WO2021041569A1 - Novel crispr dna targeting enzymes and systems - Google Patents
Novel crispr dna targeting enzymes and systems Download PDFInfo
- Publication number
- WO2021041569A1 WO2021041569A1 PCT/US2020/048037 US2020048037W WO2021041569A1 WO 2021041569 A1 WO2021041569 A1 WO 2021041569A1 US 2020048037 W US2020048037 W US 2020048037W WO 2021041569 A1 WO2021041569 A1 WO 2021041569A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- crispr
- nucleic acid
- sequence
- associated protein
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
Definitions
- CRISPR-Cas Clustered Regularly Interspaced Short Palindromic Repeats
- Cas CRISPR-associated genes
- CRISPR-Cas systems are adaptive immune systems in archaea and bacteria that defend particular species against foreign genetic elements.
- CRISPR-Cas systems comprise an extremely diverse group of proteins effectors, non- coding elements, and loci architectures, some examples of which have been engineered and adapted to produce important biotechnological advances.
- the components of the system involved in host defense include one or more effector proteins capable of modifying a nucleic acid and an RNA guide element that is responsible for targeting the effector protein(s) to a specific sequence on a phage nucleic acid.
- the RNA guide is composed of a CRISPR RNA (crRNA) and may require an additional trans-activating RNA (tracrRNA) to enable targeted nucleic acid manipulation by the effector protein(s).
- the crRNA consists of a direct repeat responsible for protein binding to the crRNA and a spacer sequence that is complementary to the desired nucleic acid target sequence.
- CRISPR systems can be reprogrammed to target alternative DNA or RNA targets by modifying the spacer sequence of the crRNA.
- CRISPR-Cas systems can be broadly classified into two classes: Class 1 systems are composed of multiple effector proteins that together form a complex around a crRNA, and Class 2 systems consist of one effector protein that complexes with the RNA guide to target nucleic acid substrates.
- the single-subunit effector composition of the Class 2 systems provides a simpler component set for engineering and application translation and have thus far been an important source of programmable effectors. Nevertheless, there remains a need for additional programmable effectors and systems for modifying nucleic acids and polynucleotides (i.e., DNA, RNA, or any hybrid, derivative, or modification) beyond the current CRISPR-Cas systems, such as smaller effectors and/or effectors having unique PAM sequence requirements, that enable novel applications through their unique properties.
- This disclosure provides non-naturally-occurring, engineered systems and compositions for novel single-effector Class 2 CRISPR-Cas systems, which were first identified computationally from genomic databases and subsequently engineered and experimentally validated.
- identification of the components of these CRISPR-Cas systems allows for their use in non-natural environments, e.g., in bacteria other than those in which the systems were initially discovered or in eukaryotic cells, such as mammalian cells.
- These new effectors are divergent in sequence and function compared to orthologs and homologs of existing Class 2 CRISPR effectors.
- the disclosure provides engineered, non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) - Cas systems of CLUST.133120 including: a CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 1-50; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid; wherein the CRISPR-associated protein is capable of binding to the RNA guide and of modifying the target nucleic acid sequence complementary to the spacer sequence.
- CRISPR Clustered Regularly Interspaced Short Palindromic Repeat
- the disclosure provides engineered, non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) - Cas systems of CLUST.133120 including: a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 1-50; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid, or a nucleic acid encoding the RNA guide; wherein the CRISPR-associated protein is capable of binding to the RNA guide and of modifying the target nucleic acid sequence complementary to the
- the direct repeat sequence includes a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a nucleotide sequence set forth in any one of SEQ ID NOs: 51-72, 85-87, 95-100, or 900-915.
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the amino acid sequence of SEQ ID NO: 1, and the direct repeat sequence comprises a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the nucleotide sequence of SEQ ID NO: 51, 95, or 85.
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence of Table 3 and the direct repeat sequence comprises a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a corresponding direct repeat nucleotide sequence listed in Table 4 (e.g., the first or second direct repeat nucleotide sequence of the corresponding row in Table 4), or to a corresponding direct repeat nucleotide sequence listed in Table 32 (e.g., a pre-cr
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 1 (CLUST.133120 3300027740) or SEQ ID NO: 2 (CLUST.1331203300017971).
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 1-50 (CLUST.133120).
- the CRISPR-associated protein is capable of recognizing a protospacer adjacent motif (PAM), wherein the PAM includes a nucleic acid sequence, including a nucleic acid sequence set forth as 5’-TTN-3’ or 5’-TN-3’.
- PAM protospacer adjacent motif
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the amino acid sequence of SEQ ID NO:1, and the PAM sequence comprises a nucleic acid sequence set forth as 5’-TTN-3’.
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the amino acid sequence of SEQ ID NO: 2, and the PAM sequence comprises a nucleic acid sequence set forth as 5’-TN-3’.
- the spacer sequence of the RNA guide includes between about 15 nucleotides to about 55 nucleotides.
- the spacer sequence of the RNA guide includes between 20 and 35 nucleotides.
- the disclosure provides a cell (e.g., a genetically modified cell), wherein the cell includes: a CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 1-50; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid.
- the disclosure provides a cell (e.g., a genetically modified cell), wherein the cell includes: a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 1-50; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid, or a nucleic acid encoding the RNA guide.
- a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein
- the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g.,
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 1-50.
- the CRISPR-associated protein is capable of recognizing a PAM sequence including a nucleic acid sequence set forth as 5’-TTN- 3’ or 5’-TN-3’.
- the direct repeat sequence includes a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a nucleotide sequence set forth in any one of SEQ ID NOs: 51-72, 85-87, 95-100, or 900-915.
- the spacer sequence includes between about 15 nucleotides to about 55 nucleotides.
- the spacer sequence includes between 20 and 35 nucleotides.
- the disclosure provides methods of modifying a target nucleic acid, the method including delivering to the target nucleic acid an engineered, non-naturally occurring CRISPR-Cas system including: a CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 1-50; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to the target nucleic acid; wherein the CRISPR-associated protein is capable of binding to the RNA guide; and wherein recognition of the target nucleic acid by the CRISPR
- the disclosure provides methods of modifying a target nucleic acid, the method including delivering to the target nucleic acid an engineered, non-naturally occurring CRISPR-Cas system including: a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 1-50; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to the target nucleic acid, or a nucleic acid encoding the RNA guide; wherein the CRISPR-associated protein is capable of binding to the RNA guide; and wherein recognition of the target nucleic acid
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 1-50 (CLUST.133120).
- the CRISPR-associated protein is capable of recognizing a PAM sequence including a nucleic acid sequence set forth as 5’-TTN-3’ or 5’-TN-3’.
- the direct repeat sequence includes a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a nucleotide sequence set forth in any one of SEQ ID NOs: 51-72, 85-87, 95-100, or 900-915.
- the spacer sequence includes between about 15 nucleotides to about 55 nucleotides.
- the spacer sequence includes between 20 and 35 nucleotides.
- the disclosure provides engineered, non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) - Cas systems of CLUST.099129 including: a CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 101-145; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid; wherein the CRISPR-associated protein is capable of binding to the RNA guide and of modifying the target nucleic acid sequence complementary to the spacer
- CRISPR Clustered Regularly Interspaced Short
- the disclosure provides engineered, non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) - Cas systems of CLUST.099129 including: a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 101-145; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid, or a nucleic acid encoding the RNA guide; wherein the CRISPR-associated protein is capable of binding to the RNA guide and of modifying the target nucleic acid sequence complementary
- the direct repeat sequence includes a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a nucleotide sequence set forth in any one of SEQ ID NOs: 146-162, 180-183, or 200-215.
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the amino acid sequence of SEQ ID NO: 101, and the direct repeat sequence comprises a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the nucleotide sequence of SEQ ID NO: 146, 181, or 200.
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence of Table 10, and the direct repeat sequence comprises a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a corresponding direct repeat nucleotide sequence listed in Table 11 (e.g., the first or second direct repeat nucleotide sequence of the corresponding row in Table 11), or to a corresponding direct repeat nucleotide sequence listed in Table 7 (e.g., a pre-cr
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 101 (CLUST.099129 SRR6837557), SEQ ID NO: 102 (CLUST.0991293300012971), or SEQ ID NO: 103 (CLUST.0991293300005764).
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 101-145 (CLUST.0991297).
- the CRISPR-associated protein is capable of recognizing a protospacer adjacent motif (PAM), wherein the PAM includes a nucleic acid sequence, including a nucleic acid sequence set forth as 5’-GTN-3’, 5’-TG-3’, 5’- TR-3’, or 5’-RATG-3’ (SEQ ID NO: 920).
- PAM protospacer adjacent motif
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the amino acid sequence of SEQ ID NO: 101, and the PAM sequence comprises a nucleic acid sequence set forth as 5’-GTN-3’.
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the amino acid sequence of SEQ ID NO: 102, and the PAM sequence comprises a nucleic acid sequence set forth as 5’-TG-3’.
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the amino acid sequence of SEQ ID NO: 103, and the PAM sequence comprises a nucleic acid sequence set forth as 5’-TR-3’ or 5’-RATG-3’ (SEQ ID NO: 920).
- the spacer sequence of the RNA guide includes between about 15 nucleotides to about 55 nucleotides.
- the spacer sequence of the RNA guide includes between 26 and 51 nucleotides.
- the disclosure provides a cell (e.g., a genetically modified cell), wherein the cell includes: a CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 101-145; and RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid.
- the disclosure provides a cell (e.g., a genetically modified cell), wherein the cell includes: a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 101-145; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid, or a nucleic acid encoding the RNA guide.
- a CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 8
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 101, SEQ ID NO: 102, or SEQ ID NO: 103.
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 101-145.
- the CRISPR-associated protein is capable of recognizing a PAM sequence including a nucleic acid sequence set forth as 5’-GTN- 3’, 5’-TG-3’, 5’-TR-3’, or 5’-RATG-3’ (SEQ ID NO: 920).
- the direct repeat sequence includes a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a nucleotide sequence set forth in any one of SEQ ID NOs: 146-162, 180-183, or 200-215.
- the spacer sequence includes between about 15 nucleotides to about 55 nucleotides.
- the spacer sequence includes between 26 and 51 nucleotides.
- the disclosure provides methods of modifying a target nucleic acid, the method including delivering to the target nucleic acid an engineered, non-naturally occurring CRISPR-Cas system including: a CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 101-145; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to the target nucleic acid; wherein the CRISPR-associated protein is capable of binding to the RNA guide; and wherein recognition of the target nucleic acid by the C
- the disclosure provides methods of modifying a target nucleic acid, the method including delivering to the target nucleic acid an engineered, non-naturally occurring CRISPR-Cas system including: a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 101-145; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to the target nucleic acid, or a nucleic acid encoding the RNA guide; wherein the CRISPR-associated protein is capable of binding to the RNA guide; and wherein recognition of the target nucleic
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 101, SEQ ID NO: 102, or SEQ ID NO: 103.
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 101-145.
- the CRISPR-associated protein is capable of recognizing a PAM sequence including a nucleic acid sequence set forth as 5’-GTN-3’, 5’-TG-3’, 5’-TR-3’, or 5’-RATG-3’.
- the direct repeat sequence includes a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a nucleotide sequence set forth in any one of SEQ ID NOs: 146-162, 180-183, or 200-215.
- the spacer sequence includes between about 15 nucleotides to about 55 nucleotides.
- the spacer sequence includes between 26 and 51 nucleotides.
- the disclosure provides engineered, non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) - Cas systems of CLUST.342201 including: a CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 301-341; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid; wherein the CRISPR-associated protein is capable of binding to the RNA guide and of modifying the target nucleic acid sequence complementary to the spacer
- CRISPR Clustered Regularly Interspaced Short
- the disclosure provides engineered, non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) - Cas systems of CLUST.342201 including: a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 301-341; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid, or a nucleic acid encoding the RNA guide; wherein the CRISPR-associated protein is capable of binding to the RNA guide and of modifying the target nucleic acid sequence complementary
- the direct repeat sequence includes a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a nucleotide sequence set forth in any one of SEQ ID NOs: 342-362, 384-402, 451, 452, or 454.
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the amino acid sequence of SEQ ID NO: 301, and the direct repeat sequence comprises a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the nucleotide sequence of SEQ ID NO: 342 or 451.
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence of Table 17, and the direct repeat sequence comprises a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a corresponding direct repeat nucleotide sequence listed in Table 14, or to a corresponding direct repeat nucleotide sequence listed in Table 18 (e.g., the first or second direct repeat nucleotide sequence of the corresponding row in Table 18).
- the direct repeat sequence comprises a nucleotide sequence that
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 301 (CLUST.3422013300006417).
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 301-341 (CLUST.342201).
- the CRISPR-associated protein is capable of recognizing a protospacer adjacent motif (PAM), wherein the PAM includes a nucleic acid sequence, including a nucleic acid sequence set forth as 5’-AAG-3’, 5’-AAD-3’, 5’- AAR-3’, 5’-RAAG-3’ (SEQ ID NO: 921), 5’-RAAR-3’ (SEQ ID NO: 922), or 5’-RAAD-3’ (SEQ ID NO: 923).
- PAM protospacer adjacent motif
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the amino acid sequence of SEQ ID NO:301, and the PAM sequence comprises a nucleic acid sequence set forth as 5’-AAG-3’, 5’- AAD-3’, or 5’-AAR-3’.
- the spacer sequence of the RNA guide includes between about 12 nucleotides to about 62 nucleotides.
- the spacer sequence of the RNA guide includes between 19 and 40 nucleotides.
- the disclosure provides a cell (e.g., a genetically modified cell), wherein the cell includes: a CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 301-341; an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid.
- the disclosure provides a cell (e.g., a genetically modified cell), wherein the cell includes: a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 301-341; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid, or a nucleic acid encoding the RNA guide.
- a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein
- the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g.
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 301.
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 301-341.
- the CRISPR-associated protein is capable of recognizing a PAM sequence including a nucleic acid sequence set forth as 5’-AAG- 3’, 5’-AAD-3’, 5’-AAR-3’, 5’-RAAG-3’ (SEQ ID NO: 921), 5’-RAAR-3’ (SEQ ID NO: 922), 5’- RAAD-3’ (SEQ ID NO: 923).
- the direct repeat sequence includes a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a nucleotide sequence set forth in any one of SEQ ID NOs: 342-362, 384-402, 451, 452, or 454.
- the spacer sequence includes between about 12 nucleotides to about 62 nucleotides.
- the spacer sequence includes between 19 and 40 nucleotides.
- the disclosure provides methods of modifying a target nucleic acid, the method including delivering to the target nucleic acid an engineered, non-naturally occurring CRISPR-Cas system including: a CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 301-341; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to the target nucleic acid; wherein the CRISPR-associated protein is capable of binding to the RNA guide; and wherein recognition of the target nucleic acid by the C
- the disclosure provides methods of modifying a target nucleic acid, the method including delivering to the target nucleic acid an engineered, non-naturally occurring CRISPR-Cas system including: a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 301-341; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to the target nucleic acid, or a nucleic acid encoding the RNA guide; wherein the CRISPR-associated protein is capable of binding to the RNA guide; and wherein recognition of the target nucleic
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 301.
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 301-341.
- the CRISPR-associated protein is capable of recognizing a PAM sequence including a nucleic acid sequence set forth as 5’-AAG-3’, 5’-AAD-3’, 5’-AAR-3’, 5’-RAAG-3’ (SEQ ID NO: 921), 5’-RAAR-3’ (SEQ ID NO: 922), 5’-RAAD-3’ (SEQ ID NO: 923).
- the direct repeat sequence includes a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a nucleotide sequence set forth in any one of SEQ ID NOs: 342-362, 384-402, 451, 452, or 454.
- the spacer sequence includes between about 12 nucleotides to about 62 nucleotides.
- the spacer sequence includes between 19 and 40 nucleotides.
- the disclosure provides engineered, non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) - Cas systems of CLUST.195009 including: a CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 501-521; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid; wherein the CRISPR-associated protein is capable of binding to the RNA guide and of modifying the target nucleic acid sequence complementary to the space
- the disclosure provides engineered, non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) - Cas systems of CLUST.195009 including: a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 501-521; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid, or a nucleic acid encoding the RNA guide; wherein the CRISPR-associated protein is capable of binding to the RNA guide and of modifying the target nucleic acid sequence
- the direct repeat sequence includes a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a nucleotide sequence set forth in any one of SEQ ID NOs: 522-532, 535, or 539-549.
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the amino acid sequence of SEQ ID NO: 501, and the direct repeat sequence comprises a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the nucleotide sequence of SEQ ID NO: 522 or 539.
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence of Table 23, and the direct repeat sequence comprises a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a corresponding direct repeat nucleotide sequence listed in Table 20, or to a corresponding direct repeat nucleotide sequence listed in Table 24 (e.g., the first or second direct repeat nucleotide sequence of the corresponding row in Table 24).
- the direct repeat sequence comprises a nucleotide sequence that
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 501 (CLUST.195009 SRR6201554).
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 501-521 (CLUST.195009).
- the CRISPR-associated protein is capable of recognizing a protospacer adjacent motif (PAM), wherein the PAM includes a nucleic acid sequence, including a nucleic acid sequence set forth as 5’-TTN-3’.
- PAM protospacer adjacent motif
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the amino acid sequence of SEQ ID NO:501, and the PAM sequence comprises a nucleic acid sequence set forth as 5’-TTN-3’.
- the spacer sequence of the RNA guide includes between about 15 nucleotides to about 55 nucleotides.
- the spacer sequence of the RNA guide includes between 20 and 39 nucleotides.
- the disclosure provides a cell (e.g., a genetically modified cell), wherein the cell includes: a CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 501-521; an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid.
- the disclosure provides a cell (e.g., a genetically modified cell), wherein the cell includes: a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 501-521; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid, or a nucleic acid encoding the RNA guide.
- a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein
- the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 501.
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 501-521.
- the CRISPR-associated protein is capable of recognizing a PAM sequence including a nucleic acid sequence set forth as 5’-TTN- 3’.
- the direct repeat sequence includes a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a nucleotide sequence set forth in any one of SEQ ID NOs: 522-532, 535, or 539-549.
- the spacer sequence includes between about 15 nucleotides to about 55 nucleotides.
- the spacer sequence includes between 20 and 39 nucleotides.
- the disclosure provides methods of modifying a target nucleic acid, the method including delivering to the target nucleic acid an engineered, non-naturally occurring CRISPR-Cas system including: a CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 501-521; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to the target nucleic acid; wherein the CRISPR-associated protein is capable of binding to the RNA guide; and wherein recognition of the target nucleic acid by the
- the disclosure provides methods of modifying a target nucleic acid, the method including delivering to the target nucleic acid an engineered, non-naturally occurring CRISPR-Cas system including: a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 501-521; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to the target nucleic acid, or a nucleic acid encoding the RNA guide; wherein the CRISPR-associated protein is capable of binding to the RNA guide; and wherein recognition of the target nucle
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 501.
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 501-521.
- the CRISPR-associated protein is capable of recognizing a PAM sequence including a nucleic acid sequence set forth as 5’-TTN-3’.
- the direct repeat sequence includes a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a nucleotide sequence set forth in any one of SEQ ID NOs: 522-532, 535, or 539-549.
- the spacer sequence includes between about 15 nucleotides to about 55 nucleotides.
- the spacer sequence includes between 20 and 39 nucleotides.
- the disclosure provides engineered, non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) - Cas systems of CLUST.057059 including: a CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 601-682; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid; wherein the CRISPR-associated protein is capable of binding to the RNA guide and of modifying the target nucleic acid sequence complementary to the spacer
- CRISPR Clustered Regularly Interspaced Short
- the disclosure provides engineered, non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) - Cas systems of CLUST.057059 including: a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 601-682; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid, or a nucleic acid encoding the RNA guide; wherein the CRISPR-associated protein is capable of binding to the RNA guide and of modifying the target nucleic acid sequence complementary
- the direct repeat sequence includes a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a nucleotide sequence set forth in any one of SEQ ID NOs: 683-734 or 751-802.
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the amino acid sequence of SEQ ID NO: 601, and the direct repeat sequence comprises a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the nucleotide sequence of SEQ ID NO: 683 or 751.
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence of Table 29, and the direct repeat sequence comprises a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a corresponding direct repeat nucleotide sequence listed in Table 26, or to a corresponding direct repeat nucleotide sequence listed in Table 30 (e.g., the first or second direct repeat nucleotide sequence of the corresponding row in Table 30).
- the direct repeat sequence comprises a nucleotide sequence that
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 601 (CLUST.0570593300023179).
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 601-682 (CLUST.057059).
- the CRISPR-associated protein is capable of recognizing a protospacer adjacent motif (PAM), wherein the PAM includes a nucleic acid sequence, including a nucleic acid sequence set forth as 5’-GTN-3’.
- PAM protospacer adjacent motif
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to the amino acid sequence of SEQ ID NO: 601, and the PAM sequence comprises a nucleic acid sequence set forth as 5’-GTN-3’.
- the spacer sequence of the RNA guide includes between about 15 nucleotides to about 50 nucleotides.
- the spacer sequence of the RNA guide includes between 20 and 44 nucleotides.
- the disclosure provides a cell (e.g., a genetically modified cell), wherein the cell includes: a CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 601-682; an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid.
- the disclosure provides a cell (e.g., a genetically modified cell), wherein the cell includes: a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 601-682; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to a target nucleic acid, or a nucleic acid encoding the RNA guide.
- a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein
- the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g.
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 601.
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 601-682.
- the CRISPR-associated protein is capable of recognizing a PAM sequence including a nucleic acid sequence set forth as 5’-GTN- 3’.
