WO2021041716A2 - Therapeutic editing to treat cardiomyopathy - Google Patents

Abstract

Described herein are guide RNAs that can be used to treat or inhibit the onset of cardiomyopathy.

Description

THERAPEUTIC EDITING TO TREAT CARDIOMYOPATHY

Priority Applications

This application claims benefit of priority to the filing date ofU.S. Provisional Application Ser. No. 62/892,856, filed August 28, 2019, the contents of which are specifically incorporated herein by reference in their entirety.

Government Support

This invention was made with government support under R01-HL130533 and R01-HL135358 awarded by the National Institutes of Health. The government has certain rights in the invention.

Background

Heart failure or heart disease are general terms denoting the inability of the heart to maintain an optimum cardiac output. In some instances, this deficiency of the heart is due to coronary artery disease, hypertension, diabetes and valvular heart disease. However, in many cases the deficiency is due to a pathology of the heart muscle itself. These various diseases are generally termed “cardiomyopathy” that can result from genetic disorders. Pathogenic heart failure and cardiomyopathy have traditionally been identified as a group of diseases including dilated cardiomyopathy (DCM), hypertrophic cardiomyopathy (HCM), restrictive cardiomyopathy (RCM), arrhythmogenic cardiomyopathy (AVC) and unclassified cardiomyopathy.

It is estimated that 750,000 people in the U.S. alone have DCM, and roughly half of these cases are familial. Of these familial cases it is estimated that more than 30 genes are involved with mutations in troponin accounting for approximately 20 percent of the cases. Similarly, familial hypertrophic cardiomyopathy is estimated to affect 640,000 people in the U.S., involving MYH7, MYBPC3, TNNT2, TNNI3, or combinations thereof. Unfortunately, methods to identify and treat the disease are hard to develop as many of those having cardiomyopathy are not diagnosed until the disease is well advanced or fatal. Moreover, other than heart transplantation, there are no available treatments for some types of cardiomyopathies. Summary

Disclosed herein are guide RNAs (gRNAs) to treat or inhibit the onset of one or more pathological mutation in the TNNT2 gene. The gRNAs can cleave TNNT2 reference alleles, or common variant alleles at a single nucleotide polymorphism (SNP) positions, to correct or delete segments of problematic TNNT2 alleles. In general, the reference and variant guide RNAs have at least one nucleotide sequence difference. For example, in some cases a guide RNA is used that cleaves at a site distinct from but correlated with a pathological TNNT2 mutation, such as a site upstream or downstream of the mutation. By using one or two of such guide RNAs, a pathological TNNT2 allele can be deleted. In other cases, a guide RNA is used that cleaves at or near a pathological TNNT2 mutation so that the pathological TNNΊ2 mutation can be corrected by endogenous mechanisms or by a corrective nucleic acid provided with the guide RNA.

Over 99% of the world’s population has one or two copies of variant alleles in their TNNT2 genes. Some of the SNP variants reside in exons 9, 11, and/or 14.

Having gRNAs that target the reference and the variant alleles can provide treatment of genetic disease allele in cis therewith for any heterozygous person.

For example, a first guide RNA with at least 95% sequence homology to TCAGCGCCTGCAACTCATTC (SEQ ID NO:l), a second guide RNA with at least 95% sequence homology to TCATGGTTTCCCGGTTTAGC (SEQ ID NO:2), a third guide RNA with at least 95% sequence homology to TGAGTTGCAGGCGC TGATCG (SEQ ID NO:3), where the underlined C is invariant in the third guide RNA, a fourth guide RNA with at least 95% sequence homology to TGAGTTGCAGGCGCTGATTG (SEQ ID NO:4), where the underlined T is the polymorphism and is invariant in the fourth guide RNA, a fifth guide RNA with at least 95% sequence homology to CAAACAACCTCACATCTGTG (SEQ ID NO: 5), where the underlined G is invariant in the fifth guide RNA, a sixth guide RNA with at least 95% sequence homology to CAAACAACCTCACATCTATG (SEQ ID NO:6), where the underlined A is invariant in the sixth guide RNA, a seventh guide RNA with at least 95% sequence homology to GCUGCUUGAACUUCUCCUGC, SEQ ID NO: 7), an eigth guide RNA with at least 95% sequence homology to GCUGCUUGAACCUCUCCUGC, SEQ ID NO:8); and where the guide RNA includes a Protospacer Adjacent Motif (PAM) sequence. The guide RNAs described herein are complimentary to the target sequence and will target the sense strand containing either the reference or SNP locus.

Vectors that encode one or more guide RNAs are described herein and can be used to express and/or deliver the guide RNAs to targeted cells. In some cases, the vector can also encode a corrective nuclease. In some cases, a separate vector can be used that encodes a corrective nuclease.

Also described are RNA-protein complexes (RNPs) that include one or more guide RNAs and one or more corrective nucleases.

Compositions that include a carrier and one or more of the guide RNAs, vectors encoding the guide RNAs, RNA-protein complexes (RNPs) that include the guide RNA, or a combination thereof are also described. Optionally, the compositions can include a corrective nuclease or a vector that encodes the corrective nuclease.

Cells that include one or more types of guide RNAs; or one or more vectors encoding a guide RNA; or one or more RNA-protein complexes (RNPs) are also described herein.

Further described are methods that include contacting one or more cells with one or more of the guide RNAs; or contacting one or more cells with one or more vectors encoding the guide RNAs; or contacting one or more cells with one or more RNA-protein complexes (RNPs) to produce one or more treated cells.

Also described are methods that involve administering to a subject one or more guide RNAs; or administering to a subject one or more vectors that encode one or more guide RNAs; or administering to a subject one or more vectors that encode one or more guide RNAs and vectors that encode one or more corrective nucleases; or administering to a subject one or more RNA-protein complexes (RNP) that include one or more guide RNAs.

The subject to whom the cells, guide RNAs, vectors, or RNA-protein complexes (RNPs) are administered can have cardiomyopathy. In some cases, the subject to whom the cells, guide RNAs, vectors, or RNA-protein complexes (RNPs) are administered can have dilated cardiomyopathy.

Description of Figures

FIG. 1 illustrates the chromosomal structures of two induced pluripotent stem (iPS) cell lines generated from cells of a patient with a heterozygous TNNT2 mutation within exon 11, and the gRNAs described herein. This mutation is dominant negative and causes an arginine at position 173 to be replaced by tryptophan (TNNT2^R173W) in the cTnT polypeptide. The first iPS cell line had a knockout of the disease containing TNNT2 allele, while the second had a knockout of the healthy TNNT2 allele. FIG. 1 A schematically illustrates a knock-out of the disease-containing allele by Tr3. FIG. IB schematically illustrates excising the disease-containing portion of the TNNT2 allele by duplexing gRNAs Tr3 and Trl3. FIG. 1C schematically illustrates a knock-out of the healthy allele by Tr4. FIG. ID schematically illustrates excision of exons 9 to 11 in the healthy allele by Tr4 and Trl4. FIG. IE schematically illustrates a knockout of both TNNT2 alleles.

FIG. 2 graphically illustrates the editing efficiency of several guide RNAs made as described herein.

FIG. 3 illustrates one example of editing over time for an RNP introduced into cells by nucleofection.

FIG. 4 illustrates an example in which plasmids encoding a guide RNA sequence and a Tet-inducible Cas9 are transfected into a cell line.

