WO2021092459A1 - Compounds and methods for reducing spdef expression - Google Patents
Compounds and methods for reducing spdef expression Download PDFInfo
- Publication number
- WO2021092459A1 WO2021092459A1 PCT/US2020/059506 US2020059506W WO2021092459A1 WO 2021092459 A1 WO2021092459 A1 WO 2021092459A1 US 2020059506 W US2020059506 W US 2020059506W WO 2021092459 A1 WO2021092459 A1 WO 2021092459A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- modified
- certain embodiments
- oligonucleotide
- oligomeric
- compound
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/02—Inorganic compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/007—Pulmonary tract; Aromatherapy
- A61K9/0073—Sprays or powders for inhalation; Aerolised or nebulised preparations generated by other means than thermal energy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
Definitions
- a disease or condition characterized by excessive mucus or fibrosis in a subject.
- disease or conditions characterized by excessive mucus that may be treated with the compounds, methods, and pharmaceutical compositions disclosed herein are asthma, chronic obstructive pulmonary disease (COPD), chronic bronchitis, cystic fibrosis, and ulcerative colitis.
- COPD chronic obstructive pulmonary disease
- fibrosis Non-limiting examples of disease or conditions characterized by fibrosis that may be treated with the compounds, methods, and pharmaceutical compositions disclosed herein are pulmonary fibrosis and idiopathic pulmonary fibrosis (IPF).
- SAM Pointed Domain Containing ETS Transcription Factor is a transcription factor that is critical for goblet cell differentiation in human lung tissue. SPDEF also regulates mucus production, inflammation, and airway responsiveness. SPDEF is expressed at low levels in the lung, but expression is increased when challenged with a virus or allergen. SPDEF expression is also increased in chronic lung disorders, such as cystic fibrosis, chronic bronchitis and asthma, relative to its expression in the lungs of subjects not diagnosed with such disorders. Chronic lung disorders are typically treated with bronchodilators, steroids and anti-inflammatory agents.
- compounds, methods and pharmaceutical compositions for reducing the amount or activity of SPDEF RNA in a cell or a subject comprise an oligomeric compound capable of reducing expression of SPDEF RNA.
- compounds, methods and pharmaceutical compositions reduce the amount or activity of SPDEF protein in a cell or a subject.
- the disease or condition is cystic fibrosis.
- the disease or condition is a gastrointestinal condition, e.g., ulcerative colitis.
- the disease or condition is a pulmonary condition.
- Non-limiting examples of such pulmonary conditions are bronchitis, asthma, COPD, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, and sarcoidosis.
- bronchitis asthma, COPD, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, and sarcoidosis.
- 2’-deoxynucleoside means a nucleoside comprising a 2’-H(H) deoxyribosyl sugar moiety.
- a 2’-deoxynucleoside is a 2’ ⁇ -D-deoxynucleoside and comprises a 2 -b- ⁇ - deoxyribosyl sugar moiety, which has the b-D configuration as found in naturally occurring deoxyribonucleic acids (DNA).
- a 2’-deoxynucleoside or nucleoside comprising an unmodified T- deoxyribosyl sugar moiety may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
- 2’-MOE or “2’-MOE sugar moiety” means a 2’-0CH 2 CH 2 0CH 3 group in place of the 2’-OH group of a ribosyl sugar moiety.
- MOE means methoxyethyl.
- 2’-MOE nucleoside means a nucleoside comprising a 2’-MOE sugar moiety.
- 2’-OMe or “2’-0-methyl sugar moiety” means a 2’-OC]3 ⁇ 4 group in place of the 2’- OH group of a ribosyl sugar moiety.
- 2’-OMe nucleoside means a nucleoside comprising a 2’-OMe sugar moiety.
- 2 ’-substituted nucleoside means a nucleoside comprising a 2 ’-substituted sugar moiety.
- 2 ’-substituted in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.
- 5 -methyl cytosine means a cytosine modified with a methyl group attached to the 5 position.
- a 5-methyl cytosine is a modified nucleobase.
- administering means providing a pharmaceutical agent to a subject.
- antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
- antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.
- antisense compound means an oligomeric compound capable of achieving at least one antisense activity.
- amelioration in reference to a treatment means improvement in at least one symptom relative to the same symptom in the absence of the treatment.
- amelioration is the reduction in the severity or frequency of a symptom or the delayed onset or slowing of progression in the severity or frequency of a symptom.
- bicyclic nucleoside or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
- bicyclic sugar or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure.
- the first ring of the bicyclic sugar moiety is a furanosyl moiety.
- the bicyclic sugar moiety does not comprise a fiiranosyl moiety.
- cleavable moiety means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell or a subject.
- complementary in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
- complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another.
- Complementary nucleobase pairs include adenine (A) with thymine (T), adenine (A) with uracil (U), cytosine (C) with guanine (G), and 5 -methyl cytosine (mC) with guanine (G).
- Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
- oligonucleotide or portion thereof, is complementary to another oligonucleotide or nucleic acid at each nucleobase of the oligonucleotide.
- conjugate group means a group of atoms that is directly or indirectly attached to an oligonucleotide.
- Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
- conjugate linker means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
- conjugate moiety means a group of atoms that is attached to an oligonucleotide via a conjugate linker.
- oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other.
- contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
- constrained ethyl or “cEf ’ or “cEt modified sugar” means a b-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4 ’-carbon and the 2’-carbon of the b-D ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH 3 )-0-2', and wherein the methyl group of the bridge is in the S configuration.
- cEt nucleoside means a nucleoside comprising cEt modified sugar moiety.
- chirally enriched population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
- the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides.
- double -stranded refers to a region of hybridized nucleic acid(s). In certain embodiments, such double-strand results from hybridization of an oligonucleotide (or portion thereof) to a target region of a transcript. In certain embodiments, a double-strand results from hybridization of two oligonucleotides (or portions thereof) to one another. In certain embodiments, the hybridized regions are portions (including the entirety) of two separate molecules (e.g., no covalent bond connects the two complementary strands together). In certain embodiments, the hybridized regions are portions of the same molecule that have hybridized (e.g., a hairpin structure).
- duplex means a structure formed by two separate nucleic acid molecules at least a portion of which are complementary and that are hybridized to one another, but are not covalently bonded to one another.
- gapmer means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
- the internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.”
- wings refers to a sugar motif.
- the sugar moiety of each nucleoside of the gap is a 2 -b- D-deoxyribosyl sugar moiety.
- cEt gapmer indicates a gapmer having a gap comprising 2 -b- D-deoxynucleosides and wings comprising a cEt nucleoside.
- a cEt gapmer may comprise one or more modified intemucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
- hotspot region is a range of nucleobases on a target nucleic acid that is amenable to oligomeric compound-mediated reduction of the amount or activity of the target nucleic acid.
- hybridization means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
- intemucleoside linkage means the covalent linkage between contiguous nucleosides in an oligonucleotide.
- modified intemucleoside linkage means any intemucleoside linkage other than a phosphodiester intemucleoside linkage.
- Phosphorothioate intemucleoside linkage is a modified intemucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester intemucleoside linkage is replaced with a sulfur atom.
- inverted nucleoside means a nucleotide having a 3’ to 3’ and/or 5’ to 5’ intemucleoside linkage, as shown herein.
- inverted sugar moiety means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having a 3’ to 3’ and/or 5’ to 5’ intemucleoside linkage.
- linker-nucleoside means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.
- LNP Lip nanoparticle
- a pharmaceutically active molecule such as a nucleic acid molecule, e.g., an RNAi or a plasmid from which an RNAi is transcribed.
- LNPs are described in, for example, U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are hereby incorporated herein by reference.
- non-bicyclic modified sugar moiety means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
- mismatch or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary with the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotide are aligned.
- motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
- nucleobase means an unmodified nucleobase or a modified nucleobase.
- an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
- a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one unmodified nucleobase.
- a “5 -methyl cytosine” is a modified nucleobase.
- a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
- nucleobase sequence means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage modification.
- nucleoside means a compound comprising a nucleobase and a sugar moiety.
- the nucleobase and sugar moiety are each, independently, unmodified or modified.
- modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
- Modified nucleosides include abasic nucleosides, which lack a nucleobase.
- Linked nucleosides are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
- overhang refers to unpaired nucleotides at either or both ends of a duplex formed by hybridization of an antisense RNAi oligonucleotide and a sense RNAi oligonucleotide.
- oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
- An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
- a “singled-stranded oligomeric compound” is an unpaired oligomeric compound.
- oligomeric duplex means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”
- oligonucleotide means a strand of linked nucleosides connected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
- modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or intemucleoside linkage is modified.
- unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications.
- pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject.
- a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
- pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
- a pharmaceutical composition means a mixture of substances suitable for administering to a subject.
- a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
- a pharmaceutical composition shows activity in a free uptake assay in certain cell lines.
- prodrug means a therapeutic agent in a form outside the body that is converted to a different form within a subject or cells thereof.
- conversion of a prodrug within the subject is facilitated by the action of an enzymes (e.g., endogenous or viral enzyme) or chemicals present in cells or tissues and/or by physiologic conditions.
- an enzymes e.g., endogenous or viral enzyme
- chemicals present in cells or tissues and/or by physiologic conditions.
- reducing or inhibiting the amount or activity refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.
- RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
- RNAi compound means an antisense compound that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
- RNAi compounds include, but are not limited to double -stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.
- an RNAi compound modulates the amount, activity, and/or splicing of a target nucleic acid.
- the term RNAi compound excludes antisense compounds that act through RNase H.
- RNAi oligonucleotide means an antisense RNAi oligonucleotide or a sense RNAi oligonucleotide.
- RNAi oligonucleotide means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNAi.
- RNAi oligonucleotide means an oligonucleotide comprising a region that is complementary to a region of an antisense RNAi oligonucleotide, and which is capable of forming a duplex with such antisense RNAi oligonucleotide.
- a duplex formed by an antisense RNAi oligonucleotide and a sense RNAi oligonucleotide is referred to as a double-stranded RNAi compound (dsRNAi) or a short interfering RNA (siRNA).
- antisense RNase H oligonucleotide means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNase H-mediated nucleic acid reduction.
- oligonucleotide that at least partially hybridizes to itself.
- stabilized phosphate group means a 5 ’-phosphate analog that is metabolically more stable than a 5 ’-phosphate as naturally occurs on DNA or RNA.
- standard cell assay means the assay described in Example 1 and reasonable variations thereof.
- stereorandom in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration.
- the number of molecules having the (5) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the ( R ) configuration of the stereorandom chiral center.
- the stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
- a stereorandom chiral center is a stereorandom phosphorothioate intemucleoside linkage.
- subject means a human or non-human animal. In certain embodiments, the subject is a human.
- sugar moiety means an unmodified sugar moiety or a modified sugar moiety.
- unmodified sugar moiety means a 2’-OH(H) ribosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) deoxyribosyl moiety, as found in DNA (an “unmodified DNA sugar moiety”).
- Unmodified sugar moieties have one hydrogen at each of the G, 3’, and 4’ positions, an oxygen at the 3’ position, and two hydrogens at the 5’ position.
- modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
- sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
- Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.
- symptom or hallmark means any physical feature or test result that indicates the existence or extent of a disease or disorder.
- a symptom is apparent to a subject or to a medical professional examining or testing said subject.
- a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.
- target nucleic acid and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.
- the target RNA is a SPDEF RNA
- the nucleic acid is a SPDEF nucleic acid.
- target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
- terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
- terapéuticaally effective amount means an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject.
- a therapeutically effective amount improves a symptom or hallmark of a disease.
- Embodiment 1 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50, 12 to 45, 12 to 40, 12 to 35, 12 to 30, 12 to 25, or 12 to 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of an SPDEF nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
- Embodiment 2 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50, 12 to 45, 12 to 40, 12 to 35, 12 to 30, 12 to 25, or 12 to 20 linked nucleosides and having a nucleobase sequence comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases complementary to an equal length portion of the nucleobase sequence of any of SEQ ID NOS: 1-5.
- Embodiment 3 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50, 12 to 45, 12 to 40, 12 to 35, 12 to 30, 12 to 25, or 12 to 20 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to: an equal length portion of nucleobases 3521-3554 of SEQ ID NO: 2; an equal length portion of nucleobases 3684- 3702 of SEQ ID NO: 2; an equal length portion of nucleobases 3785-3821 of SEQ ID NO: 2;an equal length portion of nucleobases 6356- 6377 of SEQ ID NO: 2; an equal length portion of nucleobases 8809- 8826 of SEQ ID NO: 2;an equal length portion of nucleobases 9800-98
- Embodiment 4 The oligomeric compound of embodiment 3, wherein the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases of a sequence selected from: SEQ ID NOS: 1053, 1129, 2166, 2167, 2168, 2169, 2170, 2171, 2172, 2173, 2174, 2175, 2176, 2242, and 2247; SEQ ID NOS: 1777, 1852, 1928, and 2004; SEQ ID NOS: 1282, 1358, 1434, 2177, 2178, 2179, 2180, 2181, 2182, 2183, 2184, 2185, and 2186; SEQ ID NOS: 678, 2198, 2199, 2200, 2244, and 2248; SEQ ID NOS: 683,
- SEQ ID NOS: 761, 2229, and 2230 SEQ ID NOS: 1606, 1682, 2255, 2275, and 2280; SEQ ID NOS: 999, 1075, 2262, 2263, 2264, 2265, 2266, 2267, and 2268; SEQ ID NOS: 163, 1980, 2056, and 2277; or SEQ ID NOS: 1831, 1907, 1983, 2059, and 2282.
- Embodiment 5 The oligomeric compound of any one of embodiments 1-4, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to an equal length portion of a nucleobase sequence selected from SEQ ID NOS: 1-5 when measured across the entire nucleobase sequence of the modified oligonucleotide.
- Embodiment 6 The oligomeric compound of any one of embodiments 1-5, wherein at least one modified nucleoside comprises a modified sugar moiety.
- Embodiment 7 The oligomeric compound of embodiment 6, wherein the modified sugar moiety comprises a bicyclic sugar moiety.
- Embodiment 8 The oligomeric compound of embodiment 7, wherein the bicyclic sugar moiety comprises a 2’-4’ bridge selected from -0-CH2-; and -0-CH(CH3)-.
- Embodiment 9 The oligomeric compound of embodiment 6, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.
- Embodiment 10 The oligomeric compound of embodiment 9, wherein the non-bicyclic modified sugar moiety comprises a 2’-MOE sugar moiety or 2’-OMe sugar moiety.
- Embodiment 11 The oligomeric compound of any one of embodiments 1-5, wherein at least one modified nucleoside comprises a sugar surrogate.
- Embodiment 12 The oligomeric compound of embodiment 11, wherein the sugar surrogate is selected from morpholino and PNA.
- Embodiment 13 The oligomeric compound of any of embodiments 1-12, wherein the modified oligonucleotide has a sugar motif comprising: a 5’-region consisting of 1-5 linked 5’-region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3’-region consisting of 1-5 linked 3’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises an unmodified 2’- deoxyribosyl sugar moiety.
- Embodiment 14 The oligomeric compound of any one of embodiments 1-13, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage.
- Embodiment 15 The oligomeric compound of embodiment 14, wherein the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
- Embodiment 16 The oligomeric compound of embodiment 14, wherein each intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage.
- Embodiment 17 The oligomeric compound of any one of embodiments 1-13, wherein each intemucleoside linkage of the modified oligonucleotide is a phosphorothioate intemucleoside linkage.
- Embodiment 18 The oligomeric compound of any one of embodiments 1-13, wherein the modified oligonucleotide comprises at least one phosphodiester intemucleoside linkage.
- Embodiment 19 The oligomeric compound of embodiment 14, wherein each intemucleoside linkage is independently selected from a phosphodiester intemucleoside linkage or a phosphorothioate intemucleoside linkage.
- Embodiment 20 The oligomeric compound of any of embodiments 1-19, wherein the modified oligonucleotide comprises at least one modified nucleobase.
- Embodiment 21 The oligomeric compound of embodiment 20, wherein the modified nucleobase is a 5- methyl cytosine.
- Embodiment 22 The oligomeric compound of any of embodiments 1-21, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-20, 15-25, 16-20, 18-22 or 18-20 linked nucleosides.
- Embodiment 23 The oligomeric compound of any of embodiments 1-22, wherein the modified oligonucleotide consists of 16 linked nucleosides.
- Embodiment 24 The oligomeric compound of embodiment 23, wherein each of nucleosides 1-3 and 14-16 (from 5’ to 3’) comprise a cEt modification and each of nucleosides 4-13 are 2’-deoxynucleosides.
- Embodiment 25 The oligomeric compound of embodiment 23, wherein each of nucleosides 1-2 and 15-16 (from 5’ to 3’) comprise a cEt modification and each of nucleosides 3-14 are 2’-deoxynucleosides.
- Embodiment 26 The oligomeric compound of any of embodiments 1-25, consisting of the modified oligonucleotide.
- Embodiment 27 The oligomeric compound of any of embodiments 1-25, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.
- Embodiment 28 The oligomeric compound of embodiment 27, wherein the conjugate group comprises a GalNAc cluster comprising 1-3 GalNAc ligands.
- Embodiment 29 The oligomeric compound of embodiments 27 or 28, wherein the conjugate linker consists of a single bond.
- Embodiment 30 The oligomeric compound of embodiment 27, wherein the conjugate linker is cleavable.
- Embodiment 32 The oligomeric compound of any of embodiments 27-31, wherein the conjugate group is attached to the modified oligonucleotide at the 5 ’-end of the modified oligonucleotide.
- Embodiment 33 The oligomeric compound of any of embodiments 27-31, wherein the conjugate group is attached to the modified oligonucleotide at the 3 ’-end of the modified oligonucleotide.
- Embodiment 34 The oligomeric compound of any of embodiments 1-33 comprising a terminal group.
- Embodiment 35 The oligomeric compound of any of embodiments 1-34 wherein the oligomeric compound is a single-stranded oligomeric compound.
- Embodiment 36 The oligomeric compound of any of embodiments 1-30 or 32-35, wherein the oligomeric compound does not comprise linker-nucleosides.
- Embodiment 37 An oligomeric duplex comprising an oligomeric compound of any of embodiments 1-34 or 36.
- Embodiment 38 An antisense compound comprising or consisting of an oligomeric compound of any of embodiments 1-36 or an oligomeric duplex of embodiment 37.
- Embodiment 39 A modified oligonucleotide according to the following chemical structure:
- Embodiment 40 A modified oligonucleotide according to the following chemical structure:
- Embodiment 41 A modified oligonucleotide according to the following chemical structure:
- Embodiment 42 A modified oligonucleotide according to the following chemical structure: Embodiment 43.
- Embodiment 44 A modified oligonucleotide according to the following chemical structure:
- Embodiment 45 A modified oligonucleotide according to the following chemical notation: mCks Aks Aks Tds Ads Ads Gds mCds Ads Ads Gds Tds mCds Tks Gks Gks; wherein
- Embodiment 46 A modified oligonucleotide according to the following chemical notation:
- Embodiment 47 A pharmaceutical composition comprising the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of embodiment 37, the antisense compound of embodiment 38, or the modified oligonucleotides of any one of embodiments 39-46; and a pharmaceutically acceptable carrier or diluent.
- Embodiment 48 The pharmaceutical composition of embodiment 47, wherein the pharmaceutically acceptable carrier or diluent comprises phosphate buffered saline.
- Embodiment 49 The pharmaceutical composition of embodiment 48, consisting essentially of the oligomeric compound, antisense compound or oligomeric duplex, and phosphate buffered saline.
