Gilead Sciences, Inc. Modified internucleoside linkages having one nitrogen and two carbon atoms
US5597696A (en) 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5599928A (en) 1994-02-15 1997-02-04 Pharmacyclics, Inc. Texaphyrin compounds having improved functionalization
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5614617A (en) 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5663312A (en) 1993-03-31 1997-09-02 Sanofi Oligonucleotide dimers with amide linkages replacing phosphodiester linkages
US5665557A (en) 1994-11-14 1997-09-09 Systemix, Inc. Method of purifying a population of cells enriched for hematopoietic stem cells populations of cells obtained thereby and methods of use thereof
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5677439A (en) 1990-08-03 1997-10-14 Sanofi Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5688941A (en) 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5750692A (en) 1990-01-11 1998-05-12 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
US5981276A (en) 1990-06-20 1999-11-09 Dana-Farber Cancer Institute Vectors containing HIV packaging sequences, packaging defective HIV vectors, and uses thereof
US6015886A (en) 1993-05-24 2000-01-18 Chemgenes Corporation Oligonucleotide phosphate esters
US6028188A (en) 1993-11-16 2000-02-22 Genta Incorporated Synthetic oligomers having chirally pure phosphonate internucleosidyl linkages mixed with non-phosphonate internucleosidyl linkages
WO2000022113A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. ENZYMATIC SYNTHESIS OF ssDNA
WO2000022114A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. PRODUCTION OF ssDNA $i(IN VIVO)
US6054299A (en) 1994-04-29 2000-04-25 Conrad; Charles A. Stem-loop cloning vector and method
US6124445A (en) 1994-11-23 2000-09-26 Isis Pharmaceuticals, Inc. Phosphotriester oligonucleotides, amidities and method of preparation
US6143520A (en) 1995-10-16 2000-11-07 Dana-Farber Cancer Institute, Inc. Expression vectors and methods of use
US6147200A (en) 1999-08-19 2000-11-14 Isis Pharmaceuticals, Inc. 2'-O-acetamido modified monomers and oligomers
US6160109A (en) 1995-10-20 2000-12-12 Isis Pharmaceuticals, Inc. Preparation of phosphorothioate and boranophosphate oligomers
US6166197A (en) 1995-03-06 2000-12-26 Isis Pharmaceuticals, Inc. Oligomeric compounds having pyrimidine nucleotide (S) with 2'and 5 substitutions
US6169170B1 (en) 1994-03-18 2001-01-02 Lynx Therapeutics, Inc. Oligonucleotide N3′→N5′Phosphoramidate Duplexes
US6172209B1 (en) 1997-02-14 2001-01-09 Isis Pharmaceuticals Inc. Aminooxy-modified oligonucleotides and methods for making same
US6222025B1 (en) 1995-03-06 2001-04-24 Isis Pharmaceuticals, Inc. Process for the synthesis of 2′-O-substituted pyrimidines and oligomeric compounds therefrom
US6235887B1 (en) 1991-11-26 2001-05-22 Isis Pharmaceuticals, Inc. Enhanced triple-helix and double-helix formation directed by oligonucleotides containing modified pyrimidines
US6239265B1 (en) 1990-01-11 2001-05-29 Isis Pharmaceuticals, Inc. Oligonucleotides having chiral phosphorus linkages
US6268490B1 (en) 1997-03-07 2001-07-31 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogues
US6277603B1 (en) 1991-12-24 2001-08-21 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
US6294664B1 (en) 1993-07-29 2001-09-25 Isis Pharmaceuticals, Inc. Synthesis of oligonucleotides
US6320017B1 (en) 1997-12-23 2001-11-20 Inex Pharmaceuticals Corp. Polyamide oligomers
US6326199B1 (en) 1991-12-24 2001-12-04 Isis Pharmaceuticals, Inc. Gapped 2′ modified oligonucleotides
US6346614B1 (en) 1992-07-23 2002-02-12 Hybridon, Inc. Hybrid oligonucleotide phosphorothioates
US6444423B1 (en) 1996-06-07 2002-09-03 Molecular Dynamics, Inc. Nucleosides comprising polydentate ligands
US6528640B1 (en) 1997-11-05 2003-03-04 Ribozyme Pharmaceuticals, Incorporated Synthetic ribonucleic acids with RNAse activity
US6531590B1 (en) 1998-04-24 2003-03-11 Isis Pharmaceuticals, Inc. Processes for the synthesis of oligonucleotide compounds
US6534639B1 (en) 1999-07-07 2003-03-18 Isis Pharmaceuticals, Inc. Guanidinium functionalized oligonucleotides and method/synthesis
US6576752B1 (en) 1997-02-14 2003-06-10 Isis Pharmaceuticals, Inc. Aminooxy functionalized oligomers
US6608035B1 (en) 1994-10-25 2003-08-19 Hybridon, Inc. Method of down-regulating gene expression
US6617438B1 (en) 1997-11-05 2003-09-09 Sirna Therapeutics, Inc. Oligoribonucleotides with enzymatic activity
US6639062B2 (en) 1997-02-14 2003-10-28 Isis Pharmaceuticals, Inc. Aminooxy-modified nucleosidic compounds and oligomeric compounds prepared therefrom
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
US6783931B1 (en) 1990-01-11 2004-08-31 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US20040171570A1 (en) 2002-11-05 2004-09-02 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US6815432B2 (en) 1995-06-07 2004-11-09 Inex Pharmaceuticals Corp. Methods for encapsulating plasmids in lipid bilayers
US6858225B2 (en) 1997-05-14 2005-02-22 Inex Pharmaceuticals Corporation Lipid-encapsulated polyanionic nucleic acid
US6858715B2 (en) 1999-02-04 2005-02-22 Isis Pharmaceuticals, Inc. Process for the synthesis of oligomeric compounds
US6867294B1 (en) 1998-07-14 2005-03-15 Isis Pharmaceuticals, Inc. Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages
US6878805B2 (en) 2002-08-16 2005-04-12 Isis Pharmaceuticals, Inc. Peptide-conjugated oligomeric compounds
US6998484B2 (en) 2000-10-04 2006-02-14 Santaris Pharma A/S Synthesis of purine locked nucleic acid analogues
US7015315B1 (en) 1991-12-24 2006-03-21 Isis Pharmaceuticals, Inc. Gapped oligonucleotides
US7037646B1 (en) 1990-01-11 2006-05-02 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US7045610B2 (en) 1998-04-03 2006-05-16 Epoch Biosciences, Inc. Modified oligonucleotides for mismatch discrimination
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
US7084125B2 (en) 1999-03-18 2006-08-01 Exiqon A/S Xylo-LNA analogues
WO2007091269A2 (en) 2006-02-08 2007-08-16 Quark Pharmaceuticals, Inc. NOVEL TANDEM siRNAS
US7273933B1 (en) 1998-02-26 2007-09-25 Isis Pharmaceuticals, Inc. Methods for synthesis of oligonucleotides
WO2007117686A2 (en) 2006-04-07 2007-10-18 Idera Pharmaceuticals, Inc. Stabilized immune modulatory rna (simra) compounds for tlr7 and tlr8
US7321029B2 (en) 2000-01-21 2008-01-22 Geron Corporation 2′-arabino-fluorooligonucleotide N3′→P5′ phosphoramidates: their synthesis and use
US7399845B2 (en) 2006-01-27 2008-07-15 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
US7427605B2 (en) 2005-03-31 2008-09-23 Calando Pharmaceuticals, Inc. Inhibitors of ribonucleotide reductase subunit 2 and uses thereof
US7427672B2 (en) 2003-08-28 2008-09-23 Takeshi Imanishi Artificial nucleic acids of n-o bond crosslinkage type
WO2009014887A2 (en) 2007-07-09 2009-01-29 Idera Pharmaceuticals, Inc. Stabilized immune modulatory rna (simra) compounds
US7495088B1 (en) 1989-12-04 2009-02-24 Enzo Life Sciences, Inc. Modified nucleotide compounds
WO2010141511A2 (en) 2009-06-01 2010-12-09 Halo-Bio Rnai Therapeutics, Inc. Polynucleotides for multivalent rna interference, compositions and methods of use thereof
US7858769B2 (en) 2004-02-10 2010-12-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using multifunctional short interfering nucleic acid (multifunctional siNA)
WO2011005861A1 (en) 2009-07-07 2011-01-13 Alnylam Pharmaceuticals, Inc. Oligonucleotide end caps
WO2011031520A1 (en) 2009-08-27 2011-03-17 Idera Pharmaceuticals, Inc. Composition for inhibiting gene expression and uses thereof
US8058069B2 (en) 2008-04-15 2011-11-15 Protiva Biotherapeutics, Inc. Lipid formulations for nucleic acid delivery
US8101348B2 (en) 2002-07-10 2012-01-24 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. RNA-interference by single-stranded RNA molecules
US8106022B2 (en) 2007-12-04 2012-01-31 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
US8158601B2 (en) 2009-06-10 2012-04-17 Alnylam Pharmaceuticals, Inc. Lipid formulation
US20120157511A1 (en) 2009-07-07 2012-06-21 Alnylam Pharmaceuticals, Inc. 5' phosphate mimics
US8278425B2 (en) 2007-05-30 2012-10-02 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
US8278426B2 (en) 2007-06-08 2012-10-02 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
US8278283B2 (en) 2007-07-05 2012-10-02 Isis Pharmaceuticals, Inc. 6-disubstituted or unsaturated bicyclic nucleic acid analogs
WO2013075035A1 (en) 2011-11-18 2013-05-23 Alnylam Pharmaceuticals Rnai agents, compositions and methods of use thereof for treating transthyretin (ttr) associated diseases
WO2014179627A2 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Compositions and methods for modulating hbv and ttr expression
WO2015179724A1 (en) * 2014-05-22 2015-11-26 Alnylam Pharmaceuticals, Inc. Angiotensinogen (agt) irna compositions and methods of use thereof
WO2016196111A1 (en) * 2015-06-01 2016-12-08 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting angiotensinogen (agt) and methods of use thereof
WO2017062816A2 (en) * 2015-10-08 2017-04-13 Ionis Pharmaceuiticals, Inc. Compounds and methods for modulating angiotensinogen expression
WO2018098328A1 (en) * 2016-11-23 2018-05-31 Alnylam Pharmaceuticals, Inc. Modified rna agents with reduced off-target effect
WO2019055633A1 (en) 2017-09-14 2019-03-21 Arrowhead Pharmaceuticals, Inc. RNAI AGENTS AND COMPOSITIONS FOR INHIBITING ANALOGUE EXPRESSION OF ANGIOPOIETIN 3 (ANGPTL3) AND METHODS OF USE
WO2019222166A1 (en) * 2018-05-14 2019-11-21 Alnylam Pharmaceuticals, Inc. Angiotensinogen (agt) irna compositions and methods of use thereof
WO2020097044A1 (en) * 2018-11-09 2020-05-14 Alnylam Pharmaceuticals, Inc. Modified double stranded oligonucleotides