FIG. 5A-5C illustrate the frequency and some structural features of the rs3730238 SNP. FIG. 5A shows pie charts illustrating the frequency of the rs3730238 SNP, and the genotype frequency of the rs3730238 SNP in the population. FIG. 5B is a schematic diagram of the TNNT2 gene, showing the positions of some of the SNPs described herein. FIG. 5C illustrates a portion of the TNNT2 exon 14 sequence, illustrating the position of the rs3730238 SNP. The sequence shown has SEQ ID NO:20: TGCTGCTTGAACTTCTCCTGCAGGTCGAACTTCTCTGCCTCC AAGTTATAGA, where the underlined T is a C in alleles with the rs3730238 SNP. (SEQ ID NOs: 20, 21, 22, 23)

Detailed Description

Guide RNAs are described herein are useful to treat potentially any heterozygous pathological mutation in the TNNT2 gene. Examples of such guide RNAs (gRNAs) include those with any of SEQ ID NO: 17 or 8. Designing gRNAs that target both the reference and the variant alleles allow for treatment and prevention of genetic diseases correlated with a pathogenic mutation for any heterozygous person.

TNNT2 The human TNNT2 gene (OMIM number *191045) encodes the protein cardiac troponin T protein (cTnT or TnT). This TNNT2 gene has 15 exons and spans 25 kb on chromosome lq32. The encoded cTnT protein is part of the troponin complex that regulates contraction in the heart. For example, cTnT is part of the thin filament regulatory complex which confers calcium-sensitivity to striated muscle actomyosin ATPase activity. Mutations in the TNNT2 gene can cause three phenotypically distinct cardiomyopathies: hypertrophic, restrictive, and dilated cardiomyopathies. TNNT2 mutations are responsible for approximately 15% of all cases of familial hypertrophic cardiomyopathy (HCM). ΊNNT2 mutations are also associated with dilated cardiomyopathy (DCM), and the overall frequency of TNNΊ2 mutations in familial DCM is approximately 3-6%. Optimal TNNT2 expression and functioning is needed for proper sarcomeric contractility in cardiomyocytes, the cell type driving contraction in the heart.

A Homo sapiens sequence for a cTnT polypeptide is shown below as SEQ ID NO:9 (NCBI AAK92231.1.

A reference genomic sequence for a Homo sapiens TNNT2 is available, for example, in the NCBI database as accession number NG 007556, and a cDNA encoding a reference cTnT polypeptide shown below as SEQ ID NO: 10.

Mutations in TNNT2 are associated with cardiomyopathy, mainly hypertrophic cardiomyopathy and dilated cardiomyopathy. Dilated cardiomyopathy is characterized by enlargement of the left ventricle and weak heart muscle, making it difficult to pump blood to the body. For example, mutation of the cTnT polypeptide at position 173, where the arginine is replaced by tryptophan, is a dominant negative mutation leading to dilated cardiomyopathy, a condition where the left ventricle is enlarged, and the heart muscle is weak. There are no available treatments for this condition other than heart transplantation. However, knocking out a mutated TNNT2 gene, leaving only the wild-type healthy gene intact, ameliorates dilated cardiomyopathy in vitro within cultured induced pluripotent stem cells (Karakikes et al. Circ Res 120:1561-1571 (2017)).

The Homo sapiens sequence for the cTnT polypeptide with the dominant negative mutation leading to dilated cardiomyopathy, where the arginine residue at position 173 has been replaced with a tryptophan (highlighted in bold and underlining), is shown below as SEQ ID NO: 11.

The genetic mutation for the R173W variant shown above is encoded in exon 11 of the TNNT2 gene. The Trl3 (SEQ ID NO:5) and Trl4 (SEQ ID NO:6) guide RNAs can provide cutting within an intronic region downstream of the exon 11 mutation, while the Tr3 (SEQ ID NO:3) and Tr4 (SEQ ID NO:4) provide cutting upstream of the exon 11 mutation. Similarly, the MC18 (A) (SEQ ID NO:7) and MC19 (G) SEQ ID NO:8) can provide cutting within exon 14, downstream of the exon 11 mutation, while the Tr3 (SEQ ID NO:3) and Tr4 (SEQ ID NO:4) provide cutting upstream of the exon 11 mutation. Use of any one or more downstream guide RNA, optionally with any of the upstream guide RNAs can delete a variant TNNT2 allele correlated with a cardiac disease or condition. Hence, for example, excision or partial deletion of the allele encoding the R173W mutation can alleviate, prevent, or treat cardiac disease correlated with this mutation.

For example, SNP sequences upstream of a variant ΊNNT2 allele correlated with a cardiac disease or condition can include the rs3729547 single nucleotide polymorphism (SNP). The rs3729547 SNP is likely benign in some populations. But it is associated with dilated cardiomyopathy (DCM) in the Han Chinese population and hypertrophic cardiomyopathy in the Indian population. This may be because the rs3729547 SNP is sometimes linked to another mutation that does cause a cardiac disease or condition .

The rs3729547 SNP is located within exon 9 of the coding sequence of the TNNT2 gene. Hence, the rs3729547 SNP can be an upstream target for guide RNAs to delete or excise variant TNNT2 alleles correlated with a cardiac disease or condition.

The cDNA sequence with the position of the TNNT2 rs3729547 SNP is shown below as SEQ ID NO: 12.

The rs3729547 (T) is highlighted by underlining in the SEQ ID NO: 12 sequence, with the region of the Tr4 (SEQ ID NO:4) guide RNA shown in bold. When a T is present at position 440 of the SEQ ID NO: 12, a variant polypeptide (TnT isoform 5,

NP 001263274.1) can be expressed with the following SEQ ID NO: 13.

Note that the SEQ ID NO: 13 polypeptide has additional amino acids (highlighted in bold and with underlining) compared to the reference cTnT polypeptide with SEQ ID NO:9, which has a C at position 440. Like the reference cTnT polypeptide with SEQ ID NO:9, the Tr3 (SEQ ID NO:3) guide RNA also has a C at the position corresponding to the 440 position.

The rs3730238 SNP is at position 779 in exon 14 of TNNT2 gene, where the reference sequence has an adenine (A) but the SNP has a guanine (G). In the sequence shown above as SEQ ID NO: 11, the lysine at reference position 263 is an arginine in people with the rs3730238 SNP. See FIG. 5. The rs3730238 SNP is described as HCM-associated in the Human Genome Mutation Database. Because the rs3730238 SNP is in exon 14 of TNNT2 gene, it can be a downstream target to facilitate excision of variant TNNT2 alleles correlated with a cardiac disease or condition.

The following guide RNAs can be used to target and cut in the region of the rs3730238 SNP, where the underlined nucleotide is the difference between the SNP and the reference guide RNAs:

MC18 (A) rs3730238: GCUGCUUGAACUUCUCCUGC, SEQ ID NO:7),

MC19 (G) rs3730238: GCUGCUUGAACCUCUCCUGC, SEQ IDNO:8).

The guide RNAs described herein are. of course, complimentary to the target sequence and will target the sense strand containing either A (reference) or G (SNP).

