WO2021081115A1 - Compositions and methods for in vitro activation and expansion of serial killer t cell populations and passive immunization of a cancer patient with tumor cell killing cells - Google Patents

Compositions and methods for in vitro activation and expansion of serial killer t cell populations and passive immunization of a cancer patient with tumor cell killing cells Download PDF

Info

Publication number
WO2021081115A1
WO2021081115A1 PCT/US2020/056698 US2020056698W WO2021081115A1 WO 2021081115 A1 WO2021081115 A1 WO 2021081115A1 US 2020056698 W US2020056698 W US 2020056698W WO 2021081115 A1 WO2021081115 A1 WO 2021081115A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cell
population
tumor
activated
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/056698
Other languages
English (en)
French (fr)
Inventor
Frank BORRIELLO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Alloplex Biotherapeutics
Original Assignee
Alloplex Biotherapeutics
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US16/660,442 external-priority patent/US10731128B2/en
Application filed by Alloplex Biotherapeutics filed Critical Alloplex Biotherapeutics
Priority to CA3154876A priority Critical patent/CA3154876A1/en
Priority to MX2022004772A priority patent/MX2022004772A/es
Priority to KR1020227013669A priority patent/KR20220103928A/ko
Priority to IL292355A priority patent/IL292355A/en
Priority to JP2022524134A priority patent/JP7752424B2/ja
Priority to AU2020371619A priority patent/AU2020371619A1/en
Priority to EP20879429.7A priority patent/EP4048291A4/en
Publication of WO2021081115A1 publication Critical patent/WO2021081115A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14Blood; Artificial blood
    • A61K35/17Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/15Natural-killer [NK] cells; Natural-killer T [NKT] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/17Monocytes; Macrophages
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4271Melanoma antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • A61K2039/5156Animal cells expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • A61K2039/5158Antigen-pulsed cells, e.g. T-cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00Coculture with; Conditioned medium produced by
    • C12N2502/99Coculture with; Conditioned medium produced by genetically modified cells

