WO2021076444A1 - Methods for treating breast cancer - Google Patents
Methods for treating breast cancer Download PDFInfo
- Publication number
- WO2021076444A1 WO2021076444A1 PCT/US2020/055219 US2020055219W WO2021076444A1 WO 2021076444 A1 WO2021076444 A1 WO 2021076444A1 US 2020055219 W US2020055219 W US 2020055219W WO 2021076444 A1 WO2021076444 A1 WO 2021076444A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- dapansutrile
- breast cancer
- tumor
- mice
- subject
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- OFKZBRLNSHGETP-UHFFFAOYSA-N CS(CCCN=C)(=O)=O Chemical compound CS(CCCN=C)(=O)=O OFKZBRLNSHGETP-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/275—Nitriles; Isonitriles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/24—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
- C07K16/244—Interleukins [IL]
- C07K16/245—IL-1
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2818—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
Definitions
- the present invention relates to methods for treating breast cancer by administering an effective amount of dapansutrile.
- Tumorigenesis is initiated by genomic alterations including point mutations, gene deletion, chromosomal rearrangements leading to cell transformation, self-sufficient proliferation, insensitivity to anti-proliferative signals, evasion of apoptosis and unlimited replicative potential, leading ultimately to tissue invasion and metastasis.
- genomic alterations including point mutations, gene deletion, chromosomal rearrangements leading to cell transformation, self-sufficient proliferation, insensitivity to anti-proliferative signals, evasion of apoptosis and unlimited replicative potential, leading ultimately to tissue invasion and metastasis.
- expansion of tumor cells is linked to a complex network of events that involve both cancer and non-cancer cells. Chronic inflammation is a classic example of such promoting conditions (1, 2).
- IL-Ib The pro-inflammatory cytokine IL-Ib is a potent mediator of many chronic inflammatory diseases (3). Consistent with the linkage of cancer to chronic inflammation, it has been shown that IL-Ib is over-expressed in several tumors and functions as an inducer of tumor promoting mechanisms including angiogenesis, immunosuppression, recruitment of tumor-associated macrophages (TAMs) and metastasis (4-6).
- Types of breast cancer include ductal carcinoma in situ (DCIS), invasive ductal carcinoma (IDC), triple negative breast cancer (TNBC), inflammatory breast cancer (IBC), metastatic breast cancer, and breast cancer during pregnancy, among other types.
- DCIS ductal carcinoma in situ
- IDC invasive ductal carcinoma
- TNBC triple negative breast cancer
- IBC inflammatory breast cancer
- metastatic breast cancer metastatic breast cancer
- Triple negative breast cancer tumors are characterized by an absence of estrogen receptors (ER), progesterone receptors (PR), and elevated human epidermal growth factor receptor 2 (HER2) protein levels (7).
- ER estrogen receptors
- PR progesterone receptors
- HER2 human epidermal growth factor receptor 2
- NLRP3 (NOD-like receptor family, pyrin domain containing 3), also known as NLRP3 or cryopyrin, is one of the sensors of the inflammasome, a macromolecular structure involved in interleukin- 1b (IL-Ib) and IL-18 processing.
- NLRP3 senses intracellular danger during intracellular infections (bacterial and viral proteins) or tissue injury (ischemia).
- NLRP3 activation leads to recruitment of ASC (apoptosis-associated speck-like protein containing carboxyterminal caspase recruitment domain) and caspase-1 leading to inflammasome formation and ultimately cell death.
- Dapansutrile is a small, synthetic molecule of b-sulfonyl nitrile which has been demonstrated to selectively inhibit the NLRP3 inflammasome and be safe when orally administered to healthy subjects (8).
- the method should be effective and have no significant side effects.
- FIGS. 1A-1D depict a schematic overview of experimental design.
- FIG. 1C depicts a growth curve showing tumor volume in mice treated with dapansutrile compared with tumors in mice fed a standard diet. Measurements were taken from live mice on days as indicated.
- FIG. 1C (n 5).
- FIG. ID depicts a chart showing percent survival in mice fed a dapansutrile-enriched (OLT1177 ® ) diet. * p ⁇ 0.05.
- FIGS. 2A-2G depict a schematic overview of experimental design.