Gene Editing Technology

Described herein are allele-specific guide RNAs that can repair, knockdown or knockout the expression of an undesired polypeptide encoded by a variant (mutant) TNNT2 allele. The CRISPR-Cas9 genome-editing system can be used to delete / correct ΊNNT2 mutations that are correlated with cardiomyopathy. For example, a single guide RNA (sgRNA) can be used to recognize one or more target sequence in a subject’s genome, and a corrective nuclease can act as a pair of scissors to cleave a single-strand or a double-strand of genomic DNA. Mutations in the genome that are near the cleavage site can be repaired by an endogenous Non-Homologous End Joining (NHEJ) or Homology Directed Repair (HDR) repair pathway. Hence, the guide RNAs guide the corrective nuclease to cleave the targeted genomic site for deletion and/or repair by endogenous mechanisms.

Some examples of the specific guide RNA sequences provided herein are shown below.

The allele-specific guide RNAs Tr3 and Tr4 can cut the variant and reference alleles in the same position within exon 9 of the TNNT2 allele. The Trl3 and Trl4 guide RNAs are also allele-specific and cut within an intron downstream of the exon 11 mutation. The MCI 8 and MCI 9 guide RNAs are also allele-specific and cut within exon 14, downstream of the exon 11 mutation. When paired with Tr3 or Tr4, Trl3, Trl4, MC18 or MC19 can make an allele-specific excision / deletion of at least 2,500 base pairs within the same allele. Such deletion can remove problematic TNNT2 mutations and reduce the incidence and/or severity of phenotypes associated with these mutations.

The Cas system can recognize any sequence in the genome that matches 20 bases of a gRNA. However, each gRNA must also be adjacent to a “Protospacer Adjacent Motif’ (PAM), which is invariant for each type of Cas protein, because the PAM binds directly to the Cas protein. See Doudna et al., Science 346(6213): 1077, 1258096 (2014); and Jinek et al., Science 337:816-21 (2012). Hence, the guide RNAs have a PAM site sequence that can be bound by a Cas protein.

When the Cas system was first described for Cas9, with a “NGG” PAM site, the PAM was somewhat limiting in that it required a GG in the right orientation to the site to be targeted. Different Cas9 species have now been described with different PAM sites. See Jinek et al., Science 337:816-21 (2012); Ran et al., Nature 520:186-91 (2015); and Zetsche et al., Cell 163:759-71 (2015). In addition, mutations in the PAM recognition domain (Table 1) have increased the diversity of PAM sites for SpCas9 and SaCas9. See Kleinstiver et al., Nat Biotechnol 33 : 1293-1298 (2015); and Kleinstiver et al., Nature 523:481-5 (2015).

Table 1 summarizes information about PAM sites.

Table 1: PAM sites

Note that the guide RNAs for SpCas9 and SaCas9 cover 20 bases in the 5 ’direction of the PAM site, while for FnCas2 (Cpfl) the guide RNA covers 20 bases to 3’ of the PAM.

There are a number of different types of corrective nucleases and systems that can be used for gene editing. The corrective nuclease employed can in some cases be any DNA binding protein with corrective nuclease activity. Examples of corrective nuclease include Streptococcus pyogenes Cas (SpCas9) nucleases, Staphylococcus aureus Cas9 (SpCas9) nucleases, Francisella novicida Cas2 (FnCas2, also called dFnCpfl) nucleases, Zinc Finger Nucleases (ZFN), Meganuclease, Transcription activator-like effector nucleases (TALEN), Fok-I nucleases, any DNA binding protein with nuclease activity, any DNA binding protein bound to a corrective nuclease, or any combinations thereof. However, the CRISPR-Cas systems are generally the most widely used. In some cases, the corrective nuclease is therefore a Cas nuclease.

CRISPR-Cas systems are generally divided into two classes. The class 1 system contains types I, IP and IV, and the class 2 system contains types P, V, and VI. The class 1 CRISPR-Cas system uses a complex of several Cas proteins, whereas the class 2 system only uses a single Cas protein with multiple domains. The class 2 CRISPR-Cas system is usually preferable for gene-engineering applications because of its simplicity and ease of use.

A variety of Cas nucleases can be employed in the methods described herein. Three species that have been best characterized are provided as examples. The most commonly used Cas nuclease is a Streptococcus pyogenes Cas9, (SpCas9). More recently described forms of Cas include Staphylococcus aureus Cas9 (SaCas9) and Francisella novicida Cas2 (FnCas2, also called FnCpfl). Jinek et al., Science 337:816-21 (2012); Qi et al., Cell 152:1173-83 (2013); Ran et al., Nature 520:186-91

(2015); Zetsche et al. Cell 163:759-71 (2015).

One example of an amino acid sequence for Streptococcus pyogenes Cas9

(SpCas9) nuclease is provided below (SEQ ID NO: 14).

A cDNA that encodes the Streptococcus pyogenes Cas9 (SpCas9) is provided below (SEQ ID NO: 15).

An amino acid sequence for a Francisella novicida Cas2 (FnCas2, also called FnCpfl ) is shown below (SEQ ID NO: 16).

A cDNA that encodes the foregoing Francisella novicida Cas2 (FnCas2, also called dFnCpfl) polypeptide is shown below (SEQ ID NO: 17).

Guide RNA delivery

There are different ways to deliver guide RNAs and corrective nucleases. The first and probably the most straightforward approach is to use a vector-based

CRISPR-Cas9 system encoding the corrective nuclease and guide RNA (e.g., sgRNA) from the same vector, thus avoiding multiple transfections of different components. The second is to deliver the mixture of the Cas9 mRNA and the sgRNA, and the third strategy is to deliver the mixture of the Cas9 protein and the sgRNA.

In some cases, the guide RNAs can be delivered to cells or administered to subjects in the form of an expression cassette or vector that can express one or more of the guide RNAs. Corrective nucleases can also be delivered to cells or administered to the subjects in the form of an expression cassette or vector that can express one or more corrective nucleases. The corrective nucleases can also be combined with their respective gRNAs and delivered as RNA-protein complexes (RNPs). Hence, the RNPs can be pre-assembled outside of the cell and introduced into the cell.

Hence, the guide RNAs can be recombinantly expressed in the cells. The corrective nuclease can also be expressed in the same cell with one or more gRNAs. The guide RNAs and corrective nucleases can be introduced in form of a nucleic acid molecules encoding the guide RNAs and/or corrective nucleases. The nucleic acid molecules encoding the guide RNAs and/or corrective nuclease proteins can be provided in expression cassettes or expression vectors.

The expression cassettes can be within vectors. Vectors can, for example, be expression vectors such as viruses or other vectors that is readily taken up by the cells. Examples of vectors that can be used include, for example, adeno-associated virus (AAV) gene transfer vectors, lentiviral vectors, retroviral vectors, herpes virus vectors, e.g., cytomegalovirus vectors, herpes simplex virus vectors, varicella zoster virus vectors, adenovirus vectors, e.g., helper-dependent adenovirus vectors, adenovirus-AAV hybrids, rabies virus vectors, vesicular stomatitis virus (VSV) vectors, coronavirus vectors, poxvirus vectors and the like. Non-viral vectors may be employed to deliver the expression vectors, e.g., liposomes, nanoparticles, microparticles, lipoplexes, polyplexes, nanotubes, and the like. In one embodiment, two or more expression vectors are administered, for instance, each encoding a distinct guide RNA, a distinct corrective nuclease, or a combination thereof.