Definitions

  • the described invention relates generally to immunological approaches to the treatment of cancer, and more particularly to in vitro induction and expansion of serial killer T cell populations followed by passive immunization of a cancer patient with the tumor cell killing activated and expanded serial killer T cells.
  • the human immune system is a complex arrangement of cells and molecules that maintain immune homeostasis to preserve the integrity of the organism by elimination of all elements judged to be dangerous. Responses in the immune system may generally be divided into two arms, referred to as "innate immunity” and “adaptive immunity.”
  • the innate arm of the immune system is a nonspecific fast response to pathogens that are predominantly responsible for an initial inflammatory response via a number of soluble factors, including the complement system and the chemokine/cytokine system; and a number of specialized cell types, including mast cells, macrophages, dendritic cells (DCs), and natural killer cells (NKs).
  • the adaptive immune arm involves a specific, delayed and longer-lasting response by various types of cells that create long-term immunological memory against a specific antigen. It can be further subdivided into cellular and humoral branches, the former largely mediated by T cells and the latter by B cells. T cells further can be categorized by the expression of CD4+ molecules or the expression of CD8+ molecules, the latter of which allows for the identification of CD8+ cytotoxic T lymphocytes (CTLs).
  • CTLs cytotoxic T lymphocytes
  • innate- like immunity The third arm will be referred to herein as “innate- like immunity.”
  • the three arms of immunity do not operate independently of each other, but rather work together to elicit effective immune responses. Because the initiation of an adaptive immune response requires some time, innate immunity and innate-like immunity provide the first line of defense during the critical period just after the host’s exposure to a pathogen.
  • the immune system comprises cellular interactions that occur through specific receptor-ligand pairs, which signal in both directions, so that each cell receives instructions based on the temporal and spatial distribution of those signals.
  • Cells of the immune system include lymphocytes, monocytes/macrophages, dendritic cells, the closely related Langerhans cells, natural killer (NK) cells, mast cells, basophils, and other members of the myeloid lineage of cells.
  • NK natural killer
  • a series of specialized epithelial and stromal cells provide the anatomic environment in which immunity occurs, often by secreting critical factors that regulate growth and/or gene activation in cells of the immune system, which also play direct roles in the induction and effector phases of the response.
  • the cells of the immune system are found in peripheral organized tissues, such as the spleen, lymph nodes, Peyer’s patches of the intestine and tonsils. Lymphocytes also are found in the central lymphoid organs, the thymus, and bone marrow, where they undergo developmental steps that equip them to mediate the myriad responses of the mature immune system.
  • lymphocytes and macrophages comprise a recirculating pool of cells found in the blood and lymph, providing the means to deliver immunocompetent cells to sites where they are needed and to allow immunity that is generated locally to become generalized (Id.).
  • Leukocytes derived from the myeloid or lymphoid lineage provide either innate or specific adaptive immunity.
  • Myeloid cells include highly phagocytic, motile neutrophils, monocytes, and macrophages that provide a first line of defense against most pathogens.
  • Other myeloid cells including eosinophils, basophils, and their tissue counterparts, mast cells, are involved in defense against parasites and in the genesis of allergic reactions.
  • the Complement System a part of innate immunity, comprises over 30 different proteins that circulate in blood plasma. In the absence of an infection, the complement proteins circulate in an inactive form. In the presence of a pathogen, the complement proteins become activated to kill the pathogen either directly or by facilitating phagocytosis. There are two pathways in which the complement system acts on pathogens: the classical pathway, involving antibody- dependent cell mediated cytotoxicity; and the alternative pathway, involving complement dependent cell cytotoxicity. (Ricklin, Daniel, et al.
  • ADCC Antibody-dependent cell mediated cytotoxicity
  • ADCC is triggered through interaction of target ⁇ bound antibodies (belonging to IgG or IgA or IgE classes) with certain Fc receptor glycoproteins present on the effector cell surface that bind the Fc region of immunoglobulins (Ig).
  • Effector cells that mediate ADCC include natural killer (NK) cells, monocytes, macrophages, neutrophils, eosinophils and dendritic cells.
  • NK natural killer
  • monocytes monocytes, macrophages, neutrophils, eosinophils and dendritic cells.
  • ADCC is dependent on a number of parameters, such as density and stability of the antigen on the surface of the target cell, antibody affinity, and FcR ⁇ binding affinity.
  • ADCC complement dependent cell cytotoxicity
  • This alternative pathway is initiated by spontaneous hydrolysis and activation of the complement component C3, which binds directly to microbial surfaces.
  • the lectin pathway is initiated by soluble carbohydrate binding proteins that bind to specific carbohydrate molecules on microbial surfaces.
  • Each of the ADCC and CDCC mechanisms generates a C3 convertase that cleaves C3, leaving behind C3b bound to the pathogen’s surface and releasing C3a. This results in a number of cellular activities, including activation of the complement cascade, recruitment of phagocytic cells to the site of an infection, phagocytosis of pathogens by immune cells, and/or formation of a membrane attack complex (MAC) that disrupts pathogen cell membrane and causes cell lysis.
  • MAC membrane attack complex
  • Immune response Generally speaking, immune responses are initiated by an encounter between an individual and a foreign substance, e.g., an infectious microorganism.
  • the infected individual rapidly responds with both a humoral immune response with the production of antibody molecules specific for the antigenic determinants/epitopes of the immunogen, and a cell mediated immune response with the expansion and differentiation of antigen- specific regulatory and effector T-lymphocytes, including cells that produce cytokines and killer T cells, capable of lysing infected cells.
  • This secondary response generally consists of an antibody response that is more rapid, greater in magnitude and composed of antibodies that bind to the antigen with greater affinity and that are more effective in clearing the microbe from the body, and a similarly enhanced and often more effective T- cell response.
  • immune responses against infectious agents do not always lead to elimination of the pathogen (Paul, W. E., “Chapter 1: The immune system: an introduction,” Fundamental Immunology, 4th Edition, Ed. Paul, W. E., Lippicott-Raven Publishers, Philadelphia, (1999), at p.102).
  • the immune system is a tightly regulated network that is typically able to maintain homeostasis under normal physiological conditions in that the various actors of the immune system act cooperatively to avoid immune disequilibrium. Normally, when challenged with a foreign antigen, specific appropriate responses are initiated that are aimed at restoring equilibrium. However, under certain circumstances, this balance is not maintained and immune responses either under- or over-react. Cancer is an example of a situation where the immune response can be inefficient or unresponsive, resulting in uncontrolled growth of the cancer cells. Conversely, when the immune response over- reacts, this can result in conditions such as autoimmunity, chronic inflammation, and/or pathology following infection.
  • the immune system is tolerant of self-antigens, i.e., it can discriminate between antigenic determinants expressed on foreign substances, and antigenic determinants expressed by tissues of the host.
  • the capacity of the system to ignore host antigens referred to as immune tolerance or immunological tolerance, is an active process involving the elimination or inactivation of cells that could recognize self-antigens through immunologic tolerance (Fundamental immunology, 4th Edn, William E. Paul, Ed. Lippincott-Raven Publishers, Philadelphia, (1999), at p.2).
  • Innate immune cells recognize and discriminate between self and non-self through three distinct mechanisms: 1) innate leukocytes can recognize “nonself” from “non-infectious self” by recognizing conserved products not expressed by the host; 2) innate immune cells can recognize "missing self” by recogning self-proteins that are specific to the host and absent from pathogens; 3) innate immune cells can also recognize "altered self” by recognizing abnormal cell markers that are upregulated due to infection or cellular transformation. (Spear, Paul, et al.
  • Immune tolerance is classified into 1) central tolerance or 2) peripheral tolerance, depending on where the state is originally induced, i.e., whether it is in the thymus and bone marrow (central) or in other tissues and lymph nodes (peripheral). The biological mechanisms by which these forms of tolerance are established are distinct, but the resulting effect is similar (Raker V. K. et al. Front Immunol, Vol., 6(569): 1-11, (2015)).
  • Self-antigens are present due to endogenous expression, importation of antigen from peripheral sites via circulating blood, and in the case of thymic stromal cells, expression of proteins of other non-thymic tissues by the action of the transcription factor AIRE (Murphy, Kenneth. Janeway’s Immunobiology: 8th ed. Chapter 15: Garland Science. (2012), pp. 611–668; see also, Klein L. Cell, Vol. 163(4):794-795, (2015)). Those lymphocytes that have receptors that bind strongly to self-antigens are removed by means of apoptosis of the autoreactive cells, or by induction of anergy (Id. at pp.275–334).
  • Weakly autoreactive B cells may also remain in a state of immunological inactivity where they do not respond to stimulation of their B cell receptor.
  • Some weakly self-recognizing T cells are alternatively differentiated into natural regulatory T cells (nTreg cells), which act as sentinels in the periphery to lower potential instances of T cell autoreactivity (Id. at pp.611–668).
  • the deletion threshold is more stringent for T cells than for B cells, since T cells are the main populations of cells that can cause direct tissue damage.
  • Peripheral tolerance develops after T and B cells mature and enter the peripheral tissues and lymph nodes (Murphy, Kenneth. Janeway’s Immunobiology: 8th ed. Chapter 8: Garland Sciences. pp.275–334). It is set forth by a number of overlapping mechanisms that predominantly involve control at the level of T cells, especially CD4+ helper T cells, which orchestrate immune responses and give B cells the confirmatory signals that the B cells need in order to progress to produce antibodies. Inappropriate reactivity toward a normal self-antigen that was not eliminated in the thymus can occur, since the T cells that leave the thymus are relatively, but not completely, safe.
  • Na ⁇ ve CD4+ helper T cells differentiate into induced Treg cells (iTreg cells) in the peripheral tissue, or accordingly, in nearby lymphoid tissue (lymph nodes, mucosal-associated lymphoid tissue, etc.). This differentiation is mediated by IL-2 produced upon T cell-activation, and TGF- ⁇ from any of a variety of sources, including tolerizing dendritic cells (DCs) or other antigen presenting cells (Curotto de Lafaille et al. Immunity, 30(6): 626–635, (2009)).
  • DCs dendritic cells
  • Cancer is characterized by genetic instability of particular cells, but has also been described as a disorder of the immune system, based on the fact that the immune system fails, at least in certain segments of the afflicted human population, to respond optimally to cancerous cells that have taken on a distinctly non-self phenotype that should be recognized as foreign.
  • cancer cells consist mainly of self-antigens, in striking contrast to the situation with infectious organisms.
  • Some antigens that are classified as cancer antigens are actually normal antigens that are overexpressed, or normal antigens that have a mutation in only one or two amino acids in the polypeptide chain.
  • cancer cells down-regulate MHCs, and thus do not much present tumor cell-derived peptides by way of MHC.
  • cancer cells, and associated tumor-associated macrophages express cytokines that dampen the immune response (see, e.g., Yu et al (2007) Nature Rev. Immunol. 7:41 -51). This dampening is caused, for example, by the secretion of interleukin-10 (IL-10) by the cancer cells or by the associated macrophages.
  • IL-10 interleukin-10
  • Pathogens express a variety of naturally-occurring immune adjuvants, which take the form of TLR agonists and NOD agonists (see, e.g., Kleinnijenhuis et al (2011) Clin. Dev. Immunol. 405310 (12 pages)).
  • TLR agonists and NOD agonists
  • optimal activation of dendritic cells requires contact of an immune adjuvant with one or more TLRs expressed by the dendritic cell. Without activation of the dendritic cell, contact between the dendritic cell and T cells (immune synapse) fails to result in optimal activation of the T cell.
  • Tumor Immune Surveillance and Immune Editing [0030] While a functional cancer immunosurveillance process indeed exists that acts as an extrinsic tumor suppressor, it has become clear that the immune system can facilitate tumor progression, at least in part, by sculpting the immunogenic phenotype of tumors as they develop. Thi so-called “tumor immune editing” is divided into three phases: an elimination phase, an equilibrium phase, and an escape phase.
  • the elimination phase also known as immune surveillance, is the process by which the immune system identifies cancerous or pre-cancerous cells and eliminates them before they grow out of control. This phase can be complete when all cancerous or precancerous cells are eliminated.
  • tumors cells can either remain dormant or continue to evolve by accumulating further changes to genomic DNA that can modulate the antigens they present.
  • the immune system exerts a selective pressure on evolving cells, whereby the tumor cells that are less able to be recognized have a survival advantage.
  • the immune response is unable to recognize cells of the tumor, resulting in the transition to the escape phase, where tumor cells progressively grow out of control.
  • tumors are able to evolve under selective pressure from the immune response to selectively lose receptors that activate anti-tumor immune cells.
  • tumors that are NKG2D ligand-deficient in mice that are NKG2D expressing have been able to persist despite the loss of other tumor cells.
  • Tumors also shed ligands that activate anti-tumor immune cells through a variety of techniques, such as alternative splicing, cleavage, proteolytic shedding, or exosome secretion. This can be seen in the increase of soluble ligands, such as MIC (MHC class I-related molecules distantly related to the MHC class I proteins) and UL16-binding proteins (ULBPs) which bind to MICB), that have been identified in the sera of patients with various tumor types, including breast, lung, colon, and obarious carinomal, glioma, neuroblastoma, leukemia, and melanoma.
  • MIC MHC class I-related molecules distantly related to the MHC class I proteins
  • ULBPs UL16-binding proteins
  • the shedding of ligands and the existence of soluable ligands in the surrounding reaction environment can result in several distinct effects.
  • it decreases the level of activating ligands on the cell surface and thus reducing tumor cell susceptibility to attack by lymphocytes.
  • the shedding of NKG2D ligands from tumor cells reduces their ability to be cytolytic attacked by NKs or T cells.
  • the existence of soluable ligands in the reaction environment may desensitize NKs by binding to ligand receptors on lymphocytes and preventing interactions necessary to induce cytotoxic activity on tumor cells. Id.
  • Soluable ligands are also thought to downregulate the expression of their receptors.
  • cancer patients with elevated soluble MICA in their serum exhibited strongly reduced NKG2D staning of their peripheral blood CD8+ T cells.
  • Soluble ligands along with exosomes have also been postulated to bundle together and act in concert to impact lymphocyte immune responses.
  • tumors can lose the ability to express receptors and/or shed them in an effort to evade cell death.
  • tumors can evade immune recognition through disrupting MHC class I restricted antigen processing through the loss of class I itself or components in the class I pathway.
  • Tumor Microenvironment [0035] The tumor microenvironment provides a consistently effective barrier to immune cell function, because tumors actively downregulate all phases of anti-tumor immune responses using a spectrum of different strategies and mechanisms.
  • Tregs regulatory T cells
  • CD34+CD33+CD13+CD11b+CD15 ⁇ myeloid-derived cells
  • CD34+CD33+CD13+CD11b+CD15 ⁇ myeloid-derived cells
  • the Treg cells in the tumor are a heterogeneous population of regulatory CD3+CD4+ T cells, comprising natural Treg, antigen-specific Tr1 cells, and other less well defined subsets of suppressor cells.
  • T regulatory type 1 (Tr1) cells are induced in the tumor microenvironment, which is rich in IL-10, TGF- ⁇ , and prostaglandin E2 (PGE2), all of which have been shown to promote Tr1 generation (Id.).
  • Pr1 T regulatory type 1
  • PGE2 prostaglandin E2
  • MDSC granulocytic or polymorphonuclear
  • M- MDSC monocytic
  • PMN-MDSC represent more than 80% of all MDSC.
  • MDSCs include a small group (less than 3%) of cells with myeloid colony forming activity representing a mixture of myeloid progenitors and precursors.
  • PBMCs peripheral blood mononuclear cells
  • PMN-MDSCs are defined as CD11b+CD14 ⁇ CD15+ or CD11b+CD14 ⁇ CD66b+, and M-MDSC as CD11b+CD14+HLA-DR ⁇ /loCD15 ⁇ .
  • Lin ⁇ including CD3, CD14, CD15, CD19, CD56
  • HLA-DR ⁇ CD33+ cells contain mixed groups of MDSC comprising more immature progenitors.
  • e-MDSC early-stage MDSC
  • e-MDSC head-stage MDSC
  • the main targets of MDSCs are T cells.
  • the main factors implicated in MDSC-mediated immune suppression include arginase (ARG1), iNOS, TGF ⁇ , IL-10, COX2, indoleamine 2,3-dioxygenase (IDO) sequestration of cysteine, decrease of L- selectin expression by T-cells and many others.
  • AVG1 arginase
  • iNOS iNOS
  • TGF ⁇ IL-10
  • COX2 indoleamine 2,3-dioxygenase
  • IDO indoleamine 2,3-dioxygenase sequestration of cysteine
  • M-MDSC and PMN-MDSC utilize different mechanisms of immune suppression.
  • M-MDSC suppress T-cell responses both in antigen-specific and non-specific manners utilizing mechanisms associated with production of NO and cytokines (reviewed in (Id., citing Gabrilovich, DE et al, Coordinated regulation of myeloid cells by tumours. Nat Rev Immunol.(2012)12:253– 68).
  • PMN-MDSCs are capable of suppressing immune responses primarily in an antigen-specific manner. Induction of antigen-specific T-cells tolerance is one of the major characteristics of these cells (Id., citing Koehn BH, et al. GVHD- associated, inflammasome-mediated loss of function in adoptively transferred myeloid- derived suppressor cells.
  • PNT also reduces the binding of antigenic peptides to MHC molecules on tumor cells (Id., citing Lu, T. et al., Tumor-infiltrating myeloid cells induce tumor cell resistance to cytotoxic T cells in mice. J. Clinical Investigation. (2011) 121: 4015–29) and blocks T-cell migration by nitrating T-cell specific chemokines (Id., citing Molon, B. et al., Chemokine nitration prevents intratumoral infiltration of antigen- specific T cells. J Exp Med. (2011) 208: 1949–62).
  • MDSCs promote tumor progression by affecting the remodeling of the tumor microenvironment and tumor angiogenesis via production of VEGF, bFGF, Bv8, and MMP9 (Id., citing Tartour, E. et al., Angiogenesis and immunity: a bidirectional link potentially relevant for the monitoring of antiangiogenic therapy and the development of novel therapeutic combination with immunotherapy. Cancer Metastasis Rev. (2011) 30: 83–95; Casella, I., et al., Autocrine-paracrine VEGF loops potentiate the maturation of megakaryocytic precursors through Flt1 receptor. Blood. (2003) 101:1316–23; Shojaei, F.
  • NKTs are the only cell type that is able both to interact with immature DCs, inducing their maturation, and to augment the function of both NK and CD8+ T cells. NKTs induce maturation of DCs, allowing DCs to present tumor antigens to CD8+ T cells. The activated CD8+ T cells can then eliminate HLA Class I - positive tumor cells. NKTs also produce IFN ⁇ which activates NKs thereby killing HLA Class I - negative tumor targets. (Terabe, M., & Berzofsky, J. A. (2012). Natural killer T cells balancing the regulation of tumor immunity. New York, NY: Springer).
  • NKTs can form bidirectional interactions with B cells, which can present lipid antigens to some NKTs through CD1d. In return, NKTs can license B cells to effectively prime and activate antitumor CTL responses and provide B call help to enhance and sustain a humoral response.
  • B cells which can present lipid antigens to some NKTs through CD1d.
  • NKTs can license B cells to effectively prime and activate antitumor CTL responses and provide B call help to enhance and sustain a humoral response.
  • TAMs Tumor associated macrophages
  • TAMs are prominent immunosuppressive immune cells present in the tumor microenvironment. TAMs contribute to tumor progression by enhancing angiogenesis, tumor cell invasion, suppression of NKs and T cell responses.
  • NKTs have been found to o-localize with CD1d-expressing TAMs in neuroblastomas and kill TAMs in an IL-15 and CD1d-restricted manner.
  • NKTs can also alter the effects of CD1d+ myeloid-derived suppressor cell (MDSC)-mediated immune suppression. MDSCs often acumulate during tumor growth and contribute to immune escape and tumor progression. Research has found that NKTs may inhibit the arginate 1 and nitrous oxide synthase-mediated suppressive activity of MDSCs. This ability to inhibit the immunosuppressive activity of MDSCs has been reported to be dependent on CD1d and CD40 interactions. (Id.).
  • MDSC myeloid-derived suppressor cell
  • NKTs can promote strong antitumor immunity
  • other types have been known to suppress antitumor immune responses and play more of a regulatory role, similar to Tregs and MDSCs.
  • the balance between immunomodulating and immunosuppressive NKTs can determine whether immune responses to tumors will be activated resulting in tumor elimination, or will be suppressed, allowing the tumor to grow. (Terabe, M., & Berzofsky, J. A. (2012). Natural killer T cells balancing the regulation of tumor immunity. New York, NY: Springer).
  • Some NKT types have been shown to promote the accumulation of MDSCs in tumor-bearing mice.
  • NKTs have also been shown to inhibit the proinflammatory functions of other NKT cell types, conventional T cells, and DCs.
  • immunosuppressive NKTs One attribute of immunosuppressive NKTs is their elevated production of IL-13 and IL-4 cytokines, which are capable of skewing the cytokine response predominantly towards the tumor promoting Th2 type.
  • immunosuppressive type NKTs have been shown to suppress cytotoxic T cells through IL-13 production via an IL4R and STAT6 axis, and also induce MDSCs producing immunosuppressive cytokine TGF-B. (Nair and Dhodapkar (2017). “Natural Killer T Cells in Cancer Immunotherapy.” Frontiers in Immunology 8:1178).
  • Monoclonal antibodies block a specific target on the outside of cancer cells and/or in the area around the cancer.
  • Antibody therapies such as Trastuzumab (Herceptin®), which is effective against tumors that overexpress the HER2/neu protein, and Cetuximab (Erbitux®), an epidermal growth factor receptor inhibitor antineoplastic agent, have yielded considerable improvement in clinical outcome, as measured by, e.g. the recurrence rate, progression free survival and overall survival.
  • Small molecule drugs have been designed against specific targets.
  • angiogenesis inhibitors keep tissue around the tumor from making blood vessels, thereby starving the tumor (e.g., bevacizumam (Avastin®); imatinib mesylate (GLEEVECTM); tamoxifen attenuates VEGF-mediated angiogenesis (antiangiogenic effect mediated by EGF (McNamara, DA et al., Eur. J. Surg. Oncol. (2001) 27(8): 714- 718) [0050]
  • Immunotherapy is a type of therapy that uses substances to stimulate or suppress the immune system to help the body fight cancer, infection and other diseases. Some types of immunotherapy only target certain cells of the immune system. Others affect the immune system more generally.
  • Anti-cancer immunotherapy has been an unattained goal for many years.
  • One difficulty is that target antigens are often tissue specific molecules found on both cancer cells and normal cells, and either do not elicit immunity or show non-specificity regarding cell killing (Kaufman and Wolchok eds., General Principles of Tumor Immunotherapy, Chpt 5, 67-121 (2007)).
  • tumor cells have features that make immune recognition difficult, such as loss of expression of antigens that elicit immune response, lack of major histocompatibility (MHC) class II, and downregulation of MHC class I expression. These features can lead to non-recognition of tumor cells by both CD4+ and CD8+ T cells (Id.).
  • Dendritic cell vaccines are vaccines made of antigens and dendritic antigen- presenting cells (APCs). Vaccination strategies involving DCs to induce tumor-specific effector T cells that can reduce the tumor mass specifically and that can induce immunological memory to control tumor relapse have been developed. For example, DCs generated ex vivo by culturing hematopoietic progenitor cells or monocytes with cytokine combinations have been tested as therapeutic vaccines in cancer patients for more than a decade (Ueno H, et al., Immunol. Rev. (2010) 234: 199-212).
  • sipuleucel-T also known as APC 8015
  • APC 8015 a cellular product based on enriched blood APCs that are briefly cultured with a fusion protein of prostatic acid phosphatase (PAP) and granulocyte macrophage colony-stimulating factor (GM-CSF)
  • PAP prostatic acid phosphatase
  • GM-CSF granulocyte macrophage colony-stimulating factor
  • DC-based vaccines are safe and can induce the expansion of circulating CD4+ T-cells and CD8+ T-cells specific for tumor antigens.
  • sipuleucel-T has been approved by the US Food and Drug Administration (FDA) for the treatment of metastatic prostate cancer, thereby paving the clinical development and regulatory path for the next generation of cellular immunotherapy products (Palucka K and Banchereau J, Nature Reviews Cancer (April 2012) 12: 265-276).
  • FDA US Food and Drug Administration
  • DC-tumor cell fusions provide a greater variety of tumor antigens, but have met with limited success in human trials, likely due to the autologous components required, the heterogeneity of the product caused by maturation of DC cells, and variations in antigen loading (Browning, M., Antigen presenting cell/tumor cell fusion vaccines for cancer, Human Vaccines & Immunotherapeutics 9:7, 1545–1548; July 2013; Butterfield, L., Dendritic Cells in Cancer Immunotherapy Clinical Trials: Are We Making Progress?, Frontiers of Immunology, 20134: 454).
  • Immune checkpoint inhibitors e.g., PD-1 and CTLA4 inhibitors
  • PD-1 and CTLA4 inhibitors have been reported to block discrete checkpoints in an active host immune response allowing an endogenous anti-cancer immune response to be sustained.
  • immune checkpoints refers to the array of inhibitory pathways necessary for maintaining self-tolerance and that modulate the duration and extent of immune responses to minimize damage to normal tissue.
  • Immune checkpoint molecules such as PD-1, PD- L1, CTLA-4 are cell surface signaling receptors that play a role in modulating the T-cell response in the tumor microenvironment. Tumor cells have been shown to utilize these checkpoints to their benefit by up-regulating their expression and activity.
  • TIGIT a member of the Ig super family and an immune inhibitory receptor
  • TIGIT is overexpressed on tumor antigen-specific CD8+ T cells and CD8+ TILs and plays a key role in the suppression of T-cell proliferation and activation; it is involved in tumor cell immune evasion, and the inhibition of antiviral immune responses.
  • Anti-TIGIT monoclonal antibody OMP-313M32 targets this immune checkpoint and prevents T cell downregulation.
  • anti-TIGIT monoclonal antibody OMP-313M32 binds to TIGIT expressed on various immune cells, including T cells, and prevents the interaction of TIGIT with its ligands CD112 (nectin-2; poliovirus receptor related-2; PVRL2) and CD155 (poliovirus receptor; PVR; nectin-like protein 5; NECL- 5).
  • CD112 nectin-2; poliovirus receptor related-2; PVRL2
  • CD155 poliovirus receptor
  • PVR nectin-like protein 5; NECL- 5
  • CD112 and CD155 free to interact with the costimulatory receptor CD226 (DNAX Accessory molecule-1; DNAM-1), which is expressed on immune cells, such as natural killer (NK) cells and CD8-positive T cells, and leads to CD226 dimerization and CD226-mediated signaling.
  • DNAM-1 costimulatory receptor CD226
  • TIM-3 a transmembrane protein and immune checkpoint receptor, is associated with tumor-mediated immune suppression.
  • the anti-TIM-3 monoclonal antibody TSR-022 binds to TIM-3 expressed on certain T cells, including tumor infiltrating lymphocytes (TILs). This abrogates T-cell inhibition, activates antigen-specific T lymphocytes and enhances cytotoxic T-cell-mediated tumor cell lysis, which results in a reduction in tumor growth.
  • TILs tumor infiltrating lymphocytes
  • LAG-3 is a member of the immunoglobulin superfamily (IgSF) and binds to major histocompatibility complex (MHC) class II. LAG-3 expression on TILs is associated with tumor-mediated immune suppression.
  • Relatlimab (previously known as BMS-986016, Bristol-Myers Squibb) is a monoclonal antibody directed against the inhibitor receptor lymphocyte activation gene-3 (LAG-3), with potential immune checkpoint inhibitory and antineoplastic activities.
  • LAG-3 inhibitor receptor lymphocyte activation gene-3
  • relatlimab binds to LAG-3 on tumor infiltrating lymphocytes (TILs), which may activate antigen-specific T lymphocytes and enhance cytotoxic T cell- mediated tumor cell lysis, which leads to a reduction in tumor growth.
  • TILs tumor infiltrating lymphocytes
  • Anti-LAG-3 monoclonal antibody LAG525 is a humanized monoclonal antibody directed against the inhibitory receptor lymphocyte activation gene-3 (LAG-3), with potential immune checkpoint inhibitory and antineoplastic activities.
  • LAG-3 inhibitory receptor lymphocyte activation gene-3
  • the anti-LAG-3 monoclonal antibody LAG525 binds to LAG-3 expressed on tumor-infiltrating lymphocytes (TILs) and blocks its binding with major histocompatibility complex (MHC) class II molecules expressed on tumor cells. This activates antigen-specific T-lymphocytes and enhances cytotoxic T-cell-mediated tumor cell lysis, which leads to a reduction in tumor growth.
  • TILs tumor-infiltrating lymphocytes
  • MHC major histocompatibility complex
  • Anti-LAG3 monoclonal antibody TSR-033 is a humanized, immunoglobulin G4 (IgG4) monoclonal antibody directed against the inhibitory receptor lymphocyte activation gene 3 protein (LAG3; LAG-3), with potential immune checkpoint inhibitory and antineoplastic activities.
  • IgG4 immunoglobulin G4
  • TIGIT targeting agent MK-7684 is an antagonistic agent targeting the co- inhibitory molecule and immune checkpoint inhibitor T-cell immunoglobulin (Ig) and immunoreceptor tyrosine-based inhibitory motif (ITIM) domains (TIGIT; T-cell immunoreceptor with Ig and ITIM domains; T-cell immunoglobulin and ITIM domain), with potential immune checkpoint inhibitory and antineoplastic activities.
  • Ig immune checkpoint inhibitor T-cell immunoglobulin
  • ITIM immunoreceptor tyrosine-based inhibitory motif domains
  • MK-7684 targets and binds to TIGIT expressed on various immune cells, particularly on tumor-infiltrating T lymphocytes (TILs) and natural killer (NK) cells, thereby preventing the interaction of TIGIT with its ligands CD112 (nectin-2; poliovirus receptor related-2; PVRL2) and CD155 (poliovirus receptor; PVR; nectin-like protein 5; NECL-5), which are expressed on T cells, NK cells and certain cancer cells.
  • CD112 nectin-2; poliovirus receptor related-2; PVRL2
  • CD155 poliovirus receptor
  • PVR nectin-like protein 5
  • NECL-5 nectin-like protein 5
  • DNAM-1 costimulatory receptor CD226
  • CAR-T Chimeric antigen receptor T-cell therapy
  • CARs are engineered molecules that can be introduced into T cells to enable them to target tumor antigens (Frey, N.V., Porter, D.L., The Promise of Chimeric Antigen Receptor T-Cell Therapy, Oncology (2016); 30(1)) pii 219281).
  • CAR T cells have been shown to have some efficacy against hematologic malignancies and to a lesser extent solid tumors.
  • CAR T therapy has been shown to cause several types of toxicities, including cytokine release syndrome, neurological toxicity, non-tumor recognition, and anaphylaxis (Bonifant CL, et al., Toxicity and management in CAR T-cell therapy, Molecular Therapy — Oncolytics (2016) 3, 16011).
  • GVAXTM is a GM-CSF gene transduced tumor vaccine within either an autologous or allogeneic population of tumor cells. It was believed that GM-CSF secretion of genetically modified tumor cells would stimulate cytokine release at the vaccine site to activate antigen presenting cells to induce a tumor specific cellular immune response (Eager, R. & Nemunaitis, J., GM-CSF Gene-Transduced Tumor Vaccines, Molecular Therapy, Vol. 12, No.1, 18 (July 2005)). However, GVAXTM yielded only limited clinical responses.
  • Tumor cell lines possess a broad array of antigens, many of which are common to a particular tumor type, as well as some that are shared across tumors. Many immunomodulatory components defined as a result of decades of research can be used to genetically engineer these tumor cell lines. An allogeneic approach to immunoactivation in the context of such allogeneic tumor cell lines modified to express at least 2/3/4 immunomodulators has been described. [0066] The described invention provides a method for effective tumor cell killing through adoptive transfer of in vitro (or in vivo) activated mononuclear cells.
  • the method described herein involves the in vitro immune activation of mononuclear cells following their co-incubaton with allogeneic engineered leukocyte stimulator cells (ENLSTTM cells) encoding at least three (3) immunomodulator peptides.
  • EDLSTTM cells allogeneic engineered leukocyte stimulator cells
  • the activated mononuclear cells, or subpopulations thereof comprised of serial killer cells are useful for passive adoptive transfer of the cell product to the patient. Since the cells are activated in a physiologic manner, the stimulated cells retain homeostatic control mechanisms of their cell type.
  • immortalizing the subpopulations comprising serial killer cells represents the possibility of creating an infinite supply.
  • the described invention provides a method for in vitro activation of cytotoxic T-cell populations followed by passive immunization of a cancer patient not currently under the influence of an immunosuppressive regimen with a composition comprising a cell product comprising an activated and expanded population of mononuclear cells comprising activated and expanded subpopulations of serial killer cells comprising, under sterile conditions: (a) Inducing an immune response in vitro by: (1) isolating a population of mononuclear cells (MNCs) from a biological sample; (2) preparing a population of engineered leukocyte stimulator cells comprising a population of tumor cells expressing one or more tumor specific antigens and genetically engineered to stably express a core group of three immunomodulatory molecules wherein the core group of immunomodulator molecules is OX40 Ligand (OX40L), CD27 Ligand (CD70) and CD28 Ligand (CD28L); (3) contacting the population of MNC
  • MNCs mononuclear cells
  • OX40L OX40
  • the amino acid sequence of a wild type OX40 Ligand codon optimized for human expression is SEQ ID NO: 108
  • the amino acid sequence of a wild type CD27 Ligand codon optimized for human expression is SEQ ID NO: 109
  • the amino acid sequence of a wild type CD28 Ligand codon optimized for human expression is SEQ ID NO:110, SEQ ID NO: 111, or both.
  • the engineered leukocyte stimulator cell population expressing one or more tumor specific antigens and genetically engineered to express a core group of three immunomodulatory molecules is additionally genetically engineered to express an additional number of immunomodulatory molecules comprising 3-25 immunomodulators (“R groups”).
  • CD28 ligand comprises CD80, CD86 or both.
  • the engineered leukocyte stimulator cell transduced or transformed to stably express the core immunomodulators OX40 Ligand, CD27 Ligand, and CD28 Ligand comprising CD80, CD86 or both is effective to synergistically induce a two-log expansion of activated CD8+ cells in peripheral blood mononuclear cells compared to an unmodified control cell line.
  • step (b)(i) subpopulations of the activated MNCs are identified and isolated by flow cytometry.
  • the activated and expanded MNCs comprise activated and expanded supopulations of serial killer cells comprising one or more of an NK cell population, an NKT cell population, a CD8 CTL cell population, a CD4 cell population, and a TCR ⁇ cell population.
  • the population of mononuclear cells is derived from peripheral blood or cord blood.
  • the population of mononuclear cells is autologous to the subject.
  • the population of mononuclear cells is allogeneic to the subject.
  • cytotoxic serial killer activity of the activated and expanded serial killer cell populations is specific to cancer antigens of the genetically engineered leukocyte stimulator cells, without affecting normal cells.
  • cytotoxic serial killer activity of the activated and expanded serial killer cell population(s) is effective to kill cancer cells regardless of cancer type, without affecting normal cells.
  • the administering is in conjunction with a compatible inhibitor of immune checkpoints.
  • the compatible immune checkpoints include one or more of PD-1, PD-L1, TIM-3, TIGIT, and LAG-3.
  • the described invention provides a cell product comprising a population of expanded and activated mononuclear cells comprising activated subpopulations of cytotoxic serial killer cells prepared by a process comprising: (a) isolating a population of mononuclear cells (MNCs) from a biological sample; (b) preparing a population of engineered leukocyte stimulator cells comprising a population of tumor cells expressing one or more tumor specific antigens and genetically engineered to express a core group of three immunomodulatory molecules wherein the core group of immunomodulator peptides is OX40 Ligand (OX40L), CD27 Ligand (CD70) and CD28 Ligand (CD28L); (c) contacting the population of MNCs of step (a) with the engineered leukocyte stimulator cells of step (b) in vitro to form an activated population of MNCs comprising activated subpopulations of cytotoxic serial killer cells; (d) expanding the activated population of MNCs comprising activated
  • MNCs mononu
  • the activated and expanded MNCs comprising activated and expanded subpopulations of cytotoxic serial killer cells comprising one or more of an NK cell population, an NKT cell population, a CD8 CTL cell population, a CD4 cell population, and a TCR ⁇ cell population.
  • the cytotoxic serial killer cells are tumoricidal.
  • the amino acid sequence of a wild type OX40 Ligand codon optimized for human expression is SEQ ID NO: 108
  • the amino acid sequence of a wild type CD27 Ligand codon optimized for human expression is SEQ ID NO: 109
  • the amino acid sequence of a wild type CD28 Ligand codon optimized for human expression is SEQ ID NO: 110, SEQ ID NO: 111, or both.
  • the contacting in step (c) is effective to synergistically induce a two-log expansion of CD8+ cells.
  • the biological sample is peripheral blood or cord blood.
  • FIG.1 shows a schematic of vectors 1 through 7.
  • FIG.2 shows a schematic of the organization of the scFv-anti-biotin-G3hinge- mIgG1 vector 1.
  • FIG.3 shows a schematic of the organization of the full anti-biotin – G3hinge-mIgG1 vector 2.
  • FIG.4 shows a schematic of the organization of the sGM-CSF/ires/mFLT3L vector 3.
  • FIG.5 shows a schematic of the organization of the sFLT3L/ires/(FLT3 signal-GM-CSF-Tm) vector 4.
  • FIG.6 shows a schematic of the organization of the mCD40L vector 5.
  • FIG.7 shows a schematic of the organization of the mTNFa vector 6.
  • FIG.8 shows a schematic of the organization of the mRANKL /ires/FLT3 signal-V5- scFV anti-biotin-Tm vector 7.
  • FIG.9 shows a schematic of vector 44.
  • FIG.10 shows a schematic of vector 97.
  • FIG.11 shows a schematic of vector 84.
  • FIG.12 shows a schematic of vector 29.
  • FIG.13 shows a schematic of vector 107.
  • FIG.14 shows a schematic of vector 116.
  • FIG.15 shows a schematic of vector 86.
  • FIG.16 shows a schematic of vector 18.
  • FIG.17 shows a schematic of vector 17.
  • FIG.18 shows a schematic of vector 98.
  • FIG.19 shows a schematic of vector 30.
  • FIG.20 shows a schematic of vector 109.
  • FIG.21 shows a schematic of vector 106.
  • FIG.22 shows a schematic of vector 16.
  • FIG.23 shows a schematic of vector 83.
  • FIG.24 shows a schematic of vector 31.
  • FIG.25 shows a schematic of vector 12.
  • FIG.26 shows a schematic of vector 99.
  • FIG.27 shows a schematic of vector 121.
  • FIG.28 shows a schematic of vector 105.
  • FIG.29 shows a schematic of vector 32.
  • FIG.30 shows a schematic of vector 37.
  • FIG.31 shows a schematic of vector 22.
  • FIG.32 shows a schematic of vector 19.
  • FIG.33 shows a schematic of vector 20.
  • FIG.34 shows a schematic of vector 89.
  • FIG.35 shows a schematic of vector 21.
  • FIG.36 shows a schematic of vector 23.
  • FIG.37 shows a schematic of vector 108.
  • FIG.38 shows a schematic of vector 15.
  • FIG.39 shows a schematic of vector 124.
  • FIG.40 shows a schematic of vector 65.
  • FIG.41 shows a schematic of vector 64.
  • FIG.42 shows a schematic of vector 88.
  • FIG.43 shows a schematic of vector 96.
  • FIG.44 shows a schematic of vector 14.
  • FIG.45 shows a schematic of vector 119.
  • FIG.46 shows a schematic of vector 120.
  • FIG.47 shows a schematic of vector 45.
  • FIG.48 shows a schematic of vector 60.
  • FIG.49 shows a schematic of vector 59.
  • FIG.50 shows a schematic of vector 8.
  • FIG.51 shows a schematic of vector 128.
  • FIG.52 shows a schematic of vector 35.
  • FIG.53A and 53B show flow cytometry forward (FSC) and side scatter (SSC) plots for size and granularity after incubating parent line SKMEL2 (53A) and SKMEL-2 containing immunomodulators 14, 18 and 30 (FIG.53B) with PBMCs in a mixed lymphocyte tumor response assay.
  • the dotted oval in FIG.53A and 53B indicates the lymphocyte gate.
  • FIG.53C and FIG.53D show the CD8 population after incubation of the PBMCs in the mixed lymphocyte tumor response assay with the parent cell line (FIG.
  • FIG.54A and 54B show results of characterization of PBMC lymphocyte population induction by SK-MEL-2 derived engineered leukocyte stimulator cells (ENLSTTM cells) compared to induction by unmodified SK-MEL-2 parental tumor cell line in vitro by phase contrast microscopy and flow cytometry.
  • FIG.54A shows day 9 PBMCs induced with unmodified parental 5K-MEL-2 cells, left, microscopy; right flow cytometry.
  • FIG.54B shows day 9 PBMC induced with 5K-MEL-2 derived 14-18-30 ENLSTTM cells; left, microscopy, right flow cytometry.
  • the oval outline in the flow cytometry in FIG.54A corresponds to live unmodified SKMEL 2 parent tumor cells.
  • FIG.54B shows that the ENLSTTM cells are eliminated by the induced PBMCs.
  • FIG.55A, 55B, 55C, 55D, 55E, and 55F shows results of characterization of the tumoricidal properties of PBMCs following their in vitro activation by 14-18-30 expressing SK-MEL-2-derived ENLSTTM cells with SK-MEL-2 cells, SK-MEL-28 cells, and M14 cells by flow cytometry forward (FSC) and side scatter (SSC) plots for size and granularity.
  • FSC flow cytometry forward
  • SSC side scatter
  • FIG.55A, FIG.55C, and FIG.55E show day 5, secondary mixed lymphocyte tumor response assay
  • FIG.55A SK-MEL-2 derived ENLSTTM cells coincubated with unmodified SK-MEL-2 cells
  • FIG.55C unmodified SK-MEL-28 cells
  • FIG.55E unmodified M14 cells.
  • FIG.55 B, FIG.55D, and FIG.55F show day 5, secondary mixed lymphocyte tumor response assay with SK-MEL-2 derived ENLSTTM cell-activated MNCs coincubated with: FIG.55B unmodified SK-MEL-2 cells;
  • FIG. 55D unmodified SK-MEL-28 cells;
  • FIG.55F unmodified M14 cells.
  • FIG.56A shows a CyTOF mass cytometry single-cell phenotype analysis map of PBMC populations
  • FIG.56B, 56C, 56D, 56E, and 56F show visNE density contour plots of CyTOF staining following PBMC induction by parental (FIG.56B) or immunomodulator expressing SK-MEL-2 derived ENLSTTM cells (FIG.56C, 56D 56D, 56E, 56F) after 9 days in primary mixed lymphocyte tumor response assay.
  • FIG.56B shows a PBMC subpopulation shift following induction by parental SK MEL-2 cells; note that an NK cell population and a myeloid cell population are absent;
  • FIG.56C shows a PBMC subpopulation shift following induction by ENLSTTM cells transduced or transfected with vector 3, showing induction of B and myeloid cells.
  • FIG.56D showing PBMC subpopulation shift following induction by ENLSTTM cells transduced or transfected with vectors 3 and 4, showing induction of B cells
  • FIG.56E showing PBMC subpopulation shift following induction by ENLSTTM cells transduced or transfected with vectors 3, 4 and 5, showing induction of B cells and Myeloid cells
  • FIG.56F showing PBMC subpopulation shift following induction by ENLSTTM cells transduced or transfected with vectors 3, 4 and 6.
  • FIG.57A, 57B, 57C, 57D, 57E, and 57F show by flow cytometry (FIG.57A) and phase contrast microscopy (FIG.57B, FIG.57C, FIG.57D, FIG.57E, and FIG.57F) that PBMCs previously coincubated with 14-18-30 containing ENLSTTM cells are able to lyse unmodified tumor cells. At least two distinct subpopulations of the PBMC’s previously activated by coincubation with 14-18-30 ENLSTTM cells are capable of cytolysis of unmodified tumor cells.
  • FIG.57A shows the sorting gates for CD56, CD3 and CD8 of PBMCs following a 9 day coincubation with 14-18-30 expressing ENLSTTM cells in a primary mixed lymphocyte tumor cellassay
  • the yellow arrows in FIG.57B and FIG.57D indicate that the smaller cells are lymphocytes and the larger cells allogeneic tumor cells.
  • FIG.58 is a box and whisker plot of shows results of a xenograft treatment study using NGS mice. The ends of each box are the upper and lower quartiles; the median is marked by a vertical line inside the box, and the whiskers are the two lines outside the box that extend to the highest and lowest observations.
  • Human tumor cells were implanted on the flank of NGS (NOD scid gamma) mice. The tumors were allowed to grow to 150 mm 3 . Mice were divided into two groups, a control and a treated group, with 6 mice per group.
  • mice in the control group were inoculated with vehicle only, and mice in the treated group were inoculated with 3 x 10 6 PBMCs activated by 14-18-30 expressing ENLSTTM cells (“SUPLEXATM cells”). Tumor size was measured at intervals through 36 days after inoculation. Divergence between the two groups appeared within 5 days. After day 22, the divergence became statistically significant (*P ⁇ 0.05; ** P ⁇ 005).
  • SUPLEXATM cells ENLSTTM cells
  • peptide is a reference to one or more peptides and equivalents thereof known to those skilled in the art, and so forth.
  • activation or “lymphocyte activation” refers to stimulation of lymphocytes by specific antigens, nonspecific mitogens, or allogeneic cells resulting in synthesis of RNA, protein and DNA and production of lymphokines; it is followed by proliferation and differentiation of various effector and memory cells.
  • a mature B cell can be activated by an encounter with an antigen that expresses epitopes that are recognized by its cell surface immunoglobulin Ig.
  • the activation process may be a direct one, dependent on cross-linkage of membrane Ig molecules by the antigen (cross- linkage-dependent B cell activation) or an indirect one, occurring most efficiently in the context of an intimate interaction with a helper T cell (“cognate help process”).
  • T-cell activation is dependent on the interaction of the TCR/CD3 complex with its cognate ligand, a peptide bound in the groove of a class I or class II MHC molecule.
  • the molecular events set in motion by receptor engagement are complex.
  • tyrosine kinases leading to the tyrosine phosphorylation of a set of substrates that control several signaling pathways.
  • These include a set of adapter proteins that link the TCR to the ras pathway, phospholipase C ⁇ 1, the tyrosine phosphorylation of which increases its catalytic activity and engages the inositol phospholipid metabolic pathway, leading to elevation of intracellular free calcium concentration and activation of protein kinase C, and a series of other enzymes that control cellular growth and differentiation.
  • the soluble product of an activated B lymphocyte is immmunoglobulins (antibodies).
  • the soluble product of an activated T lymphocyte is lymphokines.
  • administering refers without limitation to contact of an exogenous ligand, reagent, placebo, small molecule, pharmaceutical agent, therapeutic agent, diagnostic agent, or composition to the subject, cell, tissue, organ, or biological fluid, and the like.
  • administering can refer, e.g., to therapeutic, pharmacokinetic, diagnostic, research, placebo, and experimental methods.
  • administering also encompasses in vitro and ex vivo treatments, e.g., of a cell, by a reagent, diagnostic, binding composition, or by another cell.
  • allogeneic means that a donor and a recipient are of different genetic makeup, but of the same species.
  • an "allogeneic cell” refers to a cell that is not derived from the individual to which the cell is to be administered, that is, it has a genetic constitution different from the recipient individual.
  • An allogeneic cell is generally obtained from the same species as the recipient individual to which the cell is to be administered.
  • the allogeneic cell can be a human cell, as disclosed herein, for administering to a human patient.
  • an "allogeneic serial killer cell population” refers to a serial killer cell population including its constituent cell types (such as NKs, NKTs, and CTLs) that is derived from a donor of genetic makeup different from the recipient individual to whom the allogeneic serial killer cell population is to be administered.
  • the terrm “allorecognition” as used herein refers to the recognition by T cells of MHC molecules (HLA in humans) other than self.
  • the term “direct allorecogition” as used herein refers to the process by which CD4+ and CD8+ T cells recognize either intact allo-HLA molecules (HLA class II and I, respectively) on donor antigen-presenting cells (APCs).
  • amino acid residue or “amino acid” or “residue” are used interchangeably to refer to an amino acid that is incorporated into a protein, a polypeptide, or a peptide, including, but not limited to, a naturally occurring amino acid and known analogs of natural amino acids that can function in a similar manner as naturally occurring amino acids.
  • the amino acids may be L- or D-amino acids.
  • amino acid may be replaced by a synthetic amino acid, which is altered so as to increase the half-life of the peptide, increase the potency of the peptide, or increase the bioavailability of the peptide.
  • the single letter designation for amino acids is used predominately herein.
  • A is alanine
  • C cysteine
  • D is aspartic acid
  • E is glutamic acid
  • F is phenylalanine
  • G is glycine
  • H histidine
  • I is isoleucine
  • K is lysine
  • L leucine
  • M methionine
  • N is asparagine
  • P proline
  • Q is glutamine
  • R arginine
  • S is serine
  • T is threonine
  • V valine
  • W is tryptophan
  • Y tyrosine.
  • the term “antigen presenting cell” or “APC” as used herein refers to highly specialized cells that can process antigens and display their peptide fragments on the cell surface together with other co-stimulatory proteins required for activating na ⁇ ve T cells.
  • the main antigen presenting cells are dendritic cells (DCs), macrophages and B cells.
  • DCs dendritic cells
  • macrophages macrophages
  • B cells dendritic cells
  • autologous as used herein means derived from the same individual.
  • autocrine signaling as used herein refers to a type of cell signaling in which a cell secretes signal molecules that act on itself or on other adjacent cells of the same type.
  • binding and its other grammatical forms means a lasting attraction between chemical substances.
  • binding specificity involves both binding to a specific partner and not binding to other molecules. Functionally important binding may occur at a range of affinities from low to high, and design elements may suppress undesired cross- interactions. Post-translational modifications also can alter the chemistry and structure of interactions. “Promiscuous binding” may involve degrees of structural plasticity, which may result in different subsets of residues being important for binding to different partners. “Relative binding specificity” is a characteristic whereby in a biochemical system, a molecule interacts with its targets or partners differentially, thereby impacting them distinctively depending on the identity of individual targets or partners.
  • CD3 is a protein complex composed of four distinct chains. In mammals, the complex contains a CD3 ⁇ chain, a CD3 ⁇ chain, and two CD3 ⁇ chains, which associate with the T cell receptor (TCR) and the ⁇ -chain to generate an activation signal in T lymphocytes. Together, the TCR, the ⁇ -chain and CD3 molecules comprise the TCR complex.
  • the intracellular tails of CD3 molecules contain a conserved motif known as the immunoreceptor tyrosine-based activation motif (ITAM), which is essential for the signaling capacity of the TCR.
  • ITAM immunoreceptor tyrosine-based activation motif
  • the CD3 chain can bind ZAP70 (zeta associated protein), a kinase involved in the signaling cascade of the T cell.
  • ZAP70 zeta associated protein
  • cell line means a permanently established cell culture developed from a single cell and therefore consisting of a population of cells with a uniform genetic and functional makeup that will proliferate indefinitely.
  • chemokine refers to chemotactic cytokines, which constitute a family of low molecular mass (8-11 kDa) structurally-related proteins with diverse immune and neural functions (Mackay C.R. Nat Immunol., Vol. 2: 95-101, (2001); Youn B. et al.
  • Chemokines are essential molecules in directing leucocyte migration between blood, lymph nodes and tissues. They constitute a complex signaling network because they are not always restricted to one type of receptor (Loetscher P. et al. J. Biol. Chem. (2001). 276: 2986–2991). Chemokines affect cells by activating surface receptors that are seven- transmembrane-domain G-protein-coupled receptors.
  • Leukocyte responses to particular chemokines are determined by their expression of chemokine receptors.
  • the binding of the chemokine to the receptor activates various signaling cascades, similar to the action of cytokines that culminate in the activation of a biological response.
  • Secretion of the ligands for the CCR5 receptor regulated upon activation normal T cell expressed and secreted (RANTES), macrophage inflammatory protein (MIP)-1 ⁇ / and MIP-1 ⁇ (Schrum S. et al. J Immunol. (1996) 157: 3598–3604) and the ligand for CXC chemokine receptor 3 (CXCR3), induced protein (IP)-10 (Taub D.D. et al. J Exp Med.
  • composition refers to an aggregate material formed of two or more substances.
  • contact and its various grammatical forms as used herein refers to a state or condition of touching or of immediate or local proximity. Contacting a composition to a target destination may occur by any means of administration known to the skilled artisan.
  • costimulatory molecule refers to molecules that are displayed on the cell surface that have a role in enhancing the activation of a T cell that is already being stimulated through its TCR.
  • HLA proteins which present foreign antigen to the T cell receptor, require costimulatory proteins which bind to complementary receptors on the T cell’s surface to result in enhanced activation of the T cell.
  • co-stimulatory molecules refersto highly active immunomodulatory proteins that play a critical role in the development and maintenance of an adaptive immune response (Kaufman and Wolchok eds., General Principles of Tumor Immunotherapy, Chpt 5, 67-121 (2007)).
  • TCR cognate T cell receptor
  • cytokine refers to small soluble protein substances secreted by cells, which have a variety of effects on other cells.
  • Cytokines mediate many important physiological functions including growth, development, wound healing, and the immune response. They act by binding to their cell-specific receptors located in the cell membrane, which allows a distinct signal transduction cascade to start in the cell, which eventually will lead to biochemical and phenotypic changes in target cells. Cytokines can act both locally and distantly from a site of release.
  • type I cytokines which encompass many of the interleukins, as well as several hematopoietic growth factors
  • type II cytokines including the interferons and interleukin-10
  • TNF tumor necrosis factor
  • IL-1 immunoglobulin super-family members
  • chemokines a family of molecules that play a critical role in a wide variety of immune and inflammatory functions.
  • the same cytokine can have different effects on a cell depending on the state of the cell. Cytokines often regulate the expression of, and trigger cascades of other cytokines.
  • Nonlimiting examples of cytokines include e.g., IL-1 ⁇ ., IL- ⁇ ., IL-2, IL-3, IL-4, IL-5, IL- 6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12/IL-23 P40, IL13, IL-15, IL-17, IL-18, IL-21, IL- 23, TGF- ⁇ , IFN- ⁇ , GM-CSF, Gro- ⁇ , MCP-1 and TNF- ⁇ .
  • the term “derived from” as used herein encompasses any method for receiving, obtaining, or modifying something from a source of origin.
  • the term “derivative” or “variant” with respect to a peptide or DNA sequence refers to a non-identical peptide or DNA sequence that is modified from its original sequence.
  • the terms “derivative” or “variant” with respect to cells as used herein refers to a tumor cell line that has been modified from its cell line of origin (e.g. modified to express recombinant DNA sequences).
  • the term "detectable marker” encompasses both selectable markers and assay markers.
  • detectable markers refers to a variety of gene products to which cells transformed with an expression construct can be selected or screened, including drug- resistance markers, antigenic markers useful in fluorescence-activated cell sorting, adherence markers such as receptors for adherence ligands allowing selective adherence, and the like.
  • detectable response refers to any signal or response that may be detected in an assay, which may be performed with or without a detection reagent. Detectable responses include, but are not limited to, radioactive decay and energy (e.g., fluorescent, ultraviolet, infrared, visible) emission, absorption, polarization, fluorescence, phosphorescence, transmission, reflection or resonance transfer.
  • Detectable responses also include chromatographic mobility, turbidity, electrophoretic mobility, mass spectrum, ultraviolet spectrum, infrared spectrum, nuclear magnetic resonance spectrum and x-ray diffraction.
  • a detectable response may be the result of an assay to measure one or more properties of a biologic material, such as melting point, density, conductivity, surface acoustic waves, catalytic activity or elemental composition.
  • a "detection reagent” is any molecule that generates a detectable response indicative of the presence or absence of a substance of interest.
  • Detection reagents include any of a variety of molecules, such as antibodies, nucleic acid sequences and enzymes.
  • a detection reagent may comprise a marker.
  • dose refers to the quantity of a therapeutic substance prescribed to be taken at one time.
  • die also referred to as "fluorochrome” or "fluorophore” as used herein refers to a component of a molecule which causes the molecule to be fluorescent. The component is a functional group in the molecule that absorbs energy of a specific wavelength and re-emits energy at a different (but equally specific) wavelength. The amount and wavelength of the emitted energy depend on both the dye and the chemical environment of the dye.
  • engineered leukocyte stimulator cells refers to an allogeneic primary tumor cell line transfected or transduced with recombinant DNA sequences encoding at least 3 core immunomodulator peptides – OX40 Ligand, CD27 Ligand, and CD28 Ligand, comprising CD80, CD86 or both.
  • enrich refers to increasing the proportion of a desired substance, for example, to increase the relative frequency of a subtype of cell compared to its natural frequency in a cell population. Positive selection, negative selection, or both are generally considered necessary to any enrichment scheme.
  • Selection methods include, without limitation, magnetic separation and fluorescence activated cell sorting (FACS). Regardless of the specific technology used for enrichment, the specific markers used in the selection process are critical, since developmental stages and activation-specific responses can change a cell’s antigenic profile.
  • FACS fluorescence activated cell sorting
  • the term "expression” encompasses the biosynthesis of mRNA, polypeptide biosynthesis, polypeptide activation, e.g., by post-translational modification, or an activation of expression by changing the subcellular location or by recruitment to chromatin.
  • expression vector refers to a DNA molecule comprising a gene that is expressed in a host cell.
  • gene expression is placed under the control of certain regulatory elements including, but not limited to, promoters, tissue specific regulatory elements, and enhancers. Such a gene is said to be “operably linked to” the regulatory elements.
  • flow cytometry refers to a tool for interrogating the phenotype and characteristics of cells. It senses cells or particles as they move in a liquid stream through a laser (light amplification by stimulated emission of radiation)/light beam past a sensing area. The relative light-scattering and color-discriminated fluorescence of the microscopic particles is measured.
  • Flow analysis and differentiation of the cells is based on size, granularity, and whether the cell is carrying fluorescent molecules in the form of either antibodies or dyes.
  • the cell passes through the laser beam, light is scattered in all directions, and the light scattered in the forward direction at low angles (0.5-10°) from the axis is proportional to the square of the radius of a sphere and so to the size of the cell or particle.
  • Light may enter the cell; thus, the 90° light (right-angled, side) scatter may be labeled with fluorochrome-linked antibodies or stained with fluorescent membrane, cytoplasmic, or nuclear dyes.
  • the differentiation of cell types, the presence of membrane receptors and antigens, membrane potential, pH, enzyme activity, and DNA content may be facilitated.
  • FACS Fluorescence-activated cell sorting
  • heteroclitic is used herein to refer to variant peptides of higher biological potency than an original peptide.
  • a “heteroclitic immunogen” is an immunogen that elicits an immune response, which cross-reacts with an original non- immunogenic or poorly immunogenic antigen.
  • immunogen is an immunogen that elicits an immune response, which cross-reacts with an original non- immunogenic or poorly immunogenic antigen.
  • immune response and “immune-mediated” are used interchangeably herein to refer to any functional expression of a subject’s immune system, against either foreign or self-antigens, whether the consequences of these reactions are beneficial or harmful to the subject.
  • immunomodulatory refers to a substance that elicits an immune response
  • immune modulator refers to a substance that elicits an immune response
  • immune modulatory refers to a substance, agent, or cell that is capable of augmenting or diminishing immune responses directly or indirectly, e.g., by expressing chemokines, cytokines and other mediators of immune responses.