- FIG. 2B depicts a chart of tumor volume analysis showing that tumor volume is reduced in mice treated with dapansutrile (OLT1177 ® ) and mice treated with dapansutrile and anti-ILla.
- FIG. 2C depicts a growth curve showing that tumors in mice treated with dapansutrile compared to mice treated with a vehicle control. Measurements were taken from live mice on days as indicated.
- FIG. 2C (n 5).
- FIGS. 2D and 2E depict charts showing relative mRNA expression levels of TSLP (FIG. 2D) and its associated receptor ( TSLPR ; FIG. 2E) in primary 4T1 tumors from mice treated with dapansutrile compared to mice treated with a vehicle control. * p ⁇ 0.05 (n 8, two independent experiments).
- FIGS. 3A-3E depicts a schematic overview of experimental design.
- FIG. 3B depicts a chart showing tumor volume in 4T1 TNBC mice treated with dapansutrile (OLT1177 ® ), anti-PD-1, both anti-PD-1 and dapansutrile, or vehicle. Measurements were taken following tumor resection.
- FIG. 3A depicts a schematic overview of experimental design.
- FIG. 3B depicts a chart showing tumor volume in 4T1 TNBC mice treated with dapansutrile (OLT1177 ® ), anti-PD-1, both anti-PD-1 and dapansutrile, or vehicle. Measurements were taken following tumor resection.
- FIG. 3B (ve
- FIG. 3C depicts a growth curve showing tumor volume over 15 days in mice treated with anti-PD-1, dapansutrile, both anti-PD-1 and dapansutrile, or vehicle. Measurements were taken from live mice on days as indicated.
- FIG. 3C (n 5).
- FIGS. 4A-4C depict a schematic overview of experimental design.
- FIG. 4B depicts a chart quantifying IL-22 levels in splenocytes of mice treated with dapansutrile (OLT1177 ® ), anti-PD-1, both anti-PD-1 and dapansutrile, or vehicle.
- FIG. 4C depicts a chart quantifying INFy levels in splenocytes of mice treated dapansutrile, anti-PD-1, both anti-PD-1 and dapansutrile, or vehicle.
- Dapansutrile is a selective NLRP3 inflammasome inhibitor; dapansutrile reduces inflammation by preventing activation of the NLRP3 inflammasome. Dapansutrile inhibits the production of mature IL-Ib and IL-18 in mice and in human cells in vitro. Through this mechanism of action, dapansutrile prevents production and/or release of IL-Ib and inhibits the formation of NLRP3 inflammasome in animals and human subjects.
- the present invention is directed to a method of treating breast cancer, by administering an effective amount of dapansutrile to a subject.
- dapansutrile By inhibiting IL-Ib, a main driver of breast tumor progression, dapansutrile reduces tumor volume and/or prevents tumor from further growth.
- the present invention uses purified dapansutrile (3-methanesulfonyl-propionitrile), or the pharmaceutically acceptable salts or solvate thereof.
- “Pharmaceutically acceptable salts,” as used herein, are salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects.
- “Pharmaceutically acceptable solvates,” as used herein, are solvates that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects. “Solvates,” as used herein, are addition complexes in which the compound is combined with an acceptable co-solvent in some fixed proportion. Co-solvents include, but are not limited to, water, acetic acid, ethanol, and other appropriate organic solvents.
- the active compound dapansutrile, or its pharmaceutically acceptable salt or solvate in the pharmaceutical compositions in general is in an amount of about 0.1-5% for an injectable formulation, about 1-90% for a tablet formulation, 1-100% for a capsule formulation, about 0.01-20%, 0.05-20%, 0.1-20%, 0.2-15%, 0.5-10%, or 1-5% (w/w) for a topical formulation, and about 0.1-5% for a patch formulation.
- Pharmaceutically acceptable carriers which are inactive ingredients, can be selected by those skilled in the art using conventional criteria.
- Pharmaceutically acceptable carriers include, but are not limited to, non-aqueous based solutions, suspensions, emulsions, microemulsions, micellar solutions, gels, and ointments.