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113057959B (zh) * 2014-02-11 2024-07-16 阿尔尼拉姆医药品有限公司 己酮糖激酶(KHK)iRNA组合物及其使用方法

Patent Citations (217)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US564562A (en) 1896-07-21 Joseph p
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
US4667025A (en) 1982-08-09 1987-05-19 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4789737A (en) 1982-08-09 1988-12-06 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives and production thereof
US4835263A (en) 1983-01-27 1989-05-30 Centre National De La Recherche Scientifique Novel compounds containing an oligonucleotide sequence bonded to an intercalating agent, a process for their synthesis and their use
US4605735A (en) 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US5541313A (en) 1983-02-22 1996-07-30 Molecular Biosystems, Inc. Single-stranded labelled oligonucleotides of preselected sequence
US4948882A (en) 1983-02-22 1990-08-14 Syngene, Inc. Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
US4824941A (en) 1983-03-10 1989-04-25 Julian Gordon Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems
US4587044A (en) 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US5118802A (en) 1983-12-20 1992-06-02 California Institute Of Technology DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
US5258506A (en) 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US5552538A (en) 1984-10-16 1996-09-03 Chiron Corporation Oligonucleotides with cleavable sites
US5578717A (en) 1984-10-16 1996-11-26 Chiron Corporation Nucleotides for introducing selectably cleavable and/or abasic sites into oligonucleotides
US5545730A (en) 1984-10-16 1996-08-13 Chiron Corporation Multifunctional nucleic acid monomer
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
US4828979A (en) 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
US4845205A (en) 1985-01-08 1989-07-04 Institut Pasteur 2,N6 -disubstituted and 2,N6 -trisubstituted adenosine-3'-phosphoramidites
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US4683202B1 (cg-RX-API-DMAC7.html) 1985-03-28 1990-11-27 Cetus Corp
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4762779A (en) 1985-06-13 1988-08-09 Amgen Inc. Compositions and methods for functionalizing nucleic acids
US5139941A (en) 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors
US5317098A (en) 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
US4876335A (en) 1986-06-30 1989-10-24 Wakunaga Seiyaku Kabushiki Kaisha Poly-labelled oligonucleotide derivative
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5286717A (en) 1987-03-25 1994-02-15 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US5552540A (en) 1987-06-24 1996-09-03 Howard Florey Institute Of Experimental Physiology And Medicine Nucleoside derivatives
US5585481A (en) 1987-09-21 1996-12-17 Gen-Probe Incorporated Linking reagents for nucleotide probes
US5405939A (en) 1987-10-22 1995-04-11 Temple University Of The Commonwealth System Of Higher Education 2',5'-phosphorothioate oligoadenylates and their covalent conjugates with polylysine
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US5525465A (en) 1987-10-28 1996-06-11 Howard Florey Institute Of Experimental Physiology And Medicine Oligonucleotide-polyamide conjugates and methods of production and applications of the same
US5112963A (en) 1987-11-12 1992-05-12 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. Modified oligonucleotides
US5082830A (en) 1988-02-26 1992-01-21 Enzo Biochem, Inc. End labeled nucleotide probe
US5519126A (en) 1988-03-25 1996-05-21 University Of Virginia Alumni Patents Foundation Oligonucleotide N-alkylphosphoramidates
US5453496A (en) 1988-05-26 1995-09-26 University Patents, Inc. Polynucleotide phosphorodithioate
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5109124A (en) 1988-06-01 1992-04-28 Biogen, Inc. Nucleic acid probe linked to a label having a terminal cysteine
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5175273A (en) 1988-07-01 1992-12-29 Genentech, Inc. Nucleic acid intercalating agents
US5262536A (en) 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5512439A (en) 1988-11-21 1996-04-30 Dynal As Oligonucleotide-linked magnetic particles and uses thereof
US5599923A (en) 1989-03-06 1997-02-04 Board Of Regents, University Of Tx Texaphyrin metal complexes having improved functionalization
US5391723A (en) 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US4958013A (en) 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US5416203A (en) 1989-06-06 1995-05-16 Northwestern University Steroid modified oligonucleotides
US5451463A (en) 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5436146A (en) 1989-09-07 1995-07-25 The Trustees Of Princeton University Helper-free stocks of recombinant adeno-associated virus vectors
US5254469A (en) 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5292873A (en) 1989-11-29 1994-03-08 The Research Foundation Of State University Of New York Nucleic acids labeled with naphthoquinone probe
US5455233A (en) 1989-11-30 1995-10-03 University Of North Carolina Oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US7495088B1 (en) 1989-12-04 2009-02-24 Enzo Life Sciences, Inc. Modified nucleotide compounds
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5486603A (en) 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US6900297B1 (en) 1990-01-11 2005-05-31 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US5587469A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides containing N-2 substituted purines
US5578718A (en) 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5750692A (en) 1990-01-11 1998-05-12 Isis Pharmaceuticals, Inc. Synthesis of 3-deazapurines
US7037646B1 (en) 1990-01-11 2006-05-02 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US6783931B1 (en) 1990-01-11 2004-08-31 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US6239265B1 (en) 1990-01-11 2001-05-29 Isis Pharmaceuticals, Inc. Oligonucleotides having chiral phosphorus linkages
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5414077A (en) 1990-02-20 1995-05-09 Gilead Sciences Non-nucleoside linkers for convenient attachment of labels to oligonucleotides using standard synthetic methods
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5563253A (en) 1990-03-08 1996-10-08 Worcester Foundation For Biomedical Research Linear aminoalkylphosphoramidate oligonucleotide derivatives
US5536821A (en) 1990-03-08 1996-07-16 Worcester Foundation For Biomedical Research Aminoalkylphosphorothioamidate oligonucleotide deratives