The expression cassettes or expression vectors include promoter sequences that are operably linked to the nucleic acid segment encoding the guide RNAs, corrective nucleases, or combinations thereof. Methods for ensuring expression of a functional guide RNA, corrective nuclease or combinations thereof can involve expression from a transgene, expression cassette, or expression vector. For example, the nucleic acid segments encoding the selected guide RNAs, or combinations thereof can be present in a vector, such as for example a plasmid, cosmid, virus, bacteriophage or another vector available for genetic engineering. The coding sequences inserted in the vector can be synthesized by standard methods or isolated from natural sources. The coding sequences may further be ligated to transcriptional regulatory elements, termination sequences, and/or to other amino acid encoding sequences. Such regulatory sequences can provide initiation of transcription, internal ribosomal entry sites (IRES) (Owens, Proc. Natl. Acad. Sci. USA 98: 1471-1476 (2001)) and optionally regulatory elements ensuring termination of transcription and stabilization of the transcript. Non-limiting examples for regulatory elements ensuring the initiation of transcription comprise a translation initiation codon, transcriptional enhancers such as e.g. the SV40-enhancer, insulators and/or promoters. The promoter can be a constitutive promoter, and inducible promoter, or a tissue-specific promoter. Examples of promoters that can be used include the cytomegalovirus (CMV) promoter, SV40-promoter, RSV-promoter (Rous sarcoma virus), the lacZ promoter, chicken beta-actin promoter, CAG-promoter (a combination of chicken beta-actin promoter and cytomegalovirus immediate-early enhancer), the gailO promoter, human elongation factor 1a-promoter, AOX1 promoter, GALl promoter CaM-kinase promoter, the lac, trp or tac promoter, the lacUV5 promoter, the autographa califomica multiple nuclear polyhedrosis virus (AcMNPV) polyhedral promoter, or a globin intron in mammalian and other animal cells. Non-limiting examples for regulatory elements ensuring transcription termination include the V40-poly-A site, the tk-poly-A site or the SV40, lacZ or AcMNPV polyhedral polyadenylation signals, which are to be included downstream of the nucleic acid sequence of the invention. Additional regulatory elements may include translational enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Moreover, elements such as origin of replication, drug resistance gene or regulators (as part of an inducible promoter) may also be included.

The expression cassettes and/or expression vectors can be introduced into cells. The cells can be any mammalian or avian cell. For example, the cells can be human cells, or cells from a domesticated animal, a zoo animal, or an experimental animal. The cells can be obtained from a subject in need of treatment. The cells can be autologous or allogenic cells relative to a subject. In some cases, the cells can be stem cells, induced pluripotent stem cells, cardiac progenitor cells, cardiomyocytes and/or cardiac cells. The allogenic cells can be typed to match those of a subject.

The guide RNAs can also be introduced into cells or administered to subjects in the form of RNA-protein complexes (RNPs). The corrective nuclease can be prebound with their respective gRNAs prior to introduction into cells. The advantage RNP delivery of Cas-gRNA complexes is that complex formation it is readily controlled ex vivo and the selected Cas polypeptides can independently be complexed with selected guide RNA sequences so that the structure and compositions of the desired complexes is known with certainty. These RNPs are quite stable, with no apparent exchange of gRNAs. Hence, the nuclease-gRNA RNP can carry a selected gRNA to the site of genomic editing.

For example, Cas RNP can be prepared by incubating the Cas proteins with the selected gRNA using a molar excess of gRNA relative to protein (e.g., using about a 1 : 1.1 to 1 : 1.4 protein to gRNA molar ratio). The buffer to be used during such incubation can include 20 mM HEPES (pH 7.5), 150 mM KC1, 1 mM 10%

glycerol and 1 mM TCEP. Incubation can be done at 37°C for about 5 minutes to about 30 minutes (usually 10 minutes is sufficient). When reference DNA or an HDR template is used, it can be added to the Cas RNP.

Nucleofection can be employed to introduce the Cas RNP into cells. See Lin et al., Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery. Elife 3:e04766. For example, nucleofection reactions can involve mixing approximately 1 x 10⁴ to 1 x 10⁷ cells in about 10 ml to 40 ml of nucleofection reagent with about 5 m to 30 ml of RNP:DNA. In some instances, about 2 x 10⁵ cells are mixed with about 20 ml of nucleofection reagent and about 10 ml RNP:DNA. After electroporation, growth media is added, and the cells are transferred to tissue culture plates for growth and evaluation. The nucleofection reagents and machines are available from Lonza (Allendale, NJ).

Thus, the invention provides compounds for use in medical therapy, such as gene therapy vectors that inhibit or prevent

Administration

Guide RNAs, or expression cassettes/expression vectors that can express the guide RNA can be administered to subjects. Cells that have been modified to eliminate problematic TNNT2 mutations can also be administered to subjects. Such guide RNAs, expression cassettes, expression vectors, and cells generated as described herein can be employed for tissue reconstitution or regeneration in a human patient or other subjects. Patients or subjects can be in need of such treatment. In some cases, the patients or subjects may not yet exhibit any symptoms of disease or a medical condition. However, a patient or subject may have at least one TNNT2 allele correlated with development or existence of a cardiac condition such as cardiomyopathy. The guide RNAs, expression cassettes, expression vectors, and cells are administered in a manner that permits them to be incorporated into, graft or migrate to a specific tissue site, such as into cardiac tissues. Such guide RNAs, expression cassettes, expression vectors, and cells can reconstitute or regenerate functionally deficient areas of tissues, including cardiac tissues. Devices are available that can be adapted for administering cells, for example, to cardiac tissues.

For therapy, guide RNAs, expression cassettes, expression vectors, and/or cardiac cells can be administered locally or systemically. Administration can be by injection, catheter, implantable device, or the like. The guide RNAs, expression cassettes, expression vectors, and cells can be administered in any physiologically acceptable excipient or carrier that does not adversely affect the subject. For example, the guide RNAs, expression cassettes, expression vectors, and cells can be administered intravenously or through an intracardiac route (e.g., epicardially or intramyocardially). Methods of administering the guide RNAs, expression cassettes, expression vectors, and/or cells to subjects, particularly human subjects, include injection or implantation of the guide RNAs, expression cassettes, expression vectors, and cells into target sites or they can be inserted into a delivery device which facilitates introduction, uptake, incorporation, or implantation of the expression cassettes, expression vectors, and cells. Such delivery devices include tubes, e.g., catheters, for introducing cells, expression vectors, and fluids into the body of a recipient subject. The tubes can additionally include a needle, e.g., a syringe, through which the cells of the invention can be introduced into the subject at a desired location. Multiple injections may be made using this procedure.

As used herein, the term "solution" includes a carrier or diluent in which the guide RNAs, expression cassettes, expression vectors, and cells of the invention remain viable and/or functional. Carriers and diluents that can be used include saline, aqueous buffer solutions, solvents and/or dispersion media. The use of such carriers and diluents are available in the art. The solution is preferably sterile and fluid to the extent that easy syringability exists.

The guide RNAs, expression cassettes, expression vectors, and cells can also be embedded in a support matrix. Suitable ingredients include matrix proteins that support or promote the incorporation of adhesion of the guide RNAs, expression cassettes, expression vectors, and modified cells. In another embodiment, the composition may include physiologically acceptable matrix scaffolds. Such physiologically acceptable matrix scaffolds can be resorbable and/or biodegradable.

In some cases, cardiac cells can be modified to express the guide RNAs and optionally the corrective nuclease. In addition, cardiac cells can be modified by the guide RNAs and corrective nucleases to generate a population of modified cells that do not have a pathological mutation in their TNNT2 gene.