- the direct repeat sequence includes a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a nucleotide sequence set forth in any one of SEQ ID NOs: 683-734 or 751-802.
- the spacer sequence includes between about 15 nucleotides to about 50 nucleotides. In some embodiments of any of the cells described herein, the spacer sequence includes between 20 and 44 nucleotides.
- the disclosure provides methods of modifying a target nucleic acid, the method including delivering to the target nucleic acid an engineered, non-naturally occurring CRISPR-Cas system including: a CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 601-682; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to the target nucleic acid; wherein the CRISPR-associated protein is capable of binding to the RNA guide; and wherein recognition of the target nucleic acid by the CRISPR-associated protein and RNA guide results in a modification of the target nucleic acid.
- the disclosure provides methods of modifying a target nucleic acid, the method including delivering to the target nucleic acid an engineered, non-naturally occurring CRISPR-Cas system including: a CRISPR-associated protein or a nucleic acid encoding the CRISPR-associated protein, wherein the CRISPR-associated protein includes an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 601-682; and an RNA guide including a direct repeat sequence and a spacer sequence capable of hybridizing to the target nucleic acid, or a nucleic acid encoding the RNA guide; wherein the CRISPR-associated protein is capable of binding to the RNA guide; and wherein recognition of the target nucleic
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 601.
- the CRISPR-associated protein is a protein having at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to an amino acid sequence set forth in SEQ ID NO: 601-682.
- the CRISPR-associated protein is capable of recognizing a PAM sequence including a nucleic acid sequence set forth as 5’-GTN-3’.
- the direct repeat sequence includes a nucleotide sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to a nucleotide sequence set forth in any one of SEQ ID NOs: 683-734 or 751-802.
- the present disclosure provides a method of introducing an insertion or deletion into a target nucleic acid in a mammalian cell, comprising a transfection of: (a) a nucleic acid sequence encoding a CRISPR-associated protein described herein, e.g., wherein the CRISPR- associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 1-50, 101-145, 301-341, 501-521, or 601-682; and (b) an RNA guide (or a nucleic acid encoding the RNA guide) comprising a direct repeat sequence and a spacer sequence capable of hybridizing to the target nucleic acid, e.g., an RNA guide (
- the CRISPR-associated protein comprises an amino acid sequence that is at least 80% (e.g., 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical to an amino acid sequence set forth in any one of SEQ ID NOs: 1, 101, 301, 501, or 601.
- the CRISPR-associated protein comprises an amino acid sequence of one of any one of SEQ ID NOs: 1, 101, 301, 501, or 601.
- the transfection is a transient transfection.
- the cell is a human cell.
- the spacer sequence includes between about 15 nucleotides to about 50 nucleotides. In some embodiments of any of the methods described herein, the spacer sequence includes between 20 and 44 nucleotides. In some embodiments of any of the systems described herein, the CRISPR-associated protein includes at least one (e.g., one, two, or three) RuvC domain or at least one split RuvC domain. In some embodiments of any of the systems described herein, the CRISPR-associated protein comprises a catalytic residue (e.g., aspartic acid or glutamic acid). In some embodiments of any of the systems described herein, the CRISPR-associated protein cleaves the target nucleic acid.
- the CRISPR-associated protein further comprises a peptide tag, a fluorescent protein, a base-editing domain, a DNA methylation domain, a histone residue modification domain, a localization factor, a transcription modification factor, a light-gated control factor, a chemically inducible factor, or a chromatin visualization factor.
- the nucleic acid encoding the CRISPR-associated protein is codon-optimized for expression in a cell, e.g., a eukaryotic cell, e.g., a mammalian cell, e.g., a human cell.
- the nucleic acid encoding the CRISPR-associated protein is operably linked to a promoter. In some embodiments of any of the systems described herein, the nucleic acid encoding the CRISPR-associated protein is in a vector. In some embodiments, the vector comprises a retroviral vector, a lentiviral vector, a phage vector, an adenoviral vector, an adeno-associated vector, or a herpes simplex vector. In some embodiments of any of the systems described herein, the target nucleic acid is a DNA molecule. In some embodiments of any of the systems described herein, the target nucleic acid includes a PAM sequence.
- the CRISPR-associated protein has non-specific nuclease activity. In some embodiments of any of the systems described herein, recognition of the target nucleic acid by the CRISPR-associated protein and RNA guide results in a modification of the target nucleic acid. In some embodiments of any of the systems described herein, the modification of the target nucleic acid is a double-stranded cleavage event. In some embodiments of any of the systems described herein, the modification of the target nucleic acid is a single-stranded cleavage event. In some embodiments of any of the systems described herein, the modification of the target nucleic acid results in an insertion event.
- the modification of the target nucleic acid results in a deletion event. In some embodiments of any of the systems described herein, the modification of the target nucleic acid results in cell toxicity or cell death.
- the system further includes a donor template nucleic acid. In some embodiments of any of the systems described herein, the donor template nucleic acid is a DNA molecule. In some embodiments of any of the systems described herein, wherein the donor template nucleic acid is an RNA molecule. In some embodiments of any of the systems described herein, the system does not include a tracrRNA.
- the CRISPR-associated protein is self-processing.
- the system further includes a tracrRNA.
- the system further includes a modulator RNA.
- the system is present in a delivery composition comprising a nanoparticle, a liposome, an exosome, a microvesicle, or a gene-gun.
- the systems are within a cell.
- the cell is a eukaryotic cell.
- the cell is a mammalian cell.
- the cell is a human cell. In some embodiments, the cell is a prokaryotic cell. In some embodiments of any of the cells described herein, the CRISPR-associated protein includes at least one (e.g., one, two, or three) RuvC domain or at least one split RuvC domain. In some embodiments of any of the cells described herein, the CRISPR-associated protein comprises a catalytic residue (e.g., aspartic acid or glutamic acid). In some embodiments of any of the cells described herein, the CRISPR-associated protein cleaves the target nucleic acid.
- the CRISPR-associated protein includes at least one (e.g., one, two, or three) RuvC domain or at least one split RuvC domain. In some embodiments of any of the cells described herein, the CRISPR-associated protein comprises a catalytic residue (e.g., aspartic acid or glutamic acid). In some embodiments of any of the cells described herein, the CRISPR-associated protein cleaves
- the CRISPR-associated protein further comprises a peptide tag, a fluorescent protein, a base-editing domain, a DNA methylation domain, a histone residue modification domain, a localization factor, a transcription modification factor, a light-gated control factor, a chemically inducible factor, or a chromatin visualization factor.
- the nucleic acid encoding the CRISPR-associated protein is codon-optimized for expression in a cell, e.g., a eukaryotic cell, e.g., a mammalian cell, e.g., a human cell.
- the nucleic acid encoding the CRISPR-associated protein is operably linked to a promoter. In some embodiments of any of the cells described herein, the nucleic acid encoding the CRISPR- associated protein is in a vector. In some embodiments, the vector comprises a retroviral vector, a lentiviral vector, a phage vector, an adenoviral vector, an adeno-associated vector, or a herpes simplex vector. In some embodiments of any of the cells described herein, the cell does not include a tracrRNA. In some embodiments of any of the cells described herein, the cell optionally includes a tracrRNA.
- the CRISPR-associated protein is self-processing.
- the cell further includes a tracrRNA.
- the cell further includes a modulator RNA.
- the cell is a eukaryotic cell.
- the cell is a mammalian cell.
- the cell is a human cell.
- the cell is a prokaryotic cell.
- the cell is a genetically engineered cell.
- the target nucleic acid is a DNA molecule.
- the target nucleic acid includes a PAM sequence.
- the CRISPR-associated protein has non-specific nuclease activity.
- recognition of the target nucleic acid by the CRISPR-associated protein and RNA guide results in a modification of the target nucleic acid.
- the modification of the target nucleic acid is a double-stranded cleavage event.
- the modification of the target nucleic acid is a single-stranded cleavage event. In some embodiments of any of the cells described herein, the modification of the target nucleic acid results in an insertion event. In some embodiments of any of the cells described herein, the modification of the target nucleic acid results in a deletion event. In some embodiments of any of the cells described herein, the modification of the target nucleic acid results in cell toxicity or cell death.
- the disclosure provides a method of binding a system described herein to a target nucleic acid in a cell comprising: (a) providing the system; and (b) delivering the system to the cell, wherein the cell comprises the target nucleic acid, wherein the CRISPR-associated protein binds to the RNA guide, and wherein the spacer sequence binds to the target nucleic acid.
- the cell is a eukaryotic cell, e.g., a mammalian cell, e.g., a human cell.
- the CRISPR-associated protein comprises a catalytic residue (e.g., aspartic acid or glutamic acid).
- the CRISPR-associated protein cleaves the target nucleic acid.
- the CRISPR-associated protein further comprises a peptide tag, a fluorescent protein, a base-editing domain, a DNA methylation domain, a histone residue modification domain, a localization factor, a transcription modification factor, a light-gated control factor, a chemically inducible factor, or a chromatin visualization factor.
- the nucleic acid encoding the CRISPR-associated protein is codon-optimized for expression in a cell, e.g., a eukaryotic cell, e.g., a mammalian cell, e.g., a human cell.
- the cell is a genetically engineered cell.
- the nucleic acid encoding the CRISPR-associated protein is operably linked to a promoter.
- the nucleic acid encoding the CRISPR-associated protein is in a vector.
- the vector comprises a retroviral vector, a lentiviral vector, a phage vector, an adenoviral vector, an adeno-associated vector, or a herpes simplex vector.
- the system does not include a tracrRNA.
- the cell optionally includes a tracrRNA.
- the RNA guide optionally includes a tracrRNA and/or a modulator RNA.
- the system further includes a tracrRNA.
- the system further includes a modulator RNA.
- the target nucleic acid is a DNA molecule. In some embodiments of any of the methods described herein, the target nucleic acid includes a PAM sequence. In some embodiments of any of the methods described herein, the CRISPR-associated protein has non-specific nuclease activity. In some embodiments of any of the methods described herein, the modification of the target nucleic acid is a double-stranded cleavage event. In some embodiments of any of the methods described herein, the modification of the target nucleic acid is a single-stranded cleavage event. In some embodiments of any of the methods described herein, the modification of the target nucleic acid results in an insertion event.
- the modification of the target nucleic acid results in a deletion event. In some embodiments of any of the methods described herein, the modification of the target nucleic acid results in cell toxicity or cell death.
- the disclosure provides a method of editing a target nucleic acid, the method comprising contacting the target nucleic acid with a system described herein. In another aspect, the disclosure provides a method of modifying expression of a target nucleic acid, the method comprising contacting the target nucleic acid with a system described herein.
- the disclosure provides a method of targeting the insertion of a payload nucleic acid at a site of a target nucleic acid, the method comprising contacting the target nucleic acid with a system described herein.
- the disclosure provides a method of targeting the excision of a payload nucleic acid from a site at a target nucleic acid, the method comprising contacting the target nucleic acid with a system described herein.
- the disclosure provides a method of non-specifically degrading single-stranded DNA upon recognition of a DNA target nucleic acid, the method comprising contacting the target nucleic acid with a system described herein.
- the disclosure provides a method of detecting a target nucleic acid in a sample, the method comprising: (a) contacting the sample with a system described herein and a labeled reporter nucleic acid, wherein hybridization of the spacer sequence to the target nucleic acid causes cleavage of the labeled reporter nucleic acid; and (b) measuring a detectable signal produced by cleavage of the labeled reporter nucleic acid, thereby detecting the presence of the target nucleic acid in the sample.
- the contacting comprises directly contacting or indirectly contacting.
- contacting indirectly comprises administering one or more nucleic acids encoding an RNA guide or CRISPR-associated protein described herein under conditions that allow for production of the RNA guide and/or CRISPR-related protein.
- contacting includes contacting in vivo or contacting in vitro.
- contacting a target nucleic acid with the system comprises contacting a cell comprising the nucleic acid with the system under conditions that allow the CRISPR-related protein and guide RNA to reach the target nucleic acid.
- contacting a cell in vivo with the system comprises administering the system to the subject that comprises the cell, under conditions that allow the CRISPR-related protein and guide RNA to reach the cell or be produced in the cell.
- the disclosure provides a system provided herein for use in an in vitro or ex vivo method of: (a) targeting and editing a target nucleic acid; (b) non-specifically degrading a single-stranded nucleic acid upon recognition of the nucleic acid; (c) targeting and nicking a non- spacer complementary strand of a double-stranded target upon recognition of a spacer complementary strand of the double-stranded target; (d) targeting and cleaving a double-stranded target nucleic acid; (e) detecting a target nucleic acid in a sample; (f) specifically editing a double- stranded nucleic acid; (g) base editing a double-stranded nucleic acid; (h) inducing genotype- specific or transcriptional-state-specific cell death or dormancy in a cell; (i) creating an indel in a double-stranded nucleic acid target; (j) inserting a sequence into a double-
- the present disclosure provides a method of detecting a target nucleic acid in a sample, wherein the method comprises contacting the sample with a system described herein and a labeled reporter nucleic acid, wherein hybridization of the crRNA to the target nucleic acid causes cleavage of the labeled reporter nuclei acid, and measuring a detectable signal produced by cleavage of the labeled reporter nucleic acid, thereby detecting the presence of the target nucleic acid in the sample.
- the effectors described herein provide additional features that include, but are not limited to, 1) novel nucleic acid editing properties and control mechanisms, 2) smaller size for greater versatility in delivery strategies, 3) genotype triggered cellular processes such as cell death, and 4) programmable RNA-guided DNA insertion, excision, and mobilization, and 5) differentiated profile of pre-existing immunity through a non-human commensal source. See, e.g., Examples 1- 15 and Figures 3-44. Addition of the novel DNA-targeting systems described herein to the toolbox of techniques for genome and epigenome manipulation enables broad applications for specific, programmed perturbations. Other features and advantages of the invention will be apparent from the following detailed description and from the claims.
- FIG.1A is a schematic representation of the components of the in vivo negative selection screening assay described in Examples 2, 5, 10, 12, and 14.
- CRISPR array libraries were designed including non-representative spacers uniformly sampled from both strands of the pACYC184 or E. coli essential genes flanked by two DRs and expressed by J23119.
- FIG.1B is a schematic representation of the in vivo negative selection screening workflow described in Example 2.
- CRISPR array libraries were cloned into the effector plasmid. The effector plasmid and the non-coding plasmid were transformed into E.
- FIG. 2 is a schematic showing the RuvC and Zn finger domains of CLUST.133120 effectors, which is based upon the consensus sequence of the sequences shown in Table 3.
- FIG. 3 is a graph for CLUST.1331203300027740 (effector set forth in SEQ ID NO: 1) showing the degree of depletion activity of the engineered compositions for spacers targeting pACYC184 and direct repeat transcriptional orientations.
- FIG. 4A is a graphical representation showing the density of depleted and non-depleted targets for CLUST.133120 3300027740 by location on the pACYC184 plasmid.
- FIG. 4B is a graphic representation showing the density of depleted and non-depleted targets for CLUST.1331203300027740 by location on the E. coli strain, E. Cloni. Targets on the top strand and bottom strand are shown separately and in relation to the orientation of the annotated genes.
- the magnitude of the bands indicates the degree of depletion, wherein the lighter bands are close to the hit threshold of 3.
- the gradients are heatmaps of RNA sequencing showing relative transcript abundance.
- FIG.5 is a WebLogo of the sequences flanking depleted targets in E. Cloni as a prediction of the PAM sequence for CLUST.1331203300027740.
- FIG. 6 is a graph for CLUST.1331203300017971 (effector set forth in SEQ ID NO: 2) showing the degree of depletion activity of the engineered compositions for spacers targeting pACYC184 and direct repeat transcriptional orientations.
- FIG. 7A is a graphical representation showing the density of depleted and non-depleted targets for CLUST.133120 3300017971 by location on the pACYC184 plasmid.
- FIG. 7B is a graphic representation showing the density of depleted and non-depleted targets for CLUST.1331203300017971 by location on the E. coli strain, E. Cloni. Targets on the top strand and bottom strand are shown separately and in relation to the orientation of the annotated genes.
- the magnitude of the bands indicates the degree of depletion, wherein the lighter bands are close to the hit threshold of 3.
- the gradients are heatmaps of RNA sequencing showing relative transcript abundance.
- FIG.8 is a WebLogo of the sequences flanking depleted targets in E. Cloni as a prediction of the PAM sequence for CLUST.1331203300017971.
- FIG. 9 is a graph for CLUST.1331203300027740 (effector set forth in SEQ ID NO: 1) showing the degree of depletion activity of the engineered compositions for spacers targeting pACYC184 and direct repeat transcriptional orientations, without a non-coding sequence.
- FIG.10A is a graphical representation showing the density of depleted and non-depleted targets for CLUST.133120 3300027740, without a non-coding sequence, by location on the pACYC184 plasmid.
- FIG. 10B is a graphic representation showing the density of depleted and non-depleted targets for CLUST.1331203300027740, without a non-coding sequence, by location on the E. coli strain E. Cloni.
- FIG.11 is a WebLogo of the sequences flanking depleted targets in E. Cloni as a prediction of the PAM sequence for CLUST.1331203300027740 (without a non-coding sequence).
- FIG.12 is a graph for CLUST.1331203300017971 (effector set forth in SEQ ID NO: 2) showing the degree of depletion activity of the engineered compositions for spacers targeting pACYC184 and direct repeat transcriptional orientations, without a non-coding sequence.
- the degree of depletion with the direct repeat in the “forward” orientation (5’-GTCG...TACC- [spacer]-3’) and with the direct repeat in the “reverse” orientation (5’-GGTA...CGAC-[spacer]- 3’) are depicted.
- FIG.13A is a graphical representation showing the density of depleted and non-depleted targets for CLUST.133120 3300017971, without a non-coding sequence, by location on the pACYC184 plasmid.
- FIG. 13B is a graphic representation showing the density of depleted and non-depleted targets for CLUST.1331203300017971, without a non-coding sequence, by location on the E. coli strain E. Cloni. Targets on the top strand and bottom strand are shown separately and in relation to the orientation of the annotated genes.
- the magnitude of the bands indicates the degree of depletion, wherein the lighter bands are close to the hit threshold of 3.
- the gradients are heatmaps of RNA sequencing showing relative transcript abundance.
- FIG.14 is a WebLogo of the sequences flanking depleted targets in E. Cloni as a prediction of the PAM sequence for CLUST.1331203300017971 (without a non-coding sequence).
- FIG. 15A is a schematic of the fluorescence depletion assay described in Example 3 to measure CLUST.133120 effector activity.
- FIG.15B shows plots of GFP Depletion Ratios (Non- target/target) for the effector of SEQ ID NO: 1 for Target 1 (SEQ ID NO: 82), Target 2 (SEQ ID NO: 83), and Target 3 (SEQ ID NO: 84).
- FIG.16 is a schematic showing the RuvC domains of CLUST.099129 effectors, which is based upon the consensus sequence of the sequences shown in Table 10.
- FIG. 17 is a graph for CLUST.099129 SRR6837557 (effector set forth in SEQ ID NO: 101) showing the degree of depletion activity of the engineered compositions for spacers targeting pACYC184 and direct repeat transcriptional orientations, with a non-coding sequence. The degree of depletion with the direct repeat in the “forward” orientation (5’-GTTT...GACC-[spacer]-3’) and with the direct repeat in the “reverse” orientation (5’-AGTC...AAAC-[spacer]-3’) are depicted.
- FIG.18A is a graphical representation showing the density of depleted and non-depleted targets for CLUST.099129 SRR6837557, with a non-coding sequence, by location on the pACYC184 plasmid.
- FIG. 18B is a graphic representation showing the density of depleted and non-depleted targets for CLUST.099129 SRR6837557, with a non-coding sequence, by location on the E. coli strain, E. Cloni. Targets on the top strand and bottom strand are shown separately and in relation to the orientation of the annotated genes.
- the magnitude of the bands indicates the degree of depletion, wherein the lighter bands are close to the hit threshold of 3.
- the gradients are heatmaps of RNA sequencing showing relative transcript abundance.
- FIG.19 is a WebLogo of the sequences flanking depleted targets in E. Cloni as a prediction of the PAM sequence for CLUST.099129 SRR6837557 (with a non-coding sequence).
- FIG.20 is a graph for CLUST.099129 SRR6837557 (effector set forth in SEQ ID NO: 101) showing the degree of depletion activity of the engineered compositions for spacers targeting pACYC184 and direct repeat transcriptional orientations, without a non-coding sequence.
- FIG.21A is a graphical representation showing the density of depleted and non-depleted targets for CLUST.099129 SRR6837557, without a non-coding sequence, by location on the pACYC184 plasmid.
- FIG.21B is a graphic representation showing the density of depleted and non-depleted targets for CLUST.099129 SRR6837557, without a non-coding sequence, by location on the E. coli strain, E. Cloni.
- FIG.22 is a WebLogo of the sequences flanking depleted targets in E. Cloni as a prediction of the PAM sequence for CLUST.099129 SRR6837557 (without a non-coding sequence).
- FIG.23 is a graph for CLUST.0991293300012971 (effector set forth in SEQ ID NO: 102) showing the degree of depletion activity of the engineered compositions for spacers targeting pACYC184 and direct repeat transcriptional orientations, with a non-coding sequence.
- the degree of depletion with the direct repeat in the “forward” orientation 5’-GTGC...TCAC-[spacer]-3’) and with the direct repeat in the “reverse” orientation (5’-GTGA...GCAC-[spacer]-3’) are depicted.
- FIG.24A is a graphical representation showing the density of depleted and non-depleted targets for CLUST.099129 3300012971, with a non-coding sequence, by location on the pACYC184 plasmid.