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5514785A (en) 1990-05-11 1996-05-07 Becton Dickinson And Company Solid supports for nucleic acid hybridization assays
US5981276A (en) 1990-06-20 1999-11-09 Dana-Farber Cancer Institute Vectors containing HIV packaging sequences, packaging defective HIV vectors, and uses thereof
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5688941A (en) 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5218105A (en) 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5614617A (en) 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5677439A (en) 1990-08-03 1997-10-14 Sanofi Oligonucleotide analogues containing phosphate diester linkage substitutes, compositions thereof, and precursor dinucleotide analogues
US5245022A (en) 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
US5567810A (en) 1990-08-03 1996-10-22 Sterling Drug, Inc. Nuclease resistant compounds
US5512667A (en) 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
US5596086A (en) 1990-09-20 1997-01-21 Gilead Sciences, Inc. Modified internucleoside linkages having one nitrogen and two carbon atoms
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5510475A (en) 1990-11-08 1996-04-23 Hybridon, Inc. Oligonucleotide multiple reporter precursors
US5177195A (en) 1991-01-08 1993-01-05 Imperial Chemical Industries Plc Disazo dyes
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5371241A (en) 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5252479A (en) 1991-11-08 1993-10-12 Research Corporation Technologies, Inc. Safe vector for gene therapy
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
US6380368B1 (en) 1991-11-26 2002-04-30 Isis Pharmaceuticals, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US6235887B1 (en) 1991-11-26 2001-05-22 Isis Pharmaceuticals, Inc. Enhanced triple-helix and double-helix formation directed by oligonucleotides containing modified pyrimidines
US6326199B1 (en) 1991-12-24 2001-12-04 Isis Pharmaceuticals, Inc. Gapped 2′ modified oligonucleotides
US6277603B1 (en) 1991-12-24 2001-08-21 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
US7015315B1 (en) 1991-12-24 2006-03-21 Isis Pharmaceuticals, Inc. Gapped oligonucleotides
US5565552A (en) 1992-01-21 1996-10-15 Pharmacyclics, Inc. Method of expanded porphyrin-oligonucleotide conjugate synthesis
US5587371A (en) 1992-01-21 1996-12-24 Pharmacyclics, Inc. Texaphyrin-oligonucleotide conjugates
US5595726A (en) 1992-01-21 1997-01-21 Pharmacyclics, Inc. Chromophore probe for detection of nucleic acid
US5541316A (en) 1992-02-11 1996-07-30 Henkel Kommanditgesellschaft Auf Aktien Process for the production of polysaccharide-based polycarboxylates
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
WO1993024641A2 (en) 1992-06-02 1993-12-09 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Adeno-associated virus with inverted terminal repeat sequences as promoter
US5272250A (en) 1992-07-10 1993-12-21 Spielvogel Bernard F Boronated phosphoramidate compounds
WO1994002595A1 (en) 1992-07-17 1994-02-03 Ribozyme Pharmaceuticals, Inc. Method and reagent for treatment of animal diseases
US6683167B2 (en) 1992-07-23 2004-01-27 University Of Massachusetts Worcester Hybrid oligonucleotide phosphorothioates
US6346614B1 (en) 1992-07-23 2002-02-12 Hybridon, Inc. Hybrid oligonucleotide phosphorothioates
US5589584A (en) 1992-09-30 1996-12-31 University Of Utah Research Foundation Angiotensinogen gene variants and predisposition to hypertension
WO1994012649A2 (en) 1992-12-03 1994-06-09 Genzyme Corporation Gene therapy for cystic fibrosis
WO1994013788A1 (en) 1992-12-04 1994-06-23 University Of Pittsburgh Recombinant viral vector system
US5574142A (en) 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US5466677A (en) 1993-03-06 1995-11-14 Ciba-Geigy Corporation Dinucleoside phosphinates and their pharmaceutical compositions
US5663312A (en) 1993-03-31 1997-09-02 Sanofi Oligonucleotide dimers with amide linkages replacing phosphodiester linkages
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US6015886A (en) 1993-05-24 2000-01-18 Chemgenes Corporation Oligonucleotide phosphate esters
US6294664B1 (en) 1993-07-29 2001-09-25 Isis Pharmaceuticals, Inc. Synthesis of oligonucleotides
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US6028188A (en) 1993-11-16 2000-02-22 Genta Incorporated Synthetic oligomers having chirally pure phosphonate internucleosidyl linkages mixed with non-phosphonate internucleosidyl linkages
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
US5599928A (en) 1994-02-15 1997-02-04 Pharmacyclics, Inc. Texaphyrin compounds having improved functionalization
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US6169170B1 (en) 1994-03-18 2001-01-02 Lynx Therapeutics, Inc. Oligonucleotide N3′→N5′Phosphoramidate Duplexes
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US6054299A (en) 1994-04-29 2000-04-25 Conrad; Charles A. Stem-loop cloning vector and method
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US5597696A (en) 1994-07-18 1997-01-28 Becton Dickinson And Company Covalent cyanine dye oligonucleotide conjugates
US5580731A (en) 1994-08-25 1996-12-03 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US5591584A (en) 1994-08-25 1997-01-07 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
US6608035B1 (en) 1994-10-25 2003-08-19 Hybridon, Inc. Method of down-regulating gene expression
US5665557A (en) 1994-11-14 1997-09-09 Systemix, Inc. Method of purifying a population of cells enriched for hematopoietic stem cells populations of cells obtained thereby and methods of use thereof
US6124445A (en) 1994-11-23 2000-09-26 Isis Pharmaceuticals, Inc. Phosphotriester oligonucleotides, amidities and method of preparation
US6166197A (en) 1995-03-06 2000-12-26 Isis Pharmaceuticals, Inc. Oligomeric compounds having pyrimidine nucleotide (S) with 2'and 5 substitutions
US6222025B1 (en) 1995-03-06 2001-04-24 Isis Pharmaceuticals, Inc. Process for the synthesis of 2′-O-substituted pyrimidines and oligomeric compounds therefrom
US6815432B2 (en) 1995-06-07 2004-11-09 Inex Pharmaceuticals Corp. Methods for encapsulating plasmids in lipid bilayers
US6143520A (en) 1995-10-16 2000-11-07 Dana-Farber Cancer Institute, Inc. Expression vectors and methods of use
US6160109A (en) 1995-10-20 2000-12-12 Isis Pharmaceuticals, Inc. Preparation of phosphorothioate and boranophosphate oligomers
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
US6444423B1 (en) 1996-06-07 2002-09-03 Molecular Dynamics, Inc. Nucleosides comprising polydentate ligands
