WO2021040335A1 - Novel symbiotic strain having resistance under reactive oxygen condition and use thereof - Google Patents

Novel symbiotic strain having resistance under reactive oxygen condition and use thereof Download PDF

Info

Publication number
WO2021040335A1
WO2021040335A1 PCT/KR2020/011192 KR2020011192W WO2021040335A1 WO 2021040335 A1 WO2021040335 A1 WO 2021040335A1 KR 2020011192 W KR2020011192 W KR 2020011192W WO 2021040335 A1 WO2021040335 A1 WO 2021040335A1
Authority
WO
WIPO (PCT)
Prior art keywords
strain
present
culture
resistance under
immune activity
Prior art date
Application number
PCT/KR2020/011192
Other languages
French (fr)
Korean (ko)
Inventor
용동은
윤상선
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2021040335A1 publication Critical patent/WO2021040335A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/135—Bacteria or derivatives thereof, e.g. probiotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A61K35/741—Probiotics
    • A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/745—Bifidobacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/99—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from microorganisms other than algae or fungi, e.g. protozoa or bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Definitions

  • the present invention relates to a novel symbiotic microbial strain having resistance under reactive oxygen conditions and to a use thereof.
  • Reactive oxygen species or reactive oxygen species refer to chemically reactive molecules including oxygen atoms.
  • the active oxygen is a compound of oxygen generated in living organisms.Since it contains peroxygen ions and hydrogen peroxide and has unpaired electrons, it has very high reactivity and has a very strong oxidizing power that can attack living tissues and damage cells. Corresponds to oxygen.
  • Such reactive oxygen species can be generated even in normal metabolic processes, and it is reported that they play a role in regulating cellular signals and homeostasis.
  • concentration of free radicals increases rapidly in an individual as environmental stress, such as exposure to ultraviolet rays or high heat, and accordingly, damages the cell structure and causes various diseases.
  • oxidative stress when oxidative stress is present, the production of active oxygen increases or the antioxidant defense effect such as glutathione decreases to a significant level.
  • the effect of oxidative stress can vary depending on the magnitude of these changes, and if the level of disturbance is low, cells can overcome these conditions by themselves and return to their original state.
  • the level of disturbance by oxidative stress when the level of disturbance by oxidative stress is severe, cell death can occur, and even when the oxidative stress is at a moderate level, apoptosis can be triggered. Free radicals generated by the oxidative stress can directly damage the DNA present in the individual, and accordingly, various diseases such as aging, diabetes, hyperlipidemia, obesity, colon cancer, rheumatism, or asthma can be caused.
  • intestinal microorganisms are composed of strains and various microorganisms that coexist on the epithelial protective wall of the host, and these symbiotic strains are used to maintain and survive the individual's health. It has been reported to affect the physiological function of.
  • the symbiotic microbial colony (total of symbiotic microbes) is composed of various species and has various genes (microbiome), responding to external stimuli and minor environmental changes, and is very dynamic with the human body. Interact.
  • a healthy human body with a normal symbiotic microbial flora can overcome the invasion of pathogens through various antibacterial actions when pathogenic bacteria are infected in the intestines.
  • the immune system against pathogenic bacteria does not work normally when a broad spectrum antibiotic is continuously taken or exposed to oxidative stress conditions.
  • One object of the present invention is to provide a novel strain contained in the genus Bifidobacterium having resistance under reactive oxygen conditions, a culture solution thereof, a culture product, or an extract obtained therefrom.
  • Another object of the present invention is to provide a food composition for enhancing immune activity comprising the novel strain, a culture solution thereof, a culture product, or an extract obtained therefrom as an active ingredient.
  • Another object of the present invention is to provide a method for enhancing immune activity comprising administering to an individual the novel strain, a culture solution thereof, a culture product, or an extract obtained therefrom.
  • An embodiment of the present invention provides a strain contained in the genus Bifidobacterium.
  • the strain of the genus Bifidobacterium of the present invention may be a Bifidobacterium longum.
  • the Bifidobacterium longum of the present invention may be deposited with accession number KFCC11835P (Bifidobacterium longum YMC_19_03_38) or accession number KFCC11834P ( Bifidobacterium longum YMC_19_03_2).
  • the strains contained in the Bifidobacterium genus of the present invention are those strains that are resistant to anaerobic conditions and a culture environment containing excessive amounts of hydrogen peroxide among strains obtained from the feces of healthy humans. It was confirmed that the selected strain belongs to the genus Bifidobacterium through phylogenetic analysis using the genomic sequence and the nucleotide sequence of the 16s rRNA gene. Further, as a result of analyzing the genome sequence of each of the two deposited strains (YMC_19_03_38 and YMC_19_03_2), it was once again confirmed that it is a microorganism belonging to the genus Bifidobacterium containing a novel genome sequence.
  • the strain of the present invention may be one having resistance under reactive oxygen conditions.
  • the "resistance under active oxygen conditions" of the present invention is an environment in which active oxygen is inevitably generated during the electron transfer process for energy production in all organisms that breathe oxygen, or is generated by an inflammatory reaction caused by infection, In other words, it means the ability to survive without being killed in an oxidative stress environment.
  • the novel strain has resistance under anaerobic conditions and culture conditions containing an excessive amount of hydrogen peroxide, and thus resistance under reactive oxygen conditions, that is, a defense mechanism against oxidative stress (resistance to oxidative stress). Can have.
  • the novel strain of the present invention has resistance under reactive oxygen conditions, it is possible to maintain a normal microbial flora present in a target organ.
  • the strain of the present invention may have an ability to enhance immune activity.
  • the "enhancing immune activity" of the present invention refers to enhancing biodefensive ability by modulating an immune response.
  • Such enhancement of immune activity is one of important therapeutic and prophylactic strategies for reinforcing the body's defense mechanisms against various diseases, and it is possible to obtain an effect of enhancing immune activity by stimulating an immune response by increasing the activity of immune cells.
  • the strain may have an immune activity enhancing function, for example, infection by increasing the expression level of interleukin-1 (IL-1), a cytokine that mediates and regulates the innate immune response. And it is possible to mediate the inflammatory response of the host to other stimuli to enhance immune activity, but is not limited thereto.
  • IL-1 interleukin-1
  • a culture of the strain contained in the genus Bifidobacterium is provided.
  • the strain of the genus Bifidobacterium is the same as described in the strain, and thus is omitted to avoid excessive complexity of the specification.
  • the "culture product" of the present invention refers to a product obtained by culturing a microorganism in a known liquid or solid medium, and refers to a medium containing the microorganism.
  • the culture of the present invention is obtained after culturing the strain of the present invention in a medium, and the medium may be selected from a known liquid medium or solid medium used for culturing the strain of the genus Bifidobacterium.
  • the medium may be a GYSM medium, a humic acid agar medium, a Bennett's agar medium, or a malt extract agar medium, but is not limited thereto.
  • Another embodiment of the present invention provides a culture solution from which the strain has been removed from the culture of the strain contained in the genus Bifidobacterium.
  • the strain or culture of the genus Bifidobacterium is the same as described in the strain or culture, and thus is omitted to avoid excessive complexity of the specification.
  • the "culture solution” of the present invention refers to a product obtained by culturing microorganisms in a known liquid or solid medium, and is a concept in which microorganisms are not included.
  • the culture medium of the present invention refers to a liquid product from which the strain itself has been removed through a method such as filtration or centrifugation after culturing a predetermined strain in a liquid medium.
  • the filtration method of the present invention is not particularly limited, and the number of times the filtration is performed may be, for example, 1 to 10 times, 1 to 5 times, or 1 to 3 times.
  • the pore size of the filter paper may be performed using a filter paper having a pore size of 5 to 10 ⁇ m or a filter having a pore size of 0.1 to 1.0 ⁇ m, but is not limited thereto.
  • a culture of a strain contained in the genus Bifidobacterium or an extract of a culture solution there is provided a culture of a strain contained in the genus Bifidobacterium or an extract of a culture solution.
  • the strain, culture or culture of the genus Bifidobacterium is the same as described in the strain, culture or culture, and thus is omitted to avoid excessive complexity of the specification.
  • the extract of the present invention is a conventional extraction method known in the art, for example, solvent extraction, extraction by supercritical fluid extraction using carbon dioxide, extraction by extraction using ultrasonic waves, and constant molecular weight cut- It can be prepared using a method such as separation using an ultrafiltration membrane having an off value, separation by various chromatography (one prepared for separation according to size, charge, hydrophobicity, or affinity), or a combination thereof.
  • the extraction solvent used in the solvent extraction method of the present invention is water, a lower alcohol having 1 to 4 carbon atoms (e.g., methanol, ethanol, propanol, and butanol) or a mixture thereof, a hydrated lower alcohol, propylene glycol, 1,3 -Butylene glycol, glycerin, acetone, diethyl ether, ethyl acetate, butyl acetate, dichloromethane, chloroform, hexane, and may be selected from the group consisting of mixtures thereof, of which water, alcohol, hydrous alcohol, diethyl ether , Ethyl acetate, butyl acetate, chloroform, or may be selected from hexane, but is not limited thereto.
  • a lower alcohol having 1 to 4 carbon atoms e.g., methanol, ethanol, propanol, and butanol
  • a mixture thereof e.g., 1,3 -Buty
  • a food composition for enhancing immune activity comprising a strain contained in the genus Bifidobacterium , a culture thereof, a culture medium, or an extract obtained therefrom as an active ingredient.
  • the strains, cultures, cultures or extracts of the genus Bifidobacterium are the same as described in the strains, cultures, cultures or extracts, and thus are omitted to avoid excessive complexity of the specification.
  • the food of the present invention may be a health functional food.
  • the "health functional food” of the present invention refers to a food group or food composition that has added value to effect and express the function of the food by using physical, biochemical, biotechnological techniques, etc. to the food, It refers to a food processed by designing to sufficiently express the body's control functions related to disease prevention and recovery, etc. to the living body, which may further contain food additives acceptable for food, suitable carriers, excipients, and It may further include a diluent.
  • the function of the health functional food may be an immune activity enhancing function, for example, the expression level of interleukin-1 (IL-1), a cytokine that mediates and regulates the innate immune response. By increasing the inflammatory response of the host to infection and other stimuli can be mediated to enhance immune activity, but is not limited thereto.
  • IL-1 interleukin-1
  • the "enhancing immune activity" of the present invention refers to enhancing biodefensive ability by modulating an immune response.
  • Such enhancement of immune activity is one of the important therapeutic strategies for reinforcing body defense mechanisms against various diseases, and it is possible to obtain an effect of enhancing immune activity by stimulating an immune response by increasing the activity of immune cells.
  • the food composition of the present invention may be prepared in the form of various foods, for example, beverages, gums, teas, vitamin complexes, powders, granules, tablets, capsules, confectionery, rice cakes, bread, and the like.
  • the amount may be included in 0.001% by weight to 90% by weight, preferably 0.1% by weight to 40% by weight, and in the case of long-term intake use, the above Although it may be less than the range, since the active ingredient may be used in an amount greater than the above range when there is no problem in terms of safety, it is not limited thereto.
  • the food composition of the present invention is prepared in the form of a beverage
  • various flavoring agents or natural carbohydrates may be included as an additional component. That is, as natural carbohydrates, monosaccharides such as glucose, disaccharides such as fructose, and common sugars such as sucrose and polysaccharides, dextrins, cyclodextrins, and sugar alcohols such as xylitol, sorbitol, and erythritol can do.
  • flavoring agent examples include natural flavoring agents (taumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.).
  • other food compositions of the present invention include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavors and natural flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof. , Organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, and the like.
  • the components of the present invention may be used independently or in combination.
  • the proportion of these additives is not so critical, but is generally selected in the range of 0.1 to about 50 parts by weight per 100 parts by weight of the composition of the present invention.
  • Another embodiment of the present invention provides a probiotic composition comprising a strain contained in the genus Bifidobacterium as an active ingredient.
  • the strain of the genus Bifidobacterium is the same as described in the strain, and thus is omitted to avoid excessive complexity of the specification.
  • the "probiotic” of the present invention refers to an agent capable of improving the balance of the flora of a desired organ by using living microorganisms.
  • the strain of the present invention can be used as a probiotic composition for improving the health of an individual, and such a probiotic composition contains the strain itself, etc. contained in the Bifidobacterium of the present invention as an active ingredient, and an excipient or carrier is added Can be included as.
  • the probiotic composition of the present invention can be prepared and administered in a variety of formulations and methods. For example, by mixing a novel strain or a culture thereof according to the present invention with a carrier and flavor commonly used in the pharmaceutical field, such as tablets, troches, capsules, elixirs, syrups, powders, suspensions or granules, etc. It can be prepared and administered in a form.
  • a carrier a binder, a lubricant, a disintegrant, an excipient, a solubilizing agent, a dispersing agent, a stabilizer, a suspending agent, and the like can be used.
  • Another embodiment of the present invention provides a method for enhancing immune activity.
  • the method of the present invention includes the step of administering to a subject a strain contained in the genus Bifidobacterium , a culture solution thereof, a culture product, or an extract obtained therefrom.
  • the strain, culture, culture medium or extract of the genus Bifidobacterium is the same as described in the strain, culture medium, culture or extract, and thus is omitted to avoid excessive complexity of the specification.
  • the "individual" of the present invention refers to a mammal, including mice, livestock, etc., including humans with reduced immunity or in need of enhancing immune activity, but provided by the present invention Any individual with a possibility of enhancing immune activity by the above strain or the like may be included without limitation.
  • the method of the present invention may include administering to an individual an effective amount of the strain, a culture solution thereof, a culture product, or an extract obtained therefrom provided in the present invention.
  • the appropriate total daily use amount may be determined within the correct judgment range, and may be administered once or in several divided doses.
  • a specific effective amount for a specific individual is a specific strain, culture, culture medium or extract thereof, the age of the individual, including the type and degree of the reaction to be achieved, whether or not other agents are used in some cases, It is preferable to apply differently in consideration of body weight, general health status, sex and diet, administration time, administration route and administration period, and other active ingredients used simultaneously.
  • the novel strain of the present invention Since the novel strain of the present invention has resistance under anaerobic conditions and culture conditions containing an excess of hydrogen peroxide, it has resistance under reactive oxygen conditions, that is, a defense mechanism against oxidative stress. In addition, since the novel strain of the present invention has resistance under reactive oxygen conditions, it is possible to maintain a normal microbial flora present in a target organ. Therefore, the novel strain of the present invention can be very usefully used for maintaining a normal microbial flora or enhancing immune activity in an environment in which active oxygen is present.
  • FIG. 1 is a diagram showing an experimental design for inducing differentiation from human embryonic stem cells into vascular network tissues according to an embodiment of the present invention.
  • OCT4 which is a marker of undifferentiated stem cells
  • EOMES, MIXL1, and BRACHY which are markers of mesodermal cells, for mesodermal cells according to an embodiment of the present invention.
  • FIG 3 shows the result of measuring the OD 600 value in order to confirm the cultivation ability in the culture medium containing active oxygen of the selected strain according to an embodiment of the present invention.
  • An embodiment of the present invention relates to a strain contained in the genus Bifidobacterium.
  • One embodiment of the invention relates to a Bifidobacterium ronggum (Bifidobacterium longum) strain contained in the Bifidobacterium (Bifidobacterium).
  • Another embodiment of the present invention relates to a strain deposited with accession number KFCC11835P or accession number KFCC11834P, the strain contained in the genus Bifidobacterium.
  • Another embodiment of the present invention is a culture of the strain; Culture medium; It relates to an extract obtained therefrom.
  • Another embodiment of the present invention is a culture of the strain; Culture medium; It relates to a food composition for enhancing immune activity comprising the extract obtained therefrom as an active ingredient.
  • Another embodiment of the present invention relates to a probiotic composition
  • a probiotic composition comprising the strain as an active ingredient.
  • Another embodiment of the present invention is a culture of the strain; Culture medium; Or it relates to a method for enhancing immune activity comprising administering the extract obtained therefrom to a subject.
  • human embryonic stem cells were used, and the medium was replaced with Stemfit medium once every two days.
  • the Stemfit medium one containing b-FGF (20 ng/ml) was used.
  • Cells were cultured under a temperature condition of 5% CO 2 and 37°C, and the cells were passaged within 7 days.
  • embryonic stem cells were inoculated with 200,000 cells in RPMI1640 medium to which activin A (100 ng/ml) and CHIR99021 (3 ⁇ m) were added, followed by culture and endoderm Differentiation into sex cells was induced. Differentiation period was a total of 3 days, 0.2% by weight of FBS was added to the medium on the 2nd day, FBS was added to the medium in an amount of 2% by weight on the 3rd day, and B27 supplement was added as a supplement on the 1st day. I did.
  • FIG. 1 shows an experimental design diagram for inducing differentiation from human embryonic stem cells into vascular network tissues according to an embodiment of the present invention, and the following experiments were performed under the conditions shown in FIG. 1.
  • the human embryonic stem cells were inoculated in DMEM F/12 (KSR20%) medium to which 12 ⁇ M CHIR99021 (Tocris) was added, and under 5 vol% CO 2 conditions. Incubated for 2 days.
  • DMEM F/12 KSR20% medium to which 12 ⁇ M CHIR99021 (Tocris) was added, and under 5 vol% CO 2 conditions. Incubated for 2 days.
  • the mRNA expression levels of OCT4, markers of undifferentiated stem cells, and EOMES, MIXL1, and BRACHY, markers of mesodermal cells were measured using the primers shown in Table 1 below, as shown in FIG.
  • the level of expression of OCT4 mRNA which is a marker of undifferentiated stem cells, decreased, and the levels of mRNA expression of EOMES, MIXL1, and BRACHY, which are markers of mesodermal cells, increased, confirming that differentiation into mesodermal cells was induced.
  • OCT4 SEQ ID NO: 1 Forward direction 5'-GGGGTTCTATTTGGGAAGGTAT-3' SEQ ID NO: 2 Reverse 5'-TGTTGTCAGCTTCCTCCACC-3' EOMES SEQ ID NO: 3 Forward direction 5'-ATCATTACGAAACAGGGCAGGC-3' SEQ ID NO: 4 Reverse 5'-CGGGGTTGGTATTTGTGTAAGG-3' MIXL1 SEQ ID NO: 5 Forward direction 5'-ACGTCTTTCAGCGCCGAACAG-3' SEQ ID NO: 6 Reverse 5'-TTGGTTCGGGCAGGCAGTTCA-3' BRACHY SEQ ID NO: 7 Forward direction 5'-GTGCTGTCCCAGGTGGCTTACAGATG-3' SEQ ID NO: 8 Reverse 5'-CCTTAACAGCTCAACTCTAACTTG-3'
  • the vascular cell aggregate is inserted into a gel in which Matrigel and collagen I are mixed in a volume of 1:1, and then 15% FBS (Gibco), 100 ng/ml VEGFA and 100 ng DMEM:F12 medium containing /ml FGF-4 was covered and cultured for 6 days, and during culture, fresh medium was replaced every 2 to 3 days.
  • FBS Gibco
  • 100 ng/ml VEGFA and 100 ng DMEM:F12 medium containing /ml FGF-4 was covered and cultured for 6 days, and during culture, fresh medium was replaced every 2 to 3 days.
  • the posterior intestinal cells obtained in Preparation Example 2 and the vascular network tissue obtained in Preparation Example 3 were added with BMP4 30 ng/ml, 12 ⁇ M CHIR99021, EGF 100 ng/ml, VEGFA 30 ng/ml and FGF-4 30 ng/ml
  • BMP4 30 ng/ml, 12 ⁇ M CHIR99021, EGF 100 ng/ml, VEGFA 30 ng/ml and FGF-4 30 ng/ml Three-dimensional co-culture for 12 days in DMEM F/12 (KSR20%) was performed to induce differentiation of intestinal organoids including vascular tissues.
  • Intestinal organoids induced differentiation as described above were added with 30 ng/ml of BMP4, 12 ⁇ M CHIR99021, 100 ng/ml of EGF, 30 ng/ml of VEGFA and 30 ng/ml of FGF-4 using Matrigel. It was matured by subculture for 5 days in DMEM F/12 (KSR20%). Intestinal organoids were formed 20 days after initiation of co-culture of posterior intestinal cells and vascular network tissue.
  • the stool sample for obtaining the strain was diluted 10 -1 to 10 -10 times with saline.
  • the samples diluted 10 -1 , 10 -2 , 10 -10 times contain 2 mM hydrogen peroxide (H 2 O 2 ), containing a strain-specific culture medium of the genus Bifidobacterium.
  • H 2 O 2 hydrogen peroxide
  • the samples diluted 10 -1 , 10 -2 , 10 -10 times contain 2 mM hydrogen peroxide (H 2 O 2 ), containing a strain-specific culture medium of the genus Bifidobacterium.
  • Example 1 Each of the eight strains selected in Example 1 was dispensed into a liquid culture medium to contain the same components as the culture medium described in Example 1, and cultured in an anaerobic condition at 37° C. for 24 hours, and then an OD 600 value was determined. It was confirmed, and the results are shown in FIG. 3.
  • the control group the Bifidobacterium ronggum reference strains were used;; (tEc Typical E.Coli) ( Bifidobacterium longum Ref) and, typically E. coli.
  • S2 accession number: KFCC11834P ( Bifidobacterium longum YMC_19_03_2)
  • S10 and S38 accession number: KFCC11835P ( Bifidobacterium longum YMC_19_03_38)
  • KFCC11835P Bifidobacterium longum YMC_19_03_38
  • Example 2 S2 (Mac 0.5, 0.5 ⁇ l) or water (control) of Example 2 was injected into the intestinal organoid prepared in Preparation Example 4 of the present invention using a Micro Ingector, and cultured for 3 days. Then, RNA was extracted from the intestinal organoids according to a conventional method, RNA sequencing was performed, and an analysis program was used to identify genes with differences in RNA expression levels compared to the control group, and gene set enrichment analysis (Gene The gene set was analyzed using set enrichment analysis; GSEA) software (ver 4.0.3), and the results are shown in FIGS. 4 to 7.
  • GSEA set enrichment analysis
  • FIGS. 4 to 7 when the S2 strain according to the present invention was administered, the expression level of the gene encoding interferon-1 was remarkably increased (FIGS. 4 and 5 ), and the B cell receptor core gene ( The expression level of B cell receptor core genes) was remarkably increased (FIGS. 6 and 7 ).
  • the novel strain according to the present invention can impart resistance to free radicals by increasing the expression level of the gene encoding interferon-1 and the B cell receptor core gene, as well as activating the immune response to the individual It can be seen that the immunity of the body can be enhanced very effectively.
  • the novel strain of the present invention Since the novel strain of the present invention has resistance under anaerobic conditions and culture conditions containing an excess of hydrogen peroxide, it has resistance under reactive oxygen conditions, that is, a defense mechanism against oxidative stress. In addition, since the novel strain of the present invention has resistance under reactive oxygen conditions, it is possible to maintain a normal microbial flora present in a target organ. Therefore, the novel strain of the present invention can be very usefully used for maintaining a normal microbial flora or enhancing immune activity in an environment in which active oxygen is present.
  • SEQ ID NO: 1 OCT4 forward primer
  • SEQ ID NO: 2 OCT4 reverse primer
  • SEQ ID NO: 3 EOMES forward primer
  • SEQ ID NO: 4 EOMES reverse primer
  • SEQ ID NO: 5 MIXL1 forward primer
  • SEQ ID NO: 6 MTXL1 reverse primer
  • SEQ ID NO: 7 BRACHY forward primer
  • SEQ ID NO: 8 BRACHY reverse primer

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Diabetes (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Mycology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Endocrinology (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Emergency Medicine (AREA)
  • Molecular Biology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Dermatology (AREA)
  • Birds (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)

Abstract

A novel strain of the present invention has resistance under anaerobic conditions and culture conditions containing an excessive amount of hydrogen peroxide, and therefore has resistance under reactive oxygen conditions, that is, a defense mechanism against oxidative stress. In addition, since the novel strain of the present invention has resistance under reactive oxygen conditions, it is possible to maintain the normal microbial flora present in a target organ. Therefore, the novel strain of the present invention can be extremely usefully utilized for maintaining a normal microbial flora or enhancing immune activity in an environment in which active oxygen is present.