- FIG. 24B is a graphic representation showing the density of depleted and non-depleted targets for CLUST.0991293300012971, with a non-coding sequence, by location on the E. coli strain E. Cloni. Targets on the top strand and bottom strand are shown separately and in relation to the orientation of the annotated genes.
- the magnitude of the bands indicates the degree of depletion, wherein the lighter bands are close to the hit threshold of 3.
- the gradients are heatmaps of RNA sequencing showing relative transcript abundance.
- FIG.25 is a WebLogo of the sequences flanking depleted targets in E. Cloni as a prediction of the PAM sequence for CLUST.0991293300012971 (with a non-coding sequence).
- FIG.26 is a graph for CLUST.0991293300005764 (effector set forth in SEQ ID NO: 103) showing the degree of depletion activity of the engineered compositions for spacers targeting pACYC184 and direct repeat transcriptional orientations, with a non-coding sequence. The degree of depletion with the direct repeat in the “forward” orientation (5’-GTGC...TACT-[spacer]-3’) and with the direct repeat in the “reverse” orientation (5’-AGTA...GCAC-[spacer]-3’) are depicted.
- FIG.27A is a graphical representation showing the density of depleted and non-depleted targets for CLUST.099129 3300005764, with a non-coding sequence, by location on the pACYC184 plasmid.
- FIG. 27B is a graphic representation showing the density of depleted and non-depleted targets for CLUST.0991293300005764, with a non-coding sequence, by location on the E. coli strain E. Cloni. Targets on the top strand and bottom strand are shown separately and in relation to the orientation of the annotated genes.
- the magnitude of the bands indicates the degree of depletion, wherein the lighter bands are close to the hit threshold of 3.
- the gradients are heatmaps of RNA sequencing showing relative transcript abundance.
- FIG.28 is a WebLogo of the sequences flanking depleted targets in E. Cloni as a prediction of the PAM sequence for CLUST.0991293300005764 (with a non-coding sequence).
- FIG.29A is a schematic of the fluorescence depletion assay (FDA) described in Example 6 to measure CLUST.099129 effector activity.
- FIG. 29B shows plots of GFP Depletion Ratios (Non-target/target) for the effector of SEQ ID NO: 101 for Target 1 (SEQ ID NO: 175), Target 2 (SEQ ID NO: 176), Target 3 (SEQ ID NO: 177), Target 4 (SEQ ID NO: 178), and Target 5 (SEQ ID NO: 179).
- FIG. 30B, and FIG. 30C are schematics showing the RuvC and Zn finger domains of CLUST.342201 effectors, which are based upon the consensus sequence of the sequences shown in Table 17.
- FIG.31 is a graph for CLUST.3422013300006417 (effector set forth in SEQ ID NO: 301) showing the degree of depletion activity of the engineered compositions for spacers targeting pACYC184 and direct repeat transcriptional orientations, with a non-coding sequence. The degree of depletion with the direct repeat in the “forward” orientation (5’-CCAT...GAAC-[spacer]-3’) and with the direct repeat in the “reverse” orientation (5’-GTTC...ATGG-[spacer]-3’) are depicted.
- FIG.32A is a graphical representation showing the density of depleted and non-depleted targets for CLUST.342201 3300006417, with a non-coding sequence, by location on the pACYC184 plasmid.
- FIG. 32B is a graphic representation showing the density of depleted and non-depleted targets for CLUST.3422013300006417, with a non-coding sequence, by location on the E. coli strain, E. Cloni. Targets on the top strand and bottom strand are shown separately and in relation to the orientation of the annotated genes.
- the magnitude of the bands indicates the degree of depletion, wherein the lighter bands are close to the hit threshold of 3.
- the gradients are heatmaps of RNA sequencing showing relative transcript abundance.
- FIG.33 is a WebLogo of the sequences flanking depleted targets in E. Cloni as a prediction of the PAM sequence for CLUST.3422013300006417 (with a non-coding sequence).
- FIG. 34 is a schematic showing the RuvC and Zn finger domains of CLUST.195009 effectors, which is based upon the consensus sequence of the sequences shown in TABLE 23.
- FIG. 35 is a graph for CLUST.195009 SRR6201554 (effector set forth in SEQ ID NO: 501) showing the degree of depletion activity of the engineered compositions for spacers targeting pACYC184 and direct repeat transcriptional orientations, with a non-coding sequence.
- FIG.36A is a graphical representation showing the density of depleted and non-depleted targets for CLUST.195009 SRR6201554, with a non-coding sequence, by location on the pACYC184 plasmid.
- FIG. 36B is a graphic representation showing the density of depleted and non-depleted targets for CLUST.195009 SRR6201554, with a non-coding sequence, by location on the E. coli strain, E. Cloni.
- FIG.37 is a WebLogo of the sequences flanking depleted targets in E. Cloni as a prediction of the PAM sequence for CLUST.195009 SRR6201554 (with a non-coding sequence).
- FIG.38 is a graph for CLUST.195009 SRR6201554 (effector set forth in SEQ ID NO: 501) showing the degree of depletion activity of the engineered compositions for spacers targeting pACYC184 and direct repeat transcriptional orientations, without a non-coding sequence.
- the degree of depletion with the direct repeat in the “forward” orientation (5’- CCAG...CGAC-[spacer]-3’) and with the direct repeat in the “reverse” orientation (5’- GTCG...CTGG-[spacer]-3’) are depicted.
- FIG.39A is a graphical representation showing the density of depleted and non-depleted targets for CLUST.195009 SRR6201554, without a non-coding sequence, by location on the pACYC184 plasmid.
- FIG.39B is a graphic representation showing the density of depleted and non-depleted targets for CLUST.195009 SRR6201554, without a non-coding sequence, by location on the E. coli strain, E. Cloni. Targets on the top strand and bottom strand are shown separately and in relation to the orientation of the annotated genes.
- the magnitude of the bands indicates the degree of depletion, wherein the lighter bands are close to the hit threshold of 3.
- the gradients are heatmaps of RNA sequencing showing relative transcript abundance.
- FIG.40 is a WebLogo of the sequences flanking depleted targets in E. Cloni as a prediction of the PAM sequence for CLUST.195009 SRR6201554 (without a non-coding sequence).
- FIG. 41 is a schematic representation showing the RuvC and Zn finger domains of CLUST.057059 effectors, which are based upon the consensus sequence of the sequences shown in Table 29.
- FIG.42 is a graph for CLUST.0570593300023179 (effector set forth in SEQ ID NO: 601) showing the degree of depletion activity of the engineered compositions for spacers targeting pACYC184 and direct repeat transcriptional orientations, with a non-coding sequence.
- FIG.43A is a graphical representation showing the density of depleted and non-depleted targets for CLUST.057059 3300023179, with a non-coding sequence, by location on the pACYC184 plasmid.
- FIG. 43B is a graphic representation showing the density of depleted and non-depleted targets for CLUST.0570593300023179, with a non-coding sequence, by location on the E. coli strain, E. Cloni.
- FIG.44 is a WebLogo of the sequences flanking depleted targets in E. Cloni as a prediction of the PAM sequence for CLUST.0570593300023179 (with a non-coding sequence).
- DETAILED DESCRIPTION CRISPR-Cas systems which are naturally diverse, comprise a wide range of activity mechanisms and functional elements that can be harnessed for programmable biotechnologies.
- CRISPR-Cas system refers to nucleic acids and/or proteins involved in the expression of, or directing the activity of, CRISPR effectors, including sequences encoding CRISPR effectors, RNA guides, and other sequences and transcripts from a CRISPR locus.
- CRISPR-associated protein refers to a protein that carries out an enzymatic activity or that binds to a target site on a nucleic acid specified by an RNA guide.
- a CRISPR effector has endonuclease activity, nickase activity, and/or exonuclease activity.
- RNA guide refers to any RNA molecule that facilitates the targeting of an effector described herein to a target nucleic acid, such as DNA and/or RNA.
- exemplary “RNA guides” include, but are not limited to, crRNAs, as well as crRNAs hybridized to or fused to either tracrRNAs and/or modulator RNAs.
- an RNA guide includes both a crRNA and a tracrRNA, either fused into a single RNA molecule or as separate RNA molecules.
- an RNA guide includes a crRNA and a modulator RNA, either fused into a single RNA molecule or as separate RNA molecules.
- an RNA guide includes a crRNA, a tracrRNA, and a modulator RNA, either fused into a single RNA molecule or as separate RNA molecules.
- a CRISPR effector complex may further comprise one or more accessory proteins.
- the one or more accessory proteins may be non-catalytic and/or non-target binding.
- CRISPR RNA refers to an RNA molecule comprising a guide sequence used by a CRISPR effector to specifically recognize a nucleic acid sequence.
- crRNAs contain a sequence that mediates target recognition and a sequence that forms a duplex with a tracrRNA.
- a crRNA may comprise a sequence that hybridizes to a tracrRNA.
- the crRNA: tracrRNA duplex may bind to a CRISPR effector.
- pre-crRNA refers to an unprocessed RNA molecule comprising a DR-spacer-DR sequence.
- the term “mature crRNA” refers to a processed form of a pre-crRNA; a mature crRNA may comprise a DR-spacer sequence, wherein the DR is a truncated form of the DR of a pre-crRNA and/or the spacer is a truncated form of the spacer of a pre-crRNA.
- a crRNA “spacer” sequence is complementary to and capable of partially or completely binding to a nucleic acid target sequence.
- CRISPR array refers to a nucleic acid (e.g., DNA) segment that comprises CRISPR repeats and spacers, starting with the first nucleotide of the first CRISPR repeat and ending with the last nucleotide of the final (terminal) CRISPR repeat. Typically, each spacer in a CRISPR array is located between two repeats.
- CRISPR repeat CRISPR direct repeat
- direct repeat refer to multiple short direct repeating sequences, which show very little or no sequence variation within a CRISPR array.
- modulator RNA refers to any RNA molecule that modulates (e.g., increases or decreases) an activity of a CRISPR effector or a nucleoprotein complex that includes a CRISPR effector.
- a modulator RNA modulates a nuclease activity of a CRISPR effector or a nucleoprotein complex that includes a CRISPR effector.
- target nucleic acid refers to a nucleic acid that comprises a nucleotide sequence complementary to the entirety or a part of the spacer in an RNA guide.
- the target nucleic acid comprises a gene.
- the target nucleic acid comprises a non-coding region (e.g., a promoter). In some embodiments, the target nucleic acid is single-stranded. In some embodiments, the target nucleic acid is double-stranded.
- a “transcriptionally-active site,” as used herein, refers to a site in a nucleic acid sequence being actively transcribed.
- an activated CRISPR complex is capable of modifying a target nucleic acid following binding of the activated CRISPR complex to the target nucleic acid.
- binding of an activated CRISPR complex to a target nucleic acid results in an additional cleavage event, such as collateral cleavage.
- cleavage event refers to a break in a nucleic acid, such as DNA and/or RNA.
- a cleavage event refers to a break in a target nucleic acid created by a nuclease of a CRISPR system described herein.
- the cleavage event is a double-stranded DNA break.
- the cleavage event is a single- stranded DNA break. In some embodiments, a cleavage event refers to a break in a collateral nucleic acid.
- the term “collateral nucleic acid,” as used herein, refers to a nucleic acid substrate that is cleaved non-specifically by an activated CRISPR complex.
- the term “collateral RNase activity,” as used herein in reference to a CRISPR effector refers to non-specific RNase activity of an activated CRISPR complex.
- donor template nucleic acid refers to a nucleic acid molecule that can be used to make a templated change to a target sequence or target-proximal sequence after a CRISPR effector described herein has modified the target nucleic acid.
- the donor template nucleic acid is a double-stranded nucleic acid.
- the donor template nucleic acid is a single-stranded nucleic acid.
- the donor template nucleic acid is linear.
- the donor template nucleic acid is circular (e.g., a plasmid).
- the donor template nucleic acid is an exogenous nucleic acid molecule.
- the donor template nucleic acid is an endogenous nucleic acid molecule (e.g., a chromosome).
- a chromosome e.g., a chromosome
- the terms “polynucleotide,” “nucleotide,” “oligonucleotide,” and “nucleic acid” can be used interchangeably to refer to nucleic acid comprising DNA, RNA, derivatives thereof, or combinations thereof.
- Methods well known to those skilled in the art can be used to construct genetic expression constructs and recombinant cells according to this invention. These methods include in vitro recombinant DNA techniques, synthetic techniques, in vivo recombination techniques, and polymerase chain reaction (PCR) techniques.
- Methods of genetic modification of include, for example, heterologous gene expression, gene or promoter insertion or deletion, nucleic acid mutation, altered gene expression or inactivation, enzyme engineering, directed evolution, knowledge-based design, random mutagenesis methods, gene shuffling, and codon optimization.
- the term “recombinant” indicates that a nucleic acid, protein, or cell is the product of genetic modification, engineering, or recombination.
- the term “recombinant” refers to a nucleic acid, protein, or cell that contains or is encoded by genetic material derived from multiple sources.
- a recombinant cell may also be used to describe a cell that comprises a mutated nucleic acid or protein, including a mutated form of an endogenous nucleic acid or protein.
- the terms “recombinant cell” and “recombinant host” can be used interchangeably.
- a recombinant cell comprises a CRISPR effector disclosed herein.
- the CRISPR effector disclosed herein is self-processing.
- the CRISPR effector can be codon-optimized for expression in the recombinant cell.
- a recombinant cell disclosed herein further comprises an RNA guide.
- an RNA guide of a recombinant cell disclosed herein comprises a tracrRNA. In some embodiments, an RNA guide of a recombinant cell disclosed herein does not comprise a tracrRNA.
- the recombinant cell is a prokaryotic cell, such as an E. coli cell. In some embodiments, the recombinant cell is a eukaryotic cell, such as a mammalian cell, including a human cell.
- protospacer adjacent motif or “PAM” refers to a DNA sequence adjacent to a target sequence to which a complex comprising an effector and an RNA guide binds.
- a PAM is required for enzyme activity.
- adjacent includes instances in which an RNA guide of the complex specifically binds, interacts, or associates with a target sequence that is immediately adjacent to a PAM. In such instances, there are no nucleotides between the target sequence and the PAM.
- adjacent also includes instances in which there are a small number (e.g., 1, 2, 3, 4, or 5) of nucleotides between the target sequence, to which the targeting moiety binds, and the PAM.
- CLUST.133120 Identification of CLUST.133120, CLUST.099129, CLUST.342201, CLUST.195009, and CLUST.057059
- This application relates to the identification, engineering, and use of novel protein families referred to herein as “CLUST.133120”, “CLUST.099129”, “CLUST.342201”, “CLUST.195009”, and “CLUST.057059.”
- the proteins of CLUST.133120 comprise three RuvC domains (denoted RuvC I, RuvC II, and RuvC III) and a Zn finger domain.
- effectors of CLUST.133120 range in size from about 400 amino acids to about 800 amino acids.
- the proteins of CLUST.099129 comprise three RuvC domains (denoted RuvC I, RuvC II, and RuvC III). As shown in TABLE 9, effectors of CLUST.099129 range in size from about 500 amino acids to about 700 amino acids. As shown in FIG.30A, FIG.30B, and FIG.30C, the proteins of CLUST.342201 comprise a RuvC domain (denoted RuvC I, RuvC II, and RuvC III) and a Zn finger domain. As shown in TABLE 16, effectors of CLUST.342201 range in size from about 300 to about 650 amino acids.
- CLUST.342201 effectors of about 600 amino acids have an architecture as depicted in FIG.30A.
- CLUST.342201 effectors of about 400 amino acids or less than about 400 amino acids have an architecture as depicted in FIG.30B or FIG.30C.
- effectors having sequences set forth in SEQ ID NOs: 302, 303, 308, 309, 310, 311, 316, 324, 325, 330, 331, and 337 may have an architecture as depicted in FIG.
- CLUST.342201 effectors of about 400 amino acids or less than about 400 amino acids have a RuvC III domain at the C-terminus of the effector.
- the proteins of CLUST.195009 comprise a RuvC domain (denoted RuvC I, RuvC II, and RuvC III) and a Zn finger domain.
- effectors of CLUST.195009 range in size from about 450 amino acids to about 600 amino acids.
- the proteins of CLUST.057059 comprise a RuvC domain (denoted RuvC I, RuvC II, and RuvC III) and a Zn finger domain.
- effectors of CLUST.057059 range in size from about 350 to about 700 amino acids. Therefore, the effectors of CLUST.133120, CLUST.099129, CLUST.342201, CLUST.195009, and CLUST.057059 are significantly smaller than effectors known in the art, as shown below. See, e.g., TABLE 1. Table 1. Sizes of known CRISPR-Cas system effectors.
- the effectors of CLUST.133120, CLUST.099129, CLUST.342201, CLUST.195009, and CLUST.057059 were identified using computational methods and algorithms to search for and identify proteins exhibiting a strong co-occurrence pattern with certain other features.
- these computational methods were directed to identifying proteins that co-occurred in close proximity to CRISPR arrays.
- the methods disclosed herein are also useful in identifying proteins that naturally occur within close proximity to other features, both non-coding and protein- coding (e.g., fragments of phage sequences in non-coding areas of bacterial loci or CRISPR Cas1 proteins). It is understood that the methods and calculations described herein may be performed on one or more computing devices.
- the databases comprised short reads, or contig level data, or assembled scaffolds, or complete genomic sequences of organisms.
- the databases may comprise genomic sequence data from prokaryotic organisms, or eukaryotic organisms, or may include data from metagenomic environmental samples.
- Examples of database repositories include the National Center for Biotechnology Information (NCBI) RefSeq, NCBI GenBank, NCBI Whole Genome Shotgun (WGS), and the Joint Genome Institute (JGI) Integrated Microbial Genomes (IMG).
- NCBI National Center for Biotechnology Information
- JGI Joint Genome Institute
- IMG Integrated Microbial Genomes
- the minimum contig length may be 100 nucleotides, 500 nt, 1 kb, 1.5 kb, 2 kb, 3 kb, 4 kb, 5 kb, 10 kb, 20 kb, 40 kb, or 50 kb.
- known or predicted proteins are extracted from the complete or a selected set of genome sequence data.
- known or predicted proteins are taken from extracting coding sequence (CDS) annotations provided by the source database.
- CDS extracting coding sequence
- predicted proteins are determined by applying a computational method to identify proteins from nucleotide sequences.
- the GeneMark Suite is used to predict proteins from genome sequences.
- Prodigal is used to predict proteins from genome sequences.
- multiple protein prediction algorithms may be used over the same set of sequence data with the resulting set of proteins de-duplicated.
- CRISPR arrays are identified from the genome sequence data.
- PILER-CR is used to identify CRISPR arrays.
- CRISPR Recognition Tool is used to identify CRISPR arrays.
- CRISPR arrays are identified by a heuristic that identifies nucleotide motifs repeated a minimum number of times (e.g., 2, 3, or 4 times), where the spacing between consecutive occurrences of a repeated motif does not exceed a specified length (e.g., 50, 100, or 150 nucleotides).
- a specified length e.g. 50, 100, or 150 nucleotides.
- multiple CRISPR array identification tools may be used over the same set of sequence data with the resulting set of CRISPR arrays de-duplicated.
- proteins in close proximity to CRISPR arrays are identified.
- proximity is defined as a nucleotide distance, and may be within 20 kb, 15 kb, or 5 kb. In some embodiments, proximity is defined as the number of open reading frames (ORFs) between a protein and a CRISPR array, and certain exemplary distances may be 10, 5, 4, 3, 2, 1, or 0 ORFs.
- ORFs open reading frames
- the proteins identified as being within close proximity to a CRISPR array are then grouped into clusters of homologous proteins.
- blastclust is used to form CRISPR-proximal protein clusters.
- mmseqs2 is used to form CRISPR-proximal protein clusters.
- a BLAST search of each member of the protein cluster may be performed over the complete set of known and predicted proteins previously compiled.
- UBLAST or mmseqs2 may be used to search for similar proteins.
- a search may be performed only for a representative subset of proteins in the family.
- the CRISPR-proximal protein clusters are ranked or filtered by a metric to determine co-occurrence.
- One exemplary metric is the ratio of the number of elements in a protein cluster against the number of BLAST matches up to a certain E value threshold. In some embodiments, a constant E value threshold may be used.
- the E value threshold may be determined by the most distant members of the protein cluster.
- the global set of proteins is clustered and the co-occurrence metric is the ratio of the number of elements of the CRISPR-proximal protein cluster against the number of elements of the containing global cluster(s).
- a manual review process is used to evaluate the potential functionality and the minimal set of components of an engineered system based on the naturally occurring locus structure of the proteins in the cluster.
- a graphical representation of the protein cluster may assist in the manual review and may contain information including pairwise sequence similarity, phylogenetic tree, source organisms / environments, predicted functional domains, and a graphical depiction of locus structures.
- the graphical depiction of locus structures may filter for nearby protein families that have a high representation.
- representation may be calculated by the ratio of the number of related nearby proteins against the size(s) of the containing global cluster(s).
- the graphical representation of the protein cluster may contain a depiction of the CRISPR array structures of the naturally occurring loci.
- the graphical representation of the protein cluster may contain a depiction of the number of conserved direct repeats versus the length of the putative CRISPR array or the number of unique spacer sequences versus the length of the putative CRISPR array.
- the graphical representation of the protein cluster may contain a depiction of various metrics of co- occurrence of the putative effector with CRISPR arrays predict new CRISPR-Cas systems and identify their components. Pooled-Screening of CLUST.133120, CLUST.099129, CLUST.342201, CLUST.195009, and CLUST.057059 To efficiently validate the activity, mechanisms, and functional parameters of the engineered CLUST.133120 CRISPR-Cas systems identified herein, a pooled-screening approach in E. coli was used, as described in Example 2.