US6172209B1 (en) 1997-02-14 2001-01-09 Isis Pharmaceuticals Inc. Aminooxy-modified oligonucleotides and methods for making same
US6639062B2 (en) 1997-02-14 2003-10-28 Isis Pharmaceuticals, Inc. Aminooxy-modified nucleosidic compounds and oligomeric compounds prepared therefrom
US6576752B1 (en) 1997-02-14 2003-06-10 Isis Pharmaceuticals, Inc. Aminooxy functionalized oligomers
US6268490B1 (en) 1997-03-07 2001-07-31 Takeshi Imanishi Bicyclonucleoside and oligonucleotide analogues
US6858225B2 (en) 1997-05-14 2005-02-22 Inex Pharmaceuticals Corporation Lipid-encapsulated polyanionic nucleic acid
US6670461B1 (en) 1997-09-12 2003-12-30 Exiqon A/S Oligonucleotide analogues
WO1999014226A2 (en) 1997-09-12 1999-03-25 Exiqon A/S Bi- and tri-cyclic nucleoside, nucleotide and oligonucleotide analogues
US6794499B2 (en) 1997-09-12 2004-09-21 Exiqon A/S Oligonucleotide analogues
US6617438B1 (en) 1997-11-05 2003-09-09 Sirna Therapeutics, Inc. Oligoribonucleotides with enzymatic activity
US6528640B1 (en) 1997-11-05 2003-03-04 Ribozyme Pharmaceuticals, Incorporated Synthetic ribonucleic acids with RNAse activity
US6320017B1 (en) 1997-12-23 2001-11-20 Inex Pharmaceuticals Corp. Polyamide oligomers
US7273933B1 (en) 1998-02-26 2007-09-25 Isis Pharmaceuticals, Inc. Methods for synthesis of oligonucleotides
US7045610B2 (en) 1998-04-03 2006-05-16 Epoch Biosciences, Inc. Modified oligonucleotides for mismatch discrimination
US6531590B1 (en) 1998-04-24 2003-03-11 Isis Pharmaceuticals, Inc. Processes for the synthesis of oligonucleotide compounds
US6867294B1 (en) 1998-07-14 2005-03-15 Isis Pharmaceuticals, Inc. Gapped oligomers having site specific chiral phosphorothioate internucleoside linkages
USRE39464E1 (en) 1998-07-14 2007-01-09 Isis Pharmaceuticals Inc. Oligonucleolotides having site specific chiral phosphorothioate internucleoside linkages
WO2000022114A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. PRODUCTION OF ssDNA $i(IN VIVO)
WO2000022113A1 (en) 1998-10-09 2000-04-20 Ingene, Inc. ENZYMATIC SYNTHESIS OF ssDNA
US6858715B2 (en) 1999-02-04 2005-02-22 Isis Pharmaceuticals, Inc. Process for the synthesis of oligomeric compounds
US7041816B2 (en) 1999-02-04 2006-05-09 Isis Pharmaceuticals, Inc. Process for the synthesis of oligomeric compounds
US7084125B2 (en) 1999-03-18 2006-08-01 Exiqon A/S Xylo-LNA analogues
US7053207B2 (en) 1999-05-04 2006-05-30 Exiqon A/S L-ribo-LNA analogues
US6534639B1 (en) 1999-07-07 2003-03-18 Isis Pharmaceuticals, Inc. Guanidinium functionalized oligonucleotides and method/synthesis
US6147200A (en) 1999-08-19 2000-11-14 Isis Pharmaceuticals, Inc. 2'-O-acetamido modified monomers and oligomers
US7321029B2 (en) 2000-01-21 2008-01-22 Geron Corporation 2′-arabino-fluorooligonucleotide N3′→P5′ phosphoramidates: their synthesis and use
US6998484B2 (en) 2000-10-04 2006-02-14 Santaris Pharma A/S Synthesis of purine locked nucleic acid analogues
US8101348B2 (en) 2002-07-10 2012-01-24 Max-Planck-Gesellschaft Zur Foerderung Der Wissenschaften E.V. RNA-interference by single-stranded RNA molecules
US6878805B2 (en) 2002-08-16 2005-04-12 Isis Pharmaceuticals, Inc. Peptide-conjugated oligomeric compounds
US20040171570A1 (en) 2002-11-05 2004-09-02 Charles Allerson Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US7427672B2 (en) 2003-08-28 2008-09-23 Takeshi Imanishi Artificial nucleic acids of n-o bond crosslinkage type
US7858769B2 (en) 2004-02-10 2010-12-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using multifunctional short interfering nucleic acid (multifunctional siNA)
US7427605B2 (en) 2005-03-31 2008-09-23 Calando Pharmaceuticals, Inc. Inhibitors of ribonucleotide reductase subunit 2 and uses thereof
US7399845B2 (en) 2006-01-27 2008-07-15 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
WO2007091269A2 (en) 2006-02-08 2007-08-16 Quark Pharmaceuticals, Inc. NOVEL TANDEM siRNAS
WO2007117686A2 (en) 2006-04-07 2007-10-18 Idera Pharmaceuticals, Inc. Stabilized immune modulatory rna (simra) compounds for tlr7 and tlr8
US8278425B2 (en) 2007-05-30 2012-10-02 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
US8278426B2 (en) 2007-06-08 2012-10-02 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
US8278283B2 (en) 2007-07-05 2012-10-02 Isis Pharmaceuticals, Inc. 6-disubstituted or unsaturated bicyclic nucleic acid analogs
WO2009014887A2 (en) 2007-07-09 2009-01-29 Idera Pharmaceuticals, Inc. Stabilized immune modulatory rna (simra) compounds
US8106022B2 (en) 2007-12-04 2012-01-31 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
US8058069B2 (en) 2008-04-15 2011-11-15 Protiva Biotherapeutics, Inc. Lipid formulations for nucleic acid delivery
WO2010141511A2 (en) 2009-06-01 2010-12-09 Halo-Bio Rnai Therapeutics, Inc. Polynucleotides for multivalent rna interference, compositions and methods of use thereof
US8158601B2 (en) 2009-06-10 2012-04-17 Alnylam Pharmaceuticals, Inc. Lipid formulation
US20120157511A1 (en) 2009-07-07 2012-06-21 Alnylam Pharmaceuticals, Inc. 5' phosphate mimics
WO2011005861A1 (en) 2009-07-07 2011-01-13 Alnylam Pharmaceuticals, Inc. Oligonucleotide end caps
WO2011031520A1 (en) 2009-08-27 2011-03-17 Idera Pharmaceuticals, Inc. Composition for inhibiting gene expression and uses thereof
WO2013075035A1 (en) 2011-11-18 2013-05-23 Alnylam Pharmaceuticals Rnai agents, compositions and methods of use thereof for treating transthyretin (ttr) associated diseases
WO2014179627A2 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Compositions and methods for modulating hbv and ttr expression
WO2014179620A1 (en) 2013-05-01 2014-11-06 Isis Pharmaceuticals, Inc. Conjugated antisense compounds and their use
WO2015179724A1 (en) * 2014-05-22 2015-11-26 Alnylam Pharmaceuticals, Inc. Angiotensinogen (agt) irna compositions and methods of use thereof
WO2016196111A1 (en) * 2015-06-01 2016-12-08 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting angiotensinogen (agt) and methods of use thereof
WO2017062816A2 (en) * 2015-10-08 2017-04-13 Ionis Pharmaceuiticals, Inc. Compounds and methods for modulating angiotensinogen expression
WO2018098328A1 (en) * 2016-11-23 2018-05-31 Alnylam Pharmaceuticals, Inc. Modified rna agents with reduced off-target effect
WO2019055633A1 (en) 2017-09-14 2019-03-21 Arrowhead Pharmaceuticals, Inc. RNAI AGENTS AND COMPOSITIONS FOR INHIBITING ANALOGUE EXPRESSION OF ANGIOPOIETIN 3 (ANGPTL3) AND METHODS OF USE
WO2019222166A1 (en) * 2018-05-14 2019-11-21 Alnylam Pharmaceuticals, Inc. Angiotensinogen (agt) irna compositions and methods of use thereof
WO2020097044A1 (en) * 2018-11-09 2020-05-14 Alnylam Pharmaceuticals, Inc. Modified double stranded oligonucleotides