Description

활성산소 조건에서 저항능을 가진 신규한 공생 미생물 균주 및 이의 용도Novel symbiotic microbial strains with resistance under reactive oxygen conditions and uses thereof
본 발명은 활성산소 조건에서 저항능을 가지는 신규한 공생 미생물 균주 및 이의 용도에 관한 것이다.The present invention relates to a novel symbiotic microbial strain having resistance under reactive oxygen conditions and to a use thereof.
활성산소(Reactive oxygen species; ROS) 또는 활성산소종은 산소 원자를 포함한 화학적으로 반응성이 있는 분자를 의미한다. 상기 활성산소는 생물체내에서 생성되는 산소의 화합물로서, 과산소 이온과 과산화수소를 포함하고 짝지어지지 않은 전자를 가지고 있기 때문에 반응성이 매우 높아 생체 조직을 공격하고 세포를 손상시킬 수 있는 산화력이 매우 강력한 산소에 해당한다. 이와 같은 활성산소는 정상적인 대사과정에서도 발생될 수 있으며, 세포신호와 항상성을 조절하는데 역할을 하는 것으로 보고되어 있다. 그러나, 활성산소의 농도는 자외선이나 높은 열에 노출되는 것처럼 환경적인 스트레스로서 개체 내에서 급증할 위험이 존재하며, 이에 따라 세포 구조를 손상시켜 다양한 질환이 야기되도록 할 수 있다.Reactive oxygen species (ROS) or reactive oxygen species refer to chemically reactive molecules including oxygen atoms. The active oxygen is a compound of oxygen generated in living organisms.Since it contains peroxygen ions and hydrogen peroxide and has unpaired electrons, it has very high reactivity and has a very strong oxidizing power that can attack living tissues and damage cells. Corresponds to oxygen. Such reactive oxygen species can be generated even in normal metabolic processes, and it is reported that they play a role in regulating cellular signals and homeostasis. However, there is a risk that the concentration of free radicals increases rapidly in an individual as environmental stress, such as exposure to ultraviolet rays or high heat, and accordingly, damages the cell structure and causes various diseases.
화학적으로 산화스트레스가 존재하는 경우 활성산소의 생산량이 증가하거나, 글루타치온과 같은 항산화 방어 효과가 유의미한 수준으로 감소된다. 산화스트레스의 효과는 이러한 변화의 크기에 따라 달라질 수 있으며, 교란 수준이 적으면 세포는 스스로 이러한 상태를 극복하고 원상태로 돌아갈 수 있다. 그러나, 산화스트레스에 의한 교란 수준이 심각한 경우에는 세포 사망이 발생될 수 있고, 심지어 산화스트레스가 보통 수준인 경우에도 세포자살이 촉발될 수 있다. 상기 산화스트레스에 의해 발생된 활성산소는 개체에 존재하는 DNA에 직접적인 손상을 입힐 수 있고, 이에 따라 노화, 당뇨병, 고지혈증, 비만, 대장암, 류머티즘 또는 천식 등의 다양한 질환이 유발될 수 있다.Chemically, when oxidative stress is present, the production of active oxygen increases or the antioxidant defense effect such as glutathione decreases to a significant level. The effect of oxidative stress can vary depending on the magnitude of these changes, and if the level of disturbance is low, cells can overcome these conditions by themselves and return to their original state. However, when the level of disturbance by oxidative stress is severe, cell death can occur, and even when the oxidative stress is at a moderate level, apoptosis can be triggered. Free radicals generated by the oxidative stress can directly damage the DNA present in the individual, and accordingly, various diseases such as aging, diabetes, hyperlipidemia, obesity, colon cancer, rheumatism, or asthma can be caused.
한편, 장내 미생물은 숙주의 상피 보호벽상에서 공생하고 있는 균주와 다양한 미생물들로 구성되어 있고, 이렇게 공생중인 균주들은 개체의 건강 유지 및 생존에 있어, 신체 전반적으로는 대사, 염증, 면역, 혈액 생산 등의 생리 기능에 영향을 미치는 것으로 보고되어 있다. 공생 미생물 균총(공생미생물들의 총합)은 다양한 종(species)으로 구성되어 있으며, 다양한 유전자들(마이크로바이옴, microbiome)을 가지고 있어 외부 자극 및 미세한 환경 변화에 대응하며 인체와 매우 다이나믹(dynamic)한 상호작용을 한다. 정상 공생 미생물 균총을 가지고 있는 건강한 인체는 병원성 세균이 장내에 감염되면 다양한 항균 작용을 통해 병원균의 침입을 이겨낼 수 있다. 반면 광범위 항생제를 지속적으로 복용하거나, 또는 산화스트레스 조건 등에 노출되면 병원성 세균에 대한 면역 시스템이 정상적으로 작동하지 않는다고 알려져 있다.On the other hand, intestinal microorganisms are composed of strains and various microorganisms that coexist on the epithelial protective wall of the host, and these symbiotic strains are used to maintain and survive the individual's health. It has been reported to affect the physiological function of. The symbiotic microbial colony (total of symbiotic microbes) is composed of various species and has various genes (microbiome), responding to external stimuli and minor environmental changes, and is very dynamic with the human body. Interact. A healthy human body with a normal symbiotic microbial flora can overcome the invasion of pathogens through various antibacterial actions when pathogenic bacteria are infected in the intestines. On the other hand, it is known that the immune system against pathogenic bacteria does not work normally when a broad spectrum antibiotic is continuously taken or exposed to oxidative stress conditions.
이에, 공생 미생물 균총을 유지하고, 산화스트레스 조건에서도 살아남을 수 있는 활성산소 조건에서 저항능을 가지며, 나아가 개체의 면역 반응을 증진시킬 수 있는 신규한 균주에 대한 연구가 필요한 실정이다.Accordingly, there is a need for research on novel strains capable of maintaining symbiotic microbial flora, having resistance under reactive oxygen conditions, which can survive even in oxidative stress conditions, and further enhancing an individual's immune response.
본 발명의 일 목적은 활성산소 조건에서 저항능을 갖는 비피도박테리움(Bifidobacterium) 속에 포함되는 신규한 균주, 이의 배양액, 배양물 또는 그로부터 얻어진 추출물을 제공하는 것이다.One object of the present invention is to provide a novel strain contained in the genus Bifidobacterium having resistance under reactive oxygen conditions, a culture solution thereof, a culture product, or an extract obtained therefrom.
본 발명의 다른 목적은 상기 신규한 균주, 이의 배양액, 배양물 또는 그로부터 얻어진 추출물을 유효성분으로 포함하는 면역활성 증강용 식품 조성물을 제공하는 것이다.Another object of the present invention is to provide a food composition for enhancing immune activity comprising the novel strain, a culture solution thereof, a culture product, or an extract obtained therefrom as an active ingredient.
본 발명의 또 다른 목적은 상기 신규한 균주, 이의 배양액, 배양물 또는 그로부터 얻어진 추출물을 개체에 투여하는 단계를 포함하는 면역활성 증강 방법을 제공하는 것이다.Another object of the present invention is to provide a method for enhancing immune activity comprising administering to an individual the novel strain, a culture solution thereof, a culture product, or an extract obtained therefrom.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당 업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems that are not mentioned will be clearly understood by those of ordinary skill in the art from the following description.
본 발명의 일 구현 예에서는 비피도박테리움(Bifidobacterium) 속에 포함되는 균주를 제공한다.An embodiment of the present invention provides a strain contained in the genus Bifidobacterium.
본 발명의 상기 비피도박테리움 속 균주는 비피도박테리움 롱굼(Bifidobacterium longum)인 것일 수 있다.The strain of the genus Bifidobacterium of the present invention may be a Bifidobacterium longum.
본 발명의 상기 비피도박테리움 롱굼은 수탁번호 KFCC11835P(Bifidobacterium longum YMC_19_03_38) 또는 수탁번호 KFCC11834P(Bifidobacterium longum YMC_19_03_2)로 기탁된 것일 수 있다. The Bifidobacterium longum of the present invention may be deposited with accession number KFCC11835P (Bifidobacterium longum YMC_19_03_38) or accession number KFCC11834P ( Bifidobacterium longum YMC_19_03_2).
본 발명의 상기 비피도박테리움 속에 포함되는 균주는 건강한 사람의 대변으로부터 얻은 균주 중에서, 혐기성 조건과 과산화수소가 과량으로 포함된 배양 환경에서 내성을 갖는 균주만 선별 분리된 것으로서, 통상의 방법에 따라 전체 게놈 서열 및 16s rRNA 유전자의 염기 서열을 이용한 계통 분석을 통해 선별된 균주가 비피도박테리움 속에 속하는 것을 확인하였다. 나아가, 상기 기탁된 두개의 균주(YMC_19_03_38 및 YMC_19_03_2)에 대해 각각 유전체 서열을 분석한 결과, 신규한 유전체 서열을 함유한 비피도박테리움 속에 속하는 미생물임을 다시 한번 확인하였다.The strains contained in the Bifidobacterium genus of the present invention are those strains that are resistant to anaerobic conditions and a culture environment containing excessive amounts of hydrogen peroxide among strains obtained from the feces of healthy humans. It was confirmed that the selected strain belongs to the genus Bifidobacterium through phylogenetic analysis using the genomic sequence and the nucleotide sequence of the 16s rRNA gene. Further, as a result of analyzing the genome sequence of each of the two deposited strains (YMC_19_03_38 and YMC_19_03_2), it was once again confirmed that it is a microorganism belonging to the genus Bifidobacterium containing a novel genome sequence.
본 발명의 상기 균주는 활성산소 조건에서 저항능을 갖는 것일 수 있다.The strain of the present invention may be one having resistance under reactive oxygen conditions.
본 발명의 상기 "활성산소 조건에서 저항능"은 산소호흡을 하는 모든 생물에서 에너지 생산을 위한 전자전달과정에서 부득이하게 발생되거나, 또는 감염 등에 의한 염증 반응에 의해 발생되는 활성산소가 존재하는 환경, 즉 산화스트레스 환경에서 사멸되지 않고 살아남을 수 있는 능력을 의미한다. 본 발명의 목적상 상기 신규한 균주는 혐기성 조건 및 과산화수소가 과량으로 포함된 배양 조건에서 내성을 가지므로, 활성산소 조건에서 저항능, 즉 산화스트레스에 대항하는 방어기전(산화스트레스에 대한 저항성)을 가지고 있을 수 있다. 나아가, 본 발명의 상기 신규한 균주는 활성산소 조건에서 저항능을 가지므로 목적하는 기관에 존재하는 정상 미생물 균총을 유지할 수 있다.The "resistance under active oxygen conditions" of the present invention is an environment in which active oxygen is inevitably generated during the electron transfer process for energy production in all organisms that breathe oxygen, or is generated by an inflammatory reaction caused by infection, In other words, it means the ability to survive without being killed in an oxidative stress environment. For the purposes of the present invention, the novel strain has resistance under anaerobic conditions and culture conditions containing an excessive amount of hydrogen peroxide, and thus resistance under reactive oxygen conditions, that is, a defense mechanism against oxidative stress (resistance to oxidative stress). Can have. Furthermore, since the novel strain of the present invention has resistance under reactive oxygen conditions, it is possible to maintain a normal microbial flora present in a target organ.
본 발명의 상기 균주는 면역활성 증강능을 갖는 것일 수 있다.The strain of the present invention may have an ability to enhance immune activity.