- the effectors and noncoding elements are transcribed on an mRNA transcript, and different ribosomal binding sites are used to translate individual effectors.
- the natural crRNA and targeting spacers were replaced with a library of unprocessed crRNAs containing non-natural spacers targeting a second plasmid, pACYC184.
- This crRNA library was cloned into the vector backbone comprising the effectors and noncoding elements (e.g., pET-28a+), and the library was subsequently transformed into E. coli along with the pACYC184 plasmid target. Consequently, each resulting E. coli cell contains no more than one targeting array.
- the library of unprocessed crRNAs containing non-natural spacers additionally target E. coli essential genes, drawn from resources such as those described in Baba et al. (2006) Mol. Syst. Biol.2: 2006.0008; and Gerdes et al. (2003) J. Bacteriol. 185(19): 5673-84, the entire contents of each of which are incorporated herein by reference.
- positive, targeted activity of the novel CRISPR-Cas systems that disrupts essential gene function results in cell death or growth arrest.
- the essential gene targeting spacers can be combined with the pACYC184 targets.
- the E. coli were grown under antibiotic selection.
- triple antibiotic selection is used: kanamycin for ensuring successful transformation of the pET-28a+ vector containing the engineered CRISPR effector system and chloramphenicol and tetracycline for ensuring successful co-transformation of the pACYC184 target vector. Since pACYC184 normally confers resistance to chloramphenicol and tetracycline, under antibiotic selection, positive activity of the novel CRISPR-Cas system targeting the plasmid will eliminate cells that actively express the effectors, noncoding elements, and specific active elements of the crRNA library. Typically, populations of surviving cells are analyzed 12-14 h post-transformation.
- analysis of surviving cells is conducted 6-8 h post-transformation, 8-12 h post- transformation, up to 24 h post-transformation, or more than 24 h post-transformation. Examining the population of surviving cells at a later time point compared to an earlier time point results in a depleted signal compared to the inactive crRNAs.
- double antibiotic selection is used. Withdrawal of either chloramphenicol or tetracycline to remove selective pressure can provide novel information about the targeting substrate, sequence specificity, and potency. For example, cleavage of dsDNA in a selected or unselected gene can result in negative selection in E. coli, wherein depletion of both selected and unselected genes is observed.
- CRISPR-Cas system interferes with transcription or translation (e.g., by binding or by transcript cleavage), then selection will only be observed for targets in the selected resistance gene, rather than in the unselected resistance gene.
- only kanamycin is used to ensure successful transformation of the pET-28a+ vector comprising the engineered CRISPR-Cas system.
- This embodiment is suitable for libraries containing spacers targeting E. coli essential genes, as no additional selection beyond kanamycin is needed to observe growth alterations.
- chloramphenicol and tetracycline dependence is removed, and their targets (if any) in the library provide an additional source of negative or positive information about the targeting substrate, sequence specificity, and potency.
- mapping the active crRNAs from the pooled screen onto pACYC184 provides patterns of activity that can be suggestive of different activity mechanisms and functional parameters. In this way, the features required for reconstituting the novel CRISPR-Cas system in a heterologous prokaryotic species can be more comprehensively tested and studied.
- the key advantages of the in vivo pooled-screen described herein include: (1) Versatility - Plasmid design allows multiple effectors and/or noncoding elements to be expressed; library cloning strategy enables both transcriptional directions of the computationally predicted crRNA to be expressed; (2) Comprehensive tests of activity mechanisms & functional parameters - Evaluates diverse interference mechanisms, including nucleic acid cleavage; examines co-occurrence of features such as transcription, plasmid DNA replication; and flanking sequences for crRNA library can be used to reliably determine PAMs with complexity equivalence of 4N’s; (3) Sensitivity - pACYC184 is a low copy plasmid, enabling high sensitivity for CRISPR- Cas activity since even modest interference rates can eliminate the antibiotic resistance encoded by the plasmid; and (4) Efficiency - Optimized molecular biology steps to enable greater speed and throughput RNA-sequencing and protein expression samples can be directly harvested from the surviving cells in the screen.
- CRISPR-Cas families described herein were evaluated using this in vivo pooled- screen to evaluate their operational elements, mechanisms, and parameters, as well as their ability to be active and reprogrammed in an engineered system outside of its endogenous cellular environment.
- CRISPR Effector Activity and Modifications In some embodiments, a CRISPR effector of CLUST.133120, CLUST.099129, CLUST.342201, CLUST.195009, or CLUST.057059 and an RNA guide form a “binary” complex that may include other components.
- the binary complex is activated upon binding to a nucleic acid substrate that is complementary to a spacer sequence in the RNA guide (i.e., a sequence- specific substrate or target nucleic acid).
- a nucleic acid substrate that is complementary to a spacer sequence in the RNA guide (i.e., a sequence- specific substrate or target nucleic acid).
- the sequence-specific substrate is a double-stranded DNA.
- the sequence-specific substrate is a single- stranded DNA.
- the sequence-specific substrate is a single-stranded RNA.
- the sequence-specific substrate is a double-stranded RNA.
- the sequence-specificity requires a complete match of the spacer sequence in the RNA guide (e.g., crRNA) to the target substrate.
- the sequence specificity requires a partial (contiguous or non-contiguous) match of the spacer sequence in the RNA guide (e.g., crRNA) to the target substrate.
- the binary complex becomes activated upon binding to the target substrate.
- the activated complex exhibits “multiple turnover” activity, whereby upon acting on (e.g., cleaving) the target substrate the activated complex remains in an activated state.
- the activated binary complex exhibits “single turnover” activity, whereby upon acting on the target substrate the binary complex reverts to an inactive state.
- the activated binary complex exhibits non-specific (i.e., “collateral”) cleavage activity whereby the complex cleaves non-target nucleic acids.
- the non-target nucleic acid is a DNA molecule (e.g., a single-stranded or a double-stranded DNA).
- the non-target nucleic acid is an RNA molecule (e.g., a single-stranded or a double-stranded RNA).
- a CRISPR effector described herein can be fused to one or more peptide tags, including a His-tag, GST-tag, FLAG-tag, or myc-tag.
- a CRISPR effector described herein can be fused to a detectable moiety such as a fluorescent protein (e.g., green fluorescent protein or yellow fluorescent protein).
- a CRISPR effector and/or accessory protein of this disclosure is fused to a peptide or non-peptide moiety that allows the protein to enter or localize to a tissue, a cell, or a region of a cell.
- a CRISPR effector of this disclosure may comprise a nuclear localization sequence (NLS) such as an SV40 (simian virus 40) NLS, c-Myc NLS, or other suitable monopartite NLS.
- NLS nuclear localization sequence
- the NLS may be fused to the N-terminus and/or C-terminus of the CRISPR effector, and may be fused singly (i.e., a single NLS) or concatenated (e.g., a chain of 2, 3, 4, etc. NLS).
- at least one Nuclear Export Signal (NES) is attached to a nucleic acid sequences encoding the CRISPR effector.
- a C-terminal and/or N- terminal NLS or NES is attached for optimal expression and nuclear targeting in eukaryotic cells, e.g., human cells.
- a tag may facilitate affinity-based or charge-based purification of the CRISPR effector, e.g., by liquid chromatography or bead separation utilizing an immobilized affinity or ion-exchange reagent.
- a recombinant CRISPR effector of this disclosure comprises a polyhistidine (His) tag, and for purification is loaded onto a chromatography column comprising an immobilized metal ion (e.g.
- a Zn 2+ , Ni 2+ , Cu 2+ ion chelated by a chelating ligand immobilized on the resin which resin may be an individually prepared resin or a commercially available resin or ready to use column such as the HisTrap FF column commercialized by GE Healthcare Life Sciences, Marlborough, Massachusetts.
- the column is optionally rinsed, e.g., using one or more suitable buffer solutions, and the His-tagged protein is then eluted using a suitable elution buffer.
- the recombinant CRISPR effector of this disclosure utilizes a FLAG-tag, such protein may be purified using immunoprecipitation methods known in the industry.
- CRISPR effectors or accessory proteins can be delivered or used as either nucleic acid molecules or polypeptides.
- the nucleic acid molecule encoding the CRISPR effector can be codon-optimized.
- the nucleic acid can be codon optimized for use in any organism of interest, in particular human cells or bacteria.
- the nucleic acid can be codon-optimized for any non-human eukaryote including mice, rats, rabbits, dogs, livestock, or non-human primates.
- Codon usage tables are readily available, for example, at the “Codon Usage Database” available at www.kazusa.orjp/codon/ and these tables can be adapted in a number of ways. See Nakamura et al. Nucl. Acids Res. 28:292 (2000), which is incorporated herein by reference in its entirety. Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, PA).
- nucleic acids of this disclosure which encode CRISPR effectors for expression in eukaryotic (e.g., human, or other mammalian cells) cells include one or more introns, i.e., one or more non-coding sequences comprising, at a first end (e.g., a 5’ end), a splice-donor sequence and, at second end (e.g., the 3’ end) a splice acceptor sequence.
- Any suitable splice donor / splice acceptor can be used in the various embodiments of this disclosure, including without limitation simian virus 40 (SV40) intron, beta-globin intron, and synthetic introns.
- SV40 simian virus 40
- nucleic acids of this disclosure encoding CRISPR effectors or accessory proteins may include, at a 3’ end of a DNA coding sequence, a transcription stop signal such as a polyadenylation (polyA) signal.
- a transcription stop signal such as a polyadenylation (polyA) signal.
- the polyA signal is located in close proximity to, or adjacent to, an intron such as the SV40 intron.
- Deactivated/Inactivated CRISPR Effectors The CRISPR effectors described herein can be modified to have diminished nuclease activity, e.g., nuclease inactivation of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, or 100% as compared with the wild type CRISPR effectors.
- the nuclease activity can be diminished by several methods known in the art, e.g., introducing mutations into the nuclease domains of the proteins.
- catalytic residues for the nuclease activities are identified, and these amino acid residues can be substituted by different amino acid residues (e.g., glycine or alanine) to diminish the nuclease activity.
- the inactivated CRISPR effectors can comprise or be associated with one or more functional domains (e.g., via fusion protein, linker peptides, “GS” linkers, etc.).
- these functional domains can have various activities, e.g., methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity, DNA cleavage activity, nucleic acid binding activity, and switch activity (e.g., light inducible).
- the functional domains are Krüppel associated box (KRAB), VP64, VP16, Fok1, P65, HSF1, MyoD1, and biotin-APEX.
- KRAB Krüppel associated box
- VP64 VP64
- VP16 Fok1, P65, HSF1, MyoD1
- biotin-APEX biotin-APEX
- the functional domain is a transcription activator (e.g., VP16, VP64, or p65)
- the transcription activator is placed in a spatial orientation that allows it to affect the transcription of the target.
- a transcription repressor is positioned to affect the transcription of the target
- a nuclease e.g., Fok1
- the functional domain is positioned at the N-terminus of the CRISPR effector. In some embodiments, the functional domain is positioned at the C-terminus of the CRISPR effector.
- the inactivated CRISPR effector is modified to comprise a first functional domain at the N-terminus and a second functional domain at the C- terminus.
- Split Enzymes The present disclosure also provides a split version of the CRISPR effectors described herein. The split version of the CRISPR effectors may be advantageous for delivery. In some embodiments, the CRISPR effectors are split to two parts of the enzymes, which together substantially comprises a functioning CRISPR effector. The split can be done in a way that the catalytic domain(s) are unaffected.
- the CRISPR effectors may function as a nuclease or may be inactivated enzymes, which are essentially RNA- binding proteins with very little or no catalytic activity (e.g., due to mutation(s) in its catalytic domains).
- the nuclease lobe and a-helical lobe are expressed as separate polypeptides. Although the lobes do not interact on their own, the RNA guide recruits them into a ternary complex that recapitulates the activity of full-length CRISPR effectors and catalyzes site- specific DNA cleavage.
- RNA guide abrogates split-enzyme activity by preventing dimerization, allowing for the development of an inducible dimerization system.
- the split enzyme is described, e.g., in Wright et al. “Rational design of a split-Cas9 enzyme complex,” Proc. Natl. Acad. Sci., 112.10 (2015): 2984-2989, which is incorporated herein by reference in its entirety.
- the split enzyme can be fused to a dimerization partner, e.g., by employing rapamycin sensitive dimerization domains. This allows the generation of a chemically inducible CRISPR effector for temporal control of CRISPR effector activity.
- the CRISPR effector can thus be rendered chemically inducible by being split into two fragments, and rapamycin- sensitive dimerization domains can be used for controlled reassembly of the CRISPR effector.
- the split point is typically designed in silico and cloned into the constructs. During this process, mutations can be introduced to the split enzyme and non-functional domains can be removed.
- the two parts or fragments of the split CRISPR effector can form a full CRISPR effector, comprising, e.g., at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% of the sequence of the wild-type CRISPR effector.
- Self-Activating or Inactivating Enzymes The CRISPR effectors described herein can be designed to be self-activating or self- inactivating. In some embodiments, the CRISPR effectors are self-inactivating.
- the target sequence can be introduced into the CRISPR effector coding constructs.
- the CRISPR effectors can cleave the target sequence, as well as the construct encoding the enzyme thereby self- inactivating their expression.
- Methods of constructing a self-inactivating CRISPR system is described, e.g., in Epstein et al., “Engineering a Self-Inactivating CRISPR System for AAV Vectors,” Mol. Ther., 24 (2016): S50, which is incorporated herein by reference in its entirety.
- an additional RNA guide expressed under the control of a weak promoter (e.g., 7SK promoter), can target the nucleic acid sequence encoding the CRISPR effector to prevent and/or block its expression (e.g., by preventing the transcription and/or translation of the nucleic acid).
- a weak promoter e.g., 7SK promoter
- the transfection of cells with vectors expressing the CRISPR effector, RNA guides, and RNA guides that target the nucleic acid encoding the CRISPR effector can lead to efficient disruption of the nucleic acid encoding the CRISPR effector and decrease the levels of CRISPR effector, thereby limiting the genome editing activity.
- the genome editing activity of a CRISPR effector can be modulated through endogenous RNA signatures (e.g., miRNA) in mammalian cells.
- the CRISPR effector switch can be made by using a miRNA-complementary sequence in the 5 ⁇ -UTR of mRNA encoding the CRISPR effector.
- the switches selectively and efficiently respond to miRNA in the target cells.
- the switches can differentially control the genome editing by sensing endogenous miRNA activities within a heterogeneous cell population. Therefore, the switch systems can provide a framework for cell-type selective genome editing and cell engineering based on intracellular miRNA information (Hirosawa et al.
- CRISPR effectors can be inducible, e.g., light inducible or chemically inducible. This mechanism allows for activation of the functional domain in a CRISPR effector.
- Light inducibility can be achieved by various methods known in the art, e.g., by designing a fusion complex wherein CRY2PHR/CIBN pairing is used in split CRISPR effectors (see, e.g., Konermann et al., “Optical control of mammalian endogenous transcription and epigenetic states,” Nature, 500.7463 (2013): 472).
- Chemical inducibility can be achieved, e.g., by designing a fusion complex wherein FKBP/FRB (FK506 binding protein / FKBP rapamycin binding domain) pairing is used in split CRISPR effectors.
- Rapamycin is required for forming the fusion complex, thereby activating the CRISPR effectors (see, e.g., Zetsche et al., “A split-Cas9 architecture for inducible genome editing and transcription modulation,” Nature Biotech., 33.2 (2015): 139-142).
- expression of a CRISPR effector can be modulated by inducible promoters, e.g., tetracycline or doxycycline controlled transcriptional activation (Tet-On and Tet-Off expression system), hormone inducible gene expression system (e.g., an ecdysone inducible gene expression system), and an arabinose-inducible gene expression system.
- inducible promoters e.g., tetracycline or doxycycline controlled transcriptional activation (Tet-On and Tet-Off expression system)
- hormone inducible gene expression system e.g., an ecdysone inducible gene expression system
- RNA targeting effector protein When delivered as RNA, expression of the RNA targeting effector protein can be modulated via a riboswitch, which can sense a small molecule like tetracycline (see, e.g., Goldfless et al., “Direct and specific chemical control of eukaryotic translation with a synthetic RNA–protein interaction,” Nucl. Acids Res., 40.9 (2012): e64-e64).
- Various embodiments of inducible CRISPR effectors and inducible CRISPR systems are described, e.g., in US 8871445, US 20160208243, and WO 2016205764, each of which is incorporated herein by reference in its entirety.
- CRISPR effector As described herein to improve specificity and/or robustness.
- amino acid residues that recognize the Protospacer Adjacent Motif (PAM) are identified.
- the CRISPR effectors described herein can be modified further to recognize different PAMs, e.g., by substituting the amino acid residues that recognize PAM with other amino acid residues.
- the CRISPR effectors can recognize, e.g., 5'-TTN-3', or 5'-TN-3' PAM, wherein “N” is any nucleotide.
- the CRISPR effectors can recognize, e.g., 5’-GTN-3’, 5’-TG-3’, 5’- TR-3’, or 5’-RATG-3’, wherein “N” is any nucleotide and “R” is A or G.
- the CRISPR effectors can recognize, e.g., 5’-AAG-3’, 5’-AAD-3’, 5’-AAR-3’, 5’-RAAG-3’ (SEQ ID NO: 921), 5’-RAAR-3’ (SEQ ID NO: 922), 5’-RAAD-3’ (SEQ ID NO: 923), wherein “D” is A, G, or T, and “R” is A or G.
- the CRISPR effectors can recognize, e.g., 5’-TTN-3’, wherein “N” is any nucleotide. In some embodiments, the CRISPR effectors can recognize, e.g., 5’-GTN-3’, wherein “N” is any nucleotide. In some embodiments, the CRISPR effectors described herein can be mutated at one or more amino acid residue to modify one or more functional activities. For example, in some embodiments, the CRISPR effector is mutated at one or more amino acid residues to modify its helicase activity.
- the CRISPR effector is mutated at one or more amino acid residues to modify its nuclease activity (e.g., endonuclease activity or exonuclease activity). In some embodiments, the CRISPR effector is mutated at one or more amino acid residues to modify its ability to functionally associate with an RNA guide. In some embodiments, the CRISPR effector is mutated at one or more amino acid residues to modify its ability to functionally associate with a target nucleic acid. In some embodiments, the CRISPR effectors described herein are capable of cleaving a target nucleic acid molecule.
- the CRISPR effector cleaves both strands of the target nucleic acid molecule.
- the CRISPR effector is mutated at one or more amino acid residues to modify its cleaving activity.
- the CRISPR effector may comprise one or more mutations that increase the ability of the CRISPR effector to cleave a target nucleic acid.
- the CRISPR effector may comprise one or more mutations that render the enzyme incapable of cleaving a target nucleic acid.
- the CRISPR effector may comprise one or more mutations such that the enzyme is capable of cleaving a strand of the target nucleic acid (i.e., nickase activity). In some embodiments, the CRISPR effector is capable of cleaving the strand of the target nucleic acid that is complementary to the strand that the RNA guide hybridizes to. In some embodiments, the CRISPR effector is capable of cleaving the strand of the target nucleic acid that the RNA guide hybridizes to. In some embodiments, one or more residues of a CRISPR effector disclosed herein are mutated to an arginine moiety.
- one or more residues of a CRISPR effector disclosed herein are mutated to a glycine moiety. In some embodiments, one or more residues of a CRISPR effector disclosed herein are mutated based upon consensus residues of a phylogenetic alignment of CRISPR effectors disclosed herein. In some embodiments, a CRISPR effector described herein may be engineered to comprise a deletion in one or more amino acid residues to reduce the size of the enzyme while retaining one or more desired functional activities (e.g., nuclease activity and the ability to interact functionally with an RNA guide). The truncated CRISPR effector may be used advantageously in combination with delivery systems having load limitations.
- the present disclosure provides nucleic acid sequences that are at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic sequences described herein (e.g., in any of SEQ ID NOS: 1-50), while maintaining the domain architecture shown in FIG.2.
- the present disclosure also provides amino acid sequences that are at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequences described herein, while maintaining the domain architecture shown in FIG.2.
- the present disclosure provides nucleic acid sequences that are at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic sequences described herein (e.g., in any of SEQ ID NOS: 101-145), while maintaining the domain architecture shown in FIG. 16.
- the present disclosure also provides amino acid sequences that are at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequences described herein, while maintaining the domain architecture shown in FIG.16.
- the present disclosure provides nucleic acid sequences that are at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic sequences described herein (e.g., in any of SEQ ID NOS: 301-341), while maintaining the domain architecture shown in FIG. 30A, FIG.30B, or FIG.30C.
- the present disclosure also provides amino acid sequences that are at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequences described herein, while maintaining the domain architecture shown in FIG. 30A, FIG.30B, or FIG.30C.
- the present disclosure provides nucleic acid sequences that are at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic sequences described herein (e.g., in any of SEQ ID NOS: 501-521), while maintaining the domain architecture shown in FIG. 34.
- the present disclosure also provides amino acid sequences that are at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequences described herein, while maintaining the domain architecture shown in FIG.34.
- the present disclosure provides nucleic acid sequences that are at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic sequences described herein (e.g., in any of SEQ ID NOS: 601-682), while maintaining the domain architecture shown in FIG. 41.
- the present disclosure also provides amino acid sequences that are at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequences described herein, while maintaining the domain architecture shown in FIG. 41.