A population of modified cells generated by the methods described herein can include low percentages of non-cardiac cells (e.g., fibroblasts and/or endothelial cells). For example, a population of modified cells for use in compositions and for administration to subjects can have less than about 90% non-cardiac cells, less than about 85% non-cardiac cells, less than about 80% non-cardiac cells, less than about 75% non-cardiac cells, less than about 70% non-cardiac cells, less than about 65% non-cardiac cells, less than about 60% non-cardiac cells, less than about 55% noncardiac cells, less than about 50% non-cardiac cells, less than about 45% non-cardiac cells, less than about 40% non-cardiac cells, less than about 35% non-cardiac cells, less than about 30% non-cardiac cells, less than about 25% non-cardiac cells, less than about 20% non-cardiac cells, less than about 15% non-cardiac cells, less than about 12% non-cardiac cells, less than about 10% non-cardiac cells, less than about 8% non-cardiac cells, less than about 6% non-cardiac cells, less than about 5% non- cardiac cells, less than about 4% non-cardiac cells, less than about 3% non-cardiac cells, less than about 2% non-cardiac cells, or less than about 1 % non-cardiac cells of the total cells in the cell population.

Many cell types are capable of migrating to an appropriate site for regeneration and differentiation within a subject. To determine the suitability of various therapeutic administration regimens and dosages of cell compositions, the cells can first be tested in a suitable animal model. At one level, cells are assessed for their ability to survive and maintain their phenotype in vivo. Cells can also be assessed to ascertain whether they migrate to diseased or injured sites in vivo, or to determine an appropriate number, or dosage, of cells to be administered. Cell compositions can be administered to immunodeficient animals (such as nude mice, or animals rendered immunodeficient chemically or by irradiation). Tissues can be harvested after a period of regrowth and assessed as to whether the administered cells or progeny thereof are still present, are alive, and/or have migrated to desired or undesired locations. Injected cells can be traced by a variety of methods. For example, cells containing or expressing a detectable label (such as green fluorescent protein, or beta- galactosidase) can readily be detected. The cells can be pre-labeled, for example, with BrdU or [³H]-thymidine, or by introduction of an expression cassette that can express green fluorescent protein, or beta-galactosidase. Alternatively, the modified cells can be detected by their expression of a cell marker that is not expressed by the animal employed for testing (for example, a human-specific antigen when injecting cells into an experimental animal). The presence and phenotype of the administered population of modified cells can be assessed by fluorescence microscopy (e.g., for green fluorescent protein, or beta-galactosidase), by immunohistochemistry (e.g., using an antibody against a human antigen), by ELISA (using an antibody against a human antigen), or by RT-PCR analysis using primers and hybridization conditions that cause amplification to be specific for RNA indicative of a cardiac phenotype.

Modified cells can be included in the compositions in varying amounts depending upon the extent of disease or the condition of the subject. For example, the compositions can be prepared in liquid form for local or systemic administration containing about 10³ to about 10¹² modified cells, or about 10⁴ to about 10¹⁰ modified cells, or about 10⁵ to about 10⁸ modified cells.

One or more RNPs containing a guide RNA or expression vectors that can express one or more guide RNAs, corrective nuclease, or a combination thereof can also be administered with or without the cells.

The guide RNA, corrective nuclease, and/or RNP with or without additional cells may be administered in a composition as a single dose, in multiple doses, in a continuous or intermittent manner, depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is in response to traumatic injury or for more sustained therapeutic purposes, and other factors known to skilled practitioners. The administration of the compositions of the invention may be as a single dose, or essentially continuous over a preselected period of time, or it may be in a series of spaced doses. Both local and systemic administration is contemplated.

It will be appreciated that the amounts of guide RNAs, corrective nucleases, RNPs, and/or cells for use in treatment will vary not only with the particular carrier selected but also with the route of administration, the nature of the condition being treated and the age and condition of the patient. Ultimately, the attendant health care provider may determine proper dosage.

Karakikes et al. ( CircRes 120:1561-1571 (2017) which is specifically incorporated by reference herein in its entirety, provides information relating to a TALEN-based knockout library for generating human-induced pluripotent stem cell- based models for cardiovascular diseases.

The following Examples illustrate some features of the invention.

Example 1: Design of Guide RNAs for Targeting TNNT2^R173W Mutations This Example describes development of CRISPR-based gene therapies for treatment of cardiomyopathy.

Patient TR-P2 had a heterozygous TNNT2 dominant negative mutation within TNNT2 exon 11. This mutation causes an arginine at position 173 to be replaced by tryptophan (TNNT2^R173W) in the cTnT polypeptide. There are no treatment options for such patients other than transplantation of the heart, and such treatment is not guaranteed to cure the problem.

Five induced pluripotent stem (iPS) cell lines were generated from patient TR- P2’s cells to model guide RNA efficiency and possible outcomes of editing. FIG. 1 illustrates the chromosomal structures of the five induced pluripotent stem (iPS) cell lines generated from cells of the patient with the heterozygous TNNT2 mutation within exon 11.

Several guide RNAs were made and used, including Trl, Tr2, Tr3, Tr4, Trl3, and Trl4. The Trl and Tr2 guide RNAs are non-specific and can generate double knockout mutations in the TNNT2 gene. The Trl and Tr2 guide RNAs are non-allele specific guide RNAs used for creating a double TNNT2 gene knockout. The Tr3 and Tr4 guide RNAs are allele-specific and can both cut the TNNT2 gene at the same position within exon 9. Trl3 and Trl4 are also allele-specific and cut within an intron downstream of ΊNNT2 exon 11.

FIG. 1 also shows the gRNAs described herein. FIG. 1 A illustrates knock-out of the disease-containing allele by Tr3. FIG. IB illustrates excising the disease- containing portion of the TNNT2 allele by duplexing gRNAs Tr3 and Trl3. FIG. 1C represents a knock-out of the healthy allele by Tr4, while FIG. ID represents the excision of exons 9 to 11 in the healthy allele by Tr4 and Trl4. FIG. IE represents a knockout of both TNNT2 alleles by Trl and Tr2.

To generate the edited patient cell lines described above, the guide RNAs were complexed to SpCas9 nuclease in vitro. The RNA-protein complexes (RNPs) so formed were introduced into iPS cells by nucleofection reactions involving mixing approximately 4x10⁵ cells with about 20 ml of nucleofection reagent and about 5 ml RNP:DNA. After electroporation, growth media was added, and the cells are transferred to tissue culture plates for growth and evaluation. The nucleofection reagents used were from Lonza (Allendale, NJ).

The editing efficiency of the different guide RNAs was determined and graphically illustrated in FIG. 2.

Isolation and sequencing clones from a pool of nudeofected cells revealed no editing on the off-target allele for any of the allele-specific guides. Table 2 summarizes the editing outcomes for the main two guide pairs, Tr3+ Trl 3 (SEQ ID NOs: 3 and 5) and Tr4+ Trl4 (SEQ ID NOs:4 and 6).

Table 2: Editing by Guide RNAs

Example 2: CRISPR-Based Therapy for Cardiomyopathy This Example illustrates of CRISPR-based gene therapies that may be used for treatment of cardiomyopathy.

An RNP containing a guide RNA and a SpCas9 nuclease is complexed in vitro as described in Example 1, and the RNP was transfected into a cell population such as an autologous cell population obtained from a patient having a heterozygous or homozygous TNNT2^R173W mutation. In some cases, the cell population can include autologous or allogeneic cells (relative to a subject to be treated or who may receive the cells).

