WO2020180037A1 - Composition for culturing human gut microbiome mimic, method for culturing human gut microbiome mimic by using anaerobic culture system, microbial agent prepared thereby, and use thereof - Google Patents

Composition for culturing human gut microbiome mimic, method for culturing human gut microbiome mimic by using anaerobic culture system, microbial agent prepared thereby, and use thereof Download PDF

Info

Publication number
WO2020180037A1
WO2020180037A1 PCT/KR2020/002710 KR2020002710W WO2020180037A1 WO 2020180037 A1 WO2020180037 A1 WO 2020180037A1 KR 2020002710 W KR2020002710 W KR 2020002710W WO 2020180037 A1 WO2020180037 A1 WO 2020180037A1
Authority
WO
WIPO (PCT)
Prior art keywords
composition
bacteria
microbial community
culture
firmicutes
Prior art date
Application number
PCT/KR2020/002710
Other languages
French (fr)
Korean (ko)
Inventor
신재호
김은수
최승대
이유정
박창언
손현우
조영재
조형우
김민철
정연균
박민규
박영준
강기웅
김민지
Original Assignee
경북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020190024957A external-priority patent/KR20200106419A/en
Application filed by 경북대학교 산학협력단 filed Critical 경북대학교 산학협력단
Publication of WO2020180037A1 publication Critical patent/WO2020180037A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor

Definitions

  • the present inventors were searching for methods having the same microbial composition as the original feces by simulating and culturing the intestinal microbial community in vitro, while intestinal microbial communities including bacterioidetes, permicutes, proteobacteria, fusobacteria and actinobacteria, etc.
  • the present invention was completed based on this, because it was found a method of culturing similarly to that of Wondyeon, and it was confirmed that the intestinal microbial community obtained therefrom has a therapeutic effect on intestinal diseases.
  • Another object of the present invention is to prepare a microbial community suspension from the feces of a subject; Inoculating the suspension into the composition; And it is to provide a human intestinal microbial community simulation culture method comprising the step of culturing the composition.
  • Another aspect of the present invention provides a microbial preparation comprising as an active ingredient at least one selected from the group consisting of a culture of a microbial community simulated by the above method, a concentrate of the culture, and a dried product of the culture.
  • FIG. 16 shows (a) Bifidobacteriaceae and (b) Akermensi Asia (Bifidobacteriaceae) found in the intestine of mice after administration of a population of intestinal microorganisms simulated by a method according to an embodiment of the present invention.
  • Akkermensiaceae) is a graph showing the family (family) microorganisms.
  • the composition may further include one or more components selected from the group consisting of water-soluble starch, sodium pyruvate, and L-arginine.
  • the composition may further include one or more components selected from the group consisting of Pancreatic digest of casein and Papain digest of soybean.
  • the medium of the present invention is a fastidious anaerobe comprising a brain-heart infusion media (BHI) containing a bovine brain extract, a bovine heart extract and proteose peptone as an active ingredient, starch, sodium pyruvate and L-arginine as an active ingredient.
  • BHI brain-heart infusion media
  • FAB tryptic soy broth
  • pancreatic digests of casein and papain digests of soybeans as active ingredients is more useful for simulated culture in which the ratio of human intestinal microbial communities is maintained.
  • the first step of the present invention is to prepare a microbial community suspension from feces.
  • the step of culturing may be performed for 24 to 120 hours.
  • the microbial community of the present invention may be, for example, a human-derived intestinal microbial community that is normally selected by verification of alpha diversity, beta diversity and/or relative abundance based on criteria commonly applied in the art.
  • At least 120 ⁇ 27g or more of stool samples were obtained per sample from the donor selected in Example 1-1, and some of the obtained stool samples were stored frozen at -80°C, and the extra sample contained 20% glycerin. It was suspended 10 times by weight in 0.85% physiological saline. As a result of measuring the number of viable cells in each stool sample using a hemocytometer, it was confirmed that each stool sample contained about 10 9 to 10 11 intestinal microorganisms per gram. Fecal samples suspended in a buffer solution were stored frozen at -80°C until use in the experiment. The fecal sample pretreatment process was performed in the anaerobic chamber under conditions of 0 ppm to 40 ppm of oxygen and 10000 ppm to 50000 ppm of hydrogen.
  • Example 3 Simulated culture and formulation of fecal samples
  • At least one buffer solution was selected from a buffer group consisting of 0.85% physiological saline and 50% glycerin containing, and mixed 1 to 1 with the BHI medium culture of the simulated microbial community, and formulated in a liquid form (Fig. 7). .
  • DNA was extracted using QIAmp Power Fecal DNA Pro Kit (QIAGEN, Germany) according to a conventional method in the art.
  • the original stool sample suspension and the simulated cultured human intestinal microbial community culture solution of Example 1 were thawed and then 1.8 ml was taken, which was concentrated 6 times by centrifugation, and then extracted according to the manufacturer's instructions.
  • the V4-V5 region of the 16S rRNA gene was specifically amplified by the polymerase chain reaction method using the primers in Table 7.
  • Example 7 Confirmation of the therapeutic effect of inflammatory bowel disease of the simulated cultured intestinal microbial community culture formulation