- the nucleic acid sequences have at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non- contiguous nucleotides) that are the same as the sequences described herein. In some embodiments, the nucleic acid sequences have at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is different from the sequences described herein.
- the amino acid sequences have at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as the sequences described herein. In some embodiments, the amino acid sequences have at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from the sequences described herein.
- the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes).
- the length of a reference sequence aligned for comparison purposes should be at least 80% of the length of the reference sequence, and in some embodiments at least 90%, 95%, or 100% of the length of the reference sequence.
- an RNA guide described herein comprises a uracil (U).
- an RNA guide described herein comprises a thymine (T).
- a direct repeat sequence of an RNA guide described herein comprises a uracil (U).
- a direct repeat sequence of an RNA guide described herein comprises a thymine (T).
- a direct repeat sequence according to Table 4, 7, 11, 14, 18, 24, 32, 35, or 30 comprises a sequence comprising a uracil, in one or more (e.g., all) places indicated as thymine in the corresponding sequences in Table 4, 7, 11, 14, 18, 24, 32, 35, or 30.
- the direct repeat comprises only one copy of a sequence that is repeated in an endogenous CRISPR array.
- the direct repeat is a full-length sequence adjacent to (e.g., flanking) one or more spacer sequences found in an endogenous CRISPR array. In some embodiments, the direct repeat is a portion (e.g., processed portion) of a full-length sequence adjacent to (e.g., flanking) one or more spacer sequences found in an endogenous CRISPR array. Spacer and Direct Repeat CLUST.133120 The spacer length of RNA guides can range from about 15 to 55 nucleotides.
- the spacer length of an RNA guide is at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, or at least 22 nucleotides.
- the spacer length is from 15 to 17 nucleotides, from 15 to 23 nucleotides, from 16 to 22 nucleotides, from 17 to 20 nucleotides, from 20 to 24 nucleotides (e.g., 20, 21, 22, 23, or 24 nucleotides), from 23 to 25 nucleotides (e.g., 23, 24, or 25 nucleotides), from 24 to 27 nucleotides, from 27 to 30 nucleotides, from 30 to 45 nucleotides (e.g., 30, 31, 32, 33, 34, 35, 40, or 45 nucleotides), from 30 or 35 to 40 nucleotides, from 41 to 45 nucleotides, from 45 to 50 nucleotides, or longer.
- 20 to 24 nucleotides e.g., 20, 21, 22, 23, or 24 nucleotides
- 23 to 25 nucleotides e.g., 23, 24, or 25 nucleotides
- from 24 to 27 nucleotides from 27 to 30
- the direct repeat length of the RNA guide is at least 16 nucleotides, or is from 16 to 20 nucleotides (e.g., 16, 17, 18, 19, or 20 nucleotides). In some embodiments, the direct repeat length of the RNA guide is 19 nucleotides. Exemplary full-length direct repeat sequences (e.g., direct repeat sequences of pre-crRNAs or unprocessed crRNAs) and direct repeat sequences of mature crRNAs (e.g., direct repeat sequences of processed crRNAs) are shown in Table 32. See also TABLE 4. Table 32. Exemplary direct repeat sequences of pre-crRNA and mature crRNA sequences.
- N’s can each be any nucleotide (e.g., A, G, T, or C) or a subset thereof (e.g., R (A or G), Y (C or T), K (G or T), B (G, T, or C), H (A, C, or T).
- an RNA guide further comprises a tracrRNA.
- the tracrRNA is not required (e.g., the tracrRNA is optional).
- the tracrRNA is a portion of the non-coding sequences shown in TABLE 5.
- the optional tracrRNA is a sequence of TABLE 33. Table 33. Exemplary tracrRNA sequences.
- RNA guides can range from about 15 to 55 nucleotides. In some embodiments, the spacer length of an RNA guide is at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, or at least 22 nucleotides.
- the spacer length is from 15 to 17 nucleotides, from 15 to 23 nucleotides, from 16 to 22 nucleotides, from 17 to 20 nucleotides, from 20 to 24 nucleotides (e.g., 20, 21, 22, 23, or 24 nucleotides), from 23 to 25 nucleotides (e.g., 23, 24, or 25 nucleotides), from 24 to 27 nucleotides, from 27 to 30 nucleotides, from 30 to 45 nucleotides (e.g., 30, 31, 32, 33, 34, 35, 40, or 45 nucleotides), from 30 or 35 to 40 nucleotides, from 41 to 45 nucleotides, from 45 to 50 nucleotides, from 50 to 55 nucleotides, or longer.
- 20 to 24 nucleotides e.g., 20, 21, 22, 23, or 24 nucleotides
- 23 to 25 nucleotides e.g., 23, 24, or 25 nucleotides
- the direct repeat length of the RNA guide is at least 16 nucleotides, or is from 16 to 20 nucleotides (e.g., 16, 17, 18, 19, or 20 nucleotides). In some embodiments, the direct repeat length of the RNA guide is up to 40 nucleotides. See TABLE 11. Exemplary full-length direct repeat sequences (e.g., direct repeat sequences of pre-crRNAs or unprocessed crRNAs) and direct repeat sequences of mature crRNAs (e.g., direct repeat sequences of processed crRNAs) are shown in Table 7. See also TABLE 11. Table 7. Exemplary direct repeat sequences of pre-crRNA and mature crRNA sequences.
- PAMs corresponding to effectors of the present application are set forth as 5’-GTN-3’, 5’-TG-3’, 5’-TR-3’, or 5’-RATG-3’.
- N’s can each be any nucleotide (e.g., A, G, T, or C) or a subset thereof (e.g., R (A or G), Y (C or T), K (G or T), B (G, T, or C), H (A, C, or T).
- an RNA guide further comprises a tracrRNA. In some embodiments, the tracrRNA is not required (e.g., the tracrRNA is optional).
- the tracrRNA is a portion of the non-coding sequences shown in TABLE 12.
- the optional tracrRNA is a sequence of TABLE 8. Table 8. Exemplary tracrRNA sequences.
- CLUST.342201 The spacer length of RNA guides can range from about 12 to 62 nucleotides. In some embodiments, the spacer length of RNA guides can range from about 19 to 40 nucleotides.
- the spacer length of an RNA guide is at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, or at least 22 nucleotides.
- the spacer length is from 15 to 17 nucleotides, from 15 to 23 nucleotides, from 16 to 22 nucleotides, from 17 to 20 nucleotides, from 20 to 24 nucleotides (e.g., 20, 21, 22, 23, or 24 nucleotides), from 23 to 25 nucleotides (e.g., 23, 24, or 25 nucleotides), from 24 to 27 nucleotides, from 27 to 30 nucleotides, from 30 to 45 nucleotides (e.g., 30, 31, 32, 33, 34, 35, 40, or 45 nucleotides), from 30 or 35 to 40 nucleotides, from 41 to 45 nucleotides, from 45 to 50 nucleotides, from 50 to 62 nucleotides, or longer.
- 20 to 24 nucleotides e.g., 20, 21, 22, 23, or 24 nucleotides
- 23 to 25 nucleotides e.g., 23, 24, or 25 nucleotides
- the direct repeat length of the RNA guide is at least 16 nucleotides, or is from 16 to 20 nucleotides (e.g., 16, 17, 18, 19, or 20 nucleotides). In some embodiments, the direct repeat length of the RNA guide is 19 nucleotides. In some embodiments, the direct repeat length of the RNA guide is greater than 20 nucleotides. See TABLE 18. Exemplary full-length direct repeat sequences (e.g., direct repeat sequences of pre-crRNAs or unprocessed crRNAs) are shown in Table 14. See also TABLE 18. Table 14. Exemplary direct repeat sequences of pre-crRNA sequences.
- PAMs corresponding to effectors of the present application are set forth as 5’-AAG-3’, 5’-AAD-3’, 5’-AAR-3’, 5’-RAAG-3’ (SEQ ID NO: 921), 5’-RAAR-3’ (SEQ ID NO: 922), 5’-RAAD-3’ (SEQ ID NO: 923).
- R corresponds to A or G
- D corresponds to A or G or T.
- an RNA guide further comprises a tracrRNA.
- the tracrRNA is a portion of the non-coding sequences shown in TABLE 19.
- the optional tracrRNA is a sequence of TABLE 15. Table 15. Exemplary tracrRNA sequences.
- the spacer length of RNA guides can range from about 15 to 55 nucleotides.
- the spacer length of RNA guides can range from about 20 to 39 nucleotides.
- the spacer length of an RNA guide is at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, or at least 22 nucleotides.
- the spacer length is from 15 to 17 nucleotides, from 15 to 23 nucleotides, from 16 to 22 nucleotides, from 17 to 20 nucleotides, from 20 to 24 nucleotides (e.g., 20, 21, 22, 23, or 24 nucleotides), from 23 to 25 nucleotides (e.g., 23, 24, or 25 nucleotides), from 24 to 27 nucleotides, from 27 to 30 nucleotides, from 30 to 45 nucleotides (e.g., 30, 31, 32, 33, 34, 35, 40, or 45 nucleotides), from 30 or 35 to 40 nucleotides, from 41 to 45 nucleotides, from 45 to 50 nucleotides, from 50 to 55 nucleotides, or longer.
- 20 to 24 nucleotides e.g., 20, 21, 22, 23, or 24 nucleotides
- 23 to 25 nucleotides e.g., 23, 24, or 25 nucleotides
- the direct repeat length of the RNA guide is at least 16 nucleotides, or is from 16 to 20 nucleotides (e.g., 16, 17, 18, 19, or 20 nucleotides). In some embodiments, the direct repeat length of the RNA guide is about 39 nucleotides. See TABLE 24. Exemplary full-length direct repeat sequences (e.g., direct repeat sequences of pre-crRNAs or unprocessed crRNAs) is shown in Table 20. See also TABLE 24. Table 20. Exemplary direct repeat sequences of pre-crRNA sequences.
- the mature crRNA e.g., direct repeat sequences of processed crRNAs
- the mature crRNA corresponding to the effector of SEQ ID NO: 501 is CAACAGCCGCGTGGGGCTACTAGTACTGCG (SEQ ID NO: 535).
- PAMs corresponding to effectors of the present application are set forth as 5’-TTN-3’.
- N’s can each be any nucleotide (e.g., A, G, T, or C) or a subset thereof (e.g., R (A or G), Y (C or T), K (G or T), B (G, T, or C), H (A, C, or T).
- an RNA guide further comprises a tracrRNA.
- the tracrRNA is not required (e.g., the tracrRNA is optional).
- the tracrRNA is a portion of the non-coding sequences shown in TABLE 25.
- the optional tracrRNA is a sequence of TABLE 21. Table 21. Exemplary tracrRNA sequences. CLUST.057059
- the spacer length of RNA guides can range from about 15 to 50 nucleotides. In some embodiments, the spacer length of RNA guides can range from about 20 to 44 nucleotides.
- the spacer length of an RNA guide is at least at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, at least 21 nucleotides, or at least 22 nucleotides.
- the spacer length is from 15 to 17 nucleotides, from 15 to 23 nucleotides, from 16 to 22 nucleotides, from 17 to 20 nucleotides, from 20 to 24 nucleotides (e.g., 20, 21, 22, 23, or 24 nucleotides), from 23 to 25 nucleotides (e.g., 23, 24, or 25 nucleotides), from 24 to 27 nucleotides, from 27 to 30 nucleotides, from 30 to 45 nucleotides (e.g., 30, 31, 32, 33, 34, 35, 40, or 45 nucleotides), from 30 or 35 to 40 nucleotides, from 41 to 45 nucleotides, from 45 to 50 nucleotides, or longer.
- 20 to 24 nucleotides e.g., 20, 21, 22, 23, or 24 nucleotides
- 23 to 25 nucleotides e.g., 23, 24, or 25 nucleotides
- from 24 to 27 nucleotides from 27 to 30
- the direct repeat length of the RNA guide is at least 16 nucleotides, or is from 16 to 20 nucleotides (e.g., 16, 17, 18, 19, or 20 nucleotides). In some embodiments, the direct repeat length of the RNA guide is 19 nucleotides. In some embodiments, the direct repeat length of the RNA guide is greater than 20 nucleotides. See TABLE 30. Exemplary full-length direct repeat sequences (e.g., direct repeat sequences of pre-crRNAs or unprocessed crRNAs) are shown in Table 26. See also TABLE 30. Table 26. Exemplary direct repeat sequences of pre-crRNA sequences.
- N’s can each be any nucleotide (e.g., A, G, T, or C) or a subset thereof (e.g., R (A or G), Y (C or T), K (G or T), B (G, T, or C), H (A, C, or T).
- an RNA guide further comprises a tracrRNA.
- the tracrRNA is not required (e.g., the tracrRNA is optional).
- the tracrRNA is a portion of the non-coding sequences shown in TABLE 31.
- the optional tracrRNA is a sequence of TABLE 27. Table 27. Exemplary tracrRNA sequences.
- RNA guide sequences can be modified in a manner that allows for formation of the CRISPR complex and successful binding to the target, while at the same time not allowing for successful nuclease activity (i.e., without nuclease activity / without causing indels). These modified guide sequences are referred to as “dead guides” or “dead guide sequences.” These dead guides or dead guide sequences may be catalytically inactive or conformationally inactive with regard to nuclease activity. Dead guide sequences are typically shorter than respective guide sequences that result in active cleavage. In some embodiments, dead guides are 5%, 10%, 20%, 30%, 40%, or 50% shorter than respective RNA guides that have nuclease activity.
- Dead guide sequences of RNA guides can be from 13 to 15 nucleotides in length (e.g., 13, 14, or 15 nucleotides in length), from 15 to 19 nucleotides in length, or from 17 to 18 nucleotides in length (e.g., 17 nucleotides in length).
- the disclosure provides non-naturally occurring or engineered CRISPR systems including functional CLUST.133120, CLUST.099129, CLUST.342201, CLUST.195009, and CLUST.057059 CRISPR effectors as described herein, and an RNA guide wherein the RNA guide comprises a dead guide sequence, whereby the RNA guide is capable of hybridizing to a target sequence such that the CRISPR system is directed to a genomic locus of interest in a cell without detectable cleavage activity.
- dead guides is described, e.g., in WO 2016094872, which is incorporated herein by reference in its entirety.
- Inducible RNA Guides can be generated as components of inducible systems.
- the inducible nature of the systems allows for spatiotemporal control of gene editing or gene expression.
- the stimuli for the inducible systems include, e.g., electromagnetic radiation, sound energy, chemical energy, and/or thermal energy.
- the transcription of RNA guide can be modulated by inducible promoters, e.g., tetracycline or doxycycline controlled transcriptional activation (Tet-On and Tet- Off expression systems), hormone inducible gene expression systems (e.g., ecdysone inducible gene expression systems), and arabinose-inducible gene expression systems.
- inducible systems include, e.g., small molecule two-hybrid transcription activations systems (FKBP, ABA, etc.), light inducible systems (Phytochrome, LOV domains, or cryptochrome), or Light Inducible Transcriptional Effector (LITE). These inducible systems are described, e.g., in WO 2016205764 and US 8795965, each of which is incorporated herein by reference in its entirety. Chemical Modifications Chemical modifications can be applied to the phosphate backbone, sugar, and/or base of the RNA guide.
- FKBP small molecule two-hybrid transcription activations systems
- LITE Light Inducible Transcriptional Effector
- Backbone modifications such as phosphorothioates modify the charge on the phosphate backbone and aid in the delivery and nuclease resistance of the oligonucleotide (see, e.g., Eckstein, “Phosphorothioates, essential components of therapeutic oligonucleotides,” Nucl. Acid Ther., 24 (2014), pp.374-387); modifications of sugars, such as 2’-O-methyl (2’-OMe), 2’- F, and locked nucleic acid (LNA), enhance both base pairing and nuclease resistance (see, e.g., Allerson et al.
- sugars such as 2’-O-methyl (2’-OMe), 2’- F, and locked nucleic acid (LNA)
- RNA is amenable to both 5’ and 3’ end conjugations with a variety of functional moieties including fluorescent dyes, polyethylene glycol, or proteins.
- RNA guide molecules A wide variety of modifications can be applied to chemically synthesized RNA guide molecules. For example, modifying an oligonucleotide with a 2’-OMe to improve nuclease resistance can change the binding energy of Watson-Crick base pairing. Furthermore, a 2’-OMe modification can affect how the oligonucleotide interacts with transfection reagents, proteins or any other molecules in the cell. The effects of these modifications can be determined by empirical testing.
- the RNA guide includes one or more phosphorothioate modifications.
- the RNA guide includes one or more locked nucleic acids for the purpose of enhancing base pairing and/or increasing nuclease resistance.
- the optimized length of RNA guide can be determined by identifying the processed form of tracrRNA and/or crRNA, or by empirical length studies for RNA guides, tracrRNAs, crRNAs, and the tracrRNA tetraloops.
- the RNA guides can also include one or more aptamer sequences. Aptamers are oligonucleotide or peptide molecules that can bind to a specific target molecule.
- the aptamers can be specific to gene effectors, gene activators, or gene repressors.
- the aptamers can be specific to a protein, which in turn is specific to and recruits / binds to specific gene effectors, gene activators, or gene repressors.
- the effectors, activators, or repressors can be present in the form of fusion proteins.
- the RNA guide has two or more aptamer sequences that are specific to the same adaptor proteins. In some embodiments, the two or more aptamer sequences are specific to different adaptor proteins.
- the adaptor proteins can include, e.g., MS2, PP7, Qb, F2, GA, fr, JP501, M12, R17, BZ13, JP34, JP500, KU1, M11, MX1, TW18, VK, SP, FI, ID2, NL95, TW19, AP205, jCb5, jCb8r, jCb12r, jCb23r, 7s, and PRR1.
- the aptamer is selected from binding proteins specifically binding any one of the adaptor proteins as described herein.
- the aptamer sequence is a MS2 loop.
- aptamers can be found, e.g., in Nowak et al., “Guide RNA engineering for versatile Cas9 functionality,” Nucl. Acid. Res., 2016 Nov 16;44(20):9555-9564; and WO 2016205764, each of which is incorporated herein by reference in its entirety.
- the degree of complementarity between a guide sequence and its corresponding target sequence can be about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or 100%.
- mutations can be introduced to the CRISPR systems so that the CRISPR systems can distinguish between target and off-target sequences that have greater than 80%, 85%, 90%, or 95% complementarity.
- the degree of complementarity is from 80% to 95%, e.g., about 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, or 95% (for example, distinguishing between a target having 18 nucleotides from an off-target of 18 nucleotides having 1, 2, or 3 mismatches).
- the degree of complementarity between a guide sequence and its corresponding target sequence is greater than 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 99.9%.
- the degree of complementarity is 100%. It is known in the field that complete complementarity is not required provided that there is sufficient complementarity to be functional. Modulations of cleavage efficiency can be exploited by introduction of mismatches, e.g., one or more mismatches, such as 1 or 2 mismatches between spacer sequence and target sequence, including the position of the mismatch along the spacer/target.
- a mismatch e.g., a double mismatch
- cleavage efficiency can be modulated. For example, if less than 100% cleavage of targets is desired (e.g., in a cell population), 1 or 2 mismatches between spacer and target sequence can be introduced in the spacer sequences.
- the CRISPR systems described herein have a wide variety of utilities including modifying (e.g., deleting, inserting, translocating, inactivating, or activating) a target polynucleotide in a multiplicity of cell types.
- the CRISPR systems have a broad spectrum of applications in, e.g., DNA/RNA detection (e.g., specific high sensitivity enzymatic reporter unlocking (SHERLOCK)), tracking and labeling of nucleic acids, enrichment assays (extracting desired sequence from background), detecting circulating tumor DNA, preparing next generation library, drug screening, disease diagnosis and prognosis, and treating various genetic disorders.
- the CRISPR systems described herein can be used in DNA/RNA detection.
- Single effector RNA-guided DNases can be reprogrammed with CRISPR RNAs (crRNAs) to provide a platform for specific single-stranded DNA (ssDNA) sensing.
- crRNAs CRISPR RNAs
- ssDNA single-stranded DNA
- activated Type V single effector DNA-guided DNases engage in “collateral” cleavage of nearby non-targeted ssDNAs. This crRNA-programmed collateral cleavage activity allows the CRISPR systems to detect the presence of a specific DNA by nonspecific degradation of labeled ssDNA.
- the collateral ssDNA activity can be combined with a reporter in DNA detection applications such as a method called the DNA Endonuclease-Targeted CRISPR trans reporter (DETECTR) method, which achieves attomolar sensitivity for DNA detection (see, e.g., Chen et al., Science, 360(6387):436-439, 2018), which is incorporated herein by reference in its entirety.
- DETECTR DNA Endonuclease-Targeted CRISPR trans reporter
- One application of using the enzymes described herein is to degrade non-specific ssDNA in an in vitro environment.
- a “reporter” ssDNA molecule linking a fluorophore and a quencher can also be added to the in vitro system, along with an unknown sample of DNA (either single-stranded or double-stranded).
- the effector complex cleaves the reporter ssDNA resulting in a fluorescent readout.
- the SHERLOCK method also provides an in vitro nucleic acid detection platform with attomolar (or single-molecule) sensitivity based on nucleic acid amplification and collateral cleavage of a reporter ssDNA, allowing for real-time detection of the target. Methods of using CRISPR in SHERLOCK are described in detail, e.g., in Gootenberg, et al.
- the CRISPR systems described herein can be used in multiplexed error-robust fluorescence in situ hybridization (MERFISH). These methods are described in, e.g., Chen et al., “Spatially resolved, highly multiplexed RNA profiling in single cells,” Science, 2015 Apr 24; 348(6233):aaa6090, which is incorporated herein by reference in its entirety. Tracking and Labeling of Nucleic Acids Cellular processes depend on a network of molecular interactions among proteins, RNAs, and DNAs.