  • the term “immunostimulatory amount” refers to an amount of an immunogenic composition that is effective to stimulate an immune response by a measurable amount, for example, as measured by ELISPOT assay (cellular immune response), ICS (intracellular cytokine staining assay) and major histocompatibility complex (MHC) tetramer assay to detect and quantify antigen-specific T cells, quantifying the blood population of antigen-specific CD4+ T cells, or quantifying the blood population of antigen specific CD8+ T cells, or where the increase is by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, when compared to a suitable control.
  • ELISPOT assay cellular immune response
  • ICS intracellular cytokine staining assay
  • MHC major histocompatibility complex
  • the term “induce” and its various grammatical forms as used herein with respect to immunity refers to a process or action of bringing about or giving rise to an immune response.
  • the term “inhibitor” as used herein refers to a second molecule that binds to, contacts or otherwise interferes with activity of a first molecule thereby decreasing the first molecule’s activity.
  • the term “integrate into the genome” as used herein refers to a recombinant DNA sequence being concomitantly joined with and to the genomic DNA comprising a host cell’s genome.
  • isolated is used herein to refer to material, such as, but not limited to, a nucleic acid, peptide, or cell, which is: (1) substantially or essentially free from components that normally accompany or interact with it as found in its naturally occurring environment.
  • substantially free or essentially free are used herein to refer to considerably or significantly free of other material, or more than about 95%, 96%, 97%, 98%, 99% or 100% free.
  • the isolated material optionally comprises material not found with the material in its natural environment; or (2) if the material is in its natural environment, the material has been synthetically (non-naturally) altered by deliberate human intervention to a composition and/or placed at a location in the cell (e.g., genome or subcellular organelle) not native to a material found in that environment.
  • the alteration to yield the synthetic material may be performed on the material within, or removed, from its natural state.
  • labeling refers to a process of distinguishing a compound, structure, protein, peptide, antibody, cell or cell component by introducing a traceable constituent.
  • lymphocyte refers to a small white blood cell (leukocyte) formed in lymphatic tissue throughout the body and in normal adults making up about 22-28% of the total number of leukocytes in the circulating blood, which plays a large role in defending the body against disease. Individual lymphocytes are specialized in that they are committed to respond to a limited set of structurally related antigens through recombination of their genetic material.
  • lymphocytes This commitment, which exists before the first contact of the immune system with a given antigen, is expressed by the presence of receptors specific for determinants (epitopes) on the antigen on the lymphocyte’s surface membrane.
  • Each lymphocyte possesses a unique population of receptors, all of which have identical combining sites.
  • One set, or clone, of lymphocytes differs from another clone in the structure of the combining region of its receptors and thus differs in the epitopes that it can recognize. Lymphocytes differ from each other not only in the specificity of their receptors, but also in their functions (Id.).
  • B-lymphocytes B- cells
  • T-cells T-lymphocytes
  • B-Lymphocytes B-Lymphocytes
  • B-lymphocytes are derived from hematopoietic cells of the bone marrow.
  • a mature B-cell can be activated with an antigen that expresses epitopes recognized by its cell surface.
  • the activation process may be direct, dependent on cross-linkage of membrane immunoglobulin (Ig) molecules by the antigen (cross-linkage-dependent B- cell activation), or indirect, via interaction with a helper T-cell, in a process referred to as cognate help.
  • Ig membrane immunoglobulin
  • Cross-linkage dependent B-cell activation requires that the antigen express multiple copies of the epitope complementary to the binding site of the cell surface receptors, because each B-cell expresses Ig molecules with identical variable regions. Such a requirement is fulfilled by other antigens with repetitive epitopes, such as capsular polysaccharides of microorganisms or viral envelope proteins.
  • Cognate help allows B-cells to mount responses against antigens that cannot cross-link receptors and, at the same time, provides costimulatory signals that rescue B cells from inactivation when they are stimulated by weak cross-linkage events.
  • Cognate help is dependent on the binding of antigen by the B-cell’s membrane Ig, the endocytosis of the antigen, and its fragmentation into peptides within the endosomal/lysosomal compartment of the cell.
  • Some of the resultant peptides are loaded into a groove in a specialized set of cell surface proteins known as class II major histocompatibility complex (MHC) molecules.
  • MHC major histocompatibility complex
  • the resultant class II/peptide complexes are expressed on the cell surface and act as ligands for the antigen-specific receptors of a set of T-cells designated as CD4 + T-cells.
  • the CD4 + T-cells bear receptors on their surface specific for the B-cell’s class II/peptide complex.
  • B-cell activation depends not only on the binding of the T cell through its T cell receptor (TCR), but this interaction also allows an activation ligand on the T-cell (CD40 ligand) to bind to its receptor on the B-cell (CD40) signaling B-cell activation.
  • T helper cells secrete several cytokines that regulate the growth and differentiation of the stimulated B-cell by binding to cytokine receptors on the B cell (Id.).
  • CD40L the CD40 ligand
  • the CD40 ligand is transiently expressed on activated CD4 + T helper cells, and it binds to CD40 on the antigen-specific B cells, thereby transducing a second costimulatory signal.
  • the latter signal is essential for B cell growth and differentiation and for the generation of memory B cells by preventing apoptosis of germinal center B cells that have encountered antigen.
  • T-Lymphocytes [00179] T-lymphocytes, derived from precursors in hematopoietic tissue, undergo differentiation in the thymus, and are then seeded to peripheral lymphoid tissue and to the recirculating pool of lymphocytes. T-lymphocytes or T cells mediate a wide range of immunologic functions.
  • T cells differ from B cells in their mechanism of antigen recognition. Immunoglobulin, the B cell’s receptor, binds to individual epitopes on soluble molecules or on particulate surfaces.
  • B-cell receptors therefore see epitopes expressed on the surface of native molecules. While antibodies and B-cell receptors evolved to bind to and to protect against microorganisms in extracellular fluids, T cells recognize antigens on the surface of other cells and mediate their functions by interacting with, and altering, the behavior of these antigen-presenting cells (APCs).
  • APCs antigen-presenting cells
  • APCs display three types of protein molecules on their surface that have a role in activating a T cell to become a T effector cell: (1) HLA proteins, which present foreign antigen to the T cell receptor; (2) costimulatory proteins which bind to complementary receptors on the T cell surface; and (3) cell-cell adhesion molecules, which enable a T cell to bind to the APC for long enough to become activated (“Chapter 24: The adaptive immune system,” Molecular Biology of the Cell, Alberts, B. et al., Garland Science, NY, (2002)).
  • T-cells are subdivided into two distinct classes based on the cell surface receptors they express. The majority of T cells express T cell receptors (TCRs) consisting of ⁇ and ⁇ -chains.
  • T cells express receptors made of ⁇ and ⁇ chains.
  • ⁇ / ⁇ T cells are two sub-lineages: those that express the coreceptor molecule CD4 (CD4 + T cells); and those that express CD8 (CD8 + T cells). These cells differ in how they recognize antigen and in their effector and regulatory functions.
  • CD4+ T Cells CD4 + T cells are the major regulatory cells of the immune system. Their regulatory function depends both on the expression of their cell-surface molecules, such as CD40L whose expression is induced when the T cells are activated, and the wide array of cytokines they secrete when activated. T cells also mediate important effector functions, some of which are determined by the patterns of cytokines they secrete.
  • T cells can develop into cytotoxic T-lymphocytes (CTLs) capable of efficiently lysing target cells that express antigens recognized by the CTLs (Paul, W. E., “Chapter 1: The immune system: an introduction,” Fundamental Immunology, 4th Edition, Ed. Paul, W. E., Lippicott-Raven Publishers, Philadelphia, (1999)).
  • CTLs cytotoxic T-lymphocytes
  • TCRs T cell receptors
  • TCRs recognize a complex consisting of a peptide derived by proteolysis of the antigen bound to a specialized groove of a class II or class I HLA protein.
  • CD4 + T cells recognize only peptide/class II complexes while CD8 + T cells recognize peptide/class I complexes (Id.).
  • the TCR’s ligand i.e., the peptide/HLA protein complex
  • class II MHC molecules bind peptides derived from proteins that have been taken up by the APC through an endocytic process. These peptide-loaded class II molecules are then expressed on the surface of the cell, where they are available to be bound by CD4 + T cells with TCRs capable of recognizing the expressed cell surface complex.
  • CD4 + T cells are specialized to react with antigens derived from extracellular sources (Id.).
  • class I HLA molecules are mainly loaded with peptides derived from internally synthesized proteins, such as viral proteins. These peptides are produced from cytosolic proteins by proteolysis by the proteosome and are translocated into the rough endoplasmic reticulum. Such peptides, generally composed of nine amino acids in length, are bound into the class I HLA molecules and brought to the cell surface, where they can be recognized by CD8 + T cells expressing appropriate receptors.
  • T cells can also be classified based on their function as helper T cells; T cells involved in inducing cellular immunity; suppressor T cells; and cytotoxic T cells.
  • Helper T Cells are T cells that stimulate B cells to make antibody responses to proteins and other T cell-dependent antigens.
  • T cell-dependent antigens are immunogens in which individual epitopes appear only once or a limited number of times such that they are unable to cross-link the membrane Ig of B cells or do so inefficiently.
  • B cells bind the antigen through their membrane Ig, and the complex undergoes endocytosis.
  • the antigen is fragmented into peptides by proteolytic enzymes, and one or more of the generated peptides are loaded into class II HLA molecules, which traffic through this vesicular compartment.
  • the resulting peptide/class II HLA complex is then exported to the B-cell surface membrane.
  • T cells with receptors specific for the peptide/class II molecular complex recognize this complex on the B-cell surface.
  • B-cell activation depends both on the binding of the T cell through its TCR and on the interaction of the T-cell CD40L with CD40 on the B cell.
  • T cells do not constitutively express CD40L. Rather, CD40L expression is induced as a result of an interaction with an APC that expresses both a cognate antigen recognized by the TCR of the T cell and CD80 or CD86.
  • CD80/CD86 is generally expressed by activated, but not resting, B cells so that the helper interaction involving an activated B cell and a T cell can lead to efficient antibody production.
  • CD40L on T cells is dependent on their recognition of antigen on the surface of APCs that constitutively express CD80/86, such as DCs.
  • Such activated helper T cells can then efficiently interact with and help B cells.
  • Cross-linkage of membrane Ig on the B cell even if inefficient, may synergize with the CD40L/CD40 interaction to yield vigorous B- cell activation.
  • the subsequent events in the B-cell response including proliferation, Ig secretion, and class switching of the Ig class being expressed, either depend or are enhanced by the actions of T cell-derived cytokines (Id.).
  • CD4 + T cells tend to differentiate into cells that principally secrete the cytokines IL-4, IL-5, IL-6, and IL-10 (TH2 cells) or into cells that mainly produce IL-2, IFN- ⁇ , and lymphotoxin (T H 1 cells).
  • the T H 2 cells are very effective in helping B-cells develop into antibody-producing cells, whereas the TH1 cells are effective inducers of cellular immune responses, involving enhancement of microbicidal activity of monocytes and macrophages, and consequent increased efficiency in lysing microorganisms in intracellular vesicular compartments.
  • T cell Involvement in Cellular Immunity Induction T cells also may act to enhance the capacity of monocytes and macrophages to destroy intracellular microorganisms.
  • IFN- ⁇ interferon-gamma
  • helper T cells enhances several mechanisms through which mononuclear phagocytes destroy intracellular bacteria and parasitism including the generation of nitric oxide and induction of tumor necrosis factor (TNF) production.
  • TH1 cells are effective in enhancing the microbicidal action, because they produce IFN- ⁇ .
  • two of the major cytokines produced by T H2 cells, IL-4 and IL-10 block these activities (Id.).
  • Cytotoxic T Lymphocytes CD8 + T cells that recognize peptides from proteins produced within the target cell have cytotoxic properties in that they lead to lysis of the target cells.
  • the mechanism of CTL-induced lysis involves the production by the CTL of perforin, a molecule that can insert into the membrane of target cells and promote the lysis of that cell.
  • Perforin-mediated lysis is enhanced by granzymes, a series of enzymes produced by activated CTLs.
  • Regulatory T (Treg) Cells Immune homeostasis is maintained by a controlled balance between initiation and downregulation of the immune response. The mechanisms of both apoptosis and T cell anergy (a tolerance mechanism in which the T cells are intrinsically functionally inactivated following an antigen encounter) contribute to the downregulation of the immune response (Scwartz, R. H. Annu.
  • CD4 + T (Treg) cells suppressor or regulatory CD4 + T (Treg) cells
  • Treg CD4 + Tregs that constitutively express the IL-2 receptor alpha (IL- 2R ⁇ ) chain
  • CD4 + CD25 + are a naturally occurring T cell subset that are anergic and suppressive (Taams, L. S. et al. Eur. J. Immunol. 31: 1122-1131 (2001)).
  • Depletion of CD4 + CD25 + Tregs results in systemic autoimmune disease in mice.
  • Human CD4 + CD25 + Tregs similar to their murine counterpart, are generated in the thymus and are characterized by the ability to suppress proliferation of responder T cells through a cell-cell contact- dependent mechanism, the inability to produce IL-2, and the anergic phenotype in vitro.
  • Human CD4 + CD25 + T cells can be split into suppressive (CD25 high ) and nonsuppressive (CD25 low ) cells, according to the level of CD25 expression.
  • T-Memory Cells Following the recognition and eradication of pathogens through adaptive immune responses, the vast majority (90–95%) of T cells undergo apoptosis with the remaining cells forming a pool of memory T cells, designated central memory T cells (TCM), effector memory T cells (TEM), and resident memory T cells (TRM) (Clark, R.A. Sci. Transl.
  • DCs Dendritic Cells
  • Immature DCs act as sentinels for potentially dangerous signals from cancer cells or microbes and have strong phagocytic antigen capturing abilities. Upon receiving maturation stimuli, immature DCs lose adhesion molecule expression, undergo cytoskeleton reorganization, and migrate to the draining lymph node. Mature DCs are professional antigen presenting cells and have increased MHC class II and costimulatory molecule expression on their cell surface. The innate immune response detects molecules typical of pathogens using pattern recognition receptors that are germline encoded to recognize a limited number of patterns.
  • Monocytes and Macrophages (M ⁇ s) [00197] Monocytes (MOs), macrophages (M ⁇ s), and tumor-associated macrophages (TAMs) are part of the myeloid family (a group of hematopoietic derived cells). Monocytes are direct precursors of hematopoietic stem cell-derived macrophages.
  • TAMs tumor-associated macrophages
  • a cell population with high phenotypic and pro-tumor function heterogeneous diversity have been found to support tumor initiation, local progression and distant metastis (Richards, David M, et al. “Monocytes and Macrophages in Cancer: Development and Functions.” Cancer Microenvironment: Official Journal of the International Cancer Microenvironment Society, Springer Netherlands, Aug. 2013, www.ncbi.nlm.nih.gov/pmc/articles/PMC3).
  • TAMs have anti-tumor properties as well.
  • MO cells are largely found in bone marrow but are additionally found in the blood and spleen. Research shows that MO cells can also be generated by extra-medullary hematopoiesis in the spleen and increase under inflammatory conditions, such as the presence of cancer. MOs generated from hematopoietic stem cells (HSCs) undergo a sequential process of differentiation and commitment steps collectively called monopoiesis. Monopoiesis is tightly regulated by microenvironmental cues, modulating gene expression in developing cells and leading to the often irreversible, phenotypic and functional changes associated with hematopoietic differentiation.
  • HSCs hematopoietic stem cells
  • cytokines such as M-CSF, GM-CSF, and IL-3 play a role in monopoiesis
  • other relatively unstudied factors such as stromal cells, or extracellular matrix (ECM) components, may also have an impact on monopoiesis. (Id).
  • monocytes are generated from HSCs in the bone marrow via monopoiesis which proceeds via distinct proliferator progenitor stages, such as, common myeloid progenitors (CMP), granulocyte/macrophage progenitors (GMP), to the macrophage dendritic cell progenitor (MDP) that serves as a precursor for MOs, macrophages (M ⁇ s) and DCs.
  • CMP common myeloid progenitors
  • GFP granulocyte/macrophage progenitors
  • MDP macrophage dendritic cell progenitor
  • the monocyte subsets are mobilized from the bone marrow into the blood stream where they form a local reservoir in the spleen; in the spleen, they can be re-mobilized in response to injury or inflammation. In times of steady-state homeostasis, blood monocytes are recruited to different tissues where they give rise to MO-derived M ⁇ s and DC's involved in tissue development and maintenance of homeostasis. (Id).
  • M ⁇ s in tissue support homeostatic or trophic processes for tissue development/remodeling in developing or healing tissues.
  • the mechanisms involved in this support include phagocytosis, growth factor production, angiogenesis and degradation of ECM components.
  • immunogenic signals such as TLR signals or inflammatory cytokines, the functional properties of macrophages are polarized towards processes needed for immunity and pathogen defense.
  • M ⁇ s can be organized on a linear scale according to polarization status, i.e., from pro-inflammatory M1-M ⁇ s (classically activated) to anti-inflammatory M2-M ⁇ s (alternatively activated).
  • TAMs are produced when tumor derived factors attract and then differentiate into M ⁇ s. Similar to non-TAM M ⁇ s, TAMs display phenotypic and functional heterogeneous diversity, which depends on the type of tissue and tumor, stage of tumor progression, and location within tumor tissue.
  • TAMs can influence nearly every stage of tumor development and progression. Research has shown that they have a wide variety of anti-tumor functions, including the production of cytotoxic factors, phagocytosis of tumor cells (such as metastatic cells), and participation in cancer immune-editing. (See Bingle L, Brown NJ, Lewis CE. The role of tumor-associated macrophages in tumor progression: implications for new anticancer therapies. J Pathol.
  • TAMs may be polarized towards anti-tumor function.
  • TAMs For example, activation of the CD40 pathway has been reported to program TAMs to upregulate expression of MHC class II and costimulatory molecule CD86 accumulation in tumor tissue and result in TAM-mediated lysisof tumor cells.
  • IL-12 and TNF- ⁇ mediated treatment has also been reported to program TAMs to display their anti-tumor effector function.
  • IL-12 See Watkins SK, Egilmez NK, Suttles J, Stout RD. IL-12 rapidly alters the functional profile of tumor-associated and tumor-infiltrating macrophages in vitro and in vivo. J Immunol. (2007) 178:1357–1362).
  • CD47 serves as an anti-phagocytic signal by binding to SIRP ⁇ , a protein expressed on M ⁇ s and DCs. Blocking CD47 activity or blocking SIRP ⁇ access has been found to result in M ⁇ dependent phagocytosis of tumor cells. (See Chao MP, Weissman IL, Majeti R. The CD47-SIRPalpha pathway in cancer immune evasion and potential therapeutic implications. Curr Opin Immunol. (2012) 24: 225–232). [00204] MOs, M ⁇ s, DCs and related cells are currently identified by the phenotypic markers shown in Table 1. [00205] Table 1. MOs, M ⁇ s, and DC Phenotypes.
  • MHC Major Histocompatability Complex
  • HLA Human leukocyte antigen
  • MHC class I genes which are called HLA-A, HLA-B, and HLA-C in humans, and H2-K, H2-D and H2-L in the mouse. These encode the ⁇ chain of the respective MHC class I proteins.
  • the other subunit of an MHC class I molecule is ⁇ 2-microglobulin.
  • the class II regon includes the genes for the ⁇ and ⁇ chains (designated A and B) of the MHC class II molecules HLA-DR, HLA-DP, and HLA-DQ in humans.
  • TAP1:TAP2 peptide transporter also in the MHC class II region are the genes for the TAP1:TAP2 peptide transporter, the PSMB (or LMP) genes that encode proteasome subunits, the genes encoding the DM ⁇ and BM ⁇ chains (DMA and DMB), the genes encosing the ⁇ and ⁇ chains of the DO molecule (DOA and DOB, respectively), and the gene encoding tapasin (TAPBP).
  • PSMB or LMP genes that encode proteasome subunits
  • DMA and DMB genes encoding the DM ⁇ and BM ⁇ chains
  • DOA and DOB the genes encosing the ⁇ and ⁇ chains of the DO molecule
  • TAPBP tapasin
  • the DMA and DMB agenes seeking the subunits of the HLA- DM molecule that catalyzes peptide binding to MHC class II molecules are related to the MHC class II genes, as are the DOA and DOB genes that encode the subunits of the regulatory HLA-DO molecule.
  • MHC-like molecules while not encoded by the same gene group as true MHCs, have the same folding and overall structure of MHCs, and specifically MHC class I molecules, and thus posseses similar biological functions such as antigen presentation.
  • the CD1 family of molecules is an example of a MHC-like molecule.
  • group 1 which includes CD1a, b, and c
  • group 2 which consists of CD1d.
  • Group 1 CD1s can present antigens to a wide variety of T cells, whereas CD1d presents antigens mostly to NKT cells. (Brutkiewicz. “CD1d Ligands: The Good, the Bad, and the Ugly.” The Journal of Immunology (2006) 177 (2) 769-775). While CD1d structurally resembles MHC Class I molecules, it traffics through the endosome of the exogenous antigen presentation pathway.
  • CD1d presents lipid antigens, and requires the presence of particular mechanisms to induce uptake of these molecules by APCs and subsequent loading onto CD1d moelcules.
  • Lipid transfer protein such as apolipoprotein E and fatty acid amide hydrolase (FAAH) have been shown to enhance the presentation of certain antigens by CD1d.
  • Loading efficiency can be enhanced by specific proteins, such as saposins and microsomal triglyceride transfer protein , present in the endosomal and lysosomal compartments of cells by promoting lipid antigen exchange. Similar to MHC antigens, lipid antigens can also be processed by lysosomal enzymes to yield active compounds, as demonstrated in the case of CD1d for synthetic antigens, microbial antigens, and self- antigens. Giradi and Zajonc (2012). “Molecular basis of lipid antigen presentation by CD1d and recognition by natural killer T cells.” Immunol Rev.250(1): 167-179.
  • MHC Class I-like molecules are nonclassical MHC type molecules, while including Cd1d also include CD1a, CD1b, CD1c, CD1e, and MR1 are also expressed on APCs and can activate various subsets of T cells. Kumar and Delovitch (2014) “Different subsets of natural killer T cells may vary in their roles in health and disease.” Immunology 142: 321-336. Other non-classical histocompatibility molecules include MR1, which activate MAIT cells. [00210]
  • the terms “marker” or “cell surface marker” are used interchangeably herein to refer to an antigenic determinant or epitope found on the surface of a specific type of cell.
  • MLR mixed lymphocyte reaction
  • MLTR mixed lymphocyte tumor reaction
  • cellular proliferation of the lymphocytes is measured.
  • modify refers to a change of the form or qualities of.
  • modulate means to regulate, alter, adapt, or adjust to a certain measure or proportion. Such modulation may be any change, including an undetectable change.
  • modified or “modulated” as used herein in the context of serial killer cell types refers to changing the form or character of the cell type via one or more recombinant DNA techniques such that the immunostimulatory effect or immunosuppressive effect of the respective modified serial killer cell is reproducibly different from the respective parent serial killer cells.
  • modified serial killer cell types such as NKCs, CTLs, and NKTs refers to changing the form or character of the cell type via one or more recombinant DNA techniques such that the immunostimulatory effect or immunosuppressive effect of the respective modified serial killer cell is reproducibly different from the respective parent serial killer cells.
  • mononuclear cells refers to cells having a single round nucleus such as, for example, lymphocytes (e.g., T cells, B cells, NK cells), monocytes and macrophages.
  • myeloid suppressor cells or “myeloid-derived suppressor cells”, or “MDSCs” as used herein refers to a heterogeneous population of cells characterized by myeloid origin, immature state, and ability to potently suppress T cell responses. These cells regulate immune responses and tissue repair in healthy individuals and the population rapidly expands during inflammation.
  • nucleic acid is used herein to refer to a deoxyribonucleotide or ribonucleotide polymer in either single- or double-stranded form, and, unless otherwise limited, encompasses known analogues having the essential nature of natural nucleotides in that they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g., peptide nucleic acids).
  • nucleotide is used herein to refer to a chemical compound that consists of a heterocyclic base, a sugar, and one or more phosphate groups.
  • nucleotides are the monomers of nucleic acids, with three or more bonding together in order to form a nucleic acid. Nucleotides are the structural units of RNA, DNA, and several cofactors, including, but not limited to, CoA, FAD, DMN, NAD, and NADP.
  • Purines include adenine (A), and guanine (G); pyrimidines include cytosine (C), thymine (T), and uracil (U).
  • open reading frame refers to a sequence of nucleotides in a DNA molecule that has the potential to encode a peptide or protein: it starts with a start triplet (ATG), is followed by a string of triplets each of which encodes an amino acid, and ends with a stop triplet (TAA, TAG or TGA).
  • ATG start triplet
  • TAA stop triplet
  • operably linked refers (1) to a first sequence(s) or domain being positioned sufficiently proximal to a second sequence(s) or domain so that the first sequence(s) or domain can exert influence over the second sequence(s) or domain or a region under control of that second sequence or domain; and (2) to a functional linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence.
  • operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, are in the same reading frame.
  • the phrase “operatively linked” refers to a linkage in which two or more protein domains or polypeptides are ligated or combined via recombinant DNA technology or chemical reaction such that each protein domain or polypeptide of the resulting fusion protein retains its original function.
  • OS all survival
  • paracrine signaling refers to short range cell-cell communication via secreted signal molecules that act on adjacent cells.
  • parenteral refers to administration of a substance occurring in the body other than by the mouth or alimentary canal.
  • parenteral refers to introduction into the body by way of an injection (i.e., administration by injection), including, for example, subcutaneously (i.e., an injection beneath the skin), intramuscularly (i.e., an injection into a muscle); intravenously (i.e., an injection into a vein), intrathecally (i.e., an injection into the space around the spinal cord or under the arachnoid membrane of the brain), or infusion techniques.
  • passive immunization refers to the production of passive immunity, meaning immunity acquired from transfer of antibodies either naturally, as from mother to fetus, or by intentional inoculation (artificial passive immunity). Passive immunity can be induced by either natural or artificial mechanisms. Where antibodies are transferred, the passive immunity, with respect to the particular antibodies transferred, is specific. Passive cell-mediated immunity is produced by the transfer of living lymphoid cells froman immune cell source is sometimes referred to as adoptive or acquired immunity.
  • peripheral blood mononuclear cells or "PBMCs” are used interchangeably herein to refer to mononuclear cells derived from peripheral blood.
  • composition refers to a composition that is employed to prevent, reduce in intensity, cure or otherwise treat a target condition, syndrome, disorder or disease.
  • formulation and “composition” are used interchangeably herein to refer to a product of the described invention that comprises all active and inert ingredients.
  • pharmaceutically acceptable carrier refers to any substantially non-toxic carrier conventionally useable for administration of the active agent of the described invention in which the active agent will remain stable and bioavailable.
  • the pharmaceutically acceptable carrier must be of sufficiently high purity and of sufficiently low toxicity to render it suitable for administration to the mammal being treated. It further should maintain the stability and bioavailability of an active agent.
  • the pharmaceutically acceptable carrier can be liquid or solid and is selected, with the planned manner of administration in mind, to provide for the desired bulk, consistency, etc., when combined with an active agent and other components of a given composition.
  • pharmaceutically acceptable salt refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like and are commensurate with a reasonable benefit/risk ratio. When used in medicine the salts should be pharmaceutically acceptable, but non- pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof.
  • Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic.
  • such salts may be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.
  • salts are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like and are commensurate with a reasonable benefit/risk ratio.
  • Pharmaceutically acceptable salts are well-known in the art. For example, P. H. Stahl, et al. describe pharmaceutically acceptable salts in detail in “Handbook of Pharmaceutical Salts: Properties, Selection, and Use” (Wiley VCH, Zurich, Switzerland: 2002). The salts may be prepared in situ during the final isolation and purification of the compounds described within the present invention or separately by reacting a free base function with a suitable organic acid.
  • Representative acid addition salts include, but are not limited to, acetate, adipate, alginate, citrate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, camphorate, camphorsufonate, digluconate, glycerophosphate, hemisulfate, heptanoate, hexanoate, fumarate, hydrochloride, hydrobromide, hydroiodide, 2- hydroxyethansulfonate(isethionate), lactate, maleate, methanesulfonate, nicotinate, 2- naphthalenesulfonate, oxalate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, phosphate, glutamate, bicarbonate, p-toluenesulfonate and undecan
  • the basic nitrogen-containing groups may be quaternized with such agents as lower alkyl halides such as methyl, ethyl, propyl, and butyl chlorides, bromides and iodides; dialkyl sulfates like dimethyl, diethyl, dibutyl and diamyl sulfates; long chain halides such as decyl, lauryl, myristyl and stearyl chlorides, bromides and iodides; arylalkyl halides like benzyl and phenethyl bromides and others. Water or oil-soluble or dispersible products are thereby obtained.
  • lower alkyl halides such as methyl, ethyl, propyl, and butyl chlorides, bromides and iodides
  • dialkyl sulfates like dimethyl, diethyl, dibutyl and diamyl sulfates
  • long chain halides such as decyl
  • Basic addition salts may be prepared in situ during the final isolation and purification of compounds described within the invention by reacting a carboxylic acid- containing moiety with a suitable base such as the hydroxide, carbonate or bicarbonate of a pharmaceutically acceptable metal cation or with ammonia or an organic primary, secondary or tertiary amine.
  • Pharmaceutically acceptable salts include, but are not limited to, cations based on alkali metals or alkaline earth metals such as lithium, sodium, potassium, calcium, magnesium and aluminum salts and the like and nontoxic quaternary ammonia and amine cations including ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine and the like.
  • Other representative organic amines useful for the formation of base addition salts include ethylenediamine, ethanolamine, diethanolamine, piperidine, piperazine, and the like.
  • compositions also may be obtained using standard procedures well known in the art, for example by reacting a sufficiently basic compound such as an amine with a suitable acid affording a physiologically acceptable anion.
  • a sufficiently basic compound such as an amine
  • suitable acid affording a physiologically acceptable anion.
  • Alkali metal for example, sodium, potassium or lithium
  • alkaline earth metal for example calcium or magnesium
  • polypeptide The essential nature of such analogues of naturally occurring amino acids is that, when incorporated into a protein that protein is specifically reactive to antibodies elicited to the same protein but consisting entirely of naturally occurring amino acids.
  • polypeptide polypeptide
  • peptide and protein
  • modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma- carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation. It will be appreciated, as is well known and as noted above, that polypeptides may not be entirely linear.
  • polypeptides may be branched as a result of ubiquitination, and they may be circular, with or without branching, generally as a result of posttranslational events, including natural processing event and events brought about by human manipulation which do not occur naturally.
  • Circular, branched and branched circular polypeptides may be synthesized by non-translation natural process and by entirely synthetic methods, as well.
  • the peptide is of any length or size.
  • reference sequence refers to a sequence used as a basis for sequence comparison.
  • a reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence.
  • comparison window refers to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence may be compared to a reference sequence and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • the comparison window is at least 20 contiguous nucleotides in length, and optionally can be at least 30 contiguous nucleotides in length, at least 40 contiguous nucleotides in length, at least 50 contiguous nucleotides in length, at least 100 contiguous nucleotides in length, or longer.
  • a gap penalty typically is introduced and is subtracted from the number of matches.
  • the BLAST family of programs which can be used for database similarity searches, includes: BLASTN for nucleotide query sequences against nucleotide database sequences; BLASTX for nucleotide query sequences against protein database sequences; BLASTP for protein query sequences against protein database sequences; TBLASTN for protein query sequences against nucleotide database sequences; and TBLASTX for nucleotide query sequences against nucleotide database sequences.
  • BLASTN for nucleotide query sequences against nucleotide database sequences
  • BLASTP protein query sequences against protein database sequences
  • TBLASTN protein query sequences against nucleotide database sequences
  • TBLASTX for nucleotide query sequences against nucleotide database sequences.
  • HSPs high scoring sequence pairs
  • Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always>0) and N (penalty score for mismatching residues; always ⁇ 0).
  • M forward score for a pair of matching residues; always>0
  • N penalty score for mismatching residues; always ⁇ 0.
  • a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • the BLASTP program uses as defaults a word length (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).
  • the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl. Acad. Sci.
  • BLAST smallest sum probability
  • P(N) the smallest sum probability
  • BLAST searches assume that proteins may be modeled as random sequences. However, many real proteins comprise regions of nonrandom sequences which may be homopolymeric tracts, short-period repeats, or regions enriched in one or more amino acids. Such low-complexity regions may be aligned between unrelated proteins even though other regions of the protein are entirely dissimilar. A number of low-complexity filter programs may be employed to reduce such low-complexity alignments.
  • sequence identity or “identity” in the context of two nucleic acid or polypeptide sequences is used herein to refer to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
  • sequence similarity or “similarity.” Means for making this adjustment are well-known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity.
  • a conservative substitution is given a score between zero and 1.
  • the scoring of conservative substitutions is calculated, e.g., according to the algorithm of Meyers and Miller, Computer Applic. Biol. Sci., 4:11-17 (1988) e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif., USA).
  • the term “percentage of sequence identity” is used herein mean the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
  • polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 90% sequence identity and at least 95% sequence identity, compared to a reference sequence using one of the alignment programs described using standard parameters.
  • sequence identity e.g., sequence identity of amino acid sequences
  • a polynucleotide comprises a sequence that has at least 60% sequence identity, at least 70% sequence identity, at least 80% sequence identity, at least 90% sequence identity and at least 95% sequence identity, compared to a reference sequence using one of the alignment programs described using standard parameters.
  • amino acid sequences for these purposes normally means sequence identity of at least 60%, or at least 70%, at least 80%, at least 90%, or at least 95%.
  • nucleotide sequences are substantially identical if two molecules hybridize to each other under stringent conditions. However, nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides that they encode are substantially identical. This may occur, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
  • One indication that two nucleic acid sequences are substantially identical is that the polypeptide that the first nucleic acid encodes is immunologically cross reactive with the polypeptide encoded by the second nucleic acid. Mutations may also be made to the nucleotide sequences of the present proteins by reference to the genetic code, including taking into account codon degeneracy.
  • the term "prime” refers to a process of increasing sensitivity to. When used in an immunological sense it refers to a process whereby T cells and B cell precursors encounter the antigen for which they are specific.
  • the term “unprimed cells” also referred to as virgin, na ⁇ ve, or inexperienced cells) as used herein refers to T cells and B cells that have generated an antigen receptor (TCR for T cells, BCR for B cells) of a particular specificity, but have never encountered the antigen. For example, before helper T cells and B cells can interact to produce specific antibody, the antigen-specific T cell precursors must be primed.
  • Helper T cells express CD4, but not all CD4 T cells are helper cells (Id.). The signals required for clonal expansion of helper T cells differ from those required by other CD4 T cells.
  • the critical antigen- presenting cell for helper T cell priming appears to be a macrophage; and the critical second signal for helper T cell growth is the macrophage product interleukin 1 (IL-1) (Id.). If the primed T cells and/or B cells receive a second, co-stimulatory signal, they become activated T cells or B cells.
  • IL-1 macrophage product interleukin 1
  • PFS progression free survival
  • reporter gene refers to a gene and/or peptide that can be detected, or easily identified and measured. The expression of the reporter may be measured at either the RNA level, or at the protein level.
  • the gene product which may be detected in an experimental assay protocol, includes, but is not limited to, marker enzymes, antigens, amino acid sequence markers, cellular phenotypic markers, nucleic acid sequence markers, and the like.
  • researchers may attach a reporter gene to another gene of interest in cell culture, bacteria, animals, or plants.
  • some reporters are selectable markers, or confer characteristics upon on organisms expressing them allowing the organism to be easily identified and assayed.
  • researchers may place the reporter gene and the gene of interest in the same DNA construct to be inserted into the cell or organism. For bacteria or eukaryotic cells in culture, this may be in the form of a plasmid.
  • reporter genes may include, but are not limited to, fluorescent proteins, luciferase, beta- galactosidase, and selectable markers, such as chloramphenicol and kanomycin.
  • the term“serial killer cell” as used herein refers to a population of cells that exhibit an ability to kill multiple tumor or pathogen-infected cells, while showing resistance to such killing action. There are multiple kinds of cells that display this effector function, e.g., NK cells, NKT cells, LAK cells, CIK cells, MAIT cells, CD8+ CTLs, CD4+ CTLs.
  • serial killer effector function may be direct, through cytolytic or cytotoxic activities, or indirect, through the immunoregulation of other cells and proteins that target pathogenic and cancerous cells.
  • Effector Serial Killer Cells [00237] Serial killer cells of the immune system may provide rapid immunity against pathogens through their serial killing action. There are multiple kinds of cells that display this effector function. According to some embodiments, serial killer cells include Natural Killer (NK) cells, Natural Killer T (NKT) cells, CD8+ Cytolytic T lymphocytes (CTLs), and CD4+ CTLs.
  • the serial killing function is defined as an ability to kill multiple tumor or pathogen infected cells, while showing resistance to such killing action.
  • serial killer effector function may be direct, through cytolytic or cytotoxic activities, or indirect, through the immunoregulation of other cells and proteins that target pathogenic and cancerous cells.
  • activation pathway may differ, serial killer cells can kill target cells directlythrough a perforin/granzyme or granulysin mechanism.
  • the first step of the cytotoxic process is target cell recognition that can be specific (in the case of CTLs) or nonspecific (in the case of NKs and NKTs). Then a lytic synapse is formed between the serial killer cell and the target cell.
  • Adhesion molecules (such as the integrin LFA-1 with its ligands ICAM-1 or ICAM-2) on target cells result in the polarization of cytotoxic granules towards the immunological synapse.
  • Ig-superfamily receptor DNAM-1 CD2266
  • NKs, T cells, and B cells Ig-superfamily receptors
  • Ligands for DNAM-1 such as PVR (CD155), a member of the nectin family of proteins, and nectin-2 (CD11), a member of the nectin-like family of protein, are frequently expressed by tumor cells.
  • Perforin is able to polymerize, bind to the target cell, and form a channel in the target cell membrane with the assistance of Ca2+ ions.
  • Granzymes are serine proteases that enzymatically activate a caspase cascade leading to apoptosis.
  • Perforin binds via membrane phospholipids, and the phosphatidycholine, which binds Ca2+, increases perforin's affinity to the target cell membrane.
  • the pores formed by perforin disrupt the cell membrane and allow the free influx and efflux of ions and polypeptides and additionally allow for the delivery of granzyme molecules.
  • the disruption of the cell and the delivery of cytotoxic granzymes ultimately induce activation of pro-apoptotic pathways and DNA degradation leading to cell death. This mechanism is not only dependent on expression of perforin/granzyme, but also on a multitude of other factors such as temperature, pH, calcium concentration, etc.
  • Serial killer cells also can induce apoptosis through a death receptor/ligand pathway.
  • some serial killer cells express the Fas ligand (FasL) on their cell membrane.
  • FasL When FasL contacts and binds with Fas present on the membranes of target cells, Fas becomes ligated which leads to the activation of caspases, inducing apoptosis in the target cell.
  • TNF tumor necrosis factor
  • TRAIL apoptosis inducing ligand
  • TRAIL is a transmembrane protein expressed on many serial killer cell types that induces apoptotic death in a wide variety of tumor cells, but not in most normal cells.
  • the TRAIL ligand binds to either one of two apoptosis-inducing receptors TRAIL-R1 or TRAIL-R2, the receptors are trimerized, and the death-inducing signaling complex (DISC) is assembled on the target cell.
  • DISC death-inducing signaling complex
  • Fas/FasL and TRAIL-R/TRAIL proceed as following: the adaptor molecule, Fas-associated death domain (FADD) translocates to the DISC where it interacts with the intracellular death domain of the receptors. Via its second functional domain, the death effector domain (DED), FADD recruits procaspases 8 and 10 to the DISC where they are autocatalytically activated, thus initiating the caspase-dependent signaling cascade, leading ultimately to cell death. Id.
  • Fas-associated death domain FADD translocates to the DISC where it interacts with the intracellular death domain of the receptors.
  • DED death effector domain
  • FADD recruits procaspases 8 and 10 to the DISC where they are autocatalytically activated, thus initiating the caspase-dependent signaling cascade, leading ultimately to cell death. Id.
  • serial killer cells have immunoregulatory effects through the secretion of cytokines and chemokines that modulate the effector function of surrounding cells, such as Interferon- ⁇ (IFN- ⁇ ), Granulocyte macrophage colony-stimulating factor (GM- CSF), Colony-stimulating factor 1 (CSF-1), Tumor necrosis factor ⁇ (TNF ⁇ ), Transforming growth factor (TGF ⁇ ), Interleukin (IL- 3 (IL-3), IL-5, IL-10, IL-13, chemokines (CCL1, 2, 3, 4) and (CXCL8).
  • IFN- ⁇ Interferon- ⁇
  • GM- CSF Granulocyte macrophage colony-stimulating factor
  • CSF-1 Colony-stimulating factor 1
  • TGF ⁇ Tumor necrosis factor ⁇
  • TGF ⁇ Transforming growth factor
  • IL- 3 Interleukin
  • IL-5 Interleukin
  • IL-10 IL-13
  • CXCL8 chemokines
  • Target cells can be sensitized for TRAIL-mediated apoptosis by the presence of inflammatory cytokines, such as, TNF- ⁇ and IFN- ⁇ . These cytokines can potentiate apoptosis by indirect means, but also through a direct, contact-independent cytotoxic mechanism where they induce the production of nitric oxide and other free radicals, or by activating death pathways within the tumor cells.
  • IFN- ⁇ has also been found to activate macrophages, and recruits them to the site of the attack for both effector cell function and as APCs. IFN- ⁇ , synergistically with TNF- ⁇ or TNF- ⁇ , kills some target cells through their interaction with TNF Receptor I (TNFR-I).
  • serial killer cell types such as the various types of NKTs and NKs that cannot be easily categorized in one single arm of the immune system. These cell types include B-1 cells, marginal zone (MZ) B cells, and certain subsets of ⁇ T cells, CD8 ⁇ -expressing T cells in the gut, Cytokine-Induced Killer cells and MAIT cells.
  • Each of these cell types expresses an antigen-specific receptor, either a B cell receptor or a T cell receptor (TCR), which is generated by VDJ recombination, a process by which T cells and B cells randomly assemble different gene segments, known as variable (V), diversity (D) and joining (J) genes, in order to generate unique antigen receptors that collectively can recognize many different types of molecules. Because the repertoire of specificities of these receptors is strongly limited, these cells react with a limited diversity of antigens. [00245] The receptors expressed by the various types of NKTs and NKs bear similarities with pattern recognition receptors expressed by cells of the innate immune system.
  • Cells of the T lymphocyte lineage further display unique characteristics, such as the inability to develop immunological memory, rapid elicitation of effector functions, and a tendency for autoreactivity.
  • these cells display characteristics that are distinctly NK-like and T- cell like, such as the ability to produce certain cytokines, the ability to activate other immune cells (such as conventional T cells, NKs, and/or DCs), and the ability to induce cell death through cytotoxic activity and/or expression and interaction with cell-death inducing effector molecules, such as the Fas ligand (FasL/Fas) and TNF-related apoptosis inducing ligand (TRAIL).
  • Fas ligand Fas ligand
  • TRAIL TNF-related apoptosis inducing ligand
  • Natural Killer (NK) Cells are cytolytic granular lymphocytes found in humans and other mammals. They are characterized by their innate capacity for lytic activity even in the absence of prior immunization to targets. (Seaman (2000) “Natural Killer Cells and Natural Killer T Cells.” Arthritis & Rheumatism 43(6): 1204-1217).
  • NKs have the morphology of activated cytotoxic T cells, in that they are typically large with an expanded cytoplasm containing granules used in cytotoxicity. NKs currently can be identified by various surface receptors, such as those shown in Table 2. [00248] Table 2. Natural Killer Cells [00249] A particular NK cell will typically express two to four inhibitory receptors in addition to an array of activation receptors, and the varied combinations of inhibitory and activating receptors results in a sizeable heterogeneity within an NK population. It is for this reason that NKs are considered to have the ability to respond to a variety of stimuli and to participate in various immune responses under different pathological conditions. (Mandal and Viswanathan (2015).
  • NK cells primarily develop in the bone-marrow, similar to B cells and myeloid origin cells. They have also been found to develop in lymph nodes and the liver. They can be generated from hematopoietic stem cells (HSCs) that show a commitment towards NK lineage, thus generating NK precursors (NKPs), which eventually mature into NKs under the influence of certain transcription factors.
  • HSCs hematopoietic stem cells
  • NKs Transcription, soluble, and membrane factors involved in the development of NKs include, in the generation phase, Ets-1, Id2, Ikaros, and PU.1; in the maturation of immature NKs, Gata-3, and IRF-2; and in the functional differenttation of matured NKs, CEBP- ⁇ , MEF, and MITF.
  • the cytokine interleukin 15 (IL-15) has been shown to be essential for NK development homeostasis and survival.
  • the cytokine interleukin-2 (IL-2), a peptide derived from T cells, has been implicated in the cytolytic functional maturation of NK cells. (Id.).
  • NKs are typically found circulating in peripheral blood until activated, when they infiltrate into most tissues that contain pathogen-infected or malignant cells. They represent 10% of all cells in the total peripheral blood mononuclear cells (PBMC) population of circulating human lymphocytes. NKs found in secondary lymphoid tissues, such as tonsils, lymph nodes, and the spleen, differ from NKs in peripheral blood in that lymphoid NKs are activated by DCs and secrete certain cytokines such as interferon, which stimulate a more efficient killing response by T cells. (Id.).
  • NK stimulation and effector function depends on the integration of signals derived from its various receptors.
  • NKs can recognize and kill virally infected and neoplastic cells through their cytotoxic function.
  • NKs further play an immunoregulatory role where NKs stimulate the production of cytokines.
  • NKs have the capacity to regulate the activity of other cells, particularly the cells of the immune system.
  • the pattern of cytokines released by NK induction varies with stimulus.
  • NKs like T cells, differentiate into discrete functional subsets with differing effectiveness on adaptive immunity.
  • LAK lymphokine-activated killer
  • MHC non-major histocompatibility complex
  • NK natural killer
  • LAK cells upregulate effectors or adhesion molecules, such as perforin, NKp44, granzymes, FasL and TRAIL, and secrete IFN- ⁇ to adhere to and lyse tumor cells.
  • NKG2D is an activating receptor expressed on the surface of NK cells, CD8+ T cells, and subsets of CD4+ T cells, type I NKT cells, and ⁇ T cells. (See Lanier, LL, Cancer Immunol. Res. (2015) 3(6): 575-82). In humans and mice, NK cells express a heterodimer of two different C type lectin like receptors, CD94 and NKG2, which interact with nonpolymorphic MHC class I like molecules (HLA-E in humans and Qa1 in mice).
  • HLA-E and Qa1 are unusual in that instead of binding peptides derived from pathogens, they bind fragments of the signal peptide derived from other MHC class I molecules during processing in the ER (See Murphy, Kenneth M., et al. Janeways Immunobiology. 9th ed., GS, Garland Science, Taylor & Francis Group, 2017. p. 129).
  • This enables CD94:NKG2 to detect the presence of several different MHC class I variants, whose expression may be targeted by viruses, and to kill cells in which overall MHC molecule expression is diminished.
  • NKG2D has a specialized role in activating NK cells.
  • NKG2D molecules form a homodimer that binds to several MHC class I like molecules that are induced by various types of cellular stress.
  • MHC major histocompatibility complex
  • RAET1 functions as a ligand for NKG2D receptor.
  • Ligands for NKG2D are expressed in response to cellular or metabolic stress, and are upregulated on cells infected with intracellular bacteria and most viruses, as well as on incipient tumor cells that have become malignantly transformed.
  • NKTs Natural Killer like T Cells
  • NKTs are rapid responders of the immune system and mediate potent immunoregulatory and effector functions in a variety of disease settings. Upon activation, NKTs can immediately commence effector function, such as cytokine secretion or cytolytic activity, without first having to differentiate into effector cells. The rapidity of their response makes NKTs important players in the very first line of innate defense.
  • NKTs are cells that share morphological and functional characteristics with both conventional T cells and NKs. Despite NKTs having a T lineage and expressing T- cell antigen receptors (TCRs) characteristic of conventional T cells, they also express cell surface proteins characteristic of NKs. As such they are considered a bridge between innate and adaptive immunity.
  • TCRs T- cell antigen receptors
  • NKTs can be found virtually everywhere T cells and NKs are found, such as in the spleen, liver, thymus, bone marrow, lymph nodes, umbilical cord blood, and peripheral blood.
  • NKTs typically comprise less than 1% of peripheral blood of humans and non-human primates.
  • Activation of the various types of NKTs results in varying immunomodulatory responses, such as the ability to produce certain cytokines, the ability to activate other immune cells such as conventional T cells, NKCs, and/or DCs, and the ability to induce cell death through cytotoxic activity and/or expression and interaction with cell-death inducing effector molecules, such as the Fas ligand (FasL/Fas) and TNF-related apoptosis inducing ligand (TRAIL).
  • Fas ligand Fas ligand
  • TRAIL TNF-related apoptosis inducing ligand
  • NKT cells As shown in Table 3 below (Adapted from Godfrey et al. (2004). “NKT cells: what’s in a name?” Immunology, Nature Reviews 4:231-237), three NKT cell subtypes ( type I, II, and NKT-like cells) express different TCRs and TCR activation, which promotes various intracellular events leading to specific functional activities. Each classification contains many further subtypes depending on its various phenotypes. Type 1 NKTs (also known as NKT-I, invariant NKTs, or iNKTs) have an invariant TCR ⁇ - chain with limited TCR ⁇ -chain repertoires.
  • Type II NKTs also known as diverse NKTs, dNKTs, variant NKTs, vNKTs, or NKT-II
  • NKT-like cells such as other CD1 restricted T-cells and MR1-restricted mucosal associated invariant Tcells (MAITs).
  • MAITs MR1-restricted mucosal associated invariant Tcells
  • NKTs express a diverse or semi-invariant ⁇ TCR, the TCR being noncovalently coupled to a conserved multisubunit signaling apparatus, the CD3 complex.
  • T-cells which express ⁇ TCR that can be activated by peptide antigens bound to classic class I (CD8+) or class II (CD4+) MHC molecules
  • most NKTs responds to glycolipid antigens present on the nonclassic class I MHC-like molecule, CD1d.
  • the TCRs of NKTs recognize glycolipid, glycosphingolipid or lipid structures presented on non-polymorphic CD1d molecules expressed by professional and nonprofessional APCs (antigen presenting cells), including DCs, macrophages (Mo), B cells, thymocytes, adipocytes, hepatocytes and endothelial cells.
  • APCs antigen presenting cells
  • CD56 is present on some types of NKTs. This molecule, a form of neural cell adhesion molecule 1 (NCAM1), allows binding to other molecules. Therefore, molecules that express CD56 can bind to each other by homotypic adhesion (meaning adhesion mediated by undefined adhesion molecules between identical cell types). CD56 is the archetypal phenotypic marker of natural killer cells, but can actually be expressed by many more immune cells, including ⁇ T cells, ⁇ T cells, DCs, and monocytes. (Van Acker, HH, t al., “CD56 in the immune system: more than a marker for cytotoxicity?” Front. Immunol. (2017) 8: 892).
  • NKTs activation of NKTs may be regulated by a balance of activating and inhibitory signaling.
  • NK receptor expression by NKTs varies with the developmental stage of an NKT, its activation status and the genetic background of the host. (Wah, MakTak, et al. “Chapter 11: NK, ⁇ T and NKT Cells.” Primer to the Immune Response. Elsevier, 2014).
  • Activation can occur directly through the engagement of NKT TCRs with suitable antigens on CD1d molecules, or indirectly through inducement via APCs.
  • NKT stimulation and effector function depends on the integration of signals derived from its various receptors.
  • NKTs can recognize and kill virally infected and neoplastic cells through their cytotoxic function. NKTs can also activate APCs to initiate adaptive antitumor immunity. Additionally, NKTs may secrete pro-inflammatory cytokines that activate NK and CTL serial killing action. [00266] NKTs can kill tumor cells through: the perforin/granzyme pathway; the Fas/FasL pathway; and the TRAIL pathway. Activated NKTs express perforin and Fas ligand on their surface, which can directly kill tumor cells. CD56+ NKTs seem to be more efficient killer cells than those that are CD56-. (Terabe, Masaki, and Jay A. Berzofsky.
  • NKTs can also enhance ADCC mediated by NKs. (Terabe, Masaki, and Jay A. Berzofsky.
  • NKTs further play an immunoregulatory role where NKTs stimulate the production of cytokines, including, without limitation, Interferon- ⁇ (IFN ⁇ ), Granulocyte macrophase colony-stimulating factor (GM-CSF), Colony-stimulating factor 1 (CSF-1), Tumor necrosis factor ⁇ (TNF ⁇ ), Transforming growth factor (TGF ⁇ ), Interleukin (IL) 3 (IL-3), IL-5, IL-10, IL-13, chemokines (CCL1, 2, 3,4) and (CXCL8).
  • IFN ⁇ Interferon- ⁇
  • GM-CSF Granulocyte macrophase colony-stimulating factor
  • CSF-1 Colony-stimulating factor 1
  • TGF ⁇ Tumor necrosis factor ⁇
  • TGF ⁇ Transforming growth factor
  • IL Interleukin
  • IL-3 Interleukin
  • IL-5 Interleukin
  • IL-10 IL-13
  • chemokines CCL1, 2, 3,4 and (CXCL8).
  • NKTs in the spleen, liver, or bone marrow are stimulated to undergo rapid clonal expansion within 3 days of an antigen encounter.
  • activated NKTs can immediately carry out effector function without the need for differentiation. Therefore, it has been said that NKTs exist in a “preactivated state,” and supply timely and effective defense during the interval needed by conventional T cells for proliferation and differentiation into the effectors of the more finely tailored adaptive responses.
  • NKTs play a role in the regulation of immunity through the release of cytokines. NKTs carry preformed mRNAs for IL-4 and IFN ⁇ so that massive amounts of these cytokines can be produced within 1-2 hours of activation.
  • NKTs can synthesize IL-2, IL-10, IL-17, among other interleukins, as well as TGF ⁇ , TNF ⁇ , and a large array of chemokines.
  • NKs express inhibitory and activating NK receptors, including NKG2D and CD94/NKG2A in mice and humans, and certain KIRs in human. NKTs also express CD40L, ICOS, and PD-1.
  • Type I NKTs [00272] The type I NKT TCR is largely encoded by a germline Va gene (Va14/Ja18 in mice and Va24/JaQ) in humans) and additionally by the more diverse, non-germline VB chain genes (VB8.2/7/2 in mice and VB11 in humans). They respond to both ⁇ - and ⁇ - linked glycolipids, and bind to CD1d in a parallel configuration that mainly involves the ⁇ -chain.
  • the TCR ⁇ chain is essentially invariant among the NKTs in a species, whereas the TCR ⁇ chain can be diversified. For example, in humans all NKTs express a TCR in which the TCR ⁇ chain expresses Va24 plus Ja18, and the TCR ⁇ chain usually contains V ⁇ 2, 7, or 8. Intracellular signalling is conveyed by the associated CD3 complex. (Wah, MakTak, et al. “Chapter 11: NK, ⁇ T and NKT Cells.” Primer to the Immune Response. Elsevier, 2014).
  • NKT type I cells can also be stimulated in a CD1d-independent manner by exposure to several cytokines, such as IL-12, IL-18, or IL-12 and Type I IFN.
  • cytokines such as IL-12, IL-18, or IL-12 and Type I IFN.
  • Type I NKTs have the potential to regulate the function of essentially every type of hematopoietic cell. It has been reported that type I NKTs regulate the functions of APCS, such as DCs, macrophages, and B cells, and other lymphocytes, including NKs and other T cell subsets.
  • Type II NKTs are more abundant in humans than are Type I NKTs. Unlike Type I NKTs, Type II NKTs are not reactive to a-GalCer or other a-linked glycolipids; instead, they likely recognize B-linked glycolipids such as sulfatide, lysosulfatide, lysophosphatidylcholine (Lyso-PC), and glucosylsphingosine (lyso-GL1).
  • Type II dNKTs recognize a naturally occurring self antigen known as sulphatide, which is enriched in several membranes, including myelin in the central nervous sytem, pancreas, kidney and liver.
  • Type II NKTs mediate protection from autoimmune disease by down-regulation of inflammatory responses elicited by Type I NKTs.
  • TCRs of Type II NKTs are encoded by Va- and VB- chain genes largely of the non-germline type.
  • Type II NKTs typically contact ligands with their B chain rather than their a-chain, a mechanism shared by conventional T cells (convTCs), and to a lesser extent type I NKTs.
  • NKT-like Cells e.g., Cytokine-Induced Killer (CIK) cells
  • CIK Cytokine-Induced Killer
  • CIK cells varies between CD3 + CD56 + , CD3 + CD56-, and CD3-CD56 + , but may not express the Fc receptor CD16.
  • NKT-like cells Like other Serial Killer Cells, NKT-like cells have immunoregulatory effector function. (Gutegemann et al. (2007). “Cytokine-induced killer cells are type II natural killer T cells.” GMS German Medical Science 5: 1-4). [00280] CIK and NKT-like cell differentiation from Type I and Type II NKTs is not well understood.
  • CIKs Cytokine-Induced Killer cells
  • CIKs are a heterogenous population of CD8+ T cells that can be expanded ex vivo via incubation with an anti-CD3 antibody, IFN-y, and IL-2. They have cytotoxic activity mediated by FasL/Fas and perforin/granzyme action.
  • CIKs are generally divided into two main subsets: CD3+CD56+ type and CD3+CD56- type.
  • CD3+CD56+ T cells are considered to be the major effector cells of CIK CIK cells can lyse cancer cells in a MHC-unrestricted manner through activating NK cell receptors, such as DNAX accessory molecule-1, NKp46, NKG2D, and NKp30.