- Embodiment 50 A method comprising administering to a subject the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of embodiment 37, the antisense compound of embodiment 38, the modified oligonucleotides of any one of embodiments 39-46, or the pharmaceutical composition of any of embodiments 47-49.
- Embodiment 51 A method of treating a pulmonary condition comprising administering to a subject having or at risk for developing the pulmonary condition a therapeutically effective amount of the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of embodiment 37, the antisense compound of embodiment 38, the modified oligonucleotides of any one of embodiments 39-46, or the pharmaceutical composition according to any of embodiments 47-49, thereby treating the pulmonary condition.
- Embodiment 52 A method of reducing SPDEF RNA or SPDEF protein in a lung of a subject having or at risk for developing a pulmonary condition comprising administering a therapeutically effective amount of the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of embodiment 37, the antisense compound of embodiment 38, the modified oligonucleotides of any one of embodiments 39-46, or the pharmaceutical composition according to any of embodiments 47-49, thereby reducing SPDEF RNA or SPDEF protein in the lung.
- Embodiment 53 The method of embodiment 51 or 52, wherein the pulmonary condition is selected from bronchitis, asthma, chronic obstructive pulmonary disease, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, and sarcoidosis.
- the pulmonary condition is selected from bronchitis, asthma, chronic obstructive pulmonary disease, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, and sarcoidosis.
- Embodiment 54 The method of embodiment 51 or 52, wherein the pulmonary condition is chronic bronchitis.
- Embodiment 55 The method of embodiment 51 or 52, wherein the pulmonary condition is severe asthma.
- Embodiment 56 The method of any one of embodiments 51-55, wherein the administering comprises administering via nebulizer or inhaler.
- Embodiment 57 The method of any one of embodiments 51-56, wherein at least one symptom or hallmark of the pulmonary condition is ameliorated.
- Embodiment 59 The method of any of embodiments 51-58, wherein the method prevents or slows disease progression.
- Embodiment 60 A method of reducing mucus production in the lungs of a subject, the method comprising administering the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of embodiment 37, the antisense compound of embodiment 38, the modified oligonucleotides of any one of embodiments 39- 46; or the pharmaceutical composition of any one of embodiments 47-49.
- Embodiment 61 The method of any one of embodiments 50-60, wherein administering comprises oral delivery or nasal delivery.
- Embodiment 62 The method of any one of embodiments 50-61, wherein administering comprises aerosolized delivery.
- Embodiment 63 Use of the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of embodiment 37, the antisense compound of embodiment 38, the modified oligonucleotides of any one of embodiments 39-46; or the pharmaceutical composition of any one of embodiments 47-49 for the treatment of a pulmonary condition.
- Embodiment 64 The use of embodiment 60, wherein the pulmonary condition is selected from bronchitis, asthma, chronic obstructive pulmonary disease, pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, and sarcoidosis.
- the pulmonary condition is selected from bronchitis, asthma, chronic obstructive pulmonary disease, pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, and sarcoidosis.
- Embodiment 65 The use of embodiment 63, wherein the pulmonary condition is chronic bronchitis.
- Embodiment 66. The use of embodiment 63, wherein the pulmonary condition is severe asthma.
- Embodiment 67 A method of reducing mucus production in the gastrointestinal tract of a subject, the method comprising administering the oligomeric compound of any of embodiments 1-36, the oligomeric duplex of embodiment 37, the antisense compound of embodiment 38, the modified oligonucleotides of any one of embodiments 39-46; or the pharmaceutical composition of any one of embodiments 47-49.
- Embodiment 68 A method of treating a gastrointestinal condition comprising administering to a subject having or at risk for developing the gastrointestinal condition a therapeutically effective amount of the pharmaceutical composition according to any of embodiments 47-49, thereby treating the gastrointestinal condition.
- Embodiment 69 A method of reducing SPDEF RNA or SPDEF protein in the gastrointestinal tract of a subject having or at risk for developing a gastrointestinal condition, the method comprising administering a therapeutically effective amount of the pharmaceutical composition according to any of embodiments 47-49, thereby reducing SPDEF RNA or SPDEF protein in the gastrointestinal tract.
- Embodiment 70 The method of embodiment 68 or 69, wherein the gastrointestinal condition is ulcerative colitis.
- Embodiment 71. A method of reducing inflammation in a subject in need thereof, wherein the method comprises administering a therapeutically effective amount of the oligomeric compound of any of claims 1- 36, the oligomeric duplex of claim 37, the antisense compound of claim 38, or the modified oligonucleotides of any one of claims 39-46, or the pharmaceutical composition of any one of claim 47-49.
- Embodiment 72 The method of claim 71, wherein administering reduces inflammation in a lung of the subject.
- Embodiment 73 The method of claim 71, wherein administering reduces inflammation in the gastrointestinal tract of the subject.
- Embodiment 74 A system for treating a pulmonary condition comprising: a nebulizer or an inhaler; the oligomeric compound of any one of embodiments 1-36, the oligomeric duplex of embodiment 37, the antisense compound of embodiment 38, or the modified oligonucleotide of any one of embodiments 39-46; and a pharmaceutically acceptable carrier or diluent.
- Embodiment 75 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12,
- modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified intemucleoside linkage.
- Embodiment 76 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 contiguous nucleobases of: an equal length portion of nucleobases 19600-19642 of SEQ ID NO: 2; or an equal length portion of nucleobases 19640-19672 of SEQ ID NO: 2.
- Embodiment 77 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least
- Embodiment 78 The oligomeric compound of any of embodiments 75-77, wherein the oligomeric compound comprises an antisense RNAi oligonucleotide comprising a targeting region comprising at least 15 contiguous nucleobases, wherein the targeting region is at least 90% complementary to an equal-length portion of a SPDEF RNA.
- Embodiment 79 The oligomeric compound of embodiment 78, wherein the targeting region of the antisense RNAi oligonucleotide is at least 95% complementary or is 100% complementary to the equal length portion of a SPDEF RNA.
- Embodiment 80 The oligomeric compound of any of embodiments 78 or 79, wherein the targeting region of the antisense RNAi oligonucleotide comprises at least 19, 20, 21, or 25 contiguous nucleobases.
- Embodiment 81 The oligomeric compound of any of embodiments 78-80, wherein the SPDEF RNA has the nucleobase sequence of any of SEQ ID NOs: 1-6.
- Embodiment 82 The oligomeric compound of any of embodiments 78-81 wherein at least one nucleoside of the antisense RNAi oligonucleotide comprises a modified sugar moiety selected from: 2’-F, 2’-OMe, 2’- NMA, LNA, and cEt; or a sugar surrogate selected from GNA, and UNA.
- Embodiment 83 The oligomeric compound of any of embodiments 78-82, wherein each nucleoside of the antisense RNAi oligonucleotide comprises a modified sugar moiety or a sugar surrogate.
- Embodiment 84 The oligomeric compound of any of embodiments 78-83 wherein at least 80%, at least 90%, or 100% of the nucleosides of the antisense RNAi oligonucleotide comprises a modified sugar moiety selected from 2’-F and 2’-OMe.
- Embodiment 85 The oligomeric compound of any of embodiments 78-84, comprising a stabilized phosphate group attached to the 5’ position of the 5 ’-most nucleoside of the antisense RNAi oligonucleotide.
- Embodiment 86 The oligomeric compound of embodiment 85, wherein the stabilized phosphate group comprises a cyclopropyl phosphonate or an (E)- inyl phosphonate.
- Embodiment 87 The oligomeric compound of any of embodiments 78-86, consisting of the RNAi antisense oligonucleotide.
- Embodiment 88 The oligomeric compound of any of embodiments 78-87, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.
- Embodiment 89 The oligomeric compound of embodiment 88, wherein the conjugate linker consists of a single bond.
- Embodiment 90 The oligomeric compound of embodiment 88, wherein the conjugate linker is cleavable.
- Embodiment 91 The oligomeric compound of embodiment 88, wherein the conjugate linker comprises 1-3 linker-nucleosides .
- Embodiment 92 The oligomeric compound of any of embodiments 88-91, wherein the conjugate group is attached to the 5 ’-end of the antisense RNAi oligonucleotide.
- Embodiment 93 The oligomeric compound of any of embodiments 88-91, wherein the conjugate group is attached to the 3 ’-end of the antisense RNAi oligonucleotide.
- Embodiment 94 The oligomeric compound of any of embodiments 78-93, comprising a terminal group.
- Embodiment 96 An oligomeric duplex comprising the oligomeric compound of any one of embodiments 75- 95.
- Embodiment 97 The oligomeric duplex of embodiment 96, wherein the oligomeric complex is an RNAi compound.
- Embodiment 98 The oligomeric duplex of embodiment 96 or 97, comprising a sense RNAi oligonucleotide consisting of 17 to 30 linked nucleosides, wherein the nucleobase sequence of the sense RNAi oligonucleotide comprises an antisense-hybridizing region comprising least 15 contiguous nucleobases wherein the antisense-hybridizing region is at least 90% complementary to an equal length portion of the antisense RNAi oligonucleotide.
- Embodiment 99 The oligomeric duplex of embodiment 98, wherein the sense RNAi oligonucleotide consists of 18-25, 20-25, or 21-23 linked nucleosides.
- Embodiment 100 The oligomeric duplex of embodiment 98, wherein the sense RNAi oligonucleotide consists of 21 or 23 linked nucleosides.
- Embodiment 101 The oligomeric duplex of any of embodiments 98-100, wherein 1-43’-most nucleosides of the antisense or the sense RNAi oligonucleotide are overhanging nucleosides.
- Embodiment 102 The oligomeric duplex of any of embodiments 98-101, wherein 1-45’-most nucleosides of the antisense or sense RNAi oligonucleotide are overhanging nucleosides.
- Embodiment 103 The oligomeric duplex of any of embodiments 98-102, wherein the duplex is blunt ended at the 3 ’-end of the antisense RNAi oligonucleotide.
- Embodiment 104 The oligomeric duplex of any of embodiments 98-103, wherein the duplex is blunt ended at the 5 ’-end of the antisense RNAi oligonucleotide.
- Embodiment 105 The oligomeric duplex of any of embodiments 98-104, wherein at least one nucleoside of the sense RNAi oligonucleotide comprises a modified sugar moiety selected from: 2’-F, 2’-OMe, LNA, cEt, or a sugar surrogate selected from GNA, and UNA.
- Embodiment 106 The oligomeric duplex of embodiment 105, wherein each nucleoside of the sense RNAi oligonucleotide comprises a modified sugar moiety or a sugar surrogate.
- Embodiment 107 The oligomeric duplex of embodiment 105, wherein at least 80%, at least 90%, or 100% of the nucleosides of the sense RNAi oligonucleotide comprises a modified sugar moiety selected from 2’-F and 2’-OMe.
- Embodiment 108 The oligomeric duplex of any of embodiments 98-107, wherein at least one nucleoside of the sense RNAi oligonucleotide comprises a modified nucleobase.
- Embodiment 109 The oligomeric duplex of any of embodiments 98-108,wherein at least one intemucleoside linkage of the sense RNAi oligonucleotide is a modified intemucleoside linkage.
- Embodiment 110 The oligomeric duplex of embodiment 109, wherein at least one intemucleoside linkage of the sense RNAi oligonucleotide is a phosphorothioate intemucleoside linkage.
- Embodiment 111 The oligomeric duplex of any of embodiments 98-110, wherein the compound comprises 1-5 abasic sugar moieties attached to one or both ends of the antisense or sense RNA oligonucleotide.
- RNAi oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 2324-2510; wherein the sense RNAi oligonucleotide has a nucleobase sequence comprising the corresponding complementary nucleobase sequence of any of SEQ ID NOs: 2511-2697; and wherein the nucleobase sequence of the sense RNAi oligonucleotide is 100% complementary to the nucleobase sequence of the antisense RNAi oligonucleotide.
- Embodiment 113 The oligomeric duplex of any of embodiments 98-102, consisting of the antisense RNAi oligonucleotide and the sense RNAi oligonucleotide.
- Embodiment 114 The oligomeric duplex of any of embodiments 98-113, wherein the second oligomeric compound comprises a conjugate group comprising a conjugate moiety and a conjugate linker.
- Embodiment 115 The oligomeric duplex of embodiment 114, wherein the conjugate linker consists of a single bond.
- Embodiment 116 The oligomeric duplex of embodiment 115, wherein the conjugate linker is cleavable.
- Embodiment 117 The oligomeric duplex of embodiment 115 or 116, wherein the conjugate linker comprises 1-3 linker-nucleosides.
- Embodiment 118 The oligomeric duplex of any of embodiments 114-117, wherein the conjugate group is attached to the 5 ’-end of the sense RNAi oligonucleotide.
- Embodiment 119 The oligomeric duplex of any of embodiments 114-117, wherein the conjugate group is attached to the 3 ’-end of the sense RNAi oligonucleotide.
- Embodiment 120 The oligomeric duplex of any of embodiments 114-119, wherein the conjugate group is attached via the 2’ position of a ribosyl sugar moiety at an internal position of the sense RNAi oligonucleotide.
- Embodiment 121 The oligomeric duplex of any one of embodiment 98-120, wherein the second oligomeric compound comprises a terminal group.
- Embodiment 122 A pharmaceutical composition comprising the oligomeric compound of any one of embodiments 75-95 or the oligomeric duplex of any one of embodiments 96-121; and a pharmaceutically acceptable carrier or diluent.
- Embodiment 123 The pharmaceutical composition of embodiment 122, wherein the pharmaceutically acceptable diluent is water, sterile saline, or PBS.
- Embodiment 124 The pharmaceutical composition of embodiment 123, wherein the pharmaceutical composition consists essentially of the oligomeric duplex and sterile saline.
- Embodiment 125 A method comprising administering to a subject a pharmaceutical composition of any of embodiments 122-124.
- Embodiment 126 A method of treating a disease associated with SPDEF comprising administering to a subject having or at risk for developing a disease associated with SPDEF a therapeutically effective amount of: the oligomeric compound of any one of embodiments 75-95, the oligomeric duplex of any one of embodiments 93-118, or the pharmaceutical composition of any one of embodiments 122-124, thereby treating the disease associated with SPDEF.
- Embodiment 127 Embodiment 127.
- the disease associated with SPDEF is selected from bronchitis, asthma, chronic obstructive pulmonary disease, pulmonary fibrosis, idiopathic pulmonary fibrosis, pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, and sarcoidosis.
- Embodiment 128 The method of any of embodiments 126 or 127, wherein at least one symptom or hallmark of the disease associated with SPDEF is ameliorated.
- Embodiment 129 The method of embodiment 128, wherein the symptom or hallmark is shortness of breath, chest pain, coughing, wheezing, fatigue, and sleep disruption.
- Embodiment 130 The method of embodiment 126, wherein the disease associated with SPDEF is ulcerative colitis.
- Embodiment 131 Use of the oligomeric compound of any one of embodiments 78-98, the oligomeric duplex of any one of embodiments 96-121, or the pharmaceutical composition of any one of embodiments 122-124 for the treatment of a pulmonary condition.
- Embodiment 132 The use of embodiment 131, wherein the pulmonary condition is selected from bronchitis, asthma, chronic obstructive pulmonary disease, pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, and sarcoidosis.
- the pulmonary condition is selected from bronchitis, asthma, chronic obstructive pulmonary disease, pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, and sarcoidosis.
- Embodiment 133 The use of embodiment 131, wherein the pulmonary condition is chronic bronchitis.
- Embodiment 134. The use of embodiment 131, wherein the pulmonary condition is severe asthma.
- Embodiment 135. A method of reducing mucus production in the gastrointestinal tract of a subject, the method comprising administering the oligomeric compound of any one of embodiments 75-95, the oligomeric duplex of any one of embodiments 96-121, or the pharmaceutical composition of any one of embodiments 122-124.
- Embodiment 136 A method of treating a gastrointestinal condition comprising administering to a subject having or at risk for developing the gastrointestinal condition a therapeutically effective amount of the oligomeric compound of any one of embodiments 75-95, the oligomeric duplex of any one of embodiments 96-121, or the pharmaceutical composition of any one of embodiments 122-124, thereby treating the gastrointestinal condition.
- Embodiment 137 A method of reducing SPDEF RNA or SPDEF protein in the gastrointestinal tract of a subject having or at risk for developing a gastrointestinal condition, the method comprising administering a therapeutically effective amount of the oligomeric compound of any one of embodiments 75-95, the oligomeric duplex of any one of embodiments 96-121, or the pharmaceutical composition of any one of embodiments 122-124, thereby reducing SPDEF RNA or SPDEF protein in the gastrointestinal tract.
- Embodiment 138 The method of embodiment 136 or 137, wherein the gastrointestinal condition is ulcerative colitis.
- Embodiment 139 A method of reducing inflammation in a subject in need thereof, the method comprising administering to the subject the oligomeric compound of any one of embodiments 1-36 and 75-95; the oligomeric duplex of any one of embodiments 37 and 96-121; the antisense compound of embodiment 38; the modified oligonucleotide of any one of embodiments 39-46; or the pharmaceutical composition of any one of embodiments 47-49 and 122-124, thereby reducing inflammation in the subject.
- Embodiment 140 A method of reducing inflammation in a lung of a subject in need thereof, the method comprising administering to the subject the oligomeric compound of any one of embodiments 1-36 and 75- 95; the oligomeric duplex of any one of embodiments 37 and 96-121; the antisense compound of embodiment 38; the modified oligonucleotide of any one of embodiments 39-46; or the pharmaceutical composition of any one of embodiments 47-49 and 122-124, thereby reducing inflammation in the lung of the subject.
- Embodiment 141 Embodiment 141.
- a method of reducing inflammation in the gastrointestinal tract of a subject in need thereof comprising administering to the subject the oligomeric compound of any one of embodiments 1-36 and 75-95; the oligomeric duplex of any one of embodiments 37 and 96-121; the antisense compound of embodiment 38; the modified oligonucleotide of any one of embodiments 39-46; or the pharmaceutical composition of any one of embodiments 47-49 and 122-124, thereby reducing inflammation of the gastrointestinal tract of the subject.
- the SPDEF nucleic acid has the sequence set forth in RefSeq or GENBANK Accession No. GENBANK Accession No. NM_012391.2 (SEQ ID NO: 1), the complement of GENBANK Accession No. NC_000006.12 truncated from nucleotides 34536001 to 34558000 (SEQ ID NO: 2), GENBANK Accession No. NM_001252294.1 (SEQ ID NO: 3), GENBANK Accession No. XM_005248988.3 (SEQ ID NO: 4), or GENBANK Accession No.
- the compound is an antisense compound or oligomeric compound. In certain embodiments, the compound is single -stranded.
- Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-2284.
- the compound is an antisense compound or oligomeric compound.
- the compound is single-stranded.
- the modified oligonucleotide consists of 10 to 30 linked nucleosides.
- Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 9 to 80 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-2284.
- the compound is an antisense compound or oligomeric compound.
- the compound is single-stranded.
- the modified oligonucleotide consists of 10 to 30 linked nucleosides.
- Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 80 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-2284.
- the compound is an antisense compound or oligomeric compound.
- the compound is single-stranded.
- the modified oligonucleotide consists of 10 to 30 linked nucleosides.
- Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 11 to 80 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-2284.
- the compound is an antisense compound or oligomeric compound.
- the compound is single-stranded.
- the modified oligonucleotide consists of 11 to 30 linked nucleosides.
- Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 12 to 80 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-2284.
- the compound is an antisense compound or oligomeric compound.
- the compound is single-stranded.
- the modified oligonucleotide consists of 12 to 30 linked nucleosides.
- Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 15-2284.
- the compound is an antisense compound or oligomeric compound.
- the compound is single-stranded in certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.
- Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence consisting of the nucleobase sequence of any one of SEQ ID NOs: 15-2284.
- the compound is an antisense compound or oligomeric compound.
- the compound is single-stranded.
- a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 3531-3546, 9377-93929801-9816, 9802-9817, or 17492-17507 of SEQ ID NO: 2.
- the modified oligonucleotide consists of 10 to 30 linked nucleosides.
- the modified oligonucleotide consists of 16 to 30 linked nucleosides.
- a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides wherein the modified oligonucleotide is complementary within nucleotides 3531-3546, 9377-9392 9801-9816, 9802-9817, or 17492-17507 of SEQ ID NO: 2.
- the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 to 30 linked nucleosides.
- a compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion of the nucleobase sequence of any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230.
- the modified oligonucleotide consists of 10 to 30 linked nucleosides.
- the modified oligonucleotide consists of 16 to 30 linked nucleosides.
- a compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230.
- the modified oligonucleotide consists of 16 to 30 linked nucleosides.
- a compound comprises a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence consisting of any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230.
- any of the foregoing modified oligonucleotides has at least one modified intemucleoside linkage, at least one modified sugar, and/or at least one modified nucleobase.
- At least one nucleoside of any of the foregoing modified oligonucleotides comprises a modified sugar.
- the modified sugar comprises a 2’-0-methoxyethyl group.
- the modified sugar is a bicyclic sugar, such as a 4’-CH(CH 3 )-0-2’ group, a 4’-CEh-0-2’ group, or a 4’-(CEh) 2 -0-2’group.
- At least one intemucleoside linkage of the modified oligonucleotide comprises a modified intemucleoside linkage, such as a phosphorothioate intemucleoside linkage.
- At least one nucleobase of any of the foregoing modified oligonucleotides is a modified nucleobase, such as 5-methylcytosine.
- any of the foregoing modified oligonucleotides has: a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
- the modified oligonucleotide consists of 16 to 80 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230.
- the modified oligonucleotide consists of 16 to 30 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides and has a nucleobase sequence consisting of the nucleobase sequence recited in any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230.
- a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 15-2284, wherein the modified oligonucleotide has: a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
- the modified oligonucleotide consists of 16 to 30 linked nucleosides.
- the modified oligonucleotide consists of 16 linked nucleosides.
- a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having anucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230, wherein the modified oligonucleotide has: a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
- the modified oligonucleotide consists of 16 to 30 linked nucleosides.
- the modified oligonucleotide consists of 16 linked nucleosides.
- a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having anucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 1129, 1444, or 761, wherein the modified oligonucleotide has: a gap segment consisting of ten linked 2’-deoxynucleosides; a 5’ wing segment consisting of three linked nucleosides; and a 3’ wing segment consisting of three linked nucleosides; wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each intemucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
- the modified oligonucleotide consists of 16 to 80 linked nucle
- a compound comprises or consists of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having anucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 1983 or 2230, wherein the modified oligonucleotide comprises: a gap segment consisting of nine linked 2’-deoxynucleosides; a 5’ wing segment consisting of two linked nucleosides; and a 3’ wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment; wherein each nucleoside of the 5’ wing segment comprises a cEt nucleoside; wherein the 3’ wing segment comprises a 2’-0-methoxyethyl nucleoside, a 2’-0-methoxyethyl nucleoside, a 2’-0-methoxyethyl nucleoside
- Certain embodiments provided herein relate to methods of inhibiting SPDEF expression, which can be useful for treating, preventing, or ameliorating a disease associated with SPDEF in a subject, by administration of a compound that targets a SPDEF nucleic acid.
- the compound can be a SPDEF specific inhibitor.
- the compound can be an antisense compound, oligomeric compound, or oligonucleotide targeted to a SPDEF nucleic acid.
- diseases associated with SPDEF treatable, preventable, and/or ameliorable with the compounds and methods provided herein include bronchitis, asthma, COPD, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, or sarcoidosis.
- bronchitis asthma, COPD, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, or sarcoidosis.
- methods comprise administering a compound comprising a SPDEF specific inhibitor to a subject.
- the subject has a disease associated with SPDEF.
- the subject has bronchitis, asthma, COPD, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, or sarcoidosis.
- the disease is asthma.
- the disease is IPF.
- the disease comprises inflammation.
- the disease comprises inflammation in a lung of the subject.
- the disease comprises inflammation in the gastrointestinal tract of the subject.
- the compound comprises an antisense compound targeted to a SPDEF nucleic acid.
- the compound comprises an oligonucleotide targeted to a SPDEF nucleic acid.
- the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-2284.
- the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 15-2284. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 15-2284. In certain embodiments, the compound comprises a modified oligonucleotide of 16 to 80 linked nucleosides in length and having a nucleobase sequence comprising any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230.
- the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230.
- the modified oligonucleotide can consist of 16 to 30 linked nucleosides.
- the compound is ION 833561, 833741, 833748, 936142, or 936158.
- the compound can be an antisense compound or oligomeric compound.
- administering the compound reduces mucus production.
- administering the compound reduces lung fibrosis.
- administering the compound improves lung function.
- methods of treating or ameliorating a disease associated with SPDEF comprise administering to the subject a compound comprising a SPDEF specific inhibitor, thereby treating or ameliorating the disease.
- the disease is bronchitis, asthma, COPD, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, or sarcoidosis.
- the disease is asthma.
- the disease is IPF.
- the disease comprises inflammation.
- the disease comprises inflammation in a lung of the subject.
- the disease comprises inflammation in the gastrointestinal tract of the subject.
- the compound comprises an antisense compound targeted to a SPDEF nucleic acid.
- the compound comprises an oligonucleotide targeted to a SPDEF nucleic acid.
- the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-2284.
- the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 15-2284. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 15-2284. In certain embodiments, the compound comprises a modified oligonucleotide of 16 to 80 linked nucleosides in length and having a nucleobase sequence comprising any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230.
- the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230.
- the modified oligonucleotide can consist of 16 to 30 linked nucleosides.
- the compound is ION 833561, 833741, 833748, 936142, or 936158.
- the compound can be an antisense compound or oligomeric compound.
- administering the compound reduces mucus production.
- administering the compound reduces lung fibrosis.
- administering the compound improves lung function.
- methods of inhibiting expression of SPDEF in a subject having, or at risk of having, a disease associated with SPDEF comprise administering to the subject a compound comprising a SPDEF specific inhibitor, thereby inhibiting expression of SPDEF in the subject.
- administering the compound inhibits expression of SPDEF in the lung.
- the subject has, or is at risk of having bronchitis, asthma, COPD, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, or sarcoidosis.
- the disease is asthma.
- the disease is IPF. In certain embodiments, the disease comprises inflammation. In certain embodiments, the disease comprises inflammation in a lung of the subject. In certain embodiments, the disease comprises inflammation in the gastrointestinal tract of the subject. In certain embodiments, the compound comprises an antisense compound targeted to a SPDEF nucleic acid. In certain embodiments, the compound comprises an oligonucleotide targeted to a SPDEF nucleic acid. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-2284.
- the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 15-2284. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 15-2284. In certain embodiments, the compound comprises a modified oligonucleotide of 16 to 80 linked nucleosides in length and having a nucleobase sequence comprising any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230.
- the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230.
- the modified oligonucleotide can consist of 16 to 30 linked nucleosides.
- the compound is ION 833561, 833741, 833748, 936142, or 936158.
- the compound can be single-stranded.
- the compound can be an antisense compound or oligomeric compound.
- the compound is administered to the subject parenterally.
- administering the compound reduces mucus production. In certain embodiments, administering the compound reduces lung fibrosis. In certain embodiments, administering the compound improves lung function. In certain embodiments, the subject is identified as having or at risk of having a disease associated with SPDEF.
- methods of inhibiting expression of SPDEF in a cell comprise contacting the cell with a compound comprising a SPDEF specific inhibitor, thereby inhibiting expression of SPDEF in the cell.
- the cell is a lung cell.
- the cell is in the lung of a subject who has, or is at risk of having bronchitis, asthma, COPD, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, or sarcoidosis.
- the cell is in the lung of a subject who has asthma.
- the cell is in the lung of a subject who has IPF.
- the disease comprises inflammation.
- the disease comprises inflammation in a lung of the subject.
- the disease comprises inflammation in the gastrointestinal tract of the subject.
- the compound comprises an antisense compound targeted to a SPDEF nucleic acid.
- the compound comprises an oligonucleotide targeted to a SPDEF nucleic acid.
- the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-2284.
- the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 15-2284. In certain embodiments, the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 15-2284. In certain embodiments, the compound comprises a modified oligonucleotide of 16 to 80 linked nucleosides in length and having a nucleobase sequence comprising any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230.
- the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230.
- the modified oligonucleotide can consist of 16 to 30 linked nucleosides.
- the compound is ION 833561, 833741, 833748, 936142, or 936158.
- the compound can be single-stranded.
- the compound can be an antisense compound or oligomeric compound.
- the disease is bronchitis, asthma, COPD, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, or sarcoidosis.
- the disease is asthma.
- the disease is IPF.
- the disease comprises inflammation.
- the disease comprises inflammation in a lung of the subject.
- the disease comprises inflammation in the gastrointestinal tract of the subject.
- the compound comprises an antisense compound targeted to a SPDEF nucleic acid. In certain embodiments, the compound comprises an oligonucleotide targeted to a SPDEF nucleic acid. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-2284. In certain embodiments, the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 15-2284.
- the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 15-2284. In certain embodiments, the compound comprises a modified oligonucleotide of 16 to 80 linked nucleosides in length and having a nucleobase sequence comprising any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230.
- the modified oligonucleotide can consist of 16 to 30 linked nucleosides.
- the compound is ION 833561, 833741, 833748, 936142, or 936158.
- the compound can be single-stranded.
- the compound can be an antisense compound or oligomeric compound. Certain embodiments are drawn to use of a compound comprising a SPDEF specific inhibitor for the manufacture or preparation of a medicament for treating a disease associated with SPDEF.
- the disease is bronchitis, asthma, COPD, pulmonary fibrosis, idiopathic pulmonary fibrosis (IPF), pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, or sarcoidosis.
- the disease is asthma.
- the disease is IPF.
- the disease comprises inflammation.
- the disease comprises inflammation in a lung of the subject.
- the disease comprises inflammation in the gastrointestinal tract of the subject.
- the compound comprises an antisense compound targeted to a SPDEF nucleic acid.
- the compound comprises an oligonucleotide targeted to a SPDEF nucleic acid.
- the compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15-2284.
- the compound comprises a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 15-2284.
- the compound comprises a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 15-2284. In certain embodiments, the compound comprises a modified oligonucleotide of 16 to 80 linked nucleosides in length and having a nucleobase sequence comprising any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230. In certain embodiments, the compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230.
- the modified oligonucleotide can consist of 16 to 30 linked nucleosides.
- the compound is ION 833561, 833741, 833748, 936142, or 936158.
- the compound can be single-stranded.
- the compound can be an antisense compound or oligomeric compound.
- the compound can be targeted to a SPDEF nucleic acid.
- the compound comprises or consists of a modified oligonucleotide, for example a modified oligonucleotide consisting of 8 to 80 linked nucleosides, 10 to 30 linked nucleosides, 12 to 30 linked nucleosides, or 16 linked nucleosides.
- the modified oligonucleotide is at least 80%, 85%, 90%, 95% or 100% complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1-5.
- the modified oligonucleotide comprises at least one modified intemucleoside linkage, at least one modified sugar and/or at least one modified nucleobase.
- the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage
- the modified sugar is a bicyclic sugar or a 2’-0-methoxyethyl
- the modified nucleobase is a 5-methylcytosine.
- the modified oligonucleotide comprises a gap segment consisting of linked 2’- deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5’ wing segment and the 3 ’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
- the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 15-2284, wherein the modified oligonucleotide comprises: a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
- the modified oligonucleotide consists of 16 to 30 linked nucleosides.
- the modified oligonucleotide consists of 16 linked nucleosides.
- the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 1129, 1444, 761, 1983, or 2230, wherein the modified oligonucleotide comprises: a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
- the modified oligonucleotide consists of 16 to 30 linked nucleosides.
- the modified oligonucleotide consists of 16 linked nucleosides.
- the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 1129, 1444, or 761, wherein the modified oligonucleotide comprises: a gap segment consisting of ten linked 2’-deoxynucleosides; a 5’ wing segment consisting of three linked nucleosides; and a 3’ wing segment consisting of three linked nucleosides; wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment; wherein each nucleoside of each wing segment comprises a cEt nucleoside; wherein each intemucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
- the modified oligonucleotide comprises: a gap segment consisting of
- the modified oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.
- the compound can comprise or consist of a modified oligonucleotide consisting of 16 to 80 linked nucleobases and having a nucleobase sequence comprising the nucleobase sequence recited in any one of SEQ ID NOs: 1983 or 2230, wherein the modified oligonucleotide comprises: a gap segment consisting of nine linked 2’-deoxynucleosides; a 5’ wing segment consisting of two linked nucleosides; and a 3’ wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment; wherein each nucleoside of the 5’ wing segment comprises a cEt nucleoside; wherein
- oligomeric compounds comprising oligonucleotides, which consist of linked nucleosides.
- Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
- Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified intemucleoside linkage.
- Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.
- modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
- modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more substituent groups none of which bridges two atoms of the furanosyl ring to form a bicyclic structure.
- Such non-bridging substituents may be at any position of the furanosyl, including but not limited to substituents at the 2’, 4’, and/or 5’ positions.
- one or more non-bridging substituent of non-bicyclic modified sugar moieties is branched.
- 2’- substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'- OCH3 (“OMe” or “O-methyl”), and 2'-0(CH 2 ) 2 0CH 3 (“MOE”).
- 2 ’-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-Ci-Cio alkoxy, O- C1-C10 substituted alkoxy, O-Ci-Cio alkyl, O-Ci-Cio substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S- alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, 0(CH 2 ) 2 SCH 3 , 0(CH 2 ) 2 0N(R m )(R n ) or
- these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
- Examples of 4 ’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et ak, WO 2015/106128.
- Examples of 5 ’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5-methyl (R or S), 5'- vinyl, and 5 ’-methoxy.
- non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et ak, WO 2008/101157 and Rajeev et ak,
- a 2 ’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 ’-substituent group selected from: F, NEE, N 3 , OCF 3, OCH 3 ,
- a 2 ’-substituted nucleoside non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 ’-substituent group selected from: F, OCF 3, OCH 3 ,
- a 2 ’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 ’-substituent group selected from: F, OCH 3 , and OCH 2 CH 2 OCH 3 .
- Certain modifed sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety.
- the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms.
- Examples of such 4’ to 2’ bridging sugar substituents include but are not limited to: 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -0-2' (“ENA”), 4'-CH 2 -S-2', 4'-(CH 2 ) 2 -0-2' (“ENA”), 4'-CH(CH 3 )-0-2' (referred to as “constrained ethyl” or “cEt”), 4’-CH 2 - O-CH2-2’, 4’-CH 2 -N(R)-2’, 4'-CH(CH 2 0CH 3 )-0-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et ak, U.S.
- such 4’ to 2’ bridges independently comprise from 1 to 4 linked groups independently selected from: -
- each R a and R b is, independently selected from: H, a protecting group, hydroxyl, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, heterocycle radical, substituted heterocycle radical, heteroary
- bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
- an UNA nucleoside (described herein) may be in the a-U configuration or in the b-D configuration.
- general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., LNA or cEt) are identified in exemplified embodiments herein, they are in the b-D configuration, unless otherwise specified.
- modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 ’-substituted and 4 ’-2’ bridged sugars).
- modified sugar moieties are sugar surrogates.
- the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
- such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
- certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'- position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5’ position.
- sugar surrogates comprise rings having other than 5 atoms.
- a sugar surrogate comprises a six-membered tetrahydropyran (“THP”).
- THP tetrahydropyran
- Such tetrahydropyrans may be further modified or substituted.
- Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see, e.g., Leumann, CJ. Bioorg. &Med. Chem. 2002, 10, 841-854), fluoro HNA:
- F-HNA see e.g. Swayze et al., U.S. 8,088,904; Swayze et al., U.S. 8,440,803; Swayze et al., U.S. 8,796,437; and Swayze et al., U.S.
- F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran
- nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of said modified THP nucleoside: Bx is a nucleobase moiety; T3 and T4 are each, independently, an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; qi, q2, q3, q4, qs, qe and q7 are each, independently, H, Ci-Ce alkyl, substituted C1-C6 alkyl
- modified THP nucleosides are provided wherein qi, q2, q3, q4, qs, qe and q 7 are each H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q 7 is other than H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q 7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is F and R2 is H, in certain embodiments, Ri is methoxy and R2 is H, and in certain embodiments, Ri is methoxyethoxy and R2 is H.
- sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
- nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et ah, Biochemistry, 2002, 41, 4503-4510 and
- morpholino means a sugar surrogate having the following structure: In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modifed morpholinos.”
- sugar surrogates comprise acyclic moieites.
- nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.
- modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.
- modified nucleobases are selected from: 5-substituted pyrimidines, 6- azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine,
- cytosine 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N- methyladenine, 2-propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-CoC-C13 ⁇ 4) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoa
- nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, l,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2- one (G-clamp).
- Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2- pyridone.
- Further nucleobases include those disclosed in Merigan et al., U.S.
- nucleosides of modified oligonucleotides may be linked together using any intemucleoside linkage.
- the two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphorus atom.
- Modified intemucleoside linkages compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
- intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non- phosphorous-containing intemucleoside linkages are well known to those skilled in the art.
- Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates.
- Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations.
- populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of the phosphorothioate intemucleoside linkages are stereorandom.
- modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nonetheless, as is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration.
- populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkages in a particular, independently selected stereochemical configuration.
- the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population.
- the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population.
- modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et ak, JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO 2017/015555.
- a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (rip) configuration.
- a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (/Zp) configuration.
- modified oligonucleotides comprising (/Zp) and/or (.S'p) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
- chiral intemucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
- Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research ; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.
- modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another.
- a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
- oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif.
- sugar motifs include but are not limited to any of the sugar modifications discussed herein.
- modified oligonucleotides comprise or consist of a region having a fully modified sugar motif.
- each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety.
- each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety.
- modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
- a fully modified oligonucleotide is a uniformly modified oligonucleotide.
- modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or “wings” and a central or internal region or “gap.”
- the three regions of a gapmer motif (the 5 ’-wing, the gap, and the 3 ’-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
- the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction).
- the sugar moieties within the gap are the same as one another.
- the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
- the sugar motifs of the two wings are the same as one another (symmetric gapmer).
- the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).
- the wings of a gapmer comprise 1-5 nucleosides.
- each nucleoside of each wing of a gapmer is a modified nucleoside.
- at least one nucleoside of each wing of a gapmer is a modified nucleoside.
- at least two nucleosides of each wing of a gapmer are modified nucleosides.
- at least three nucleosides of each wing of a gapmer are modified nucleosides.
- at least four nucleosides of each wing of a gapmer are modified nucleosides.
- the gap of a gapmer comprises 7-12 nucleosides.
- each nucleoside of the gap of a gapmer is an unmodified 2’-deoxynucleoside.
- at least one nucleoside of the gap of a gapmer is a modified nucleoside.
- the gapmer is a deoxy gapmer.
- the nucleosides on the gap side of each wing/gap junction are unmodified 2’-deoxynucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides.