- the pharmaceutically acceptable carriers may also contain ingredients that include, but are not limited to, saline and aqueous electrolyte solutions; ionic and nonionic osmotic agents such as sodium chloride, potassium chloride, glycerol, and dextrose; pH adjusters and buffers such as salts of hydroxide, phosphate, citrate, acetate, borate; and trolamine; antioxidants such as salts, acids and/or bases of bisulfite, sulfite, metabi sulfite, thiosulfite, ascorbic acid, acetyl cysteine, cystein, glutathione, butylated hydroxyanisole, butylated hydroxytoluene, tocopherols, and ascorbyl palmitate; surfactants such as lecithin, phospholipids, including but not limited to phosphatidylcholine, phosphatidylethanolamine and phosphatidyl inositiol; polox
- Such pharmaceutically acceptable carriers may be preserved against bacterial contamination using well-known preservatives, these include, but are not limited to, benzalkonium chloride, ethylene diamine tetra-acetic acid and its salts, benzethonium chloride, chlorhexidine, chlorobutanol, methylparaben, thimerosal, and phenylethyl alcohol, or may be formulated as a non-preserved formulation for either single or multiple use.
- preservatives include, but are not limited to, benzalkonium chloride, ethylene diamine tetra-acetic acid and its salts, benzethonium chloride, chlorhexidine, chlorobutanol, methylparaben, thimerosal, and phenylethyl alcohol, or may be formulated as a non-preserved formulation for either single or multiple use.
- a tablet formulation or a capsule formulation of dapansutrile may contain other excipients that have no bioactivity and no reaction with the active compound.
- Excipients of a tablet may include fillers, binders, lubricants and glidants, disintegrators, wetting agents, and release rate modifiers.
- Binders promote the adhesion of particles of the formulation and are important for a tablet formulation. Examples of binders include, but not limited to, carboxymethylcellulose, cellulose, ethylcellulose, hydroxypropylmethylcellulose, methylcellulose, karaya gum, starch, starch, and tragacanth gum, poly(acrylic acid), and polyvinylpyrrolidone.
- a patch formulation of dapansutrile may comprise some inactive ingredients such as 1,3-butylene glycol, dihydroxyaluminum aminoacetate, disodium edetate, D-sorbitol, gelatin, kaolin, methylparaben, polysorbate 80, povidone, propylene glycol, propylparaben, sodium carboxymethylcellulose, sodium polyacrylate, tartaric acid, titanium dioxide, and purified water.
- a patch formulation may also contain skin permeability enhancer such as lactate esters ( e.g ., lauryl lactate) or di ethylene glycol monoethyl ether.
- Topical formulations including dapansutrile can be in a form of gel, cream, lotion, liquid, emulsion, ointment, spray, solution, and suspension.
- the inactive ingredients in the topical formulations for example include, but not limited to, lauryl lactate (emollient/permeation enhancer), diethylene glycol monoethylether (emollient/permeation enhancer), DMSO (solubility enhancer), silicone elastomer (rheology/texture modifier), caprylic/capric triglyceride, (emollient), octisalate, (emollient/UV filter), silicone fluid (emollient/diluent), squalene (emollient), sunflower oil (emollient), and silicone dioxide (thickening agent).
- diethylene glycol monoethylether is included in the topical gel formulation.
- dapansutrile By inhibiting assembly of the NLRP3 inflammasome, dapansutrile prevents the production and/or release of proinflammatory cytokines IL-Ib and IL-22, and ultimately treating breast cancer tumor growth.
- the present invention is directed to a method of treating breast cancer.
- the method comprises a step of administering to a subject in need thereof an effective amount of dapansutrile.
- An effective amount is the amount effective to treat a disease by ameliorating the pathological condition, and/or reducing, improving, and/or eliminating the symptoms of the disease.
- an effective amount is an amount that reduces the growth of breast cancer, and/or reduces the breast tumor size.
- Breast cancer suitable to be treated by the present method includes triple negative breast cancer (TNBC), ductal carcinoma in situ (DCIS), invasive ductal carcinoma (IDC), inflammatory breast cancer (IBC), metastatic breast cancer, and breast cancer during pregnancy, among other types.
- TNBC triple negative breast cancer
- DCIS ductal carcinoma in situ
- IBC invasive ductal carcinoma
- IBC inflammatory breast cancer
- metastatic breast cancer metastatic breast cancer, and breast cancer during pregnancy, among other types.