  • NK cell receptors such as DNAX accessory molecule-1, NKp46, NKG2D, and NKp30.
  • ⁇ T cells are another serial killer cell population that bridges the gap between innate and adaptive immunity. Despite being of a T cell lineage and expressing surface TCRs, ⁇ T cells also display NKG2D, an NK receptor, and display nonspecific recognition that activate their cytotoxic and immunomodulating effector function. (Wu YL, Ding YP, Tanaka Y, Shen LW, Wei CH, Minato N, Zhang W.
  • GDTs can be organized into two major populations distinguished by their surface expression of ⁇ TCRs (discussed infra) and ⁇ TCRs. T cells that express the ⁇ TCR generally also express CD4 or CD8 lineage markers (discussed supra). However, GDTs generally do not express these markers, and further do not require conventional antigen presentation in the context of MHC presentation. GDTs can be further organized into populations based on ⁇ chain expression, specifically, V ⁇ 1, V ⁇ 2, and V ⁇ 3 chains.
  • the diversity for GDTs is at least as large as that of the ⁇ TCR repertoire, due to extensive non-genetic mechanisms.
  • GDTs Similar to other serial killer cells, GDTs have cytolytic/cytotoxic effector function through the perforin/granulysin-granzyme pathway as well as the death receptor/ligand pathway, such as Fas/FasL. Further, GDTs secrete Th1, Th2, and Th17 cytokines, each of which has an immunoregulatory impact on innate and adaptive immunity.
  • Cytolytic T Lymphocytes CTLs
  • Cytolytic T Lymphocytes constitute a distinct lymphocyte subpopulation.
  • NKTs Unlike NKTs, they are induced by several diverse stimuli, including major histocompatibility antigens, protein antigens, viruses, and intracellular bacteria and peptides.
  • CTLs Like a number of other cells discussed herein, CTLs have cytolytic effector function. However, unlike NKs and NKTs, CTLs release the cytoxic proteins perforin and granzyme in an antigen-dependent manner.
  • CD8+ CTLs [00287] Unlike some NKTs and NKs, CD8+ CTLs recognize peptides bound to class I MHCs. Activation and proliferation of the CTLs are induced by exposure to specific antigens.
  • CD8+ CTLs Like NKTs, activation of CD8+ CTLs results in the secretion of cytolytic mediators, such as perforin and granzyme that induce apoptosis in target cells, such as tumor cells.
  • cytolytic mediators such as perforin and granzyme that induce apoptosis in target cells, such as tumor cells.
  • This action is cell specific: research suggests that CD8+ CTLs reorient their secretory apparatus toward each cell and attack at only one point of contact at any one time. (Murphy, Kenneth M., et al. Janeways Immunobiology. 9th ed., GS, Garland Science, Taylor & Francis Group, 2017. pps.387-395).
  • CTLs secrete various cytokines, such as IFNy and TNF- ⁇ , which enhance antigen presentation and mediate antipathogenic effects.
  • IFN- y induces the increased expression of MHC Class I and other molecules involved in peptide loading of the newly synthesized MHC Class I proteins in infected cells. This increases the chance that target cells will be recognized for cytotoxic attack.
  • TNF- ⁇ synergistically works with IFN-y to increase its effector function. It has been reported that various cytokines, such as IL-2 or IFNy producing CD4+ T cells, are required for the generation of effective CTL immunity.
  • type I NKT activation causes immunopotentiation against tumors or microbes.
  • activation of type I NKTs such as by IL-12 (CIKs), or a-GalCer (non-CIK NKT), can result in Th1 cytokine production (IFNy).
  • CIKs IL-12
  • a-GalCer non-CIK NKT
  • Type I NKT activation by a-GalCer can result in NKTs secreting both Th1 cytokines (IFNy) and Th2 cytokines (IL-4).
  • activated type II NKTs suppress CD8+ CTL activity via cytokine production, namely IL-4, IL-13, and TGF-B.
  • CD8+ CTLs are activated when na ⁇ ve CD8+ T cells interact with APCs.
  • This activation depends on the number of MHC complexes present on the APCs, the affinity of the CTL’s TCR for the MHC complex, and the signals provided by the APCs in the form of costimulatory molecules.
  • the B7/CD28 and CD40/CD40L costimulatory pathways are well known examples of costimulatory interaction pathways that contribute to T cell activation and production.
  • NKT activation can upregulate costimulatory molecules (such as CD40, CD80, and CD86) in both CD8+ and CD8- DC subsets. Both B7/CD28 and CD40/CD40L costimulatory pathways are additionally linked to NKT activation.
  • CD4+ CTLs [00292] Very little is known about the phenotype, function and transcriptional profile of cytolytic CD4+ T cells. Similar to NKTs, CD4+ CTLs display a multitude of markers and effector function that cross adaptive and innate immunity.
  • CD4+ T cells differ from other Th1 lineage cells.
  • CD4+ cells lose the ability to secrete IL-2, lack the expression of CD28 and CD27, and further upregulate the expression of integrin a chains CD11a and CD11b as well as CD57.
  • cytolytic CD4+ cells express NKG2D, KIR2DS2 and KARAP/DAP12 receptors; NKG2D has been hypothesized to act as a receptor in cytolytic CD4+ T cells lacking CD28 CD28.
  • CTLs express CD25, a cell marker that is characteristic of Tregs.
  • Cytolytic CD4+ cells additionally express FasL, and have been shown to kill targets that express Fas.
  • CD4+ CTLs further express high levels of perforin and granzyme or granulysin, and have been shown to lyse target cells in an antigen dependent fashion.
  • CD4+ CTLs that express TRAIL may induce bystander apoptosis in antigen-presenting cells as well as in TRAIL-sensitive tumor cell lines. Id. [00295] CD4+ CTLs also play an immunoregulatory role, as they have been found to secrete TNF- ⁇ and INF- ⁇ . As discussed en supra, target cells can be sensitized for TRAIL-mediated apoptosis by the presence of pro-inflammatory cytokines.
  • MAIT cells Mucosal-associated invariant T cells
  • MR1 Mucosal-associated invariant T cells
  • MAIT cells have both peripheral CD56+ and CD56 ⁇ subsets, although the CD56- subset is thought to be linked to tumor infiltrating T cells.
  • the CD56- subset of MAIT cells has been correlated with the expression of pro- inflammatory cytokines, although not IL-4, IL-5 and IL-10.
  • Lymphokine Activated Killer Cells [00297] Lymphokine-activated killer cells (LAKs) are cytotoxic effector cells with an exceptionally wide target cell spectrum including normal and malignant cells of different origins. They are killer cell lymphocytes activated in the presence of interleukin-2 (IL-2).
  • IL-2 interleukin-2
  • LAK cells exhibit a profound heterogeneity with regard to phenotype surface marker expression; it remains to be determined if they represent a unique cell lineage Activation of Serial Killer Cell Populations [00298]
  • Serial killer cells can directly or indirectly recognize histocompatibity molecules between genetically disparate individuals within the same species, otherwise known as "allorecognition.” Some serial killer cells, through direct allorecognition, can recognize determinants on MHC, MHC-like complexes, and other molecules displayed on the surface of host cells (i.e., tumor infiltrated cells), without the requirement for antigen processing. Some serial killer cells can recognize processed peptides of antigens presented by MHC molecules via indirect allorecognition in a self-restricted manner.
  • serial killer cell effector function may further require prevention of inhibitory receptor ligand binding either on the surface of host cells or in the reaction environment, interference of inhibitory receptors on the surface of serial killer cells, or a blockade of the inhibitory signals induced in serial killer cells.
  • Natural cytotoxicity receptors exist on the surface of serial killer cells, such as NKs, NKTs, GDT, macrophages, CD4+ CTLs, and CD8+ CTLs.
  • NKG2D is a C-type lectin-like type II transmembrane glycoprotein.
  • Other natural cytotoxicity recptors include, without limitation, NKp46 (NCR1, CD335), NKp44 (NCR2, CD336), and NKp30 (NCR3, CD337). These natural cytotoxicity receptors act as activators of serial killer cells, or as co-stimulatory signals in heteroclitic cross-reactivity activation.
  • PAMPs pathogen-associated molecular patterns
  • DAMPs damage associated molecular patterns
  • PRRs germline-encoded pattern recognition receptors
  • TLRs toll-like receptors
  • NOD nucleotide oligomerization domain
  • CLRs C-type lectin receptors
  • PRRs on APCs result in multiple immune system effects: 1) high level expression of stable "non-self" protein presenting MHC complexes on the cell surface, which triggers T cell responses; 2) expression of high levels of costimulatory molecules such as CD80 and CD86 that prime and activate antigen-specific T cells; and 3) the secretion of proinflammatory cytokines, such as IL-1, IL-6, IL-12, TNF- ⁇ , GM- CSF, and IFN-y. The secretion of proinflammatory cytokines then induces the activation of APCs, which directly activate non-specific serial killer cells and help to promote T-cell differentiation into antigen-specific helper T cells or cytotoxic T cells that mediate acquired immunity.
  • proinflammatory cytokines such as IL-1, IL-6, IL-12, TNF- ⁇ , GM- CSF, and IFN-y.
  • DAMPs are molecules that are not pathogen derived, but instead are molecules such as the intracellular contents of a cell that has undergone cell death. There is evidence that DAMP signaling through TLRs initiates and amplies pathogen-independent responses.
  • NKG2D ligand expression indicates cellular stress and represents a self-identification mark for cyotoxic lymphocytes. NKG2D ligand expression has been found to be upregulated by the stimulation of immature DCs with PAMPs.
  • p38 MAPK is selectively phosphorylated by MAPKKs (MKK3 and MKK6), which in turn are activated by MAPKKKs, including TGF ⁇ -activated kinase 1 (TAK1), apoptosis signal-regulating kinase 1 (ASK1), mixed- lineage kinase 2 (MLK2) or MLK3.
  • TGF ⁇ -activated kinase 1 TGF ⁇ -activated kinase 1
  • ASK1 apoptosis signal-regulating kinase 1
  • MLK2 mixed- lineage kinase 2
  • MLK3 and MKK6 mixed- lineage kinase 2
  • the p38 MAPK-mediated signals initiate the activation of several transcriptional factors including CREB, ATF2 and Myc, as well as other kinases including MK2, but also MK3, MNK1/2, and MSK1/2 (Id. citingId. citing Obata, T. et al,
  • ENLSTTM cells of the described invention refers to a stably transfected ENLSTTM cell population that yields a reproducible level of MNC immunostimulation in dose dependent fashion in an MLTR in vitro. It includes stably transfected live ENLSTTM cells, membrane fragments of ENLSTTM cells comprising an exogenous immunomodulatory protein, and dead necrotic ENLSTTM cells comprising an immunomodulatory protein expressed on their surface, each of which is capable of MNC immunostimulation either directly or indirectly.
  • stem cells refers to undifferentiated cells having high proliferative potential with the ability to self-renew that can generate daughter cells that can undergo terminal differentiation into more than one distinct cell phenotype.
  • the terms “subject” or “individual” or “patient” are used interchangeably to refer to a member of an animal species of mammalian origin, including humans.
  • subject in need thereof refers to a patient that (i) will be administered a composition according to the described invention, (ii) is receiving an composition according to the described invention; or (iii) has received a composition according to the described invention, unless the context and usage of the phrase indicates otherwise. “Subject in need thereof” may also refer to a subject that has or is suspected of having an disorder susceptible to treatment with a composition of the described invention. [00312]
  • substantially pure with regard to a cell component of a composition as used herein refers to that cell component being substantially separated from substances with which it may be associated in living systems.
  • the term “suppress” in any of its grammatical forms as used herein refers to inhibiting or decreasing activity.
  • the term “symptom” as used herein refers to a sign or an indication of disorder or disease, especially when experienced by an individual as a change from normal function, sensation, or appearance.
  • the term “therapeutic agent” as used herein refers to a drug, molecule, nucleic acid, protein, metabolite, cell, composition or other substance that provides a therapeutic effect.
  • active refers to the ingredient, component or constituent of the compositions of the described invention responsible for the intended therapeutic effect.
  • therapeutic agent and “active agent” are used interchangeably herein.
  • therapeutic component refers to a therapeutically effective dosage (i.e., dose and frequency of administration) that eliminates, reduces, or prevents the progression of a particular disease manifestation in a percentage of a population.
  • ED50 which describes the dose in a particular dosage that is therapeutically effective for a particular disease manifestation in 50% of a population.
  • terapéuticaally effective amount of an active agent is used interchangeably to refer to an amount that is sufficient to provide the intended benefit of treatment.
  • dosage levels are based on a variety of factors, including the age, weight, sex, medical condition of the patient, the severity of the condition, the route of administration, and the particular active agent employed. Thus the dosage regimen may vary widely, but can be determined routinely by a physician using standard methods.
  • therapeutic amount and “pharmaceutically effective amounts” include prophylactic or preventative amounts of the compositions of the described invention.
  • compositions or medicaments are administered to a patient susceptible to, or otherwise at risk of, a disease, disorder or condition in an amount sufficient to eliminate or reduce the risk, lessen the severity, or delay the onset of the disease, disorder or condition, including biochemical, histologic and/or behavioral symptoms of the disease, disorder or condition, its complications, and intermediate pathological phenotypes presenting during development of the disease, disorder or condition. It is generally preferred that a maximum dose be used, that is, the highest safe dose according to some medical judgment.
  • dose and “dosage” are used interchangeably herein.
  • therapeutic effect refers to a consequence of treatment, the results of which are judged to be desirable and beneficial.
  • a therapeutic effect can include, directly or indirectly, the arrest, reduction, or elimination of a disease manifestation.
  • a therapeutic effect can also include, directly or indirectly, the arrest reduction or elimination of the progression of a disease manifestation.
  • the therapeutically effective amount may be initially determined from preliminary in vitro studies and/or animal models.
  • a therapeutically effective dose may also be determined from human data.
  • the applied dose may be adjusted based on the relative bioavailability and potency of the administered compound. Adjusting the dose to achieve maximal efficacy based on the methods described above and other well-known methods is within the capabilities of the ordinarily skilled artisan.
  • the term "therapeutic window” refers to a concentration range that provides therapeutic efficacy without unacceptable toxicity. Following administration of a dose of a drug, its effects usually show a characteristic temporal pattern. A lag period is present before the drug concentration exceeds the minimum effective concentration ("MEC") for the desired effect. Following onset of the response, the intensity of the effect increases as the drug continues to be absorbed and distributed. This reaches a peak, after which drug elimination results in a decline in the effect's intensity that disappears when the drug concentration falls back below the MEC.
  • MEC minimum effective concentration
  • the duration of a drug's action is determined by the time period over which concentrations exceed the MEC.
  • the therapeutic goal is to obtain and maintain concentrations within the therapeutic window for the desired response with a minimum of toxicity.
  • Drug response below the MEC for the desired effect will be subtherapeutic, whereas for an adverse effect, the probability of toxicity will increase above the MEC.
  • Increasing or decreasing drug dosage shifts the response curve up or down the intensity scale and is used to modulate the drug's effect.
  • Increasing the dose also prolongs a drug's duration of action but at the risk of increasing the likelihood of adverse effects. Accordingly, unless the drug is nontoxic, increasing the dose is not a useful strategy for extending a drug's duration of action.
  • a plasma-concentration range associated with effective therapy has been defined.
  • a target level strategy is reasonable, wherein a desired target steady-state concentration of the drug (usually in plasma) associated with efficacy and minimal toxicity is chosen, and a dosage is computed that is expected to achieve this value. Drug concentrations subsequently are measured and dosage is adjusted if necessary to approximate the target more closely.
  • drugs are administered in a series of repetitive doses or as a continuous infusion to maintain a steady-state concentration of drug associated with the therapeutic window.
  • the rate of drug administration is adjusted such that the rate of input equals the rate of loss. If the clinician chooses the desired concentration of drug in plasma and knows the clearance and bioavailability for that drug in a particular patient, the appropriate dose and dosing interval can be calculated.
  • living cellular therapies break this concept, since they divide and may even take up permanent residence in the body in the case of autologous cellular therapy. Hence what is initially administered can bear little correlation to what is present in the recipient over time.
  • treating includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical symptoms of a condition, or substantially preventing the appearance of clinical symptoms of a condition. Treating further refers to accomplishing one or more of the following: (a) reducing the severity of the disorder; (b) limiting development of symptoms characteristic of the disorder(s) being treated; (c) limiting worsening of symptoms characteristic of the disorder(s) being treated; (d) limiting recurrence of the disorder(s) in patients that have previously had the disorder(s); and (e) limiting recurrence of symptoms in patients that were previously asymptomatic for the disorder(s).
  • Treatment also includes eliciting a clinically significant response, whether detectable or undetectable, without excessive levels of side effects.
  • tumor burden and “tumor load” are used interchangeably to refer to the number of cancer cells, the size of a tumor, or the amount of cancer in the body.
  • wild type As used herein, the terms “wild type,” “naturally occurring,” or grammatical equivalents thereof, are meant to refer to an amino acid sequence or a nucleotide sequence that is found in nature and includes allelic variations; that is, an amino acid sequence or a nucleotide sequence that usually has not been intentionally modified.
  • non-naturally occurring “synthetic,” “recombinant,” or grammatical equivalents thereof, are used interchangeably to refer to an amino acid sequence or a nucleotide sequence that is not found in nature; that is, an amino acid sequence or a nucleotide sequence that usually has been intentionally modified.
  • nucleic acid once a recombinant nucleic acid is made and reintroduced into a host cell or organism, it will replicate non-recombinantly, i.e., using the in vivo cellular machinery of the host cell rather than in vitro manipulations, however, such nucleic acids, once produced recombinantly, although subsequently replicated non- recombinantly, are still considered recombinant for the purpose of the described invention.
  • the described invention provides a method for in vitro activation of cytotoxic T-cell populations followed by passive immunization of a cancer subject not currently under the influence of an immunosuppressive regimen with a composition comprising a cell product containing activated and expanded mononuclear cells including activated and expanded subpopulations of serial killer cells, the method comprising, under sterile conditions: [00330]
  • STEP 1 Inducing an immune response in vitro by: [00331] (a) isolating a population of mononuclear cells (MNCs) from a biological sample; [00332] (b) preparing a population of engineered leukocyte stimulator cells (“ENLSTTM cells”) comprising an allogeneic tumor cell line transfected or transduced with recombinant DNA sequences encoding at least three essential immunomodulators peptides, wherein the three essential immunomodul
  • the immune system of the cancer subject not currently under the influence of an immunosuppressive regimen is intact, meaning it is not depleted by the immunosuppressive regimen.
  • the immunosuppressive regimen comprises chemotherapy.
  • the subject is a melanoma patient.
  • the subject is a prostate cancer patient.
  • the subject is a breast cancer patient.
  • STEP 1 Inducing an immune response in vitro (i) Isolating a population of mononuclear cells (MNCs) from a biological sample
  • MNCs mononuclear cells
  • the biological sample is autologous to the recipient subject.
  • the biological sample is allogeneic to the recipient subject.
  • the biological sample is derived from a subject not currently under the influence of an immunosuppressive regimen that is not the recipient.
  • the biological sample is of mammalian origin.
  • the biological sample is human.
  • the source of the mononuclear cell population is a body fluid.
  • the body fluid is umbilical cord blood, whole blood, peripheral blood, mobilized peripheral blood, or bone marrow.
  • the source of the smononuclear cell population is whole blood.
  • the biological sample is a bone marrow sample.
  • the biological sample is umbilical cord blood.
  • the biological sample is a peripheral blood sample.
  • the sample is a mobilized peripheral blood sample. Treatment with hematopoietic growth factors has been shown to cause a marked rise in the number of hematopoietic progenitor cells in the peripheral blood as measured by the presence of CD34+ cells, or as measured in a colony formation assay as CFUs.
  • HSCs mobilized-peripheral blood hematopoietic stem cells
  • Colony stimulating factors are agents used for hematopoietic stem cell mobilization.
  • colony stimulating factors include, without limitation, G-CSF, GM-CSF, and pharmaceutically acceptable analogs and derivatives thereof.
  • filgrastim a G-CSF analog produced by recombinant technology, is marketed under the brand names Neupogen® (Amgen); Religrast® (Reliance Life Sciences), Nugraf® (Zenotech Laboratories, Ltd., and Neukine® (Intas Biopharmaceuticals).
  • the mononuclear cells can be isolated from whole blood by density gradient centrifugation using a hydrophilic colloid (e.g., polymers formed by the copolymerization of sucrose and epichlorohydrin (Ficoll-Paque®) or polyvinylpyrrolidone-coated colloidal silica (Percoll®).
  • a hydrophilic colloid e.g., polymers formed by the copolymerization of sucrose and epichlorohydrin (Ficoll-Paque®) or polyvinylpyrrolidone-coated colloidal silica (Percoll®).
  • a diluted mixture of PBS and peripheral blood is layered in a 50 ml centrifuge tube on top of Ficoll-Paque®, and centrifuged at 400 x g for 30-40 minutes at 20°C in a swinging- bucket rotor without brake.
  • the upperlayer is aspirated, leaving the mononuclear cell layer (lymphocytes, monocytes and thrombocytes) undisturbed at the interface.
  • the mononuclear cell layer is carefully transferred into a new 50 ml centrifuge tube. Cells are washed with PBS (pH 7.2) containing 2 mM EDTA, centrifuged at 300 x g for 10 min at room temperature and the supernatant discarded. For removal of platelets, the cell pellet is resuspended in 50 mL buffer and centrifuged at 200 x g for 10-15 minutes at room temperature. The supernatant containing the platelets is removed. This step is repeated.
  • the cell pellet is resuspended in a suitable buffer solution or medium for downstream applications.
  • An alternative exemplary protocol for isolating PBMCs is via leukapheresis.
  • whole blood can be obtained from a patient with informed consent, and run through a device that automatically separates the target PBMC fraction from other components of the blood, such as plasma and red blood cells; the other components are then returned to the patient while the isolated PBMC is collected.
  • the collected PBMC may undergo further processing, for example the removal of residual red blood cells through lysis.
  • mononuclear cells also can be isolated from an allogeneic source, e.g., umbilical cord blood.
  • the mononuclear cell (MNC) fraction of umbilical cord blood is composed of lymphocytes (T cells, B cells, and NK cells), monocytes, dendritic cells and stem/progenitor cells.
  • Anticoagulated cord blood citrate phosphate dextrose (Sigma-Aldrich, St. Louis, MO) is drawn directly into a 50 mL tube containing 5 mL buffer and stored at 4 C prior to separation.
  • Anticoagulated cord bblood is diluted with 3x volume of buffer.
  • the diluted cell suspension is carefully layered over Ficoll-Paque® in a 50 ml conical tube and centrifuged at 400 x g for 35 minutes at 20° C in a swinging bucket rotor without brake.
  • the upper layer is aspirated, leaving the mononuclear cell layer undisturbed at the interphase.
  • the mononuclear layer is careflyy transferred to a new 50 mL conical tube.
  • the tube is filled with buffer, mixed and centrifuged at 300 x g for 10 min at 20 C. The supernatant is carefully aspirated.
  • the cell pellet is resuspended in 50 mL of buffer and centrifuged at 200 xg for 10-15 minutes at 20 C. The supernatant is carefully removed completely.
  • the cell pellet is resuspended in an appropriate amount of buffer for downstream applications.
  • mononuclear cells can be isolated from bone marrow: Bone marrow is collected from the upper iliac crest or the sternum using an aspiration needle. The aspirated human bone marrow is diluted at a ratio of 7:1 with a suitable buffer. The cells are passed through a 100 ⁇ m filter to remove bone fragments and cell clumps. The diluted cell suspension is layered over Ficoll-Paque® in a 50 ml conical tube, and centrifuged at 445 x g for 35 minutes at 20° C in a swinging bucket rotor without brake. The upper layer is aspirated, leaving the mononuclear cell layer undisturbed.
  • the isolated population of MNCs comprises a mixed population of lymphocytes, a population of monocytes, and a population of dendritic cells.
  • the frequencies of these populations in peripheral blood vary across individuals, but typically, lymphocytes are in the range of 70–90 %, monocytes from 10 to 20 %, while dendritic cells are rare, accounting for only 1–2 %.
  • lymphocytes are in the range of 70–90 %, monocytes from 10 to 20 %, while dendritic cells are rare, accounting for only 1–2 %.
  • the mixed population of lymphocytes comprises a subpopulation of T cells, a subpopulation of B cells, and a subpopulation of NK cells.
  • the T lymphocytes comprise a subpopulation of CD8 T lymphocytes and a subpopulation of CD4 T lymphocytes.
  • the term “ENLSTTM cells” as used herein refers to engineered leukocyte stimulator cells.
  • the ENLSTTM cells comprise a primary tumor cell line transfected or transduced with recombinant DNA sequences.
  • the recombinant DNA sequences encode a core of the following essential immunomodulatory peptides: OX40 Ligand (OX40L), CD27 Ligand (CD70) and CD28 Ligand (CD28L) comprising CD80, CD86, or both.
  • the recombinant sequences can comprise one or more additional subsets of immunomodulators designated as R groups (by analogy to those in a core chemical structure), with each subset comprising 3-25 immunomodulators.
  • the method further comprises developing a clonal cell bank of the ENLSTTM cell population(s) to minimize cell heterogeneity.
  • the ENLSTTMs are clonal.
  • the disclosure provides a population of ENLSTTM cells expressing one or more tumor specific antigens.
  • the tumor specific antigens may be encoded by a primary open reading frame of gene products that are differentially expressed by tumors, and not by normal tissues.
  • the tumor specific antigens may be encoded by mutated genes, intronic sequences, or translated alternative open reading frames, pseudogenes, antisense strands, or may represent the products of gene translocation events.
  • the tumor cell provides a broad array of tumor specific antigens, many of which are of unknown nature.
  • the tumor antigen is a neoantigen.
  • tumor specific antigens include, without limitation: (a) nonmutated shared antigens (e.g., melanoma-associated antigen (MAGE), B-melanoma antigen (BAGE), renal tumor antigen (RAGE), and a cancer testis antigen (e.g.
  • differentiation antigens e.g., prostate-specific membrane antigen [PSMA] and prostate-specific antigen (PSA) in prostate carcinoma, Mart1/MelanA and tyrosinase present in many melanomas, and carcino embryonic antigen (CEA) present in a large percentage of colon cancers
  • PSMA prostate-specific membrane antigen
  • CEA carcino embryonic antigen
  • mutated oncogenes and tumor suppressor genes e.g., mutated ras, rearranged bcr/abl, mutated p53
  • unique idiotypes e.g., immunoglobulin antigensin myeloma and B-cell myeloma, T- cell receptor (TCR) expressed in CTCL
  • oncovirus-derived epitopes e.g., the human papillomavirus–encoded E6 and E7 proteins, Epstein–Barr virus
  • the tumor specific antigen is selected from an antigen listed in the publically available Cancer Antigenic Peptide Database (on the worldwide web at caped.icp.ucl.ac.be/Peptide/list, incorporated by reference in its entirety herein).
  • the tumor specific antigen comprisesan antigen set forth in Table 4, shown below. Table 4. Tumor Specific Antigens.
  • the population of tumor cells is derived from a cancer selected from the group consisting of melanoma, colorectal carcinoma, leukemia, chronic myeloid leukemia, prostate cancer, head and neck cancer, squamous cell carcinoma, tongue cancer, larynx cancer, tonsil cancer, hypopharynx cancer, nasalpharynx cancer, breast cancer, colon cancer, lung cancer, pancreatic cancer, hepatocellular carcinoma, glioblastoma and brain cancer.
  • a cancer selected from the group consisting of melanoma, colorectal carcinoma, leukemia, chronic myeloid leukemia, prostate cancer, head and neck cancer, squamous cell carcinoma, tongue cancer, larynx cancer, tonsil cancer, hypopharynx cancer, nasalpharynx cancer, breast cancer, colon cancer, lung cancer, pancreatic cancer, hepatocellular carcinoma, glioblastoma and brain cancer.
  • the population of tumor cells is characterized by the expression of one or more of gp100, tyrosinase, Melan-A, tyrosinase-related protein (TRP-2-INT2), melanoma antigen-1 (MAGE-A1), NY-ESO-1, preferentially expressed antigen of melanoma (PRAME) CDK4 and multiple myeloma oncogene 1 (MUM-1).
  • the population of colorectal cancer tumor cells is characterized by the expression of one or more of carcinoembryonic antigen (CEA), MAGE, HPV, human telomerase reverse transcriptase (hTERT), EPCAM, PD-1, PD-L1, p53, cell surface-associated mucin 1 (MUC1) .
  • CCA carcinoembryonic antigen
  • MAGE HPV
  • hTERT human telomerase reverse transcriptase
  • EPCAM telomerase reverse transcriptase
  • PD-1 PD-1
  • PD-L1 cell surface-associated mucin 1
  • MUC1 cell surface-associated mucin 1
  • Immunologic antigenic specificity may arise from one or more of the amino acid sequence of the antigen, from the degree of expression of that antigen by the tumor cell, from post-translational modification of the antigen, and the like.
  • Immunologic antigen specificity to a certain type of cancer cell may also arise from one or more of a particular fingerprint of a plurality of tumor antigens, from the fact that a particular antigen, while expressed by a wide variety of tumor cells, has particular use in immunotherapy against a smaller number of tumor types, from the fact that a particular collection of MHC class I presentable and MHC class II presentable epitopes exist on a particular polypeptide or polypeptide fragment, and by omitting one or more peptides that may provoke immunotolerance.
  • the skilled artisan can locate the relevant nucleic acid and polypeptide sequences, e.g., on the U.S. Government's web site, at ncbi.nlm.nih.
  • the tumor cells are derived from a sample from a subject. According to some embodiments, the tumor cells are derived from a tumor cell line or tumor cell line variant.
  • tumor antigen specificity of the described invention may be determined by the parental tumor cell line or tumor cell line variant that is selected for modification with immunomodulators.
  • Parent Cell Lines [00357] According to some embodiments, tumor cell line or tumor cell line variants may be derived from established cell lines from either public sources (e.g. NIH, DCTD Tumor Repository operated by Charles River Laboratories Inc.) or commercial sources (e.g. ATCC, Sigma Alrich, Thermo Fischer Scientific, Genescript, DSM2).
  • new cell lines can be established de novo from tumor cells derived from the tumor of a cancer patient.
  • cancer tissues, cancer cells, cells infected with a cancer-causing agent, other preneoplastic cells, and cell lines of human origin can be used as a source.
  • a cancer cell can be from an established tumor cell line or tumor cell line variant such as, without limitation, an established non-small cell lung carcinoma (NSCLC), a bladder cancer, a melanoma, an ovarian cancer, a renal cell carcinoma, a prostate carcinoma, a sarcoma, a breast carcinoma, a squamous cell carcinoma, a head and neck carcinoma, a hepatocellular carcinoma, a pancreatic carcinoma, or a colon carcinoma cell line.
  • the established cell lines comprise the LNCaP clone FGC (ATCC CRL-1740), which itself is derived from a metastatic prostate cancer that had migrated to a lymph node.
  • the established cell lines comprise the PC-3 (ATCC CRL-1435) cell line, which itself is derived from metastatic prostate cancer that migrated to bone.
  • the tumor cell line or tumor cell line variants are derived from one or more of the following ATCC cell lines: VCaP (ATCC CRL-2876); MDA PCa 2b (ATCC CRL- 2422); or DU 145 (ATCC HTB-81).
  • the established cell lines comprise the SK- MEL-2 clone (ATCC HTB-68), which itself is derived from metastasis on skin of thigh.
  • the established cell lines comprise one or more of mammary carcinoma cell lines designated COO-G, DU4475, ELL-G, HIG-G, MCF/7, MDA-MB-436, MX-1, SW-613, and VAN-G.
  • the established cell lines comprise one or more of alveolar soft part sarcoma cell lines designated ASPS, and ASPS-1.
  • the established cell lines comprise one or more lung cell lines designated LX-1, COS-G, H-MESO-1, H- MESO-1A, NCI-H23, and NCI-H460.
  • the established cell lines comprise one or more colon cancer cell lines designated CX-5, GOB-G, HCC- 2998, HCT-15, KLO-G, KM20L2, MRI-H-194, LOVO I, LOVO II, and MRI-H-250.
  • the established cell lines comprise one or more melanoma cell lines designated NIS-G, TRI-G, WIL-G, MRI-H-121B, MRI-H-187, MRI- H-221, and MRI-H-255.
  • the established cell lines comprise one or more cervical cancer cell lines designated MRI-H-177, MRI-H-186, MRI-H-196, and MRI-H-215.
  • the established cell lines comprise one or more kidney cancer cell lines designated MRI-H-121 and MRI-H-166. According to some embodiments, the established cell lines comprise one or more endometrium cancer cell lines designated MRI-H-147 and MRI-H-220. According to some embodiments, the established cell lines comprise one or more ovarian cancer cell lines designated MRI-H-258, MRI-H-273, MRI-H-1834, and SWA-G. According to some embodiments, the established cell lines comprise one or more sarcoma cell lines designated HS-1, OGL-G, and DEL-G. According to some embodiments, the established cell lines comprise the epidermoid cell line designated DEAC-1.
  • the established cell line comprises the glioblastoma cell line designated SF 295.
  • the established cell line comprises the prostate cancer cell line designated CWR-22.
  • the established cell line comprises the Burkitt’s lymphoma cell line designated DAU.
  • the foregoing established cell lines described herein are commercially available, e.g. from American Type Culture Collection (ATCC), European Collection of Cell Cultures (ECACC), or any depository listed as an International Depositary Authority (IDA) under Article 7 of the Budapest Treaty.
  • exemplary established cell lines comprise one or more of the cell lines in the following table: Table 5. Cell lines.
  • the choice of the parental cell line from which the tumor cell line or tumor cell line variant may be derived may affect the immune specificity of a given engineered leukocyte stimulator cell.
  • the use of a tumor cell line or tumor cell line variant derived from metastatic prostate cancer that migrated to the bone of a patient may result in ENLSTTM cells that elicit an immune response specific for metastatic prostate cancer in the bone of a patient.
  • the tumor cell line or tumor cell line variants may be derived from a parental cell that comprises a universal cancer specific antigen.
  • the use of a parental tumor cell line or tumor cell line variant derived from metastatic prostate cancer that migrated to the bone of a patient may result in ENLSTTM cells that elicits an immune response against all prostate cancer cells.
  • the tumor cell line or tumor cell line variants are derived from patient derived cells derived from various cancers.
  • fresh tissue surgically removed from a tumor is enzymatically digested by type IV collagenase, followed by collection of disaggregated cells.
  • disaggregated cells may then be grown in vitro in growth media with 10% fetal bovine serum on an extracellular matrix substrate, such as collagen or fibronectin, to promote attachment.
  • adherent cells may then be passaged until the immortal cancer cells outgrow the non- cancerous fibroblast cells.
  • the tumor cell line or tumor cell line variants may be derived from a solid tumor comprising tumor cells, including cancer stem cells, a metastatic cancer comprising metastatic tumor cells, comprising cancer stem cells, or a non-metastatic cancer.
  • the cancer may originate in the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, duodenum, small intestine, large intestine, colon, rectum, anus, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus.
  • the cancer may be of a histological type, e.g., a cancer that begins in the skin or tissues that line or cover internal organs (carcinoma); a cancer that begins in bone or in the soft tissue of the body including cartilage, fat, muscle, blood vessels, and fibrous tissue (sarcoma); a cancer that starts in blood-forming tissue (leukemia); a cancer that begins in cells of the immune system (lymphoma); a cancer that arises in plasma cells (myeloma), or a brain/spinal cord cancer.
  • a histological type e.g., a cancer that begins in the skin or tissues that line or cover internal organs (carcinoma); a cancer that begins in bone or in the soft tissue of the body including cartilage, fat, muscle, blood vessels, and fibrous tissue (sarcoma); a cancer that starts in blood-forming tissue (leukemia); a cancer that begins in cells of the immune system (lymphoma); a cancer that arises in plasma cells (mye
  • carcinomas include, without limitation, giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; an adenocarcinoma; a gastrinoma, a cholangiocarcinoma; a hepatocellular carcinoma; a combined hepatocellular carcinoma and cholangiocarcinoma; a trabecular adenocarcinoma; an adenoid cystic carcinoma; an adenocarcinoma in adenomatous polyp; an adenocarcinoma, familial polyposis coli; a solid carcinoma; a carcinoid tumor; a branchiolo-alveolar adenocarcinoma; a papillary adenocarcinoma; a chromophobe carcinoma; an acidophil carcinoma; an oxyphilic
  • sarcomas include, without limitation, glomangiosarcoma; sarcoma; fibrosarcoma; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; carcinosarcoma; synovial sarcoma; hemangiosarcoma; kaposi’s sarcoma; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing’s sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic
  • leukemias include, without limitation, leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; and hairy cell leukemia.
  • lymphomas and myelomas include, without limitation, malignant lymphoma; hodgkin’s disease; hodgkin’s; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-hodgkin’s lymphomas; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; multiple myeloma.
  • brain/spinal cord cancers include, without limitation, pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant.
  • Examples of other cancers include, without limitation, a thymoma; an ovarian stromal tumor; a thecoma; a granulosa cell tumor; an androblastoma; a leydig cell tumor; a lipid cell tumor; a paraganglioma; an extra-mammary paraganglioma; a pheochromocytoma; blue nevus, malignant; fibrous histiocytoma, malignant; mixed tumor, malignant; mullerian mixed tumor; nephroblastoma; hepatoblastoma; mesenchymoma, malignant; brenner tumor, malignant; phyllodes tumor, malignant; mesothelioma, malignant; dysgerminoma; teratoma, malignant; struma ovarii, malignant; mesonephroma, malignant; hemangioendothelioma, malignant;
  • tumor cell line or tumor cell line variants may be commercially available. According to some embodiments, pooling of several of these cells lines, either as a mixture of whole cells or by making a membrane preparation out of the mixture of whole cells, may provide an array of cell surface tumor antigens for that tumor type. [00374] According to some embodiments, the tumor cells or tumor cell line or tumor cell line variants may be rendered proliferation incompetent by irradiation.
  • an exogenous immunomodulatory molecule of the disclosed invention is a polypeptide that, alone or in combination with other exogenous immunomodulatory molecules, when incorporated into a population of ENLSTTM cells, mediates stimulation of an immune cell.
  • an exogenous immunomodulatory molecule of the disclosed invention is a polypeptide that, alone or in combination with other exogenous immunomodulatory molecules, mediates stimulation of T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the NK cell is a memory-like NK cell.
  • the T lymphocyte is a cytotoxic T-lymphocyte (CTL) (CD8+ T cell).
  • CTL cytotoxic T-lymphocyte
  • the T lymphocyte is a memory T cell.
  • the T lymphocyte is a regulatory T cell.
  • the T lymphocyte is a helper T cell.
  • the B lymphocyte is a memory B cell. It is a feature of the present invention that, according to some embodiments, the population of tumor cells comprising at least three core exogenous immunomodulatory molecules is effective to stimulate more than one type of immune cell, e.g.
  • the allogeneic ENLSTTM cells comprising a population of tumor cells of the present disclosure are effective to stimulate one or more of T-lymphocytes (e.g. CD8+ T cells), natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • T-lymphocytes e.g. CD8+ T cells
  • NK natural killer
  • DCs dendritic cells
  • B lymphocytes B lymphocytes.
  • “stimulating an immune cell” refers to a combination of one or more of activation, expansion, and/or increased cytoxicity of the immune cell.
  • the ENLSTTM cells population of tumor cells comprising at least three core exogenous immunomodulatory molecules is effective to activate and/or expand immune cells (e.g. T-lymphocytes (e.g. CD8+T cells), natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes) ex vivo.
  • the ENLSTTM cells population of tumor cells comprising the at least three core exogenous immunomodulatory molecules is effective to activate and/or expand immune killer cells (e.g. T-lymphocytes (e.g.
  • CD8+T cells CD8+T cells
  • natural killer (NK) cells natural killer cells
  • DCs dendritic cells
  • B lymphocytes B lymphocytes
  • the disclosure thus provides an ENLSTTM cell population comprising a population of tumor cells expressing one or more tumor specific antigens and genetically engineered to stably express a plurality of immunomodulatory molecules effective to stimulate one or more of T lymphocytes (e.g., CD8+ T cells), natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes
  • T lymphocytes e.g., CD8+ T cells
  • NK natural killer
  • DCs dendritic cells
  • B lymphocytes e.g., B lymphocytes
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least three stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least four stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least five stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least six stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least seven stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least eight stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least nine stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of p tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least ten stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cell population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least eleven stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least twelve stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least thirteen stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least fourteen stably expressed exogenous immunomodulatory molecules effective to stimulate the T- lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cell population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least fifteen stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least sixteen stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least seventeen stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least eighteen stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least ninteen stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least twenty stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least twenty-one stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least twenty-two stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of t tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least twenty-three stably expressed exogenous immunomodulatory molecules effective to stimulate the T- lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least twenty-four stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least twenty-five stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least twenty-six stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least twenty-seven stably expressed exogenous immunomodulatory molecules effective to stimulate the T- lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least twenty-eight stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least twenty-nine stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising at least thirty stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population characterized by the expression of three essential stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, wherein the three essential stably expressed exogenous immunomoculatory molecules are GMCSF, OX40L and 4IBB-L.
  • the exogenous immunomodulatory molecules that constitute additional R subsets comprising from 3-25, inclusive immunomodulators may be particularly selected from a group for their ability to either initiate an anti-tumor immune response, and/or to sustain an anti-tumor immune response, and/or for their ability to abrogate pre-existing immunosuppression characteristically present in cancer patients, or a combination of all three.
  • combinations of immunomodulatory molecules are evaluated and selected by a human mixed lymphocyte tumor cell reaction.
  • exemplary classes of exogenous immunomodulatory molecule include a cytokine, a TNF-family member, a secreted receptor, a chaperone, an IgG superfamily member and a chemokine receptor or other immunomodulatory molecule.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising a plurality of stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, wherein the exogenous immunomodulatory molecules comprise one or more cytokine family member proteins and one or more TNF family member proteins; wherein the exogenous immunomodulatory molecules comprise one or more cytokine family member proteins and one or more secreted receptor proteins; wherein the exogenous immunomodulatory molecules comprise one or more cytokine family member proteins and one or more chaperone proteins; wherein the exogenous immunomodulatory molecules comprise one or more cytokine family member proteins and one or more IgG superfamily member
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising a plurality of stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, wherein the exogenous immunomodulatory molecules comprise one or more TNF family member proteins and one or more secreted receptor proteins; wherein the exogenous immunomodulatory molecules comprise one or more TNF family member proteins and one or more chaperone proteins; wherein the exogenous immunomodulatory molecules comprise one or more TNF family member proteins and one or more IgG superfamily member proteins; wherein the exogenous immunomodulatory molecules comprise one or more TNF family member proteins and one or more chemokine receptor proteins.
  • the ENLSTTM cells population comprises a population of t tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising a plurality of stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, wherein the exogenous immunomodulatory molecules comprise one or more secreted receptor proteins and one or more chaperone proteins; wherein the exogenous immunomodulatory molecules comprise one or more secreted receptor proteins and one or more IgG superfamily member proteins; wherein the exogenous immunomodulatory molecules comprise one or more secreted receptor proteins and one or more chemokine receptor proteins.
  • the ENLSTTM cells population comprises of the present disclosure comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising a plurality of stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, wherein the exogenous immunomodulatory molecules comprise one or more chaperone proteins and one or more IgG superfamily member proteins; wherein the exogenous immunomodulatory molecules comprise one or more chaperone proteins and one or more chemokine receptor proteins.
  • the ENLSTTM cells population comprises of the present disclosure comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising a plurality of stably expressed exogenous immunomodulatory molecules effective to stimulate the T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, wherein the exogenous immunomodulatory molecules comprise one or more IgG superfamily member proteins and one or more chemokine receptor proteins.
  • Exemplary immunomodulators are shown in Table 6 below.
  • the exogenous immunomodulatory molecule in the R subset is selected from one of more of a TNF-family member, a secreted receptor, a chaperone protein, an IgG superfamily member, a chemokine receptor.
  • the TNF-family member is selected from a TNF-family member listed in Table 6.
  • the secreted receptor is selected from a secreted receptor listed in Table 6.
  • the chaperone protein is selected from a chaperone proten listed in Table 6.
  • the IgG superfamily member is selected from an IgG superfamily member listed in Table 6.
  • the chemokine receptor is selected from a chemokine receptor listed in Table 6.
  • the exogenous immunomodulatory molecule is derived from a mouse.
  • the exogenous immunomodulatory molecule is derived from a human. [00387] Table 6. Exogenous Immunomodulatory Molecules
  • the exogenous immunomodulatory molecule of Table 6 is in a membrane bound form (i.e. comprises a membrane anchor). According to other embodiments, the exogenous immunomodulatory molecule of Table 6 is in a secreted form.
  • the membrane bound form of the exogenous immunomodulator is one or more selected from the group consisting of 4- 1BB ligand, BAFF, April, CD40 ligand, CD80, CD86, Flt3 Ligand, GM-CSF, HSP90, ICOS ligand, IL-12, IL-15, IL-18, IL-2, IL-21, IL-23, IL7, LIGHT, OX40 ligand, RANK ligand and TNF.
  • the secreted form of the immunomodulator is one or more selected from the group consisting of Flt3 ligand, GM- CSF, IL10R, IL7 and TGFbeta Receptor.
  • the exogenous immunomodulatory molecule is a molecule with a wild-type amino acid sequence. According to some embodiments, the exogenous immunomodulatory molecule is a molecule with a variant amino acid sequence. [00390] According to some embodiments, the exogenous immunomodulatory molecule is one or more selected from the group consisting of 4-1BB Ligand, APRIL, BAFF, CD27 Ligand, CD30L, CD40 Ligand, CD80, CD86, FLT-3 Ligand, FLT-3 ligand engineered to remove transmembrane region, GM-CSF, GMCSF engineered with CD8 membrane anchor and IRES compatible Signal Sequence, HSP-70, HSP-90, ICOS Ligand, IL-10R, IL-12, IL-15, IL-18, IL-2, IL-21, IL-23, IL-7, IL-7 engineered with CD8 membrane anchor, LIGHT, OX-40 Ligand, RANK Ligand, TGF-b Re
  • the one or more exogenous immunomodulatory molecules comprise at least three essential immunomodulatory molecules, wherein the three essential immunomodulatory molecules are OX40 Ligand (OX40L), CD27 Ligand (CD70), and CD28 Ligand (CD28L) comprising CD80, CD86 or both.
  • additional immunomodulatory components identified as R may also be present.
  • an ENLSTTM cell population comprises a population of tumor cells expressing one or more tumor specific antigens and three stably expressed essential exogenous immunomodulatory molecules, OX40L, CD70, and CD28L, effective to stimulate the MNC population.
  • the ENLSTTM cells population comprising a population of tumor cells expressing one or more tumor specific antigens and the three stably expressed essential exogenous immunomodulatory molecules OX40L, CD70, and CD28L comprising CD80, CD86 or both is effective to stimulate synergistic expansion of CTLs.
  • the ENLSTTM cell population further comprises one or more subsets of R immunomodulators comprising 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 immunomodulators.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stably express at least the four stably expressed exogenous immunomodulatory molecules OX40L, CD70, and CD28L comprising CD80, CD86 or both, plus one R subset comprising 3-25, inclusive immunomodulators.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stably express at least the four stably expressed exogenous immunomoculatory molecules OX40L, CD70, and CD28L comprising CD80, CD86 or both, plus two R subsets comprising 3-25, inclusive immunomodulators.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stably express at least the four stably expressed exogenous immunomoculatory molecules OX40L, CD70, and CD28L comprising CD80, CD86 or both, plus three R subsets comprising 3-25, inclusive immunomodulators.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stably express at least the three essential stably expressed exogenous immunomodulatory molecules OX40L, CD70, and CD28L comprising CD80, CD86 or both, plus four R subsets comprising 3-25, inclusive immunomodulators.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stably express at least the three essential stably expressed exogenous immunomoculatory molecules OX40L, CD70, and CD28L comprising CD80, CD86 or both, plus five R subsets comprising 3-25, inclusive immunomodulators.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stably express at least the three essential stably expressed exogenous immunomoculatory molecules OX40L, CD70, and CD28L comprising CD80, CD86 or both, plus six R subsets comprising 3-25, inclusive immunomodulators.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stably express at least the three essential stably expressed exogenous immunomoculatory molecules OX40L, CD70, and CD28L comprising CD80, CD86 or both, plus seven R subsets comprising 3-25, inclusive immunomodulators.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stably express at least the three essential stably expressed exogenous immunomoculatory molecules OX40L, CD70, and CD28L comprising CD80, CD86 or both, plus eight R subsets comprising 3-25, inclusive immunomodulators.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stably express at least the three essential stably expressed exogenous immunomoculatory molecules OX40L, CD70, and CD28L comprising CD80, CD86 or both, plus nine R subsets comprising 3-25, inclusive immunomodulators.
  • the ENLSTTM cells population comprises a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stably express at least the three essential stably expressed exogenous immunomoculatory molecules OX40L, CD70, and CD28L comprising CD80, CD86 or both, plus ten R subsets comprising 3-25, inclusive immunomodulators.
  • the exogenous immunomodulatory molecule R 1 is APRIL.
  • the exogenous immunomodulatory molecule R 2 is BAFF.
  • the exogenous immunomodulatory molecule R 3 is 4-IBB Ligand.
  • the exogenous immunomodulatory molecule R 4 is CD30 Ligand.
  • the exogenous immunomodulatory molecule R 5 is CD40 Ligand.
  • the exogenous immunomodulatory molecule R 6 is CD80.
  • the exogenous immunomodulatory molecule R 7 is CD86.
  • the exogenous immunomodulatory molecule R 8 is FLT-3 Ligand.
  • the exogenous immunomodulatory molecule R 9 is HSP-70.
  • the exogenous immunomodulatory molecule R 10 is HSP-90.
  • the exogenous immunomodulatory molecule R 11 is ICOS Ligand.
  • the exogenous immunomodulatory molecule R 12 is IL- 10R.
  • the exogenous immunomodulatory molecule R 13 is IL-12.
  • the exogenous immunomodulatory molecule R 14 is IL-15.
  • the exogenous immunomodulatory molecule R 15 is IL-18.
  • the exogenous immunomodulatory molecule R 16 is IL-2.
  • the exogenous immunomodulatory molecule R 17 is IL-21.
  • the exogenous immunomodulatory molecule R 18 is IL-23.
  • the exogenous immunomodulatory molecule R 19 is IL-7.
  • the exogenous immunomodulatory molecule R 20 is LIGHT.
  • the exogenous immunomodulatory molecule R 21 is RANK Ligand.
  • the exogenous immunomodulatory molecule R 22 is TGF-b Receptor.
  • the exogenous immunomodulatory molecule R 23 is TNF,
  • the exogenous immunomodulatory molecule R 24 is GM-CSF.
  • the exogenous immunomodulatory molecule R comprises between 1 and 30 immunomodulators, inclusive, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 exogenous immunomodulatory molecules selected from the group consisting of APRIL, BAFF, 4-IBB Ligand, CD30 Ligand, CD80, CD86, FLT-3 Ligand, FLT-3 ligand engineered to remove transmembrane region, HSP-70, HSP-90, ICOS Ligand, IL-10R, IL-12, IL-15, IL-18, IL-2, IL-21, IL-23, IL-7, IL-7 engineered with CD8 membrane anchor, LIGHT, RANK Ligand, TGF-b Receptor and GM-CSF.
  • exogenous immunomodulatory molecules selected from the group consisting of APRIL, BAFF, 4-IBB Ligand, CD30 Ligand, CD80, CD86, FLT-3 Ligand, FLT-3 lig
  • the exogenous immunomodulatory molecule comprises between 1 and 30, inclusive, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 exogenous immunomodulatory molecules, wherein at least three immunomodulatory molecules are OX40 Ligand (OX40L), CD27 Ligand, and CD28 Ligand comprising CD80, CD86 or both, and wherein additional immunomodulatory components identified as R 1 – R 24 are selected from the group consisting of APRIL, BAFF, 4-IBB Ligand (4-IBBL), CD30L, CD40 Ligand, CD80, CD86, FLT-3 Ligand, FLT-3 ligand engineered to remove transmembrane region, GMCSF engineered with CD8 membrane anchor and IRES compatible Signal Sequence, HSP-70, HSP-90, ICOS Ligand, IL-10R, IL-12, IL-15, IL- 18, IL-2, IL-21, IL-
  • the exogenous immunomodulatory molecule comprises between 1 and 20, inclusive, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 exogenous immunomodulatory molecules selected from the group consisting of 4-1BB Ligand, APRIL, BAFF, CD27 Ligand, CD28 Ligand, CD30 Ligand, CD40 Ligand, CD80, CD86, FLT-3 Ligand, FLT-3 ligand engineered to remove transmembrane region, GM-CSF, GMCSF engineered with CD8 membrane anchor and IRES compatible Signal Sequence, HSP-70, HSP-90, ICOS Ligand, IL-10R, IL-12, IL- 15, IL-18, IL-2, IL-21, IL-23, IL-7, IL-7 engineered with CD8 membrane anchor, LIGHT, OX-40 Ligand, RANK Ligand, TGF-b Receptor, and TNF.
  • 4-1BB Ligand i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
  • the exogenous immunomodulatory molecule comprises between 1 and 20, inclusive, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 exogenous immunomodulatory molecules, wherein at least three immunomodulatory molecules are OX40 Ligand (OX40L), CD27 Ligand, and CD28 Ligand, and wherein additional immunomodulatory components identified as R 1 – R 24 are selected from the group consisting of APRIL, BAFF, 4-IBB Ligand, CD30L, CD40 Ligand, CD80, CD86, FLT-3 Ligand, FLT-3 ligand engineered to remove transmembrane region, GMCSF engineered with CD8 membrane anchor and IRES compatible Signal Sequence, HSP-70, HSP-90, ICOS Ligand, IL-10R, IL-12, IL-15, IL-18, IL-2, IL-21, IL-23, IL-7, IL-7 engineered with CD8 membrane anchor, LIGHT, RANK Ligand, TGF-
  • the exogenous immunomodulatory molecule comprises between 1 and 10, inclusive, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 exogenous immunomodulatory molecules selected from the group consisting of 4-1BB Ligand, APRIL, BAFF, CD27 Ligand, CD28 Ligand, CD30 Ligand, CD40 Ligand, CD80, CD86, FLT-3 Ligand, FLT-3 ligand engineered to remove transmembrane region, GM-CSF, GMCSF engineered with CD8 membrane anchor and IRES compatible Signal Sequence, HSP-70, HSP-90, ICOS Ligand, IL-10R, IL-12, IL-15, IL-18, IL-2, IL-21, IL-23, IL-7, IL-7 engineered with CD8 membrane anchor, LIGHT, OX-40 Ligand, RANK Ligand, TGF-b Receptor, and TNF.
  • 4-1BB Ligand i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 exogenous immunomodulatory molecules selected from
  • the exogenous immunomodulatory molecule comprises between 1 and 10, inclusive, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 exogenous immunomodulatory molecules, wherein at least three immunomodulatory molecules are OX40 Ligand (OX40L), CD27 Ligand, and CD28Ligand, and wherein additional immunomodulatory components identified as R 1 – R 24 are selected from the group consisting of APRIL, BAFF, 4-IBB Ligand, CD30 Ligand, CD40 Ligand, CD80, CD86, FLT-3 Ligand, FLT-3 ligand engineered to remove transmembrane region, GMCSF engineered with CD8 membrane anchor and IRES compatible Signal Sequence, HSP-70, HSP-90, ICOS Ligand, IL-10R, IL-12, IL-15, IL- 18, IL-2, IL-21, IL-23, IL-7, IL-7 engineered with CD8 membrane anchor, LIGHT, RANK Ligand, TGF-b Receptor, and T
  • the exogenous immunomodulatory molecule comprises between 5 and 20, inclusive, i.e., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 exogenous immunomodulatory molecules R selected from the group consisting of, APRIL, BAFF, 4-IBB Ligand, CD30 Ligand, CD80, CD86, FLT-3 Ligand, FLT-3 ligand engineered to remove transmembrane region, GM-CSF, GMCSF engineered with CD8 membrane anchor and IRES compatible Signal Sequence, HSP-70, HSP-90, ICOS Ligand, IL-10R, IL-12, IL-15, IL-18, IL-2, IL-21, IL-23, IL-7, IL-7 engineered with CD8 membrane anchor, LIGHT, RANK Ligand, TGF-b Receptor., and TNF.
  • exogenous immunomodulatory molecules R selected from the group consisting of, APRIL, BAFF, 4-IBB Ligand, CD30 Ligand, CD80, CD86, FLT-3
  • the exogenous immunomodulatory molecule comprises between 5 and 20, inclusive, i.e., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 exogenous immunomodulatory molecules, wherein at least three immunomodulatory molecules are OX40 Ligand (OX40L), CD27 Ligand (CD70), and CD28 Ligand (CD28L) comprising CD80, CD86 or both, and wherein additional immunomodulatory components identified as R 1 – R 24 are selected from the group consisting of APRIL, BAFF, 4-IBB Ligand, CD30 Ligand, CD40 Ligand, CD80, CD86, FLT-3 Ligand, FLT-3 ligand engineered to remove transmembrane region, GMCSF engineered with CD8 membrane anchor and IRES compatible Signal Sequence, HSP-70, HSP-90, ICOS Ligand, IL-10R, IL-12, IL-15, IL-18, IL-2, IL-21, IL-23, IL-7, IL-7 engineered with CD8 membrane
  • the exogenous immunomodulatory molecule R comprises between 10 and 15, inclusive, i.e., 10, 11, 12, 13, 14 or 15 exogenous immunomodulatory molecules selected from the group consisting of APRIL, BAFF, 4- IBB Ligand, CD30 Ligand, CD80, CD86, FLT-3 Ligand, FLT-3 ligand engineered to remove transmembrane region, HSP-70, HSP-90, ICOS Ligand, IL-10R, IL-12, IL-15, IL-18, IL-2, IL-21, IL-23, IL-7, IL-7 engineered with CD8 membrane anchor, LIGHT, RANK Ligand, TGF-b Receptor, and TNF.
  • exogenous immunomodulatory molecule R comprises between 10 and 15, inclusive, i.e., 10, 11, 12, 13, 14 or 15 exogenous immunomodulatory molecules selected from the group consisting of APRIL, BAFF, 4- IBB Ligand, CD30 Ligand, CD80, CD86, FLT-3 Ligand, FLT-3 ligand