- RNA targeting effector proteins can for instance be used to target probes to selected RNA sequences.
- the methods of tracking and labeling of nucleic acids are described, e.g., in US 8795965; WO 2016205764; and WO 2017070605, each of which is incorporated herein by reference in its entirety.
- High-Throughput Screening The CRISPR systems described herein can be used for preparing next generation sequencing (NGS) libraries.
- NGS next generation sequencing
- the CRISPR systems can be used to disrupt the coding sequence of a target gene, and the CRISPR effector transfected clones can be screened simultaneously by next-generation sequencing (e.g., on the Ion Torrent PGM system).
- NGS libraries A detailed description regarding how to prepare NGS libraries can be found, e.g., in Bell et al., “A high-throughput screening strategy for detecting CRISPR-Cas9 induced mutations using next-generation sequencing,” BMC Genomics, 15.1 (2014): 1002, which is incorporated herein by reference in its entirety.
- Engineered Cells Microorganisms e.g., E. coli, yeast, and microalgae
- the development of synthetic biology has a wide utility, including various clinical applications.
- the programmable CRISPR systems can be used to split proteins of toxic domains for targeted cell death, e.g., using cancer-linked RNA as target transcript.
- pathways involving protein-protein interactions can be influenced in synthetic biological systems with e.g., fusion complexes with the appropriate effectors such as kinases or enzymes.
- RNA guide sequences that target phage sequences can be introduced into the microorganism.
- the disclosure also provides methods of “vaccinating” a microorganism (e.g., a production strain) against phage infection.
- the CRISPR systems provided herein can be used to engineer microorganisms, e.g., to improve yield or improve fermentation efficiency.
- the CRISPR systems described herein can be used to engineer microorganisms, such as yeast, to generate biofuel or biopolymers from fermentable sugars, or to degrade plant-derived lignocellulose derived from agricultural waste as a source of fermentable sugars. More particularly, the methods described herein can be used to modify the expression of endogenous genes required for biofuel production and/or to modify endogenous genes, which may interfere with the biofuel synthesis.
- microorganisms such as yeast
- CRISPR/Cpf1 enables fast and simple genome editing of Saccharomyces cerevisiae,” Yeast, 2017 Sep 8.
- the CRISPR systems provided herein can be used to engineer eukaryotic cells or eukaryotic organisms.
- the CRISPR systems described herein can be used to engineer eukaryotic cells not limited to a plant cell, a fungal cell, a mammalian cell, a reptile cell, an insect cell, an avian cell, a fish cell, a parasite cell, an arthropod cell, an invertebrate cell, a vertebrate cell, a rodent cell, a mouse cell, a rat cell, a primate cell, a non-human primate cell, or a human cell.
- eukaryotic cell is in an in vitro culture.
- the eukaryotic cell is in vivo.
- the eukaryotic cell is ex vivo.
- Gene drive is the phenomenon in which the inheritance of a particular gene or set of genes is favorably biased.
- the CRISPR systems described herein can be used to build gene drives.
- the CRISPR systems can be designed to target and disrupt a particular allele of a gene, causing the cell to copy the second allele to fix the sequence. Because of the copying, the first allele will be converted to the second allele, increasing the chance of the second allele being transmitted to the offspring.
- a detailed method regarding how to use the CRISPR systems described herein to build gene drives is described, e.g., in Hammond et al., “A CRISPR-Cas9 gene drive system targeting female reproduction in the malaria mosquito vector Anopheles gambiae,” Nat.
- pooled CRISPR screening is a powerful tool for identifying genes involved in biological mechanisms such as cell proliferation, drug resistance, and viral infection.
- Cells are transduced in bulk with a library of RNA guide-encoding vectors described herein, and the distribution of gRNAs is measured before and after applying a selective challenge.
- Pooled CRISPR screens work well for mechanisms that affect cell survival and proliferation, and they can be extended to measure the activity of individual genes (e.g., by using engineered reporter cell lines).
- Arrayed CRISPR screens in which only one gene is targeted at a time, make it possible to use RNA-seq as the readout.
- the CRISPR systems as described herein can be used in single-cell CRISPR screens. A detailed description regarding pooled CRISPR screenings can be found, e.g., in Datlinger et al., “Pooled CRISPR screening with single-cell transcriptome read-out,” Nat. Methods., 2017 Mar; 14(3):297-301, which is incorporated herein by reference in its entirety.
- Saturation Mutagenesis (“Bashing”) The CRISPR systems described herein can be used for in situ saturating mutagenesis.
- a pooled RNA guide library can be used to perform in situ saturating mutagenesis for particular genes or regulatory elements. Such methods can reveal critical minimal features and discrete vulnerabilities of these genes or regulatory elements (e.g., enhancers). These methods are described, e.g., in Canver et al., “BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis,” Nature, 2015 Nov 12; 527(7577):192-7, which is incorporated herein by reference in its entirety.
- the CRISPR systems described herein can be used to edit a target nucleic acid to modify the target nucleic acid (e.g., by inserting, deleting, or mutating one or more amino acid residues).
- the CRISPR systems described herein comprise an exogenous donor template nucleic acid (e.g., a DNA molecule or an RNA molecule), which comprises a desirable nucleic acid sequence.
- the molecular machinery of the cell can utilize the exogenous donor template nucleic acid in repairing and/or resolving the cleavage event.
- the molecular machinery of the cell can utilize an endogenous template in repairing and/or resolving the cleavage event.
- the CRISPR systems described herein may be used to modify a target nucleic acid resulting in an insertion, a deletion, and/or a point mutation).
- the insertion is a scarless insertion (i.e., the insertion of an intended nucleic acid sequence into a target nucleic acid resulting in no additional unintended nucleic acid sequence upon resolution of the cleavage event).
- Donor template nucleic acids may be double-stranded or single-stranded nucleic acid molecules (e.g., DNA or RNA).
- RNA sequence specific interference RNA sequence-specific gene regulation
- screening of RNA, RNA products, lncRNA, non-coding RNA, nuclear RNA, or mRNA RNA sequence-specific gene regulation
- screening of RNA, RNA products, lncRNA, non-coding RNA, nuclear RNA, or mRNA mutagenesis
- inhibition of RNA splicing fluorescence in situ hybridization
- breeding induction of cell dormancy; induction of cell cycle arrest; reduction of cell growth and/or cell proliferation; induction of cell anergy; induction of cell apoptosis; induction of cell necrosis; induction of cell death; or induction of programmed cell death.
- the CRISPR systems described herein can have various therapeutic applications.
- the new CRISPR systems can be used to treat various diseases and disorders, e.g., genetic disorders (e.g., monogenetic diseases) or diseases that can be treated by nuclease activity (e.g., Pcsk9 targeting or BCL11a targeting).
- the methods described here are used to treat a subject, e.g., a mammal, such as a human patient.
- the mammalian subject can also be a domesticated mammal, such as a dog, cat, horse, monkey, rabbit, rat, mouse, cow, goat, or sheep.
- the methods can include the condition or disease being infectious, and wherein the infectious agent is selected from the group consisting of human immunodeficiency virus (HIV), herpes simplex virus-1 (HSV1), and herpes simplex virus-2 (HSV2).
- the CRISPR systems described herein can be used for treating a disease caused by overexpression of RNAs, toxic RNAs and/or mutated RNAs (e.g., splicing defects or truncations).
- expression of the toxic RNAs may be associated with the formation of nuclear inclusions and late-onset degenerative changes in brain, heart, or skeletal muscle.
- the disorder is myotonic dystrophy.
- DM DM type 1
- UTR 3 '-untranslated region
- the CRISPR systems as described herein can target overexpressed RNA or toxic RNA, e.g., the DMPK gene or any of the mis-regulated alternative splicing in DM1 skeletal muscle, heart, or brain.
- the CRISPR systems described herein can also target trans-acting mutations affecting RNA-dependent functions that cause various diseases such as, e.g., Prader Willi syndrome, Spinal muscular atrophy (SMA), and Dyskeratosis congenita.
- SMA Spinal muscular atrophy
- Dyskeratosis congenita e.g., Prader Willi syndrome, Spinal muscular atrophy (SMA), and Dyskeratosis congenita.
- a list of diseases that can be treated using the CRISPR systems described herein is summarized in Cooper et al., “RNA and disease,” Cell, 136.4 (2009): 777-793, and WO 2016205764, each of which is incorporated herein by reference in its entirety.
- the CRISPR systems described herein can also be used in the treatment of various tauopathies, including, e.g., primary and secondary tauopathies, such as primary age-related tauopathy (PART)/Neurofibrillary tangle (NFT)-predominant senile dementia (with NFTs similar to those seen in Alzheimer Disease (AD), but without plaques), dementia pugilistica (chronic traumatic encephalopathy), and progressive supranuclear palsy.
- PART primary age-related tauopathy
- NFT Neurofibrillary tangle
- a useful list of tauopathies and methods of treating these diseases are described, e.g., in WO 2016205764, which is incorporated herein by reference in its entirety.
- the CRISPR systems described herein can also be used to target mutations disrupting the cis-acting splicing codes that can cause splicing defects and diseases. These diseases include, e.g., motor neuron degenerative disease that results from deletion of the SMN1 gene (e.g., spinal muscular atrophy), Duchenne Muscular Dystrophy (DMD), frontotemporal dementia, and Parkinsonism linked to chromosome 17 (FTDP-17), and cystic fibrosis.
- the CRISPR systems described herein can further be used for antiviral activity, in particular, against RNA viruses.
- the effector proteins can target the viral RNAs using suitable RNA guides selected to target viral RNA sequences.
- RNA sensing assays can be used to detect specific RNA substrates.
- the RNA targeting effector proteins can be used for RNA-based sensing in living cells. Examples of applications are diagnostics by sensing of, for examples, disease-specific RNAs.
- a detailed description of therapeutic applications of the CRISPR systems described herein can be found, e.g., in US 8795965, EP 3009511, WO 2016205764, and WO 2017070605, each of which is incorporated herein by reference in its entirety.
- Applications in Plants The CRISPR systems described herein have a wide variety of utility in plants.
- the CRISPR systems can be used to engineer genomes of plants (e.g., improving production, making products with desired post-translational modifications, or introducing genes for producing industrial products).
- the CRISPR systems can be used to introduce a desired trait to a plant (e.g., with or without heritable modifications to the genome) or regulate expression of endogenous genes in plant cells or whole plants.
- the CRISPR systems can be used to identify, edit, and/or silence genes encoding specific proteins, e.g., allergenic proteins (e.g., allergenic proteins in peanuts, soybeans, lentils, peas, green beans, and mung beans).
- CRISPR systems described herein, components thereof, nucleic acid molecules thereof, or nucleic acid molecules encoding or providing components thereof can be delivered by various delivery systems such as vectors, e.g., plasmids or viral delivery vectors.
- RNAs e.g., RNA guides
- suitable vectors e.g., plasmids or viral vectors, such as adeno-associated viruses (AAV), lentiviruses, adenoviruses, and other viral vectors, or combinations thereof.
- AAV adeno-associated viruses
- An effector and one or more RNA guides can be packaged into one or more vectors, e.g., plasmids or viral vectors.
- vectors e.g., plasmids or viral vectors
- tissue of interest e.g., intramuscular injection, intravenous administration, transdermal administration, intranasal administration, oral administration, or mucosal administration.
- Such delivery may be either via one dose or multiple doses.
- the actual dosage to be delivered herein may vary greatly depending upon a variety of factors, including, but not limited to, the vector choices, the target cells, organisms, tissues, the general conditions of the subject to be treated, the degrees of transformation/modification sought, the administration routes, the administration modes, and the types of transformation/modification sought.
- delivery is via adenoviruses, which can be one dose containing at least 1 x 10 5 particles (also referred to as particle units, pu) of adenoviruses.
- the dose preferably is at least about 1 x 10 6 particles, at least about 1 x 10 7 particles, at least about 1 x 10 8 particles, and at least about 1 x 10 9 particles of the adenoviruses.
- the delivery methods and the doses are described, e.g., in WO 2016205764 and US 8454972, each of which is incorporated herein by reference in its entirety.
- delivery is via plasmids.
- the dosage can be a sufficient number of plasmids to elicit a response.
- suitable quantities of plasmid DNA in plasmid compositions can be from about 0.1 to about 2 mg.
- Plasmids will generally include (i) a promoter; (ii) a sequence encoding a nucleic acid-targeting CRISPR effector, operably linked to the promoter; (iii) a selectable marker; (iv) an origin of replication; and (v) a transcription terminator downstream of and operably linked to (ii).
- the plasmids can also encode the RNA components of a CRISPR complex, but one or more of these may instead be encoded on different vectors.
- the frequency of administration is within the ambit of the medical or veterinary practitioner (e.g., physician, veterinarian), or a person skilled in the art.
- delivery is via liposomes or lipofectin formulations or the like and can be prepared by methods known to those skilled in the art. Such methods are described, for example, in WO 2016205764, US 5593972, US 5589466, and US 5580859, each of which is incorporated herein by reference in its entirety.
- delivery is via nanoparticles or exosomes.
- exosomes have been shown to be particularly useful in delivery RNA.
- Further means of introducing one or more components of the CRISPR systems described herein to a cell is by using cell-penetrating peptides (CPP).
- CRISPR cell-penetrating peptides
- a cell penetrating peptide is linked to a CRISPR effector.
- a CRISPR effector and/or RNA guide is coupled to one or more CPPs for transportation into a cell (e.g., plant protoplasts).
- the CRISPR effector and/or RNA guide(s) are encoded by one or more circular or non-circular DNA molecules that are coupled to one or more CPPs for cell delivery.
- CPPs are short peptides of fewer than 35 amino acids derived either from proteins or from chimeric sequences capable of transporting biomolecules across cell membrane in a receptor independent manner.
- CPPs can be cationic peptides, peptides having hydrophobic sequences, amphipathic peptides, peptides having proline- rich and anti-microbial sequences, and chimeric or bipartite peptides.
- CPPs include, e.g., Tat (which is a nuclear transcriptional activator protein required for viral replication by HIV type l), penetratin, Kaposi fibroblast growth factor (FGF) signal peptide sequence, integrin b3 signal peptide sequence, polyarginine peptide Args sequence, Guanine rich-molecular transporters, and sweet arrow peptide.
- Tat which is a nuclear transcriptional activator protein required for viral replication by HIV type l
- FGF Kaposi fibroblast growth factor
- FGF Kaposi fibroblast growth factor
- integrin b3 signal peptide sequence polyarginine peptide Args sequence
- Guanine rich-molecular transporters and sweet arrow peptide.
- Example 1 Identification of Components of CLUST.133120 CRISPR-Cas System This protein family was identified using the computational methods described above.
- the CLUST.133120 system comprises single effectors associated with CRISPR systems found in uncultured metagenomic sequences collected from freshwater, wastewater, soil, and rhizosphere environments (TABLE 2).
- Exemplary CLUST.133120 effectors include those shown in TABLES 2 and 3, below. Examples of direct repeat sequences for these systems are shown in TABLE 4. Optionally, the system includes a tracrRNA that is contained in a non-coding sequence listed in TABLE 5.
- Example 2 Functional Validation of Two Engineered CLUST.133120 CRISPR-Cas Systems Having identified components of CLUST.133120 CRISPR-Cas systems, two loci were selected for functional validation: 1) a locus from the metagenomic source designated 3300027740 (SEQ ID NO: 1) and 2) a locus from the metagenomic source designated 3300017971 (SEQ ID NO: 2). DNA Synthesis and Effector Library Cloning To test the activity of the exemplary CLUST.133120 CRISPR-Cas systems, systems were designed and synthesized using a pET28a(+) vector. Briefly, an E.
- coli codon-optimized nucleic acid sequence encoding the CLUST.133120 3300027740 effector (SEQ ID NO: 1 shown in TABLE 3) and an E. coli codon-optimized nucleic acid sequence encoding CLUST.133120 3300017971 effector (SEQ ID NO: 2 shown in TABLE 3) were synthesized (Genscript) and individually cloned into a custom expression system derived from pET-28a(+) (EMD-Millipore).
- the vector also included an acceptor site for a CRISPR array library driven by a J23119 promoter following the open reading frame for the CLUST.133120 3300027740 effector.
- the non-coding sequence used for the CLUST.133120 3300027740 effector (SEQ ID NO: 1) is set forth in SEQ ID NO: 78
- the non-coding sequence used for the CLUST.1331203300017971 effector (SEQ ID NO: 2) is set forth in SEQ ID NO: 75, shown in TABLE 5.
- the repeat sequence used for the CLUST.1331203300027740 effector (SEQ ID NO: 1) is set forth in SEQ ID NO: 51
- the repeat sequence used for the CLUST.1331203300017971 effector (SEQ ID NO: 2) is set forth in SEQ ID NO: 52, as shown in TABLE 4.
- the spacer length was determined by the mode of the spacer lengths found in the endogenous CRISPR array.
- the repeat-spacer- repeat sequence was appended with restriction sites enabling the bi-directional cloning of the fragment into the aforementioned CRISPR array library acceptor site, as well as unique PCR priming sites to enable specific amplification of a specific repeat-spacer-repeat library from a larger pool.
- each repeat-spacer-repeat was first amplified from the OLS pool (Agilent Genomics) using unique PCR primers and pre-linearized the plasmid backbone using BsaI to reduce potential background. Both DNA fragments were purified with Ampure XP (Beckman Coulter) prior to addition to Golden Gate Assembly Master Mix (New England Biolabs) and incubated per the manufacturer’s instructions. The Golden Gate reaction was further purified and concentrated to enable maximum transformation efficiency in the subsequent steps of the bacterial screen.
- the plasmid library containing the distinct repeat-spacer-repeat elements and CRISPR effectors was electroporated into E. Cloni electrocompetent E. coli (Lucigen) using a Gene Pulser Xcell ® (Bio-rad) following the protocol recommended by Lucigen.
- the library was either co- transformed with purified pACYC184 plasmid or directly transformed into pACYC184- containing E. Cloni electrocompetent E.
- coli (Lucigen), plated onto agar containing chloramphenicol (Fisher), tetracycline (Alfa Aesar), and kanamycin (Alfa Aesar) in BioAssay ® dishes (Thermo Fisher), and incubated for 10-12 hours at 37 °C.
- the bacteria were harvested, and plasmid DNA WAS extracted using a QIAprep Spin Miniprep® Kit (Qiagen) to create an “output library.”
- QIAprep Spin Miniprep® Kit Qiagen
- a barcoded next generation sequencing library was generated from both the pre-transformation “input library” and the post-harvest “output library,” which were then pooled and loaded onto a Nextseq 550 (Illumina) to evaluate the effectors. At least two independent biological replicates were performed for each screen to ensure consistency. See FIG.1B.
- the depletion score was calculated by dividing normalized output reads for a given array element by normalized input reads. To identify specific parameters resulting in enzymatic activity and bacterial cell death, next generation sequencing (NGS) was used to quantify and compare the representation of individual CRISPR arrays (i.e., repeat-spacer-repeat) in the PCR product of the input and output plasmid libraries.
- NGS next generation sequencing
- the array depletion ratio was defined as the normalized output read count divided by the normalized input read count. An array was considered to be “strongly depleted” if the depletion ratio was less than 0.3 (more than 3-fold depletion), depicted by the dashed line in FIG.3, FIG. 6, FIG.9, and FIG.12.
- FIG.3 and FIG.6 show the degree of interference activity of the engineered compositions by plotting for a given target the normalized ratio of sequencing reads in the screen output versus the screen input. The results are plotted for each DR transcriptional orientation.
- an active effector complexed with an active RNA guide will interfere with the ability of the pACYC184 to confer E. coli resistance to chloramphenicol and tetracycline, resulting in cell death and depletion of the spacer element within the pool.
- Comparison of the results of deep sequencing the initial DNA library (screen input) versus the surviving transformed E. coli (screen output) suggests specific target sequences and DR transcriptional orientations that enable an active, programmable CRISPR system.
- the screen also indicates that the effector complex is only active with one orientation of the DR.
- FIG. 4A and FIG. 4B depict the location of strongly depleted targets for the CLUST.1331203300027740 effector (plus non-coding sequence) targeting pACYC184 and E. coli E. Cloni essential genes, respectively.
- FIG.7A and FIG.7B show the location of strongly depleted targets for the CLUST.1331203300017971 effector targeting pACYC184 and E. coli E. Cloni essential genes, respectively. Flanking sequences of depleted targets were analyzed to determine the PAM for CLUST.133120 3300027740 and CLUST.133120 3300017971. WebLogo representations (Crooks et al., Genome Research 14: 1188-90, 2004) of the PAM sequences for CLUST.1331203300027740 and CLUST.1331203300017971 are shown in FIG. 5 and FIG. 8, respectively. The “20” position corresponds to the nucleotide adjacent to the 5’ location of the target.
- FIG.9 shows that the CLUST.1331203300027740 effector retains activity in the absence of the non-coding sequence.
- the CLUST.133120 3300027740 effector was active in the forward (5’-CCAA...CGAC-[spacer]-3’) orientation of the DR.
- FIG. 10A and FIG. 10B depict the locations of the strongly depleted targets for CLUST.1331203300027740 effector (minus the non-coding sequence) targeting pACYC184 and E. coli E. Cloni essential genes, respectively.
- a WebLogo of the PAM sequences for CLUST.1331203300027740 (minus the non-coding sequence) is shown in FIG. 11.
- FIG.12 shows that the CLUST.1331203300017971 effector retains activity in the absence of the non-coding sequence.