Non-Patent Citations (103)

* Cited by examiner, † Cited by third party
Title
"Biotechnology and Medicine", 2008, WILEY-VCH, article "Modified Nucleosides in Biochemistry"
"GenBank", Database accession no. NM_007428.3
AIGNER, A., J. BIOMED. BIOTECHNOL., 2006, pages 71659
AKANEYA,Y. ET AL., J. NEUROPHYSIOL., vol. 93, 2005, pages 594 - 602
AKHTAR S.JULIAN RL., TRENDS CELL. BIOL., vol. 2, no. 5, 1992, pages 139 - 144
AMERICAN COLLEGE OF OBSTETRICS AND GYNECOLOGY (ACOG: "Hypertension in pregnancy. Report of the American College of Obstetricians and Gynecologists' Task Force on Hypertension in Pregnancy", OBSTET GYNECOL, vol. 122, 2013, pages 1122 - 31
ARNOLD, AS ET AL., J. HYPERTENS., vol. 25, 2007, pages 197 - 205
BARANY, PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 189 - 193
BERNSTEIN ET AL., NATURE, vol. 409, 2001, pages 363
BITKO, V. ET AL., NAT. MED., vol. 11, 2005, pages 50 - 55
BOESEN ET AL., BIOTHERAPY, vol. 6, 1994, pages 291 - 302
BONNET ME. ET AL., PHARM. RES., 16 August 2008 (2008-08-16)
BOUT ET AL., HUMAN GENE THERAPY, vol. 5, 1994, pages 3 - 10
CHATTOPADHYAYA ET AL., J. ORG. CHEM., vol. 74, 2009, pages 118 - 134
CHIEN, PY. ET AL., CANCER GENE THER, vol. 12, 2005, pages 321 - 328
CHOBANIAN ET AL.: "The JNC 7 Report", JAMA, vol. 289, no. 19, 2003, pages 2560
CHOBANIAN ET AL.: "the National High Blood Pressure Education Program Coordinating Committee. Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure", HYPERTENSION, vol. 42, 2003, pages 1206 - 52
CLOWES ET AL., J CLIN. INVEST., vol. 93, 1994, pages 644 - 651
COUTURE, A ET AL., TIG, vol. 12, 1996, pages 5 - 10
CROOKE ET AL., J PHARMACOL. EXP. THER., vol. 277, 1996, pages 923
CROOKE ET AL., J. PHARMACOL. EXP. THER., vol. 277, 1996, pages 923 - 937
DIAS, N. ET AL., MOL CANCER THER, vol. 1, 2002, pages 347 - 355
DOCHERTY ET AL., FASEB J, vol. 8, 1994, pages 20 - 24
DORN, G. ET AL., NUCLEIC ACIDS, vol. 32, 2004, pages e49
DULEY LMEHER SJONES L: "Drugs for treatment of very high blood pressure during pregnancy", COCHRANE DATABASE SYST REV, vol. 7, 2013, pages CD001449
ELBASHIR ET AL., GENES DEV, vol. 15, 2001, pages 188
ELMEN, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 33, no. 1, 2005, pages 439 - 447
FISHER K J ET AL., J. VIROL, vol. 70, 1996, pages 520 - 532
FLUITER ET AL., MOL. BIOSYST., vol. 10, 2009, pages 1039
GASSMANN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 92, 1995, pages 1292
GROSSMANWILSON, CURR. OPIN. IN GENETICS AND DEVEL., vol. 3, 1993, pages 110 - 114
GRUNWELLER, A. ET AL., NUCLEIC ACIDS RESEARCH, vol. 31, no. 12, 2003, pages 3185 - 3193
GUATELLI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 1874 - 1878
HOWARD, KA. ET AL., MOL. THER., vol. 14, 2006, pages 476 - 484
JEFFREY OLEARCZYK ET AL: "Suppl. Table 1; Targeting of hepatic angiotensinogen using chemically modified siRNAs results in significant and sustained blood pressure lowering in a rat model of hypertension", HYPERTENSION RESEARCH, 12 December 2013 (2013-12-12), XP055206994, Retrieved from the Internet <URL:http://www.nature.com/hr/journal/v37/n5/extref/hr2013155x3.doc> [retrieved on 20150810] *
JEFFREY OLEARCZYK ET AL: "Targeting of hepatic angiotensinogen using chemically modified siRNAs results in significant and sustained blood pressure lowering in a rat model of hypertension", HYPERTENSION RESEARCH, vol. 37, no. 5, 12 December 2013 (2013-12-12), pages 405 - 412, XP055206991, ISSN: 0916-9636, DOI: 10.1038/hr.2013.155 *
KABANOV ET AL., FEBS LETT., vol. 259, 1990, pages 327 - 330
KAMAROFF ET AL., HINDAWI INTERNATIONAL J CHRON DIS, 2018
KIDNEY DISEASE: IMPROVING GLOBAL OUTCOMES (KDIGO) CKD WORK GROUP, KIDNEY INTERNATIONAL SUPPLEMENTS, vol. 3, 2013, pages 1 - 150
KIEM ET AL., BLOOD, vol. 83, 1994, pages 1467 - 1473
KIM SH. ET AL., JOURNAL OF CONTROLLED RELEASE, vol. 129, no. 2, 2008, pages 107 - 116
KOZARSKYWILSON, CURRENT OPINION IN GENETICS AND DEVELOPMENT, vol. 3, 1993, pages 499 - 503
KUBO, T. ET AL., BIOCHEM. BIOPHYS. RES. COMM., vol. 365, no. 1, 2007, pages 54 - 61
LAM ET AL., NATURE, vol. 354, 1991, pages 82 - 84
LETSINGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 6553 - 1177
LETSINGER ET AL., PROC. NATL. ACID. SCI. USA, vol. 86, 1989, pages 6553 - 6556
LI, S. ET AL., MOL. THER., vol. 15, 2007, pages 515 - 523
LIMA ET AL., CELL, vol. 150, 2012, pages 883 - 894
LIU, S., MOL. PHARM., vol. 3, 2006, pages 472 - 487
LIZARDI ET AL., BIO/TECHNOLOGY, vol. 6, 1988, pages 1197
MAKIMURA, H. ET AL., BMC NEUROSCI, vol. 3, 2002, pages 18
MANOHARAN ET AL., ANN. N.Y. ACAD. SCI., vol. 660, 1992, pages 306 - 309
MANOHARAN ET AL., ANN. NY. ACAD. SCI., vol. 660, 1992, pages 306
MANOHARAN ET AL., BIOORG. MED. CHEM. LET., vol. 3, 1993, pages 2765