  • the exogenous immunomodulatory molecule comprises between 10 and 15, inclusive, i.e., 10, 11, 12, 13, 14 or 15 exogenous immunomodulatory molecules, wherein at least three immunomodulatory molecules are OX40 Ligand (OX40L), CD27 Ligand (CD70), and CD28 Ligand (CD28L) comprising CD80, CD86 or both, and wherein additional immunomodulatory components identified as R 1 – R 24 are selected from the group consisting of APRIL, BAFF, 4-IBB Ligand, CD30 Ligand, CD40 Ligand, CD80, CD86, FLT-3 Ligand, FLT-3 ligand engineered to remove transmembrane region, GMCSF engineered with CD8 membrane anchor and IRES compatible Signal Sequence, HSP-70, HSP-90, ICOS Ligand, IL-10R, IL-12, IL-15, IL-18, IL-2, IL-21, IL-23, IL-7, IL-7 engineered with CD8 membrane anchor, LIGHT, RANK Ligand
  • the exogenous immunomodulatory molecule comprises 14 exogenous immunomodulatory molecules selected from the group consisting of APRIL, BAFF, 4-IBB Ligand, CD30L, CD80, CD86, FLT-3 Ligand, FLT-3 ligand engineered to remove transmembrane region, HSP-70, HSP-90, ICOS Ligand, IL-10R, IL-12, IL-15, IL-18, IL-2, IL-21, IL-23, IL-7, IL-7 engineered with CD8 membrane anchor, LIGHT, RANK Ligand, TGF-b Receptor, and TNF.
  • the exogenous immunomodulatory molecule comprises 14 exogenous immunomodulatory molecules, wherein at least three immunomodulatory molecules are OX40 Ligand (OX40L), CD27 Ligand (CD70), and CD28 Ligand comprising CD80, CD86 or both, and wherein additional immunomodulatory components identified as R 1 – R 24 are selected from the group consisting of APRIL, BAFF, 4-IBB Ligand, CD30 Ligand, CD40 Ligand, CD80, CD86, FLT-3 Ligand, FLT- 3 ligand engineered to remove transmembrane region, GM-CSF, GMCSF engineered with CD8 membrane anchor and IRES compatible Signal Sequence, HSP-70, HSP-90, ICOS Ligand, IL-10R, IL-12, IL-15, IL-18, IL-2, IL-21, IL-23, IL-7, IL-7 engineered with CD8 membrane anchor, LIGHT, OX-40 Ligand, RANK Ligand, TGF-b Receptor, and
  • each of the exogenous immunomodulatory molecules 4-1BB Ligand, APRIL, BAFF, CD27 Ligand, CD28 Ligand, CD30L, CD40 Ligand, CD80, CD86, FLT-3 Ligand, GM-CSF, HSP-70, HSP-90, ICOS Ligand, IL- 10R, IL-12, IL-15, IL-18, IL-2, IL-21, IL-23, IL-7, LIGHT, OX-40 Ligand, RANK Ligand, TGF-b Receptor, and TNF is a wild type molecule.
  • each of the exogenous immunomodulatory molecules 4-1BB Ligand, APRIL, BAFF, CD27 Ligand, CD28 Ligand, CD30L, CD40 Ligand, CD80, CD86, FLT-3 Ligand, GM-CSF, HSP-70, HSP-90, ICOS Ligand, IL-10R, IL-12, IL-15, IL-18, IL-2, IL-21, IL-23, IL-7, LIGHT, OX-40 Ligand, RANK Ligand, TGF-b Receptor, and TNF is a mutant or variant sequence.
  • the exogenous immunomodulatory molecule R 1 is APRIL.
  • the exogenous immunomodulatory molecule R 2 is BAFF.
  • the exogenous immunomodulatory molecule R 3 is 4-IBB Ligand.
  • the exogenous immunomodulatory molecule R 4 is CD30L.
  • the exogenous immunomodulatory molecule R 5 is CD40 Ligand.
  • the exogenous immunomodulatory molecule R 6 is CD80.
  • the exogenous immunomodulatory molecule R 7 is CD86.
  • the exogenous immunomodulatory molecule R 8 is FLT-3 Ligand.
  • the exogenous immunomodulatory molecule R 9 is HSP-70.
  • the exogenous immunomodulatory molecule R 10 is HSP-90.
  • the exogenous immunomodulatory molecule R 11 is ICOS Ligand.
  • the exogenous immunomodulatory molecule R 12 is IL-10R.
  • the exogenous immunomodulatory molecule R 13 is IL-12.
  • the exogenous immunomodulatory molecule R 14 is IL-15.
  • the exogenous immunomodulatory molecule R 15 is IL-18.
  • the exogenous immunomodulatory molecule R 16 is IL-2.
  • the exogenous immunomodulatory molecule R 17 is IL-21.
  • the exogenous immunomodulatory molecule R 18 is IL-23.
  • the exogenous immunomodulatory molecule R 19 is IL-7.
  • the exogenous immunomodulatory molecule R 20 is LIGHT.
  • the exogenous immunomodulatory molecule R 21 is RANK Ligand.
  • the exogenous immunomodulatory molecule R 22 is TGF-b Receptor.
  • the exogenous immunomodulatory molecule R 23 is TNF.
  • the exogenous immunomodulatory molecule R 24 is a CD86 variant that has been engineered with an IRES compatible signal sequence.
  • the exogenous immunomodulatory molecule R 25 is a FLT3L variant that has been engineered to remove the transmembrane region.
  • the exogenous immunomodulatory molecule R 26 is a GM-CSF variant that has been engineered with a CD8 membrane anchor and IRES compatible Signal Sequence.
  • the exogenous immunomodulatory molecule R 27 is an HSP70 variant that has been engineered with a CD8 membrane anchor.
  • the exogenous immunomodulatory molecule R 28 is an HSP-90B1 (GRP94/96) variant that has been engineered with a CD8 membrane anchor.
  • the exogenous immunomodulatory molecule R 29 is an HSP90 variant that has been engineered with a CD8 membrane anchor.
  • the exogenous immunomodulatory molecule R 30 is an ICOSL variant that has been engineered with an IRES compatible signal sequence.
  • the exogenous immunomodulatory molecule R 31 is an IL10R variant that has been engineered to remove the transmembrane region.
  • the exogenous immunomodulatory molecule R 32 is an IL-R ⁇ variant that has been engineered to remove transmembrane region (VSV-GM-CSF tag).
  • the exogenous immunomodulatory molecule R 33 is an IL12 variant that has been engineered to be a single chain with a CD8 membrane anchor.
  • the exogenous immunomodulatory molecule R 34 is an IL15 variant that has been engineered with CD8 membrane anchor.
  • the exogenous immunomodulatory molecule R 35 is an IL18 variant that has been engineered with a CD8 membrane anchor.
  • the exogenous immunomodulatory molecule R 36 is an IL2 variant that has been engineered with a CD8 membrane anchor and IRES compatible sequence.
  • the exogenous immunomodulatory molecule R 37 is an IL21 variant that has been engineered with a CD8 membrane anchor.
  • the exogenous immunomodulatory molecule R 38 is an IL23 variant that has been engineered to be a single chain with a CD8 membrane anchor.
  • the exogenous immunomodulatory molecule R 39 is an IL7 variant that has been engineered with a CD8 membrane anchor.
  • the exogenous immunomodulatory molecule R 40 is a TGFb-R variant that has been engineered to remove the transmembrane region.
  • the exogenous immunomodulatory molecule R 41 is a TGFb Receptor III variant engineered to remove transmembrane region.
  • the exogenous immunomodulatory molecule R 42 is an mIFN ⁇ variant modified to be membrane bound.
  • the exogenous immunomodulatory molecule R 43 is an mIFN ⁇ variant which is modified to be membrane bound.
  • the exogenous immunomodulatory molecule R 44 is a CD40 Ligand (CD40L) variant which is cleavage resistant. Table 7 below sets forth R groups R 1 -R 44 . [00403] Table 7
  • At least 12 vectors comprise 14 immunomodulators, wherein three essential immunomodulatory molecules are OX40 Ligand (OX40L), CD27 Ligand (CD70), and CD28 Ligand (CD28L) comprising CD80, CD86 or both, and wherein the remaining 11 immunomodulators are selected from R 1 – R 44 in Table 7.
  • at least 11 vectors comprise 14 immunomodulators, wherein three essential immunomodulatory molecules are OX40 Ligand (OX40L), CD27 Ligand (CD70), and CD28 Ligand (CD28L) comprising CD80, CD86 or both, and wherein the remaining 11 immunomodulators are selected from R 1 – R 44 in Table 7.
  • At least 10 vectors comprise 14 immunomodulators, wherein three essential immunomodulatory molecules are OX40 Ligand (OX40L) CD27 Ligand (CD70), and CD28 Ligand (CD28L) comprising CD80, CD86 or both, and wherein the remaining 11 immunomodulators are selected from R 1 – R 44 in Table 7.
  • 14 immunomodulators are selected from Table 6, wherein at least three immunomodulatory molecules are, OX40 Ligand (OX40L), CD27 Ligand (CD70), and CD28 Ligand (CD28L) comprising CD80, CD86 or both, wherein the remaining 11 immunomodulators are selected from R 1 – R 44 in Table 7 and wherein the 14 immunomodulators are in 12 vectors.
  • 14 immunomodulators are selected from Table 6, wherein the three essential immunomodulatory molecules are OX40 Ligand (OX40L), CD27 Ligand (CD70), and CD28 Ligand (CD28L) comprising CD80, CD86 or both, wherein the remaining 11 immunomodulators are selected from R 1 – R 44 in Table 7, and wherein the 14 immunomodulators are in 11 vectors.
  • OX40L OX40 Ligand
  • CD70 CD27 Ligand
  • CD28L CD28 Ligand
  • 14 immunomodulators are selected from Table 6, wherein the three essential immunomodulatory molecules are OX40 Ligand (OX40L), CD27 Ligand (CD70), and CD28 Ligand (CD28L) comprising CD80, CD86 or both, wherein the remaining 11 immunomodulators are selected from R 1 – R 44 in Table 7, and wherein the 14 immunomodulators are in 10 vectors.
  • the vectors may further comprise tags.
  • the immunomodulators are codon optimized. "Codon optimization" means a modification of a codon of a polynucleotide encoding a protein with a codon that is used first before others in a specific organism such that the coded protein can be more efficiently expressed therein.
  • codons that are referred to as “synonym” or “synonymous codon”
  • genetic codes have degeneracy.
  • codon usage by a specific organism is not random, and it is rather biased to specific codon triplets.
  • Such codon usage bias may be even higher in relation with a certain gene, a gene with common function or ancestor origin, protein expressed at high level vs. proteins with low copy number, or a group protein coding region of a genome of an organism.
  • the disclosure encompasses an ENLSTTM cell population comprising a population of tumor cells expressing one or more tumor specific antigens and genetically engineered to express a core group of three immunomodulatory molecules plus optionally one or more R groups of immunomodulatory molecules comprising one or more cytokines, wherein the ENLSTTM cells population is effective to stimulate one or more populations of serial killer cells, including T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • the disclosure encompasses a cytokine, including a full-length, fragment, homologue, variant or mutant of the cytokine.
  • a cytokine includes a protein that is capable of affecting the biological function of another cell.
  • a biological function affected by a cytokine can include, but is not limited to, cell growth, cell differentiation or cell death.
  • a cytokine of the present disclosure is capable of binding to a specific receptor on the surface of a cell, thereby stimulating an immune cell (e.g. T lymphocytes (e.g., CD8+ T cell), natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes).
  • T lymphocytes e.g., CD8+ T cell
  • NK natural killer cells
  • DCs dendritic cells
  • the cytokine is selected from Granulocyte- macrophage colony-stimulating factor (GM-CSF), Granulocyte colony-stimulating factor (G-CSF), Fms-related tyrosine kinase 3 ligand (FLT3LG), interleukin-1 (IL-1), IL-1a, IL-1b, Il-1ra, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12p40, IL- 12p70, IL-12/IL-23 P40, IL13, IL-15, IL-15/IL15-RA, IL-17, IL-17A, IL-18, IL-21, IL- 23, TGF- ⁇ , MCP-1, TNF- ⁇ and interferon alpha (IFN ⁇ ), IFN ⁇ , MIP1b, Rantes, Tweak, and TREM-1.
  • GM-CSF Granulocyte- macrophage colon
  • the cytokine is granulocyte- macrophage colony-stimulating factor (GM-CSF). According to some embodiments, the cytokine is Fms-related tyrosine kinase 3 ligand (FLT3LG). [00408] According to some embodiments, the cytokine is secreted. According to some embodiments, the cytokine is membrane bound.
  • GM-CSF granulocyte- macrophage colony-stimulating factor
  • FLT3LG Fms-related tyrosine kinase 3 ligand
  • Granulocyte-Macrophage Colony Stimulating Factor (GM-CSF) [00409] Granulocyte-macrophage colony-stimulating factor (GM-CSF; colony stimulating factor 2; CSF2) is found in monocytes/macrophages and activated T cells, and can act as a growth factor to stimulate and recruit dendritic cells.
  • GM-CSF is a monomeric glycoprotein secreted by cells of the immune system, as well as endothelial cells and fibroblasts.
  • Human GM-CSF is a 144 amino acid protein comprising a 17 amino acid signal peptide that can be cleaved to produce a mature 127 amino acid protein.
  • GM-CSF GM-CSF receptor
  • GM-CSFR GM-CSF receptor
  • the GM-CSF receptor typically has a low expression (e.g. 20-200/cell), but has a high affinity (Shi Y et al., Granulocyte- macrophage colony-stimulating factor (GM-CSF) and T-cell responses: what we do and don't know, Cell Research (2006) 16: 126–133).
  • GM-CSF has been used as an immune adjuvant in various ways, including, without limitation, systemic and topical application of soluble GM-CSF, GM-CSF fusion proteins, transfection of tumor cells with GM-CSF and injection of GM-CSF DNA.
  • Recombinant GM-CSF has been used an adjuvant for various peptide, protein, and viral vaccines, and has been shown to be an effective adjuvant in patients with melanoma, breast, and ovarian cancer.
  • a fusion protein comprising GM-CSF has also been shown to enhance immunogenicity of an antigen.
  • a tumor cell line or tumor cell line variant may express the GM-CSF peptide of SEQ ID NO: 13.
  • a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 60% to the protein of SEQ ID NO: 13.
  • a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 70% to the protein of SEQ ID NO: 13. According to some embodiments, a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 80% to the protein of SEQ ID NO: 13. According to some embodiments, a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 90% to the protein of SEQ ID NO: 13. According to some embodiments, a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 95% to the protein of SEQ ID NO: 13.
  • a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 96% to the protein of SEQ ID NO: 13. According to some embodiments, a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 97% to the protein of SEQ ID NO: 13. According to some embodiments, a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 98% to the protein of SEQ ID NO: 13. According to some embodiments, a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 99% to the protein of SEQ ID NO: 13.
  • a tumor cell line or tumor cell line variant may comprise one or more proteins comprising a fusion between GM-CSF and HLA-I to enable membrane expression.
  • a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 60% to the protein of SEQ ID NO: 42 or SEQ ID NO: 5.
  • a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 70% to the protein of SEQ ID NO: 42 or SEQ ID NO: 5.
  • a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 80% to the protein of SEQ ID NO: 42 or SEQ ID NO: 5. According to some embodiments, a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 90% to the protein of SEQ ID NO: 42 or SEQ ID NO: 5. According to some embodiments, a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 95% to the protein of SEQ ID NO: 42 or SEQ ID NO: 5.
  • a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 96% to the protein of SEQ ID NO: 42 or SEQ ID NO: 5. According to some embodiments, a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 97% to the protein of SEQ ID NO: 42 or SEQ ID NO: 5. According to some embodiments, a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 98% to the protein of SEQ ID NO: 42 or SEQ ID NO: 5.
  • a tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 99% to the protein of SEQ ID NO: 42 or SEQ ID NO: 5.
  • Fms-like tyrosine kinase-3 ligand Fms-like tyrosine kinase-3 ligand (Flt-3L)
  • the human Flt3L protein is a membrane bound hematopoietic four helical bundle cytokine encoded by the FLT3LG gene.
  • Flt3L acts as a growth factor that stimulates proliferation and differentiation of various blood cell progenitors, and is crucial for production and development of dendritic cells.
  • a subset of R immunomodulators may comprise the membrane bound form of Flt-3L.
  • the ENLSTTM cells expresses the Flt3L peptide of SEQ ID NO: 14.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 60% to the protein of SEQ ID NO: 14.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 70% to the protein of SEQ ID NO: 14. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 80% to the protein of SEQ ID NO: 14. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 90% to the protein of SEQ ID NO: 14. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 95% to the protein of SEQ ID NO: 14.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 96% to the protein of SEQ ID NO: 14. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 97% to the protein of SEQ ID NO: 14. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 98% to the protein of SEQ ID NO: 14. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 99% to the protein of SEQ ID NO: 14.
  • an R subset of immunomodulators may comprise a soluble form of Flt3L.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 60% to the protein of SEQ ID NO: 44.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 70% to the protein of SEQ ID NO: 44.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 80% to the protein of SEQ ID NO: 44.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 90% to the protein of SEQ ID NO: 44. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 95% to the protein of SEQ ID NO: 44. According to some embodiments, a ENLSTTM tumor cell line or tumor cell line variant may be genetically engineered to comprise one or more proteins with a sequence identity of at least 96% to the protein of SEQ ID NO: 44. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 97% to the protein of SEQ ID NO: 44.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 98% to the protein of SEQ ID NO: 44. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 99% to the protein of SEQ ID NO: 44.
  • a population of allogeneic ENLSTTM cells comprising a population of tumor cells expressing one or more tumor specific antigens, and genetically engineered to express a core group of three immunomodulators comprises one or more (e.g., 2, 3, 4, 5, or more) cytokines, or variants or fragments thereof.
  • the disclosure encompasses a ENLSTTM cell population comprising a population of tumor cells expressing one or more tumor specific antigens and genetically engineered to express a core group of three immunomodulatory molecules plus optionally one or more R group of immunomodulatory molecules comprising one or more TNF-family members, wherein the ENLSTTM cell population is effective to activate serial killer cells effective to kill tumor cells comprising one or more of T lymphocytes, natural killer (NK) cells, NKT cells, dendritic cells (DCs) or B lymphocytes.
  • the disclosure encompasses one or more TNF-family member proteins, including a full-length, fragment, homologue, variant or mutant of the TNF-family protein.
  • the TNF superfamily member is selected from one or more of tumor necrosis factor alpha (TNF ⁇ ), CD40 ligand (CD40L), OX40 Ligand (OX40L), FAS ligand (FASL), CD27 ligand (CD70), CD30 ligand (CD30L), CD137 ligand (CD137L), TNFSF8, TNFSF9, TNFSF10, TNFSF11, TNFS12, TNFSF13, TNFSF13B, TNFSF14, TNFSF15, TNFSF18, TNF ⁇ , TNFSF1B, TNF ⁇ , Ectodysplasin A (EDA), 4-IBB, and its ligand 4-IBB Ligand (4- IBBL).
  • TNF ⁇ tumor necrosis factor alpha
  • CD40L CD40 ligand
  • OX40L OX40 Ligand
  • FAS ligand FAS ligand
  • CD27 ligand CD70
  • CD30L CD137 ligand
  • TNFSF8 TNFSF9
  • the TNF superfamily member is TNF ⁇ .
  • the TNF superfamily member is CD40L.
  • the TNF superfamily member is OX40 Ligand.
  • the TNF superfamily member is CD27 Ligand.
  • the TNF superfamily member is 4-IBBL.
  • the TNF family member is membrane bound.
  • the tumor necrosis factor (TNF) superfamily is a protein superfamily of type II transmembrane proteins containing TNF homology domain and forming trimers. Members of this superfamily can be released from the cell membrane by extracellular proteolytic cleavage and function as a cytokine.
  • TNF-family molecules deliver co-stimulatory signals. These seem to function by activating NF ⁇ B through a TRAF-dependent pathway. For example, the binding of CD70 on dendritic cells to its constituitively expressed CD20 receptor on na ⁇ ve T cells delivers a potent co-stimulatory signal to T cells early in the activation process.
  • the receptor CD40 on dendritic cells binds to CD40 ligand expressed on T cells, initiating two-way signaling that transmits activating signals to the T cell, and also induces the dendritic cell to express increased B7, thus stimulating further-cell proliferation.
  • Another costimulatory receptor and its ligand, OX40 and OX40L are expressed on activated T cells and dendritic cells, respectively.
  • TNFR family members OX40 (CD134) and 4-IBB (CD137) have been found to play major roles as costimulatory receptors for both CD4 and CD8 T cells. Both OX40 and 4-IBB signal through TRAF adaptor molecules that are shared; distinct; inflammatory cascades also can be triggered through these receptors. OX40 and CD28 signaling activates multiple signaling pathways, such as those involving PI3K/Akt, AP- 1, and NF- ⁇ B pathways. In addition, OX40 and 4-IBB are strong controllers of immunosuppressive or immunomodulatory cells, including Tregs.
  • OX40L (TNFSF4, bTNF Superfamily member 4)
  • the OX40 Ligand (OX40L)(CD252, TNFSF4) which was originally termed glycoprotein 34 kDa (GP34), belongs to the TNF superfamily; it is mainly expressed on the surface of antigen-presenting cells (APC), including activated dendritic cells (DCs), B cells, macrophages, T cells as well as endothelial cells [Huang, L. et al., J. Trans. Med.
  • OX40 (ACT35, CD134, TNFRSF4) is constitutively expressed on the cell surface of activated CD4+ T cells [Id., citing Ogawa R, et al., Cytokine Growth Factor Rev. (2008) 19:253–262. doi: 10.1016/j.cytogfr.2008.04.003, Paterson DJ, et al.
  • OX-40 receptor is a transmembrane protein found on the surface of activated CD4(+) T cells. Weinberg, AD, et al., “OX-40: life beyond the effector T cell stage,” Semin. Immunol. (1998) 10(6): 471-80).
  • OX-40R When engaged by an agonist such as anti-OX-40 antibody or the OX-40 ligand (OX-40L) during antigen presentation to T cell lines, the OX-40R generates a costimulatory signal that is as potent as CD28 costimulation.
  • OX-40R enhances effector and memory-effector T cell function by up- regulating IL-2 production and increasing the life-span of effector T cells.
  • CD25-Foxp3- na ⁇ ve CD4 T cells can aquire Foxp3 driven by TGF- ⁇ R and IL- 2R signals leading to differentiation into an inducible Treg (iTreg). So, T et al, Cytokine Growth Factor Rev.
  • the ENLSTTM cells may be engineered to express a membrane bound form of OX40L on the membrane of the ENLSTTM cells.
  • the ENLSTTM cells may be engineered to express a soluble form of OX40L.
  • ENLSTTM cells may be engineered to express a membrane bound form of OX40L on the membrane of the ENLSTTM cells of SEQ ID NO: 108.
  • the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 60% to the protein of SEQ ID NO: 108.
  • the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 70% to the protein of SEQ ID NO: 108.
  • the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 80% to the protein of SEQ ID NO: 108.
  • the ENLSTTM cells variant may comprise one or more proteins with a sequence identity of at least 90% to the protein of SEQ ID NO: 108.
  • the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 95% to the protein of SEQ ID NO:108.
  • the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 96% to the protein of SEQ ID NO: 108.
  • the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 97% to the protein of SEQ ID NO: 108. According to some embodiments, the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 98% to the protein of SEQ ID NO:108. According to some embodiments, the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 99% to the protein of SEQ ID NO: 108.
  • CD27 Ligand (CD70) [00428] CD27 ligand (CD70), a type II transmembrane protein, is a member of the TNF superfamily. It is expressed on activated T and B lymphocytes, as well as NK cells.
  • CD27 signals during the later phase of the primary CD8+ T cell response, prevent apoptosis of antigen-specific CD8+ T cells. Lack of CD27 signals decreases the quality of memory CD8+ T cell responses.
  • CD27 acts indirectly to regulate primary antigen-specific CD8+ T cell responses by preventing apoptosis of CD8+ T cells during the later phase of the primary response, and is required for optimal quality of memory cells, but is not required during normally primed secondary CD8+ T cell responses.
  • CD27 Ligand is a 193 amino acid protein, consisting of a 17 amino acid cytoplasmic domain, a 21 amino acid transmembrane domain, and a 155 amino acid extracellular domain. Human soluble CD70 corresponds to the 155 amino acid extracellular domain of the full length CD70 protein.
  • an ENLSTTM cells tumor cell line or tumor cell line variant may be engineered to express a membrane bound form of CD70 on the membrane of the ENLSTTM cells.
  • an ENLSTTM cell tumor cell line or tumor cell line variant may be engineered to express a soluble form of CD70.
  • the ENLSTTM cells may be engineered to express a membrane bound form of CD70 on the membrane of the ENLSTTM cells of SEQ ID NO: 109.
  • the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 60% to the protein of SEQ ID NO: 109.
  • the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 70% to the protein of SEQ ID NO: 109. According to some embodiments, the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 80% to the protein of SEQ ID NO: 109. According to some embodiments, the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 90% to the protein of SEQ ID NO: 109. According to some embodiments, the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 95% to the protein of SEQ ID NO: 109.
  • the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 96% to the protein of SEQ ID NO: 109. According to some embodiments, the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 97% to the protein of SEQ ID NO: 109. According to some embodiments, the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 98% to the protein of SEQ ID NO: 109. According to some embodiments, the ENLSTTM cells may comprise one or more proteins with a sequence identity of at least 99% to the protein of SEQ ID NO: 109.
  • Na ⁇ ve CD8 T cells require more co-stimulatory activity to drive them to become activated effector cells than do na ⁇ ve CD4 T cells.
  • This requirement can be met in two ways. The simplest is priming by activated DCs, which have high intrinsic co- stimulatory activity. In some viral infections, dendritic cells become sufficiently activated to directly induce CD8 T cells to produce the IL-2 required for their differentiation into cytotoxic effector cells, without help from CD4 T cells. This property of DCs has been exploited to generate cytotoxic T cell responses against tumors. In the majority of viral infections, however, CD8 T-cell activation requires additional help, which is provided by CD4 effector T cells.
  • CD4 T cells that recognize related antigens presented by the APC can amplify the activation of na ⁇ ve CD T cells by further activating the APC.
  • B7 expressed by the DC first activates the CD4 T cells to express IL-2 and CD40L.
  • CD40L binds CD40 on the DC, delivering an additional signal that increases the expression of B7 and 4-IBBL by the dendritic cell, which in turn provides additional co- stimulaton to the na ⁇ ve CD8 T cell.
  • the IL-2 produced by activated CD4 T cells also acts to promote effector CD8 T-cell differentiation. Murphy, Kenneth. Janeway’s Immunobiology: 8th ed. Chapter 15: Garland Science. (2012), at 372.
  • 4-IBB has a pattern of expression that follows the primary activation of T cells and is restricted to activated CD4+ and CD8+ T cells. Guinn, B, et al., J. Immuno. (1999) 162: 5003-5010. Engagement of the 4-IBB receptor has been shown to relay strong costimulatory signals within activated T cells, which lead to their enhanced proliferaton and cytokine secretion. Id. Such signaling prevents activation-induced cell death following TCR cross-linking in the absence of other accessory signals.
  • 4-IBBL a high affinity ligand for 4-IBB, expressed on the surface of activated APCs, is a type II membrane protein that shows homology to members of the TNF receptor family.
  • the ENLSTTM cells may be engineered to express a membrane bound form of 4-IBBL.
  • an ENLSTTM tumor cell line or tumor cell line variant may be engineered to express a soluble form of 4-IBBL.
  • CD40 Ligand (CD40L)
  • CD154 or CD40L The ligand of CD40, known as CD154 or CD40L, is a type II transmembrane protein, with a variable molecular weight between 32 and 39 kDa because of post- translation modifications (Elgueta R et al., Molecular mechanism and function of CD40/CD40L engagement in the immune system. Immunological reviews. 2009; 229(1):10.1111/j.1600-065X.2009.00782.x. doi:10.1111/j.1600-065X.2009.00782.x, citing van Kooten C et al., J. Leukoc Biol. 2000 Jan; 67(1):2-17.).
  • CD40L is a member of the TNF superfamily and is characterized by a sandwich extracellular structure that is composed of a ⁇ -sheet, ⁇ -helix loop, and a ⁇ - sheet, which allows for the trimerization of CD40L (Id. citing Karpusas M et al., Structure. 1995 Oct 15; 3(10):1031-9).
  • CD40L is expressed primarily by activated T cells, as well as activated B cells and platelets; under inflammatory conditions it is also induced on monocytic cells, natural killer cells, mast cells, and basophils (Id. citing Carbone E et al., J Exp Med.1997 Jun 16; 185(12):2053-60). The widespread expression of the costimulatory pair of CD40L and CD40 indicates the pivotal roles they play in different cellular immune processes. [00437] CD40L has three binding partners: CD40, ⁇ 5 ⁇ 1 integrin and ⁇ IIb ⁇ 3 integrin.
  • CD40L acts as a costimulatory molecule and is particularly important on a subset of T cells called T follicular helper cells (TFH cells), where it promotes B cell maturation and function by engaging CD40 on the B cell surface facilitating cell-cell communication.
  • T follicular helper cells T follicular helper cells
  • a defect in the CD40L gene results in an inability to undergo immunoglobulin class switching and is associated with hyper-IgM syndrome. Absence of CD40L also stops the formation of germinal centers thereby prohibiting antibody affinity maturation, an important process in the adaptive immune system.
  • CD40 has been found to be expressed on APCs, while its ligand, CD40L, has been found on activated T cells.
  • CD40 has been found to play a critical role in the humoral immune response, and has been identified as enabling APCs to activate T cells.
  • Several pathologies have been associated with the CD40/CD40L pathway including lupus and atherosclerosis, but anti-CD40L antibodies have been limited to clinical applications of thrombic complications from CD40 expression on activated platelets (Kaufman and Wolchok eds., General Principles of Tumor Immunotherapy, Chpt 5, 67-121 (2007)).
  • CD40 has also been found on several types of cancer, including solid tumors and hematologic malignancies. Signaling through CD40 in hematological cancer may mediate growth or regression, while CD40 signaling in solid tumors is only tumoricidal.
  • Tumor cell vaccines expressing CD40L have proved useful in cancer models. For example, ligation of CD40 with CD40L or anti-CD40 antibodies has shown synergy with GM-CSF, IFN-gamma, IL-2, and CTLA-4 blockade.
  • an R subset of immunomodulators may comprise CD40 Ligand (CD40L).
  • CD40L CD40 Ligand
  • the ENLSTTM tumor cell line or tumor cell line variant may be engineered to express a noncleavable CD40L peptide of SEQ ID NO: 6.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 60% to the protein of SEQ ID NO: 6.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 70% to the protein of SEQ ID NO: 6. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 80% to the protein of SEQ ID NO: 6. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 90% to the protein of SEQ ID NO: 6. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 95% to the protein of SEQ ID NO: 6.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 96% to the protein of SEQ ID NO: 6. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 97% to the protein of SEQ ID NO: 6. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 98% to the protein of SEQ ID NO: 6. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 99% to the protein of SEQ ID NO: 6.
  • the ENLSTTM cells may be engineered to express the non-cleavable membrane bound CD40L peptide of SEQ ID NO: 7 on the membrane surface of the tumor cell.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 60% to the protein of SEQ ID NO: 7.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 70% to the protein of SEQ ID NO: 7.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 80% to the protein of SEQ ID NO: 7.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 90% to the protein of SEQ ID NO: 7. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 95% to the protein of SEQ ID NO: 7. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 96% to the protein of SEQ ID NO: 7. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 97% to the protein of SEQ ID NO: 7.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 98% to the protein of SEQ ID NO: 7. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 99% to the protein of SEQ ID NO: 7.
  • Tumor Necrosis Factor Alpha [00443] Tumor necrosis factor (TNF; tumor necrosis factor alpha (TNF ⁇ ); cachexin, cachectin) is a cytokine, primarily produced by activated macrophages and lymphocytes, which is involved in systemic inflammation. It is also one of the cytokines involved in the acute phase of an immunogenic response.
  • TNF may be produced by other cell types such as, for example, CD4+ lymphocytes, NK cells, neutrophils, mast cells, eosinophils, and neurons.
  • TNF In its primary role as a regulator of immune cells, TNF is capable of inducing fever, apoptotic cell death, cachexia, inflammation, and inhibition of tumorigenesis; of inhibiting viral replication; and of initiating a response to sepsis vial IL-1 and IL-6 producing cells.
  • Dysregulated TNF production has been associated with a wide array of human diseases, including Alzheimer’s disease, major depression, psoriasis, and inflammatory bowel disease (IBD).
  • IBD inflammatory bowel disease
  • TNF can be produced ectopically in the setting of malignancy and parallels parathyroid hormone both in causing secondary hypercalcemia and in the cancers with which excessive production is associated.
  • TNF comprises a 26 kDa membrane bound form and 17 kDa soluble cytokine form.
  • the soluble form of TNF is derived from proteolytic cleavage of the membrane bound form by TNF- ⁇ lpha converting enzyme (TACE) (Grell M. et al., The Transmembrane Form of Tumor Necrosis Factor Is the Prime Activating Ligand of the 80 kDa Tumor Necrosis Factor Receptor, Cell, Vol. 83, 793-802).
  • TACE TNF- ⁇ lpha converting enzyme
  • TACE is a matrix metalloprotease that recognizes a cleavage site in the extracellular domain of full-length TNF (Rieger, R., Chimeric form of tumor necrosis factor-alpha has enhanced surface expression and antitumor activity, Cancer Gene Therapy, 2009, 16, 53-64). Deletion of the cleavage site on TNF results in enhanced membrane stability of TNF (Id.). [00446] TNF has antiproliferative and cytotoxic effects on cells, is known to reduce tumor blood flow and tumor vascular damage, and is able to modulate immune response by stimulating macrophage and NK cell activity. However, the use of TNF as a therapeutic itself has been limited by dose-dependent hypotension and capillary leak that can cause a sepsis-like syndrome.
  • TNF has been added to standard chemotherapy agents to improve response rates.
  • Other approaches to administering TNF include injection of adenovirus altered to express TNF in gastrointestinal malignancies.
  • a tumor vascular-targeted TNF compound has also been developed (Kaufman and Wolchok eds., General Principles of Tumor Immunotherapy, Chpt 5, 67-121 (2007)).
  • Recombinant TNF has been used as an immunostimulant under the name tasonermin, while HUMIRA® is an antibody to TNF, useful for the treatment of inflammatory diseases (e.g. psoriasis and rheumatoid arthritis).
  • a subset of R immunomodulators may comprise TNF.
  • the ENLSTTM cells may be genetically engineered to express the membrane bound form of TNF on the membrane of the tumor cell.
  • the cell line variants comprise the peptide of SEQ ID NO: 8.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 60% to the protein of SEQ ID NO: 8. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 70% to the protein of SEQ ID NO: 8. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 80% to the protein of SEQ ID NO: 8. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 90% to the protein of SEQ ID NO: 8.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 95% to the protein of SEQ ID NO: 8. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 96% to the protein of SEQ ID NO: 8. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 97% to the protein of SEQ ID NO: 8. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 98% to the protein of SEQ ID NO: 8.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 99% to the protein of SEQ ID NO: 8.
  • the ENLSTTM cells may be genetically engineered to express a non-cleavable membrane bound form of TNF.
  • the ENLSTTM tumor cell line or tumor cell line variant may be genetically engineered to comprise the TNF protein of SEQ ID NO: 8 with one or more of amino acids VRSSSRTPSDKP (SEQ ID NO 104) deleted (see e.g. SEQ ID NO: 26).
  • the ENLSTTM cells may be genetically engineered to express a soluble form of TNF.
  • the ENLSTTM tumor cell line or tumor cell line variant may be genetically engineered to express the TNF protein of SEQ ID NO: 8 with part or the entire transmembrane region removed.
  • the ENLSTTM tumor cell line or tumor cell line variant may be genetically engineered to comprise a derivative TNF protein of SEQ ID NO: 8 with one or more of amino acids F, S, F, L, I, V, A, G, A, T, T, L, F, C, L, L, H, F, G, V, I deleted (see e.g.
  • the ENLSTTM cells may be genetically engineered to express a non-cleavable membrane bound chimeric form of CD40L and TNF.
  • the ligand binding portion of a TNF molecule may be fused with the transmembrane and proximal extracellular domains of CD40L, such that the TNF lacks a defined TNF alpha cleaving enzyme (TACE) site.
  • TACE TNF alpha cleaving enzyme
  • the intracellular, transmembrane, and partial extracellular portions CD40L may be fused with the extracellular region of TNF distal to the TACE cleavage site.
  • the chimeric form of CD40L/TNF may comprise the CD40L sequence of SEQ ID NO: 9 and the TNF sequence of SEQ ID NO: 10.
  • the CD40L/TNF sequences are operably linked via a linking peptide between 1 and 30 amino acids in length.
  • the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 60% to the proteins of SEQ ID NO: 9 and SEQ ID NO: 10.
  • the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 70% to the proteins of SEQ ID NO: 9 and SEQ ID NO: 10.
  • the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 80% to the proteins of SEQ ID NO: 9 and SEQ ID NO: 10. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 90% to the proteins of SEQ ID NO: 9 and SEQ ID NO: 10. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 95% to the proteins of SEQ ID NO: 9 and SEQ ID NO: 10.
  • the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 96% to the proteins of SEQ ID NO: 9 and SEQ ID NO: 10. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 97% to the proteins of SEQ ID NO: 9 and SEQ ID NO: 10. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 98% to the proteins of SEQ ID NO: 9 and SEQ ID NO: 10.
  • the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 99% to the proteins of SEQ ID NO: 9 and SEQ ID NO: 10.
  • the ENLSTTM cells may be genetically engineered to express a non-cleavable membrane bound form of TNF with a sequence identity of at least 60% to the protein of SEQ ID NO: 11.
  • the ENLSTTM cells may be genetically engineered to express a non- cleavable membrane bound form of TNF with a sequence identity of at least 70% to the protein of SEQ ID NO: 11.
  • the ENLSTTM cells may be genetically engineered to express a non-cleavable membrane bound form of TNF with a sequence identity of at least 80% to the protein of SEQ ID NO: 11. According to some embodiments, the ENLSTTM cells may be genetically engineered to express a non- cleavable membrane bound form of TNF with a sequence identity of at least 90% to the protein of SEQ ID NO: 11. According to some embodiments, the ENLSTTM cells may be genetically engineered to express a non-cleavable membrane bound form of TNF with a sequence identity of at least 95% to the protein of SEQ ID NO: 11.
  • the ENLSTTM cells may be genetically engineered to express a non- cleavable membrane bound form of TNF with a sequence identity of at least 96% to the protein of SEQ ID NO: 11. According to some embodiments, the ENLSTTM cells may be genetically engineered to express a non-cleavable membrane bound form of TNF with a sequence identity of at least 97% to the protein of SEQ ID NO: 11. According to some embodiments, the ENLSTTM cells may be genetically engineered to express a non- cleavable membrane bound form of TNF with a sequence identity of at least 98% to the protein of SEQ ID NO: 11.
  • the ENLSTTM cells may be genetically engineered to express a non-cleavable membrane bound form of TNF with a sequence identity of at least 99% to the protein of SEQ ID NO: 11.
  • the ENLSTTM cells may be genetically engineered to express a non-cleavable membrane bound chimeric form of CD40L and TNF.
  • the ligand portion of a TNF molecule may be fused with extracellular portions of CD40L, wherein CD40L comprises an extracellular portion that is non-cleavable and the TNF lacks a defined TACE site (e.g. cleavage site between amino acids 76 and 77).
  • CD40L peptide sequence is fused with the extracellular region of a TNF peptide sequence distal to the TACE cleavage site.
  • the chimeric form of CD40L/TNF may comprise the sequence of SEQ ID NO: 31.
  • the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 60% to the protein of SEQ ID NO: 31.
  • the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 70% to the protein of SEQ ID NO: 31.
  • the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 80% to the protein of SEQ ID NO: 31. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 90% to the protein of SEQ ID NO: 31. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 95% to the protein of SEQ ID NO: 31. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 96% to the protein of SEQ ID NO: 31.
  • the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 97% to the protein of SEQ ID NO: 31. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 98% to the protein of SEQ ID NO: 31. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise a fusion protein with a sequence identity of at least 99% to the protein of SEQ ID NO: 31.
  • the disclosure encompasses an ENLSTTM cellpopulation comprising a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population comprising a subset of R immunomodulators comprising one or more secreted receptors.
  • R immunomodulators may comprise one or more (e.g., 2, 3, 4, 5, or more) secreted receptor proteins, or variants or fragments thereof.
  • the secreted receptor is IL10R, TGF ⁇ R3, or both.
  • Interleukin-10 is a key immunosuppressive cytokine that is produced by a wide range of leukocytes, as well as nonhematopoietic cells. Shouval, DS., et al., Immunity (2014) 40: 706-719. IL-10 mediates its anti-inflammatory effects through IL- 10 receptor (IL-10R)-dependent signals emanating from the cell surface.
  • the IL-10R is a heterotetramer that consists of two subunits of IL-10R ⁇ and two subunits of IL-10R ⁇ . Id., citing Moore, KW, et al., Annu. Rev. Immunol.
  • the IL-10R ⁇ subunit is unique to IL-10 signaling, the IL-10R ⁇ subunit is shared by other cytokine receptors, including IL-22, IL-26, and interferon ⁇ , Id.
  • IL-10 downstream signaling through the IL-10R inhibits the induction of proinflammatory cytokines by blocking NF- ⁇ B-dependent signals.
  • TbetaRIII Transforming growth factor-beta receptor 3
  • TbetaRIII is an 853 amino acid transmembrane proteoglycan, which contains a short 41 amino acid cytoplasmic domain. It is ubiquitously expressed on nearly all cell types. The level of TbetaRIII expression is cell type specific. It is a member of the TGF-beta superfamily signaling pathways, which have essential roles in mediating cell proliferation, apoptosis, differentiation, and migration in most human tissues.
  • TbetaRIII is the most abundantly expressed TGF-beta superfamily receptor and functions as a TGF-beta superfamily co- receptor, by binding the TGF-beta superfamily members, TGF-beta1, TGF-beta2, or TGF-beta3, inhibin, BMP-2, BMP-4, BMP-7, and GDF-5 and presents these ligand to their respective signaling receptors to activate or repress (in the case of inhibin) TGF- beta1, BMP, or activin signaling to the Smad transcription factors.
  • TbetaRIII presents ligand to the TGF-beta type II receptor (TbetaRII).
  • TbetaRII TGF-beta type I receptor
  • TbetaRI TGF-beta type I receptor
  • Phosphorylation of Smad2 and Smad3 leads to formation of a complex with Smad4, and accumulation of this complex in the nucleus, where along with co-activators and co-repressors they regulate the transcription of genes involved in proliferation, angiogenesis, apoptosis, and differentiation.
  • TbetaRIII In addition to regulating receptor mediated Smad signaling, TbetaRIII also mediates ligand dependent and independent p38 pathway signaling.
  • TbetaRIII can also undergo ectodomain shedding to generate soluble TbetaRIII (sTbetaRIII), which binds and sequesters TGF-beta superfamily members to inhibit their signaling.
  • sTbetaRIII expression has been demonstrated to correlate with the cell surface expression of TbetaRIII, little is known about the regulation of sTbetaRIII production.
  • TbetaRIII shedding may be mediated in part by the membrane type matrix metalloproteases (MT-MMP) MT1-MMP and/or MT3- MMP, and plasmin, a serine proteinase which has been shown to cleave the extracellular domain of TbetaRIII.
  • MT-MMP membrane type matrix metalloproteases
  • TbetaRIII shedding is modulated by pervanadate, a tyrosine phosphatase inhibitor.
  • TAPI-2 a MT-MMP and ADAM protease inhibitor
  • the regulation of TbetaRIII expression is sufficient to alter TGF-beta signaling.
  • the cytoplasmic domain of TbetaRIII interacts with GAIP interacting protein, C terminus (GIPC), a PDZ-domain containing protein, which stabilizes TbetaRIII cell surface expression and increases TGF- beta signaling.
  • TbetaRIII The interaction between TbetaRIII and GIPC also plays an important role in TbetaRIII mediated inhibition of TGF-beta signaling, cell migration, and invasion during breast cancer progression.
  • the cytoplasmic domain of TbetaRIII is phosphorylated by TbetaRII, which results in TbetaRIII binding to the scaffolding protein beta-arrestin2.
  • TbetaRIII/beta-arrestin2 interaction results in the co-internalization of beta- arrestin2/TbetaRIII/ TbetaRII and the down-regulation of TGF-beta signaling.
  • TbetaRIII complexes with ALK6, a BMP type I receptor, in a beta- arrestin2 dependent manner to mediate the internalization of ALK6 and stimulation of ALK6 specific BMP signaling events.
  • TbetaRIII negatively regulates NF ⁇ -B signaling in the context of breast cancer, regulates epithelial cellular adhesion to fibronectin, fibrillogenesis, and focal adhesion formation via regulation of alpha5beta1 internalization and trafficking to nascent focal adhesions, activates Cdc42, to alter the actin cytoskeleton and suppresses migration in normal and cancerous ovarian epithelial cells.
  • TbetaRIII has an important role in the formation of the atrioventricular cushion in the heart. Consistent with an important role for TbetaRIII during development, TGFbetaR3 null mice are embryonic lethal due to heart and liver defects. TGFbetaR3 has been recently identified as a tumor suppressor in multiple types of human cancers, including breast, lung, ovarian, pancreatic and prostate cancer. The loss of TGFbetaR3 in these cancer types correlates with disease progression, and results in increased motility and invasion in vitro and increased invasion and metastasis in vivo. (http://atlasgeneticsoncology.org/Genes/TGFBR3ID42541ch1p33.html, visited 8/26/2019).
  • the disclosure encompasses an ENLSTTM cell population comprising a population of tumor cells expressing one or more tumor specific antigens, wherein the tumor cells are genetically engineered to stimulate one or more of T lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes, the population a subset of R immunomodulators comprising one or more chaperone proteins.
  • the disclosure encompasses a chaperone protein, including a full-length, fragment, homologue, variant or mutant of the chaperone protein.
  • Chaperones are a functionally related group of proteins that assist protein folding in the cell under physiological and stress conditions.
  • the chaperone protein is selected from one or more of GRP78/BiP, GRP94, GRP170, Calnexin, calreticulin, HSP47, ERp29, Protein disulfide isomerase (PDI), Peptidyl prolyl cis-trans-isomerase (PPI), Erp57, Hsp60, Hsp70, Hsp90, Hsp100.
  • the chaperone protein is membrane bound.
  • a population of ENLSTTM cells expressing one or more tumor specific antigens may be genetically engineered to comprise one or more (e.g., 2, 3, 4, 5, or more) chaperone proteins, or variants or fragments thereof.
  • Immunoglobulin Superfamily (IgSF) [00460] According to some embodiments, a subset of R immunomodulators may comprise one or more IgSF proteins. Thus, the disclosure encompasses a member of the IgSF superfamily, including a full-length, fragment, homologue, variant or mutant of the IgSF superfamily member.
  • the immunoglobulin superfamily (IgSF) is a class of proteins that are associated with the adhesion, binding and recognition processes of cells.
  • Molecules are categorized as members of this superfamily based on shared structural features with immunoglobulins; they all possess a domain known as an immunoglobulin domain or fold.
  • Members of the IgSF include cell surface antigen receptors, co-receptors and co- stimulatory molecules of the immune system, molecules involved in antigen presentation to lymphocytes, cell adhesion molecules, certain cytokine receptors and intracellular muscle proteins.
  • Members of the IgSF can be classified as follows: antigen receptors (e.g. antibodies or immunoglobulins: IgA, IgD, IgE, IgG, IgM) ; antigen presenting molecules (e.g. MHC class I, MHC class II); co-receptors (e.g.
  • the IgSF member is membrane bound.
  • Poliovirus Receptor is a transmembrane glycoprotein belonging to the immunoglobulin superfamily. PVR/ CD155 mediates NK cell adhesion and triggers NK cell effector functions. PVR/ CD155 binds two different NK cell receptors: CD96 and CD226. These interactions accumulate at the cell-cell contact site, leading to the formation of a mature immunological synapse between NK cell and target cell. This may trigger adhesion and secretion of lytic granules and IFN-gamma (IFN ⁇ ) and activate cytoxicity of activated NK cells, and may also promote NK cell-target cell modular exchange, and PVR transfer to the NK cell.
  • IFN ⁇ IFN-gamma
  • Poliovirus receptor-related 2 (PVRL2), also known as Nectin-2, is a single- pass type I membrane glycoprotein with two Ig-like C2-type domains and an Ig-like V- type domain. This protein is one of the plasma membrane components of adherens junctions.
  • CD48 antigen Cluster of Differentiation 48
  • BLAST-1 B-lymphocyte activation marker
  • SLAMF2 signaling lymphocytic activation molecule 2
  • CD48 is a member of the CD2 subfamily of the IgSF, which includes SLAM (signaling lymphocyte activation molecules) proteins, such as CD84, CD150, CD229 and CD244.
  • CD48 is found on the surface of lymphocytes and other immune cells, dendritic cells and endothelial cells, and participates in activation and differentiation pathways in these cells.
  • NK-T-B antigen is a surface molecule expressed on NK, T, and B cells. In human NK cells, NTBA has been shown to act primarily as a coreceptor since it could trigger cytolytic activity only in cells expressing high surface densities of natural cytotoxicity receptors (NCR).
  • the IgSF protein is IgG.
  • the IgSF protein is PVR/CD155.
  • the IgSF protein is CD48.
  • the IgSF protein is Nectin2.
  • the IgSF protein is NK-T-B antigen.
  • Immunoglobulins (Ig) are glycoproteins produced by immune cells. Antibodies are serum proteins, the molecules of which possess small areas of their surface that are complementary to small chemical groupings on their targets.
  • CDRs complementary determining regions
  • Immunoglobulins play a critical role in an immune response by binding to particular antigens, such as those exhibited by bacteria or viruses. According to some embodiments, the binding of immunoglobulins to antigens may target them for destruction by the subject’s immune cells.
  • the basic structural unit of a whole antibody molecule consists of four polypeptide chains, two identical light (L) chains (each containing about 220 amino acids) and two identical heavy (H) chains (each usually containing about 440 amino acids).
  • the two heavy chains and two light chains are held together by a combination of noncovalent and covalent (disulfide) bonds.
  • the molecule is composed of two identical halves, each with an identical antigen-binding site composed of the N-terminal region of a light chain and the N-terminal region of a heavy chain. Both light and heavy chains usually cooperate to form the antigen binding surface.
  • IgA In mammals, there are five classes of antibodies, IgA, IgD, IgE, IgG, and IgM, each with its own class of heavy chain- ⁇ (for IgA), ⁇ (for IgD), ⁇ (for IgE), ⁇ (for IgG) and ⁇ (for IgM).
  • IgG immunoglobulins IgG1, IgG2, IgG3, IgG4 having ⁇ 1, ⁇ 2, ⁇ 3, and ⁇ 4 heavy chains respectively.
  • IgM In its secreted form, IgM is a pentamer composed of five four-chain units, giving it a total of 10 antigen binding sites.
  • each pentamer contains one copy of a J chain, which is covalently inserted between two adjacent tail regions.
  • VH immunoglobulin heavy
  • V ⁇ and V ⁇ immunoglobulin heavy chain variable genes from peripheral blood lymphocytes
  • PCR polymerase chain reaction
  • Genes encoding single polypeptide chains in which the heavy and light chain variable domains are linked by a polypeptide spacer can be made by randomly combining heavy and light chain V-genes using PCR.
  • the ENLSTTM cells may be engineered to express an IgG1 heavy chain constant region.
  • the Ig gamma-1 (IgG-1) chain C region is a protein encoded by the IGHG1 gene in humans.
  • the ENLSTTM cells may express a membrane bound form IgG-1 chain C protein of SEQ ID NO: 1.
  • the ENLSTTM cells may be genetically engineered to express a secreted form of IgG-1 chain C of SEQ ID NO: 2.
  • the ENLSTTM cells may be genetically engineered to express a secreted form of IgG-1 chain C of SEQ ID NO: 3.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 60% to one or more of proteins with an amino acid sequence SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 70% to one or more of proteins with an amino acid sequence SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 80% to one or more of proteins with an amino acid sequence SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 90% to one or more of proteins with an amino acid sequence SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 95% to one or more of proteins with an amino acid sequence SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 96% to one or more of proteins with an amino acid sequence SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 97% to one or more of proteins with an amino acid sequence SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 98% to one or more of proteins with an amino acid sequence SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 99% to one or more of proteins with an amino acid sequence SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 60% to one or more proteins with amino acid sequence SEQ ID NO: 12, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 45, and SEQ ID NO: 46.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 70% to one or more proteins with amino acid sequence SEQ ID NO: 12, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 45, and SEQ ID NO: 46.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 80% to one or more proteins with amino acid sequence SEQ ID NO: 12, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 45, and SEQ ID NO: 46.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 90% to one or more proteins with amino acid sequence SEQ ID NO: 12, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 45, and SEQ ID NO: 46.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 95% to one or more proteins with amino acid sequence SEQ ID NO: 12, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 45, and SEQ ID NO: 46.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 96% to one or more proteins with amino acid sequence SEQ ID NO: 12, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 45, and SEQ ID NO: 46.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 97% to one or more proteins with amino acid sequence SEQ ID NO: 12, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 45, and SEQ ID NO: 46.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 98% to one or more proteins with amino acid sequence SEQ ID NO: 12, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 45, and SEQ ID NO: 46.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 99% to one or more proteins with amino acid sequence SEQ ID NO: 12, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 45, and SEQ ID NO: 46.
  • the ENLSTTM cells may be engineered to express an IgG protein that is capable of binding to tumor cell specific antigens.
  • the ENLSTTM cells may be engineered to express an IgG protein capable of binding to a prostate cancer specific antigen; e.g., the extracellular region of prostate-specific membrane antigen (PSMA) (See Chang, S., Overview of Prostate-Specific Membrane Antigen, Reviews in Urology, Vol.6 Suppl. 10, S13 (2004)).
  • the ENLSTTM cells may be engineered to express an IgG protein that is capable of binding to immune cell specific antigens.
  • the ENLSTTM cells may be engineered to express an IgG protein capable of binding to T cell markers, e.g., CD3, CD4, or CD8.
  • the ENLSTTM cells may be engineered to express an IgG protein capable of binding to dendritic cell markers, e.g. CD11c or CD123.
  • the ENLSTTM cells may be engineered to express an IgG3 heavy chain constant region.
  • the IgG3 heavy chain constant region comprises CH1-hinge-CH2-CH3 domains, and is encoded by the IGHG3 gene in humans; the IGHG3 gene comprises structural polymorphisms comprising different hinge lengths.
  • the ENLSTTM cells may be genetically engineered to express an IgG-3 heavy chain constant region of SEQ ID NO: 4.
  • the ENLSTTM cells may be genetically engineered to express a derivative of SEQ ID NO: 4 with amino acids 1-76 missing. According to some embodiments, the ENLSTTM cells may be genetically engineered to express the derivative of SEQ ID NO: 4 with amino acids 1-76 missing. According to some embodiments, the ENLSTTM cells may be genetically engineered to express the derivative of SEQ ID NO: 4 with amino acids 77-98 replaced with amino acids QMQGVNCTVSS (SEQ ID NO: 101). According to some embodiments, the ENLSTTM cells may be genetically engineered to express the derivative of SEQ ID NO: 4 comprising an E213Q variant (SEQ ID NO: 16).
  • the ENLSTTM cells may be genetically engineered to express the derivative of SEQ ID NO: 4 comprising a P221L variant (SEQ ID NO: 17). According to some embodiments, the ENLSTTM cells may be genetically engineered to express the derivative of SEQ ID NO: 4 comprising an E224Q variant (SEQ ID NO: 18). According to some embodiments, the ENLSTTM cells may be genetically engineered to express the derivative of SEQ ID NO: 4 comprising a Y226F variant (SEQ ID NO: 19). According to some embodiments, the ENLSTTM cells may be genetically engineered to express the derivative of SEQ ID NO: 4 comprising a D242N variant (SEQ ID NO: 20).
  • the ENLSTTM cells may be genetically engineered to express the derivative of SEQ ID NO: 4 comprising a N245D variant (SEQ ID NO: 21). According to some embodiments, the ENLSTTM cells may express the derivative of SEQ ID NO: 4 comprising a T269A variant (SEQ ID NO: 22). According to some embodiments, the ENLSTTM cells may be genetically engineered to express the derivative of SEQ ID NO: 4 comprising a S314N variant (SEQ ID NO: 23). According to some embodiments, the ENLSTTM cells may be genetically engineered to express the derivative of SEQ ID NO: 4 comprising a deleted S314 (SEQ ID NO: 24).
  • the ENLSTTM cells may be genetically engineered to express the derivative of SEQ ID NO: 4 comprising F366Y variant (SEQ ID NO: 25). [00476] According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 60% to the protein of SEQ ID NO: 4. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 70% to the protein of SEQ ID NO: 4. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 80% to the protein of SEQ ID NO: 4.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 90% to the protein of SEQ ID NO: 4. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 95% to the protein of SEQ ID NO: 4. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 96% to the protein of SEQ ID NO: 4. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 97% to the protein of SEQ ID NO: 4.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 98% to the protein of SEQ ID NO: 4. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 99% to the protein of SEQ ID NO: 4. [00477] According to some embodiments, the ENLSTTM cells may be engineered to express one or more IgG heavy chain variable regions. According to some embodiments, the ENLSTTM cells may be engineered to express a lambda/kappa light chain constant and/or light chain variable region. According to some embodiments, the hinge region of IgG binds to the FcyR receptors on immune cells.
  • the IgG is effective to activate the FcyR and enhance presentation of antigens (e.g. PSA associated with prostate cancer cells).
  • the ENLSTTM cells may be engineered to express an intact monoclonal or polyclonal antibody on the cell surface of the tumor cell.
  • the intact monoclonal or polyclonal antibody may be designed to deliver a molecule that elicits an immunogenic response.
  • the intact monoclonal antibody may be designed to bind to DNA to deliver CpG motifs to immune cells.
  • the immunostimulatory activity of bacterial DNA may be mimicked by engineering an immunomodulator to deliver unmethylated CpG motifs to immune cells.
  • the IgG may be engineered to bind to biotin, which is then capable of delivering biotinylated CpG to cells of the immune system.
  • CpG motifs may be bound directly or indirectly to the surface of the tumor cells of the ENLSTTM cells.
  • CpG motifs may be conjugated to one or more antigens presented on the surface of tumor cells from the tumor cell line or tumor cell line variant.
  • the CpG is a class A CpG.
  • the CpG is a class B CpG. According to some embodiments, the CpG is a class C CpG. According to some embodiments, the CpG is a CpG 30-mer of the sequence 5’ EEAACCGTATCGGCGATATCGGTTEEEEEG 3’ (SEQ ID NO: 102). As used herein with respect to CpG motifs, “E” is a G-phosphorothioate and this linkage refers to the 3’ end of the nucleotide (i.e. the phosphorothioate bond substitutes a sulfur atom for a non-bridging oxygen in the nucleotide backbone).
  • the CpG is a biotinylated 30-mer of the sequence 5’-biotin- EEAACCGTATCGGCGATATCGGTTEEEEEG-3’ (SEQ ID NO: 102).
  • the CpG is a CpG 30-mer of the sequence 5’ EEAACCGTATGCGGCATATCGGTTEEEEEG 3’ (SEQ ID NO: 103).
  • the CpG is a biotinylated CpG 30-mer of the sequence 5’-biotin- EEAACCGTATGCGGCATATCGGTTEEEEEG-3’(SEQ ID NO: 103).
  • the IgG may be engineered as a hybrid of one or more IgG subclasses.
  • the IgG comprises sequences from IgG1 and IgG3.
  • the IgG may be engineered to have an affinity for biotin.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 60% to the protein of SEQ ID NO: 45.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 70% to the protein of SEQ ID NO: 45.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 80% to the protein of SEQ ID NO: 45. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 90% to the protein of SEQ ID NO: 45. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 95% to the protein of SEQ ID NO: 45. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 96% to the protein of SEQ ID NO: 45.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 97% to the protein of SEQ ID NO: 45. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 98% to the protein of SEQ ID NO: 45. According to some embodiments, the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 99% to the protein of SEQ ID NO: 45. [00481] According to some embodiments, the IgG comprises one or more mutations relative to wild type IgG that enhance affinity for Fc receptors for IgG (FcyR).