본 발명의 상기 "면역활성 증강"은 면역반응을 조절하여 생체방어 능력을 증강시키는 것을 의미한다. 이와 같은 면역활성 증강은 다양한 질환에 대해 신체 방어 기전을 보강하는 중요한 치료, 예방학적 전략 중 하나로서, 면역세포의 활성을 증가시켜 면역반응을 자극하여 면역활성 증강 효과를 얻을 수 있다. 본 발명의 목적상 상기 균주는 면역활성 증진 기능을 가질 수 있고, 예를 들면 선천 면역 반응을 매개 및 조절하는 사이토카인인 인터루킨-1(Interleukin-1; IL-1)의 발현 수준을 증가시켜 감염 및 다른 자극에 대한 숙주의 염증반응을 매개하여 면역활성을 증진시킬 수 있으나, 이에 제한되는 것은 아니다.The "enhancing immune activity" of the present invention refers to enhancing biodefensive ability by modulating an immune response. Such enhancement of immune activity is one of important therapeutic and prophylactic strategies for reinforcing the body's defense mechanisms against various diseases, and it is possible to obtain an effect of enhancing immune activity by stimulating an immune response by increasing the activity of immune cells. For the purposes of the present invention, the strain may have an immune activity enhancing function, for example, infection by increasing the expression level of interleukin-1 (IL-1), a cytokine that mediates and regulates the innate immune response. And it is possible to mediate the inflammatory response of the host to other stimuli to enhance immune activity, but is not limited thereto.
본 발명의 다른 구현 예에서는 비피도박테리움(Bifidobacterium) 속에 포함되는 균주의 배양물을 제공한다.In another embodiment of the present invention, a culture of the strain contained in the genus Bifidobacterium is provided.
본 발명의 상기 배양물에서 상기 비피도박테리움 속 균주는 상기 균주에서 기재한 바와 동일하여 명세서의 과도한 복잡성을 피하기 위해 생략한다.In the culture of the present invention, the strain of the genus Bifidobacterium is the same as described in the strain, and thus is omitted to avoid excessive complexity of the specification.
본 발명의 상기 "배양물"은 미생물을 공지의 액체 또는 고체 배지에서 배양시켜 수득한 산물을 의미하며, 미생물이 포함되어 있는 배지를 의미한다.The "culture product" of the present invention refers to a product obtained by culturing a microorganism in a known liquid or solid medium, and refers to a medium containing the microorganism.
본 발명의 상기 배양물은 본 발명의 상기 균주를 배지에서 배양시킨 후, 얻어지는 것으로서, 상기 배지는 비피도박테리움 속 균주의 배양에서 사용되는 공지의 액체 배지 또는 고체 배지에서 선택될 수 있으며, 예를 들면, GYSM 배지, 흄산 한천 배지(Humic acid agar medium), 베네트 한천 배지(Bennett's agar medium) 또는 맥아 추출 한천 배지(Malt extract agar medium)일 수 있으나, 이에 제한되는 것은 아니다.The culture of the present invention is obtained after culturing the strain of the present invention in a medium, and the medium may be selected from a known liquid medium or solid medium used for culturing the strain of the genus Bifidobacterium. For example, it may be a GYSM medium, a humic acid agar medium, a Bennett's agar medium, or a malt extract agar medium, but is not limited thereto.
본 발명의 또 다른 구현 예에서는 비피도박테리움(Bifidobacterium) 속에 포함되는 균주의 배양물로부터 상기 균주가 제거된 배양액을 제공한다.Another embodiment of the present invention provides a culture solution from which the strain has been removed from the culture of the strain contained in the genus Bifidobacterium.
본 발명의 상기 배양액에서 상기 비피도박테리움 속 균주 또는 배양물은 상기 균주 또는 배양물에서 기재한 바와 동일하여 명세서의 과도한 복잡성을 피하기 위해 생략한다.In the culture solution of the present invention, the strain or culture of the genus Bifidobacterium is the same as described in the strain or culture, and thus is omitted to avoid excessive complexity of the specification.
본 발명의 상기 "배양액"은 미생물을 공지의 액체 또는 고체 배지에서 배양하여 얻은 산물을 의미하며, 미생물이 포함되지 않은 개념이다.The "culture solution" of the present invention refers to a product obtained by culturing microorganisms in a known liquid or solid medium, and is a concept in which microorganisms are not included.
본 발명의 상기 배양액은 소정의 균주를 액체 배지에서 배양한 뒤에 여과 또는 원심분리와 같은 방법을 통해 균주 자체가 제거된 액상의 산물을 의미한다.The culture medium of the present invention refers to a liquid product from which the strain itself has been removed through a method such as filtration or centrifugation after culturing a predetermined strain in a liquid medium.
본 발명의 상기 여과 방법은 특별히 제한되지 않으며, 상기 여과의 수행 횟수는 예를 들면 1회 내지 10회, 1회 내지 5회, 또는 1회 내지 3회 수행될 수 있다. 또한, 상기 여과 시에 여과지 또는 필터를 사용할 경우, 여과지의 포어 사이즈는 5 내지 10 μm 여과지 또는 포어 사이즈가 0.1 내지 1.0 μm인 필터를 사용하여 수행될 수 있으나, 이에 제한되는 것은 아니다.The filtration method of the present invention is not particularly limited, and the number of times the filtration is performed may be, for example, 1 to 10 times, 1 to 5 times, or 1 to 3 times. In addition, when a filter paper or a filter is used during the filtration, the pore size of the filter paper may be performed using a filter paper having a pore size of 5 to 10 μm or a filter having a pore size of 0.1 to 1.0 μm, but is not limited thereto.
본 발명의 또 다른 구현 예에서는 비피도박테리움(Bifidobacterium) 속에 포함되는 균주의 배양물 또는 배양액의 추출물을 제공한다.In another embodiment of the present invention, there is provided a culture of a strain contained in the genus Bifidobacterium or an extract of a culture solution.
본 발명의 상기 추출물에서 상기 비피도박테리움 속 균주, 배양물 또는 배양액은 상기 균주, 배양액 또는 배양물에서 기재한 바와 동일하여 명세서의 과도한 복잡성을 피하기 위해 생략한다.In the extract of the present invention, the strain, culture or culture of the genus Bifidobacterium is the same as described in the strain, culture or culture, and thus is omitted to avoid excessive complexity of the specification.
본 발명의 상기 추출물은 당업계에서 공지된 통상의 추출 방법, 예를 들면 용매 추출법, 이산화탄소를 이용한 초임계 유체 추출법(supercritical fluid extraction)에 의한 추출, 초음파를 이용한 추출법에 의한 추출, 일정한 분자량 컷-오프 값을 갖는 한외 여과막을 이용한 분리 또는 다양한 크로마토그래피(크기, 전하, 소수성 또는 친화성에 따른 분리를 위해 제작된 것)에 의한 분리 또는 이들의 조합 등의 방법을 사용하여 제조될 수 있다.The extract of the present invention is a conventional extraction method known in the art, for example, solvent extraction, extraction by supercritical fluid extraction using carbon dioxide, extraction by extraction using ultrasonic waves, and constant molecular weight cut- It can be prepared using a method such as separation using an ultrafiltration membrane having an off value, separation by various chromatography (one prepared for separation according to size, charge, hydrophobicity, or affinity), or a combination thereof.
본 발명의 상기 용매 추출법에 이용되는 추출 용매는 물, 탄소 수가 1 내지 4인 저급 알코올(예를 들면, 메탄올, 에탄올, 프로판올 및 부탄올) 또는 이들의 혼합물인 함수 저급 알코올, 프로필렌글리콜, 1,3-부틸렌글리콜, 글리세린, 아세톤, 다이에틸에테르, 에틸아세테이트, 부틸아세테이트, 다이클로로메탄, 클로로포름, 헥산 및 이들의 혼합물로 구성된 군으로부터 선택될 수 있고, 이중 물, 알코올, 함수 알코올, 다이에틸에테르, 에틸아세테이트, 부틸아세테이트, 클로로포름 또는 헥산에서 선택될 수 있지만, 이에 제한되는 것은 아니다.The extraction solvent used in the solvent extraction method of the present invention is water, a lower alcohol having 1 to 4 carbon atoms (e.g., methanol, ethanol, propanol, and butanol) or a mixture thereof, a hydrated lower alcohol, propylene glycol, 1,3 -Butylene glycol, glycerin, acetone, diethyl ether, ethyl acetate, butyl acetate, dichloromethane, chloroform, hexane, and may be selected from the group consisting of mixtures thereof, of which water, alcohol, hydrous alcohol, diethyl ether , Ethyl acetate, butyl acetate, chloroform, or may be selected from hexane, but is not limited thereto.
본 발명의 또 다른 구현 예에서는 비피도박테리움(Bifidobacterium) 속에 포함되는 균주, 이의 배양물, 배양액 또는 그로부터 얻어진 추출물을 유효성분으로 포함하는 면역활성 증강용 식품 조성물을 제공한다.In another embodiment of the present invention, there is provided a food composition for enhancing immune activity comprising a strain contained in the genus Bifidobacterium , a culture thereof, a culture medium, or an extract obtained therefrom as an active ingredient.
본 발명의 상기 식품 조성물에서 상기 비피도박테리움 속 균주, 배양물, 배양액 또는 추출물은 상기 균주, 배양액, 배양물 또는 추출물에서 기재한 바와 동일하여 명세서의 과도한 복잡성을 피하기 위해 생략한다.In the food composition of the present invention, the strains, cultures, cultures or extracts of the genus Bifidobacterium are the same as described in the strains, cultures, cultures or extracts, and thus are omitted to avoid excessive complexity of the specification.
본 발명의 상기 식품은 건강기능식품일 수 있다.The food of the present invention may be a health functional food.
본 발명의 상기 "건강기능식품"은 식품에 물리적, 생화학적, 생물공학적 수법 등을 이용하여 해당 식품의 기능을 특정 목적에 작용, 발현하도록 부가가치를 부여한 식품군이나 식품 조성이 갖는 생체방어리듬조절, 질병방지와 회복 등에 관한 체내조절기능을 생체에 대하여 충분히 발현하도록 설계하여 가공한 식품을 의미하며, 이는 식품학적으로 허용 가능한 식품 보조 첨가제를 더 포함할 수 있으며, 통상적으로 사용되는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 본 발명의 목적상 상기 건강기능식품의 기능은 면역활성 증진 기능일 수 있고, 예를 들면 선천 면역 반응을 매개 및 조절하는 사이토카인인 인터루킨-1(Interleukin-1; IL-1)의 발현 수준을 증가시켜 감염 및 다른 자극에 대한 숙주의 염증반응을 매개하여 면역활성을 증진시킬 수 있으나, 이에 제한되는 것은 아니다.The "health functional food" of the present invention refers to a food group or food composition that has added value to effect and express the function of the food by using physical, biochemical, biotechnological techniques, etc. to the food, It refers to a food processed by designing to sufficiently express the body's control functions related to disease prevention and recovery, etc. to the living body, which may further contain food additives acceptable for food, suitable carriers, excipients, and It may further include a diluent. For the purposes of the present invention, the function of the health functional food may be an immune activity enhancing function, for example, the expression level of interleukin-1 (IL-1), a cytokine that mediates and regulates the innate immune response. By increasing the inflammatory response of the host to infection and other stimuli can be mediated to enhance immune activity, but is not limited thereto.
본 발명의 상기 "면역활성 증강"은 면역반응을 조절하여 생체방어 능력을 증강시키는 것을 의미한다. 이와 같은 면역활성 증강은 다양한 질환에 대해 신체 방어 기전을 보강하는 중요한 치료학적 전략 중 하나로서, 면역세포의 활성을 증가시켜 면역반응을 자극하여 면역활성 증강 효과를 얻을 수 있다. The "enhancing immune activity" of the present invention refers to enhancing biodefensive ability by modulating an immune response. Such enhancement of immune activity is one of the important therapeutic strategies for reinforcing body defense mechanisms against various diseases, and it is possible to obtain an effect of enhancing immune activity by stimulating an immune response by increasing the activity of immune cells.