- each nucleoside of the gap is an unmodified 2’-deoxynucleoside.
- each nucleoside of each wing of a gapmer is a modified nucleoside.
- modified oligonucleotides comprise or consist of a region having a fully modified sugar motif.
- each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety.
- each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety.
- modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
- a fully modified oligonucleotide is a uniformly modified oligonucleotide.
- each nucleoside of a uniformly modified comprises the same 2 ’-modification.
- the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5’-wing] - [# of nucleosides in the gap] - [# of nucleosides in the 3’- wing].
- a 3-10-3 gapmer consists of 3 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where such nomenclature is followed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise unmodified deoxynucleosides sugars.
- a 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5’-wing, 10 linked deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3 ’-wing.
- a 2-12-2 cEt gapmer consists of 2 linked cEt nucleosides in the 5 ’-wing, 12 linked deoxynucleosides in the gap, and 2 linked cEt nucleosides in the 3’- wing.
- modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers. In certain embodiments, modified oligonucleotides are 2-12-2 BNA gapmers. In certain embodiments, modified oligonucleotides are 2-12-2 cEt gapmers. In certain embodiments, modified oligonucleotides are 2-12-2 LNA gapmers. Antisense RNAi Oligonucleotides
- the sugar moiety of at least one nucleoside of an antisense RNAi oligonucleotide is a modified sugar moiety.
- At least one nucleoside of the antisense RNAi oligonucleotide comprises a 2’-OMe modified sugar moiety.
- at least 2 nucleosides comprise 2’- OMe modified sugar moieties.
- at least 5 nucleosides comprise 2’-OMe modified sugar moieties.
- at least 8 nucleosides comprise 2’-OMe modified sugar moieties.
- at least 10 nucleosides comprise 2’-OMe modified sugar moieties.
- at least 12 nucleosides comprise 2’-OMe modified sugar moieties.
- At least 14 nucleosides comprise 2’-OMe modified sugar moieties. In certain embodiments, at least 15 nucleosides comprise 2’-OMe modified sugar moieties. In certain embodiments, at least 17 nucleosides comprise 2’-OMe modified sugar moieties. In certain such embodiments, at least 18 nucleosides comprise 2’-OMe modified sugar moieties. In certain such embodiments, at least 20 nucleosides comprise 2’-OMe modified sugar moieties. In certain embodiments, at least 21 nucleosides comprise 2’-OMe modified sugar moieties. In certain such embodiments, the remainder of the nucleosides are 2’-F modified.
- At least one nucleoside of the antisense RNAi oligonucleotide comprises a 2’-F modified sugar moiety.
- at least 2 nucleosides comprise 2’-F modified sugar moieties.
- at least 3 nucleosides comprise 2’-F modified sugar moieties.
- at least 4 nucleosides comprise 2’-F modified sugar moieties.
- one, but not more than one nucleoside comprises a 2’-F modified sugar.
- 1 or 2 nucleosides comprise 2’-F modified sugar moieties.
- 1-3 nucleosides comprise 2’-F modified sugar moieties.
- nucleosides comprise 2’-F modified sugar moieties.
- antisense RNAi oligonucleotides have a block of 2-4 contiguous 2’-F modified nucleosides.
- 4 nucleosides of an antisense RNAi oligonucleotide are 2’-F modified nucleosides and 3 of those 2’-F modified nucleosides are contiguous. In certain such embodiments, the remainder of the nucleosides are 2’-OMe modified.
- At least one nucleoside of the antisense RNAi oligonucleotide comprises a 2’-OMe modified sugar moiety and at least one nucleoside comprises a 2’-F modified sugar moiety.
- at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides comprises a 2’-OMe modified sugar moiety and at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides comprises a 2’-F modified sugar moiety.
- the antisense RNAi oligonucleotide comprises a sugar motif of fyf or yfy, wherein each “f ’ represents a 2’-F modified sugar moiety and each “y” represents a 2’-OMe modified sugar moiety.
- the antisense RNAi oligonucleotide has a sugar motif of yfyfyfyfyfyfyfyfyfyfyfyfyfyyyyyyyyyyy, wherein each “f” represents a 2’-F modified sugar moiety and each “y” represents a 2’-OMe modified sugar moiety.
- the sugar moiety of at least one nucleoside of a sense RNAi oligonucleotides is a modified sugar moiety.
- At least one nucleoside of the sense RNAi oligonucleotide comprises a 2’-OMe modified sugar moiety.
- at least 2 nucleosides comprise 2’-OMe modified sugar moieties.
- at least 5 nucleosides comprise 2’-OMe modified sugar moieties.
- at least 8 nucleosides comprise 2’-OMe modified sugar moieties.
- at least 10 nucleosides comprise 2’-OMe modified sugar moieties.
- at least 12 nucleosides comprise 2’-OMe modified sugar moieties.
- at least 14 nucleosides comprise 2’-OMe modified sugar moieties.
- nucleosides comprise 2’-OMe modified sugar moieties. In certain embodiments, at least 17 nucleosides comprise 2’- OMe modified sugar moieties. In certain such embodiments, at least 18 nucleosides comprise 2’-OMe modified sugar moieties. In certain such embodiments, at least 20 nucleosides comprise 2’-OMe modified sugar moieties. In certain such embodiments, at least 21 nucleosides comprise 2’-OMe modified sugar moieties.
- At least one nucleoside of the sense RNAi oligonucleotide comprises a 2’-F modified sugar moiety.
- at least 2 nucleosides comprise 2’-F modified sugar moieties.
- at least 3 nucleosides comprise 2’-F modified sugar moieties.
- at least 4 nucleosides comprise 2’-F modified sugar moieties.
- one, but not more than nucleoside comprises a 2’-F modified sugar moiety.
- 1 or 2 nucleosides comprise 2’-F modified sugar moieties.
- 1-3 nucleosides comprise 2’-F modified sugar moieties.
- nucleosides comprise 2’-F modified sugar moieties.
- sense RNAi oligonucleotides have a block of 2-4 contiguous 2’-F modified nucleosides.
- 4 nucleosides of a sense RNAi oligonucleotide are 2’-F modified nucleosides and 3 of those 2’-F modified nucleosides are contiguous. In certain such embodiments the remainder of the nucleosides are 2’OMe modified.
- At least one nucleoside of the sense RNAi oligonucleotide comprises a 2’- OMe modified sugar moiety and at least one nucleoside comprises a 2’-F modified sugar moiety.
- at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides comprises a 2’-OMe modified sugar moiety and at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides comprises a 2’-F modified sugar moiety.
- the sense RNAi oligonucleotide comprises a sugar motif of fyf or yfy, wherein each “f ’ represents a 2’-F modified sugar moiety and each “y” represents a 2’-OMe modified sugar moiety.
- the sense RNAi oligonucleotide has a sugar motif of fyfyfyfyfyfyfyfyfyfyfyfyfyfyfyf, wherein each “f ’ represents a 2’-F modified sugar moiety and each “y” represents a 2’-OMe modified sugar moiety.
- oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif.
- each nucleobase is modified.
- none of the nucleobases are modified.
- each purine or each pyrimidine is modified.
- each adenine is modified.
- each guanine is modified.
- each thymine is modified.
- each uracil is modified.
- each cytosine is modified.
- some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methyl cytosines.
- all of the cytosine nucleobases are 5 -methyl cytosines and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.
- modified oligonucleotides comprise a block of modified nucleobases.
- the block is at the 3 ’-end of the oligonucleotide.
- the block is within 3 nucleosides of the 3 ’-end of the oligonucleotide.
- the block is at the 5’- end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5 ’-end of the oligonucleotide.
- oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase.
- one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif.
- the sugar moiety of said nucleoside is a 2’-deoxyribosyl moiety.
- the modified nucleobase is selected from: a 2-thiopyrimidine and a 5-propynepyrimidine.
- one nucleoside of an antisense RNAi oligonucleotide is a UNA.
- one nucleoside of an antisense RNAi oligonucleotide is a GNA.
- 1-4 nucleosides of an antisense RNAi oligonucleotide is/are DNA.
- the 1-4 DNA nucleosides are at one or both ends of the antisense RNAi oligonucleotide.
- one nucleoside of a sense RNAi oligonucleotide is a UNA. In certain embodiments, one nucleoside of a sense RNAi oligonucleotide is a GNA. In certain embodiments, 1-4 nucleosides of a sense RNAi oligonucleotide is/are DNA. In certain such embodiments, the 1-4 DNA nucleosides are at one or both ends of the sense RNAi oligonucleotide.
- oligonucleotides comprise modified and/or unmodified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif.
- each intemucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate intemucleoside linkage and phosphodiester intemucleoside linkage.
- each phosphorothioate intemucleoside linkage is independently selected from a stereorandom phosphorothioate a (.S'p) phosphorothioate, and a (rip) phosphorothioate .
- the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified.
- some or all of the intemucleoside linkages in the wings are unmodified phosphodiester intemucleoside linkages.
- the terminal intemucleoside linkages are modified.
- the sugar motif of a modified oligonucleotide is a gapmer
- the intemucleoside linkage motif comprises at least one phosphodiester intemucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal intemucleoside linkage, and the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages.
- all of the phosphorothioate linkages are stereorandom.
- all of the phosphorothioate linkages in the wings are (rip) phosphorothioates
- the gap comprises at least one rip, rip, rip motif.
- populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such intemucleoside linkage motifs.
- At least one linkage of the antisense RNAi oligonucleotide is a modified linkage.
- the 5 ’-most linkage i.e., linking the first nucleoside from the 5 ’-end to the second nucleoside from the 5 ’-end
- the two 5 ’-most linkages are modified.
- the first one or 2 linkages from the 3 ’-end are modified.
- the modified linkage is a phosphorothioate linkage.
- the remaining linkages are all unmodified phosphodiester linkages.
- antisense RNAi oligonucleotides have an intemucleoside linkage motif of ssooooooooooooooooooss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphate intemucleoside linkage.
- at least one linkage of the antisense RNAi oligonucleotide is an inverted linkage.
- At least one linkage of the sense RNAi oligonucleotides is a modified linkage.
- the 5 ’-most linkage i.e., linking the first nucleoside from the 5 ’-end to the second nucleoside from the 5 ’-end
- the two 5 ’-most linkages are modified.
- the first one or 2 linkages from the 3 ’-end are modified.
- the modified linkage is a phosphorothioate linkage.
- the remaining linkages are all unmodified phosphodiester linkages.
- sense RNAi oligonucleotides have an intemucleoside linkage motif of ssooooooooooooooooss, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphate intemucleoside linkage.
- at least one linkage of the sense RNAi oligonucleotides is an inverted linkage.
- oligonucleotide it is possible to increase or decrease the length of an oligonucleotide without eliminating activity.
- Woolf et al. Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992
- a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
- Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches.
- target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
- oligonucleotides can have any of a variety of ranges of lengths.
- oligonucleotides consist of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
- X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,
- oligonucleotides consist of 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15,
- antisense RNAi oligonucleotides consist of 17-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 17-25 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 17-23 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 17-21 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 18-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 20-30 linked nucleosides.
- antisense RNAi oligonucleotides consist of 21-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 23-30 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 18-25 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 20-22 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 21-23 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 23-24 linked nucleosides.
- antisense RNAi oligonucleotides consist of 20 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 21 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 22 linked nucleosides. In certain embodiments, antisense RNAi oligonucleotides consist of 23 linked nucleosides.
- sense RNAi oligonucleotides consist of 17-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 17-25 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 17-23 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 17-21 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 18-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 20-30 linked nucleosides.
- sense RNAi oligonucleotides consist of 21-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 23-30 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 18-25 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 20-22 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 21-23 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 23-24 linked nucleosides.
- sense RNAi oligonucleotides consist of 20 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 21 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 22 linked nucleosides. In certain embodiments, sense RNAi oligonucleotides consist of 23 linked nucleosides.
- modified oligonucleotides are incorporated into a modified oligonucleotide.
- modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
- the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif.
- sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
- Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for b-D ribosyl sugar moieties, and all of the phosphorothioate intemucleoside linkages are stereorandom.
- the modified oligonucleotides of a chirally enriched population are enriched for both b-D ribosyl sugar moieties and at least one, particular phosphorothioate intemucleoside linkage in a particular stereochemical configuration.
- oligonucleotides are further described by their nucleobase sequence.
- oligonucleotides have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
- a region of an oligonucleotide has a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid, such as a target nucleic acid.
- the nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or nucleic acid, such as a target nucleic acid.
- oligomeric compounds which consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and/or terminal groups.
- Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups.
- conjugate groups or terminal groups are attached at the 3’ and/or 5 ’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5 ’-end of oligonucleotides.
- terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
- RNAi compounds comprise an antisense RNAi oligonucleotide and optionally a sense RNAi oligonucleotide. RNAi compounds may also comprise terminal groups and/or conjugate groups which may be attached to the antisense RNAi oligonucleotide or the sense RNAi oligonucleotide (when present).
- RNAi compounds comprising an antisense RNAi oligonucleotide and a sense RNAi oligonucleotide form a duplex, because the sense RNAi oligonucleotide comprises an antisense-hybridizing region that is complementary to the antisense RNAi oligonucleotide.
- each nucleobase of the antisense RNAi oligonucleotide and the sense RNAi oligonucleotide are complementary to one another.
- the two RNAi oligonucleotides have at least one mismatch relative to one another.
- the antisense hybridizing region constitutes the entire length of the sense RNAi oligonucleotide and the antisense RNAi oligonucleotide.
- one or both of the antisense RNAi oligonucleotide and the sense RNAi oligonucleotide comprise additional nucleosides at one or both ends that do not hybridize (overhanging nucleosides).
- overhanging nucleosides are DNA.
- overhanging nucleosides are linked to each other (where there is more than one) and to the first non-overhanging nucleoside with phosphorothioate linkages.
- oligonucleotides are covalently attached to one or more conjugate groups.
- conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
- conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
- Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg.
- athioether e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl.
- a phospholipid e.g., di-hexadecyl-rac -glycerol or triethyl-ammonium l,2-di-0-hexadecyl-rac-glycero-3- H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res.,
- Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
- a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (.V)-(+)-pranoprofcn carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
- an active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (.V)-(+)-pranoprofc
- Conjugate moieties are attached to oligonucleotides through conjugate linkers.
- the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond).
- the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
- a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.
- conjugate linkers are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein.
- a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
- bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
- a conjugate linker comprises pyrrolidine.
- conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
- ADO 8-amino-3,6-dioxaoctanoic acid
- SMCC succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1-carboxylate
- AHEX or AHA 6-aminohexanoic acid
- conjugate linkers include but are not limited to substituted or unsubstituted Ci- Cio alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
- conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif.
- linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
- a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N-benzoyl-5-methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
- linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.
- an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide.
- the total number of contiguous linked nucleosides in such an oligomeric compound is more than 30.
- an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30.
- conjugate linkers comprise no more than 10 linker-nucleosides.
- conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.
- a conjugate group it is desirable for a conjugate group to be cleaved from the oligonucleotide.
- oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide.
- certain conjugate linkers may comprise one or more cleavable moieties.
- a cleavable moiety is a cleavable bond.
- a cleavable moiety is a group of atoms comprising at least one cleavable bond.
- a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
- a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome.
- a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
- a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.
- a cleavable moiety comprises or consists of one or more linker-nucleosides.
- the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds.
- such cleavable bonds are unmodified phosphodiester bonds.
- a cleavable moiety is 2'- deoxynucleoside that is attached to either the 3' or 5 '-terminal nucleoside of an oligonucleotide by a phosphate intemucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage.
- the cleavable moiety is 2'-deoxyadenosine.
- oligomeric compounds comprise one or more terminal groups.
- oligomeric compounds comprise a stabilized 5’-phophate.
- Stabilized 5 ’-phosphates include, but are not limited to 5’-phosphanates, including, but not limited to 5’-vinylphosphonates.
- terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides.
- terminal groups comprise one or more 2’-linked nucleosides. In certain such embodiments, the 2 ’-linked nucleoside is an abasic nucleoside.
- oligomeric compounds comprise one or more terminal groups.
- modified oligonucleotides comprise a phosphorus-containing group at the 5 ’-end of the modified oligonucleotide.
- the phosphorus-containing group is at the 5 ’-end of the antisense RNAi oligonucleotide and/or the sense RNAi oligonucleotide.
- the terminal group is a phosphate stabilized phosphate group.
- the 5 ’-end phosphorus-containing group can be 5 ’-end phosphate (5’-P), 5 ’-end phosphorothioate (5 ’-PS), 5 ’-end phosphorodithioate (5’-PS 2 ), 5 ’-end vinylphosphonate (5 ’-VP), 5 ’-end methylphosphonate (MePhos) or 5’-deoxy-5’-C-malonyl.
- the 5 ⁇ R can be either 5 ’-E-VP isomer (i.e., trans- vinylphosphonate), 5’-Z-VP isomer (i.e., cis-vinylphosphonate), or mixtures thereof.
- 5 ’-E-VP isomer i.e., trans- vinylphosphonate
- 5’-Z-VP isomer i.e., cis-vinylphosphonate
- phosphate group can be attached to any modified oligonucleotide, it has particularly been shown that attachment of such a group to an antisense RNAi oligonucleotide improves activity of certain RNAi agents.
- the phosphate stabilizing group is 5 ’-cyclopropyl phosphonate. See e.g., WO/2018/027106.
- terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2’-linked nucleosides. In certain such embodiments, the 2 ’-linked nucleoside is an abasic nucleoside.
- RNAi agents can be described by motif or by specific features.
- RNAi agents described herein comprise:
- RNAi oligonucleotide having: (i) a length of 23 nucleotides
- RNAi agents described herein comprise:
- RNAi duplex includes a two nucleotide overhang at the 3 ’end of the antisense RNAi oligonucleotide, and a blunt end at the 5’-end of the antisense RNAi oligonucleotide.
- RNAi agents described herein comprise:
- RNAi duplex has a two nucleotide overhang at the 3 ’end of the antisense RNAi oligonucleotide, and a blunt end at the 5 ’-end of the antisense RNAi oligonucleotide.
- RNAi agents described herein comprise:
- RNAi duplex has a two nucleotide overhang at the 3 ’end of the antisense RNAi oligonucleotide, and a blunt end at the 5 ’-end of the antisense RNAi oligonucleotide.
- RNAi agents described herein comprise:
- RNAi duplex has a two nucleotide overhang at the 3 ’end of the antisense RNAi oligonucleotide, and a blunt end at the 5 ’-end of the antisense RNAi oligonucleotide.
- RNAi agents described herein comprise:
- RNAi duplex has a two nucleotide overhang at the 3 ’end of the antisense RNAi oligonucleotide, and a blunt end at the 5 ’-end of the antisense RNAi oligonucleotide.
- RNAi agents described herein comprise:
- RNAi duplex includes a two nucleotide overhang at the 3 ’end of the antisense
- RNAi oligonucleotide and a blunt end at the 5’-end of the antisense RNAi oligonucleotide.
- RNAi agents described herein comprise:
- RNAi duplex includes a two nucleotide overhang at the 3 ’end of the antisense RNAi oligonucleotide, and a blunt end at the 5’-end of the antisense RNAi oligonucleotide.
- RNAi agents described herein comprise:
- RNAi duplex includes a two nucleotide overhang at the 3 ’end of the antisense RNAi oligonucleotide, and a blunt end at the 5’-end of the antisense RNAi oligonucleotide.
- RNAi agents described herein comprise:
- RNAi duplex includes a two nucleotide overhang at the 3 ’end of the antisense
- RNAi oligonucleotide and a blunt end at the 5’-end of the antisense RNAi oligonucleotide.