- the CLUST.1331203300017971 effector was active in the reverse (5’-GGTA...CGAC-[spacer]-3’) orientation of the DR.
- FIG.13A and FIG. 13B depict the locations of the strongly depleted targets for CLUST.1331203300017971 effector (minus the non-coding sequence) targeting pACYC184 and E. coli E. Cloni essential genes, respectively.
- a WebLogo of the PAM sequences for CLUST.1331203300017971 (minus the non- coding sequence) is shown in FIG.14.
- the “20” position corresponds to the nucleotide adjacent to the 5’ location of the target.
- multiple effectors of CLUST.133120 CRISPR-Cas show activity in vivo, both in the presence or absence of non-coding sequences. These results suggest that effectors of CLUST.133120 do not require a tracrRNA. CLUST.133120 effectors may thus be self-processing, allowing for ease in multiplexing.
- FDA fluorescence depletion assay
- an active CRISPR system designed to target GFP binds and cleaves the double- stranded DNA region encoding GFP, resulting in depletion of GFP fluorescence.
- the FDA assay involves in vitro transcription and translation, allowing production of an RNP from a DNA template encoding a CLUST.133120 effector and a DNA template containing a pre-crRNA sequence under a T7 promoter with direct repeat (DR)-spacer-direct repeat (DR); the spacer targeted GFP.
- DR direct repeat
- DR spacer-direct repeat
- GFP and RFP were also produced as both the target and the fluorescence reporter (FIG.15A).
- the target GFP plasmid sequence is set forth in SEQ ID NO: 192, and the RFP plasmid sequence is set forth in SEQ ID NO: 193.
- GFP and RFP fluorescence values were measured every 20 min at 37°C for 12 hr, using a TECAN Infinite F Plex plate reader. Since RFP was not targeted, its fluorescence was not affected and was therefore used as an internal signal control.
- RNA guide sequences, target sequences, and the non-target control sequences used for the FDA assay are listed in Table 6.
- the pre-crRNA sequences shown in Table 6 further include a T7 promoter at the 5’ end and a hairpin motif that caps the 3’ end of the RNA to ensure that the RNA is not degraded by nucleases present in the in vitro transcription and translation mixture.
- a 5’-TTN-3’ PAM was used for the target sequences. Table 6.
- GFP signal was normalized to RFP signal, then the average fluorescence of three technical replicates was taken at each time point.
- GFP fluorescence depletion was then calculated by dividing the GFP signal of an effector incubated with a non-GFP targeting RNA guide (which instead targets a kanamycin resistance gene and does not deplete GFP signal) by the GFP signal of an effector incubated with a GFP targeting RNA guide. The resulting value is referred to as “Depletion” in FIG.15B.
- a Depletion of one or approximately one indicated that there was little to no difference in GFP depletion with respect to a non-GFP targeting pre-crRNA and a GFP targeting pre-crRNA (e.g., 10 RFU / 10 RFU 1).
- a Depletion of greater than one indicated that there was a difference in GFP depletion with respect to a non-GFP targeting pre-crRNA and a GFP targeting pre-crRNA (e.g., 10 RFU / 5 RFU 2).
- Depletion of the GFP signal indicated that the effector formed a functional RNP and interfered with the production of GFP by introducing double-stranded DNA cleavage within the GFP coding region.
- FIG. 15B shows depletion curves for RNPs formed by the effector of SEQ ID NO: 1, measured every 20 minutes for each of the GFP targets (Targets 1-3). At each target, the depletion values for RNPs formed with the effector of SEQ ID NO: 1 were greater than one. This indicated that the CLUST.133120 effector formed a functional RNP capable of interfering with the production of GFP.
- Example 4 Identification of Components of CLUST.099129 CRISPR-Cas System This protein family was identified using the computational methods described above.
- the CLUST.099129 system comprises single effectors associated with CRISPR systems found in uncultured metagenomic sequences collected from freshwater, wastewater, soil, and rhizosphere environments as well as from Anaerolineae bacterium (TABLE 9).
- Exemplary CLUST.099129 effectors include those shown in TABLES 9 and 10, below. Examples of direct repeat sequences for these systems are shown in TABLE 11.
- the system includes a tracrRNA that is contained in a non-coding sequence listed in TABLE 12. Table 9.
- coli codon-optimized nucleic acid sequence encoding CLUST.0991293300005764 effector (SEQ ID NO: 103 shown in TABLE 10) were synthesized (Genscript) and individually cloned into a custom expression system derived from pET-28a(+) (EMD-Millipore).
- the vectors included the nucleic acid encoding CLUST.099129 effectors under the control of a lac promoter and an E. coli ribosome binding sequence.
- the vector also included an acceptor site for a CRISPR array library driven by a J23119 promoter following the open reading frame for the CLUST.099129 effector.
- the non- coding sequence used for the CLUST.099129 SRR6837557 effector (SEQ ID NO: 101) is set forth in SEQ ID NO: 163, the non-coding sequence used for the CLUST.0991293300012971 effector (SEQ ID NO: 102) is set forth in SEQ ID NO: 174, and the non-coding sequence used for the CLUST.0991293300005764 effector (SEQ ID NO: 103) is set forth in SEQ ID NO: 170, as shown in TABLE 12.
- An additional condition was tested, wherein the CLUST.099129 SRR6837557 effector (SEQ ID NO: 101) was individually cloned into pET28a(+) without the non-coding sequence. See FIG.1A.
- oligonucleotide library synthesis (OLS) pool containing “repeat-spacer-repeat” sequences was computationally designed, where “repeat” represents the consensus direct repeat sequence found in the CRISPR array associated with the effector, and “spacer” represents sequences tiling the pACYC184 plasmid or E. coli essential genes.
- the repeat sequence used for the CLUST.099129 SRR6837557 effector (SEQ ID NO: 101) is set forth in SEQ ID NO: 146
- the repeat sequence used for the CLUST.0991293300012971 effector (SEQ ID NO: 102) is set forth in SEQ ID NO: 147
- the repeat sequence used for the CLUST.099129 3300005764 effector (SEQ ID NO: 103) is set forth in SEQ ID NO: 148, as shown in TABLE 11.
- the spacer length was determined by the mode of the spacer lengths found in the endogenous CRISPR array.
- the repeat-spacer-repeat sequence was appended with restriction sites enabling the bi-directional cloning of the fragment into the aforementioned CRISPR array library acceptor site, as well as unique PCR priming sites to enable specific amplification of a specific repeat-spacer- repeat library from a larger pool.
- the repeat-spacer-repeat library was cloned into the plasmid using the Golden Gate assembly method. Briefly, each repeat-spacer-repeat was first amplified from the OLS pool (Agilent Genomics) using unique PCR primers and pre-linearized the plasmid backbone using BsaI to reduce potential background.
- coli (Lucigen), plated onto agar containing chloramphenicol (Fisher), tetracycline (Alfa Aesar), and kanamycin (Alfa Aesar) in BioAssay ® dishes (Thermo Fisher), and incubated for 10-12 hours at 37 °C.
- the bacteria were harvested, and plasmid DNA WAS extracted using a QIAprep Spin Miniprep® Kit (Qiagen) to create an “output library.”
- QIAprep Spin Miniprep® Kit Qiagen
- a barcoded next generation sequencing library was generated from both the pre-transformation “input library” and the post-harvest “output library,” which were then pooled and loaded onto a Nextseq 550 (Illumina) to evaluate the effectors. At least two independent biological replicates were performed for each screen to ensure consistency. See FIG.1B.
- the depletion score was calculated by dividing normalized output reads for a given array element by normalized input reads. To identify specific parameters resulting in enzymatic activity and bacterial cell death, next generation sequencing (NGS) was used to quantify and compare the representation of individual CRISPR arrays (i.e., repeat-spacer-repeat) in the PCR product of the input and output plasmid libraries.
- NGS next generation sequencing
- the array depletion ratio was defined as the normalized output read count divided by the normalized input read count. An array was considered to be “strongly depleted” if the depletion ratio was less than 0.3 (more than 3-fold depletion), depicted by the blue dashed line in FIG.17, FIG. 20, FIG. 23, and FIG. 26.
- FIG.17, FIG.23, and FIG.26 show the degree of interference activity of the engineered compositions, with a non-coding sequence, by plotting for a given target the normalized ratio of sequencing reads in the screen output versus the screen input.
- results are plotted for each DR transcriptional orientation.
- an active effector complexed with an active RNA guide will interfere with the ability of the pACYC184 to confer E. coli resistance to chloramphenicol and tetracycline, resulting in cell death and depletion of the spacer element within the pool.
- Comparison of the results of deep sequencing the initial DNA library (screen input) versus the surviving transformed E. coli (screen output) suggests specific target sequences and DR transcriptional orientations that enable an active, programmable CRISPR system.
- the screen also indicates that the effector complex is only active with one orientation of the DR.
- the screen indicated that the CLUST.099129 SRR6837557 effector was active in the “reverse” orientation (5’-AGTC...AAAC-[spacer]-3’) of the DR (FIG. 17), that the CLUST.0991293300012971 was active in the reverse orientation (5’-GTGA...GCAC-[spacer]- 3’) of the DR (FIG. 23), and that the CLUST.099129 3300005764 effector was active in the forward orientation (5’-GTGC...TACT-[spacer]-3’) of the DR (FIG.26).
- FIG. 18B depict the location of strongly depleted targets for the CLUST.099129 SRR6837557 effector (plus non-coding sequence) targeting pACYC184 and E. coli E. Cloni essential genes, respectively.
- FIG.27A and FIG.27B depict the location of strongly depleted targets for the CLUST.0991293300005764 effector (plus non-coding sequence) targeting pACYC184 and E. coli E. Cloni essential genes, respectively.
- Flanking sequences of depleted targets were analyzed to determine the PAM for CLUST.099129 effectors.
- WebLogo representations (Crooks et al., Genome Research 14: 1188-90, 2004) of the PAM sequences for CLUST.099129 SRR6837557, CLUST.0991293300012971, and CLUST.099129 3300005764 are shown in FIG. 19, FIG. 25, and FIG.14, respectively.
- the “20” position corresponds to the nucleotide adjacent to the 5’ end of the target.
- multiple effectors of CLUST.099129 revealed activity in vivo.
- FIG.20 shows that the CLUST.099129 SRR6837557 effector retains activity in the absence of the non-coding sequence.
- the CLUST.099129 SRR6837557 effector, without the non-coding sequence was active in the reverse orientation (5’-AGTC...AAAC-[spacer]-3’) of the DR.
- FIG.21A and FIG.21B depict the locations of the strongly depleted targets for the CLUST.099129 SRR6837557 effector, without the non-coding sequence, targeting pACYC184 and E. coli E. Cloni essential genes, respectively.
- Example 6 Targeting of GFP by a CLUST.099129 Effector This Example describes use of a fluorescence depletion assay (FDA) to measure activity of a CLUST.099129 effector.
- FDA fluorescence depletion assay
- an active CRISPR system designed to target GFP binds and cleaves the double-stranded DNA region encoding GFP, resulting in depletion of GFP fluorescence.
- the FDA assay involves in vitro transcription and translation, allowing production of an RNP from a DNA template encoding a CLUST.099129 effector and a DNA template containing a pre-crRNA sequence under a T7 promoter with direct repeat (DR)-spacer-direct repeat (DR); the spacer targeted GFP.
- DR direct repeat
- DR spacer-direct repeat
- GFP and RFP were also produced as both the target and the fluorescence reporter (FIG. 29A).
- the target GFP plasmid sequence is set forth in SEQ ID NO: 192, and the RFP plasmid sequence is set forth in SEQ ID NO: 193.
- GFP and RFP fluorescence values were measured every 20 min at 37°C for 12 hr, using a TECAN Infinite F Plex plate reader. Since RFP was not targeted, its fluorescence was not affected and was therefore used as an internal signal control.
- RNA guide sequences, target sequences, and the non-target control sequences used for the FDA assay are listed in Table 13.
- a 5’-GTN-3’ PAM was used for the target sequences.
- RNA guide and Target Sequences for FDA Assay GFP signal was normalized to RFP signal, then the average fluorescence of three technical replicates was taken at each time point. GFP fluorescence depletion was then calculated by dividing the GFP signal of an effector incubated with a non-GFP targeting RNA guide (which instead targets a kanamycin resistance gene and does not deplete GFP signal) by the GFP signal of an effector incubated with a GFP targeting RNA guide. The resulting value is referred to as “Depletion” in FIG.29B.
- a Depletion of one or approximately one indicated that there was little to no difference in GFP depletion with respect to a non-GFP targeting pre-crRNA and a GFP targeting pre-crRNA (e.g., 10 RFU / 10 RFU 1).
- a Depletion of greater than one indicated that there was a difference in GFP depletion with respect to a non-GFP targeting pre-crRNA and a GFP targeting pre-crRNA (e.g., 10 RFU / 5 RFU 2).
- Depletion of the GFP signal indicated that the effector formed a functional RNP and interfered with the production of GFP by introducing double-stranded DNA cleavage within the GFP coding region.
- FIG.29B shows depletion curves for RNPs formed by the effector of SEQ ID NO: 101, measured every 20 minutes for each of the GFP targets (Targets 1-5). At each target, the depletion values for RNPs formed with the effector of SEQ ID NO: 101 were greater than one. This indicated that the CLUST.099129 effector formed a functional RNP capable of interfering with the production of GFP.
- Example 7 Identification of Components of CLUST.342201 CRISPR-Cas Systems This protein family was identified using the computational methods described above.
- the CLUST.342201 system comprises single effectors associated with CRISPR systems found in uncultured metagenomic sequences collected from wastewater, freshwater, marine, lake sediment, gut, microbial mat, and soil environments (TABLE 16).
- Exemplary CLUST.342201 effectors include those shown in TABLES 16 and 17, below. Examples of direct repeat sequences and spacer lengths for these systems are shown in TABLE 18.
- the system includes a tracrRNA that is contained within a non-coding sequence listed in TABLE 19. Table 16.
- tracrRNA transactivating RNA
- tracrRNAs typically include a complementary region that hybridizes to the crRNA.
- the crRNA-tracrRNA hybrid forms a complex with an effector resulting in the activation of programmable enzymatic activity.
- ⁇ tracrRNA sequences can be identified by searching genomic sequences flanking CRISPR arrays for short sequence motifs that are homologous to the direct repeat portion of the crRNA.
- Search methods include exact or degenerate sequence matching for the complete direct repeat (DR) or DR subsequences.
- a DR of length n nucleotides can be decomposed into a set of overlapping 6-10 nt kmers. These kmers can be aligned to sequences flanking a CRISPR locus, and regions of homology with 1 or more kmer alignments can be identified as DR homology regions for experimental validation as tracrRNAs.
- RNA cofold free energy can be calculated for the complete DR or DR subsequences and short kmer sequences from the genomic sequence flanking the elements of a CRISPR system.
- Flanking sequence elements with low minimum free energy structures can be identified as DR homology regions for experimental validation as tracrRNAs.
- ⁇ tracrRNA elements frequently occur within close proximity to CRISPR associated genes or a CRISPR array.
- non-coding sequences flanking CRISPR effectors or the CRISPR array can be isolated by cloning or gene synthesis for direct experimental validation of tracrRNAs.
- Experimental validation of tracrRNA elements can be performed using small RNA sequencing of the host organism for a CRISPR system or synthetic sequences expressed heterologously in non-native species.
- RNA sequencing can be validated in vitro or in vivo by expressing the crRNA and effector in combination with or without the tracrRNA candidate and monitoring the activation of effector enzymatic activity.
- the expression of tracrRNAs can be driven by promoters including, but not limited to U6, U1, and H1 promoters for expression in mammalian cells or J23119 promoter for expression in bacteria.
- a tracrRNA can be fused with a crRNA and expressed as a single RNA guide.
- Example 9 Identification of Novel RNA Modulators of Enzymatic Activity
- some CRISPR systems described herein may also include an additional small RNA to activate or modulate the effector activity, referred to herein as an RNA modulator.
- RNA modulators are expected to occur within close proximity to CRISPR-associated genes or a CRISPR array. To identify and validate RNA modulators, non-coding sequences flanking CRISPR effectors or the CRISPR array can be isolated by cloning or gene synthesis for direct experimental validation.
- RNA modulators can be performed using small RNA sequencing of the host organism for a CRISPR system or synthetic sequences expressed heterologously in non-native species. Alignment of small RNA sequences to the originating genomic locus can be used to identify expressed RNA products containing DR homology regions and sterotyped processing. ⁇ Candidate RNA modulators identified by RNA sequencing can be validated in vitro or in vivo by expressing a crRNA and an effector in combination with or without the candidate RNA modulator and monitoring alterations in effector enzymatic activity.
- RNA modulators can be driven by promoters including U6, U1, and H1 promoters for expression in mammalian cells, or J23119 promoter for expression in bacteria.
- the RNA modulators can be artificially fused with either a crRNA, a tracrRNA, or both and expressed as a single RNA element.
- Example 10 Functional Validation of Engineered CLUST.342201 CRISPR-Cas System Having identified components of CLUST.342201 CRISPR-Cas systems, a locus from the metagenomic source designated 3300006417 (SEQ ID NO: 301) was selected for functional validation.
- the vector also included an acceptor site for a CRISPR array library driven by a J23119 promoter following the open reading frame for the CLUST.342201 effector.
- the non-coding sequence used for the CLUST.3422013300006417 effector (SEQ ID NO: 301) is set forth in SEQ ID NO: 373, as shown in TABLE 19. A separate condition was tested, wherein the CLUST.3422013300006417 effector (SEQ ID NO: 301) was individually cloned into pET28a(+) without the non-coding sequence. See FIG.1A.
- oligonucleotide library synthesis (OLS) pool containing “repeat-spacer-repeat” sequences was computationally designed, where “repeat” represents the consensus direct repeat sequence found in the CRISPR array associated with the effector, and “spacer” represents sequences tiling the pACYC184 plasmid or E. coli essential genes.
- the repeat sequence used for the CLUST.3422013300006417 effector (SEQ ID NO: 301) is set forth in SEQ ID NO: 342, as shown in TABLE 18.
- the spacer length was determined by the mode of the spacer lengths found in the endogenous CRISPR array.
- the repeat-spacer-repeat sequence was appended with restriction sites enabling the bi-directional cloning of the fragment into the aforementioned CRISPR array library acceptor site, as well as unique PCR priming sites to enable specific amplification of a specific repeat-spacer-repeat library from a larger pool.
- the repeat-spacer-repeat library was cloned into the plasmid using the Golden Gate assembly method. Briefly, each repeat-spacer-repeat was first amplified from the OLS pool (Agilent Genomics) using unique PCR primers and pre-linearized the plasmid backbone using BsaI to reduce potential background.
- coli (Lucigen), plated onto agar containing chloramphenicol (Fisher), tetracycline (Alfa Aesar), and kanamycin (Alfa Aesar) in BioAssay ® dishes (Thermo Fisher), and incubated for 10-12 hours at 37 °C.
- the bacteria were harvested, and plasmid DNA WAS extracted using a QIAprep Spin Miniprep® Kit (Qiagen) to create an “output library.”
- QIAprep Spin Miniprep® Kit Qiagen
- a barcoded next generation sequencing library was generated from both the pre-transformation “input library” and the post-harvest “output library,” which were then pooled and loaded onto a Nextseq 550 (Illumina) to evaluate the effectors. At least two independent biological replicates were performed for each screen to ensure consistency. See FIG.1B.
- the depletion score was calculated by dividing normalized output reads for a given array element by normalized input reads. To identify specific parameters resulting in enzymatic activity and bacterial cell death, next generation sequencing (NGS) was used to quantify and compare the representation of individual CRISPR arrays (i.e., repeat-spacer-repeat) in the PCR product of the input and output plasmid libraries.
- NGS next generation sequencing
- the array depletion ratio was defined as the normalized output read count divided by the normalized input read count. An array was considered to be “strongly depleted” if the depletion ratio was less than 0.3 (more than 3-fold depletion), depicted by the blue dashed line in FIG.31.
- FIG.31 shows the degree of interference activity of the engineered compositions, with a non-coding sequence, by plotting for a given target the normalized ratio of sequencing reads in the screen output versus the screen input.
- results are plotted for each DR transcriptional orientation.
- an active effector complexed with an active RNA guide will interfere with the ability of the pACYC184 to confer E. coli resistance to chloramphenicol and tetracycline, resulting in cell death and depletion of the spacer element within the pool.
- Comparison of the results of deep sequencing the initial DNA library (screen input) versus the surviving transformed E. coli (screen output) suggests specific target sequences and DR transcriptional orientations that enable an active, programmable CRISPR system.
- the screen also indicates that the effector complex is only active with one orientation of the DR.
- FIG. 32A and FIG. 32B depict the location of strongly depleted targets for the CLUST.3422013300006417 effector (plus non-coding sequence) targeting pACYC184 and E. coli E. Cloni essential genes, respectively.
- Flanking sequences of depleted targets were analyzed to determine the PAM sequence for CLUST.342201 3300006417.
- a WebLogo representation (Crooks et al., Genome Research 14: 1188-90, 2004) of the PAM sequence for CLUST.342201 3300006417 is shown in FIG.33.
- Example 11 - Identification of Components of CLUST.195009 CRISPR-Cas System This protein family was identified using the computational methods described above.
- the CLUST.195009 system comprises single effectors associated with CRISPR systems found in uncultured metagenomic sequences collected from environments not limited to hypersaline lake, aquatic, landfill, soil, and wastewater environments as well as from Acidobacteria (TABLE 22).