본 발명의 상기 식품 조성물은 각종 식품류, 예를 들어, 음료, 껌, 차, 비타민 복합제, 분말, 과립, 정제, 캡슐, 과자, 떡, 빵 등의 형태로 제조될 수 있다.The food composition of the present invention may be prepared in the form of various foods, for example, beverages, gums, teas, vitamin complexes, powders, granules, tablets, capsules, confectionery, rice cakes, bread, and the like.
본 발명의 상기 균주 등이 식품 조성물에 포함될 때 그 양은 0.001 중량% 내지 90 중량%로 포함할 수 있으며, 바람직하게는 0.1 중량% 내지 40 중량%로 포함할 수 있고, 장기간 섭취 용도일 경우에는 상기 범위 이하일 수 있으나, 유효성분이 안전성 면에서 아무런 문제가 없는 경우에는 상기 범위 이상의 양으로 사용될 수 있으므로, 이에 제한되는 것은 아니다.When the strain of the present invention is included in the food composition, the amount may be included in 0.001% by weight to 90% by weight, preferably 0.1% by weight to 40% by weight, and in the case of long-term intake use, the above Although it may be less than the range, since the active ingredient may be used in an amount greater than the above range when there is no problem in terms of safety, it is not limited thereto.
본 발명의 상기 식품 조성물이 음료 형태로 제조되는 경우 지시된 비율로 상기 식품 조성물을 함유하는 것 외에 특별한 제한점은 없으며 통상의 음료와 같이 여러가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 즉, 천연 탄수화물로서 포도당 등의 모노사카라이드, 과당 등의 디사카라이드, 슈크로스 등의 및 폴리사카라이드, 덱스트린, 시클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜 등을 포함할 수 있다. 상기 향미제로서는 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진등) 및 합성 향미제(사카린, 아스파르탐 등) 등을 들 수 있다.When the food composition of the present invention is prepared in the form of a beverage, there are no particular limitations other than containing the food composition in the indicated ratio, and as an ordinary beverage, various flavoring agents or natural carbohydrates may be included as an additional component. That is, as natural carbohydrates, monosaccharides such as glucose, disaccharides such as fructose, and common sugars such as sucrose and polysaccharides, dextrins, cyclodextrins, and sugar alcohols such as xylitol, sorbitol, and erythritol can do. Examples of the flavoring agent include natural flavoring agents (taumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.).
본 발명의 상기 식품 조성물에서 그 외 본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다.In the food composition of the present invention, other food compositions of the present invention include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavors and natural flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof. , Organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, and the like.
본 발명의 상기 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.1 내지 약 50 중량부의 범위에서 선택되는 것이 일반적이다.The components of the present invention may be used independently or in combination. The proportion of these additives is not so critical, but is generally selected in the range of 0.1 to about 50 parts by weight per 100 parts by weight of the composition of the present invention.
본 발명의 또 다른 구현 예에서는 비피도박테리움(Bifidobacterium) 속에 포함되는 균주를 유효성분으로 포함하는 생균제 조성물을 제공한다.Another embodiment of the present invention provides a probiotic composition comprising a strain contained in the genus Bifidobacterium as an active ingredient.
본 발명의 상기 생균제 조성물에서 상기 비피도박테리움 속 균주는 상기 균주에서 기재한 바와 동일하여 명세서의 과도한 복잡성을 피하기 위해 생략한다.In the probiotic composition of the present invention, the strain of the genus Bifidobacterium is the same as described in the strain, and thus is omitted to avoid excessive complexity of the specification.
본 발명의 상기 "생균제"는 살아있는 미생물을 이용하여 목적하는 기관의 균총의 균형을 개선할 수 있는 제제를 의미한다.The "probiotic" of the present invention refers to an agent capable of improving the balance of the flora of a desired organ by using living microorganisms.
본 발명의 상기 균주는 개체의 건강 증진을 위한 생균제 조성물로 사용될 수 있고, 이와 같은 생균제 조성물은 본 발명의 상기 비피도박테리움 속에 포함되는 균주 자체 등을 유효성분으로 포함하며, 부형제 또는 담체가 추가로 포함될 수 있다.The strain of the present invention can be used as a probiotic composition for improving the health of an individual, and such a probiotic composition contains the strain itself, etc. contained in the Bifidobacterium of the present invention as an active ingredient, and an excipient or carrier is added Can be included as.
본 발명의 상기 생균제 조성물은 다양한 제형과 방법으로 제조 및 투여될 수 있다. 예를 들어, 본 발명에 따른 신규한 균주 또는 이의 배양물을 약제학적 분야에서 통상적으로 사용하는 담체 및 향료와 혼합하여 정제, 트로키, 캡슐, 엘릭실, 시럽, 산제, 현탁제 또는 과립제 등의 형태로 제조 및 투여될 수 있다. 담체로는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제 등을 사용할 수 있다.The probiotic composition of the present invention can be prepared and administered in a variety of formulations and methods. For example, by mixing a novel strain or a culture thereof according to the present invention with a carrier and flavor commonly used in the pharmaceutical field, such as tablets, troches, capsules, elixirs, syrups, powders, suspensions or granules, etc. It can be prepared and administered in a form. As the carrier, a binder, a lubricant, a disintegrant, an excipient, a solubilizing agent, a dispersing agent, a stabilizer, a suspending agent, and the like can be used.
본 발명의 또 다른 구현 예에서는 면역활성 증강 방법을 제공한다.Another embodiment of the present invention provides a method for enhancing immune activity.
본 발명의 상기 방법은 비피도박테리움(Bifidobacterium) 속에 포함되는 균주, 이의 배양액, 배양물 또는 그로부터 얻어진 추출물을 개체에 투여하는 단계를 포함한다.The method of the present invention includes the step of administering to a subject a strain contained in the genus Bifidobacterium , a culture solution thereof, a culture product, or an extract obtained therefrom.
본 발명의 상기 방법에서 상기 비피도박테리움 속 균주, 배양물, 배양액 또는 추출물은 상기 균주, 배양액, 배양물 또는 추출물에서 기재한 바와 동일하여 명세서의 과도한 복잡성을 피하기 위해 생략한다.In the method of the present invention, the strain, culture, culture medium or extract of the genus Bifidobacterium is the same as described in the strain, culture medium, culture or extract, and thus is omitted to avoid excessive complexity of the specification.
본 발명의 상기 "개체"는 면역력이 감소되어 있거나, 또는 면역활성 증진을 필요로 하는 개체로서, 면역활성이 요구되는 인간을 포함한 쥐, 가축 등을 포함하는 포유동물을 의미하나, 본 발명에서 제공하는 상기 균주 등에 의해 면역활성이 증진될 가능성이 있는 개체는 제한 없이 모두 포함될 수 있다.The "individual" of the present invention refers to a mammal, including mice, livestock, etc., including humans with reduced immunity or in need of enhancing immune activity, but provided by the present invention Any individual with a possibility of enhancing immune activity by the above strain or the like may be included without limitation.
본 발명의 상기 방법은 본 발명에서 제공하는 상기 균주, 이의 배양액, 배양물 또는 그로부터 얻어진 추출물을 유효량으로 개체에 투여하는 것을 포함할 수 있다. 적합한 총 1일 사용량은 올바른 판단범위 내에서 결정될 수 있으며, 1회 또는 수회로 나누어 투여될 수 있다. 그러나, 본 발명의 목적상, 특정 개체에 대한 구체적인 유효량은 달성하고자 하는 반응의 종류와 정도, 경우에 따라 다른 제제가 사용되는 여부를 비롯한 구체적인 균주, 배양물, 배양액 또는 이의 추출물, 개체의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 투여 기간, 동시 사용되는 다른 유효성분 등을 고려하여 다르게 적용하는 것이 바람직하다.The method of the present invention may include administering to an individual an effective amount of the strain, a culture solution thereof, a culture product, or an extract obtained therefrom provided in the present invention. The appropriate total daily use amount may be determined within the correct judgment range, and may be administered once or in several divided doses. However, for the purposes of the present invention, a specific effective amount for a specific individual is a specific strain, culture, culture medium or extract thereof, the age of the individual, including the type and degree of the reaction to be achieved, whether or not other agents are used in some cases, It is preferable to apply differently in consideration of body weight, general health status, sex and diet, administration time, administration route and administration period, and other active ingredients used simultaneously.
본 발명의 신규한 균주는 혐기성 조건 및 과산화수소가 과량으로 포함된 배양 조건에서 내성을 가지므로, 활성산소 조건에서 저항능, 즉 산화스트레스에 대항하는 방어기전을 가진다. 또한, 본 발명의 상기 신규한 균주는 활성산소 조건에서 저항능을 가지므로 목적하는 기관에 존재하는 정상 미생물 균총을 유지할 수 있다. 따라서, 본 발명의 상기 신규한 균주는 활성산소가 존재하는 환경에서 정상 미생물 균총을 유지하거나, 또는 면역활성을 증강시키는 용도로 매우 유용하게 활용될 수 있다.Since the novel strain of the present invention has resistance under anaerobic conditions and culture conditions containing an excess of hydrogen peroxide, it has resistance under reactive oxygen conditions, that is, a defense mechanism against oxidative stress. In addition, since the novel strain of the present invention has resistance under reactive oxygen conditions, it is possible to maintain a normal microbial flora present in a target organ. Therefore, the novel strain of the present invention can be very usefully used for maintaining a normal microbial flora or enhancing immune activity in an environment in which active oxygen is present.
도 1은 본 발명의 일 실시예에 따른 인간 배아줄기세포로부터 혈관망 조직으로의 분화를 유도하는 실험 설계도를 나타낸 것이다.1 is a diagram showing an experimental design for inducing differentiation from human embryonic stem cells into vascular network tissues according to an embodiment of the present invention.
도 2는 본 발명의 일 실시예에 따른 중배엽성 세포에 대하여 미분화 줄기세포의 마커인 OCT4와, 중배엽성 세포의 마커인 EOMES, MIXL1 및 BRACHY의 mRNA 발현 수준을 측정한 결과를 나타낸 것이다.2 shows the results of measuring the mRNA expression levels of OCT4, which is a marker of undifferentiated stem cells, and EOMES, MIXL1, and BRACHY, which are markers of mesodermal cells, for mesodermal cells according to an embodiment of the present invention.