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The present invention relates to a composition for culturing a human gut microbiome mimic, a method for culturing a human gut microbiome mimic by using an anaerobic culture system, a microbial agent prepared thereby, and a use thereof. A microbiome obtained according to the method of the present invention exhibits similar efficacy to that of gut microorganisms contained in feces of normal populations, thereby being effectively usable in various fields such as gut microorganism improvement and functional food and cosmetic manufacturing.

Description

인간 장내 미생물 군집 모사 배양용 조성물, 혐기 배양 체계를 이용한 인간 장내 미생물 군집의 모사 배양 방법, 이에 의해 제조된 미생물 제제 및 이의 용도Composition for replicating human intestinal microbial community, method for replicating human intestinal microbial community using anaerobic culture system, microbial preparation prepared thereby, and use thereof
본 발명은 인간 장내 미생물 군집 모사 배양용 조성물, 혐기 배양 체계를 이용한 인간 장내 미생물 군집의 모사 배양 방법, 이에 의해 제조된 미생물 제제 및 이의 용도에 관한 것이다.The present invention relates to a composition for replicating human intestinal microbial communities, a method for replicating human intestinal microbial communities using an anaerobic culture system, a microbial preparation prepared thereby, and a use thereof.
포유동물의 장점막 표면에 정착하고 있는 장내 미생물 군집(gut microbiome)은 장관 내부 생태계(ecosystem)를 구성하면서 숙주의 물질 대사에 관여하는 것으로 알려져 있다. 정상의 경우, 그람 음성균인 프로테오박테리아 문 과 박테로이데테스 문, 그리고 그람 양성 세균인 퍼미큐테스 문이 적절한 비율(symbiosis)로 존재하고 있으며, 이들이 장내에 상재 하면서 다른 세균들과 함께 영양분을 획득하기 위해 복잡하고 정교한 생태학적 네트워크 및 생화학적 에너지 흐름을 만들어낸다. 특히 장내 미생물에 의해 생산되는 단사슬 지방산(short chain fatty acids, SCFAs)은 장 상피 세포와 숙주의 면역에 직접적인 영향을 미치는 것으로 알려졌으며 최근의 연구는 장과 뇌 사이에서 생체 신호를 주고받는 장-뇌 연결 축(gut-brain axis)의 존재 가능성과 장내 미생물 불균형에 따른 비만, 당뇨, 염증성 장 질환 등을 보고하며 장내 미생물 군집이 숙주인 사람 및 동물과 직접적인 상호작용을 하고 있음을 시사하고 있다.It is known that the gut microbiome settling on the surface of the intestinal mucosa of mammals is involved in the metabolism of the host while constituting the intestinal internal ecosystem. In the normal case, Gram-negative bacteria (proteobacteria phylum and Bacteroidetes phylum), and Gram-positive bacteria (Permicutes phylum) exist in an appropriate ratio (symbiosis), and they reside in the intestine and provide nutrients along with other bacteria. It creates complex and sophisticated ecological networks and biochemical energy flows to acquire. In particular, short chain fatty acids (SCFAs) produced by intestinal microbes are known to have a direct effect on the intestinal epithelial cells and the immunity of the host. Obesity, diabetes, and inflammatory bowel disease are reported due to the possibility of the existence of a gut-brain axis and an imbalance of intestinal microflora, suggesting that the intestinal microbial community directly interacts with humans and animals as hosts.
한편, 비만과 장내 미생물 군집 변화의 상관관계에 대해서는 렙틴(leptin)이 결핍된 생쥐의 장내 미생물 군집에서 퍼미큐테스 문이 증가하고, 박테로이데테스 문이 감소한다는 것이 처음 보고되었다. 또한 비만을 가진 사람의 장내 미생물 군집에서도 퍼미큐테스 문/박테로이데테스 문의 비율 증가가 확인되어 비만과 장내 미생물 군집 간의 연관성이 사람에서도 유효하다는 것이 알려졌고, 비만 생쥐의 장내 미생물 군집을 이식받은 무균 생쥐가 마른 생쥐의 장내 미생물 군집을 이식받은 생쥐보다 체중이 더 증가한다는 것이 밝혀졌다. 