FIG. 3 illustrates one example of editing over time for an RNP introduced by nucleofection. Editing at a target site (solid line) increases quickly and then levels off, while the amount of RNP degrades over time. Some off-target editing can also occur, but the amount of off-target editing is ideally small compared to the on-target editing. Peak editing of the target can occur within about 72 hours.

In some cases, the guide RNA and the corrective nuclease are introduced into selected cells and expressed from an expression cassette in a constitutive manner or an inducible manner. FIG. 4 depicts an example in which plasmids containing a guide RNA sequence and a Tet-inducible Cas9 are transfected into a cell line. The expression of the Cas9 nuclease can be activated by a small molecule called doxycycline, which will initiate allele-specific editing in the cells.

In the presence of calcium, the troponin complex undergoes binding and conformational changes that initiate cardiovascular contraction. Patients with TNNT2 mutations can have reduced calcium handling abilities. Deletion or correction of those TNNT2 mutations as described herein can correct these problems. References:

1. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. (2013) Multiplex Genome Engineering Using CRISPR/Cas Systems. Science

2. Doudna JA, Charpentier E. (2014) Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346:1258096.

3. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337:816-21.

4. Mali P, Esvelt KM, Church GM. (2013) Cas9 as a versatile tool for engineering biology. Nat Methods 10:957-63.

5. Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann M, Weissman JS. (2014) Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell 159:647-61.

6. Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. (2013) CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell 154:442-51.

7. Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP, Lim WA. (2013) Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152:1173-83. 8. Slaymaker IM, Gao L, Zetsche B, Scott DA, Yan WX, Zhang F. (2015)

Rationally engineered Cas9 nucleases with improved specificity. Science

9. Fu Y, Sander JD, Reyon D, Cascio VM, Joung JK. (2014) Improving CRISPR- Cas nuclease specificity using truncated guide RNAs. Nat Biotechnol

10. Gupta A, Meng X, Zhu LJ, Lawson ND, Wolfe SA. (2011) Zinc finger protein- dependent and -independent contributions to the in vivo off-target activity of zinc finger nucleases. Nucleic Acids Res 39:381-92.

11. Pattanayak V, Lin S, Guilinger JP, Ma E, Doudna JA, Liu DR. (2013) High- throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity. Nat Biotechnol 31 : 839-43. 12. Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V, Li Y,

Fine EJ, Wu X, Shalem O, Cradick TJ, Marraffini LA, Bao G, Zhang F. (2013) DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol 31:827-32.

13. Miller JC, Tan S, Qiao G, Barlow KA, Wang J, Xia DF, Meng X, Paschon DE, Leung E, Hinkley SJ, Dulay GP, Hua KL, Ankoudinova I, Cost GJ, et al. (2011) A TALE nuclease architecture for efficient genome editing. Nat Biotechnol 29:143-8.

14. Pattanayak V, Ramirez CL, Joung JK, Liu DR. (2011) Revealing off-target cleavage specificities of zinc-finger nucleases by in vitro selection. Nat Methods 8:765-70.

15. Ran FA, Cong L, Yan WX, Scott DA, Gootenberg JS, Kriz AJ, Zetsche B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang F. (2015) In vivo genome editing using Staphylococcus aureus Cas9. Nature 520:186-91.

16. Zetsche B, Gootenberg JS, Abudayyeh OO, Slaymaker IM, Makarova KS, Essletzbichler P, Volz SE, Joung J, van der Oost J, Regev A, Koonin EV, Zhang F. (2015) Cpfl Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell 163:759-71.

17. Sternberg SH, Doudna JA. (2015) Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell 58:568-74. 18. Knight SC, Xie L, Deng W, Guglielmi B, Witkowsky LB, Bosanac L, Zhang

ET, El Beheiry M, Masson JB, Dahan M, Liu Z, Doudna JA, Tjian R. (2015) Dynamics of CRISPR-Cas9 genome interrogation in living cells. Science 350:823-6.

19. Kleinstiver BP, Prew MS, Tsai SQ, Nguyen NT, Topkar VV, Zheng Z, Joung JK. (2015) Broadening the targeting range of Staphylococcus aureus CRISPR- Cas9 by modifying PAM recognition. Nat Biotechnol 33:1293-1298.

20. Kleinstiver BP, Prew MS, Tsai SQ, Topkar VV, Nguyen NT, Zheng Z,

Gonzales AP, Li Z, Peterson RT, Yeh JR, Aiyee MJ, Joung JK. (2015) Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature 523:481-5. 21. Porteus M. (2015) Genome Editing: A New Approach to Human Therapeutics. Annu Rev Pharmacol Toxicol

22. Fahim AT, Daiger SP, Weleber RG. (1993) Retinitis Pigmentosa Overview. In GeneReviews(R) (Pagon RA, Adam MP, et al., eds) Seattle (WA), pp

23. Kim D, Bae S, Park J, Kim E, Kim S, Yu HR, Hwang J, Kim JI, Kim JS. (2015) Digenome-seq: genome-wide profiling of CRISPR-Cas9 off-target effects in human cells. Nat Methods 12:237-43, 1 p following 243.

24. Tsai SQ, Zheng Z, Nguyen NT, Liebers M, Topkar VV, Thapar V, Wyvekens N, Khayter C, Iafrate AJ, Le LP, Aryee MJ, Joung JK. (2015) GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nat Biotechnol 33:187-97.

25. Lin S, Staahl BT, Alla RK, Doudna JA. (2014) Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery. Elife 3:e04766.

26. Sun, Ning et al. Patient-Specific Induced Pluripotent Stem Cells as a Model for Familial Dilated Cardiomyopathy, Science Translational Medicine 4(130): 130ra47 (2012).

27. Karakikes et al. A Comprehensive TALEN-Based Knockout Library for Generating Human-Induced Pluripotent Stem Cell-Based Models for Cardiovascular Diseases Circ Res 120:1561-1571 (2017).

All patents and publications referenced or mentioned herein are indicative of the levels of skill of those skilled in the art to which the invention pertains, and each such referenced patent or publication is hereby specifically incorporated by reference to the same extent as if it had been incorporated by reference in its entirety individually or set forth herein in its entirety. Applicants reserve the right to physically incorporate into this specification any and all materials and information from any such cited patents or publications.

The following statements are intended to describe and summarize various embodiments of the invention according to the foregoing description in the specification.

Statements:

1. A guide RNA specific for TNNT2 genomic sites comprising: a first guide RNA with at least 95% sequence homology to TCAGCGCCTGCAACTCATTC (SEQ ID NO:l), a second guide RNA with at least 95% sequence homology to TCATGGTTTCCCGGTTTAGC (SEQ ID NO:2), a third guide RNA with at least 95% sequence homology to

TGAGTTGCAGGCGC TGATCG (SEQ ID NO:3), where the underlined C is invariant in the third guide RNA, a fourth guide RNA with at least 95% sequence homology to

TGAGTTGCAGGCGCTGATTG (SEQ ID NO:4), where the underlined T is invariant in the fourth guide RNA, a fifth guide RNA with at least 95% sequence homology to

CAAACAACCTCACATCTGTG (SEQ ID NO:5), where the underlined G is invariant in the fifth guide RNA, or a sixth guide RNA with at least 95% sequence homology to

CAAACAACCTCACATCTATG (SEQ ID NO:6), where the underlined A is invariant in the sixth guide RNA, a seventh guide RNA with at least 95% sequence homology to GCUGCUUGAACUUCUCCUGC, SEQ ID NO:7), or an eighth guide RNA with at least 95% sequence homology to GCUGCUUGAACCUCUCCUGC, SEQ IDNO:8); wherein each of the guide RNAs includes a Protospacer Adjacent Motif (PAM) sequence.