  • an ENLSTTM tumor cell line or tumor cell line variant may be genetically engineered to comprise one or more proteins of SEQ ID NO: 45 with one or more of mutations T323A and E325A.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 60% to the proteins of one or more of SEQ ID NO: 41, SEQ ID NO: 30, and SEQ ID NO: 43.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 70% to the proteins of one or more of SEQ ID NO: 41, SEQ ID NO: 30, and SEQ ID NO: 43.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 80% to the proteins of one or more of SEQ ID NO: 41, SEQ ID NO: 30, and SEQ ID NO: 43.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 90% to the proteins of one or more of SEQ ID NO: 41, SEQ ID NO: 30, and SEQ ID NO: 43.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 95% to the proteins of one or more of SEQ ID NO: 41, SEQ ID NO: 30, and SEQ ID NO: 43.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 96% to the proteins of one or more of SEQ ID NO: 41, SEQ ID NO: 30, and SEQ ID NO: 43.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 97% to the proteins of one or more of SEQ ID NO: 41, SEQ ID NO: 30, and SEQ ID NO: 43.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 98% to the proteins of one or more of SEQ ID NO: 41, SEQ ID NO: 30, and SEQ ID NO: 43.
  • the ENLSTTM cells may be genetically engineered to comprise one or more proteins with a sequence identity of at least 99% to the proteins of one or more of SEQ ID NO: 41, SEQ ID NO: 30, and SEQ ID NO: 43.
  • Chemokine Receptors [00482] According to some embodiments, a subset of R immunomodulators may comprise one or more chemokine receptors. Chemokine receptors are defined as mediators that activate cellular responses upon binding of chemokines. Twenty-three subtypes of human chemokine receptors have been identified, all of which are members of the seven-transmembrane (7TM) domain superfamily of receptors.
  • the disclosure encompasses a chemokine receptor, including a full-length, fragment, homologue, variant or mutant of the chemokine receptor.
  • a cytokine includes a protein that is effective to affect the biological function of another cell.
  • a biological function affected by a cytokine can include, but is not limited to, cell growth, cell differentiation or cell death.
  • a chemokine receptor of the present disclosure is capable of stimulating an immune cell (e.g. T lymphocytes (e.g., CD8+ T cell), natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes).
  • T lymphocytes e.g., CD8+ T cell
  • NK natural killer cells
  • DCs dendritic cells
  • B lymphocytes e.g., B lymphocytes
  • the chemokine receptor is selected from CXCR1, CXCR2, CXCR3, CXCR5, CXCR6, CXCR8, CCR8, CCR1, CCR2, CCR3, CCR5, CCR4, CCR6, CCR7, CCR9, CCR10, CXCR1, and CXCR3.
  • the chemokine receptor is membrane bound.
  • the three or more discrete biologics are expressed by the ENLSTTMtumor cell line or tumor cell line variant in either soluble or membrane bound form.
  • expression and activity of the soluble and membrane bound forms can be confirmed, in vitro, by flow cytometry and mixed lymphocyte tumor assays, respectively.
  • expression and activity of the soluble and membrane bound forms are confirmed, in vitro, by flow cytometry and by mixed lymphocyte tumor assays.
  • the genetic material for transfecting or transducing the ENLSTTM cell tumor cell line or tumor cell line variant is effective to stably introduce one or more immunomodulatory molecules into a tumor cell line or tumor cell line variant.
  • the genetic material can be introduced by viral transduction techniques and isolated by positive selection for the genetically introduced immune modulator.
  • the positive selection of the genetically introduced immune modulator molecule comprises selection using antibodies.
  • CD28 Ligand (CD28L) [00487] Ligation of the CD28 receptor on T cells provides a critical second signal alongside T cell receptor (TCR) ligation for naive T cell activation. Esenstein, JH et al, Immunity (2016) 44(5): 973-988).
  • CD28 drives critical intracellular biochemical events including unique phosphorylation and transcriptional signaling, metabolism, and the production of key cytokines, chemokines, and survival signals that are essential for long- term expansion and differentiation of T cells (Id., citing Bluestone, JA et al., Immunity. (2006)24: 233–238; Bour-Jordan, H. et al., Immunol Rev. (2011) 241:180–205; Martin, PJ et al., J Immunol. (1986) 136: 3282–3287; Weiss, A. et al., J Immunol. (1986) 137:819–825).
  • CD28 is the founding member of a subfamily of costimulatory molecules characterized by an extracellular variable immunoglobulin-like domain. Other members of the subfamily include ICOS, CTLA4, PD1, PD1H, and BTLA (Id., citing Chen, L. and Flies, D.B., Nat Rev Immunol.2013;13:227–242). CD28 is expressed constitutively on mouse T cells, whereas the expression of other family members ICOS and CTLA4 is induced by T cell receptor stimulation and in response to cytokines such as interleukin 2 (IL-2). CD28 is expressed on roughly 80% of human CD4+ T cells and 50% CD8+ T cells. The proportion of CD28 positive T cells in humans declines with age.
  • IL-2 interleukin 2
  • CD28 expression has been identified on other cell lineages, including bone marrow stromal cells, plasma cells, neutrophils, and eosinophils, the functional importance of CD28 on these cells is not completely understood (Id., citing Gray Parkin, K., et al., J Immunol. (2002) 169:2292–2302; Rozanski, CH et al., J Exp Med. (2011) 208:1435– 1446; Venuprasad, K., et al., Eur J Immunol. (2001) 31:1536–1543; Woerly, G. et al., Clin Exp Allergy. (2004) 34:1379–1387).
  • CD80 and CD86 diverge in their expression patterns, multimeric states, and functionality, adding another layer of complexity to the regulation of CD28 signaling.
  • CD80 is present in predominantly dimeric form on the cell surface whereas CD86 is monomeric (Id., citing Bhatia, S. et al., Proc Natl Acad Sci U S A. (2005) 102:15569–155742005).
  • CD86 is expressed constitutively on antigen presenting cells (APCs) and is rapidly upregulated by innate stimuli of APCs (Id., citing Lenschow, DJ et al., J Immunol.
  • CD80 CD28 ligand
  • CD80 CD80
  • CD86 may therefore be more important in the initiation of immune responses.
  • CD80 and CD86 are induced by different stimuli in different cell types and they are not interchangeable in function.
  • CD28 and CTLA4 have opposing effects on T cell stimulation.
  • CD28 provides an activating signal and CTLA4 provides an inhibitory signal, which is now considered a prototypical immune checkpoint (Id., citing Krummel, MF and Allison, JP, J Exp Med.
  • ICOS which also contributes to activation, binds to its ligand B7H2 (ICOSL), which also serves as a ligand for human CD28 and CTLA4 (Id., citing Chen, L. and Flies, DB, Nat Rev Immunol. (2013) 13:227–242; Yao, S. et al., Immunity (2011) 34:729–740).
  • ICOSL ligand B7H2
  • CD80 and CD86 may also act as signal transducing receptors themselves, since ligation with CTLA4Ig has been shown to regulate tryptophan metabolism in APCs (Id., citing Grohmann, U et al., Nat Immunol. (2002) 3:1097–1101).
  • plasma cells also express CD28.
  • CD28 signals may regulate antibody production by plasma cells or plasma cell survival although the precise role that CD28 plays in plasma cell biology is still unclear (Id., citing Njau, NM and Jacob, J., Adv Exp Med Biol. (2013) 785:67–75).
  • the CD28 gene is composed of four exons encoding a protein of 220 amino acids that is expressed on the cell surface as a glycosylated, disulfide-linked homodimer of 44 kDa.
  • Members of the CD28 family share a number of common features.
  • These receptors consist of paired V-set immunoglobulin superfamily (IgSF) domains attached to single transmembrane domains and cytoplasmic domains that contain critical signaling motifs (Id., citing Carreno, BM and Collins, M, Annu Rev Immunol. (2002) 20: 29–53).
  • the CD28 and CTLA4 ligands, CD80 and CD86 consist of single V-set and C1-set IgSF domains. The interaction of these costimulatory receptors with ligand is mediated through the MYPPPY motif (SEQ ID NO: 105) within the receptor V-set domains (Id., citing Evans, EJ et al., Nat Immunol.
  • CD28 engagement by its ligand initiates signal transduction events that are dependent on specific associations of proteins with the cytoplasmic tail of CD28.
  • the 41 amino acid cytoplasmic tail of human CD28 contains highly conserved tyrosine-based signaling motifs that are phosphorylated in response to TCR or CD28 stimulation, and bind targets with SH2 domains in a phosphotyrosine-dependent manner.
  • Proline rich sequences within the cytoplasmic tail also bind SH3-domain containing proteins.
  • the membrane proximal YMNM motif (SEQ ID NO: 106), and the distal PYAP motif (SEQ ID NO: 107) have been shown to complex with several kinases and adaptor proteins, with some proteins being able to bind to either or both motifs via SH2 and/or SH3 domain interactions (Id., citing Boomer, JS and Green, JM, Cold Spring Harb Perspect Biol. (2010) 2: a002436). These motifs are important for IL-2 gene expression, which is mediated by the CD28-dependent activation of NFAT, AP-1, and NF- ⁇ B family transcription factors (Id., citing Fraser, JD et al., Science.
  • the membrane-proximal YXXM motif is shared between CD28, CTLA4, and ICOS, and is a consensus site for the p85 subunit of the lipid kinase phosphatidylinositol 3-kinase (PI3K) (Id., citing August, A. and Dupont, B. Int Immunol. (1994) 6:769–774; Pages, F., et al., Nature.
  • the adaptor proteins, GRB2 and GADS can bind to CD28 either through their SH3 domains at the distal PYAP motif (SEQ ID NO: 107) or via their SH2 domains to the membrane proximal YMNM motif (SEQ ID NO: 106).
  • CD28 serves both pro- and anti-inflammatory roles depending on the cell type and context in which it is expressed.
  • CD28 signals are critical for allowing effector T cells to overcome Treg cell-mediated suppression to immunization (Id., citing Lyddane, C et al., J Immunol. (2006) 176: 3306–3310), but CD28 in another context prevents spontaneous autoimmunity by promoting Treg function (Id., citing Salomon B. et al., Immunity.2000;12:431–440).
  • CD28 supports T cell homeostasis and function in a variety of ways.
  • CD28 signals support the expression of miR17–92 family members, which are critical for maximal IL-10 production by Treg cells (de Kouchkovsky, D et al., J Immunol. (2013) 191: 1594–1605). Thymocytes require simultaneous TCR and CD28 signals to upregulate Foxp3 and differentiate into Treg cells. CD28 is also necessary for the production of peripheral induced Treg cells. CD4+CD25 ⁇ T cells required CD28 ligation to differentiate into functional Foxp3+ Treg cells when activated with TGF- ⁇ . [00497] According to some embodiments of the disclosed invention, the ENLSTTM cells may be engineered to express a membrane bound form of CD80 on the membrane of the ENLSTTM of SEQ ID NO: 110.
  • the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 60% to the protein of SEQ ID NO: 110. According to some embodiments, the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 70% to the protein of SEQ ID NO: 110. According to some embodiments, the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 80% to the protein of SEQ ID NO: 110. According to some embodiments, the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 90% to the protein of SEQ ID NO: 110.
  • the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 95% to the protein of SEQ ID NO: 110. According to some embodiments, the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 96% to the protein of SEQ ID NO: 110. According to some embodiments, the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 97% to the protein of SEQ ID NO: 110. According to some embodiments, the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 98% to the protein of SEQ ID NO:110.
  • the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 99% to the protein of SEQ ID NO: 110.
  • the ENLSTTM cells may be engineered to express a membrane bound form of CD86 on the membrane of the ENLSTTM of SEQ ID NO: 111.
  • the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 60% to the protein of SEQ ID NO: 111.
  • the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 70% to the protein of SEQ ID NO: 111.
  • the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 80% to the protein of SEQ ID NO: 111. According to some embodiments, the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 90% to the protein of SEQ ID NO: 111. According to some embodiments, the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 95% to the protein of SEQ ID NO: 111. According to some embodiments, the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 96% to the protein of SEQ ID NO: 111.
  • the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 97% to the protein of SEQ ID NO: 111. According to some embodiments, the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 98% to the protein of SEQ ID NO:111. According to some embodiments, the ENLSTTM tumor cell line or tumor cell line variant may comprise one or more proteins with a sequence identity of at least 99% to the protein of SEQ ID NO: 111.
  • step (c) contacting the population of MNCs of step 1(i) with the ENLSTTM cells of step 1(ii) in vitro to induce an immune response comprising an activated population of MNCs (in vitro immune activation); [00499]
  • the contacting of the ENLSTTM cells population and the MNC population is effective to induce an immune response comprising an activated population of MNCs comprising one or more serial killer cell subpopulations.
  • the one or more serial killer cell subpopulations include, without limitation, one or more of an NK cell subpopulation, an NKT subpopulation, a CIK subpopulation, a GDT subpopulation, a MAIT cell subpopulation, a CD8+ CTL cell population, or a CD4+ CTL cell subpopulation.
  • the activated serial killer cell population comprises an activated NK cell population.
  • the activated serial killer cell population comprises an activated NKT population.
  • the activated serial killer cell population comprises an activated NK cell population.
  • the activated serial killer cell population comprises an activated CIK population.
  • the activated serial killer cell population comprises an activated GDT population.
  • the activated serial killer cell population comprises an activated MAIT cell population.
  • the activated serial killer cell population comprises an activated, CD8+ CTL population.
  • the activated serial killer cell population comprises an activated, CD4+ CTL population.
  • the NK cell subpopulation comprises cytotoxic effector-like NK cells.
  • the NKT cell subpopulation comprisescytotoxic effector Teff cells.
  • the CIK cell population comprises cytotoxic Teff cells.
  • the GDT cell population comprises cytotoxic effector T eff cells.
  • the MAIT cell population comprises cytotoxic Teff cells.
  • the CD8+ CTL cell subpopulation comprises cytotoxic Teff cells.
  • the CD4+ CTL cell subpopulation comprisescytotoxic T eff cells.
  • the term “stimulate” with reference to the MNC population” refers to one or more of expansion of the activated MNC population, ” activation of one or more subpopulations of the activated MNC population, or an increase in cytoxic activity of one or more subpopulations of the active MNC population.
  • “stimulating the serial killer cell” refers to a combination of expansion, activation and/or increased cytoxic activity of one or more subpopulations of the activated MNC population.
  • the activated MNCs comprise one or more activated serial killer cell population(s).
  • the activated serial killer cell population(s) may comprise one or more of an activated NK cell population, an activated NKT population, an activated CIK population; an activated GDT population; an activated MAIT cell population; an activated, CD8+ CTL population; and an activated CD4+ CTL population.
  • the population of ENLSTTM cells is effective to activate subpopulations of the population of MNCs in a mixed lymphocyte tumor cell reaction (MLTR).
  • the exemplary method for activating the MNC population comprises incubating the MNC population comprising contacting the population of MNCs with the ENLSTTM cells population in vitro for several days to allow the ENLSTTM cells to elicit an immune response from the mixed lymphocytes.
  • the immune response against the allogeneic ENLSTTM cells comprises a heteroclitic cross reaction between a peptide native to the ENLSTTMtumor cell line or tumor cell line variant and a peptide native to the tumor cells of a patient.
  • the heteroclitic cross-reaction enhances immunogenicity via enhanced binding of a T cell receptor with a tumor cell peptide-MHC complex that normally provides a non-immunogenic surface.
  • Mixed lymphocyte tumor cell reactivity may be assessed for their immunogenic potential by a mixed lymphocyte tumor cell reaction (MLTR).
  • the MLTR assay comprises incubating mixed lymphocytes with tumor cell line or tumor cell line variants (or controls) for several days to allow the tumor cells of the ENLSTTM cells populationENLSTTM cells population(s) to elicit an immune response from the mixed lymphocytes in vitro.
  • This method is a rapid in vitro method to assess mixed lymphocyte responses (such as cellular proliferation of lymphocytes, cellular subset differentiation of lymphocytes, cytokine release profile of lymphocytes, and tumor cell death) to tumor cells or lysates.
  • This approach can enable comprehensive monitoring of cellular, humoral, or both, immunity responses to phenotypically modified transfected tumor cells using human peripheral blood mononuclear cells.
  • the MLTR also can provide an alternative to murine tumor survival studies, and can result in selection of optimal tumor cell line or tumor cell line variants for anti-tumor response.
  • a similar assay has been described by Hunter TB et al., (2007) Scandanavian J. Immunology 65, 479-486, which is incorporated herein by reference in its entirety.
  • the ENLSTTM cells population of tumor cell line or tumor cell line variants may be tested for immunogenic potential by contacting transfected tumor cells with mixed lymphocytes from MNCs, for example, peripheral blood mononuclear cells, followed by measuring cellular proliferation, cellular subset differentiation, cytokine release profile, and tumor cell lysate.
  • the MNCs containing mixed lymphocyte populations can be co-cultured with the genetically engineered ENLSTTM cells for up to 28 days.
  • An exemplary protocol for co-culture of the MNC population and the genetically engineered ENLSTTM cell population comprises combining the MNCs with ENLSTTM cells in Lonza’s X-Vivo medium + antibiotics+glutaMax (Thermo Fisher Scientific) in a Thermo Fisher Scientific T flask of defined geometry (volume, surface area, and cell number) until cell concentration reaches 100-300 million cells/liter.
  • nicotinamide 5 mM may be added to the culture medium.
  • the co-culturing of the MNC populations with the genetically engineered ENLSTTM cells is effective to activate one or more serial killer cell populations.
  • the serial killer cell populations comprise one or more of an NK cell population, an NKT cell opulation, a CIK cell poulation, a GDT cell population, a MAIT cell population, a CD8+ CTL cell population, or a CD4+ CTL cell population.
  • the co-culturing of the MNC population with the genetically engineered ENLSTTM cells is effective to activate one or more populations of antigen presenting cells.
  • the antigen presenting cell population comprises a macrophage cell population, a dendritic cell population, or both.
  • the serial killer activity of the activated serial killer cell populations is specific to cancer cancer antigens of the genetically engineered ENLSTTM cells, without affecting normal cells.
  • the serial killer activity of the serial killer cell population(s) is cancer-generalized, i.e., the serial killer cell population may kill cancer cells regardless of the cancer type, and yet not affect normal cells.
  • subpopulations of the activated MNCs effective to kill tumor cells may be identified, isolated/sorted, e.g., by flow cytometry, and then each subpopulation expanded to form an expanded, enriched isolated subpopulations of serial killer cells.
  • Flow cytometry is a technique for counting, examining, and sorting microscopic particles suspended in a stream of fluid. It allows simultaneous multi- parametric analysis of the physical and/or chemical characteristics of single cells flowing through an optical and/or electronic detection apparatus.
  • Flow cytometry utilizes a beam of light (usually laser light) of a single wavelength that is directed onto a hydro-dynamically focused stream of fluid.
  • a number of detectors are aimed at the point where the stream passes through the light beam; one in line with the light beam (Forward Scatter or FSC) and several perpendicular to it (Side Scatter (SSC) and one or more fluorescent detectors).
  • FSC Forward Scatter
  • SSC Segmented Scatter
  • Each suspended particle passing through the beam scatters the light in some way, and fluorescent chemicals found in the particle or attached to the particle may be excited into emitting light at a lower frequency than the light source.
  • This combination of scattered and fluorescent light is picked up by the detectors, and by analyzing fluctuations in brightness at each detector (usually one for each fluorescent emission peak) it then is possible to derive various types of information about the physical and chemical structure of each individual particle.
  • FSC correlates with the cell volume and SSC depends on the inner complexity of the particle (i.e.
  • FACS Fluorescence-activated cell sorting
  • a cell suspension is entrained in the center of a narrow, rapidly flowing stream of liquid. The flow is arranged so that there is a large separation between cells relative to their diameter. A vibrating mechanism causes the stream of cells to break into individual droplets. The system is adjusted so that there is a low probability of more than one cell being in a droplet.
  • the flow passes through a fluorescence measuring station where the fluorescent character of interest of each cell is measured.
  • An electrical charging ring or plane is placed just at the point where the stream breaks into droplets.
  • a charge is placed on the ring based on the prior light scatter and fluorescence intensity measurements, and the opposite charge is trapped on the droplet as it breaks from the stream.
  • the charged droplets then fall through an electrostatic deflection system that diverts droplets into containers based upon their charge. In some systems the charge is applied directly to the stream while a nearby plane or ring is held at ground potential and the droplet breaking off retains charge of the same sign as the stream. The stream then is returned to neutral after the droplet breaks off.
  • Mass cytometry or CyTOF (Fluidigm) is a variation of flow cytometry in which antibodies are labeled with heavy metal ion tags rather than fluorochromes. Readout is by time-of-flight mass spectrometry. viSNE plots individual cells in a visual similar to a scatter plot, while using all pairwise distances in high dimension to determine each cell's location in the plot [00515] According to some embodiments, activated NK and non-NK cells can be sorted and isolated based on expression of the markers CD56, CD3, CD8, and CD4.
  • exemplary phenotypes of the activated MNC cell populations can include: CD4+, CD8+, CD56+CD3+, CD56+CD3-, TCR ⁇ +, and TCRV ⁇ 7.2+.
  • the activated serial killer cells in the activated mixed mononuclear cell population can be identified by one or more of cellular proliferation of the activated lymphocytes, cellular subset differentiation of the activated lymphocytes, cytokine release profile of the lymphocytes, and tumor cell death. Cytotoxicity markers [00517]
  • the MNC population and ENLSTpopulation are cocultured for up to 28 days.
  • NK cells are their intrinsic ability to conduct “natural killing” of cellular targets without prior sensitization.
  • the ENLSTTM cells populationENLSTTM cells population(s) described herein are effective to activate and expand NK cells, such that the NK cells that are activated and expanded exhibit higher degranulation activity compared to control NK cells.
  • cytotoxic degranulation activity can be estimated by determining expression of a cell marker that correlates with degranulation activity.
  • CD107a expression correlates closely with degranulation and release of cytotoxic granules.
  • CD107a expression can be measured, for example, by flow cytometry.
  • flow cytometry See, e.g., BD FastImmuneTM CD107a (H4A3, Becton Dickinson & Co.; Alter G, Malenfant J M, Altfeld M. CD107a as a functional marker for the identification of natural killer cell activity. J Immunol Methods. (2004) 294: 15-22, the entire contents of which are incorporated herein by reference).
  • the expanded and activated NK cells obtained by contact with the ENLSTTM cells populationENLSTTM cells population(s) of the described invention, comprise at least about 50%, about 60%, about 70%, about 80% or about 90% increased cytotoxicity, e.g. as measured by degranulation activity, compared to non expanded NK cells.
  • the expanded and activated NK cells comprise at least about 100% increased cytotoxicity compared to non expanded NK cells.
  • the expanded and activated NK cells comprise at least about 200% increased cytotoxicity compared to non expanded NK cells.
  • the expanded and activated NK cells comprise at least about 300% increased cytotoxicity compared to non-ex vivo expanded NK cells. According to some embodiments, the expanded and activated NK cells comprise at least about 400% increased cytotoxicity compared to non-ex vivo expanded NK cells. [00520] According to some embodiments the expanded and activated NK cells, following contact with the ENLSTTM cells populationENLSTTM cells population(s) of the described invention, comprise at least about 50%, about 60%, about 70%, about 80% or about 90% increased degranulation activity compared to non expanded NK cells. According to some embodiments the expanded and activated NK cells comprise at least about 100% increased degranulation activity compared to non expanded NK cells.
  • the expanded and activated NK cells comprise at least about 200% increased degranulation activity compared to non expanded NK cells. According to some embodiments, the expanded and activated NK cells comprise at least about 300% increased degranulation activity compared to non-ex vivo expanded NK cells. According to some embodiments, the expanded and activated NK cells comprise at least about 400% increased degranulation activity compared to non-ex vivo expanded NK cells.
  • Tumor cell toxicity [00521] According to some embodiments, tumor cell toxicity can be used to measure immune activation of MNCs comprising mixed lymphocytes comprising activated serial killer cells.
  • a lactic dehydrogenase (LDH)-cytotoxicity colorimetric assay kit (BioVision Cat. # K311-400) can be used to measure tumor cell cytotoxicity.
  • LDH a soluble cytosolic enzyme present in most eukaryotic cells, is released into culture medium upon cell death due to damage of the plasma membrane. The increase of LDH activity in the culture supernatant is proportional to the number of lysed cells. Briefly, 100 ⁇ l of media from each of the control group (comprising untransfected MSCs), the experimental group (comprising immune modulator transfected MSCs), and media alone is pipetted into the wells of a 96 well plate.
  • serial killer cell types can be identified by their phenotypic markers.
  • Exemplary phenotypic markers of NKs, LAKs, CIKs, NKTs, GDTs, MAIT cells, CD8+ CTLs, and CD4+ CDLs are shown in Table 8. [00523] Table 8. Phenotypic Markers
  • human NK cells are phenotypically characterized by the expression of CD56 and the absence of CD3 and can be further subdivided into a CD56 bright population and a CD56 dim population.
  • the CD56 bright population produces immunoregulatory cytokines, including interferon- ⁇ (IFN ⁇ ), tumor necrosis factor-beta (TNF-B), tumor necrosis factor- ⁇ (TNF- ⁇ ), granulocyte macrophage-colony stimulating factor (GMCSF), IL-10, and IL-13 (4).
  • the CD56 dim subset is the terminally differentiated successor of the CD56 bright population and is primarily responsible for exerting cytolytic functions.
  • CD56 dim NK cells can produce cytokines, specifically IFN ⁇ , after cell triggering via NKp46 of NKp30 activating receptors or after stimulation with combinations of IL-2, IL-12, and IL-15.
  • various markers of NK cell maturation and/or activation can be detected using, e.g. flow cytometric methods.
  • a classical marker of NK cells is the activating receptor Fc ⁇ RIII, also called CD16.
  • Fc ⁇ RIII also called CD16.
  • the expression at the cell surface of death-inducing ligands belonging to the tumor necrosis factor (TNF) family such as Fas ligand (FasL) and TNF-related apoptosis- inducing ligand (TRAIL)
  • Fas ligand Fas ligand
  • TRAIL TNF-related apoptosis- inducing ligand
  • DRs death receptors
  • Fas Fas
  • DR4 TRAIL-RI
  • DR5 TRAIL- RII
  • the induction of an immune response by the allogeneic ENLSTTM cells as described herein upregulates at least one NK cell activating receptor (e.g., an activating receptor listed in Table 3) by at least about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 150%, about 200%, about 300% or more.
  • NK cell activating receptor e.g., an activating receptor listed in Table 3
  • the induction of an immune response by the allogeneic ENLSTTM cells described herein upregulates at least one NK cell activating receptor by at least about 75%, i.e., at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 110%, at least about 120%, at least about 130%, at least about 140%, at least about 150%, at least about 160%, at least about 170%, at least about 180%, at least about 190%
  • the induction of an immune response by the allogeneic ENLSTTM cells described herein upregulate at least one NK cell activating receptor by at least about 100%. According to some embodiments, the induction of an immune response by the allogeneic ENLSTTM cells described herein upregulate at least one NK cell activating receptor by at least about 200%. [00528] According to another embodiment, the induction of an immune response by the allogeneic ENLSTTM cells as described herein downregulates expression of at least one NK cell receptor, such as an inhibitory receptor or a chemokine receptor (e.g. CCR7).
  • a chemokine receptor e.g. CCR7
  • KIRs Key Inhibitory Receptors
  • CD158 Non-limiting examples of inhibitory receptors are inhibitory killer immunoglobulin-like receptors (KIRs), GL183, KIR2DL 1, Lir-1, NKB1, and NKG2A.
  • the induction of an immune response by the allogeneic ENLSTTM cells as described herein downregulates at least one NK cell inhibitory receptor (e.g., an inhibitory receptor listed in Table 4) by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 110%, 120%, at least about 130%, about 140%, at least about 150%, at least about 160%, at least about 170%, at least about 180%, at least about 190%, at least about 200%, at least about 220%, at least about 230%, at least about 240%, at least about 250%, at least about 260%, at least about 270%, at least about 280%, at least about 290%, at least about 300% or more.
  • NK cell inhibitory receptor e.g., an inhibitory receptor listed in Table 4
  • the induction of an immune response by the allogeneic ENLSTTM cells described herein downregulates at least one NK cell inhibitory receptor by at least about 75%. According to some embodiments, the induction of an immune response by the allogeneic ENLSTTM cells described herein downregulates at least one NK cell inhibitory receptor by at least about 100%. According to some embodiments, the induction of an immune response by the allogeneic ENLSTTM cells described herein downregulates at least one NK cell inhibitory receptor by at least about 200%.
  • the change in receptor expression can be calculated by mean fluorescence intensity (MFI) ratios: MFI dayX /MFI day0 where x is the number of days of expansion of the NK cell.
  • MFI ratio When the MFI for day X samples is higher than for day 0, the MFI ratio will be higher than 1, which indicates the relative extent of upregulation in that receptor. Thus, an MFI ratio of e.g.1.5 would mean a 50% upregulation of a specific receptor. The calculation of MFI ratios is well known to persons skilled in the art. [00532] Exemplary NK cell activating or inhibitory receptors are shown below in Table 9.
  • Table 9 Abbreviations in Table 4: ACT, activation; BAT-3, HLA-B-associated transcript 3; H, human; HA, hemagglutinin; HLA, human leukocyte antigen; INHIB, inhibitory; KIR, killer immunoglobulin-like receptor; KLRG1, killer cell lectin-like receptor G1; LILR, leukocyte immunoglobulin-like receptor; M, mouse; MHC, major histocompatibility complex; MULT-1, mouse UL16-binding-like transcript-1; NCR, natural cytotoxicity receptor; NK, natural killer; PVR, polio virus receptor; RAE-1, retinoic acid early transcript-1. BOLD indicates family.
  • the human killer cell immunoglobulin-like receptors are a family of transmembrane glycoproteins expressed on NK cells and a subset of T cells. (Campbell, K.S. and Purdy, A.K., “Structure/function of human killer cell immunoglobulin-like receptors: lessons from polymorphisms, evolution, crystal structures and mutations,” Immunol. (2011) 132(3): 315-325).
  • the KIR are key regulators of the development, tolerance and activation of NK cells. Id.
  • MHC class I HLA-A, -B or -C
  • KIR gamma-A
  • NKG2A/CD94 ⁇ -I-binding inhibitory receptors
  • Id Tolerance of NK cells toward normal cells is achieved through their expression of MHC-I-binding inhibitory receptors, which include KIR, NKG2A/CD94 and CD85j (ILT2, LIR1).
  • KIR KIR
  • NKG2A/CD94 a class I MHC receptor related to KIRs
  • KIRs a class I MHC receptor related to KIRs
  • KIRs a class I MHC receptor related to KIRs
  • the inhibitory receptor LIR-1 uses a common binding interaction to recognize class I MHC molecues and the viral homolog UL18,” Immunity (1999) 11 (5): 603-13)
  • the KIR family is encoded by 14 highly polymorphic genes (2DL1 to 2DL5, 3DL1 to 3DL3, 2DS1 to 2DS5, and 3DS1], and distinct family members can transduce either activating or inhibitory signals (Campbell, K.S. and Purdy, A.K., “Structure/function of human killer cell immunoglobulin-like receptors: lessons from polymorphism,s evolution, crystal structures and mutations,” Immunol. (2011) 132(3): 315-325).
  • Nomenclature of KIR is based upon the number of C2-type immunoglobulin-like domains in the extracellular region (2D for two domains, 3D for three domains) and by the length of the cytoplasmic domain (L for long-tailed receptors and S for short ones) (Id. All inhibitory KIR have long cytoplasmic domains possessing immunoreceptor tyrosine-based inhibitory motifs (ITIMs; I/VxYxxL/V), which recruit protein tyrosine phosphatases that are critical for mediating inhibitory function. Id. In contrast, KIR with short cytoplasmic domains associate with a transmembrane signalling adaptor protein, DAP12 (also called KARAP). Id.
  • DAP12 also called KARAP
  • DAP12-dependent activation occurs through the recruitment of Syk/ZAP-70 tyrosine kinases by immunoreceptor tyrosine-based activation motifs [ITAM; Yxx(L/I/V)x6–8Yxx(L/I/V)]. Id.
  • ITAM immunoreceptor tyrosine-based activation motifs
  • KIR2DL4 is a unique long-tailed activating KIR.
  • 2DL4 is only expressed on CD56high NK cells, functions as a more potent activator of cytokine production rather than cytotoxicity, and associates with ITAM-containing Fc ⁇ RI- ⁇ adaptor instead of DAP12 Id.
  • KIR are expressed by 5–40% of CD8+ TILs, and contribute to the altered cytotoxic activity of tumor-reactive CTLs (See Gati, A. et al., CD158 Receptor Controls T- Lymphocyte Susceptibility to Tumor-mediated Activation-induced Cell Death by Interfering with Fas signaling,”Cancer Res. (2003) 63 (21): 7475-82).
  • KIR3DL1, originally named NKB1 is specific for HLABw4.
  • GL183 is a surface molecule cpable of mediating cell activation selectively expressed by a subset of human CD3-CD16+ NK cells. Moretta, A. et al., “A Novel surface antigen expressed by a subset of human CD3- CD16+ natural killer cells.
  • CD8+ T Cell Activation and Expansion [00535]
  • the induction of an immune response by the allogeneic ENLSTTM cells as described herein is effective to activate CD8+ T-cells.
  • the induction of an immune response by the allogeneic ENLSTTM cells is effective to expand CD8+ T-cells.
  • the induction of an immune response by the allogeneic ENLSTTM cells is effective to lead to activation and expansion of the population of CD8+ T cells, compared to a parental cell control.
  • T cell activation and expansion can be measured by various assays as described herein.
  • T cell activities that may be measured include the induction of proliferation of T cells, the induction of signaling in T cells, the induction of expression of activation markers in T cells, the induction of cytokine secretion by T cells, and the cytotoxic activity of T cells.
  • CD8+ T cell activation is measured by a proliferation assay.
  • Cytokine Secretion [00537]
  • the induction of an immune response comprising activation of CD8+ T-cells by the allogeneic ENLSTTM cells of the invention may be assessed or measured by determining secretion of cytokines, such as gamma interferon (IFN ⁇ ), tumor necrosis factor alpha (TNFa), interleukin-12 (IL-12) or interleukin 2 (IL-2).
  • cytokines such as gamma interferon (IFN ⁇ ), tumor necrosis factor alpha (TNFa), interleukin-12 (IL-12) or interleukin 2 (IL-2).
  • ELISA is used to determine cytokine secretion, for example secretion of gamma interferon (IFN ⁇ ), tumor necrosis factor alpha (TNFa), interleukin-12 (IL-12) or interleukin 2 (IL-2).
  • the ELISPOT (enzyme-linked immunospot) technique may be used to detect T cells that secrete a given cytokine (e.g., gamma interferon (IFN ⁇ )) in response to stimulation with the engineered ENLSTTM cells described herein.
  • T cells are cultured with engineered ENLSTTM cells in wells which have been coated with anti-IFN ⁇ antibodies.
  • the secreted IFN ⁇ is captured by the coated antibody and then revealed with a second antibody coupled to a chromogenic substrate.
  • locally secreted cytokine molecules form spots, with each spot corresponding to one IFN ⁇ -secreting cell. The number of spots allows one to determine the frequency of IFN ⁇ -secreting cells in the analyzed sample.
  • the ELISPOT assay has also been described for the detection of tumor necrosis factor alpha, interleukin-4 (IL-4), IL-5, IL-6, IL-10, IL-12, granulocyte- macrophage colony-stimulating factor , and granzyme B-secreting lymphocytes (Klinman D, Nutman T. Current protocols in immunology. New York, N.Y: John Wiley & Sons, Inc.; 1994. pp.6.19.1–6.19.8, incorporated by reference in its entirety herein).
  • Flow cytometric analyses of intracellular cytokines may be used to measure the cytokine content in culture supernatants, but provides no information on the number of T cells that actually secrete the cytokine.
  • T cells When T cells are treated with inhibitors of secretion such as monensin or brefeldin A, they accumulate cytokines within their cytoplasm upon activation (e.g. with engineered ENLSTTM cells of the present invention). After fixation and permeabilization of the lymphocytes, intracellular cytokines can be quantified by cytometry. This technique allows the determination of the cytokines produced, the type of cells that produce these cytokines, and the quantity of cytokine produced per cell. Cytotoxicity [00539] The activation of CD8+ T-cells by contact with ENLSTTM cells of the described invention may be assessed by assaying the cytotoxic activity of the CD8+ T- cells.
  • the cytotoxic activity of T cells may be assessed by any suitable technique known to those of skill in the art.
  • a sample comprising T cells that have been exposed to the ENLSTTM cells can be assayed for cytotoxic activity after an appropriate period of time, in a standard cytotoxicity assay, for example, Cr 51 release, or Almar BlueTM fluorescence (See for example, Wolint, Petra, et al. “Immediate Cytotoxicity but Not Degranulation Distinguishes Effector and Memory Subsets of CD8 T Cells.” J. Experimental Medicine, The Rockefeller University Press, (5 Apr.2004), www.ncbi.nlm.nih.gov/pmc/articles/PMC2211884/).
  • target cells ENLSTTM cells
  • MNCs are added in an appropriate medium.
  • the label is released from the target cells by cytolysis, and can be isolated by centrifuging the samples and collecting the supernatants.
  • Supernatants from centrifugation can either be counted directly in a gamma counter, or mixed with scintillation cocktail in a microplate (or dried on a LumaPlateTM) and counted in a liquid scintillation counter.
  • alamarBlue TM fluorescence viability assay For the alamarBlue TM fluorescence viability assay (Thermofisher), MNCs and ENLSTTM cells are added in appropriate medium to microplate wells. Either alarmaBlue HS or alarmaBlue reagent is added to the wells and incubated at 37° C for 1 to 4 hours. Fluorescence (560/590 nm) or absorbance (570) is read (the signal is stable for 7 hours). Upon entering living cells, resazurin is reduced to resorufin, a compound that is red in color and highly fluorescent. After viability determination, the diluted alamarBlue HS or alamarBlue reagent can be replaced with complete media and returned to the incubator. The cells will continue to proliferate normally.
  • Either alarmaBlue HS or alarmaBlue reagent is added to the wells and incubated at 37° C for 1 to 4 hours. Fluorescence (560/590 nm) or absorbance (570) is read (the
  • CFSE staining The ability of the ENLSTTM cells to stimulate expansion of T cell populations can be evaluated by using CFSE staining. To compare the initial rate of cell expansion, the cells are subject to CFSE staining to determine how well the ENLSTTM cells induced the proliferation of T cells. CFSE staining provides a much more quantitative endpoint and allows simultaneous phenotyping of the expanded cells. Every day after stimulation, an aliquot of cells is removed from each culture and analyzed by flow cytometry. CFSE staining makes cells highly fluorescent. Upon cell division, the fluorescence is halved and thus the more times a cell divides the less fluorescent it becomes.
  • the ability of the ENLSTTM cells to induce T cell proliferation is quantitated by measuring the number of cells that divided once, twice, three times and so on.
  • the ENLSTcellsTM population(s) that induce the greatest number of cell divisions at a particular time point is/are deemed the most potent expander.
  • cell growth curves can be generated. These experiments are set up as the foregoing CFSE experiments, but no CFSE is used. Every 2-3 days of culture, T cells are removed from the respective cultures and counted using a Coulter counter which measures how many cells are present and the mean volume of the cells. The mean cell volume is the best predictor of when to restimulate the cells.
  • T cells when T cells are properly stimulated they triple their cell volume. When this volume is reduced to more than about half of the initial blast, it may be necessary to restimulate the T cells to maintain a log linear expansion (Levine et al., 1996, Science 272:1939-1943; Levine et al., 1997, J. Immunol.159:5921-5930). The time it takes T cell populations to induce 20 population doublings is calculated. The relative differences of each ENLSTTM cell population to induce this level of T cell expansion is one criterion for assessing potency of the ENLSTTM cell population.
  • the phenotypes of the cells expanded by each ENLSTTM cell population can be characterized to determine whether a particular subset is preferentially expanded.
  • a phenotype analysis of the expanding T cell populations is performed to define the differentiation state of the expanded T cells using the CD27 and CD28 definitions proposed by Appay et al. (2002, Nature Med.8, 379- 385, incorporated by reference in its entirety herein) and CCR7 definitions proposed by Sallusto et al. (1999, Nature 401:708-712, incorporated by reference in its entirety herein).
  • Perforin and Granzyme B intracellular staining can be used to perform a gross measure to estimate cytolytic potential.
  • Apoptosis Markers [00546] According to certain embodiments of the present invention, stimulation, activation, and expansion of T cells following contact with the ENLSTTM cell population(s) as described herein enhances expression of certain key molecules in T cells that protect against apoptosis or otherwise prolong survival in vivo or in vitro. Apoptosis usually results from induction of a specific signal in the T cell.
  • the ENLSTTM cells of the invention may provide for protecting a T cell from cell death resulting from stimulation of the T cell.
  • T cell growth by protection from premature death or from absence or depletion of recognized T cell growth markers, such as Bcl-xL, growth factors, cytokines, or lymphokines normally necessary for T cell survival, as well as from Fas or Tumor Necrosis Factor Receptor (TNFR) cross-linking or by exposure to certain hormones or stress.
  • Immunosuppressive populations [00547] T regulatory cells (Tregs) are characterized by constitutive expression of high levels of the interleukin (IL)-2 receptor ⁇ chain (CD25). DeMatteis, S.
  • Tregs acquire the phenotype of effector T cells in chronic lymphocytic leukemia patients,” J. Translational Medicine (2016) 16: article 172).
  • the majority of CD4+CD25 high Tregs also express a forkhead family transcription factor (FoxP3) which is required for both their differentiation and their immunosuppressive function.
  • FoxP3 forkhead family transcription factor
  • the suppressive function of Tregs may be related to different factors, such as modulation of target cell signaling via cell–cell contact and/or secretion of immunosuppressive cytokines such as IL-10, IL-35 and transforming growth factor ⁇ (TGF- ⁇ ). Id.
  • FoxP3+ cells constitute less than 1% of the activated MNC population.
  • STEP 2 expanding the activated population of MNCs comprising subpopulations of activated serial killer cells in vitro to form a cell product comprising the activated population of MNCs comprising subpopulations of activated serial killer cells Proliferation/ Expansion [00549]
  • the activated MNC population comprising activated subpopulations of serial killer cells can be expanded in vitro in Lonza’s X-Vivo basal medium plus antibiotics plus GlutaMax (Thermo Fisher Scientific) in a Thermo- Fisher T flask of defined geometry (volume, surface area, and cell number),.
  • nicotinamide 5 mM may be added to the medium.
  • 2.5% by volume human plasma autologous to the mononuclear cells may be added to the medium.
  • one or more cytokines may be added to the medium.
  • the cytokine is one or more selected from IL2, IL7, and IL15.
  • the conditions of expansion are effective to bosst cell number at least two-fold.
  • the expansion results in formation of a cell product comprising either the activated MNC population comprising the activated subpopulations of serial killer cells, or a cell product comprising one or more of the isolated, expanded and enriched populations of serial killer cells.
  • Expansion of the activated MNC population comprising activated subpopulations of serial killer cells can be evaluated by cytofluorimetric techniques, for example by the use of 5- (and 6-) carboxy fluorescein diacetatesuccinimidyl ester (CFSE) staining.
  • CFSE carboxy fluorescein diacetatesuccinimidyl ester
  • CFSE staining provides a quantitative endpoint and allows simultaneous phenotyping of the expanded cells because CFSE staining makes cells highly fluroescent. Every day after stimulation, an aliquot of cells is removed from each culture and analyzed by flow cytometry. Upon cell division, the fluorescence is halved and thus the more times a cell divides the less fluorescent it becomes. [00551] The ability of the ENLSTTM cells to induce MNC proliferation is quantified by measuring the number of cells that divided once, twice, three times and so on. [00552] According to some embodiments, cell growth curves can be generated. These experiments are set up like the foregoing CFSE experiments, but no CFSE is used.
  • MNCs comprising serial killer cells are removed from the respective cultures and counted using a Coulter counter which measures how many cells are present and the mean volume of the cells.
  • the mean cell volume is the best predicator of when to restimulate the cells. In general, when serial killer cells are properly stimulated they triple their cell volume. When this volume is reduced to more than about half of the initial blast, it may be necessary to restimulate the MNCs comprising the serial killer cells to maintain a log linear expansion (Levine et al., 1996, Science 272:1939-1943; Levine et al., 1997, J. Immunol.159:5921-5930). The time it takes each engineered cell to induce 20 population doublings is calculated.
  • each allogeneic primary tumor cell lline transfected or transduced with recombinant DNA sequences encoding at least 4 immunomodulator peptides is one criteria on which a particular allogeneic primary tumor cell lline transfected or transduced with recombinant DNA sequences encoding at least 4 immunomodulator peptides is assessed.
  • proliferation can be detected by 3 H- thymidine incorporation. Cells can then be harvested onto filter mats, and 3 H-thymidine incorporation can be measured using a scintillation counter.
  • proliferation of MNCs comprising one or more serial killer cell population(s) with tumor cell line variants compared to non-transfected tumor cell controls can be measured.
  • the proliferation of the expanded activated MNC population comprising activated subpopulations of serial killer cells can be characterized by flow cytometry analysis.
  • STEP 3 preparing a unit dose package comprising an individual dose of the cell product; freezing the unit packages containing the cell product at -86°C, and cryostoring the frozen unit dose packages in cryostorage, e.g., a vapor phase of a liquid nitrogen freezer;
  • the cell product comprising the expanded activated MNC population comprising subpopulations of activated serial killer cells is centrifuged through Ficoll-Paque®, and resuspended in a pharmaceutical composition comprising X-Vivo basal media plus a cryoprotectant fluid.
  • recombinant human albumin may be added.
  • cryoprotectants are chemicals that protect the cells during freezing and therefore minimize the detrimental effects of increased solute concentration and ice crystal formation.
  • the most commonly used cryoprotective agents are dimethylsulfoxide (DMSO) and glycerol, which generally are used in concentrations ranging from 5-10% (v/v).
  • DMSO dimethylsulfoxide
  • glycerol glycerol
  • Other cryoprotectants that have been used include polyethylene glycol, propylene glycol, glycerin, polyvinylpyrrolidone, sorbital, dextran and trehalose.
  • Cryoprotective agents serve several functions during the freezing process.
  • Freezing point depression is observed when DMSO is used which serves to encourage greater dehydration of the cells prior to intracellular freezing. Cryoprotective agents also seem to be most effective when they can penetrate the cell, delay intracellular freezing, and minimize the solution effects.
  • the choice of a cryoprotective agent is dependent upon the type of cell to be preserved. When preparing mammalian cells for cryopreservation, for example, cell populations need to be adjusted to levels that ensure adequate recovery. For most mammalian cells, a starting population between 10 6 to 10 7 cells/mL is optimum.
  • the cell suspension initially can be prepared at a concentration twice that desired for preservation so that an equal volume of cryoprotectant (2 x cryoprotective agent + medium) can be added.
  • the cell pellet can be resuspended in the cryoprotectant (1 x cryoprotective agent + medium) to the desired cell concentration.
  • the next step is to cool the suspension.
  • the rate of cooling affects the rate of formation and size of ice crystals, as well as the solution effects that occur during freezing. Different types of cells may require different cooling rates, however a uniform cooling rate of 1°C per minute from ambient temperature is effective for a wide variety of cells and organisms.
  • a programmable-rate cell freezing apparatus may be used to achieve uniform, controlled cooling rates.
  • the activated and expanded MNC population comprising activated and expanded serial killer cells can be frozen and thawed multiple times without loss of effector function due to prolonged stimulation (T cell exhaustion).
  • at least some of the activated and expanded serial killer cell subpopulations, once rested, may be reactivated.
  • the pharmaceutical compositions according to the described invention may further include one or more compatible active ingredients, which are aimed at proving the composition with another pharmaceutical effect in addition to that provided by the cell product.
  • “Compatible” as used herein means that the active ingredients of such a composition are capable of being combined with each other in such a manner so that there is no interaction that would substantially reduce the efficacy of each active ingredient or the composition under ordinary use conditions.
  • STEP 4 thawing a therapeutic amount of the frozen unit dose packages comprising the cell product under controlled conditions; and optionally combining the frozen and thawed cell product of Step 4 with a pharmaceutically acceptable carrier component to form a pharmaceutical composition; and [00563]
  • the frozen unit dose packages are removed from the liquid nitrogen freezer, they are thawed under controlled conditions, i.e., the termperature is changed slowly to preserve the health of the cells.
  • the cell product contents of the unit dose package may be immediately transferred to fresh X-Vivo medium following thawing to minimize exposure to the cryoprotective agent.
  • the cell product may be centrifuged at 100 x g for 10 minutes after initial dilution, the supernatant removed, and the cells resuspended into fresh X-Vivo growth media.
  • cell recovery is determined by estimating the number of viable cells.
  • an exemplary regimen for treating the patent with cancer not currently under the influence of an immunosuppressive regimen comprises administering parenterally on one or more dates during the lifetime of the subject a therapeutic amount of the cell product comprising the expanded ENLSTTM cell activated MNC population comprising activated and expanded subpopulations of serial killer cells.
  • parenteral refers to introduction into the body by way of an injection (i.e., administration by injection), including, for example, subcutaneously (i.e., an injection beneath the skin), intramuscularly (i.e., an injection into a muscle); intravenously (i.e., an injection into a vein), intrathecally (i.e., an injection into the space around the spinal cord or under the arachnoid membrane of the brain), or infusion techniques.
  • the composition is administered multiple times, or as needed in the judgment of the treating physician.
  • the composition is administered at the first infusion date, and optionally at a second infusion date, a third infusion date, a fourth infusion date, a fifth infusion date, a sixth infusion date, a seventh infusion date, an eighth infusion date, a ninth infusion date, a tenth infusion date, and so on.
  • the first infusion date is at least about one day, at least about two days, at least about three days, at least about four days, at least about five days, at least about six days, at least about 7 days, at least about 8 days, at least about 9 days, at least about 10 days, at least about 11 days, at least about 12 days, at least about 13 days, at least about 14 days, at least about 15 days, at least about 16 days, at least about 17 days, at least about 18 days, at least about 19 days, at least about 20 days, at least about 21 days, at least about 22 days, at least about 23 days, at least about 24 days, at least about 25 days, at least about 26 days, at least about 27 days, at least about 28 days, at least about 29 days, at least about 30 days or more after diagnosis.
  • the second infusion date is at least about one day, at least about two days, at least about three days, at least about four days, at least about five days, at least about six days, at least about 7 days, at least about 8 days, at least about 9 days, at least about 10 days, at least about 11 days, at least about 12 days, at least about 13 days, at least about 14 days, at least about 15 days, at least about 16 days, at least about 17 days, at least about 18 days, at least about 19 days, at least about 20 days, at least about 21 days, at least about 22 days, at least about 23 days, at least about 24 days, at least about 25 days, at least about 26 days, at least about 27 days, at least about 28 days, at least about 29 days, at least about 30 days or more after the first infusion date.
  • the third infusion date is at least about one day, at least about two days, at least about three days, at least about four days, at least about five days, at least about six days, at least about 7 days, at least about 8 days, at least about 9 days, at least about 10 days, at least about 11 days, at least about 12 days, at least about 13 days, at least about 14 days, at least about 15 days, at least about 16 days, at least about 17 days, at least about 18 days, at least about 19 days, at least about 20 days, at least about 21 days, at least about 22 days, at least about 23 days, at least about 24 days, at least about 25 days, at least about 26 days, at least about 27 days, at least about 28 days, at least about 29 days, at least about 30 days or more after the second infusion.
  • the viability and potential efficacy of the cell product of the described invention depends on the expanded activated MNC population comprising activated subpopulations of serial killer cells maintaining their potency as they pass through a catheter.
  • the catheter used in the methods of the described invention has an internal diameter of at least 0.3175 cm Any type of catheter having an internal diameter of at least 0.3175 cm may be effective in delivering the pharmaceutical compositions of the described invention.
  • a flow control catheter which slows drainage of blood through the vasculature, allows the activated cells time to transit through the blood vessel wall and into tissue.
  • the catheter is a balloon catheter.
  • a catheter is used to directly inject the pharmaceutical composition into contact with a tumor.
  • the cell product compositions of the described invention may be administered in conjunction with a compatible inhibitor of immune checkpoints.
  • Exemplary compatible immune checkpoints include PD-1, PD-L1, TIM-3, TIGIT, and LAG-3. According to some embodiments, inhibitors of these immune checkpoints may be effective to control immune excape tumor cells. [00573] According to some embodiments, the administering of the therapeutic amount of the cell product, or pharmaceutical composition is effective to reduce tumor burden. [00574] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the invention.
  • the membrane is then incubated with a 1:500 dilution of primary antibody in 5% non-fat dry milk in TBST blocking buffer, followed by three washes in 20 Mn Tris, Ph 7.5; 150 mM NaCl, 0.1% Tween 20 (TBST) for 5 minutes.
  • the membrane is then incubated with conjugated secondary antibody at a 1:2000 dilution in 5% non-fat dry milk in TBST blocking buffer for 1 hour at room temperature, followed by three washes in TBST for 5 minutes each. Images of the blot are obtained using dark room development techniques for chemiluminesence detection, or using image scanning techniques for colorimetric or fluorescent detection.
  • Real-time PCR techniques may be performed as described to analyze expression level of mRNAs (Zhao Y. et al., Biochemical and Biophysical Research Communications 360 (2007) 205-211). Briefly, total RNA is extracted from cells using the Quiagen kit (Valencia CA), followed by first strand cDNA synthesis using random hexamer primers (Fermentas, Hanover MD). Real-time PCR is performed on each sample using the Mx3000p Quantitative PCR system (Stratagene, La Jolla, CA), for 40 cycles using validated gene specific RT-PCR primer sets for each gene of interest. Relative expression level of each transcript is corrected for that of the house keeping gene beta- actin as an internal control.
  • Flow Cytometry analysis may be performed as described (Zhao Y. et al., Exp. Cell Res., 312, 2454 (2006)). Briefly, tumor cell line variant cells that are either treated with trypsin/EDTA or left untreated are collected by centrifugation and re-suspended in PBS. The cells are fixed in 4% formaldehyde for 10 minutes at 37o C. For extracellular staining with antibodies, cells are not permeabilized.
  • cells are permeabilized by adding ice-cold 100% methanol to pre-chilled cells to a final concentration of 90% methanol and incubated on ice for 30 minutes.
  • Cells are immunostained by first resuspending cells in incubation buffer and adding dilutions of primary antibody. Cells are incubated with primary antibody for 1 hour at room temperature, followed by three washes with incubation buffer. Cells are then resuspended in incubation buffer with dilutions of conjugated secondary antibody for 30 minutes at room temperature, followed by three washes in incubation buffer. Stained cells are then analyzed by flow cytometry.
  • Enzyme-linked immunosorbent assay [00584] Briefly, a capture antibody, specific for a protein of interest, is coated onto the wells of a microplate. Samples, including a standard containing protein of interest, control specimens, and unknowns, are pipetted into wells of the microplate, where the protein antigen binds to the capture antibody. After washing 4 times, a detection antibody is added to the wells for one hour, binding to the immobilized protein captured during the first incubation. After removal of excess detection antibody and washing 4 times, a horse radish peroxidase (HRP) conjugate (secondary antibody or streptavidin) is added for 30 minutes to bind to the detection antibody.
  • HRP horse radish peroxidase
  • MLTR Human Mixed Lymphocyte Tumor Reaction
  • the MLTR measures proliferation and differentiation by flow cytometry and mass cytometry (CyTOF), by cytotoxicity, measured by lactate dehydrogenase (LDH) release assay, and by cytokine profile.
  • CyTOF flow cytometry and mass cytometry
  • LDH lactate dehydrogenase
  • allogeneic cell pools expressing a single immunomodulatory protein are used in the MLTR.
  • allogenic cell pools expressing one or more, two or more, three or more, four or more or five or more immunomodulatory proteins are used in the MLTR.
  • the basic MLTR one day procedure is carried out as follows: [00587] A vial of PBMC (20 MN cells) is thawed. Cells are then washed in dPBS.
  • PMBC cells are resuspended at 2.5 x 10 6 cell per ml in X-VIVO ( ⁇ 8 ml). The cells are characterized by flow cytometry to document the nature of the cell population.
  • Use in the MLTR is carried out as follows: 2.5 x 10 5 cell PBMC (100 ⁇ l of stock) 0.5 x 10 5 allogeneic cells (100 ⁇ l of stock), when used 0.5 x 10 5 allogeneic cell (100 ⁇ l of stock). These cells will be inactivated with Mitomycin C.
  • Luminex Multiplex Assay [00591]
  • the Luminex xMAP technology (formerly LabMAP, FlowMetrix) uses digital signal processing capable of classifying polystyrene beads (microspheres) dyed with distinct proportions of red and near-infrared fluorophores. These proportions define ‘spectral addresses’ for each bead population. As a result, up to one hundred different detection reactions can be carried out simultaneously on the various bead populations in very small sample volumes (Earley et al. Report from a Workshop on Multianalyte Microsphere Arrays. Cytometry 2002;50:239–242; Oliver et al.
  • Luminex Multiplex Assay is commercially available and is described on the world wide web at thermofisher.com/us/en/home/life-science/protein-biology/protein- assays-analysis/luminex-multiplex-assays.html, incorporated by reference in its entirety herein.
  • a tumor cell line can be selected for modification, and lentiviral transfection of recombinant immune modulator sequences may be used to stably integrate immunomodulators into the cell genome.
  • Example 3 describes 7 lentiviral vectors (vector 1, vector 2, vector 3, vector 4, vector 5, vector 6 and vector 7) that may be used to stably integrate immunomodulators into the cell genome.
  • two recombinant immunomodulator proteins may be transfected simultaneously, followed by transfections of two more recombinant immunomodulator proteins simultaneously, followed by transfection of a single recombinant immunomodulator protein to achieve the total of five recombinant peptides.
  • two recombinant peptides may be transfected simultaneously, followed by transfection of a single recombinant peptide, followed by transfection of a single recombinant peptide, followed by transfection of a single recombinant peptide to achieve the total of five recombinant peptides.
  • a single recombinant peptide is transfected, followed by transfection of two recombinant peptides simultaneously, followed by transfection of two recombinant peptides simultaneously to achieve a total of five recombinant peptide.