- RNAi agents described herein comprise:
- RNAi oligonucleotide having: (i) a length of 21 nucleotides
- RNAi agents described herein comprise:
- RNAi agents described herein comprise:
- RNAi agents described herein comprise:
- the conjugate at the 3 ’-end of the sense RNAi oligonucleotide may comprise a targeting moiety.
- the targeting moiety targets a neurotransmitter receptor.
- the cell targeting moiety targets a neurotransmitter transporter.
- the cell targeting moiety targets a GABA transporter. See e.g., WO 2011/131693, WO 2014/064257.
- the RNAi agent comprises a 21 nucleotide sense RNAi oligonucleotide and a 23 nucleotide antisense RNAi oligonucleotide, wherein the sense RNAi oligonucleotide contains at least one motif of three contiguous 2’-F modified nucleosides at positions 9, 10, 11 from the 5 ’-end; the antisense RNAi oligonucleotide contains at least one motif of three 2 ’-O-methyl modifications on three consecutive nucleotides at positions 11, 12, 13 from the 5’ end, wherein one end of the RNAi agent is blunt, while the other end comprises a 2 nucleotide overhang.
- the 2 nucleotide overhang is at the 3 ’-end of the antisense RNAi oligonucleotide.
- the 2 nucleotide overhang is at the 3 ’-end of the antisense RNAi oligonucleotide
- the RNAi agent additionally has two phosphorothioate intemucleoside linkages between the terminal three nucleotides at both the 5 ’-end of the sense RNAi oligonucleotide and at the 5 ’-end of the antisense RNAi oligonucleotide.
- every nucleotide in the sense RNAi oligonucleotide and the antisense RNAi oligonucleotide of the RNAi agent is a modified nucleotide.
- each nucleotide is independently modified with a 2’-0-methyl or 3’-fluoro, e.g. in an alternating motif.
- the RNAi agent comprises a conjugate.
- every nucleotide in the sense RNAi oligonucleotide and antisense RNAi oligonucleotide of the RNAi agent may be modified.
- Each nucleotide may be modified with the same or different modification, which can include one or more alteration of one or both of the non-linking phosphate oxygens; alteration of a constituent of the ribose sugar, e.g., of the 2’ hydroxyl on the ribose sugar; wholesale replacement of the phosphate moiety with “dephospho” linkers; modification or replacement of a naturally occurring base; and replacement or modification of the ribose-phosphate backbone.
- each nucleoside of the sense RNAi oligonucleotide and antisense RNAi oligonucleotide is independently modified with LNA, cEt, UNA, HNA, CeNA, 2’-MOE, 2’-OMe, 2’-0-allyl, 2’-C-allyl, 2’-deoxy, 2’-hydroxyl, or 2’-fluoro.
- the RNAi agent can contain more than one modification.
- each nucleoside of the sense RNAi oligonucleotide and antisense RNAi oligonucleotide is independently modified with 2’-0-methyl or 2’-F. In certain embodiments, the modification is a 2’- NMA modification.
- alternating motif refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of one RNAi oligonucleotide.
- the alternating nucleotide may refer to one per every other nucleotide or one per every three nucleotides, or a similar pattern.
- A, B and C each represent one type of modification to the nucleotide, the alternating motif can be "ABABABABABAB ... ,” “AABBAABBAABB ... ,” “AABAABAABAAB ... ,” “AAABAAABAAAB ... ,” “AAABBBAAABBB ... ,” or “ABCABCABCABC ... ,” etc.
- the type of modifications contained in the alternating motif may be the same or different.
- the alternating pattern i.e., modifications on every other nucleotide
- each of the sense RNAi oligonucleotide or antisense RNAi oligonucleotide can be selected from several possibilities of modifications within the alternating motif such as "ABABAB ... ", "ACACAC ... " "BDBDBD ... " or "CDCDCD ... ,” etc.
- the modification pattern for the alternating motif on the sense RNAi oligonucleotide relative to the modification pattern for the alternating motif on the antisense RNAi oligonucleotide is shifted.
- the shift may be such that the group of modified nucleotides of the sense RNAi oligonucleotide corresponds to a group of differently modified nucleotides of the antisense RNAi oligonucleotide and vice versa.
- the sense RNAi oligonucleotide when paired with the antisense RNAi oligonucleotide in the RNAi duplex the alternating motif in the sense RNAi oligonucleotide may start with "ABABAB" from 5' -3' of the RNAi oligonucleotide and the alternating motif in the antisense RNAi oligonucleotide may start with "BABABA" from 5' -3 'of the RNAi oligonucleotide within the duplex region.
- the alternating motif in the sense RNAi oligonucleotide may start with "AABBAABB” from 5'-3' of the RNAi oligonucleotide and the alternating motif in the antisense RNAi oligonucleotide may start with "BBAABBAA” from 5' -3' of the RNAi oligonucleotide within the duplex region, so that there is a complete or partial shift of the modification 10 patterns between the sense RNAi oligonucleotide and the antisense RNAi oligonucleotide .
- the RNAi agent comprising the pattern of the alternating motif of 2’-0- methyl modification and 2’-F modification on the sense RNAi oligonucleotide initially has a shift relative to the pattern of the alternating motif of 2’-0-methyl modification and 2’-F modification on the antisense RNAi oligonucleotide initially, i.e., the 2’-0-methyl modified nucleotide on the sense RNAi oligonucleotide base pairs with a 2’-F modified nucleotides on the antisense RNAi oligonucleotide and vice versa.
- the 1 position of the sense RNAi oligonucleotide may start with the 2’-F modification
- the 1 position of the antisense RNAi oligonucleotide may start with a 2’ -O-methyl modification.
- RNAi oligonucleotide and/or antisense RNAi oligonucleotide interrupts the initial modification pattern present in the sense RNAi oligonucleotide and/or antisense RNAi oligonucleotide.
- This interruption of the modification pattern of the sense and/or antisense RNAi oligonucleotide by introducing one or more motifs of three identical modifications on three consecutive nucleotides to the sense and/or antisense RNAi oligonucleotide surprisingly enhances the gene silencing activity to the target gene.
- the modification of the nucleotide next to the motif is a different modification than the modification of the motif.
- the portion of the sequence containing the motif is " ... NaYYYNb ⁇ ⁇ ⁇ ,” where "Y” represents the modification of the motif of three identical modifications on three consecutive nucleotide, and "Na” and “Nb” represent a modification to the nucleotide next to the motif "YYY” that is different than the modification of Y, and where Na and Nb can be the same or different modifications.
- Na and/or Nb may be present or absent when there is a wing modification present.
- the sense RNAi oligonucleotide may be represented by formula (I):
- XXX, YYY and ZZZ each independently represent modified nucleosides where each X nucleoside has the same modification; each Y nucleoside has the same modification; and each Z nucleoside has the same modification.
- each Y comprises a 2’-F modification.
- the N a and N b comprise modifications of alternating patterns.
- the YYY motif occurs at or near the cleavage site of the target nucleic acid.
- the YYY motif can occur at or near the vicinity of the cleavage site (e.g., can occur at positions 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11, 12; or 11, 12, 13) of the sense RNAi oligonucleotide , the count starting from the 1 st nucleotide from the 5 ’-end; or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5’- end.
- the antisense RNAi oligonucleotide of the RNAi may be represented by the formula:
- each X’X’X’, Y’Y’Y’ and Z’Z’Z’ each independently represent modified nucleosides where each X’ nucleoside has the same modification; each Y’ nucleoside has the same modification; and each Z’ nucleoside has the same modification.
- each Y’ comprises a 2’-F modification.
- each Y’ comprises a 2’-OMe modification.
- the N a ’ and/or N b ’ comprise modifications of alternating patterns.
- the Y’Y’Y’ motif occurs at or near the cleavage site of the target nucleic acid.
- the Y’Y’Y’ motif can occur at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense RNAi oligonucleotide , with the count starting from the 1 st nucleotide from the 5 ’-end; or, optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5 ’-end.
- the Y’Y’Y’ motif occurs at positions 11, 12, 13.
- k is 1 and 1 is 0, or k is 0 and 1 is 1, or both k and 1 are 1.
- the antisense RNAi oligonucleotide can therefore be represented by the following formulas:
- N b represents 0-10, 0-7, 0- 5, 0-4, 0-2, or 0 linked nucleosides.
- Each N a ’ independently represents 2-20, 2-15, or 2-10 linked nucleosides.
- N b represents 0-10, 0-7, 0- 5, 0-4, 0-2, or 0 linked nucleosides.
- Each N a ’ independently represents 2-20, 2-15, or 2-10 linked nucleosides.
- N b represents 0-10, 0-7, 0- 5, 0-4, 0-2, or 0 linked nucleosides.
- Each N a ’ independently represents 2-20, 2-15, or 2-10 linked nucleosides.
- N b ’ is 0, 1, 2, 3, 4, 5, or 6.
- k is 0 and 1 is 0 and the antisense RNAi oligonucleotide may be represented by the formula:
- each N a independently represents 2-20, 2-15, or 2-10 linked nucleosides.
- Each X’, Y’, and Z’ may be the same or different from each other.
- Each nucleotide of the sense RNAi oligonucleotide and antisense RNAi oligonucleotide may be independently modified with LNA, UNA, cEt, HNA, CeNA, 2’-methoxyethyl, 2 ’-O-methyl, 2’-0-allyl, 2’-C- allyl, 2’-hydroxyl, or 2’-fluoro.
- each nucleotide of the sense RNAi oligonucleotide and antisense RNAi oligonucleotide is independently modified with, 2’-0-methyl or 2’-fluoro.
- Each X, Y, Z, X’, Y’, and Z’ in particular, may represent a 2’-0-methyl modification or 2’-fluoro modification. In certain embodiments, the modification is a 2’ - NMA modification.
- the sense RNAi oligonucleotide of the RNAi agent may contain U ⁇ motif occurring at 9, 10, and 11 positions of the RNAi oligonucleotide when the duplex region is 21 nucleotides, the count starting from the 1 st nucleotide from the 5 ’-end, or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5 ’-end; and Y represents 2’-F modification.
- the sense RNAi oligonucleotide may additionally contain XXX motif or ZZZ motifs as wing modifications at the opposite end of the duplex region; and XXX and ZZZ each independently represents a 2’-0-methyl modification or 2’-fluoro modification.
- the antisense RNAi oligonucleotide may contain Y’Y’Y’ motif occurring at positions 11, 12, 13 of the RNAi oligonucleotide , the count starting from the 1 st nucleotide from the 5 ’-end, or optionally, the count starting at the 1 st paired nucleotide within the duplex region, from the 5 ’-end; and Y’ represents 2’-0-methyl modification.
- the antisense RNAi oligonucleotide may additionally contain X’X’X’ motif or Z’Z’Z’ motif as wing modifications at the opposite end of the duplex region; and X’X’X’ or Z’Z’Z’ each independently represents a 2’-0-methyl modification or 2’-fluoro modification.
- RNAi oligonucleotide represented by any one of the above formulas la, lb, Ic, and Id forms a duplex with an antisense RNAi oligonucleotide being represented by any one of the formulas Ila, lib, He, and lid, respectively.
- RNAi agents described herein may comprise a sense RNAi oligonucleotide and an antisense RNAi oligonucleotide, each RNAi oligonucleotide having 14 to 30 nucleotides, the RNAi duplex represented by formula (III):
- XXX, YYY, X’X’X’, Y’Y’Y’, and Z’Z’Z’ each independently represent one motif of three identical modifications on three consecutive nucleotides.
- i is 0 and j is 0; or i is 1 and j is 0; or i is 0 and j is 1 ; or both i and j are 0; or both i and j are 1.
- k is 0 and 1 is 0; or k is 1 and 1 is 0, or k is 0 and 1 is 1; or both k and 1 are 0; or both k and 1 are 1.
- RNAi duplex exemplary combinations of the sense RNAi oligonucleotide and antisense RNAi oligonucleotide forming a RNAi duplex include the formulas below:
- each N a independently represents 2-20, 2-15, or 2-10 linked nucleosides.
- each N b independently represents 1-10, 1-7, 1-5, or 1-4 linked nucleosides.
- Each N a independently represents 2-20, 2-15, or 2-10 linked nucleosides.
- each N b , N b ’ independently represents 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides.
- Each N a independently represents 2-20, 2-15, or 2-10 linked nucleosides.
- each N b , N b ’ independently represents 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides.
- Each N a , N a ’ independently 2-20, 2-15, or 2-10 linked nucleosides.
- Each N a , N a ’, N b , N b ’ independently comprises modifications of alternating pattern.
- Each of X, Y, and Z in formulas III, Ilia, Illb, IIIc, and Hid may be the same or different from each other.
- RNAi agent When the RNAi agent is represented by formula III, Ilia, Illb, IIIc, and/or Hid, at least one of the Y nucleotides may form a base pair with one of the Y’ nucleotides. Alternatively, at least two of the Y nucleotides may form base pairs with the corresponding Y’ nucleotides; or all three of the Y nucleotides may form base pairs with the corresponding Y’ nucleotides.
- RNAi agent When the RNAi agent is represented by formula Illb or Hid, at least one of the Z nucleotides may form a base pair with one of the Z’ nucleotides. Alternatively, at least two of the Z nucleotides may form base pairs with the corresponding Z’ nucleotides; or all three of the Z nucleotides may form base pairs with the corresponding Z’ nucleotides.
- RNAi agent When the RNAi agent is represented by formula IIIc or Hid, at least one of the X nucleotides may form a base pair with one of the X’ nucleotides. Alternatively, at least two of the X nucleotides may form base pairs with the corresponding X’ nucleotides; or all three of the X nucleotides may form base pairs with the corresponding X’ nucleotides.
- the modification of the Y nucleotide is different than the modification on the Y’ nucleotide
- the modification on the Z nucleotide is different than the modification on the Z’ nucleotide
- the modification on the X nucleotide is different than the modification on the X’ nucleotide.
- the N a modifications are 2’-0-methyl or 2’-fluoro modifications.
- the N a modifications are 2’-0-methyl or 2’-fluoro modifications and n p ’>0 and at least one n p ’ is linked to a neighboring nucleotide via phosphorothioate linkage.
- the N a modifications are 2’-0-methyl or 2’-fluoro modifications, n p ’>0 and at least one n p ’ is linked to a neighboring nucleotide via phosphorothioate linkage, and the sense RNAi oligonucleotide is conjugated to one or more cell targeting group attached through a bivalent or trivalent branched linker.
- the N a modifications are 2’-0-methyl or 2’-fluoro modifications, n p ’>0 and at least one n p ’ is linked to a neighboring nucleotide via phosphorothioate linkage, the sense RNAi oligonucleotide comprises at least one phosphorothioate linkage and the sense RNAi oligonucleotide is conjugated to one or more cell targeting group attached through a bivalent or trivalent branched linker.
- the N a modifications are 2’-0-methyl or 2’-fluoro modifications and n p ’>0 and at least one n p ’ is linked to a neighboring nucleotide via phosphorothioate linkage
- the sense RNAi oligonucleotide comprises at least one phosphorothioate linkage and the sense RNAi oligonucleotide is conjugated to one or more cell targeting group attached through a bivalent or trivalent branched linker.
- the modification is a 2’ - NMA modification.
- the antisense strand may comprise a stabilized phosphate group attached to the 5’ position of the 5 ’-most nucleoside.
- the stabilized phosphate group comprises an (E)-v inyl phosphonate.
- the stabilized phosphate group comprises a cyclopropyl phosphonate.
- the antisense strand may comprise a seed-pairing destabilizing modification.
- the seed-pairing destabilizing modification is located at position 6 (counting from the 5’ end). In certain embodiments, the seed-pairing destabilizing modification is located at position 7 (counting from the 5’ end). In certain embodiments, the seed-pairing destabilizing modification is a GNA sugar surrogate. In certain embodiments, the seed-pairing destabilizing modification is an (.V)-GNA In certain embodiments, the seed-pairing destabilizing modification is a UNA. In certain embodiments, the seed-pairing destabilizing modification is a morpholino.
- the sense strand may comprise an inverted abasic sugar moiety attached to the 5 ’-most nucleoside. In certain embodiments, the sense strand may comprise an inverted abasic sugar moiety attached to the 3 ’-most nucleoside. In certain embodiments, the sense strand may comprise inverted abasic sugar moieties attached to both the 5’-most and 3’-most nucleosides.
- the sense strand may comprise a conjugate attached at position 6 (counting from the 5’ end). In certain embodiments, the conjugate is attached at the 2’ position of the nucleoside. In certain embodiments the conjugate is a Ci 6 lipid conjugate. In certain embodiments, the modified nucleoside at position 6 of the sense strand has a 2’-0-hexadecyl modified sugar moiety.
- oligomeric compounds described herein comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid.
- an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex.
- Such oligomeric duplexes comprise a first oligomeric compound having a region complementary to a target nucleic acid and a second oligomeric compound having a region complementary to the first oligomeric compound.
- the first oligomeric compound of an oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group.
- Either or both oligomeric compounds of an oligomeric duplex may comprise a conjugate group.
- the oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides.
- oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds.
- antisense compounds have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid.
- Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
- hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
- certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid.
- RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex.
- the DNA in such an RNA:DNA duplex need not be unmodified DNA.
- described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity.
- one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.
- an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid.
- RISC RNA-induced silencing complex
- certain antisense compounds result in cleavage of the target nucleic acid by Argonaute.
- Antisense compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double- stranded (siRNA) or single -stranded (ssRNA).
- hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
- Antisense activities may be observed directly or indirectly.
- observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.
- oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid.
- the target nucleic acid is an endogenous RNA molecule.
- the target nucleic acid encodes a protein.
- the target nucleic acid is selected from: a mature mRNA and a pre-mRNA, including intronic, exonic and untranslated regions.
- the target RNA is a mature mRNA.
- the target nucleic acid is a pre-mRNA.
- the target region is entirely within an intron. In certain embodiments, the target region spans an intron/exon junction.
- the target region is at least 50% within an intron.
- the target nucleic acid is the RNA transcriptional product of a retrogene.
- the target nucleic acid is a non-coding RNA.
- the target non-coding RNA is selected from: a long non coding RNA, a short non-coding RNA, an intronic RNA molecule.
- Gapmer Oligonucleotides It is possible to introduce mismatch bases without eliminating activity.
- Gautschi et al J. Natl. Cancer Inst. 93:463-471, March 2001
- this oligonucleotide demonstrated potent anti tumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res.
- oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or fully complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20, 10 to 18, or 18 to 20 nucleobases in length.
- oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
- antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
- selectivity of the oligonucleotide is improved.
- the mismatch is specifically positioned within an oligonucleotide having a gapmer motif.
- the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of the gap region.
- the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3 ’-end of the gap region.
- the mismatch is at position 1, 2, 3, or 4 from the 5 ’-end of the wing region.
- the mismatch is at position 4, 3, 2, or 1 from the 3 ’-end of the wing region.
- antisense RNAi oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
- RNAi activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount.
- selectivity of the antisense RNAi oligonucleotides is improved.
- antisense RNAi oligonucleotides comprise a targeting region complementary to the target nucleic acid.
- the targeting region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 25 or at least 25 contiguous nucleotides.
- the targeting region constitutes 70%, 80%, 85%, 90%, 95% of the nucleosides of the antisense RNAi oligonucleotide.
- the targeting region constitutes all of the nucleosides of the antisense RNAi oligonucleotide.
- the targeting region of the antisense RNAi oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the targeting region of the antisense RNAi oligonucleotide is 100% complementary to the target nucleic acid .