2. A vector comprising a first promoter operably linked to a sequence encoding or comprising the guide RNA of statement 1.

3. The vector of statement 2, further comprising a nucleic acid segment encoding a corrective nuclease operably linked to the first promoter or to a second promoter.

4. The vector of statement 3, wherein the corrective nuclease is a Streptococcus pyogenes Cas9, (SpCas9), Staphylococcus aureus Cas9 (SaCas9), a Francisella novicida Cas2 or a combination thereof.

5. The vector of statement 2, 3, or 4, wherein one or more of vectors is an adeno- associated virus (AAV) vector, lenti viral vector, retroviral vector, herpes virus vector, cytomegalovirus vector, herpes simplex virus vector, varicella zoster virus vector, adenovirus vector, helper-dependent adenovirus vector, adenovirus- AAV hybrid vector, rabies virus vector, vesicular stomatitis virus (VSV) vector, coronavirus vector, poxvirus vector, or a combination thereof.

6. A RNA-protein complex (RNP) comprising the guide RNA of statement 1 and a corrective nuclease. 7. The RNA-protein of statement 6, wherein the corrective nuclease is a Streptococcus pyogenes Cas9, (SpCas9), Staphylococcus aureus Cas9 (SaCas9), a Francisella novicida Cas2 or a combination thereof.

8. A system comprising the vector of statement 2-4 or 5, the vector of statement 2 combined with a second vector comprising a nucleic acid segment encoding a corrective nuclease operably linked to a second promoter, the RNA-protein complex (RNP) of statement 6 or 7, or a combination thereof.

9. A composition comprising a carrier and one or more of the guide RNAs of statement 1.

10. The composition of statement 8, further composing a corrective nuclease.

11. A composition comprising one or more of the guide RNAs of statement 1; the vector of statement 2-4 or 5; the vector of statement 2 combined with a second vector comprising a nucleic acid segment encoding a corrective nuclease operably linked to a second promoter, the RNA-protein complex (RNP) of statement 6 or 7, or a combination thereof.

12. A cell comprising one or more of the guide RNAs of statement 1 ; the vector of statement 2-4 or 5; the vector of statement 2 combined with a second vector comprising a nucleic acid segment encoding a corrective nuclease operably linked to a second promoter; the RNA-protein complex (RNP) of statement 6 or 7; or a combination thereof.

13. A method comprising contacting one or more cells with: one or more of the guide RNA of statement 1; the vector of statement 2-4 or 5; the vector of statement 2 combined with a second vector comprising a nucleic acid segment encoding a corrective nuclease operably linked to a second promoter; the RNA-protein complex (RNP) of statement 6 or 7; or a combination thereof; to produced one or more treated cells.

14. The method of statement 13, further comprising sequencing one or more TNNT2 gene sequences in one or more of the treated cells.

15. The method of statement 13 or 14, further comprising evaluating whether one or more of the treated cells expresses a cardiac troponin T protein troponin complex that regulates contraction in the heart.

16. The method of statement 13, 14 or 15, further comprising evaluating whether one or more of the treated cells expresses a full-length cTnT protein.

17. The method of statement 13-15 or 16, further comprising evaluating whether one or more of the treated cells express a cTnT protein with tryptophan at position 173 rather than an arginine.

18. The method of statement 16 or 17, wherein evaluating comprises sequencing cDNA, RNA or genomic DNA from one or more of the treated cells.

19. The method of statement 17 or 18, further comprising selecting one or more cells that do not express a cTnT protein with tryptophan at position 173.

20. The method of statement 17 or 18, further comprising selecting one or more cells that express a cTnT protein with an arginine at position 173.

21. The method of statement 17 or 18, further comprising selecting one or more cells that express a cTnT protein with a tryptophan at position 173.

22. The method of statement 13-20 or 21, further comprising incubating one or more selected cells in a culture medium to generate a population of selected cells.

23. The method of statement 13-21 or 22, further comprising administering one or more of the cells to a subject or administering the population of selected cells to a subject.

24. The method of statement 23, wherein the subject suffers from cardiomyopathy or is suspected of suffering from cardiomyopathy.

25. The method of statement 23 or 24, wherein the subject suffers from dilated cardiomyopathy. 26. The method of statement 20, 21 or 22, wherein administering is local administration.

27. The method of statement 23-25 or 26, wherein administering is local administration to the subject’s heart.

28. A method comprising administering to a subject: one or more of the guide RNA of statement 1; the vector of statement 2-4 or 5; the vector of statement 2 combined with a second vector comprising a nucleic acid segment encoding a corrective nuclease operably linked to a second promoter; the RNA-protein complex (RNP) of statement 6 or 7; the system of statement 8; the composition of statement 9, 10 or 11; or a combination thereof.

29. The method of statement 28, wherein administering is local administration.

30. The method of statement 28 or 29, wherein administering is local administration to the subject’s heart.

31. The method of statement 28, 29 or 30, wherein the subject suffers from cardiomyopathy or is suspected of suffering from cardiomyopathy.

32. The method of statement 28-30 or 31, wherein the subject suffers from dilated cardiomyopathy.

The specific methods and compositions described herein are representative of preferred embodiments and are exemplary and not intended as limitations on the scope of the invention. Other objects, aspects, and embodiments will occur to those skilled in the art upon consideration of this specification and are encompassed within the spirit of the invention as defined by the scope of the claims. It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, or limitation or limitations, which is not specifically disclosed herein as essential. The methods and processes illustratively described herein suitably may be practiced in differing orders of steps, and the methods and processes are not necessarily restricted to the orders of steps indicated herein or in the claims.

The terms and expressions that have been employed are used as terms of description and not of limitation, and there is no intent in the use of such terms and expressions to exclude any equivalent of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention as claimed. Thus, it will be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims and statements of the invention. Under no circumstances may the patent be interpreted to be limited to the specific examples or embodiments or methods specifically disclosed herein. Under no circumstances may the patent be interpreted to be limited by any statement made by any Examiner or any other official or employee of the Patent and Trademark Office unless such statement is specifically and without qualification or reservation expressly adopted in a responsive writing by Applicants.

Claims

What is claimed:

1. A guide RNA specific for TNNT2 genomic sites comprising: a first guide RNA with at least 95% sequence homology to TCAGCGCCTGCAACTCATTC (SEQ ID NO:l), a second guide RNA with at least 95% sequence homology to TCATGGTTTCCCGGTTTAGC (SEQ ID NO:2), a third guide RNA with at least 95% sequence homology to

TGAGTTGCAGGCGC TGATCG (SEQ ID NO:3), where the imderlined C is invariant in the third guide RNA, a fourth guide RNA with at least 95% sequence homology to

TGAGTTGCAGGCGCTGATTG (SEQ ID NO:4), where the underlined T is invariant in the fourth guide RNA, a fifth guide RNA with at least 95% sequence homology to

CAAACAACCTCACATCTGTG (SEQ ID NO:5), where the underlined G is invariant in the fifth guide RNA, or a sixth guide RNA with at least 95% sequence homology to

CAAACAACCTCACATCTATG (SEQ ID NO:6), where the underlined A is invariant in the sixth guide RNA, a seventh guide RNA with at least 95% sequence homology to GCUGCUUGAACUUCUCCUGC, SEQ ID NO:7), an eighth guide RNA with at least 95% sequence homology to GCUGCUUGAACCUCUCCUGC, SEQ IDNO:8); or a combination thereof; wherein each of the guide RNAs includes a Protospacer Adjacent Motif (PAM) sequence.