- Checkpoint inhibitor therapy is a form of cancer immunotherapy.
- the therapy targets immune checkpoints, key regulators of the immune system that when stimulated can dampen the immune response to an immunologic stimulus. Some cancers can protect themselves from attack by stimulating immune checkpoint targets.
- Immunotherapy has significantly improved the standard of care for breast cancer patients; however, non-responders and the number of relapsing patients are still high. Therefore, combination therapies that increase the efficacy of checkpoint inhibitors represent an important clinical benefit.
- the present invention is directed to a combination therapy by combining dapansutrile and a checkpoint inhibitor for treating breast cancer.
- the method comprises administering an effective amount of dapansutrile and an effective amount of a checkpoint inhibitor to a subject in need thereof.
- Dapansutrile and a checkpoint inhibitor can be administered simultaneously or sequentially. It is advantageous to co-administer dapansutrile with a checkpoint inhibitor because dapansutrile may improve the efficacy of a checkpoint inhibitor and dapansutrile has a safe drug profile.
- the co-administration may also reduce the required dosage of the checkpoint inhibitor, which reduces immunotherapy-related adverse events.
- Checkpoint inhibitors suitable for use with dapansutrile for treating breast cancer include cytotoxic T lymphocyte associated protein 4 (CTLA-4), programmed cell death protein 1 (PD-1), and programmed death ligand 1 (PD-L1).
- CTL-4 cytotoxic T lymphocyte associated protein 4
- PD-1 programmed cell death protein 1
- PD-1 is found on the surface of T cells and is the receptor for PD-L1. PD-1 plays a role in down-regulating immune responses by suppressing inflammatory T cell activity. This mechanism helps the body to prevent autoimmune diseases, however, the mechanism can also prevent the cancer cells from being killed (9).
- the checkpoint inhibitor is an anti-PD-1 antibody.
- the method comprises administering an effective amount of dapansutrile and an effective amount of anti-PD-1 antibody to a subject in need thereof. Dapansutrile and anti-PD-1 antibody can be administered simultaneously or sequentially. It is advantageous to co-administer dapansutrile with anti-PD-1 antibody because dapansutrile improves the efficacy of anti-PD-1 and dapansutrile has a safe drug profile. The co-administration may also reduce the required dosage of anti-PD-1 antibody, which reduces immunotherapy-related adverse events.
- the inventors have demonstrated that dapansutrile treatment reduces tumor growth of 4T1 TNBC in mice compared to vehicle.
- dapansutrile reduces tumor promoting IL-22 and increases INFy in splenocytes of treated mice.
- the pharmaceutical composition of the present invention can be applied by systemic administration or local administration.
- Systemic administration includes, but is not limited to oral, parenteral (such as intravenous, intramuscular, subcutaneous or rectal), and inhaled administration.
- parenteral such as intravenous, intramuscular, subcutaneous or rectal
- inhaled administration In systemic administration, the active compound first reaches plasma and then distributes into target tissues.
- Oral administration is a preferred route of administration for the present invention.
- Local administration includes topical administration.
- Dosing of the composition can vary based on the extent of the subject’s breast cancer and each patient’s individual response.
- plasma concentrations of the active compound delivered can vary; but are generally lxlO 10 -lxlO 4 moles/liter, and preferably Ixl0 8 -lxl0 5 moles/liter.
- the pharmaceutical composition is administrated orally to a subject.
- the dosage for oral administration is generally at least 1 mg/kg/day and less than 100 mg/kg/day, preferably 5-100 mg/kg/day, depending on the subject’s age and condition.
- the dosage for oral administration is 1-10, or 1-50, or 1-100, or 5-50, or 5-100, or 10-50, or 10-100 mg/kg/day for a human subject.
- the dosage for oral administration is 100-10,000 mg/day, and preferably 100-2500, 500-2500, 500-4000, 1000- 5000, 2000-5000, 2000-6000, or 2000-8000 mg/day for a human subject.
- the drug can be orally taken once, twice, three times, or four times a day.
- the patient is treated daily for 14 days up to 1 month, 2 months, or 3 months or for lifespan.
- the pharmaceutical composition is administrated intravenously to a subject.