  • Example 3 describes the lentiviral vectors that may be used to stably integrate immunomodulators into the ENLSTTM cell genome.
  • Lentiviral Vectors [00599] The described invention provides nucleic acid constructs that encode two or more immunomodulators that can be expressed in prokaryotic and eukaryotic cells.
  • the described invention provides expression vectors (e.g., DNA- or RNA-based vectors) containing nucleotide sequences that encode two or more immunomodulators.
  • the described invention provides methods for making the vectors described herein, as well as methods for introducing the vectors into appropriate host cells for expression of the encoded polypeptides.
  • the methods provided herein include constructing nucleic acid sequences encoding two or more immunomodulators, and cloning the sequences into an expression vector.
  • the expression vector can be introduced into host cells or incorporated into virus particles, either of which can be administered to a subject to, for example, treat cancer.
  • cDNA or DNA sequences encoding two or more immunomodulators can be obtained (and, if desired, modified) using conventional DNA cloning and mutagenesis methods, DNA amplification methods, and/or synthetic methods.
  • a sequence encoding two or more immunomodulators can be inserted into a cloning vector for genetic modification and replication purposes prior to expression.
  • Each coding sequence can be operably linked to a regulatory element, such as a promoter, for purposes of expressing the encoded protein in suitable host cells in vitro and in vivo.
  • Expression vectors can be introduced into host cells for producing secreted immunomodulators. There are a variety of techniques available for introducing nucleic acids into viable cells.
  • Techniques suitable for the transfer of nucleic acid into mammalian cells in vitro include the use of liposomes, electroporation, microinjection, cell fusion, polymer-based systems, DEAE-dextran, viral transduction, the calcium phosphate precipitation method, etc.
  • liposomes For in vivo gene transfer, a number of techniques and reagents may also be used, including liposomes; and natural polymer-based delivery vehicles, such as chitosan and gelatin; viral vectors are also suitable for in vivo transduction.
  • a targeting agent such as an antibody or ligand specific for a cell surface membrane protein.
  • proteins which bind to a cell surface membrane protein associated with endocytosis may be used for targeting and/or to facilitate uptake, e.g., capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins which undergo internalization in cycling, proteins that target intracellular localization and enhance intracellular half-life.
  • the technique of receptor-mediated endocytosis is described, for example, by Wu et al., J. Biol. Chem.262, 4429-4432 (1987); and Wagner et al., Proc. Natl. Acad. Sci. USA 87, 3410-3414 (1990).
  • gene delivery agents such as, e.g., integration sequences can also be employed.
  • Cells may be cultured in vitro or genetically engineered, for example. Host cells can be obtained from normal or affected subjects, including healthy humans, cancer patients, private laboratory deposits, public culture collections such as the American Type Culture Collection, or from commercial suppliers.
  • Cells that can be used for production and secretion of two or more immunomodulators in vivo include, without limitation, epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, or granulocytes, various stem or progenitor cells, such as hematopoietic stem or progenitor cells (e.g., as obtained from bone marrow), umbilical cord blood, peripheral blood, fetal liver, etc., and tumor cells (e.g., human tumor cells).
  • epithelial cells e.g., endothelial cells
  • keratinocytes keratinocytes
  • fibroblasts muscle cells
  • hepatocytes hepatocytes
  • blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophag
  • an expression construct as provided herein can be introduced into an antigenic cell.
  • antigenic cells can include preneoplastic cells that are infected with a cancer-causing infectious agent, such as a virus, but that are not yet neoplastic, or antigenic cells that have been exposed to a mutagen or cancer-causing agent, such as a DNA-damaging agent or radiation, for example.
  • a cancer-causing infectious agent such as a virus
  • antigenic cells that have been exposed to a mutagen or cancer-causing agent, such as a DNA-damaging agent or radiation, for example.
  • Other cells that can be used are preneoplastic cells that are in transition from a normal to a neoplastic form as characterized by morphology or physiological or biochemical function.
  • an expression construct as provided herein can be introduced into a non-antigenic cell, for example a serial killer cells, such as NK cells, NKTs, CIKs, GDTs, DCs, MAIT cells, and CD8+ and/or CD4+ CTL cells.
  • a serial killer cells such as NK cells, NKTs, CIKs, GDTs, DCs, MAIT cells, and CD8+ and/or CD4+ CTL cells.
  • the cancer cells and preneoplastic cells used in the methods provided herein are of mammalian origin.
  • cancer cells e.g., human tumor cells
  • Cell lines derived from a preneoplastic lesion, cancer tissue, or cancer cells also can be used.
  • a cancer cell can be from an established tumor cell line or tumor cell line variant such as, without limitation, an established non-small cell lung carcinoma (NSCLC), bladder cancer, melanoma, ovarian cancer, renal cell carcinoma, prostate carcinoma, sarcoma, breast carcinoma, squamous cell carcinoma, head and neck carcinoma, hepatocellular carcinoma, pancreatic carcinoma, or colon carcinoma cell line.
  • NSCLC non-small cell lung carcinoma
  • bladder cancer melanoma
  • ovarian cancer renal cell carcinoma
  • renal cell carcinoma prostate carcinoma
  • sarcoma breast carcinoma
  • squamous cell carcinoma head and neck carcinoma
  • pancreatic carcinoma pancreatic carcinoma
  • the activated serial killer cell compositions provide for an adjuvant effect that further allows the immune system of a patient, when used in the various methods described herein, to be activated against a disease of interest.
  • Both prokaryotic and eukaryotic vectors can be used for expression of the two or more immunomodulators in the methods provided herein.
  • Prokaryotic vectors include constructs based on E. coli sequences (see, e.g., Makrides, Microbiol Rev 1996, 60:512- 538).
  • Non-limiting examples of regulatory regions that can be used for expression in E. coli include lac, trp, 1pp, phoA, recA, tac, T3, T7 and lamda PL.
  • Non-limiting examples of prokaryotic expression vectors may include the Agt vector series such as .lamda.gt11 (Huynh et al., in "DNA Cloning Techniques, Vol. I: A Practical Approach," 1984, (D. Glover, ed.), pp.49-78, IRL Press, Oxford), and the pET vector series (Studier et al., Methods Enzymol 1990, 185:60-89). [00611] A variety of regulatory regions can be used for expression of the exogenous immunomodulators in mammalian host cells.
  • the SV40 early and late promoters can be used.
  • Inducible promoters that may be useful in mammalian cells include, without limitation, promoters associated with the metallothionein II gene, mouse mammary tumor virus glucocorticoid responsive long terminal repeats (MMTV-LTR), the n-interferon gene, and the hsp70 gene (see, Williams et al., Cancer Res 1989, 49:2735-42; and Taylor et al., Mol Cell Biol 1990, 10:165-75).
  • Heat shock promoters or stress promoters also may be advantageous for driving expression of the fusion proteins in recombinant host cells.
  • Animal regulatory regions that exhibit tissue specificity and have been utilized in transgenic animals also can be used in tumor cells of a particular tissue type: the elastase I gene control region that is active in pancreatic acinar cells (Swift et al., Cell 1984, 38:639-646; Ornitz et al., Cold Spring Harbor Symp Quant Biol 1986, 50:399-409; and MacDonald, Hepatology 1987, 7:425-515); the insulin gene control region that is active in pancreatic beta cells (Hanahan, Nature 1985, 315:115-122), the immunoglobulin gene control region that is active in lymphoid cells (Grosschedl et al., Cell 1984, 38:647- 658; Adames et al., Nature 1985, 318:533-538; and Alexander et al., Mol Cell Biol
  • An expression vector also can include transcription enhancer elements, such as those found in SV40 virus, Hepatitis B virus, cytomegalovirus, immunoglobulin genes, metallothionein, and .beta.-actin (see, Bittner et al., Meth Enzymol 1987, 153:516-544; and Gorman, Curr Op Biotechnol 1990, 1:36-47).
  • an expression vector can contain sequences that permit maintenance and replication of the vector in more than one type of host cell, or integration of the vector into the host chromosome. Such sequences include, without limitation, to replication origins, autonomously replicating sequences (ARS), centromere DNA, and telomere DNA.
  • ARS autonomously replicating sequences
  • an expression vector can contain one or more selectable or screenable marker genes for initially isolating, identifying, or tracking host cells that contain DNA encoding the immunogenic proteins as described herein.
  • selectable or screenable marker genes for initially isolating, identifying, or tracking host cells that contain DNA encoding the immunogenic proteins as described herein.
  • stable expression in mammalian cells can be useful.
  • a number of selection systems can be used for mammalian cells.
  • the Herpes simplex virus thymidine kinase (Wigler et al., Cell 1977, 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalski and Szybalski, Proc Natl Acad Sci USA 1962, 48:2026), and adenine phosphoribosyltransferase (Lowy et al., Cell 1980, 22:817) genes can be employed in tk-, hgprf-, or aprf- cells, respectively.
  • antimetabolite resistance can be used as the basis of selection for dihydrofolate reductase (dhfr), which confers resistance to methotrexate (Wigler et al., Proc Natl Acad Sci USA 1980, 77:3567; O'Hare et al., Proc Natl Acad Sci USA 1981, 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan and Berg, Proc Natl Acad Sci USA 1981, 78:2072); neomycin phosphotransferase (neo), which confers resistance to the aminoglycoside G-418 (Colberre-Garapin et al., J Mol Biol 1981, 150:1); and hygromycin phosphotransferase (hyg), which confers resistance to hygromycin (Santerre et al., Gene 1984, 30:147).
  • dhfr dihydrofolate reductase
  • a number of viral-based expression systems also can be used with mammalian cells to produce the allogeneic ENLSTTM cells.
  • Vectors using DNA virus backbones have been derived from simian virus 40 (SV40) (Hamer et al., Cell 1979, 17:725), adenovirus (Van Doren et al., Mol Cell Biol 1984, 4:1653), adeno-associated virus (McLaughlin et al., J Virol 1988, 62:1963), and bovine papillomas virus (Zinn et al., Proc Natl Acad Sci USA 1982, 79:4897).
  • SV40 simian virus 40
  • adenovirus Van Doren et al., Mol Cell Biol 1984, 4:1653
  • adeno-associated virus McLaughlin et al., J Virol 1988, 62:1963
  • bovine papillomas virus Zainn et al., Proc Nat
  • the donor DNA sequence may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence.
  • This fusion gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E1 or E3) can result in a recombinant virus that is viable and capable of expressing heterologous products in infected hosts.
  • a non-essential region of the viral genome e.g., region E1 or E3
  • a recombinant virus that is viable and capable of expressing heterologous products in infected hosts.
  • Bovine papillomavirus can infect many higher vertebrates, including man, and its DNA replicates as an episome.
  • a number of shuttle vectors have been developed for recombinant gene expression, which exist as stable, multicopy (20-300 copies/cell) extrachromosomal elements in mammalian cells.
  • these vectors typically contain a segment of BPV DNA (the entire genome or a 69% transforming fragment), a promoter with a broad host range, a polyadenylation signal, splice signals, a selectable marker, and "poisonless" plasmid sequences that allow the vector to be propagated in E. coli.
  • the expression gene constructs are transfected into cultured mammalian cells by, for example, calcium phosphate coprecipitation. For those host cells that do not manifest a transformed phenotype, selection of transformants is achieved by use of a dominant selectable marker, such as histidinol and G418 resistance.
  • a dominant selectable marker such as histidinol and G418 resistance.
  • the vaccinia 7.5K promoter can be used.
  • ENLSTTM cell populations also can be made with retrovirus-based expression systems.
  • Retroviruses such as Moloney murine leukemia virus, can be used since most of the viral gene sequence can be removed and replaced with exogenous coding sequence while the missing viral functions can be supplied in trans. In contrast to transfection, retroviruses can efficiently infect and transfer genes to a wide range of cell types including, for example, primary hematopoietic cells.
  • a retroviral vector can comprise a 5' long terminal repeat (LTR), a 3' LTR, a packaging signal, a bacterial origin of replication, and a selectable marker.
  • the gp96-Ig fusion protein coding sequence for example, can be inserted into a position between the 5' LTR and 3' LTR, such that transcription from the 5' LTR promoter transcribes the cloned DNA.
  • the 5' LTR contains a promoter (e.g., an LTR promoter), an R region, a U5 region, and a primer binding site, in that order.
  • Nucleotide sequences of these LTR elements are well known in the art.
  • a heterologous promoter as well as multiple drug selection markers also can be included in the expression vector to facilitate selection of infected cells. See, McLauchlin et al., Prog Nucleic Acid Res Mol Biol 1990, 38:91-135; Morgenstern et al., Nucleic Acid Res 1990, 18:3587-3596; Choulika et al., J Virol 1996, 70:1792-1798; Boesen et al., Biotherapy 1994, 6:291-302; Salmons and Gunzberg, Human Gene Ther 1993, 4:129-141; and Grossman and Wilson, Curr Opin Genet Devel 1993, 3:110-114.
  • any of the cloning and expression vectors described herein may be synthesized and assembled from known DNA sequences using techniques that are known in the art.
  • the regulatory regions and enhancer elements can be of a variety of origins, both natural and synthetic.
  • Some vectors and host cells may be obtained commercially. Non-limiting examples of useful vectors are described in Appendix 5 of Current Protocols in Molecular Biology, 1988, ed. Ausubel et al., Greene Publish. Assoc. & Wiley Interscience, which is incorporated herein by reference; and the catalogs of commercial suppliers such as Clontech Laboratories, Stratagene Inc., and Invitrogen, Inc.
  • two or more immunomodulators may be cloned into two or more plasmid constructs for transfection (via, e.g., lipids, calcium phosphate, cationic polymers, DEAE-dextran, activated dendrimers, magnetic beads, electroporation, biolistic technology, microinjection, laserfection/optoinjection) or transduction (via, e.g., retrovirus, lentivirus, adenovirus, adeno-associated virus) into cells of tumor cell line or tumor cell line variants.
  • transfection via, e.g., lipids, calcium phosphate, cationic polymers, DEAE-dextran, activated dendrimers, magnetic beads, electroporation, biolistic technology, microinjection, laserfection/optoinjection
  • transduction via, e.g., retrovirus, lentivirus, adenovirus, adeno-associated virus
  • recombinant DNA encoding each immune modulator protein may be cloned into a lentiviral vector plasmid for integration into the genome of cells of tumor cell line or tumor cell line variants.
  • recombinant DNA encoding the immune modulator protein may be cloned into a plasmid DNA construct encoding a selectable trait, such as an antibiotic resistance gene.
  • recombinant DNA encoding the immune modulator protein may be cloned into a plasmid construct that is adapted to stably express each recombinant protein in the cells of the tumor cell line or tumor cell line variant.
  • the transfected or transduced tumor cells may be clonally expanded to achieve a cell line variant with a homogenous site of integration of the recombinant DNA encoding each immune modulator protein into the genome of the cells of the tumor cell line or tumor cell line variant.
  • Lentiviral Constructs [00622]
  • the DNA sequences coding for exogenous immunomodulatory molecules may be cloned into a lentiviral vector for transduction into mammalian cells.
  • the lentiviral system may comprise a lentiviral transfer plasmid encoding the two or more immune modulator sequences, packaging plasmids encoding the GAG, POL, TAT, and REV sequences, and an envelope plasmid encoding the ENV sequences.
  • the lentiviral transfer plasmid uses a viral LTR promoter for gene expression.
  • the lentiviral transfer plasmid uses a hybrid promoter, or other specialized promoter.
  • the promoter of the lentiviral transfer plasmid is selected to express the two or more immune modulator sequences at a desired level relative to other immunomodulatory sequences.
  • the relative level is measured on the level of transcription as mRNA transcripts. According to some embodiments, the relative level is measured on the level of translation as protein expression.
  • Multicistronic plasmid constructs [00623] According to some embodiments, one or more immune modulator sequence may be cloned in a multicistronic vector for co-expression of one immune modulator with a second immune modulator or other recombinant sequence. According to some embodiments, an immune modulator sequence may be cloned into a plasmid comprising an IRES element to promote translation of two or more proteins from a single transcript.
  • one or more immune modulator sequences is cloned into a multicistronic vector comprising sequences for a self cleaving 2A peptide to produce two or more exogenous immunomodulatory molecules from a single transcript. Genetic introduction of exogenous immunomodulatory molecules [00624] According to some embodiments, plasmid constructs comprising the recombinant immune modulator sequences may be transfected or transduced into tumor cell line or tumor cell line variants.
  • up to 25 immunomodulators may be cloned into 10 separate vectors for transduction into mammalian cells.
  • up to 25 immunomodulators i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25
  • up to 25 immunomodulators may be cloned into 11separate vectors for transduction into mammalian cells.
  • up to 25 immunomodulators may be cloned into 12 separate vectors for transduction into mammalian cells.
  • 14 or more immunomodulators i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more
  • 14 or more immunomodulators i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more
  • 14 or more immunomodulators i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more
  • 14 or more immunomodulators may be cloned into 12 separate vectors for transduction into mammalian cells.
  • 14 or more immunomodulators i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more
  • 14 or more immunomodulators may be cloned into 13 separate vectors for transduction into mammalian cells.
  • 14 or more immunomodulators i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more
  • 14 or more immunomodulators i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more
  • 14 separate vectors for transduction into mammalian cells i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more
  • the vector constructs further comprise one or more tags, as described herein.
  • Lentiviral System the lentiviral system may be employed where the transfer vector with immune modulator sequences, an envelope vector, and a packaging vector are each transfected into host cells for virus production.
  • the lentiviral vectors may be transfected into 293T cells by any of calcium phosphate precipitation transfection, lipid based transfection, or electroporation, and incubated overnight.
  • the immune modulator sequence may be accompanied by a fluorescence reporter, inspection of the 293T cells for florescence may be checked after overnight incubation.
  • the culture medium of the 293T cells comprising virus particles may be harvested 2 or 3 times every 8-12 hours and centrifuged to sediment detached cells and debris. The culture medium may then be used directly, frozen or concentrated as needed.
  • the ENLSTTM cell tumor cell line or tumor cell line variants may be grown to a confluency of about 70% under standard tissue culture conditions. The cells may then be treated with hexadimethrine bromide (to enhance transduction of cells) and lentiviral particles comprising recombinant constructs in fresh media, and incubated for 18-20 hours followed by a media change.
  • ENLSTTM cells of tumor cell lines or tumor cell line variants may be transfected with immune modulator sequences using a lipid based transfection method.
  • established lipid based transfection reagents such as LIPOFECTAMINE, may be used.
  • Tumor cell line or tumor cell line variants may be grown to about 70-90% confluence in a tissue culture vessel.
  • Appropriate amounts of Lipofectamine® and plasmid construct comprising the immune modulator sequences may be separately diluted in tissue culture media and briefly incubated at room temperature. The diluted Lipofectamine® and plasmid constructs in media may be mixed together and incubated briefly at room temperature.
  • ENLSTTM cell populations of tumor cells of the tumor cell line or tumor cell line variant that have been transfected with immune modulator sequences may be selected for various levels of expression.
  • the immunomodulator sequences may be accompanied by antibiotic resistance genes, which may be used to select for clones with stable integration of the recombinant DNA encoding the immunomodulator sequences.
  • the immunomodulator sequences may be cloned into a plasmid construct comprising antibiotic resistance, such as the Neomycin/Kanamycin resistance gene.
  • antibiotic resistance such as the Neomycin/Kanamycin resistance gene.
  • Transfected cells are treated with antibiotics according to the manufacturer’s protocol for 1-2 weeks or more with daily media changes.
  • there is massive tumor cell death of all cells that have not stably integrated the antibiotic resistance gene leaving behind small colonies of stably expressing clones.
  • Each of the stably expressing clones may be picked, cultured in a separate tissue culture container, and tested for levels of immunomodulator expression by any established method, such as western blot, flow cytometry, and fluorescence microscopy.
  • transfected ENLSTTM cells may be selected for high expression of the immunomodulators by fluorescence activated cell sorting (FACS).
  • immune modulator sequences may be accompanied by one or more fluorescent proteins (e.g. GFP), which can be used to quantify expression of immune modulator.
  • GFP fluorescent proteins
  • a bicistronic plasmid comprising an immune modulator sequence connected to a GFP sequence via IRES sequence would result in both an immune modulator and GFP protein translated from the same transcript.
  • the GFP expression level would act as a proxy for the expression level of immune modulator.
  • Single cell suspensions of immune modulator/GFP transfected tumor cells could be selected for the desired level of expression by FACS based on the fluorescence intensity.
  • Any fluorescent protein may be used in this regard.
  • any of the following recombinant fluorescent proteins (rXFP) may be used: EBFP, ECFP, EGFP, YFP, mHoneydew, mBanana, mOrange, tdTomato, mTangerine, mStrawberry, mCherry, mGrape, mRasberry, mGrape2, mPlum.
  • the expression of the recombinant immunomodulator may be directly observed by fluorescent antibodies specific to each immunomodulator or specific to a tag engineered onto each immunomodulator.
  • the extracellular region of an immunomodulator sequence may be fused with a FLAG tag or HA tag.
  • Anti-FLAG or anti-HA antibodies may be used, along with a fluorophore attached to the primary antibody or a secondary antibody) to detect the expression of the immunomodulator on the surface of the transfected tumor cells.
  • Tumor cells expressing the desired level of immunomodulator may be selected by FACS sorting and cultured separately.
  • a tumor cell line or tumor cell line variants that expresses one or more immunomodulator sequence(s) is transfected with additional immunomodulators for stable expression in a sequential manner.
  • cells of a tumor cell line or tumor cell line variant may be created that express several immunomodulators simultaneously.
  • a tumor cell line or tumor cell line variant may be created that expresses two immunomodulators simultaneously.
  • a tumor cell line or tumor cell line variant may be created that expresses three immunomodulators simultaneously.
  • a tumor cell line or tumor cell line variant may be created that expresses four immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses five immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses six immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses seven immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses eight immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses nine immunomodulators simultaneously.
  • a tumor cell line or tumor cell line variant may be created that expresses ten immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses eleven immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses twelve immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses thirteen immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses fourteen immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses fifteen immunomodulators simultaneously.
  • a tumor cell line or tumor cell line variant may be created that expresses sixteen immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses seventeen immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses eighteen immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses nineteen immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses twenty immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses twenty-one immunomodulators simultaneously.
  • a tumor cell line or tumor cell line variant may be created that expresses twenty-two immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses twenty-three immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses twenty-four immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses twenty-five immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses twenty-six immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses twenty-seven immunomodulators simultaneously.
  • a tumor cell line or tumor cell line variant may be created that expresses twenty-eight immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses twenty-nine immunomodulators simultaneously. According to some embodiments, a tumor cell line or tumor cell line variant may be created that expresses thirty immunomodulators simultaneously.
  • Variably Expressing Clones [00635] According to one aspect of the disclosed invention, multiple recombinant immunomodulator peptides may be expressed in a single clonally derived tumor cell line or tumor cell line variant. According to some embodiments, the amount (or level) of each individual immunomodulator expressed in each cell is the same as the level of expression of all other immunomodulator peptides.
  • the level of each individual immunomodulator expressed in each cell is different from the level of expression of the other immunomodulators expressed in the cell.
  • clonally derived tumor cell line or tumor cell line variants that express the same complement of immunomodulators stably express those immunomodulators in varying amounts relative to each other.
  • the relative amount of recombinant immune modulator expressed within each clonally derived tumor cell line or tumor cell line variant, and between tumor cell line or tumor cell line variants, can be measured on the level of transcription or translation.
  • the relative amount of recombinant immunomodulator can be quantified by western blot, RT-PCR, flow cytometry, immunofluorescence, and northern blot, among others.
  • the differences in the amount of expressed immunomodulators relative to one another may be a result of random integration into more or less transcriptionally active regions of the genome of the tumor cell line or tumor cell line variant.
  • the relative differences in the amount of expressed immunomodulator may be achieved by elements engineered into the transfected or transduced DNA used to create the tumor cell line or tumor cell line variant.
  • the level of expression of the exogenous immunomodulatory molecules may be achieved on the transcriptional level by engineering stronger or weaker gene promoter sequences to control expression of the immune modulator gene.
  • one or more of the following promoters may be used to control expression of immunomodulators: simian virus 40 early promoter (SV40), cytomegalovirus immediate-early promoter (CMV), human Ubiquitin C promoter (UBC), human elongation factor 1 ⁇ promoter (EF1A), mouse phosphoglycerate kinase 1 promoter (PGK), and chicken ⁇ -Actin promoter coupled with CMV early enhancer (CAGG).
  • SV40 simian virus 40 early promoter
  • CMV cytomegalovirus immediate-early promoter
  • UBC human Ubiquitin C promoter
  • EEF1A human elongation factor 1 ⁇ promoter
  • PGK mouse phosphoglycerate kinase 1 promoter
  • CAGG CMV early enhancer
  • the level of expression of the exogenous immunomodulatory molecules may be achieved on the translational level by engineering stronger or weaker Kozak consensus sequences around the start codon of the immunomodulator transcript.
  • nucleotide sequences may be provided to control immune modulator translation: GCCGCC(A/G)CCAUGG (SEQ ID NO: 15).
  • a sequence that is at least 60% identical to SEQ ID NO: 15 may be provided to control immunomodulator translation.
  • a sequence that is at least 70% identical to SEQ ID NO: 15 may be provided to control immunomodulator translation.
  • a sequence that is at least 80% identical to SEQ ID NO: 15 may be provided to control immunomodulator translation.
  • a sequence that is at least 90% identical to SEQ ID NO: 15 may be provided to control immunomodulator translation.
  • a sequence that is at least 95% identical to SEQ ID NO: 15 may be provided to control immunomodulator translation.
  • a sequence that is at least 96% identical to SEQ ID NO: 15 may be provided to control immunomodulator translation.
  • a sequence that is at least 97% identical to SEQ ID NO: 15 may be provided to control immunomodulator translation.
  • a sequence that is at least 98% identical to SEQ ID NO: 15 may be provided to control immunomodulator translation.
  • a sequence that is at least 99% identical to SEQ ID NO: 15 may be provided to control immunomodulator translation.
  • Non-viral approaches can also be employed for the introduction of a vector encoding one or more immunomodulatory molecules to a cell derived from a patient having a tumor or a tumor cell line or variant.
  • a nucleic acid molecule encoding an immunomodulatory molecule can be introduced into a cell by administering the nucleic acid molecule in the presence of lipofection (Feigner et al., Proc. Natl. Acad. Sci. U.S.A.84:7413, 1987; Ono et al., Neuroscience Letters 17:259, 1990; Brigham et al., Am. J. Med.
  • nucleic acids are administered in combination with a liposome and protamine.
  • Methods for accomplishing transfection in vitro include the use of calcium phosphate, DEAE dextran, electroporation, and protoplast fusion.
  • immunomodulators whose functionality has been modified by genetic engineering are intended to be included within the scope of the claimed invention.
  • an immunomodulator may be modified by genetic engineering to change a signal sequence, to make the immunomodulator product a secreted product, to increase stability of the immunomodulator in the membrane; to alter key amino acids, or to codon optimize sequernces for humans. All such modification are included within the scope of the claimed invention.
  • Example 3 below describes 47 lentiviral vectors (vector 44, vector 97, vector 84, vector 29, vector 107, vector 116, vector 86, vector 18, vector 17, vector 98, vector 5, vector 30, vector 109, vector 3, vector 4, vector 106, vector 16, vector 83, vector 31, vector 12, vector 99, vector 121, vector 105, vector 32, vector 37, vector 22, vector 19, vector 20, vector 89, vector 21, vector 23, vector 108, vector 15, vector 124, vector 65, vector 64, vector 88, vector 96, vector 14, vector 119, vector 120, vector 45, vector 60, vector 59, vector 8, vector 128, vector 35, and vector 6) that may be used to stably integrate immunomodulators into the cell genome.
  • vector 44 vector 97, vector 84, vector 29, vector 107, vector 116, vector 86, vector 18, vector 17, vector 98, vector 5, vector 30, vector 109, vector 3, vector 4, vector 106, vector 16, vector 83, vector 31, vector 12, vector 99, vector 121, vector 105, vector 32, vector 37, vector 22,
  • vector 44 comprises one or more TNF family member immunomodulators.
  • vector 29 comprises one or more TNF family member immunomodulators.
  • vector 18 comprises one or more TNF family member immunomodulators.
  • vector 17 comprises one or more TNF family member immunomodulators.
  • vector 5 comprises one or more TNF family member immunomodulators.
  • vector 16 comprises one or more TNF family member immunomodulators.
  • vector 99 comprises one or more TNF family member immunomodulators.
  • vector 15 comprises one or more TNF family member immunomodulators.
  • vector 14 comprises one or more TNF family member immunomodulators.
  • vector 45 comprises one or more TNF family member immunomodulators.
  • vector 6 comprises one or more TNF family member immunomodulators.
  • the one or more TNF family immunomodulators are selected from those listed in Table 6 or Table 7.
  • vector 44 comprises between 3-25, inclusive TNF family member immunomodulators.
  • vector 29 comprises between 3-25, inclusive TNF family member immunomodulators.
  • vector 18 comprises between 3-25, inclusive TNF family member immunomodulators.
  • vector 17 comprises between 3- 25, inclusive TNF family member immunomodulators.
  • vector 5 comprises between 3-25, inclusive TNF family member immunomodulators.
  • vector 16 comprises between 3- 25, inclusive TNF family member immunomodulators.
  • vector 99 comprises between 3-25, inclusive TNF family member immunomodulators.
  • vector 15 comprises between 3- 25, inclusive TNF family member immunomodulators.
  • vector 14 comprises between 3-25, inclusive TNF family member immunomodulators.
  • vector 45 comprises between 3- 25, inclusive TNF family member immunomodulators.
  • vector 6 comprises between 3-25, inclusive TNF family member immunomodulators.
  • the between 3-25, inclusive TNF family immunomodulators are selected from those listed in Table 6 or Table 7.
  • vector 97 comprises one or more Ig family member immunomodulators.
  • vector 84 comprises one or more Ig family member immunomodulators.
  • vector 107 comprises one or more Ig family member immunomodulators.
  • vector 98 comprises one or more Ig family member immunomodulators.
  • vector 30 comprises one or more Ig family member immunomodulators.
  • vector 83 comprises one or more Ig family member immunomodulators.
  • vector 121 comprises one or more Ig family member immunomodulators.
  • vector 119 comprises one or more Ig family member immunomodulators.
  • the one or more Ig family member immunomodulators are selected from those listed in Table 6 or Table 7.
  • vector 97 comprises between 3-25, inclusive Ig family member immunomodulators.
  • vector 84 comprises between 3-25, inclusive Ig family member immunomodulators.
  • vector 107 comprises between 3-25, inclusive Ig family member immunomodulators.
  • vector 98 comprises between 3- 25, inclusive Ig family member immunomodulators.
  • vector 30 comprises between 3-25, inclusive Ig family member immunomodulators.
  • vector 83 comprises between 3-25, inclusive Ig family member immunomodulators.
  • vector 121 comprises between 3-25, inclusive Ig family member immunomodulators.
  • vector 119 comprises between 3-25, inclusive Ig family member immunomodulators.
  • the between 3-25, inclusive Ig family member immunomodulators are selected from those listed in Table 6 or Table 7.
  • vector 116 comprises one or more chemokine immunomodulators.
  • the one or more chemokine immunomodulators are selected from those listed in Table 6 or Table 7.
  • vector 116 comprises between 3-25, inclusive chemokine immunomodulators.
  • the between 3-25, inclusive chemokine immunomodulators are selected from those listed in Table 6 or Table 7.
  • vector 109 comprises one or more growth factor immunomodulators.
  • vector 109 comprises between 3-25, inclusive growth factor immunomodulators.
  • vector 3 comprises one or more cytokine immunomodulators.
  • vector 4 comprises one or more cytokine immunomodulators.
  • vector 32 comprises one or more cytokine immunomodulators.
  • vector 22 comprises one or more cytokine immunomodulators.
  • vector 19 comprises one or more cytokine immunomodulators.
  • vector 20 comprises one or more cytokine immunomodulators.
  • vector 89 comprises one or more cytokine immunomodulators.
  • vector 21 comprises one or more cytokine immunomodulators.
  • vector 23 comprises one or more cytokine immunomodulators.
  • vector 121 comprises one or more cytokine immunomodulators.
  • vector 65 comprises one or more cytokine immunomodulators.
  • vector 64 comprises one or more cytokine immunomodulators.
  • vector 88 comprises one or more cytokine immunomodulators.
  • vector 96 comprises one or more cytokine immunomodulators.
  • vector 60 comprises one or more cytokine immunomodulators.
  • vector 59 comprises one or more cytokine immunomodulators.
  • vector 128 comprises one or more cytokine immunomodulators.
  • the one or more cytokine immunomodulators are selected from those listed in Table 6 or Table 7.
  • vector 3 comprises between 3-25, inclusive cytokine immunomodulators.
  • vector 4 comprises between 3-25, inclusive cytokine immunomodulators.
  • vector 32 comprises between 3-25, inclusive cytokine immunomodulators.
  • vector 22 comprises between 3-25, inclusive cytokine immunomodulators.
  • vector 19 comprises between 3- 25, inclusive cytokine immunomodulators.
  • vector 20 comprises between 3-25, inclusive cytokine immunomodulators.
  • vector 89 comprises between 3-25, inclusive cytokine immunomodulators.
  • vector 21 comprises between 3-25, inclusive cytokine immunomodulators.
  • vector 23 comprises between 3- 25, inclusive cytokine immunomodulators.
  • vector 121 comprises between 3-25, inclusive cytokine immunomodulators.
  • vector 65 comprises between 3-25, inclusive cytokine immunomodulators.
  • vector 64 comprises between 3-25, inclusive cytokine immunomodulators.
  • vector 88 comprises between 3- 25, inclusive cytokine immunomodulators.
  • vector 96 comprises between 3-25, inclusive cytokine immunomodulators.
  • vector 60 comprises between 3-25, inclusive cytokine immunomodulators.
  • vector 59 comprises between 3-25, inclusive cytokine immunomodulators.
  • vector 128 comprises between 3- 25, inclusive cytokine immunomodulators.
  • the between 3-25, inclusive cytokine immunomodulators are selected from those listed in Table 6 or Table 7.
  • vector 37 comprises one or more receptor immunomodulators.
  • vector 124 comprises one or more receptor immunomodulators.
  • vector 88 comprises one or more receptor immunomodulators.
  • vector 8 comprises one or more receptor immunomodulators.
  • the one or more receptor immunomodulators are selected from those listed in Table 6 or Table 7.
  • vector 37 comprises between 3-25, inclusive receptor immunomodulators.
  • vector 124 comprises between 3-25, inclusive receptor immunomodulators.
  • vector 88 comprises between 3-25, inclusive receptor immunomodulators.
  • vector 8 comprises between 3-25, inclusive receptor immunomodulators.
  • the between 3-25, inclusive receptor immunomodulators are selected from those listed in Table 6 or Table 7.
  • vector 86 comprises one or more other immunomodulators.
  • vector 106 comprises one or more other immunomodulators.
  • vector 107 comprises one or more other immunomodulators.
  • vector 31 comprises one or more other immunomodulators.
  • vector 12 comprises one or more other immunomodulators.
  • vector 105 comprises one or more other immunomodulators.
  • vector 108 comprises one or more other immunomodulators.
  • vector 120 comprises one or more other immunomodulators.
  • vector 35 comprises one or more other immunomodulators.
  • the one or more other immunomodulators are selected from those listed in Table 6 or Table 7. [00657]
  • vector 86 comprises between 3-25, inclusive other immunomodulators.
  • vector 106 comprises between 3-25, inclusive other immunomodulators.
  • vector 107 comprises between 3-25, inclusive other immunomodulators.
  • vector 31 comprises between 3-25, inclusive other immunomodulators.
  • vector 12 comprises between 3- 25, inclusive other immunomodulators.
  • vector 105 comprises between 3-25, inclusive other immunomodulators.
  • vector 108 comprises between 3-25, inclusive other immunomodulators.
  • vector 120 comprises between 3-25, inclusive other immunomodulators.
  • vector 35 comprises between 3- 25, inclusive other immunomodulators.
  • the between 3-25, inclusive other immunomodulators are selected from those listed in Table 6 or Table 7.
  • Immunomodulator scFv-anti- biotin-G3hinge-mIgG1 (to generate surface IgG).
  • FIG.2 A schematic of the organization of vector 1, used for the immunomodulator scFv-anti-biotin-G3hinge-mIgG1 is shown in FIG.2.
  • Table 11, below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description.
  • Table 11 [00661] When vector 1 is employed, anti-IgG is used for flow detection.
  • a biotin + fluorescent labelled oligodeoxynucleotides (ODN) is used as a secondary detection method.
  • Type Immunoglobulin Annotation: • H7 heavy chain leader • Anti-biotin Variable Heavy chain (VH) allows for loading biotin labeled CpG • Inter-domain disulfide linkage VH44 (G->C) and VL100 (G->C) • IgG3 hinge to enhance FcyR interaction • Linkage is standard • IgG1 (CH2-CH3-Tm-Cyt) used for interaction with FcyR/FcRn and membrane anchoring • T233A mutation to enhance FcRn and FcyR interaction Vector 2.
  • Immunomodulator full anti-biotin – G3hinge-mIgG1 (using heavy chain/ires/light chain)
  • FIG.3 A schematic of the organization of vector 2, used for the immunomodulator full anti-biotin – G3hinge-mIgG1 is shown in FIG.3.
  • Vector 2 is bicistronic.
  • Table 12 shows the vector component name, the corresponding nucleotide position in SEQ ID NO.48, the full name of the component and a description. Table 12
  • anti-IgG is used for flow detection.
  • Biotin + fluorescent labelled ODN is used as a secondary detection method.
  • the following is a description of the immunomodulator full anti-biotin – G3hinge-mIgG1 (using heavy chain/ires/light chain).
  • Type Membrane anchored Immunoglobulin [00666] Annotation: • H7 heavy chain leader • IgG3 hinge to enhance FcyR interaction • T233A mutation to enhance FcRn and FcyR interaction • Anti-biotin Variable H allows for loading biotin labeled CpG • CH1 (generic) • LC Variable (human lambda variable) • LC Constant Region 1 from Lambda (http://www.uniprot.org/uniprot/P0CG04) • Interdomain disulfide linkage VH44 (G->C) and VL100 (G->C) (ref) • Linkage is standard • IgG1 (CH2-CH3-Tm-Cyt) for interaction with FcyR/FcRn and membrane anchoring Vector 3.
  • Immunomodulator sGM-CSF/ires/mFLT3L
  • FIG.4 A schematic of the organization of vector 3, used for the immunomodulator sGM-CSF/ires/mFLT3L is shown in FIG.4.
  • Vector 3 is bicistronic.
  • Table 13, below, shows the vector component name, the corresponding nucleotide position in SEQ ID NO.49, the full name of the component and a description.
  • Table 13 [00668] When vector 3 is employed, anti-FLT3L is used for flow detection. The highest surface FLT3L expressor will have the highest secreted GM-CSF expression.
  • the following is a description of the immunomodulator sGM- CSF/ires/mFLT3L.
  • Immunomodulator sFLT3L/ires/(FLT3 signal-GM-CSF-Tm)
  • FIG.5 A schematic of the organization of vector 4, used for the immunomodulator sFLT3L/ires/(FLT3 signal-GM-CSF-Tm) is shown in FIG.5.
  • Vector 4 is bicistronic.
  • Table 14, below, shows the vector component name, the corresponding nucleotide position in SEQ ID NO.50, the full name of the component and a description.
  • Table 14 [00671] When vector 4 is employed, anti-GM-CSF is used for flow detection. The highest surface GMCSF expressor will have highest secreted FLT3L expression.
  • Immunomodulator mCD40L
  • FIG.6 A schematic of the organization of vector 5, used for the immunomodulator mCD40L is shown in FIG.6.
  • Vector 5 is monocistronic.
  • Table 15, below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description.
  • Table 15 [00674] When Vector 5 is employed, anti-CD40L is used for flow detection.
  • Immunomodulator mTNFalpha (TNFa)
  • FIG.7 A schematic of the organization of vector 6, used for the immunomodulator mTNF ⁇ is shown in FIG.7.
  • Vector 6 is monocistronic.
  • Table 16, below, shows the vector component name, the corresponding nucleotide position in SEQ ID NO.52, the full name of the component and a description.
  • Table 16 [00677] When vector 6 is employed, anti-TNF ⁇ is used for flow detection. [00678] The following is a description of the immunomodulator mTNF ⁇ .
  • Type TNF type II transmembrane protein Annotation:Mutations were introduced to make a non-cleavable version.
  • Vector 7. Immunomodulator: mRANKL /ires/FLT3 signal-V5- scFV anti-biotin-Tm [00679] A schematic of the organization of vector 7, used for the immunomodulator mRANKL /ires/FLT3 signal-V5- scFV anti-biotin-Tm is shown in FIG.8.
  • Table 17, below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 17:
  • anti-RANKL When vector 7 is employed, anti-RANKL is used for flow detection. Anti-V5 mAb is used as a secondary detection method.
  • Type TNF type II transmembrane protein
  • Annotation wild-type sequence
  • FIG.9 shows a schematic of vector 44.
  • Table 18 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 18
  • FIG.10 shows a schematic of vector 97.
  • Table 19 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 19
  • FIG.11 shows a schematic of vector 84.
  • Table 20 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 20
  • FIG.12 shows a schematic of vector 29.
  • Table 21 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 21
  • FIG.13 shows a schematic of vector 107.
  • Table 22 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 22
  • FIG.14 shows a schematic of vector 116.
  • Table 23 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 23
  • FIG.15 shows a schematic of vector 86.
  • Table 24 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 24
  • FIG.16 shows a schematic of vector 18.
  • Table 25, below shows the vector component name, the corresponding nucleotide position, the full name of the component and a description.
  • Table 25 Vector 17
  • FIG.17 shows a schematic of vector 17.
  • Table 26 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 26
  • FIG.18 shows a schematic of vector 98.
  • Table 27 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. [00702] Table 27
  • FIG.19 shows a schematic of vector 30.
  • Table 28 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 28
  • FIG.20 shows a schematic of vector 109.
  • Table 29 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 29
  • FIG.21 shows a schematic of vector 106.
  • Table 30 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description.
  • Table 30 Vector 16 [00709]
  • FIG.22 shows a schematic of vector 16.
  • Table 31 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description.
  • Table 31 Vector 83 [00711]
  • FIG.23 shows a schematic of vector 83.
  • Table 32 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 32
  • FIG.24 shows a schematic of vector 31.
  • Table 33 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description.
  • Table 33 Vector 12 [00715]
  • FIG.25 shows a schematic of vector 12.
  • Table 34 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description.
  • Table 34 Vector 99 [00717]
  • FIG.26 shows a schematic of vector 99.
  • Table 35 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description.
  • Table 35 Vector 121 [00719]
  • FIG.27 shows a schematic of vector 121.
  • Table 36 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description.
  • Table 36 Vector 105
  • FIG.28 shows a schematic of vector 105.
  • Table 37 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 37
  • FIG.29 shows a schematic of vector 32.
  • Table 38 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 38
  • FIG.30 shows a schematic of vector 37.
  • Table 39 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 39
  • FIG.31 shows a schematic of vector 22.
  • Table 40 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 40
  • FIG.32 shows a schematic of vector 19.
  • Table 41 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 41
  • FIG.33 shows a schematic of vector 20.
  • Table 42 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 42
  • FIG.34 shows a schematic of vector 89.
  • Table 43 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 43
  • FIG.35 shows a schematic of vector 21.
  • Table 44 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 44
  • FIG.36 shows a schematic of vector 23.
  • Table 45 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 45
  • FIG.37 shows a schematic of vector 108.
  • Table 46 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 46
  • FIG.38 shows a schematic of vector 15.
  • Table 47 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 47
  • FIG.39 shows a schematic of vector 124.
  • Table 48 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 48
  • FIG.40 shows a schematic of vector 65.
  • Table 49 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 49
  • FIG.41 shows a schematic of vector 64.
  • Table 50 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 50
  • FIG.42 shows a schematic of vector 88.
  • Table 51 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 51
  • FIG.43 shows a schematic of vector 96.
  • Table 52 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description.
  • Table 52 Vector 14
  • FIG.44 shows a schematic of vector 14.
  • Table 53 below, shows the vector component name, the corresponding nucleotide position, the full name of the component and a description.
  • Table 53 Vector 119
  • FIG.45 shows a schematic of vector 119.
  • Table 54 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 54
  • FIG.46 shows a schematic of vector 120.
  • Table 55 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description.
  • Table 55 Vector 45
  • FIG.47 shows a schematic of vector 45.
  • Table 56 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description.
  • Table 56 Vector 60
  • FIG.48 shows a schematic of vector 60.
  • Table 57 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description.
  • Table 57 Vector 59
  • FIG.49 shows a schematic of vector 59.
  • Table 58 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description.
  • Table 58 Vector 8
  • FIG.50 shows a schematic of vector 8.
  • Table 59 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 59
  • FIG.51 shows a schematic of vector 128.
  • Table 60 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 60
  • FIG.52 shows a schematic of vector 35 [00768]
  • Table 61 shows the vector component name, the corresponding nucleotide position, the full name of the component and a description. Table 61
  • ENLSTTM cells derived from an allogeneic human melanoma cell line are genetically engineered to express the core three essential human immunomodulators OX40 Ligand (OX40L), CD27 Ligand (CD70), and CD28 Ligand (CD28L)by the following process.
  • OX40L OX40 Ligand
  • CD27 Ligand CD70
  • CD28L CD28 Ligand
  • Vector 14 comprising an exogenous nucleic acid encoding a stably expressed immunomodulatory molecule, wherein the immunomodulatory molecule is OX40L is introduced into a population of live 5K-MEL2 tumor cells;
  • Vector 18 comprising an exogenous nucleic acid encoding a stably expressed immunomodulatory molecule, wherein the immunomodulatory molecule is CD27 Ligand (CD70) is introduced into a second population of live 5K-MEL2 tumor cells;
  • Vector 30 comprising an exogenous nucleic acid encoding a stably expressed immunomodulatory molecule, wherein the immunomodulatory molecule is CD28 Ligand (CD28L) is introduced into a third population of live 5K-MEL2 tumor cells.
  • a fourth population of llive 5K-MEL-2 tumor cells is transduced or transfected with Vector 14 comprising an exogenous nucleic acid encoding stably expressed OX40L, Vector 18 comprising an exogenous nucleic acid encoding stably expressed CD70, and Vector 30 comprising an exogenous nucleic acid encoding stably expressed CD28L
  • the resulting live 5K-MEL2 tumor cell stably expresses OX40L, CD70 and CD28L (hereinafter “14-18-30”).
  • the same process may be used to introduce one or more additional subsets of immunomodulators designated as R, with each subset comprising 3-25, inclusive immunomodulators.
  • Tumor cell line variants are generated by selecting for tumor cell clones that stably express an immunogenic amount of the exogenous subset of the immunomodulatory molecules.
  • Clonally derived cell line variants are selecting in a mixed lymphocyte tumor cell reaction (MLTR) by one or more parameters selected from: cellular proliferation, cellular subset differentiation, cytokine release profile, and tumor cell lysis; wherein the selected clonally derived cell line variant is effective to stimulate activation of one or more of T-lymphocytes, natural killer (NK) cells, dendritic cells (DCs) or B lymphocytes.
  • MLTR mixed lymphocyte tumor cell reaction
  • the allogeneic genetically engineered SK-MEL2 tumor cell lines are tested for their immunomodulatory potential by primary and secondary MLTR assay.
  • Stable expression of OX40 Ligand (OX40-L), CD27 Ligand (CD70), or CD28 Ligand (CD28L) by the SK-MEL2 ENLSTTM cells and by SK-MEL2 ENLSTTM cells genetically engineered to simultaneously express immunomodulators OX40 Ligand, CD27 Ligand and CD28 Ligand is effective to induce one or more subpopulations of PBMCs to proliferate in response to the expressed immunomodulatory molecules and to then enter an effector phase for killing of tumor cells.
  • Primary MLTR assay Primary MLTR assay.
  • PBMCs Peripheral blood mononuclear cells
  • Anticoagulant-treated blood is diluted in the range of 1:2 to 1:4 with PBS/EDTA to reduce aggregation of erythrocytes.
  • the diluted blood is then layered above a Ficoll-Paque solution in a centrifuge tube, without mixing.
  • the layered blood/Ficoll-Paque is centrifuged for 40 minutes at 400 x g between 18o and 20o C, without the use of the centrifuge brake, resulting in the formation of blood fractions comprising, from top to bottom, a first fraction comprising blood plasma; a second fraction comprising mononuclear cells; a third fraction comprising Ficoll-Paque media; and a fourth fraction comprising granulocytes and erythrocytes.
  • the fraction comprising mononuclear cells is selected for further processing.
  • Each of the cells from the transfected ENLSTTM cells and from parental tumor cell line SK-MEL2 (control) is co-cultured with PBMCs for up to 28 days under standard tissue culture conditions, followed by evaluation for immune cell proliferation, immune cell differentiation, measured by flow cytometry and CyTOF, cytokine release profile, and cytoxicity, measured by LDH release assay.
  • PBMCs SKMEL-2 derived ENLSTTM cells transfected or transduced with recombinant DNA sequences encoding one or more of immunomodulators OX40 Ligand, CD27 Ligand, and CD28 Ligand on CD8+ T cell activation and expansion.
  • Parental cell line SKMEL2 was modified with Vector 14 encoding OX40L (“14”), with Vector 18 encoding CD27 Ligand only (“18”), with Vector 30 encoding CD28 Ligand comprising CD80 and CD86 only (“30”), and with Vectors 14, 18 and 30 (“14-18-30”).
  • Functional characterization of the immunostimulatory effects of the ENLSTTM cells was performed using a primary MLTR assay, as described in Example 1.
  • CD8+ T-cell proliferation was measured by flow cytometry. Tumor cell killing was observed on day 9.
  • FIG.53A and 53B show flow cytometry forward (FSC) and side scatter (SSC) plots for size and granularity after incubating parent line SKMEL2 (FIG.53A) and SKMEL-2 containing immunomodulators 14, 18 and 30 (FIG.53B) with PBMCs in a mixed lymphocyte tumor response assay.
  • FSC flow cytometry forward
  • SSC side scatter
  • FIG.53C and FIG.53D show the CD8 population after incubation of the PBMCs in the mixed lymphocyte tumor response assay with the parent cell line (FIG.53C) and SKMEL2 transfected or transduced with recombinant DNA sequences encoding immunomodulators OX40 Ligand (Vector 14), CD27 Ligand (Vector 18), and CD28 Ligand (Vector 30 comprising CD80, CD86, or both) (FIG.53D).
  • the dotted circle in the bottom panel of graphs shows the CD8 gate.
  • PBMCs following coincubation with the parental cell line (SKMEL-2) there is an approximately equal number of CD4+ and CD8+ T cells.
  • FIG.54A and 54B Results are shown in FIG.54A and 54B.
  • PBMCs were induced with unmodified 5K-MEL2 (SK) cells (control) (FIG.54A) or with the genetically engineered 14-18-305K-MEL2 ENLSTTM cells (“activation cells”) (FIG.54B).
  • FIG.54A shows day 9 PBMCs induced with unmodified parental 5K-MEL-2 cells, left, microscopy; right flow cytometry.
  • FIG.54A shows day 9 PBMC induced with 5K-MEL- 2 derived ENLSTTM cells; left, microscopy, right flow cytometry.
  • the oval outline in the flow cytometry in FIG.54A corresponds to live unmodified SKMEL 2 parent tumor cells.
  • the arrow in FIG.54B shows that the ENLSTTM cells are eliminated by the induced PBMCs.
  • Example 6. Characterization of tumoricidal properties of the MNCs following in vitro activation. [00781] Since the ENLSTTM cells genetically engineered to express 14-18-30 were derived from SK melanoma cells, the cytolytic activity of PBMCs activated by the ENLSTTM cells against other melanoma cell lines, unmodified melanoma cell lines, and against non-melanoma cell lines was assessed. [00782] Secondary MLTR assay.
  • PBMCs were tested against parental cell line SK-MEL-2 and two unrelated melanoma cell lines (SK-MEL-28 cell line, and M14 cell line) which are distinct from 5K-MEL-2. Unmodified SK-MEL-28 and unmodified M14 represent third party cell lines to which the SK-MEL-2-derived activated PBMCs are na ⁇ ve.
  • FSC flow cytometry forward
  • SSC side scatter
  • FIG.55A, FIG.55C, and FIG.55E show day 5 secondary mixed lymphocyte tumor response assays assessing cytolysis of PBMC against unmodified tumor targets;
  • FIG.55A shows that PBMCs previously incubated with unmodified SK-MEL-2 cells do not lyse unmodified SK-MEL-2 cells;
  • FIG.55C shows that PBMCs previously incubated with unmodified SK-MEL-2 cells do not lyse unmodified SK-MEL-28 cells;
  • FIG.55E shows that PBMCs previously incubated with unmodified SK-MEL-2 cells do not lyse unmodified M14 cells.
  • FIG.55 B, FIG.55D, and FIG.55F show day 5, secondary mixed lymphocyte tumor response assay with SK-MEL-2 derived 14-18-30 ENLSTTM cell- activated MNCs coincubated with: FIG.55B PBMCs previously coincubated with ENLSTTM cells lyse unmodified SK-MEL-2 cells; FIG.55D, PBMCs previously coincubated with ENLSTTM cells lyse unmodified SK-MEL-28 cells; FIG.55F PBMCs previously coincubated with ENLSTTM cells lyse unmodified M14 cells. Therefore, cytolytic activity was dependent on prior treatment with the genetically engineered ENLSTTM tumor cell lines.
  • Unmodified SK-MEL-2 cells, SK-MEL-28 cells, or ML14 cells therefore are unable to induce PBMC activation; however, each of these cell lines is lysed by PBMCs activated by SK-MEL-2-derived ENLSTTM cells once the activated PBMCs are formed.Therefore, cytolytic activity was dependent on prior treatment with the genetically engineered ENLSTTM cells.
  • FIG.56A shows a CyTOF mass cytometry single-cell phenotype analysis map of PBMC populations
  • FIG.56B, 56C, 56D, 56E, 56F show visNE density contour plots of CyTOF staining following PBMC induction by parental (FIG.56B) or immunomodulator expressing SK-MEL-2 derived ENLSTTM cells (FIG.56C, 56D 56D, 56E, 56F) after 9 days in primary mixed lymphocyte tumor response assay.
  • FIG.56B shows a PBMC subpopulation shift following induction by parental SK MEL-2 cells; note that an NK cell population and a myeloid cell population are absent;
  • FIG.56C shows a PBMC subpopulation shift following induction by ENLSTTM cells transduced or transfected with vector 3, showing induction of B and myeloid cells.
  • FIG.56D showing PBMC subpopulation shift following induction by ENLSTTM cells transduced or transfected with vectors 3 and 4, showing induction of B cells
  • FIG.56E showing PBMC subpopulation shift following induction by ENLSTTM cells transduced or transfected with vectors 3, 4 and 5, showing induction of B cells and Myeloid cells
  • FIG.56F showing PBMC subpopulation shift following induction by ENLSTTM cells transduced or transfected with vectors 3, 4 and 6.
  • FIG.57A, 57B, 57C, 57D, 57E, and 57F show by flow cytometry (FIG.57A) and phase contrast microscopy (FIG.57B, FIG.57C, FIG.57D, FIG.57E, and FIG.57F) that PBMCs previously coincubated with 14-18-30 containing ENLSTTM cells are able to lyse unmodified tumor cells. At least two distinct subpopulations of the PBMC’s previously activated by coincubation with 14-18-30 ENLSTTM cells are capable of cytolysis of unmodified tumor cells.
  • FIG.57A shows the sorting gates for CD56, CD3 and CD8 of PBMCs following a 9 day coincubation with 14-18-30 expressing ENLSTTM cells in a primary mixed lymphocyte tumor cellassay
  • Example 8 In vivo xenograft mouse experiments [00790] Six week old female in-bred SCID mice are obtained from Charles River Laboratories (Hartford, CT, USA).
  • mice Animals are handled according to a protocol approved by the Institutional Animal Care and Use Committee of the facility. Mice are allowed to acclimate to animal housing.
  • a human tumor xenograft was established in NSG (NOD scid gamma mice (Jackson Laboratory). Human tumors were implanted on the flank of the NSG mice Human tumor cells were implanted on the flank of NGS (NOD scid gamma) mice and allowed to grow to 150 mm 3 . Mice were randomly divided into two groups, a control and a treated group, with 6 mice per group. The treated group was treated with expanded activated PBMCs comprising expanded activated serial killer cells activated by 14-18-30 expressing ENLSTTMcells.
  • FIG.58 is a box and whisker plot of shows results of a xenograft treatment study using NGS mice. The ends of each box are the upper and lower quartiles; the median is marked by a vertical line inside the box, and the whiskers are the two lines outside the box that extend to the highest and lowest observations. Human tumor cells were implanted on the flank of NGS (NOD scid gamma) mice.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Cell Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Mycology (AREA)
  • Oncology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Virology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2020/056698 2019-10-22 2020-10-21 Compositions and methods for in vitro activation and expansion of serial killer t cell populations and passive immunization of a cancer patient with tumor cell killing cells Ceased WO2021081115A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
CA3154876A CA3154876A1 (en) 2019-10-22 2020-10-21 Compositions and methods for in vitro activation and expansion of serial killer t cell populations and passive immunization of a cancer patient with tumor cell killing cells
MX2022004772A MX2022004772A (es) 2019-10-22 2020-10-21 Composiciones y métodos para la activación y la expansión in vitro de poblaciones de linfocitos t citolíticos en serie e inmunización pasiva de un paciente de cáncer con células tumorales asesinas.
KR1020227013669A KR20220103928A (ko) 2019-10-22 2020-10-21 시험관 내 활성화 및 연쇄 살해 t 세포 집단의 확장 및 종양 세포 사멸 세포로 암 환자의 수동 면역화를 위한 조성물 및 방법
IL292355A IL292355A (en) 2019-10-22 2020-10-21 Compositions and methods for in vitro activation and expansion of serial killer t-cell populations and passive vaccination of a cancer patient with tumor cell-killing cells
JP2022524134A JP7752424B2 (ja) 2019-10-22 2020-10-21 シリアルキラーt細胞集団のインビトロ活性化及び拡大、ならびに腫瘍細胞殺傷細胞を有するがん患者の受動免疫化のための組成物及び方法
AU2020371619A AU2020371619A1 (en) 2019-10-22 2020-10-21 Compositions and methods for in vitro activation and expansion of serial killer T cell populations and passive immunization of a cancer patient with tumor cell killing cells
EP20879429.7A EP4048291A4 (en) 2019-10-22 2020-10-21 COMPOSITIONS AND METHODS FOR IN VITRO ACTIVATION AND EXPANSION OF SERIAL KILLER T CELL POPULATIONS AND FOR PASSIVE IMMUNIZATION OF A CANCER PATIENT WITH TUMOR CELL KILLING CELLS