2. The guide RNA of claim 1 encoded in a vector comprising a first promoter operably linked to a sequence encoding or comprising the guide RNA.

3. The guide RNA of claim 2, wherein the vector further comprises a nucleic acid segment encoding a corrective nuclease operably linked to the first promoter or to a second promoter.

4. The guide RNA of claim 3, wherein the corrective nuclease is a Streptococcus pyogenes Cas9, (SpCas9), Staphylococcus aureus Cas9 (SaCas9), a Francisella novicida Cas2 or a combination thereof.

5. The guide RNA of claim 1, in an RNA-protein complex (RNP) comprising the guide RNA and a corrective nuclease.

6. The guide RNA of claim 5, wherein the corrective nuclease is a Streptococcus pyogenes Cas9, (SpCas9), Staphylococcus aureus Cas9 (SaCas9), a Francisella novicida Cas2 or a combination thereof.

7. A system comprising: a guide RNA specific for a TNNT2 genomic site comprising: a first guide RNA with at least 95% sequence homology to TCAGCGCCTGCAACTCATTC (SEQ ID NO:l), a second guide RNA with at least 95% sequence homology to TC ATGGTTTCCCGGTTT AGC (SEQ ID NO:2), a third guide RNA with at least 95% sequence homology to

TGAGTTGCAGGCGC TGATCG (SEQ ID NO:3), where the underlined C is invariant in the third guide RNA, a fourth guide RNA with at least 95% sequence homology to

TGAGTTGCAGGCGCTGATTG (SEQ ID NO:4), where the underlined T is invariant in the fourth guide RNA, a fifth guide RNA with at least 95% sequence homology to

CAAACAACCTCACATCTGTG (SEQ ID NO:5), where the underlined G is invariant in the fifth guide RNA, or a sixth guide RNA with at least 95% sequence homology to

C AAAC AACCTC AC ATCT AT G (SEQ ID NO:6), where the underlined A is invariant in the sixth guide RNA, a seventh guide RNA with at least 95% sequence homology to GCUGCUUGAACUUCUCCUGC, SEQ ID NO:7), or an eighth guide RNA with at least 95% sequence homology to GCUGCUUGAACCUCUCCUGC, SEQ ID NO:8); or a combination thereof, wherein each of the guide RNAs includes a Protospacer Adjacent Motif (PAM) sequence; a vector encoding one or more of the guide RNAs; optionally a second vector comprising a nucleic add segment encoding a corrective nuclease operably linked to a second promoter; an RNA-protein complex (RNP) comprising one or more of the guide RNAs and a corrective nuclease; or a combination thereof.

8. The system of claim 7 within a mammalian cell.

9. A composition comprising a carrier and one or more of the guide RNAs of claim 1.

10. The composition of claim 9, further comprising a corrective nuclease.

11. The composition of claim 9 comprising: a guide RNA specific for a TNNT2 genomic site comprising: a first guide RNA with at least 95% sequence homology to TCAGCGCCTGCAACTCATTC (SEQ ID NO:l), a second guide RNA with at least 95% sequence homology to TC ATGGTTTCCCGGTTT AGC (SEQ ID NO:2), a third guide RNA with at least 95% sequence homology to

TGAGTTGCAGGCGC TGATCG (SEQ ID NO:3), where the underlined C is invariant in the third guide RNA, a fourth guide RNA with at least 95% sequence homology to

TGAGTTGCAGGCGCTGATTG (SEQ ID NO:4), where the underlined T is invariant in the fourth guide RNA, a fifth guide RNA with at least 95% sequence homology to

CAAACAACCTCACATCTGTG (SEQ ID NO:5), where the underlined G is invariant in the fifth guide RNA, or a sixth guide RNA with at least 95% sequence homology to

C AAAC AACCTC AC ATCT AT G (SEQ ID NO:6), where the underlined A is invariant in the sixth guide RNA, a seventh guide RNA with at least 95% sequence homology to GCUGCUUGAACUUCUCCUGC, SEQ ID NO:7), or an eighth guide RNA with at least 95% sequence homology to GCUGCUUGAACCUCUCCUGC, SEQ ID NO: 8); or a combination thereof; wherein each of the guide RNAs includes a Protospacer Adjacent Motif (PAM) sequence; a vector comprising or encoding one or more of the guide RNAs; optionally a second vector comprising a nucleic add segment encoding a corrective nuclease operably linked to a second promoter; an RNA-protein complex (RNP) comprising one or more of the guide RNAs and a corrective nuclease; or a combination thereof.

12. A method comprising administering the composition of claim 11 to a subject.

13. The method of claim 12, comprising contacting one or more cells with: a guide RNA specific for a TNNT2 genomic site comprising: a first guide RNA with at least 95% sequence homology to TCAGCGCCTGCAACTCATTC (SEQ ID NO:l), a second guide RNA with at least 95% sequence homology to TCATGGTTTCCCGGTTTAGC (SEQ ID NO:2), a third guide RNA with at least 95% sequence homology to

TGAGTTGCAGGCGC TGATCG (SEQ ID NO:3), where the underlined C is invariant in the third guide RNA, a fourth guide RNA with at least 95% sequence homology to

TGAGTTGCAGGCGCTGATTG (SEQ ID NO:4), where the underlined T is invariant in the fourth guide RNA, a fifth guide RNA with at least 95% sequence homology to

C AAAC AACCTC AC ATCTGT G (SEQ ID NO:5), where the underlined G is invariant in the fifth guide RNA, or a sixth guide RNA with at least 95% sequence homology to

CAAACAACCTCACATCTATG (SEQ ID NO:6), where the underlined A is invariant in the sixth guide RNA, a seventh guide RNA with at least 95% sequence homology to GCUGCUUGAACUUCUCCUGC, SEQ ID NO:7), or an eighth guide RNA with at least 95% sequence homology to GCUGCUUGAACCUCUCCUGC, SEQ IDNO:8); or a combination thereof; wherein each of the guide RNAs includes a Protospacer Adjacent Motif (PAM) sequence; a vector comprising or encoding one or more of the guide RNAs; optionally a second vector comprising a nucleic acid segment encoding a corrective nuclease operably linked to a second promoter; an RNA-protein complex (RNP) comprising one or more of the guide RNAs and a corrective nuclease; or a combination thereof; to produce one or more treated cells.

14. The method of claim 13, further comprising sequencing one or more TNNT2 gene sequences in one or more of the treated cells.

15. The method of claim 13, further comprising administering one or more of the treated cells to a subject.

16. The method of claim 15 wherein the subject has cardiomyopathy, or can develop cardiomyopathy, or has a TNNT2 R173W mutation.

17. The method of claim 15 wherein the subject has a rs3729547 polymorphism, a genomic TNNT2 R173W mutation, or a combination thereof.