- the dosage for intravenous bolus injection or intravenous infusion is generally 0.03 to 5 or 0.03 to 1 mg/kg/day.
- the pharmaceutical composition is administrated subcutaneously to the subject.
- the dosage for subcutaneous administration is generally 0.3-20, 0.3-3, or 0.1- 1 mg/kg/day.
- the composition is applied topically.
- the composition is topically applied at least 1 or 2 times a day, or 3 to 4 times per day, depending on the medical issue and the disease pathology.
- the topical composition comprises about 0.01- 20%, or 0.05-20%, or 0.1-20%, or 0.2-15%, 0.5-10, or 1-5 % (w/w) of the active compound.
- 0.2-10 mL of the topical composition is applied to the individual per dose.
- the present invention is useful in treating a mammal subject, such as humans, horses, dogs and cats.
- the present invention is particularly useful in treating humans.
- the mammary carcinoma cell lines 4T1, E0771, and MDA-468 were obtained from ATCC (Manassas, VA). Cells were cultured in DMEM supplemented with 10% FBS, 100 units/mL penicillin, 0.1 mg/ml streptomycin. Cells were maintained in a humidified 5% CO2 atmosphere at 37°C.
- Tslp forward 5’-TACTCTCAATCCTATCCCTGGCTG-3’ (SEQ ID NO: 1); Tslp reverse, 5’-TGTGAGGTTTGATTCAGGCAGATG-3’(SEQ ID NO: 2); Tslpr forward, 5’- TGACGTCACGGGGTGATGTC-3 ’ (SEQ ID NO: 3); Tslpr reverse, 5’- GAGGATGC ACCCGGAAGTGA-3 ’ (SEQ ID NO: 4); PdcdlLl forward, 5’- GCTCCAAAGGACTTGTACGTG3 ’ (SEQ ID NO: 5); PdcdlLl reverse, 5’- TGATCTGAAGGGCAGCATTTC3 ’ (SEQ ID NO: 6).
- mice Female BALB/c mice, 6-8 weeks old (The Jackson Laboratory), were fed standard or dapansutrile (OLT1177®) diet (4), which was started on the day of 4T1 injection.
- 4Tlcells (2xl0 5 ) were injected orthotopically into the mammary fat pad. Mice treated with dapansutrile were fed ad libidum with food pellets containing 7.5 g/kg dapansutrile, which started on the day of the 4T1 injection and continued for 15 days.
- mice typically consume about 4 g of food per day, resulting in an approximate daily dose of 0 mg/kg/day for control groups and 1,000 mg/kg/day for the treatment groups.
- This food pellet concentration (7.5g/kg of dapansutrile in food) in mouse chow resulted in a blood level nearly the same as that of humans treated orally with dapansutrile at doses of 1000 mg/day (40 pg/mL blood level) (14).
- Control (“vehicle”) mice were fed with control food pellets without dapansutrile. Mice were sacrificed following 15 days after 4T1 injection.
- 4T1 cells were injected as described. After instillation of 4T1 cells, mice were started on dapansutrile (OLT1177®) diet or continued on standard diet as described and at day seven a neutralizing antibody against PD-1 (200pg/mouse; BioXCell, West Riverside, NH) was injected peritoneally. Mice were sacrificed following 15 days from the B16F10 instillation.
- OHT1177® dapansutrile
- a neutralizing antibody against PD-1 200pg/mouse
- BioXCell West Lebanon, NH
- 4T1 cells were injected as described. After instillation of 4T1 cells, mice were started on dapansutrile (OLT1177®) diet or continued on standard diet as described and every three days a neutralizing antibody against anti-IL-la (200pg/mouse; XBioTech, Austin, TX) was injected peritoneally. Mice were sacrificed following 15 days from the B16F10 instillation.
- OHT1177® dapansutrile
- XBioTech Austin, TX
- Splenocyte Cytokine Secretion 4T1 cells were injected as described. Spleens from tumor-bearing mice were processed for cell culture through mechanical dissociation. Cells suspended in RPMI supplemented with 10% FBS, 100 units/mL penicillin, 0.1 mg/ml streptomycin and were plated at 5.0e A 5 and stimulated with 10pg/mL LPS. After 72 hours, supernatants were removed and cytokines were measured via ELISA (R&D Systems, Minneapolis, MN).