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US16/660,442 2019-10-22
US16/660,442 US10731128B2 (en) 2016-11-22 2019-10-22 Compositions and methods for in vitro activation and expansion of serial killer T cell populations and passive immunization of a cancer patient with tumor cell killing cells

Publications (1)

Publication Number Publication Date
WO2021081115A1 true WO2021081115A1 (en) 2021-04-29

Family

ID=75619361

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/056698 Ceased WO2021081115A1 (en) 2019-10-22 2020-10-21 Compositions and methods for in vitro activation and expansion of serial killer t cell populations and passive immunization of a cancer patient with tumor cell killing cells

Country Status (8)

Country Link
EP (1) EP4048291A4 (https=)
JP (1) JP7752424B2 (https=)
KR (1) KR20220103928A (https=)
AU (1) AU2020371619A1 (https=)
CA (1) CA3154876A1 (https=)
IL (1) IL292355A (https=)
MX (1) MX2022004772A (https=)
WO (1) WO2021081115A1 (https=)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113403274A (zh) * 2021-06-28 2021-09-17 上海睿臻迈生物医疗科技有限公司 细胞治疗组合物及其制备方法和作为过敏性反应及自身免疫疾病治疗药物的应用
CN114875069A (zh) * 2022-04-22 2022-08-09 四川大学 基因工程修饰的il2细胞因子的重组载体、宿主细胞及其用途
CN116970562A (zh) * 2023-09-22 2023-10-31 北京翊博生物集团有限公司 一种抗原特异性t细胞的制备方法及其在免疫治疗中的应用
CN119320750A (zh) * 2024-10-15 2025-01-17 南开大学 Tnfsf15蛋白在制备促进肥大细胞激活的产品中的应用
WO2024221005A3 (en) * 2023-04-21 2025-03-13 H. Lee Moffitt Cancer Center And Research Institute, Inc. Methods for inhibiting resistance to immune blockade inhibitor therapy

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020006413A1 (en) * 2000-01-27 2002-01-17 Sobol Robert E. Genetically engineered tumor cell vaccines
US20030100074A1 (en) * 2001-08-16 2003-05-29 Guo-Liang Yu Methods and compositions for treating metabolic bone diseases relating to human endokine alpha
US20100150950A1 (en) * 2006-12-14 2010-06-17 Medarex, Inc. Human antibodies that bind cd70 and uses thereof
US20110014162A1 (en) * 2009-07-10 2011-01-20 Mark Lowdell Preserved Compositions of Activated NK Cells and Methods of Using the Same
US20180185463A1 (en) * 2016-11-22 2018-07-05 Alloplex Biotherapeutics Allogenic tumor cell vaccine
US20180267024A1 (en) * 2015-06-08 2018-09-20 Lophius Biosciences Gmbh Composition for determination of cell-mediated immune responsiveness
US20190038671A1 (en) * 2016-02-04 2019-02-07 Nanjing Legend Biotech Co., Ltd. Engineered mammalian cells for cancer therapy

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020006413A1 (en) * 2000-01-27 2002-01-17 Sobol Robert E. Genetically engineered tumor cell vaccines
US20030100074A1 (en) * 2001-08-16 2003-05-29 Guo-Liang Yu Methods and compositions for treating metabolic bone diseases relating to human endokine alpha
US20100150950A1 (en) * 2006-12-14 2010-06-17 Medarex, Inc. Human antibodies that bind cd70 and uses thereof
US20110014162A1 (en) * 2009-07-10 2011-01-20 Mark Lowdell Preserved Compositions of Activated NK Cells and Methods of Using the Same
US20180267024A1 (en) * 2015-06-08 2018-09-20 Lophius Biosciences Gmbh Composition for determination of cell-mediated immune responsiveness
US20190038671A1 (en) * 2016-02-04 2019-02-07 Nanjing Legend Biotech Co., Ltd. Engineered mammalian cells for cancer therapy
US20180185463A1 (en) * 2016-11-22 2018-07-05 Alloplex Biotherapeutics Allogenic tumor cell vaccine

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP4048291A4 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113403274A (zh) * 2021-06-28 2021-09-17 上海睿臻迈生物医疗科技有限公司 细胞治疗组合物及其制备方法和作为过敏性反应及自身免疫疾病治疗药物的应用
CN113403274B (zh) * 2021-06-28 2023-11-10 上海睿臻迈生物医疗科技有限公司 细胞治疗组合物及其制备方法和作为过敏性反应及自身免疫疾病治疗药物的应用
CN114875069A (zh) * 2022-04-22 2022-08-09 四川大学 基因工程修饰的il2细胞因子的重组载体、宿主细胞及其用途
CN114875069B (zh) * 2022-04-22 2023-09-15 四川大学 基因工程修饰的il2细胞因子的重组载体、宿主细胞及其用途
WO2024221005A3 (en) * 2023-04-21 2025-03-13 H. Lee Moffitt Cancer Center And Research Institute, Inc. Methods for inhibiting resistance to immune blockade inhibitor therapy
CN116970562A (zh) * 2023-09-22 2023-10-31 北京翊博生物集团有限公司 一种抗原特异性t细胞的制备方法及其在免疫治疗中的应用
CN116970562B (zh) * 2023-09-22 2024-01-02 北京翊博生物集团有限公司 一种抗原特异性t细胞的制备方法及其在免疫治疗中的应用
CN119320750A (zh) * 2024-10-15 2025-01-17 南开大学 Tnfsf15蛋白在制备促进肥大细胞激活的产品中的应用

Also Published As

Publication number Publication date
CA3154876A1 (en) 2021-04-29
JP7752424B2 (ja) 2025-10-10
EP4048291A1 (en) 2022-08-31
JP2022553411A (ja) 2022-12-22
MX2022004772A (es) 2022-07-19
IL292355A (en) 2022-06-01
AU2020371619A1 (en) 2022-05-12
KR20220103928A (ko) 2022-07-25
EP4048291A4 (en) 2024-01-17

Similar Documents

Publication Publication Date Title
US10731128B2 (en) Compositions and methods for in vitro activation and expansion of serial killer T cell populations and passive immunization of a cancer patient with tumor cell killing cells
US12403186B2 (en) Allogeneic tumor cell vaccine
TWI875709B (zh) 製備表現嵌合抗原受體的細胞之方法
JP7752424B2 (ja) シリアルキラーt細胞集団のインビトロ活性化及び拡大、ならびに腫瘍細胞殺傷細胞を有するがん患者の受動免疫化のための組成物及び方法
TW202134264A (zh) 嵌合抗原受體及其用途
US11185586B2 (en) Allogeneic tumor cell vaccine
JP2019514393A (ja) 細胞に基づくネオ抗原ワクチンおよびその使用
KR20140135715A (ko) 항종양 활성 및 car 지속을 증진시키기 위한 icos 기반 car의 용도
JP2025163127A (ja) 同種異系腫瘍細胞ワクチン
Kusumoto et al. Epithelial membrane protein 3 (Emp3) downregulates induction and function of cytotoxic T lymphocytes by macrophages via TNF-α production
TW202140790A (zh) 病毒載體轉導細胞的方法
KR20260016919A (ko) 제시된 hpv16-, mart1-, cmv-, ebv-, 또는 인플루엔자-펩티드에 결합하는 t 세포 수용체
US20240382591A1 (en) Methods and composition using patient-derived autologous neoantigens for treating cancer
RU2822196C2 (ru) Способы получения клеток, экспрессирующих химерный антигенный рецептор
HK40048881A (en) Methods of making chimeric antigen receptor-expressing cells
Nawaf Abrogation of CD4 driven autoimmunity associated with tumour immunotherapy while preserving anti-tumour CD8 mediated immunity

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20879429

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3154876

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2022524134

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020371619

Country of ref document: AU

Date of ref document: 20201021

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020879429

Country of ref document: EP

Effective date: 20220523