- RNAi agents comprise a sense RNAi oligonucleotide.
- sense RNAi oligonucleotides comprise an antisense hybridizing region complementary to the antisense RNAi oligonucleotide.
- the antisense hybridizing region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 25 or at least 25 contiguous nucleotides.
- the antisense hybridizing region constitutes 70%, 80%, 85%, 90%, 95% of the nucleosides of the sense RNAi oligonucleotide. In certain embodiments, the antisense hybridizing region constitutes all of the nucleosides of the sense RNAi oligonucleotide. In certain embodiments, the antisense hybridizing region of the sense RNAi oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the antisense RNAi oligonucleotide. In certain embodiments, the antisense hybridizing region of the sense RNAi oligonucleotide is 100% complementary to the antisense RNAi oligonucleotide.
- a duplex region comprises least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 25 or at least 25 hybridized pairs.
- each nucleoside of antisense RNAi oligonucleotide is paired in the duplex region (i.e., the antisense RNAi oligonucleotide has no overhanging nucleosides).
- the antisense RNAi oligonucleotide includes unpaired nucleosides at the 3 ’-end and/or the 5 ’end (overhanging nucleosides).
- each nucleoside of sense RNAi oligonucleotide is paired in the duplex region (i.e., the sense RNAi oligonucleotide has no overhanging nucleosides).
- the sense RNAi oligonucleotide includes unpaired nucleosides at the 3 ’-end and/or the 5 ’end (overhanging nucleosides).
- duplexes formed by the antisense RNAi oligonucleotide and the sense RNAi oligonucleotide do not include any overhangs at one or both ends. Such ends without overhangs are referred to as blunt.
- the antisense RNAi oligonucleotide has overhanging nucleosides, one or more of those overhanging nucleosides are complementary to the target nucleic acid.
- the antisense RNAi oligonucleotide has overhanging nucleosides, one or more of those overhanging nucleosides are not complementary to the target nucleic acid.
- oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a SPDEF nucleic acid.
- the SPDEF nucleic acid has the sequence set forth in SEQ ID NO: 1 (GENBANK Accession No. NM_012391.2).
- the SPDEF nucleic acid has the sequence set forth in SEQ ID NO: 2 (the complement of GENBANK Accession No. NC_000006.12 truncated from nucleotides 34536001 to 34558000).
- the SPDEF nucleic acid has the sequence set forth in SEQ ID NO: 3 (GENBANK Accession No. NM_001252294.1).
- the SPDEF nucleic acid has the sequence set forth in SEQ ID NO: 4 (GENBANK Accession No. XM_005248988.3). In certain embodiments, the SPDEF nucleic acid has the sequence set forth in SEQ ID NO: 5 (GENBANK Accession No. XM_006715048.1).
- an oligomeric compound complementary to any one of SEQ ID NOS: 1-5 is capable of reducing an SPDEF RNA in a cell. In certain embodiments an oligomeric compound complementary to any one of SEQ ID NOS: 1-5 is capable of reducing an SPDEF protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide.
- an oligomeric compound complementary to any one of SEQ ID NOS: 1-5 is capable of ameliorating one or more symptoms or hallmarks of a pulmonary condition when it is introduced to a cell in a subject.
- the one or more symptoms or hallmarks are selected from shortness of breath, chest pain, coughing, wheezing, fatigue, sleep disruption, bronchospasm, and combinations thereof.
- the pulmonary condition is selected from bronchitis, asthma, COPD, pneumonia, emphysema, rhinitis, sinusitis, nasal polyposis, sinus polyposis, bronchiectasis, and sarcoidosis.
- the pulmonary condition is chronic bronchitis.
- Chronic bronchitis may be characterized by a cough productive of sputum for over three months' duration for two consecutive years.
- the pulmonary condition is a result of an allergic reaction.
- the pulmonary condition is a result of a viral infection.
- the pulmonary condition may be a common cold, croup, bronchitis or pneumonia caused by an adenovirus infection.
- the pulmonary condition is severe asthma.
- the pulmonary condition is Type 2 asthma, also referred to as Th2 asthma.
- an oligomeric compound complementary to any one of SEQ ID NOS: 1-5 is capable of ameliorating one or more symptoms or hallmarks of a gastrointestinal condition when it is introduced to a cell in a subject.
- the gastrointestinal condition is characterized by mucus in the stool of the subject.
- the gastrointestinal condition is ulcerative colitis.
- an oligomeric compound complementary to any one of SEQ ID NOS: 1-5 is capable of reducing a detectable amount of an SPDEF RNA in the lung of a subject when the oligomeric compound is administered to the subject.
- the oligomeric compound is administered via an inhaler or nebulizer.
- the detectable amount of the SPDEF RNA may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
- an oligomeric compound complementary to any one of SEQ ID NOS: 1-5 is capable of reducing a detectable amount of an SPDEF protein in the lung of the subject when the oligomeric compound is administered to the subject.
- the detectable amount of the SPDEF protein may be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
- the oligomeric compound is Compound No. 833561.
- Compound No. 833561 is characterized as an oligomeric compound consisting of a modified oligonucleotide, wherein the modified oligonucleotide is a 3-10-3 cEt gapmer, having a sequence of (from 5’ to 3’) CAATAAGCAAGTCTGG (SEQ ID NO: 1129), wherein each of nucleosides 1-3 and 14-16 (from 5’ to 3’) comprise a cEt modification and each of nucleosides 4-13 are 2’-deoxynucleosides, wherein the intemucleoside linkages between all nucleosides are phosphorothioate linkages, and wherein each cytosine is a 5 -methyl cytosine.
- Compound No. 833561 is represented by the following chemical structure:
- Compound No. 833561 is in the form of an anion or a salt thereof.
- the oligomeric compound may be in the form of a sodium salt.
- the oligomeric compound is in anionic form in a solution.
- Compound No. 833561 is represented by the following chemical structure:
- Compound No. 833561 is represented by the following chemical structure:
- the oligomeric compound is Compound No. 936142.
- Compound No. 936142 is characterized as an oligomeric compound consisting of a modified oligonucleotide, wherein the modified oligonucleotide is a 2-9-5 mixed-wing cEt/MOE gapmer, having a sequence of ACTTGTAACAGTGGTT (from 5’ to 3’) (SEQ ID NO: 1983), wherein each of nucleosides 1-2 and 15-16 (from 5’ to 3’) comprise a cEt modification, each of nucleosides 12-14 is a 2’-MOE nucleoside, and each of nucleosides 3-11 is a 2’-deoxynucleoside, wherein the intemucleoside linkages between all nucleosides are phosphorothioate linkages, and wherein each cytosine is a 5-methyl cytosine.
- Compound No. 936142 is characterized by the following chemical notation: Aks mCks Tds Tds Gds Tds Ads Ads mCds Ads Gds Tes Ges Ges Tks Tk; wherein
- A an adenine nucleobase
- mC a 5 -methyl cytosine nucleobase
- Compound No. 936142 is represented by the following chemical structure:
- Compound No. 936142 is in the form of an anion or a salt thereof.
- the oligomeric compound may be in the form of a sodium salt.
- the oligomeric compound is in anionic form in a solution.
- Compound No. 936142 is characterized by the following chemical structure: (SEQ ID NO: 1983).
- compositions comprising one or more oligomeric compounds.
- the one or more oligomeric compounds each consists of a modified oligonucleotide.
- the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier.
- a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound.
- the sterile saline is pharmaceutical grade saline.
- a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile water.
- the sterile water is pharmaceutical grade water.
- a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate-buffered saline (PBS).
- PBS phosphate-buffered saline
- the sterile PBS is pharmaceutical grade PBS.
- a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid.
- the artificial cerebrospinal fluid is pharmaceutical grade.
- compositions comprise one or more oligomeric compound and one or more excipients.
- excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
- oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
- Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
- compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters.
- pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
- the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
- Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
- prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within the body.
- Lipid moieties have been used in nucleic acid therapies in a variety of methods.
- the nucleic acid such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
- DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
- compositions comprise a delivery system.
- delivery systems include, but are not limited to, liposomes and emulsions.
- Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
- certain organic solvents such as dimethylsulfoxide are used.
- compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types.
- pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
- pharmaceutical compositions comprise a co-solvent system.
- co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
- co-solvent systems are used for hydrophobic compounds.
- VPD co-solvent system is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
- the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
- co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
- compositions are prepared for oral administration.
- pharmaceutical compositions are prepared for buccal administration.
- a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.).
- a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
- other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
- injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
- compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
- Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
- compositions suitable for aerosolization and/or dispersal by a nebulizer or inhaler are a solid comprising particles of compounds that are of respirable size.
- a solid particulate composition can optionally contain a dispersant which serves to facilitate the formation of an aerosol, e.g., lactose.
- Solid pharmaceutical compositions comprising an oligonucleotide can also be aerosolized using any solid particulate medicament aerosol generator known in the art, e.g., a dry powder inhaler.
- the powder employed in the inhaler consists of the compound comprising the active compound or of a powder blend comprising the active compound, a suitable powder diluent, and an optional surfactant.
- the pharmaceutical composition is a liquid.
- the liquid is administered as an aerosol that is produced by any suitable means, such as with a nebulizer or inhaler. See, e.g., U.S. Pat. No. 4,501,729.
- the nebulizer is a device for producing a spray of liquid. Nebulizers are devices that transform solutions or suspensions into an aerosol mist and are well known in the art.
- Suitable nebulizers include jet nebulizers, ultrasonic nebulizers, electronic mesh nebulizers, and vibrating mesh nebulizers.
- the nebulizer is activated manually by squeezing a flexible bottle that contains the pharmaceutical composition.
- the aerosol is produced by a metered dose inhaler, which typically contains a suspension or solution formulation of the active compound in a liquefied propellant.
- Pharmaceutical compositions suitable for aerosolization can comprise propellants, surfactants, co solvents, dispersants, preservatives, and/or other additives or excipients.
- a compound described herein complementary to an SPDEF nucleic acid can be utilized in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier and/or additional components such that the pharmaceutical composition is suitable for aerosolization by a nebulizer or inhaler.
- a pharmaceutically acceptable diluent is phosphate buffered saline.
- employed in the methods described herein is a pharmaceutical composition comprising a compound complementary to an SPDEF nucleic acid and a pharmaceutically acceptable diluent.
- the pharmaceutically acceptable diluent is phosphate buffered saline.
- the compound comprises or consists of a modified oligonucleotide provided herein.
- compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
- the compounds are antisense compounds or oligomeric compounds.
- the compound comprises or consists of a modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
- Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
- a prodrug can include the incorporation of additional nucleosides at one or both ends of a compound which are cleaved by endogenous nucleases within the body, to form the active compound.
- oligonucleotides are shown in the form of a free acid. Although such compounds may be drawn or described in protonated (free acid) form, aqueous solutions of such compounds may exist in equilibrium among an ionized (anion) form, and in association with a cation (salt form). For example, a phosphate linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion, and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions, all at equilibrium.
- oligonucleotide is intended to include all such forms.
- Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms.
- a structure depicting the free acid of a compound followed by the term “or salts thereof’ expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with a cation. In certain instances, one or more specific cation is identified.
- oligomeric compounds disclosed herein are in a form of a sodium salt. In certain embodiments, oligomeric compounds disclosed herein are in a form of a potassium salt. In certain embodiments, oligomeric compounds disclosed herein are in aqueous solution with sodium. In certain embodiments, oligomeric compounds are in aqueous solution with potassium. In certain embodiments, oligomeric compounds are in PBS. In certain embodiments, oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HC1 to achieve a desired pH.
- nucleobases 3521-3554 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion of nucleobases 3521-3554 of SEQ ID NO: 2.
- the modified oligonucleotides are 16 to 20 nucleobases in length.
- the modified oligonucleotides are gapmers.
- the modified oligonucleotides comprise a 2’-MOE nucleoside, a 2’-OMe nucleoside, a cEt nucleoside, or a combination thereof.
- the intemucleoside linkages of the modified nucleotides are phosphorothioate intemucleoside linkages or phosphodiester linkages, or a combination thereof.
- nucleobase sequences of SEQ ID NOs: 1053, 1129, 2166, 2167, 2168, 2169, 2170, 2171, 2172, 2173, 2174, 2175, 2176, 2242, and 2247 are complementary to nucleobases 3521-3554 of SEQ ID NO: 2.
- nucleobase sequences of Compound Nos: 833560, 833561, 936068, 936108, 936146, 936178, 936218, 936256, 936288, 936290, 936291, 936292, 936293, 936294, 936297, 936298, 936299, 936300, and 936301 are complementary to nucleobases 3521-3554 of SEQ ID NO: 2.
- modified oligonucleotides complementary to a portion of nucleobases 3521- 3554 of SEQ ID NO: 2 achieve at least 27% reduction of SPDEF RNA in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 3521-3554 of SEQ ID NO: 2 achieve an average of 55% reduction of SPDEF RNA in a standard cell assay.
- nucleobases 3684-3702 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion of nucleobases 3684-3702 of SEQ ID NO: 2.
- the modified oligonucleotides are 16 to 20 nucleobases in length.
- the modified oligonucleotides are gapmers.
- the modified oligonucleotides comprise a 2’-MOE nucleoside, a 2’-OMe nucleoside, a cEt nucleoside, or a combination thereof.
- the intemucleoside linkages of the modified nucleotides are phosphorothioate intemucleoside linkages or phosphodiester linkages, or a combination thereof.
- the nucleobase sequences of SEQ ID NOs: 1777, 1852, 1928, and 2004 are complementary to nucleobases 3684-3702 of SEQ ID NO: 2.
- nucleobase sequences of Compound NOs: 854213, 854214, 854215, 854216, 936069, 936109, 936147, 936179, 936219, and 936257 are complementary to nucleobases 3684-3702 of SEQ ID NO: 2.
- modified oligonucleotides complementary to a portion of nucleobases 3684- 3702 of SEQ ID NO: 2 achieve at least 45% reduction of SPDEF RNA in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 3684-3702 of SEQ ID NO: 2 achieve an average of 57% reduction of SPDEF RNA in a standard cell assay.
- nucleobases 3785-3821 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion of nucleobases 3785-3821 of SEQ ID NO: 2.
- the modified oligonucleotides are 16 to 20 nucleobases in length.
- the modified oligonucleotides are gapmers.
- the modified oligonucleotides comprise a 2’-MOE nucleoside, a 2’-OMe nucleoside, a cEt nucleoside, or a combination thereof.
- the intemucleoside linkages of the modified nucleotides are phosphorothioate intemucleoside linkages or phosphodiester linkages, or a combination thereof.
- nucleobase sequences ofSEQ ID Nos: 1282, 1358, 1434, 2177, 2178, 2179, 2180, 2181, 2182, 2183, 2184, 2185, and 2186 are complementary to nucleobases 3785-3821 of SEQ ID NO: 2.
- nucleobase sequences of Compound Nos: 833579, 833580, 833581, 936070, 936110, 936148, 936180, 936220, 936258, 936310, 936311, 936312, 936313, 936314, 936315, 936316, 936317, 936318, and 936325 are complementary to nucleobases 3785-3821 of SEQ ID NO: 2.
- modified oligonucleotides complementary to a portion of nucleobases 3785- 3821 of SEQ ID NO: 2 achieve at least 37% reduction of SPDEF RNA in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 3785-3821 of SEQ ID NO: 2 achieve an average of 60% reduction of SPDEF RNA in a standard cell assay.
- nucleobases 6356- 6377 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion of nucleobases 6356- 6377 of SEQ ID NO: 2.
- the modified oligonucleotides are 16 to 20 nucleobases in length.
- the modified oligonucleotides are gapmers.
- the modified oligonucleotides comprise a 2’-MOE nucleoside, a 2’-OMe nucleoside, a cEt nucleoside, or a combination thereof.
- the intemucleoside linkages of the modified nucleotides are phosphorothioate intemucleoside linkages or phosphodiester linkages, or a combination thereof.
- nucleobase sequences of SEQ ID NOs: 678, 2198, 2199, 2200, 2244, and 2248 are complementary to nucleobases 6356- 6377 of SEQ ID NO: 2.
- nucleobase sequences of Compound Nos: 833635, 936079, 936119, 936154, 936189, 936229, 936264, 936347, 936348, and 936349 are complementary to nucleobases 6356- 6377 of SEQ ID NO: 2.
- modified oligonucleotides complementary to a portion of nucleobases 6356- 6377 of SEQ ID NO: 2 achieve at least 38% reduction of SPDEF RNA in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 6356- 6377 of SEQ ID NO: 2 achieve an average of 53% reduction of SPDEF RNA in a standard cell assay.
- nucleobases 8809- 8826 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion of nucleobases 8809-8826 of SEQ ID NO: 2.
- the modified oligonucleotides are 16 to 20 nucleobases in length.
- the modified oligonucleotides are gapmers.
- the modified oligonucleotides comprise a 2’-MOE nucleoside, a 2’-OMe nucleoside, a cEt nucleoside, or a combination thereof.
- the intemucleoside linkages of the modified nucleotides are phosphorothioate intemucleoside linkages or phosphodiester linkages, or a combination thereof.
- nucleobase sequences of SEQ ID NOs: 683, 1715, and 2245 are complementary to nucleobases 8809-8826 of SEQ ID NO: 2.
- nucleobase sequences of Compound Nos: 833715, 854302, 936081, 936082, 936121, 936191, 936192, and 936231 are complementary to nucleobases 8809-8826 of SEQ ID NO: 2.
- modified oligonucleotides complementary to a portion of nucleobases 8809- 8826 of SEQ ID NO: 2 achieve at least 52% reduction of SPDEF RNA in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 8809-8826 of SEQ ID NO: 2 achieve an average of 66% reduction of SPDEF RNA in a standard cell assay.
- nucleobases 9800-9817 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion of nucleobases 9800-9817 of SEQ ID NO: 2.
- the modified oligonucleotides are 16 to 20 nucleobases in length.
- the modified oligonucleotides are gapmers.
- the modified oligonucleotides comprise a 2’-MOE nucleoside, a 2’-OMe nucleoside, a cEt nucleoside, or a combination thereof.
- the intemucleoside linkages of the modified nucleotides are phosphorothioate intemucleoside linkages or phosphodiester linkages, or a combination thereof.
- nucleobase sequences of SEQ ID Nos: 761, 2229, and 2230 are complementary to nucleobases 9800-9817 of SEQ ID NO: 2.
- nucleobase sequences of Compound Nos: 833748, 936084, 936123, 936158, 936194, 936233, 936268, 936409, and 936410 are complementary to nucleobases 9800-9817 of SEQ ID NO: 2.
- modified oligonucleotides complementary to a portion of nucleobases 9800- 9817 of SEQ ID NO: 2 achieve at least 51% reduction of SPDEF RNA in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 9800-9817 of SEQ ID NO: 2 achieve an average of 58% reduction of SPDEF RNA in a standard cell assay.
- nucleobases 14212- 14231 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion of nucleobases 14212- 14231 of SEQ ID NO: 2.
- the modified oligonucleotides are 16 to 20 nucleobases in length.
- the modified oligonucleotides are gapmers.
- the modified oligonucleotides comprise a 2’-MOE nucleoside, a 2’-OMe nucleoside, a cEt nucleoside, or a combination thereof.
- the intemucleoside linkages of the modified nucleotides are phosphorothioate intemucleoside linkages or phosphodiester linkages, or a combination thereof.
- nucleobase sequences of SEQ ID NOs: 1606, 1682, 2255, 2275, and 2280 are complementary to nucleobases 14212- 14231 of SEQ ID NO: 2.