- 4T1 TNBC mice were generated and fed a standard diet or a dapansutrile diet for 15 days. Tumors were measured on indicated days to generate a growth curve (FIG. 1C). Final tumor volume was taken following resection of the tumors (FIG. IB). Tumor-bearing mice fed a dapansutrile diet showed significantly decreased tumor volume (FIG. IB, ** /> ⁇ 0.01).
- FIGS. 1 A-1D show that dapansutrile reduced tumor volume and resulted in significantly higher survival rates in a mouse model for triple-negative breast cancer (4T1 TNBC mice).
- Example 2 Dapansutrile reduces breast tumor volume alone and when co-administered with anti-IL-la
- FIGS. 2B and 2C show significantly reduced tumor volumes (* p ⁇ 0.05) for tumor-bearing mice treated with a dapansutrile diet alone and in combination with IL-la when compared to vehicle.
- mice treated with dapansutrile was effective in reducing tumor volumes, whereas anti-IL-la monotherapy did not significantly reduce tumor volumes.
- IL-Ib may have stronger tumor-promoting effects than IL-la in 4T1 TNBC.
- TSLP thymic stromal lymphopoietin
- FIGS. 2D and 2E show significantly lower TSLP and TSLPR expression (* / 0.05) in tumor bearing mice treated with a dapansutrile diet compared to vehicle. This analysis was performed on the same mice as in FIGS. 2B and 2C.
- inventors used the human TNBC cell line MDA-468. MDA-468 cells were stimulated with IL-la (20ng/mL) and incubated with dapansutrile (IOmM) or without dapansutrile (control) for 24 hours.
- FIGS. 2F and 2G show significantly lower TSLP and TSLPR expression (* p ⁇ 0.05) compared to controls.
- Example 3 Dapansutrile reduces breast tumor volume alone and when co-administered with anti-PD-1
- 4T1 TNBC mice were generated and fed a standard diet or a dapansutrile diet for 15 days. Mice receiving a combination therapy were injected with anti-PD-1 on day 7 as indicated (FIG. 3 A).
- FIGS. 3B and 3C The results are shown in FIGS. 3B and 3C.
- Tumor volume measurements were taken from tumors on mice in vivo on the days indicated in FIG. 3C. Following sacrifice on day 15, tumors were removed and tumor volume measured as shown in FIG. 3B.
- FIG. 3D 4T1 tumors from mice fed a dapansutrile diet expressed significantly less PD-L1 gene expression than mice fed a standard diet as quantified by relative mRNA expression.
- IL-la stimulation was used to simulate cell death signaling in the tumor- microenvironment.
- Cells were stimulated with IL-la at lOng/mL and treated with dapansutrile at the indicated concentration or untreated (vehicle).
- Example 4 Dapansutrile reduces IL-22 and increases INFy in splenocytes
- cytokine IL-22 Recent insight into the cytokine IL-22 has revealed a tumor-promoting role in breast cancer in that it recruits immunosuppressive cells to the tumor-microenvironment (11). Experiments were performed here to examine cytokine production in spleens from tumor bearing mice after monotherapy of dapansutrile and anti-PD-1, and also in combination.