도 3은 본 발명의 일 실시예에 따른 선별된 균주의 활성산소 포함 배양 배지에서 배양 능력을 확인하기 위하여 OD600 값을 측정한 결과를 나타낸 것이다.3 shows the result of measuring the OD 600 value in order to confirm the cultivation ability in the culture medium containing active oxygen of the selected strain according to an embodiment of the present invention.
도 4 내지 도 7은 본 발명의 일 실시예에 따른 대조군과 비교하여 선별된 균주에서 발현 수준이 변화된 유전자를 분석한 결과를 나타낸 것이다.4 to 7 show the results of analyzing genes whose expression levels are changed in the selected strain compared to the control according to an embodiment of the present invention.
본 발명의 일 실시예는 비피도박테리움(Bifidobacterium) 속에 포함되는 균주에 관한 것이다.An embodiment of the present invention relates to a strain contained in the genus Bifidobacterium.
본 발명의 일 실시예는 비피도박테리움(Bifidobacterium) 속에 포함되는 비피도박테리움 롱굼(Bifidobacterium longum) 균주에 관한 것이다.One embodiment of the invention relates to a Bifidobacterium ronggum (Bifidobacterium longum) strain contained in the Bifidobacterium (Bifidobacterium).
본 발명의 또 다른 실시예는 비피도박테리움(Bifidobacterium) 속에 포함되는 균주는 수탁번호 KFCC11835P 또는 수탁번호 KFCC11834P로 기탁된 균주에 관한 것이다.Another embodiment of the present invention relates to a strain deposited with accession number KFCC11835P or accession number KFCC11834P, the strain contained in the genus Bifidobacterium.
본 발명의 또 다른 실시예는 상기 균주의 배양물; 배양액; 그로부터 얻어진 추출물에 관한 것이다.Another embodiment of the present invention is a culture of the strain; Culture medium; It relates to an extract obtained therefrom.
본 발명의 또 다른 실시예는 상기 균주의 배양물; 배양액; 그로부터 얻어진 추출물을 유효성분으로 포함하는 면역활성 증강용 식품 조성물에 관한 것이다.Another embodiment of the present invention is a culture of the strain; Culture medium; It relates to a food composition for enhancing immune activity comprising the extract obtained therefrom as an active ingredient.
본 발명의 또 다른 실시예는 상기 균주를 유효성분으로 포함하는 생균제 조성물에 관한 것이다.Another embodiment of the present invention relates to a probiotic composition comprising the strain as an active ingredient.
본 발명의 또 다른 실시예는 상기 균주의 배양물; 배양액; 또는 그로부터 얻어진 추출물을 개체에 투여하는 단계를 포함하는 면역활성 증강 방법에 관한 것이다.Another embodiment of the present invention is a culture of the strain; Culture medium; Or it relates to a method for enhancing immune activity comprising administering the extract obtained therefrom to a subject.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .
실시예Example
[준비예 1] [Preparation Example 1] 세포주의 준비 및 유지Preparation and maintenance of cell lines
이하의 실험에서는 인간 배아 줄기세포를 사용하였고, 배지는 Stemfit 배지로 이틀에 한번 교체하였다. 여기서, 상기 Stemfit 배지로는 b-FGF(20 ng/ml)를 포함하는 것을 사용하였다. 세포는 5% CO2 및 37℃의 온도 조건 하에서 배양하였고, 세포를 7일 이내로 계대 배양하였다. In the following experiment, human embryonic stem cells were used, and the medium was replaced with Stemfit medium once every two days. Here, as the Stemfit medium, one containing b-FGF (20 ng/ml) was used. Cells were cultured under a temperature condition of 5% CO 2 and 37°C, and the cells were passaged within 7 days.
[준비예 2] [Preparation Example 2] 후장 세포로의 분화 유도Induction of differentiation into posterior cells
1. 줄기세포로부터 내배엽성 세포로의 분화 유도1. Induction of differentiation from stem cells into endoderm cells
인간 배아 줄기세포로부터 내배엽성 세포로의 분화를 유도하기 위해 액티빈 A(100 ng/ml) 및 CHIR99021(3 ㎛)를 첨가한 RPMI1640 배지에 배아줄기세포를 200,000 세포수로 접종한 뒤 배양하며 내배엽성 세포로의 분화를 유도하였다. 분화 기간은 총 3일로, 2일 째에 상기 배지에 FBS를 0.2중량% 첨가하고, 3일 째에 상기 배지에 FBS를 2중량%의 양으로 첨가하였으며, 1일 째에 보충제로 B27 보충제를 첨가하였다.In order to induce differentiation from human embryonic stem cells into endoderm cells, embryonic stem cells were inoculated with 200,000 cells in RPMI1640 medium to which activin A (100 ng/ml) and CHIR99021 (3 µm) were added, followed by culture and endoderm Differentiation into sex cells was induced. Differentiation period was a total of 3 days, 0.2% by weight of FBS was added to the medium on the 2nd day, FBS was added to the medium in an amount of 2% by weight on the 3rd day, and B27 supplement was added as a supplement on the 1st day. I did.
2. 내배엽성 세포로부터 후장(hind gut) 세포의 분화 유도2. Induction of differentiation of hind gut cells from endoderm cells
상기 내배엽성 세포로부터 후장 세포의 분화를 유도하기 위하여 FBS 2 중량%, FGF4(500 ㎍/ml) 및 CHIR99021(3 μM)를 첨가한 DMEM F-12 배지에 상기 내배엽성 세포를 접종한 뒤 4일 동안 분화를 유도하였다. 분화 유도 기간이 도과하자 스페로이드(spheroids) 형상의 후장 세포가 얻어졌고, 웰당 30개의 스페로이드가 형성되었다.4 days after inoculating the endoderm cells in DMEM F-12 medium to which 2% by weight of FBS, FGF4 (500 μg/ml) and CHIR99021 (3 μM) were added to induce the differentiation of posterior cells from the endoderm cells. During which differentiation was induced. When the differentiation induction period elapsed, spheroids-shaped posterior intestinal cells were obtained, and 30 spheroids were formed per well.
[준비예 3] [Preparation Example 3] 혈관망 조직으로의 분화 유도Induction of differentiation into vascular network tissue
도 1은 본 발명의 일 실시예에 따라 인간 배아 줄기세포로부터 혈관망 조직으로의 분화를 유도하는 실험 설계도를 나타낸 것으로, 이하의 실험에서는 도 1에 나타낸 조건으로 수행하였다.FIG. 1 shows an experimental design diagram for inducing differentiation from human embryonic stem cells into vascular network tissues according to an embodiment of the present invention, and the following experiments were performed under the conditions shown in FIG. 1.
1. 중배엽성 세포로의 분화 유도1. Induction of differentiation into mesodermal cells
인간 배아 줄기세포로부터 중배엽성 세포로의 분화를 유도하기 위하여, 상기 인간 배아 줄기세포를 12 μM CHIR99021 (Tocris)가 첨가된 DMEM F/12 (KSR20%) 배지에 접종하여 5부피% CO2 조건 하에서 2 일간 배양하였다. 배양 후 얻어진 세포에 대하여, 하기 표 1의 프라이머를 사용하여 미분화 줄기세포의 마커인 OCT4와, 중배엽성 세포의 마커인 EOMES, MIXL1 및 BRACHY의 mRNA 발현 수준을 측정한 결과, 도 2에서 보는 바와 같이 상기 세포에서 미분화 줄기세포의 마커인 OCT4 mRNA 발현 수준은 감소하고, 중배엽성 세포의 마커인 EOMES, MIXL1 및 BRACHY의 mRNA 발현 수준은 증가하였는 바, 중배엽성 세포로의 분화가 유도되었음을 확인할 수 있었다. In order to induce differentiation from human embryonic stem cells to mesodermal cells, the human embryonic stem cells were inoculated in DMEM F/12 (KSR20%) medium to which 12 μM CHIR99021 (Tocris) was added, and under 5 vol% CO 2 conditions. Incubated for 2 days. For the cells obtained after culture, the mRNA expression levels of OCT4, markers of undifferentiated stem cells, and EOMES, MIXL1, and BRACHY, markers of mesodermal cells were measured using the primers shown in Table 1 below, as shown in FIG. In the above cells, the level of expression of OCT4 mRNA, which is a marker of undifferentiated stem cells, decreased, and the levels of mRNA expression of EOMES, MIXL1, and BRACHY, which are markers of mesodermal cells, increased, confirming that differentiation into mesodermal cells was induced.
유전자gene 서열번호Sequence number 특징Characteristic 염기서열(5'-3')Base sequence (5'-3')
OCT4OCT4 서열번호 1SEQ ID NO: 1 정방향Forward direction 5'-GGGGTTCTATTTGGGAAGGTAT-3'5'-GGGGTTCTATTTGGGAAGGTAT-3'
서열번호 2SEQ ID NO: 2 역방향Reverse 5'-TGTTGTCAGCTTCCTCCACC-3'5'-TGTTGTCAGCTTCCTCCACC-3'
EOMESEOMES 서열번호 3SEQ ID NO: 3 정방향Forward direction 5'-ATCATTACGAAACAGGGCAGGC-3'5'-ATCATTACGAAACAGGGCAGGC-3'
서열번호 4SEQ ID NO: 4 역방향Reverse 5'-CGGGGTTGGTATTTGTGTAAGG-3'5'-CGGGGTTGGTATTTGTGTAAGG-3'
MIXL1MIXL1 서열번호 5SEQ ID NO: 5 정방향Forward direction 5'-ACGTCTTTCAGCGCCGAACAG-3'5'-ACGTCTTTCAGCGCCGAACAG-3'
서열번호 6SEQ ID NO: 6 역방향Reverse 5'-TTGGTTCGGGCAGGCAGTTCA-3'5'-TTGGTTCGGGCAGGCAGTTCA-3'
BRACHYBRACHY 서열번호 7SEQ ID NO: 7 정방향Forward direction 5'-GTGCTGTCCCAGGTGGCTTACAGATG-3'5'-GTGCTGTCCCAGGTGGCTTACAGATG-3'
서열번호 8SEQ ID NO: 8 역방향Reverse 5'-CCTTAACAGCTCAACTCTAACTACTTG-3'5'-CCTTAACAGCTCAACTCTAACTACTTG-3'
상기 중배엽성 세포로부터 혈관계 세포로의 분화를 유도하기 위하여, 상기 중배엽성 세포로의 분화 배지에 BMP4 30 ng/ml, VEGFA 30 ng/ml 및 FGF-4 30 ng/ml를 처리한 뒤 5부피% CO2 조건 하에서 6 일간 배양하였다. 배양 7일 째에 배양 배지를 VEGFA 30 ng/ml, FGF-4 30 ng/ml 및 SB43152 10 μM를 포함하는 DMEM:F12 배지로 교체해 주고 5부피% CO2 조건 하에서 2 일간 배양하였다.In order to induce differentiation from the mesodermal cells to vascular cells, 5% by volume of BMP4 30 ng/ml, VEGFA 30 ng/ml and FGF-4 30 ng/ml in the differentiation medium for the mesodermal cells. Incubated for 6 days under CO 2 conditions. On the 7th day of culture, the culture medium was replaced with a DMEM:F12 medium containing 30 ng/ml of VEGFA, 30 ng/ml of FGF-4 and 10 μM of SB43152, and cultured for 2 days under 5 vol% CO2 conditions.
2. 혈관망 조직의 형성2. Formation of vascular network tissue
상기 혈관계 세포로부터 혈관망 조직을 형성하기 위하여, 혈관계 세포 집합체를 마트리겔과 콜라겐 I이 1:1의 부피로 혼합된 겔에 끼워 넣은 뒤 15% FBS (Gibco), 100 ng/ml VEGFA 및 100 ng/ml FGF-4를 포함하는 DMEM:F12 배지를 덮고 6 일간 배양하였고, 배양 시 2 내지 3 일 마다 신선한 배지로 교체해 주었다. 그 결과, 4일째에는 중배엽성 세포로 분화가 완료된 것을 볼 수 있고, 7일째에는 혈관계 세포로 분화가 유도되는 것을 확인할 수 있으며, 10일째에는 혈관망 조직이 형성되었다.In order to form a vascular network from the vascular cells, the vascular cell aggregate is inserted into a gel in which Matrigel and collagen I are mixed in a volume of 1:1, and then 15% FBS (Gibco), 100 ng/ml VEGFA and 100 ng DMEM:F12 medium containing /ml FGF-4 was covered and cultured for 6 days, and during culture, fresh medium was replaced every 2 to 3 days. As a result, it can be seen that differentiation into mesodermal cells is completed on the 4th day, it can be confirmed that differentiation is induced into vascular cells on the 7th day, and the vascular network tissue is formed on the 10th day.
[준비예 4] [Preparation Example 4] 혈관 조직을 포함하는 장관 오가노이드의 제작Production of intestinal organoids containing vascular tissue
이하의 실험에서는 도 1에 나타낸 조건으로 수행하였다. In the following experiment, it was carried out under the conditions shown in FIG. 1.