MANOHARAN ET AL., BIOORG. MED. CHEM. LETT., vol. 4, 1994, pages 1053
MANOHARAN ET AL., BIORG. MED. CHEM. LET., vol. 3, 1993, pages 2765 - 2770
MANOHARAN ET AL., BIORG. MED. CHEM. LET., vol. 4, 1994, pages 1053 - 1060
MANOHARAN ET AL., NUCLEOSIDES & NUCLEOTIDES, vol. 14, 1995, pages 969 - 973
MANOHARAN ET AL., TETRAHEDRON LETT., vol. 36, 1995, pages 3651 - 3654
MARK K. SCHLEGEL ET AL: "Chirality Dependent Potency Enhancement and Structural Impact of Glycol Nucleic Acid Modification on siRNA", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, vol. 139, no. 25, 19 June 2017 (2017-06-19), US, pages 8537 - 8546, XP055602525, ISSN: 0002-7863, DOI: 10.1021/jacs.7b02694 *
MARTIN ET AL., HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504
MASTRANGELI ET AL., J CLIN. INVEST., vol. 91, 1993, pages 225 - 234
MCNAMARA, JO. ET AL., NAT. BIOTECHNOL., vol. 24, 2006, pages 1005 - 1015
MILLER ET AL., METH. ENZYMOL., vol. 217, 1993, pages 581 - 599
MISHRA ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 1264, 1995, pages 229 - 237
MOOK, OR. ET AL., MOL CANC THER, vol. 6, no. 3, 2007, pages 833 - 843
NUC. ACIDS SYMP. SERIES, vol. 52, 2008, pages 133 - 134
NYKANEN ET AL., CELL, vol. 107, 2001, pages 309
OBERHAUSER ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 533 - 538
PAL, A. ET AL., INT J ONCOL, vol. 26, 2005, pages 1087 - 1091
PILLE, J. ET AL., MOL. THER., vol. 11, 2005, pages 267 - 274
RABINOWITZ J E ET AL., J VIROL, vol. 76, 2002, pages 791 - 801
REBOUSSIN ET AL.: "Systematic Review for the 2017 ACC/AHA/AAPA/ABC/ACPM/AGS/APhA/ASH/ASPC/NMA/PCNA Guideline for the Prevention, Detection, Evaluation, and Management of High Blood Pressure in Adults: A Report of the American College of Cardiology/American Heart Association Task Force on Clinical Practice Guidelines", J AM COLL CARDIOL, no. 17, 7 November 2017 (2017-11-07), pages 0735 - 1097
REBOUSSIN ET AL.: "Systematic Review for the 2017 ACC/AHA/AAPA/ABC/ACPM/AGS/APhA/ASH/ASPC/NMA/PCNA Guideline for the Prevention, Detection, Evaluation, and Management of High Blood Pressure in Adults: A Report of the American College of Cardiology/American Heart Association Task Force on Clinical Practice Guidelines", JAM COLL CARDIOL, no. 17, 7 November 2017 (2017-11-07), pages 0735 - 1097
REICH, SJ. ET AL., MOL. VIS., vol. 9, 2003, pages 210 - 216
ROSENFELD ET AL., CELL, vol. 68, 1992, pages 143 - 155
ROSENFELD ET AL., SCIENCE, vol. 254, 1991, pages 1497 - 1500
SAISON-BEHMOARAS ET AL., EMBO J, vol. 10, 1991, pages 1111 - 1118
SAISON-BEHMOARAS ET AL., EMBO J., vol. 10, 1991, pages 111
SALMONSGUNZBERG, HUMAN GENE THERAPY, vol. 4, 1993, pages 129 - 141
SAMULSKI R ET AL., J. VIROL., vol. 61, 1987, pages 3096 - 3101
SAMULSKI R ET AL., J. VIROL., vol. 63, 1989, pages 3822 - 3826
SHEA ET AL., NUCL. ACIDS RES., vol. 18, 1990, pages 3777 - 3783
SHISHKINA, GT. ET AL., NEUROSCIENCE, vol. 129, 2004, pages 521 - 528
SIMEONI ET AL., NUCL. ACIDS RES., vol. 31, 2003, pages 2717 - 2724
SORENSEN, DR. ET AL., J. MOL. BIOL, vol. 327, 2003, pages 761 - 766
SOUTSCHEK, J. ET AL., NATURE, vol. 432, 2004, pages 173 - 178
SVINARCHUK ET AL., BIOCHIMIE, vol. 75, 1993, pages 49 - 54
TAN, PH. ET AL., GENE THER, vol. 12, 2005, pages 59 - 66
THAKKER, ER. ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 101, 2004, pages 17270 - 17275
THE SPRINT RESEARCH GROUP, NEJM, vol. 373, no. 22, 2015, pages 2103 - 2116
TOLENTINO, MJ. ET AL., RETINA, vol. 24, 2004, pages 132 - 138
TOMALIA, DA. ET AL., BIOCHEM. SOC. TRANS., vol. 35, 2007, pages 61 - 67
TOMLINSON, PLOS ONE, vol. 8, no. 11, 2013
VERMA, UN. ET AL., CLIN. CANCER RES., vol. 9, 2003, pages 1291 - 1300
WALSH ET AL., PROC. SOC. EXP. BIOL. MED., vol. 204, 1993, pages 289 - 300
WANG ET AL., GENE THERAPY, vol. 2, 1995, pages 775 - 783
WHELTON ET AL.: "2017 ACC/AHA/AAPA/ABC/ACPM/AGS/APhA/ASH/ASPC/NMA/PCNA Guideline for the Prevention, Detection, Evaluation, and Management of High Blood Pressure in Adults: A Report of the American College of Cardiology/American Heart Association Task Force on Clinical Practice Guidelines", J AM COLL CARDIOL, no. 17, 7 November 2017 (2017-11-07), pages 0735 - 1097
WHELTON ET AL.: "2017 ACC/AHA/AAPA/ABC/ACPM/AGS/APhA/ASH/ASPC/NMA/PCNA Guideline for the Prevention, Detection, Evaluation, and Management of High Blood Pressure in Adults: A Report of the American College of Cardiology/American Heart Association Task Force on Clinical Practice Guidelines", JAM COLL CARDIOL., no. 17, 7 November 2017 (2017-11-07), pages 0735 - 1097
XIA H ET AL., NAT. BIOTECH., vol. 20, 2002, pages 1006 - 1010
YOO, H. ET AL., PHARM. RES., vol. 16, 1999, pages 1799 - 1804
ZHANG, X. ET AL., J. BIOL. CHEM., vol. 279, 2004, pages 10677 - 10684
ZIMMERMANN, TS. ET AL., NATURE, vol. 441, 2006, pages 111 - 114