- mice were generated and fed a standard diet or a dapansutrile diet for 15 days. Mice were injected with anti-PD-1 in a combination study on day 7 as indicated in FIG. 4A.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Mycology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Endocrinology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP20877745.8A EP4045009A4 (en) | 2019-10-14 | 2020-10-12 | METHOD FOR TREATING BREAST CANCER |
| JP2022522322A JP2022551672A (ja) | 2019-10-14 | 2020-10-12 | 乳癌治療法 |
| AU2020366300A AU2020366300A1 (en) | 2019-10-14 | 2020-10-12 | Methods for treating breast cancer |
| CN202080071066.3A CN114555053B (zh) | 2019-10-14 | 2020-10-12 | 治疗乳腺癌的方法 |
| US17/659,121 US12582628B2 (en) | 2019-10-14 | 2022-04-13 | Methods for treating breast cancer |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201962914833P | 2019-10-14 | 2019-10-14 | |
| US62/914,833 | 2019-10-14 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US17/659,121 Continuation US12582628B2 (en) | 2019-10-14 | 2022-04-13 | Methods for treating breast cancer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2021076444A1 true WO2021076444A1 (en) | 2021-04-22 |
Family
ID=75538857
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2020/055219 Ceased WO2021076444A1 (en) | 2019-10-14 | 2020-10-12 | Methods for treating breast cancer |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US12582628B2 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4045009A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2022551672A (cg-RX-API-DMAC7.html) |
| CN (1) | CN114555053B (cg-RX-API-DMAC7.html) |
| AU (1) | AU2020366300A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2021076444A1 (cg-RX-API-DMAC7.html) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4463147A4 (en) * | 2022-01-10 | 2025-12-31 | Olatec Therapeutics Inc | METHODS OF TREATMENT FOR PANCREATIC CANCER |
| EP4487122A4 (en) * | 2022-03-02 | 2026-03-11 | Olatec Therapeutics Inc | TREATMENT METHODS FOR PATIENTS WITH SOLID CANCER AND CLONAL HEMATOPOIESIS OF UNDETERMINED POTENTIAL |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018129347A1 (en) * | 2017-01-06 | 2018-07-12 | Olatec Therapeutics Llc | Methods for treating cardiovascular diseases |
| WO2018129231A1 (en) * | 2017-01-06 | 2018-07-12 | Olatec Therapeutics Llc | Method for treating multiple sclerosis |
| WO2019152627A1 (en) * | 2018-01-31 | 2019-08-08 | Olatec Therapeutics Llc | Method for preventing or treating alzheimer's disease |
| WO2019182981A1 (en) | 2018-03-21 | 2019-09-26 | Olatec Therapeutics Llc | Methods for treating melanoma |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2651407B1 (en) | 2010-12-15 | 2016-12-21 | Olatec Industries LLC | 3-methanesulfonylpropionitrile for treating inflammation and pain |
| PL2914264T3 (pl) * | 2012-11-02 | 2017-12-29 | Merck Patent Gmbh | Pochodna 6-okso-1,6-dihydropirydazyny do zastosowania w leczeniu raka wątrobowokomórkowego (hcc) |
| PE20170255A1 (es) * | 2014-01-24 | 2017-03-22 | Dana Farber Cancer Inst Inc | Moleculas de anticuerpo que se unen a pd-1 y usos de las mismas |
| WO2019032672A1 (en) * | 2017-08-11 | 2019-02-14 | Olatec Therapeutics Llc | METHOD OF TREATING SCHNITZLER SYNDROME |
-
2020
- 2020-10-12 EP EP20877745.8A patent/EP4045009A4/en active Pending
- 2020-10-12 AU AU2020366300A patent/AU2020366300A1/en active Pending
- 2020-10-12 WO PCT/US2020/055219 patent/WO2021076444A1/en not_active Ceased
- 2020-10-12 JP JP2022522322A patent/JP2022551672A/ja active Pending
- 2020-10-12 CN CN202080071066.3A patent/CN114555053B/zh active Active
-
2022
- 2022-04-13 US US17/659,121 patent/US12582628B2/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018129347A1 (en) * | 2017-01-06 | 2018-07-12 | Olatec Therapeutics Llc | Methods for treating cardiovascular diseases |
| WO2018129231A1 (en) * | 2017-01-06 | 2018-07-12 | Olatec Therapeutics Llc | Method for treating multiple sclerosis |
| WO2019152627A1 (en) * | 2018-01-31 | 2019-08-08 | Olatec Therapeutics Llc | Method for preventing or treating alzheimer's disease |