- nucleobase sequences of Compound Nos: 833886, 833887, 936096, 936097, 936135, 936136, 936169, 936206, 936207, 936245, 936246, 936279, and 936442 are complementary to nucleobases 14212- 14231 of SEQ ID NO: 2.
- modified oligonucleotides complementary to a portion of nucleobases 14212- 14231 of SEQ ID NO: 2 achieve at least 45% reduction of SPDEF RNA in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 14212- 14231 of SEQ ID NO: 2 achieve an average of 59% reduction of SPDEF RNA in a standard cell assay.
- nucleobases 15385- 15408 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion of nucleobases 15385- 15408 of SEQ ID NO: 2.
- the modified oligonucleotides are 16 to 20 nucleobases in length.
- the modified oligonucleotides are gapmers.
- the modified oligonucleotides comprise a 2’-MOE nucleoside, a 2’-OMe nucleoside, a cEt nucleoside, or a combination thereof.
- the intemucleoside linkages of the modified nucleotides are phosphorothioate intemucleoside linkages or phosphodiester linkages, or a combination thereof.
- nucleobase sequences of SEQ ID NOs: 999, 1075, 2262, 2263, 2264, 2265, 2266, 2267, and 2268 are complementary to nucleobases 15385- 15408 of SEQ ID NO: 2.
- nucleobase sequences of Compound Nos: 833910, 833911, 936098, 936137, 936170, 936208, 936247, 936280, 936452, 936453, 936454, 936455, 936456, 936457, and 936458 are complementary to nucleobases 15385- 15408 of SEQ ID NO: 2.
- modified oligonucleotides complementary to a portion of nucleobases 15385- 15408 of SEQ ID NO: 2 achieve at least 44% reduction of SPDEF RNA in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 15385- 15408 of SEQ ID NO: 2 achieve an average of 59% reduction of SPDEF RNA in a standard cell assay.
- nucleobases 17289- 17307 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion of nucleobases 17289- 17307 of SEQ ID NO: 2.
- the modified oligonucleotides are 16 to 20 nucleobases in length.
- the modified oligonucleotides are gapmers.
- the modified oligonucleotides comprise a 2’-MOE nucleoside, a 2’-OMe nucleoside, a cEt nucleoside, or a combination thereof.
- the intemucleoside linkages of the modified nucleotides are phosphorothioate intemucleoside linkages or phosphodiester linkages, or a combination thereof.
- nucleobase sequences of SEQ ID NOs: 163, 1980, 2056, and 2277 are complementary to nucleobases 17289- 17307 of SEQ ID NO: 2.
- nucleobase sequences of Compound Nos: 802094, 854526, 854527, 936100, 936101, 936139, 936210, 936211, and 936249 are complementary to nucleobases 17289- 17307 of SEQ ID NO: 2.
- modified oligonucleotides complementary to a portion of nucleobases 17289- 17307 of SEQ ID NO: 2 achieve at least 43% reduction of SPDEF RNA in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 17289- 17307 of SEQ ID NO: 2 achieve an average of 60% reduction of SPDEF RNA in a standard cell assay.
- nucleobases 17490- 17509 of SEQ ID NO: 2 comprise a hotspot region.
- modified oligonucleotides are complementary to a portion of nucleobases 17490-17509 of SEQ ID NO: 2.
- the modified oligonucleotides are 16 to 20 nucleobases in length.
- the modified oligonucleotides are gapmers.
- the modified oligonucleotides comprise a 2’-MOE nucleoside, a 2’-OMe nucleoside, a cEt nucleoside, or a combination thereof.
- the intemucleoside linkages of the modified nucleotides are phosphorothioate intemucleoside linkages or phosphodiester linkages, or a combination thereof.
- nucleobase sequences of SEQ ID NOs: 1831, 1907, 1983, 2059, and 2282 are complementary to nucleobases 17490-17509 of SEQ ID NO: 2.
- nucleobase sequences of Compound Nos: 854542, 854543, 854544, 854545, 936104, 936142, 936174, 936214, 936252, and 936284 are complementary to nucleobases 17490-17509 of SEQ ID NO: 2.
- modified oligonucleotides complementary to a portion of nucleobases 17490- 17509 of SEQ ID NO: 2 achieve at least 39% reduction of SPDEF RNA in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 17490-17509 of SEQ ID NO: 2 achieve an average of 63% reduction of SPDEF RNA in a standard cell assay.
- nucleobases 19600-19642 of SEQ ID NO: 2 comprise a hotspot region.
- oligomeric compounds or oligomeric duplexes comprise modified oligonucleotides that are complementary within nucleobases 19600-19642 of SEQ ID NO: 2.
- modified oligonucleotides are 23 nucleobases in length.
- modified oligonucleotides are antisense RNAi oligonucleotides.
- the antisense RNAi oligonucleotide has a sugar motif (from 5’ to 3’) of: yfyfyfyfyfyfyfyfyfyfyyyyy; wherein “y” represents a 2’-0-methylribosyl sugar, and the “f ’ represents a 2’-fluororibosyl sugar; and a linkage motif (from 5’ to 3’) of: ssooooooooooooooooooss; wherein ‘o’ represents a phosphodiester intemucleoside linkage and ‘s’ represents a phosphorothioate intemucleoside linkage.
- nucleobase sequences of SEQ ID Nos: 2670, 2582, and 2677 are complementary within nucleobases 19600-19642 of SEQ ID NO: 2.
- RNAi compounds 1537312, 1527655, and 1537332 comprise an antisense RNAi oligonucleotide that is complementary within nucleobases 19600-19642 of SEQ ID NO: 2.
- modified oligonucleotides complementary within nucleobases 19600-19642 of SEQ ID NO: 2 achieve at least 59% reduction of SPDEF RNA in a standard cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 19600-19642 of SEQ ID NO: 2 achieve an average of 67% reduction of SPDEF RNA in a standard cell assay.
- nucleobases 19640-19672 of SEQ ID NO: 2 comprise a hotspot region.
- oligomeric compounds or oligomeric duplexes comprise modified oligonucleotides that are complementary within nucleobases 19640-19672 of SEQ ID NO: 2.
- modified oligonucleotides are 23 nucleobases in length.
- modified oligonucleotides are antisense RNAi oligonucleotides.
- the antisense RNAi oligonucleotide has a sugar motif (from 5’ to 3’) of: yfyfyfyfyfyfyfyfyfyfyyyyy; wherein “y” represents a 2’-0-methylribosyl sugar, and the “f’ represents a 2’-fluororibosyl sugar; and a linkage motif (from 5’ to 3’) of: ssooooooooooooooooooss; wherein ‘o’ represents a phosphodiester intemucleoside linkage and ‘s’ represents a phosphorothioate intemucleoside linkage.
- nucleobase sequences of SEQ ID Nos: 2609, 2606, and 2578 are complementary within nucleobases 19640-19672 of SEQ ID NO: 2.
- RNAi compounds 1528397, 1528231, and 1527651 comprise an antisense RNAi oligonucleotide that is complementary within nucleobases 19640-19672 of SEQ ID NO: 2.
- modified oligonucleotides complementary within nucleobases 19640-19672 of SEQ ID NO: 2 achieve at least 33% reduction of SPDEF RNA in a standard cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 19640-19672 of SEQ ID NO: 2 achieve an average of 59% reduction of SPDEF RNA in a standard cell assay.
- RNA nucleoside comprising a 2 ’-OH sugar moiety and a thymine base
- nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
- an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5-position.
- Certain compounds described herein e.g., modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (5), as a or b such as for sugar anomers, or as (D) or (L), such as for amino acids, etc.
- Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.
- Compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
- tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms.
- the compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element.
- compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 'H hydrogen atoms.
- Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of 3 ⁇ 4, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 0 or 18 0 in place of 16 0, and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
- non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
- radioactive isotopic substitutions may make the compound suitable for research or diagnostic purposes such as imaging.
- Example 1 Effect of 3-10-3 cEt gapmer modified oligonucleotides on human SPDEF RNA in vitro, single dose
- Modified oligonucleotides complementary to human SPDEF nucleic acid were tested for their effect on SPDEF RNA levels in vitro.
- the newly designed modified oligonucleotides in the tables below were designed as 3-10-3 cEt gapmers.
- the gapmers are 16 nucleosides in length, wherein the central gap segment comprises of ten 2’- deoxynucleosides and is flanked by wing segments on the 5 ’ direction and the 3 ’ direction comprising three nucleosides each.
- Each nucleoside in the 5’ wing segment and each nucleoside in the 3’ wing segment has a cEt sugar modification.
- “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the human gene sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the human gene sequence.
- Each modified oligonucleotide listed in the Tables below is 100% complementary to SEQ ID NO: 1 (GENBANK Accession No. NM_012391.2), SEQ ID NO: 2 (the complement of GENBANK Accession No. NC_000006.12 truncated from nucleotides 34536001 to 34558000), SEQ ID NO: 3 (GENBANK Accession No.
- NM_001252294.1 SEQ ID NO: 4 (GENBANK Accession No. XM_005248988.3) or SEQ ID NO: 5 (GENBANK Accession No. XM_006715048.1).
- N/A indicates that the modified oligonucleotide is not 100% complementary to that particular gene sequence.
- RNA levels were measured by quantitative real-time RTPCR.
- Human SPDEF primer probe set RTS35007 forward sequence CGCTTCATTAGGTGGCTCAA, designated herein as SEQ ID NO: 6; reverse sequence GCTCAGCTTGTCGTAGTTCA, designated herein as SEQ ID NO: 7; probe sequence AATTGAGGACTCAGCCCAGGTGG, designated herein as SEQ ID NO: 8) was used to measure RNA levels. SPDEF RNA levels were normalized to total RNA content, as measured by
- RIBOGREEN® Reduction of SPDEF RNA is presented in the tables below as percent SPDEF RNA levels relative to untreated control (UTC) cells. Each table represents results from an individual assay plate.
- the modified oligonucleotides marked with an asterisk (*) indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
- Example 2 Effect of modified oligonucleotides on human SPDEF RNA in vitro, single dose Additional oligonucleotides with further chemistry modifications were designed to target an SPDEF nucleic acid and were tested for their effect on SPDEF RNA levels in vitro.
- chemistry notation column in the tables below specifies the specific chemistry notation for modified oligonucleotides; wherein subscript ‘d’ represents a 2’- -D-deoxyribosyl sugar moiety, subscript ‘e’ represents a 2’-MOE sugar moiety, subscript ‘y’ represents a 2'-0-methyl sugar moiety, subscript ‘k’ represents a cEt modified sugar moiety, subscript ‘s’ represents a phosphorothioate intemucleoside linkage, and superscript ‘m’ before the cytosine residue represents a 5 -methyl cytosine. “Start site” indicates the 5 ’-most nucleoside to which the gapmer is targeted in the human gene sequence.
- “Stop site” indicates the 3’-most nucleoside to which the gapmer is targeted in the human gene sequence. Modified oligonucleotide listed in the tables below are targeted to either SEQ ID NO: 1 or SEQ ID NO: 2 (described herein above). ‘N/A’ indicates that the modified oligonucleotide does not target that particular gene sequence with 100% complementarity.
- the modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below.
- Cultured VCaP cells at a density of 20,000 cells per well were transfected using electroporation with 4 mM of modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and SPDEF RNA levels were measured by quantitative real-time RTPCR. Human primer probe set RTS35007 was used to measure RNA levels. SPDEF RNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Reduction of SPDEF RNA is presented in the tables as percent SPDEF RNA levels relative to untreated control (UTC) cells (% UTC).
- Each table represents results from an individual assay plate.
- the compounds marked with an asterisk (*) indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of the modified oligonucleotides complementary to the amplicon region.
- Example 3 Effect of modified oligonucleotides on human SPDEF RNA in vitro, multiple doses
- Modified oligonucleotides selected from the examples above were tested at various doses in VCaP cells.
- Cultured VCaP cells at a density of 20,000 cells per well were treated with modified oligonucleotide at various doses by electroporation, as specified in the tables below.
- total RNA was isolated from the cells and SPDEF RNA levels were measured by quantitative real time RTPCR.
- Human SPDEF primer probe set RTS35007 was used to measure RNA levels as described above. SPDEF RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of SPDEF RNA, relative to untreated control (UTC).
- the half maximal inhibitory concentration (IC50) of each modified oligonucleotide is also presented. IC50 was calculated using a linear regression on a log/linear plot of the data in Excel.
- CD-I mice are a multipurpose mouse model frequently utilized for safety and efficacy testing.
- the mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.
- Study 1
- Groups of four 6-to-8-week-old male CD-I mice were injected subcutaneously once a week for six weeks (for a total of 6 treatments) with 50 mg/kg of modified oligonucleotides.
- One group of four male CD-I mice was injected with saline. Mice were euthanized 72 hours following the final administration.
- AST aspartate aminotransferase
- ALT alanine aminotransferase
- TBIL total bilirubin
- BUN blood urea nitrogen
- CRT creatinine
- albumin albumin
- Body weights of CD-I mice were measured at days 1 and 39, and the average body weight for each group is presented in the table below. Liver, kidney and spleen weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies. Table 50. Body and organ weights (in grams)
- mice Groups of 6-to-8-week-old male CD-I mice were injected subcutaneously once a week for six weeks (for a total of 6 treatments) with 50 mg/kg of modified oligonucleotides.
- One group of male CD-I mice was injected with PBS. Mice were euthanized 48 hours following the final administration.
- AST aspartate aminotransferase
- ALT alanine aminotransferase
- TBIL total bilirubin
- BUN blood urea nitrogen
- CRT creatinine
- albumin albumin
- Body weights of CD-I mice were measured at days 1 and 37, and the average body weight for each group is presented in the table below. Liver, kidney and spleen weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies. Table 52. Body and organ weights (in grams)
- mice Groups of 6-to-8-week-old male CD-I mice were injected subcutaneously once a week for six weeks (for a total of 6 treatments) with 50 mg/kg of modified oligonucleotides.
- One group of male CD-I mice was injected with PBS. Mice were euthanized 48 hours following the final administration.
- AST aspartate aminotransferase
- ALT alanine aminotransferase
- TBIL total bilirubin
- BUN blood urea nitrogen
- CRT creatinine
- albumin albumin
- Body weights of CD-I mice were measured at days 1 and 37, and the average body weight for each group is presented in the table below. Liver, kidney and spleen weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies. Table 54. Body and organ weights (in grams)
- Table 55 Plasma chemistry markers in male CD-I mice Body weights of CD-I mice were measured at days 1 and 37, and the average body weight for each group is presented in the table below. Liver, kidney and spleen weights were measured at the end of the study and are presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies. Table 56. Body and organ weights (in grams)
- CD-I mice are a multipurpose mouse model frequently utilized for safety and efficacy testing. The mice were treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.
- MAC macrophages
- NEU neutrophils
- LYM lymphocytes
- EOS eosinophils
- Modified oligonucleotides that caused changes in the levels of any of the BAL markers outside the expected range for modified oligonucleotides were excluded in further studies. In some cases, where less than 4 samples were available in a group, the values are marked with an asterisk (*).
- IL-10 Interleukin- 10
- IL-6 Interleukin-6
- MCP monocyte chemotactic protein
- MIP macrophage inflammatory protein
- MAC macrophages
- NEU neutrophils
- LYM lymphocytes
- EOS eosinophils
- Modified oligonucleotides that caused changes in the levels of any of the BAL markers outside the expected range for modified oligonucleotides were excluded in further studies. In some cases, where less than 4 samples were available in a group, the values are marked with an asterisk (*).
- IL-10 Interleukin- 10
- IL-6 Interleukin-6
- MCP monocyte chemotactic protein
- MIP macrophage inflammatory protein 1 p/CCL4 in the bronchoalveolar lavage fluid
- mice Groups of 7-to-8-week-old male CD-I mice were dosed orotracheally once a week for six weeks (for a total of 6 treatments) with 20 mg/kg of modified oligonucleotides.
- One group of male CD-I mice was treated with saline. Mice were euthanized 48 hours following the final administration.
- Groups of 7-to-8-week-old male CD-I mice were dosed orotracheally once a week for six weeks (for a total of 6 treatments) with 20mg/kg of modified oligonucleotides.
- One group of male CD-I mice was treated with saline. Mice were euthanized 72 hours following the final administration. Body weights of CD-I mice were measured at days 1 and 36, and the average body weight for each group is presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
- MAC macrophages
- NEU neutrophils
- LYM lymphocytes
- EOS eosinophils
- IL-10 Interleukin- 10
- IL-6 Interleukin-6
- MCP monocyte chemotactic protein
- MIP macrophage inflammatory protein
- Groups of 7-to-8-week-old male CD-I mice were dosed orotracheally once a week for six weeks (for a total of 6 treatments) with 20 mg/kg of modified oligonucleotides.
- One group of male CD-I mice was treated with saline. Mice were euthanized 72 hours following the final administration. Body weights of CD-I mice were measured at days 1 and 36, and the average body weight for each group is presented in the table below. Modified oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
- Bronchoalveolar Lavage (BAL) cellular profile To evaluate the effect of modified oligonucleotides on lung function, levels of macrophages (MAC), neutrophils (NEU), lymphocytes (LYM), and eosinophils (EOS) in the bronchoalveolar lavage fluid (BAL) were measured.
- Mouse lungs were lavaged two times with 0.5 ml of PBS containing 1% BSA (Sigma- Aldrich).
- BAL fluid samples were centrifuged to generate a cell pellet and a cell-free supernatant. The recovered airway cells were resuspended in PBS with 1% BSA, and a cytospin was performed. Cells were stained with Diff-Quik stain (VWR). Data are presented as the percent of cells present in the total recovered BAL cell population.
- IL-10 Interleukin- 10
- IL-6 Interleukin-6
- MCP monocyte chemotactic protein
- MIP macrophage inflammatory protein
- HBEs were obtained from Epithelix (Cat# EP61SA) and grown per manufacturer instructions.
- HBEs were plated at 80,000 cells/well in a 96-well transwell plate, and an air-liquid interface (ALI) was established by differentiation for 5 weeks. Post establishment of ALI, the cells were treated with modified oligonucleotide at the concentrations indicated in the table below by free uptake at the basolateral surface. 72 hours post treatment, total RNA was isolated from the cells and SPDEF RNA levels were measured by quantitative real-time RTPCR.
- ALI air-liquid interface
- Human SPDEF primer probe set RTS35575 (forward sequence AAGTGCTCAAGGACATCGAG, designated herein as SEQ ID NO: 9; reverse sequence CGGTATTGGTGCTCTGTCC, designated herein as SEQ ID NO: 10; probe sequence TCCATGGGATCTGCGGTGATGTT, designated herein as SEQ ID NO: 11) was used to measure RNA levels as described above.
- SPDEF RNA levels were normalized to levels of cyclophilin A, measured by human primer probe set HTS3936 (forward sequence GCCATGGAGCGCTTTGG, designated herein as SEQ ID NO: 12; reverse sequence TCCACAGTCAGCAATGGTGATC, designated herein as SEQ ID NO: 13; probe sequence TCCAGGAATGGCAAGACCAGCAAGA, designated herein as SEQ ID NO: 14). Results are presented in the tables below as percent reduction of the amount of SPDEF RNA, relative to untreated control (UTC). The half maximal inhibitory concentration (IC50) of each modified oligonucleotide is also presented. IC50 was calculated using the log (inhibitor) vs response (three parameters) function in GraphPad Prism 7.01.