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11834661B2 (en) 2018-05-14 2023-12-05 Alnylam Pharmaceuticals, Inc. Angiotensinogen (AGT) iRNA compositions and methods of use thereof
US12584130B2 (en) 2018-05-14 2026-03-24 Alnylam Pharmaceuticals, Inc. Angiotensinogen (AGT) iRNA compositions and methods of use thereof
WO2023278576A1 (en) * 2021-06-30 2023-01-05 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating an angiotensinogen- (agt-) associated disorder
CN120272480A (zh) * 2021-09-30 2025-07-08 北京安龙生物医药有限公司 用于治疗与pcsk9相关疾病的靶向寡核苷酸
US12534726B2 (en) 2021-11-16 2026-01-27 Shanghai Argo Biopharmaceutical Co., Ltd. Composition and method for inhibiting angiotensinogen (AGT) protein expression
WO2023088427A1 (zh) * 2021-11-19 2023-05-25 上海拓界生物医药科技有限公司 靶向血管紧张素原的siRNA及其医药用途
WO2023138663A1 (zh) * 2022-01-20 2023-07-27 上海拓界生物医药科技有限公司 一种dsRNA、其应用及制备方法
TWI853550B (zh) * 2022-04-29 2024-08-21 大陸商默化(無錫)生物科技有限公司 一類含核苷酸類似物的雙鏈RNAi類似物的綴合物
WO2024032679A1 (zh) * 2022-08-11 2024-02-15 益杰立科(上海)生物科技有限公司 一种表观编辑靶点的方法及用途
WO2024234831A1 (zh) * 2023-05-15 2024-11-21 苏州时安生物技术有限公司 一种用于调节血管紧张素原基因表达的双链rna、其缀合物、药物组合物及用途
WO2025128614A1 (en) * 2023-12-12 2025-06-19 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating an angiotensinogen- (agt-) associated disorder
WO2026050125A1 (en) * 2024-08-28 2026-03-05 Alnylam Pharmaceuticals, Inc. Methods and compositions for treating an angiotensinogen- (agt-) associated disorder