1. 후장 세포와 혈관망 조직의 공배양을 통한 장관 오가노이드의 분화 유도1. Induction of differentiation of intestinal organoids through co-culture of posterior intestinal cells and vascular network tissue
상기 준비예 2에서 얻어진 후장 세포와 상기 준비예 3에서 얻어진 혈관망 조직을 BMP4 30 ng/ml, 12 μM CHIR99021, EGF 100 ng/ml, VEGFA 30 ng/ml 및 FGF-4 30 ng/ml가 첨가된 DMEM F/12 (KSR20%)에서 12 일 동안 3차원 공배양 하여 혈관 조직을 포함하는 장관 오가노이드의 분화를 유도하였다. The posterior intestinal cells obtained in Preparation Example 2 and the vascular network tissue obtained in Preparation Example 3 were added with BMP4 30 ng/ml, 12 μM CHIR99021, EGF 100 ng/ml, VEGFA 30 ng/ml and FGF-4 30 ng/ml Three-dimensional co-culture for 12 days in DMEM F/12 (KSR20%) was performed to induce differentiation of intestinal organoids including vascular tissues.
2. 장관 오가노이드의 성숙2. Maturation of intestinal organoids
상기와 같이 분화 유도된 장관 오가노이드를 마트리겔(Matrigel)을 이용하여 BMP4 30 ng/ml, 12 μM CHIR99021, EGF 100 ng/ml, VEGFA 30 ng/ml 및 FGF-4 30 ng/ml가 첨가된 DMEM F/12 (KSR20%)에서 5 일간 계대 배양하여 성숙시켰다. 후장 세포와 혈관망 조직의 공배양 개시 후 20일 째에 장관 오가노이드가 형성되었다.Intestinal organoids induced differentiation as described above were added with 30 ng/ml of BMP4, 12 μM CHIR99021, 100 ng/ml of EGF, 30 ng/ml of VEGFA and 30 ng/ml of FGF-4 using Matrigel. It was matured by subculture for 5 days in DMEM F/12 (KSR20%). Intestinal organoids were formed 20 days after initiation of co-culture of posterior intestinal cells and vascular network tissue.
[실시예 1] [Example 1] 균주의 선별Selection of strains
균주를 얻기 위한 대변(Stool) 시료를 식염수를 이용하여 10-1 내지 10-10 배로 희석하였다. 상기 희석된 시료 중에서 10-1, 10-2, 10-10 배 희석된 시료를 2 mM의 과산화수소(H2O2)가 포함된 비피도박테리움(Bifidobacterium) 속 균주 특이적 배양 배지가 포함되어 있는 페트리 디스크에 각각 스프레딩하고, 37℃의 혐기성 조건에서 16시간 내지 18시간 동안 배양하였다. 그런 다음, 상기 페트리 디스크에 생성된 콜로니(Colony)인 8종의 균주를 선별하고(하기 표 2), 이를 이하 실시예에 사용하기 전까지 스킴 밀크에 넣고 -20℃에 보관하였다.The stool sample for obtaining the strain was diluted 10 -1 to 10 -10 times with saline. Among the diluted samples, the samples diluted 10 -1 , 10 -2 , 10 -10 times contain 2 mM hydrogen peroxide (H 2 O 2 ), containing a strain-specific culture medium of the genus Bifidobacterium. Spread on each Petri disk, and incubated for 16 to 18 hours in an anaerobic condition at 37°C. Then, eight strains, which are colonies generated on the Petri disk, were selected (Table 2 below), and then put in skim milk and stored at -20°C until used in the following examples.
구분division 박테리아 명칭Bacteria name
S2S2 Bifidobacterium longumBifidobacterium longum
S10S10 Bifidobacterium longumBifidobacterium longum
S38S38 Bifidobacterium longumBifidobacterium longum
[실시예 2] [Example 2] 선별된 균주의 활성산소가 포함된 배지에서 배양 능력 확인Confirmation of cultivation ability in medium containing active oxygen of the selected strain
상기 실시예 1에 기재된 배양 배지와 동일한 성분을 포함하도록 액체 배양 배지에, 상기 실시예 1에서 선별된 8종의 균주를 각각 분주하고 37 ℃의 혐기성 조건에서 24시간 동안 배양한 뒤 OD600 값을 확인하여, 그 결과를 도 3에 나타내었다. 여기서, 대조군으로는 레퍼런스 균주인 비피도박테리움 롱굼(Bifidobacterium longum; Ref) 및 전형적 대장균(Typical E.Coli; tEc)를 사용하였다.Each of the eight strains selected in Example 1 was dispensed into a liquid culture medium to contain the same components as the culture medium described in Example 1, and cultured in an anaerobic condition at 37° C. for 24 hours, and then an OD 600 value was determined. It was confirmed, and the results are shown in FIG. 3. Here, the control group, the Bifidobacterium ronggum reference strains were used;; (tEc Typical E.Coli) ( Bifidobacterium longum Ref) and, typically E. coli.
도 3에서 보는 바와 같이, 레퍼런스 균주(Ref)의 경우에는 과산화수소가 포함된 조건에서 OD600 값이 0인 반면, S2, S10 및 S38는 2 mM의 과산화수소가 포함된 조건에서 OD600 값이 0.4 내지 0.6인 것을 확인하였다.As shown in Figure 3, in the case of the reference strain (Ref), the OD 600 value is 0 in the condition containing hydrogen peroxide, whereas the OD 600 value in the condition containing 2 mM hydrogen peroxide is 0.4 to S2, S10, and S38. It was confirmed that it was 0.6.
상기 결과를 통해, 본 발명에 따른 S2(수탁번호: KFCC11834P(Bifidobacterium longum YMC_19_03_2)), S10 및 S38(수탁번호: KFCC11835P(Bifidobacterium longum YMC_19_03_38))은 종래의 비피도박테리움 롱굼과는 전혀 다른 활성산소 조건에 저항능을 갖는 신규한 균주임을 알 수 있다.Through the above results, S2 (accession number: KFCC11834P ( Bifidobacterium longum YMC_19_03_2)), S10 and S38 (accession number: KFCC11835P ( Bifidobacterium longum YMC_19_03_38)) according to the present invention is a completely different active oxygen from the conventional Bifidobacterium longum It can be seen that it is a novel strain having resistance to conditions.
[실시예 3] [Example 3] 장관 오가노이드에서 신규한 균주의 효과 확인Confirmation of the effect of novel strains on intestinal organoids
본 발명의 상기 준비예 4에서 제조한 장관 오가노이드에 마이크로 인젝터(Micro Ingector)를 사용하여 상기 실시예 2의 S2(Mac 0.5, 0.5 ㎕) 또는 물(대조군)을 주입하고 3일 동안 배양하였다. 그런 다음, 상기 장관 오가노이드로부터 통상의 방법에 따라 RNA를 추출한 뒤, RNA 시퀀싱을 수행하고 분석 프로그램을 사용하여 대조군과 비교하여 RNA 발현 수준의 차이가 있는 유전자를 동정하고, 유전자 세트 농축 분석(Gene set enrichment analysis; GSEA) 소프트웨어(ver 4.0.3)를 사용하여 유전자 세트를 분석하고, 그 결과를 도 4 내지 도 7에 나타내었다.S2 (Mac 0.5, 0.5 µl) or water (control) of Example 2 was injected into the intestinal organoid prepared in Preparation Example 4 of the present invention using a Micro Ingector, and cultured for 3 days. Then, RNA was extracted from the intestinal organoids according to a conventional method, RNA sequencing was performed, and an analysis program was used to identify genes with differences in RNA expression levels compared to the control group, and gene set enrichment analysis (Gene The gene set was analyzed using set enrichment analysis; GSEA) software (ver 4.0.3), and the results are shown in FIGS. 4 to 7.
도 4 내지 도 7에서 보는 바와 같이, 본 발명에 따른 S2 균주를 투여한 경우에는 인터페론-1을 암호화하는 유전자의 발현 수준이 현저하게 증가되었으며(도 4 및 도 5), B 세포 수용체 코어 유전자(B cell receptor core genes)의 발현 수준이 현저하게 증가되었다(도 6 및 도 7).As shown in FIGS. 4 to 7, when the S2 strain according to the present invention was administered, the expression level of the gene encoding interferon-1 was remarkably increased (FIGS. 4 and 5 ), and the B cell receptor core gene ( The expression level of B cell receptor core genes) was remarkably increased (FIGS. 6 and 7 ).
상기 결과를 통해, 본 발명에 따른 신규한 균주는 인터페론-1을 암호화하는 유전자 및 B 세포 수용체 코어 유전자의 발현 수준을 증가시킴으로써 활성산소에 저항성을 부여할 수 있을 뿐만 아니라, 면역반응을 활성화시켜 개체의 면역을 매우 효과적으로 증강시킬 수 있는 것을 알 수 있다.Through the above results, the novel strain according to the present invention can impart resistance to free radicals by increasing the expression level of the gene encoding interferon-1 and the B cell receptor core gene, as well as activating the immune response to the individual It can be seen that the immunity of the body can be enhanced very effectively.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.As described above, specific parts of the present invention have been described in detail, and it is clear that these specific techniques are only preferred embodiments for those of ordinary skill in the art, and the scope of the present invention is not limited thereto. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.
[수탁번호][Accession number]
기탁기관명 : 한국미생물보존센터Depositary institution name: Korea Microorganism Conservation Center
수탁번호 : KFCC11835PAccession number: KFCC11835P
수탁일자 : 2019. 08. 06Consignment Date: 2019. 08. 06
Figure PCTKR2020011192-appb-I000001
Figure PCTKR2020011192-appb-I000001
기탁기관명 : 한국미생물보존센터Depositary institution name: Korea Microorganism Conservation Center
수탁번호 : KFCC11834PAccession number: KFCC11834P
수탁일자 : 2019. 08. 06Consignment Date: 2019. 08. 06
Figure PCTKR2020011192-appb-I000002
Figure PCTKR2020011192-appb-I000002
본 발명의 신규한 균주는 혐기성 조건 및 과산화수소가 과량으로 포함된 배양 조건에서 내성을 가지므로, 활성산소 조건에서 저항능, 즉 산화스트레스에 대항하는 방어기전을 가진다. 또한, 본 발명의 상기 신규한 균주는 활성산소 조건에서 저항능을 가지므로 목적하는 기관에 존재하는 정상 미생물 균총을 유지할 수 있다. 따라서, 본 발명의 상기 신규한 균주는 활성산소가 존재하는 환경에서 정상 미생물 균총을 유지하거나, 또는 면역활성을 증강시키는 용도로 매우 유용하게 활용될 수 있다.Since the novel strain of the present invention has resistance under anaerobic conditions and culture conditions containing an excess of hydrogen peroxide, it has resistance under reactive oxygen conditions, that is, a defense mechanism against oxidative stress. In addition, since the novel strain of the present invention has resistance under reactive oxygen conditions, it is possible to maintain a normal microbial flora present in a target organ. Therefore, the novel strain of the present invention can be very usefully used for maintaining a normal microbial flora or enhancing immune activity in an environment in which active oxygen is present.
서열번호 1: OCT4 forward primerSEQ ID NO: 1: OCT4 forward primer
GGGGTTCTATTTGGGAAGGTATGGGGTTCTATTTGGGAAGGTAT
서열번호 2: OCT4 reverse primerSEQ ID NO: 2: OCT4 reverse primer
TGTTGTCAGCTTCCTCCACCTGTTGTCAGCTTCCTCCACC
서열번호 3: EOMES forward primerSEQ ID NO: 3: EOMES forward primer
ATCATTACGAAACAGGGCAGGCATCATTACGAAACAGGGCAGGC
서열번호 4: EOMES reverse primerSEQ ID NO: 4: EOMES reverse primer
CGGGGTTGGTATTTGTGTAAGGCGGGGTTGGTATTTGTGTAAGG
서열번호 5: MIXL1 forward primerSEQ ID NO: 5: MIXL1 forward primer
ACGTCTTTCAGCGCCGAACAGACGTCTTTCAGCGCCGAACAG
서열번호 6: MTXL1 reverse primerSEQ ID NO: 6: MTXL1 reverse primer
TTGGTTCGGGCAGGCAGTTCATTGGTTCGGGCAGGCAGTTCA
서열번호 7: BRACHY forward primerSEQ ID NO: 7: BRACHY forward primer
GTGCTGTCCCAGGTGGCTTACAGATGGTGCTGTCCCAGGTGGCTTACAGATG
서열번호 8: BRACHY reverse primerSEQ ID NO: 8: BRACHY reverse primer
CCTTAACAGCTCAACTCTAACTACTTGCCTTAACAGCTCAACTCTAACTACTTG