| WO2019182981A1 (en) | 2018-03-21 | 2019-09-26 | Olatec Therapeutics Llc | Methods for treating melanoma |
Non-Patent Citations (18)
| Title |
|---|
| B. GUO ET AL., SCI REP, vol. 6, 2016, pages 36107 |
| C. A. DINARELLO, BLOOD, vol. 117, 2011, pages 3720 - 3732 |
| C. A. DINARELLO, CANCER METASTASIS REV, vol. 29, 2010, pages 317 - 329 |
| C. MARCHETTI ET AL., ARTHRITIS RES THER, vol. 20, 2018, pages 169 |
| C. MARCHETTI ET AL., PROC NATL ACAD SCI, vol. 115, 2018, pages 1530 - 1539 |
| C. VOIGT ET AL., PROC NATL ACAD SCI, vol. 114, 2017, pages 12994 - 12999 |
| E.L. KUAN ET AL., NAT IMMUNOL, vol. 19, 2018, pages 366 - 374 |
| I. KAPLANOV ET AL., PROC NATL ACAD SCI, vol. 116, no. 4, 2019, pages 1361 - 1369 |
| K. L. LEE ET AL., CANCERS, vol. 11, no. 9, 2019, pages 1334 |
| KAPLANOV ET AL., PNAS, vol. 116, no. 4, 22 January 2019 (2019-01-22), pages 1361 - 1369 |
| KAPLANOV ET AL.: "Blocking IL -1beta Reverses the Immunosuppression in Mouse Breast Cancer and Synergizes with anti-PD-1 for Tumor Abrogation", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 116, no. Iss. 4, 22 January 2019 (2019-01-22), pages 1361 - 1369, XP055819543 * |
| N. L. SYN ET AL., LANCET ONCOLOGY, vol. 18, no. 12, 2017, pages 731 - 741 |
| P.M. RIDKER ET AL., LANCET, vol. 390, no. 10105, 2017, pages 1833 - 1842 |
| R. N. APTE ET AL., CANCER METASTASIS REV, vol. 25, 2006, pages 387 - 408 |
| S. SHALAPOUR ET AL., J CLIN INVEST, vol. 125, 2015, pages 3347 - 3355 |
| See also references of EP4045009A4 |
| T. C. WU ET AL., CANCER RES, vol. 78, no. 18, 2018, pages 5243 - 5258 |
| Y. GUO ET AL., CANCER RES, vol. 77, 2017, pages 6429 - 6441 |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4463147A4 (en) * | 2022-01-10 | 2025-12-31 | Olatec Therapeutics Inc | METHODS OF TREATMENT FOR PANCREATIC CANCER |
| EP4487122A4 (en) * | 2022-03-02 | 2026-03-11 | Olatec Therapeutics Inc | TREATMENT METHODS FOR PATIENTS WITH SOLID CANCER AND CLONAL HEMATOPOIESIS OF UNDETERMINED POTENTIAL |
Also Published As
| Publication number | Publication date |
|---|---|
| US20220249425A1 (en) | 2022-08-11 |
| CN114555053A (zh) | 2022-05-27 |
| JP2022551672A (ja) | 2022-12-12 |
| AU2020366300A1 (en) | 2022-06-02 |
| EP4045009A4 (en) | 2023-11-01 |
| CN114555053B (zh) | 2025-09-30 |
| EP4045009A1 (en) | 2022-08-24 |
| US12582628B2 (en) | 2026-03-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20130022609A1 (en) | Method of treating androgen independent prostate cancer | |
| US20210059985A1 (en) | Method for preventing and/or treating aging-associated cognitive impairment and neuroinflammation | |
| US12582628B2 (en) | Methods for treating breast cancer | |
| US11857529B2 (en) | Methods for treating melanoma | |
| US20210379143A1 (en) | Drug containing recombinant mistletoe lectins for treating | |
| EP4338742A1 (en) | Application of hydroxyprogesterone caproate in enhancing tumor treatment effect | |
| US20240417812A1 (en) | Methods for treating solid cancer patients with clonal hematopoiesis of indeterminate potential | |
| US20210386736A1 (en) | Combination therapy for treating cancer | |
| US20240358669A1 (en) | Methods for treating pancreatic cancer | |
| CN113905764A (zh) | 用于治疗癌症的前体半胱天冬酶-3活化作用和免疫疗法 | |
| WO2020026102A1 (en) | Combination therapy for treating cancer | |
| US9687472B2 (en) | Use of antioxidants as an adjuvant to immune stimulators to augment tumor immunity and prevent toxicity associated with oxidative stress |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20877745 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2022522322 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2020877745 Country of ref document: EP Effective date: 20220516 |
|
| ENP | Entry into the national phase |
Ref document number: 2020366300 Country of ref document: AU Date of ref document: 20201012 Kind code of ref document: A |
|
| WWG | Wipo information: grant in national office |
Ref document number: 202080071066.3 Country of ref document: CN |