Also Published As

Publication number Publication date
JP7707164B2 (ja) 2025-07-14
TWI877247B (zh) 2025-03-21
CA3161703A1 (en) 2021-05-20
TW202526019A (zh) 2025-07-01
MX2022005692A (es) 2022-06-08
EP4058577A1 (en) 2022-09-21
CL2022001256A1 (es) 2023-02-10
PH12022551158A1 (en) 2023-10-02
JP2023502038A (ja) 2023-01-20
IL292865A (en) 2022-07-01
TW202132568A (zh) 2021-09-01
AU2020382478A1 (en) 2022-06-02
CO2022006092A2 (es) 2022-05-20
PE20230179A1 (es) 2023-02-01
CN114981431A (zh) 2022-08-30
US20230002765A1 (en) 2023-01-05
BR112022009216A2 (pt) 2022-08-02
WO2021096763A8 (en) 2021-06-24
KR20220115946A (ko) 2022-08-19

Similar Documents

Publication Publication Date Title
US12584130B2 (en) Angiotensinogen (AGT) iRNA compositions and methods of use thereof
US20230002765A1 (en) Methods and compositions for treating an angiotensinogen- (agt-) associated disorder
US20240247266A1 (en) Methods and compositions for treating an angiotensinogen- (agt-) associated disorder
EP4381071A1 (en) Irna compositions and methods for silencing angiotensinogen (agt)
CN117651768A (zh) 用于治疗血管紧张素原(agt)相关病症的方法和组合物
CA3161703C (en) Methods and compositions for treating an angiotensinogen- (agt-) associated disorder
HK40107874A (en) Angiotensinogen (agt) irna compositions and methods of use thereof
HK40050733A (en) Angiotensinogen (agt) irna compositions and methods of use thereof
HK40050733B (en) Angiotensinogen (agt) irna compositions and methods of use thereof
EA049470B1 (ru) Способы и композиции для лечения расстройства, ассоциированного с ангиотензиногеном (agt)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20816344

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: NC2022/0006092

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 2022527782

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3161703

Country of ref document: CA

WWP Wipo information: published in national office

Ref document number: NC2022/0006092

Country of ref document: CO

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112022009216

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: DZP2022000316

Country of ref document: DZ

ENP Entry into the national phase

Ref document number: 2020382478

Country of ref document: AU

Date of ref document: 20201106

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020816344

Country of ref document: EP

Effective date: 20220613

ENP Entry into the national phase

Ref document number: 112022009216

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20220512

WWG Wipo information: grant in national office

Ref document number: 202291455

Country of ref document: EA