Claims (14)

  1. 비피도박테리움(Bifidobacterium) 속에 포함되는 균주.Strains contained in the genus Bifidobacterium.
  2. 상기 비피도박테리움 속 균주는 비피도박테리움 롱굼(Bifidobacterium longum)인 것인, 균주.The strain of the genus Bifidobacterium is that of the Bifidobacterium longum (Bifidobacterium longum), the strain.
  3. 제2항에 있어서,The method of claim 2,
    상기 비피도박테리움 롱굼은 수탁번호 KFCC11835P 또는 수탁번호 KFCC11834P로 기탁된 것인, 균주.The Bifidobacterium longum is deposited with accession number KFCC11835P or accession number KFCC11834P, strain.
  4. 제1항에 있어서,The method of claim 1,
    상기 균주는 활성산소 조건에서 저항능을 갖는 것인, 균주.The strain is to have resistance under reactive oxygen conditions, strain.
  5. 제1항에 있어서,The method of claim 1,
    상기 균주는 면역활성 증강능을 갖는 것인, 균주.The strain is one having the ability to enhance the immune activity, strain.
  6. 제1항 내지 제5항 중 어느 한 항의 균주의 배양물.A culture of the strain of any one of claims 1 to 5.
  7. 제1항 내지 제5항 중 어느 한 항의 균주의 배양물로부터 상기 균주가 제거된 배양액.The culture medium in which the strain has been removed from the culture of the strain of any one of claims 1 to 5.
  8. 제1항 내지 제5항 중 어느 한 항의 균주의 배양물 또는 배양액의 추출물.The culture product of any one of claims 1 to 5 or an extract of the culture solution.
  9. 제1항 내지 제5항 중 어느 한 항의 균주를 유효성분으로 포함하는 면역활성 증강용 식품 조성물.A food composition for enhancing immune activity comprising the strain of any one of claims 1 to 5 as an active ingredient.
  10. 제6항의 배양물을 유효성분으로 포함하는 면역활성 증강용 식품 조성물.A food composition for enhancing immune activity comprising the culture of claim 6 as an active ingredient.
  11. 제7항의 배양액을 유효성분으로 포함하는 면역활성 증강용 식품 조성물.A food composition for enhancing immune activity comprising the culture medium of claim 7 as an active ingredient.
  12. 제8항의 추출물을 유효성분으로 포함하는 면역활성 증가용 식품 조성물.A food composition for increasing immune activity comprising the extract of claim 8 as an active ingredient.
  13. 제1항 내지 제5항 중 어느 한 항의 균주를 유효성분으로 포함하는 생균제 조성물.A probiotic composition comprising the strain of any one of claims 1 to 5 as an active ingredient.
  14. 비피도박테리움(Bifidobacterium) 속에 포함되는 균주; 상기 균주의 배양물; 배양액; 또는 그로부터 얻어진 추출물을 개체에 투여하는 단계를 포함하는 면역활성 증강 방법.Strains contained in the genus Bifidobacterium; A culture of the strain; Culture medium; Or a method for enhancing immune activity comprising administering an extract obtained therefrom to a subject.
PCT/KR2020/011192 2019-08-23 2020-08-21 Novel symbiotic strain having resistance under reactive oxygen condition and use thereof WO2021040335A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0103632 2019-08-23
KR20190103632 2019-08-23