- Exemplary CLUST.195009 effectors include those shown in TABLES 22 and 23, below. Examples of direct repeat sequences and spacer lengths for these systems are shown in TABLE 24. Optionally, the system includes a tracrRNA that is contained in a non-coding sequence listed in TABLE 25. Table 224. Representative CLUST.195009 Effector Proteins Table 235. Amino acid sequences of Representative CLUST.195009 Effector Proteins
- coli codon-optimized nucleic acid sequence encoding the CLUST.195009 SRR6201554 effector (SEQ ID NO: 501 shown in TABLE 23) was synthesized (Genscript) and cloned into a custom expression system derived from pET-28a(+) (EMD-Millipore).
- the vector included the nucleic acid encoding the CLUST.195009 effector under the control of a lac promoter and an E. coli ribosome binding sequence.
- the vector also included an acceptor site for a CRISPR array library driven by a J23119 promoter following the open reading frame for the CLUST.195009 effector.
- the non-coding sequence used for the CLUST.195009 SRR6201554 effector (SEQ ID NO: 501) is set forth in SEQ ID NO: 533, as shown in TABLE 25. An additional condition was tested, wherein the CLUST.195009 SRR6201554 effector (SEQ ID NO: 501) was individually cloned into pET28a(+) without the non- coding sequence. See FIG.1A.
- oligonucleotide library synthesis (OLS) pool containing “repeat-spacer-repeat” sequences was computationally designed, where “repeat” represents the consensus direct repeat sequence found in the CRISPR array associated with the effector, and “spacer” represents sequences tiling the pACYC184 plasmid or E. coli essential genes.
- the repeat sequence used for the CLUST.195009 SRR6201554 effector (SEQ ID NO: 501) is set forth in SEQ ID NO: 522, as shown in TABLE 24.
- the spacer length was determined by the mode of the spacer lengths found in the endogenous CRISPR array.
- the repeat-spacer-repeat sequence was appended with restriction sites enabling the bi-directional cloning of the fragment into the aforementioned CRISPR array library acceptor site, as well as unique PCR priming sites to enable specific amplification of a specific repeat-spacer-repeat library from a larger pool.
- the repeat-spacer-repeat library was cloned into the plasmid using the Golden Gate assembly method. Briefly, each repeat-spacer-repeat was first amplified from the OLS pool (Agilent Genomics) using unique PCR primers and pre-linearized the plasmid backbone using BsaI to reduce potential background.
- coli (Lucigen), plated onto agar containing chloramphenicol (Fisher), tetracycline (Alfa Aesar), and kanamycin (Alfa Aesar) in BioAssay ® dishes (Thermo Fisher), and incubated for 10-12 hours at 37 °C.
- the bacteria were harvested, and plasmid DNA WAS extracted using a QIAprep Spin Miniprep® Kit (Qiagen) to create an “output library.”
- QIAprep Spin Miniprep® Kit Qiagen
- a barcoded next generation sequencing library was generated from both the pre-transformation “input library” and the post-harvest “output library,” which were then pooled and loaded onto a Nextseq 550 (Illumina) to evaluate the effectors. At least two independent biological replicates were performed for each screen to ensure consistency. See FIG.1B.
- the depletion score was calculated by dividing normalized output reads for a given array element by normalized input reads. To identify specific parameters resulting in enzymatic activity and bacterial cell death, next generation sequencing (NGS) was used to quantify and compare the representation of individual CRISPR arrays (i.e., repeat-spacer-repeat) in the PCR product of the input and output plasmid libraries.
- NGS next generation sequencing
- the array depletion ratio was defined as the normalized output read count divided by the normalized input read count. An array was considered to be “strongly depleted” if the depletion ratio was less than 0.3 (more than 3-fold depletion), depicted by the blue dashed line in FIG.35 and FIG.38.
- FIG. 35 shows the degree of interference activity of the engineered composition, with a non-coding sequence, by plotting for a given target the normalized ratio of sequencing reads in the screen output versus the screen input.
- results are plotted for each DR transcriptional orientation.
- an active effector complexed with an active RNA guide will interfere with the ability of the pACYC184 to confer E. coli resistance to chloramphenicol and tetracycline, resulting in cell death and depletion of the spacer element within the pool.
- Comparison of the results of deep sequencing the initial DNA library (screen input) versus the surviving transformed E. coli (screen output) suggests specific target sequences and DR transcriptional orientations that enable an active, programmable CRISPR system.
- the screen also indicates that the effector complex is only active with one orientation of the DR.
- FIG. 36A and FIG. 36B depict the location of strongly depleted targets for the CLUST.195009 SRR6201554 effector (plus non-coding sequence) targeting pACYC184 and E. coli E. Cloni essential genes, respectively. Flanking sequences of depleted targets were analyzed to determine the PAM for CLUST.195009 effectors.
- FIG.37 A WebLogo representation (Crooks et al., Genome Research 14: 1188-90, 2004) of the PAM sequence for CLUST.195009 SRR6201554 is shown in FIG.37, where the “20” position corresponds to the nucleotide adjacent to the 5’ end of the target. Furthermore, FIG.38 shows that the CLUST.195009 SRR6201554 effector retains activity in the absence of the non-coding sequence. In agreement with FIG.35, the CLUST.195009 SRR6201554 effector, without the non-coding sequence, was active in the “forward” orientation (5’-CCAG...CGAC-[spacer]-3’) of the DR.
- FIG.39A and FIG.39B depict the locations of the strongly depleted targets for the CLUST.195009 SRR6201554 effector, without the non-coding sequence, targeting pACYC184 and E. coli E. Cloni essential genes, respectively.
- a WebLogo of the PAM sequence for CLUST.195009 SRR6201554, without the non-coding sequence, is shown in FIG.40, where the “20” position corresponds to the nucleotide adjacent to the 5’ end of the target.
- Example 13 Identification of Components of CLUST.057059 CRISPR-Cas Systems This protein family was identified using the computational methods described above.
- the CLUST.057059 system comprises single effectors associated with CRISPR systems found in particular environments, including freshwater, aquatic, biofilm, crustacean, microbial mat, sediment and soil crust environments as well as in Aphanizomenon phage, Cyanothece sp., Propionimicrobium lymphophilum, Sphaerospermopsis reniformis (TABLE 28).
- Exemplary CLUST.057059 effectors include those shown in TABLES 28 and 29, below. Examples of direct repeat sequences and spacer lengths for these systems are shown in TABLE 30.
- the system includes a tracrRNA that is contained within a non-coding sequence listed in TABLE 31. Table 288. Representative CLUST.057059 Effector Proteins
- coli codon-optimized nucleic acid sequence encoding the CLUST.057059 3300023179 effector was synthesized (Genscript) and cloned into a custom expression system derived from pET-28a(+) (EMD-Millipore).
- the vector included the nucleic acid encoding CLUST.057059 effectors under the control of a lac promoter and an E. coli ribosome binding sequence.
- the vector also included an acceptor site for a CRISPR array library driven by a J23119 promoter following the open reading frame for the CLUST.057059 effector.
- the non-coding sequence used for the CLUST.0570593300023179 effector (SEQ ID NO: 601) is set forth in SEQ ID NO: 619, as shown in TABLE 31. A separate condition was tested, wherein the CLUST.0570593300023179 effector (SEQ ID NO: 601) was individually cloned into pET28a(+) without the non-coding sequence. See FIG.1A.
- oligonucleotide library synthesis (OLS) pool containing “repeat-spacer-repeat” sequences was computationally designed, where “repeat” represents the consensus direct repeat sequence found in the CRISPR array associated with the effector, and “spacer” represents sequences tiling the pACYC184 plasmid or E. coli essential genes.
- the repeat sequence used for the CLUST.0570593300023179 effector (SEQ ID NO: 601) is set forth in SEQ ID NO: 611, as shown in TABLE 30.
- the spacer length was determined by the mode of the spacer lengths found in the endogenous CRISPR array.
- the repeat-spacer-repeat sequence was appended with restriction sites enabling the bi-directional cloning of the fragment into the aforementioned CRISPR array library acceptor site, as well as unique PCR priming sites to enable specific amplification of a specific repeat-spacer-repeat library from a larger pool.
- the repeat-spacer-repeat library was cloned into the plasmid using the Golden Gate assembly method. Briefly, each repeat-spacer-repeat was first amplified from the OLS pool (Agilent Genomics) using unique PCR primers and pre-linearized the plasmid backbone using BsaI to reduce potential background.
- coli (Lucigen), plated onto agar containing chloramphenicol (Fisher), tetracycline (Alfa Aesar), and kanamycin (Alfa Aesar) in BioAssay ® dishes (Thermo Fisher), and incubated for 10-12 hours at 37 °C.
- the bacteria were harvested, and plasmid DNA WAS extracted using a QIAprep Spin Miniprep® Kit (Qiagen) to create an “output library.”
- QIAprep Spin Miniprep® Kit Qiagen
- a barcoded next generation sequencing library was generated from both the pre-transformation “input library” and the post-harvest “output library,” which were then pooled and loaded onto a Nextseq 550 (Illumina) to evaluate the effectors. At least two independent biological replicates were performed for each screen to ensure consistency. See FIG.1B.
- the depletion score was calculated by dividing normalized output reads for a given array element by normalized input reads. To identify specific parameters resulting in enzymatic activity and bacterial cell death, next generation sequencing (NGS) was used to quantify and compare the representation of individual CRISPR arrays (i.e., repeat-spacer-repeat) in the PCR product of the input and output plasmid libraries.
- NGS next generation sequencing
- the array depletion ratio was defined as the normalized output read count divided by the normalized input read count. An array was considered to be “strongly depleted” if the depletion ratio was less than 0.3 (more than 3-fold depletion), depicted by the blue dashed line in FIG.42.
- FIG.42 shows the degree of interference activity of the engineered compositions, with a non-coding sequence, by plotting for a given target the normalized ratio of sequencing reads in the screen output versus the screen input.
- results are plotted for each DR transcriptional orientation.
- an active effector complexed with an active RNA guide will interfere with the ability of the pACYC184 to confer E. coli resistance to chloramphenicol and tetracycline, resulting in cell death and depletion of the spacer element within the pool.
- Comparison of the results of deep sequencing the initial DNA library (screen input) versus the surviving transformed E. coli (screen output) suggests specific target sequences and DR transcriptional orientations that enable an active, programmable CRISPR system.
- the screen also indicates that the effector complex is only active with one orientation of the DR.
- FIG. 43A and FIG. 43B depict the location of strongly depleted targets for the CLUST.0570593300023179 effector (plus non-coding sequence) targeting pACYC184 and E. coli E. Cloni essential genes, respectively.
- Flanking sequences of depleted targets were analyzed to determine the PAM sequence for CLUST.057059 3300023179.
- a WebLogo representation (Crooks et al., Genome Research 14: 1188-90, 2004) of the PAM sequence for CLUST.057059 3300023179 is shown in FIG.44, where the “20” position corresponds to the nucleotide adjacent to the 5’ end of the target.
- Example 15 – Targeting of Mammalian Genes This Example describes an indel assessment on a mammalian target by the effector disclosed herein introduced into mammalian cells by transient transfection. An effector described herein is cloned into a pcda3.1 backbone (Invitrogen).
- RNA guide preparation a dsDNA fragment encoding an RNA guide is derived by ultramers containing the target sequence scaffold, and the U6 promoter. Ultramers are resuspended in 10 mM Tris•HCl at a pH of 7.5 to a final stock concentration of 100 mM. Working stocks are subsequently diluted to 10 mM, again using 10 mM Tris•HCl to serve as the template for the PCR reaction.
- the amplification of the RNA guide is done in 50 mL reactions with the following components: 0.02 ml of aforementioned template, 2.5 ml forward primer, 2.5 ml reverse primer, 25 mL NEB HiFi Polymerase, and 20 ml water. Cycling conditions are: 1 x (30s at 98oC), 30 x (10s at 98oC, 15s at 67oC), 1 x (2min at 72oC). PCR products are cleaned up with a 1.8X SPRI treatment and normalized to 25 ng/mL.
- the sequence of a target locus is selected as described herein. For example, a target locus adjacent to a PAM sequence of TABLE 34 is selected. Table 34. PAM sequence for target selection.
- a crRNA sequence is selected as described herein.
- a crRNA comprises a direct repeat sequence of the length and sequence described herein.
- Non-limiting examples of direct repeats are shown in TABLE 35. Table 35. Direct Repeat for crRNA design. Approximately 16 hours prior to transfection, 100 ml of 25,000 HEK293T cells in DMEM/10%FBS+Pen/Strep are plated into each well of a 96-well plate. On the day of transfection, the cells are 70-90% confluent. For each well to be transfected, a mixture of 0.5 ml of Lipofectamine 2000 and 9.5 ml of Opti-MEM is prepared and then incubated at room temperature for 5-20 minutes (Solution 1).
- the lipofectamine:OptiMEM mixture is added to a separate mixture containing 182 ng of effector plasmid and 14 ng of crRNA and water up to 10 mL (Solution 2). In the case of negative controls, the crRNA is not included in Solution 2.
- the solution 1 and solution 2 mixtures are mixed by pipetting up and down and then incubated at room temperature for 25 minutes.
- PCR1 The first round (PCR1) is used to amplify specific genomic regions depending on the target. PCR1 products are purified by column purification. Round 2 PCR (PCR2) is done to add Illumina adapters and indexes. Reactions are then pooled and purified by column purification. Sequencing runs are done with a 150 cycle NextSeq v2.5 mid or high output kit. Percentages of indels in the target locus in HEK293T cells following transfection are calculated. Indel percentages over background are indicative of nuclease activity in mammalian cells.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202080073597.6A CN114729011A (zh) | 2019-08-27 | 2020-08-26 | 新型crispr dna靶向酶及系统 |
| EP20857507.6A EP4021924A4 (en) | 2019-08-27 | 2020-08-26 | NOVEL CRISPR DNA TARGETING ENZYMES AND SYSTEMS |
| US17/638,065 US20230016656A1 (en) | 2019-08-27 | 2020-08-26 | Novel crispr dna targeting enzymes and systems |
| JP2022513214A JP2022546701A (ja) | 2019-08-27 | 2020-08-26 | 新規crispr dnaターゲティング酵素及びシステム |
| CA3152788A CA3152788A1 (en) | 2019-08-27 | 2020-08-26 | Novel crispr dna targeting enzymes and systems |
| AU2020340353A AU2020340353A1 (en) | 2019-08-27 | 2020-08-26 | Novel CRISPR DNA targeting enzymes and systems |
Applications Claiming Priority (16)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201962892358P | 2019-08-27 | 2019-08-27 | |
| US201962892434P | 2019-08-27 | 2019-08-27 | |
| US201962892446P | 2019-08-27 | 2019-08-27 | |
| US201962892390P | 2019-08-27 | 2019-08-27 | |
| US201962892382P | 2019-08-27 | 2019-08-27 | |
| US62/892,446 | 2019-08-27 | ||
| US62/892,382 | 2019-08-27 | ||
| US62/892,358 | 2019-08-27 | ||
| US62/892,434 | 2019-08-27 | ||
| US62/892,390 | 2019-08-27 | ||
| US201962893059P | 2019-08-28 | 2019-08-28 | |
| US201962893064P | 2019-08-28 | 2019-08-28 | |
| US62/893,059 | 2019-08-28 | ||
| US62/893,064 | 2019-08-28 | ||
| US201962896277P | 2019-09-05 | 2019-09-05 | |
| US62/896,277 | 2019-09-05 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2021041569A1 true WO2021041569A1 (en) | 2021-03-04 |
Family
ID=74683321
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2020/048037 Ceased WO2021041569A1 (en) | 2019-08-27 | 2020-08-26 | Novel crispr dna targeting enzymes and systems |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20230016656A1 (https=) |
| EP (1) | EP4021924A4 (https=) |
| JP (1) | JP2022546701A (https=) |
| CN (1) | CN114729011A (https=) |
| AU (1) | AU2020340353A1 (https=) |
| CA (1) | CA3152788A1 (https=) |
| WO (1) | WO2021041569A1 (https=) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3877517A1 (en) | 2018-11-09 | 2021-09-15 | Inari Agriculture, Inc. | Rna-guided nucleases and dna binding proteins |
| WO2022256440A2 (en) | 2021-06-01 | 2022-12-08 | Arbor Biotechnologies, Inc. | Gene editing systems comprising a crispr nuclease and uses thereof |
| WO2024173645A1 (en) | 2023-02-15 | 2024-08-22 | Arbor Biotechnologies, Inc. | Gene editing method for inhibiting aberrant splicing in stathmin 2 (stmn2) transcript |
| WO2025171210A1 (en) | 2024-02-09 | 2025-08-14 | Arbor Biotechnologies, Inc. | Compositions and methods for gene editing via homology-mediated end joining |
| WO2026015829A2 (en) | 2024-07-12 | 2026-01-15 | Arbor Biotechnologies, Inc. | Small reverse transcriptases and gene editing systems comprising such |
| WO2026015832A2 (en) | 2024-07-12 | 2026-01-15 | Arbor Biotechnologies, Inc. | Reverse transcriptases and gene editing systems comprising such |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024078645A2 (zh) * | 2023-12-28 | 2024-04-18 | 广州瑞风生物科技有限公司 | Cas蛋白及其应用 |
| WO2025201481A1 (en) * | 2024-03-29 | 2025-10-02 | Yoltech Therapeutics Co., Ltd | Crispr-cas systems |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20190002875A1 (en) * | 2017-06-30 | 2019-01-03 | Arbor Biotechnologies, Inc. | Novel crispr rna targeting enzymes and systems and uses thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3500967A1 (en) * | 2016-08-17 | 2019-06-26 | The Broad Institute, Inc. | Methods for identifying class 2 crispr-cas systems |
| BR112019006388A2 (pt) * | 2016-09-30 | 2019-06-25 | Univ California | enzimas modificadoras de ácido nucleico guiadas por rna e métodos de uso das mesmas |
-
2020
- 2020-08-26 JP JP2022513214A patent/JP2022546701A/ja active Pending
- 2020-08-26 WO PCT/US2020/048037 patent/WO2021041569A1/en not_active Ceased
- 2020-08-26 CN CN202080073597.6A patent/CN114729011A/zh active Pending
- 2020-08-26 CA CA3152788A patent/CA3152788A1/en active Pending
- 2020-08-26 AU AU2020340353A patent/AU2020340353A1/en not_active Abandoned
- 2020-08-26 US US17/638,065 patent/US20230016656A1/en not_active Abandoned
- 2020-08-26 EP EP20857507.6A patent/EP4021924A4/en not_active Withdrawn
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20190002875A1 (en) * | 2017-06-30 | 2019-01-03 | Arbor Biotechnologies, Inc. | Novel crispr rna targeting enzymes and systems and uses thereof |
Non-Patent Citations (2)
| Title |
|---|
| DATABASE UNIPROTKB 12 September 2018 (2018-09-12), ANONYMOUS: "OrfB Zn ribbon domain-containing protein", XP055905247, retrieved from UNIPROT Database accession no. A0A2W4LE77 * |
| See also references of EP4021924A4 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3877517A1 (en) | 2018-11-09 | 2021-09-15 | Inari Agriculture, Inc. | Rna-guided nucleases and dna binding proteins |
| EP3877517A4 (en) * | 2018-11-09 | 2022-09-07 | Inari Agriculture, Inc. | RNA-DRIVEN NUCLEASES AND DNA-BINDING PROTEINS |
| US12460189B2 (en) | 2018-11-09 | 2025-11-04 | Inari Agriculture Technology, Inc. | RNA-guided nucleases and DNA binding proteins |
| WO2022256440A2 (en) | 2021-06-01 | 2022-12-08 | Arbor Biotechnologies, Inc. | Gene editing systems comprising a crispr nuclease and uses thereof |
| WO2024173645A1 (en) | 2023-02-15 | 2024-08-22 | Arbor Biotechnologies, Inc. | Gene editing method for inhibiting aberrant splicing in stathmin 2 (stmn2) transcript |
| WO2025171210A1 (en) | 2024-02-09 | 2025-08-14 | Arbor Biotechnologies, Inc. | Compositions and methods for gene editing via homology-mediated end joining |
| WO2026015829A2 (en) | 2024-07-12 | 2026-01-15 | Arbor Biotechnologies, Inc. | Small reverse transcriptases and gene editing systems comprising such |
| WO2026015832A2 (en) | 2024-07-12 | 2026-01-15 | Arbor Biotechnologies, Inc. | Reverse transcriptases and gene editing systems comprising such |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4021924A1 (en) | 2022-07-06 |
| CA3152788A1 (en) | 2021-03-04 |
| EP4021924A4 (en) | 2024-02-07 |
| CN114729011A (zh) | 2022-07-08 |
| US20230016656A1 (en) | 2023-01-19 |
| JP2022546701A (ja) | 2022-11-07 |
| AU2020340353A1 (en) | 2022-03-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11976308B2 (en) | CRISPR DNA targeting enzymes and systems | |
| US11667904B2 (en) | CRISPR-associated systems and components | |
| US20220333102A1 (en) | Novel crispr dna targeting enzymes and systems | |
| US20220282283A1 (en) | Novel crispr dna targeting enzymes and systems | |
| US20230016656A1 (en) | Novel crispr dna targeting enzymes and systems | |
| US20220372456A1 (en) | Novel crispr dna targeting enzymes and systems | |
| US20220315913A1 (en) | Novel crispr dna targeting enzymes and systems |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20857507 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2022513214 Country of ref document: JP Kind code of ref document: A Ref document number: 3152788 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2020340353 Country of ref document: AU Date of ref document: 20200826 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2020857507 Country of ref document: EP Effective date: 20220328 |