- Study 2 HBEs were plated at 150,000 cells/well in a 24-well transwell plate, and an air-liquid interface (ALI) was established by differentiation for 5 weeks. Post establishment of ALI, the cells were treated with modified oligonucleotide at the concentrations indicated in the table below by free uptake at the basolateral surface. 72 hours post treatment, total RNA was isolated from the cells and SPDEF RNA levels were measured by quantitative real-time RTPCR. Human SPDEF primer probe set RTS35575 was used to measure RNA levels as described above. SPDEF RNA levels were normalized to cyclophilin A, as measured by human primer probe set HTS3936. Results are presented in the tables below as percent reduction of the amount of SPDEF RNA, relative to untreated control (UTC).
- UTC untreated control
- IC 50 half maximal inhibitory concentration
- RNA levels of airway secretory mucins MUC5AC and MUC5B were measured in the samples.
- SPDEF sterile a-motif pointed domain epithelial specific transcription factor
- Human MUC5AC primer probe set (ThermoFisher
- RNA levels were normalized to cyclophilin A, as measured by human primer probe set HTS3936.
- HBEs were plated at 150,000 cells/well in a 24-well transwell plate, and an air-liquid interface (AFI) was established by differentiation for 5 weeks. Post establishment of AFI, the cells were treated with modified oligonucleotide at the concentrations indicated in the table below by free uptake at the basolateral surface. 72 hours post treatment, total RNA was isolated from the cells and SPDEF RNA levels were measured by quantitative real-time RTPCR. Human SPDEF primer probe set RTS35575 was used to measure RNA levels as described above. SPDEF RNA levels were normalized to cyclophilin A levels, as measured by human primer probe set HTS3936. Results are presented in the tables below as percent reduction of the amount of SPDEF RNA, relative to untreated control (UTC).
- AFI air-liquid interface
- IC50 half maximal inhibitory concentration
- HBEs were plated at 500,000cells/well in a 6well transwell plate, and an air-liquid interface (ALI) was established by differentiation for 5 weeks. Post establishment of ALI, the cells were treated with modified oligonucleotide at the concentrations indicated in the table below by free uptake at the basolateral surface. 72 hours post treatment, total RNA was isolated from the cells and SPDEF RNA levels were measured by quantitative real-time RTPCR. Human SPDEF primer probe set RTS35575 was used to measure RNA levels as described above. SPDEF RNA levels were normalized to cyclophilin A levels, as measured by human primer probe set HTS3936. Results are presented in the tables below as percent reduction of the amount of SPDEF RNA, relative to untreated control (UTC).
- UTC untreated control
- RNA levels of airway secretory mucins MUC5AC and MUC5B were measured in the samples.
- Human MUC5AC primer probe set (ThermoFisher Scientific 4453320) and human MUC5B primer probe set (ThermoFisher Scientific 4448892) were used to measure MUC5AC and MUC5B RNA levels as described above.
- RNA levels were normalized to cyclophilin A, as measured by human primer probe set HTS3936. Knockdown of SPDEF led to significant knockdown of MUC5AC, as well as of MUC5B RNA.
- Example 7 Tolerability of modified oligonucleotides targeting human SPDEF in Sprague-Dawley rats Sprague-Dawley rats are a multipurpose model used for safety and efficacy evaluations. The rats were treated with Ionis modified oligonucleotides from the studies described in the Examples above and evaluated for changes in the levels of various plasma chemistry markers.
- Plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the table below expressed in IU/L. Plasma levels of total bilirubin (TBIL), creatinine (CREA), albumin (ALB), and Blood Urea Nitrogen (BUN) were also measured using the same clinical chemistry analyzer and the results are also presented in the table below.
- TBIL total bilirubin
- CREA creatinine
- ALB albumin
- BUN Blood Urea Nitrogen
- Ionis modified oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for modified oligonucleotides were excluded in further studies. In some cases, where less than 4 samples were available in a group, the compounds are marked with an asterisk (*). Table 74. Plasma chemistry markers in Sprague-Dawley rats
- Counts taken include red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), and individual white blood cell counts, such as that of monocytes (MON), neutrophils (NEU), lymphocytes (LYM), and platelets (PLT).
- RBC red blood cell
- WBC white blood cell
- HGB hemoglobin
- HCT hemoglobin
- HCT hemoglobin
- HCT hemoglobin
- HCT hemoglobin
- HCT hemoglobin
- HCT hemoglobin
- MCV Mean corpuscular volume
- MH mean corpuscular hemoglobin
- MCHC mean corpuscular hemoglobin concentration
- PHT platelets
- MTP micro total protein
- creatinine an automated clinical chemistry analyzer
- MTP/C ratio MTP/C ratio
- Body weights of rats were measured at days 1 and 40, and the average body weight for each group is presented in the table below.
- Liver, spleen and kidney weights were measured at the end of the study, and are presented in the table below.
- Ionis oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
- Plasma chemistry markers To evaluate the effect of Ionis oligonucleotides on hepatic function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the Table below expressed in IU/L. Plasma levels of total bilirubin (TBIL), creatinine (CREA), albumin (ALB), and Blood Urea Nitrogen (BUN) were also measured using the same clinical chemistry analyzer and the results are also presented in the Table below. Ionis modified oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for modified oligonucleotides were excluded in further studies. Table 78. Plasma chemistry markers in Sprague-Dawley rats
- Counts taken include red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), and individual white blood cell counts, such as that of monocytes (MON), neutrophils (NEU), lymphocytes (LYM), and platelets (PLT).
- RBC red blood cell
- WBC white blood cell
- HGB hemoglobin
- HCT hemoglobin
- HCT hemoglobin
- HCT hemoglobin
- HCT hemoglobin
- HCT hemoglobin
- HCT hemoglobin
- MCV Mean corpuscular volume
- MH mean corpuscular hemoglobin
- MCHC mean corpuscular hemoglobin concentration
- PHT platelets
- MTP micro total protein
- creatinine a ratio of MTP to creatinine (MTP/C ratio) are presented in the table below. Ionis oligonucleotides that caused changes in the levels of the ratio outside the expected range for modified oligonucleotides were excluded in further studies. Table 80. MTP to creatinine ratio in Sprague-Dawley rats
- Body weights of rats were measured at days 1 and 38, and the average body weight for each group is presented in the table below.
- Liver, spleen and kidney weights were measured at the end of the study, and are presented in the table below.
- Ionis oligonucleotides that caused any changes in organ weights outside the expected range for modified oligonucleotides were excluded from further studies.
- Example 8 Effect of modified oligonucleotides targeting human SPDEF in cynomolgus monkeys, inhalation study
- Cynomolgus monkeys were treated with Ionis modified oligonucleotides selected from studies described in the Examples above. Modified oligonucleotide tolerability was evaluated.
- the monkeys Prior to the study, the monkeys were housed according to Ionis-Specific NHP Socialization and Enrichment Guidelines (Laboratory Animal Science (Life Science) Work Instruction LAS 001).
- red blood cell (RBC) count Hemoglobin (HGB), Hematocrit (HCT), Mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), platelet count (PLT), white blood cells (WBC) count, monocyte count (MON), neutrophil count (NEU), lymphocyte count (LYM), eosinophil count (EOS), and basophil count (BAS) using an ADVIA2120 hematology analyzer (Siemens, USA).
- oligonucleotides did not cause any changes in hematologic parameters outside the expected range for modified oligonucleotides at this dose. Specifically, treatment with ION 833561 was well tolerated in terms of the hematologic parameters of the monkeys.
- Lung lavage was performed after collection of whole lung weight. The two washes were pooled and centrifuged at 300 x g forlO minutes. The pellet was resuspended in PBS in 1% BSA and a cytospin was performed. The slides were fixed and stained with modified Wright’s stain (Siemens) with a Hematek 3000 instrument. The slides were used to obtain a cell differential using a Nikon E400 microscope. Cell counts taken include macrophages (MAC), neutrophils (NEU), eosinophils (EOS), and lymphocytes (LYM).
- MAC macrophages
- NEU neutrophils
- EOS eosinophils
- LYM lymphocytes
- IL-10 Interleukin- 10
- IL-6 Interleukin-6
- MCP monocyte chemotactic protein
- MIP macrophage inflammatory protein
- BAL bronchoalveolar lavage fluid
- Cytokines were measured with 2 NHP kits from Meso Scale Diagnostics, LLC: U-PLEX Chemokine combo 1 K15055K-1 and U-PLEX TH17 Combo 1 K15079K-1.
- Example 9 Effect of modified oligonucleotides on cynomolgus monkey SPDEF RNA in vitro, multiple doses
- Modified oligonucleotides selected from the examples above were tested at various doses in 4MBr-5 cells.
- Cultured 4MBr-5 cells at a density of 30,000 cells per well were treated with modified oligonucleotide at various doses by electroporation, as specified in the tables below.
- the electroporated cells were plated into culture media containing 50 ng/mL of human IL-13 protein (R&D systems #213-ILB-005). After an incubation of approximately 24 hours, total RNA was isolated from the cells and SPDEF RNA levels were measured by quantitative real-time RTPCR. Cynomolgus SPDEF primer probe set Mf02917915_ml was used to measure RNA levels as described above.
- SPDEF RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Results are presented in the tables below as percent reduction of the amount of SPDEF RNA, relative to untreated control (UTC). The half maximal inhibitory concentration (IC50) of each modified oligonucleotide is also presented. IC50 was calculated using a linear regression on a log/linear plot of the data in Excel.
- Example 10 Effect of a modified oligonucleotide complementary to SPDEF in a bleomycin induced pulmonary fibrosis model
- 652553 has a sequence (from 5’ to 3’) of GCTCATGTGTATCCCT (SEQ ID NO: 2285), and is designed to be complementary to the mouse SPDEF target sequence, designated herein as SEQ ID NO: 2286 (GENBANK Accession No. NM_013891.4) at Start site 1540 and Stop site 1555, wherein “Start site” indicates the 5’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary, and “Stop site” indicates the 3 ’-most nucleoside of the target sequence to which the modified oligonucleotide is complementary.
- Compound No. 549148 is a control oligonucleotide with a sequence (from 5’ to 3’) of GGCTACTACGCCGTCA (SEQ ID NO: 2287), and is designed to not target mouse SPDEF or any known gene.
- mice Following a total of 3 loading doses of lOmg/kg of modified oligonucleotide administered orotracheally twice per week prior to Day 0, the mice were dosed orotracheally twice per week with lOmg/kg/dose of modified oligonucleotide for a total of 6 doses. Mice were sacrificed on Day 18 (48 hours post final dose of modified oligonucleotide). Following the loading dose, the mice were also treated with 2.5u/kg of Bleomycin (Savmart, catalog# NDC-0783-3154-01) on Day 0 and 1.5u/kg of Bleomycin on Day 14.
- Bleomycin Sevmart, catalog# NDC-0783-3154-01
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Veterinary Medicine (AREA)
- Biomedical Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Biotechnology (AREA)
- Epidemiology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Pulmonology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Inorganic Chemistry (AREA)
- Otolaryngology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Saccharide Compounds (AREA)
- Medicinal Preparation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2022526072A JP2023501352A (ja) | 2019-11-08 | 2020-11-06 | Spdef発現を低減するための化合物及び方法 |
| EP20886021.3A EP4054655A4 (en) | 2019-11-08 | 2020-11-06 | Compounds and methods for reducing spdef expression |
| US17/147,215 US20210139906A1 (en) | 2019-11-08 | 2021-01-12 | Compounds and methods for reducing spdef expression |
| US17/508,516 US20220290137A1 (en) | 2019-11-08 | 2021-10-22 | Compounds and methods for reducing spdef expression |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201962932758P | 2019-11-08 | 2019-11-08 | |
| US62/932,758 | 2019-11-08 | ||
| US202063056969P | 2020-07-27 | 2020-07-27 | |
| US63/056,969 | 2020-07-27 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US17/147,215 Continuation US20210139906A1 (en) | 2019-11-08 | 2021-01-12 | Compounds and methods for reducing spdef expression |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2021092459A1 true WO2021092459A1 (en) | 2021-05-14 |
Family
ID=75849553
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2020/059506 Ceased WO2021092459A1 (en) | 2019-11-08 | 2020-11-06 | Compounds and methods for reducing spdef expression |
Country Status (5)
| Country | Link |
|---|---|
| US (2) | US20210139906A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4054655A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2023501352A (cg-RX-API-DMAC7.html) |
| TW (1) | TW202128999A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2021092459A1 (cg-RX-API-DMAC7.html) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4168549A4 (en) * | 2020-06-19 | 2024-10-09 | Ionis Pharmaceuticals, Inc. | COMPOUNDS AND METHODS FOR PMP22 MODULATION |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050255487A1 (en) * | 2002-11-14 | 2005-11-17 | Dharmacon, Inc. | Methods and compositions for selecting siRNA of improved functionality |
| WO2010129708A2 (en) * | 2009-05-05 | 2010-11-11 | Children's Hospital Medical Center | Methods and compositions related to the regulation of goblet cell differentiation, mucus production and mucus secretion |
| WO2019169219A1 (en) * | 2018-03-02 | 2019-09-06 | Ionis Pharmaceuticals, Inc. | Modulators of irf4 expression |
Family Cites Families (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20010010934A1 (en) * | 1998-07-31 | 2001-08-02 | Towia Aron Libermann | Prostate derived ets factor |
| US6821724B1 (en) * | 1998-09-17 | 2004-11-23 | Affymetrix, Inc. | Methods of genetic analysis using nucleic acid arrays |
| US20060257851A1 (en) * | 2002-11-26 | 2006-11-16 | Itzhak Bentwich | Bioinformatically detectable group of novel viral regulatory genes and uses thereof |
| US20070009899A1 (en) * | 2003-10-02 | 2007-01-11 | Mounts William M | Nucleic acid arrays for detecting gene expression in animal models of inflammatory diseases |
| US20050244851A1 (en) * | 2004-01-13 | 2005-11-03 | Affymetrix, Inc. | Methods of analysis of alternative splicing in human |
| US20050221354A1 (en) * | 2004-02-18 | 2005-10-06 | Wyeth | Nucleic acid arrays for monitoring expression profiles of drug target genes |
| US20070048756A1 (en) * | 2005-04-18 | 2007-03-01 | Affymetrix, Inc. | Methods for whole genome association studies |
| AU2007225238A1 (en) * | 2006-03-10 | 2007-09-20 | Wyeth | Microarray for monitoring gene expression in multiple strains of Streptococcus pneumoniae |
| US20090123928A1 (en) * | 2007-10-11 | 2009-05-14 | The Johns Hopkins University | Genomic Landscapes of Human Breast and Colorectal Cancers |
| EP2220230A2 (en) * | 2007-11-09 | 2010-08-25 | Isis Pharmaceuticals, Inc. | Modulation of factor 9 expression |
| US8257716B2 (en) * | 2007-12-21 | 2012-09-04 | Ashwani Sood | Anti-PDEF antibodies and uses thereof |
| WO2010115278A1 (en) * | 2009-04-06 | 2010-10-14 | University Of Saskatchewan | Methods and compositions for treating and preventing shiga toxin-producing escherichia coli infection |
| US20140004565A1 (en) * | 2009-07-06 | 2014-01-02 | Alnylam Pharmaceuticals, Inc. | Cell-based bioprocessing |
| US9920317B2 (en) * | 2010-11-12 | 2018-03-20 | The General Hospital Corporation | Polycomb-associated non-coding RNAs |
| CA2817256A1 (en) * | 2010-11-12 | 2012-05-18 | The General Hospital Corporation | Polycomb-associated non-coding rnas |
| AR092982A1 (es) * | 2012-10-11 | 2015-05-13 | Isis Pharmaceuticals Inc | Modulacion de la expresion de receptores androgenicos |
| US9988626B2 (en) * | 2013-07-29 | 2018-06-05 | Universität Zu Köln | Neurocalcin delta inhibitors and therapeutic and non-therapeutic uses thereof |
| CA2954791C (en) * | 2014-07-14 | 2025-11-18 | The Regents Of The University Of California | CRISPR/CAS TRANSCRIPTIONAL MODULATION |
| US20180305689A1 (en) * | 2015-04-22 | 2018-10-25 | Mina Therapeutics Limited | Sarna compositions and methods of use |
| US20170343551A1 (en) * | 2016-04-05 | 2017-11-30 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Method of diagnosing and treating prostate cancer |
-
2020
- 2020-11-06 JP JP2022526072A patent/JP2023501352A/ja active Pending
- 2020-11-06 WO PCT/US2020/059506 patent/WO2021092459A1/en not_active Ceased
- 2020-11-06 EP EP20886021.3A patent/EP4054655A4/en active Pending
- 2020-11-09 TW TW109139080A patent/TW202128999A/zh unknown
-
2021
- 2021-01-12 US US17/147,215 patent/US20210139906A1/en not_active Abandoned
- 2021-10-22 US US17/508,516 patent/US20220290137A1/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050255487A1 (en) * | 2002-11-14 | 2005-11-17 | Dharmacon, Inc. | Methods and compositions for selecting siRNA of improved functionality |
| WO2010129708A2 (en) * | 2009-05-05 | 2010-11-11 | Children's Hospital Medical Center | Methods and compositions related to the regulation of goblet cell differentiation, mucus production and mucus secretion |
| WO2019169219A1 (en) * | 2018-03-02 | 2019-09-06 | Ionis Pharmaceuticals, Inc. | Modulators of irf4 expression |
Non-Patent Citations (1)
| Title |
|---|
| See also references of EP4054655A4 * |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4054655A4 (en) | 2024-02-28 |
| TW202128999A (zh) | 2021-08-01 |
| US20220290137A1 (en) | 2022-09-15 |
| EP4054655A1 (en) | 2022-09-14 |
| US20210139906A1 (en) | 2021-05-13 |
| JP2023501352A (ja) | 2023-01-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7645301B2 (ja) | Apol1発現のモジュレーター | |
| WO2020006267A1 (en) | Compounds and methods for reducing lrrk2 expression | |
| JP2025000693A (ja) | Appの発現を低減するための化合物及び方法 | |
| EP3947684B1 (en) | Compounds and methods for modulating ube3a-ats | |
| JP7446443B2 (ja) | Smn2を調節するための化合物及び方法 | |
| EP4281084A1 (en) | Compounds and methods for reducing dux4 expression | |
| WO2022026589A1 (en) | Compounds and methods for reducing app expression | |
| JP2024540537A (ja) | プログラニュリン発現を調節するための化合物及び方法 | |
| EP4216964A1 (en) | Compounds and methods for reducing apoe expression | |
| EP4054655A1 (en) | Compounds and methods for reducing spdef expression | |
| IL322549A (en) | Compounds and methods for reducing expression of applications | |
| AU2018357932A1 (en) | Modulators of ENaC expression | |
| EP4402260A1 (en) | Compounds and methods for reducing dnm1l or drp1 expression | |
| EP4262822A2 (en) | Compounds and methods for modulating factor xii | |
| JP2023532518A (ja) | Plp1を調節するための化合物及び方法 | |
| HK40129490A (en) | Compounds and methods for modulating ube3a-ats | |
| HK40067280A (en) | Compounds and methods for modulating ube3a-ats | |
| HK40067280B (en) | Compounds and methods for modulating ube3a-ats | |
| WO2023122681A2 (en) | Compounds and methods for reducing pcdh19 expression | |
| EA048039B1 (ru) | Соединения и способы модулирования smn2 | |
| BR122024003572A2 (pt) | Oligonucleotídeo modificado, composto oligomérico, população de oligonucleotídeos modificados, população de compostos oligoméricos e composição farmacêutica |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20886021 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2022526072 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2020886021 Country of ref document: EP Effective date: 20220608 |