Publications (1)

Publication Number Publication Date
WO2021040335A1 true WO2021040335A1 (en) 2021-03-04

Family

ID=74683840

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/011192 WO2021040335A1 (en) 2019-08-23 2020-08-21 Novel symbiotic strain having resistance under reactive oxygen condition and use thereof

Country Status (2)

Country Link
KR (1) KR20210023768A (en)
WO (1) WO2021040335A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101768678B1 (en) * 2015-02-16 2017-08-18 (주) 피엘바이오 Bifidobacterium longum ssp. infantis BI9988 isolated from Korean longevity village and having high nutraceutical activities
KR20180089324A (en) * 2017-01-31 2018-08-08 경희대학교 산학협력단 Novel lactic acid bacteria and use thereof
US20180280453A1 (en) * 2015-08-27 2018-10-04 Alimentary Health Limited Use of bifidobacterium longum and an exopolysaccharide produced thereby

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101768678B1 (en) * 2015-02-16 2017-08-18 (주) 피엘바이오 Bifidobacterium longum ssp. infantis BI9988 isolated from Korean longevity village and having high nutraceutical activities
US20180280453A1 (en) * 2015-08-27 2018-10-04 Alimentary Health Limited Use of bifidobacterium longum and an exopolysaccharide produced thereby
KR20180089324A (en) * 2017-01-31 2018-08-08 경희대학교 산학협력단 Novel lactic acid bacteria and use thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LORENA RUIZ; PATRICIA RUAS-MADIEDO; MIGUEL GUEIMONDE; CLARA G. DE LOS REYES-GAVILÁN; ABELARDO MARGOLLES; BORJA SÁNCHEZ: "How do bifidobacteria counteract environmental challenges? Mechanisms involved and physiological consequences", GENES & NUTRITION ; STUDYING THE RELATIONSHIP BETWEEN GENETICS AND NUTRITION IN THE IMPROVEMENT OF HUMAN HEALTH, SPRINGER-VERLAG, BERLIN/HEIDELBERG, vol. 6, no. 3, 13 January 2011 (2011-01-13), Berlin/Heidelberg, pages 307 - 318, XP019931656, ISSN: 1865-3499, DOI: 10.1007/s12263-010-0207-5 *
PARK HO-EUN, UM HYUN-BUM, LEE WAN-KYU: "The immune enhancing effects and characteristics of Bifidobacterium longum and Bifidobacterium breve for the probiotic use in humans and animals", JOURNAL OF BIOMEDICAL TRANSLATIONAL RESEARCH, vol. 19, no. 4, 1 December 2018 (2018-12-01), pages 65 - 72, XP055786822, ISSN: 2508-1357, DOI: 10.12729/jbtr.2018.19.4.065 *

Also Published As

Publication number Publication date
KR20210023768A (en) 2021-03-04

Similar Documents

Publication Publication Date Title
WO2020040408A1 (en) Novel cutibacterium granulosum strain, and composition comprising such strain or culture thereof for preventing or treating acne
WO2017119795A1 (en) Novel lactobacillus casei gfc1 strain, fermented ginseng extract using strain, and preparation method thereof
WO2020075949A1 (en) Novel lactobacillus plantarum strain atg-k2, atg-k6 or atg-k8, and composition for preventing or treating vaginitis comprising same
WO2020116733A1 (en) Novel lactobacillus reuteri atg-f4 strain having function of enhancing dopamine secretion and pharmaceutical composition comprising same for prevention or treatment of psychopathy
WO2019088379A1 (en) Novel lactic acid bacteria and use thereof
WO2021261632A1 (en) Novel faecalibacterium prausnitzii strain eb-fpdk11 and use thereof
WO2016064000A1 (en) Lactobacillus plantarum probio 090 having antiviral and antipathogenic bacterial activities, and product thereof
WO2018128408A1 (en) Pharmaceutical composition for preventing or treating allergic diseases such as asthma or atopy, comprising baicalein as active ingredient
WO2014069874A1 (en) Composition for removing keratinous skin material comprising green tea lactobacillus
WO2021132879A1 (en) Composition for prevention and treatment of atopic dermatitis comprising, as active ingredient, novel bifidobacterium animalis subsp. lactis lm1017 derived from korean infants
KR20180001460A (en) Uses of microorganism a member of family Sporichthyaceae
WO2019132233A1 (en) Microorganism having ability to degrade ethanol and acetaldehyde, and composition and kit each including the same
WO2023055188A1 (en) Novel probiotics and use thereof
WO2021040335A1 (en) Novel symbiotic strain having resistance under reactive oxygen condition and use thereof
WO2020180037A1 (en) Composition for culturing human gut microbiome mimic, method for culturing human gut microbiome mimic by using anaerobic culture system, microbial agent prepared thereby, and use thereof
WO2024075937A1 (en) Fucoidan fermentation product and uses thereof for improving condition of skin
WO2023177215A1 (en) Weissella cibaria strain having dental health enhancement activity and use thereof
WO2022231178A1 (en) Novel lactobacillus fermentum atg-v5 strain, or composition for enhancing immunity, comprising same
WO2021242056A1 (en) Bifidobacterium sp. strain and extracellular vesicle derived therefrom, and anti-inflammatory and anti-bacterial uses thereof
WO2021261631A1 (en) Novel picalibacterium prosnich eb-fpdk9 strain and uses thereof
WO2021071159A1 (en) Antidiabetic, hypotensive, or antioxidant composition comprising yeast fermentate of rhynchosia nulubilis and method for preparing same composition
WO2020171256A1 (en) Lactobacillus strain having growth-inhibitory effect on clostridium difficile
WO2013151363A1 (en) Novel separated bacillus licheniformis and probiotics using same
WO2024038980A1 (en) Lactobacillus plantarum ku15120 strain or use thereof
WO2024085623A1 (en) Microbiome composition of fermentation culture supernatant of lactiplantibacillus plantarum strain km2 having anti-inflammatory effect

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20856136

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20856136

Country of ref document: EP

Kind code of ref document: A1