이러한 사실들을 바탕으로 장내 미생물 군집이 마른 사람과 비만인 사람에게서 다른 양상을 보이며, 더 나아가 장내 미생물 군집의 교체나 외부로부터의 도입이 체내 대사의 변화를 유도할 수 있음을 보여주고 있다.On the other hand, for the correlation between obesity and changes in intestinal microbial community, it was first reported that permicutes phlegm increased and Bacteroidetes phlegm decreased in the intestinal microbial community of leptin-deficient mice. In addition, an increase in the ratio of Permicutes phylum/Bacteroidetes phylum in the intestinal microbial community of obese people was confirmed, and it was known that the association between obesity and the intestinal microbial community was also effective in humans. It was found that mice gained more weight than mice transplanted with lean mice's gut microbiota. Based on these facts, the intestinal microbial community shows different patterns in the lean and obese people, and furthermore, it is shown that replacement of the intestinal microbial community or introduction from the outside can induce changes in metabolism in the body.
또한, 염증성 장 질환(inflammatory bowel disease, IBD)은 장에 염증 또는 궤양이 발생하여 일련의 복부 경련 및 설사 혈변 등의 증상을 보이고 재발이 반복되는 난치병으로, 염증성 장 질환의 발병 원인은 아직 명확하게 밝혀지지 않았으나, 최근의 연구 결과들에 따르면 유전적, 환경적인 인자, 자가면역증상 등이 원인으로 꼽히고 있으며, 장내 미생물 군집 또한 염증성 장 질환과 높은 상관관계를 갖는 것으로 밝혀졌다. 정상인에서는 박테로이데테스와 퍼미큐테스 및 프로테오박테리아의 비율이 적절히 유지되지만 염증성 장 질환 환자군에서는 유전적 요인과 함께 스트레스, 식이 및 항생제와 같은 환경적 요인이 복합적으로 작용하여 프로테오박테리아의 폭발적인 증가 등 장내 미생물 군집 조성의 비정상적인 변화를 유도(dysbiosis)하고, 장내 점막 세포에 일련의 면역 반응을 유도하게 되어 결국에는 만성 염증 및 과민성 염증을 유발한다.In addition, inflammatory bowel disease (IBD) is an incurable disease in which inflammation or ulceration occurs in the intestine, causing a series of abdominal cramps and diarrhea, bloody stools, and recurring recurrence. The cause of inflammatory bowel disease is still unclear. Although not revealed, according to recent research results, genetic and environmental factors, autoimmune symptoms, etc. are considered as causes, and it was found that the intestinal microbial community also had a high correlation with inflammatory bowel disease. In normal people, the ratio of Bacteroidetes, Permicutes, and Proteobacteria is maintained properly, but in the inflammatory bowel disease patient group, environmental factors such as stress, diet, and antibiotics act in combination with genetic factors, resulting in an explosive effect of proteobacteria. It induces abnormal changes in the composition of the intestinal microbial community such as increase (dysbiosis), and induces a series of immune responses to the intestinal mucosa cells, eventually causing chronic inflammation and irritable inflammation.
또한, 클로스트리디움 디피실 감염증은 클로스트리디움 디피실( Clostridioides difficile)의 감염으로 인하여 증상을 보이는 감염증으로 클로스트리디움 디피실 관련 질병(CDAD, C. difficile associated diarrhea)으로도 알려져 있으며, 클로스트리디움 디피실 균이 A 독소(장 독소, enterotoxin), B 독소(세포 독소, cytotoxin)를 생성하여 장점막에 손상을 주는 것으로 알려져 있다. 항생제 치료, 소화기계 수술, 고령, 입원 및 양성자 펌프 억제제 복용 등을 위험인자로 볼 수 있으며, 발병과 연관성이 높은 항생제로는 clindamycin, cephalosporin, fluoroquinolone 등이 알려져 있다.In addition, Clostridium difficile infection is an infection that exhibits symptoms due to an infection of Clostridioides difficile, and is also known as Clostridium difficile-associated disease (CDAD, C. difficile associated diarrhea). Dium difficile bacteria are known to produce A toxin (enterotoxin) and B toxin (cytotoxin, cytotoxin) to damage the intestinal tract. Antibiotic treatment, gastrointestinal surgery, old age, hospitalization, and taking proton pump inhibitors can be seen as risk factors. Antibiotics that are highly associated with onset include clindamycin, cephalosporin, and fluoroquinolone.
이와 같은 항생제 처방은 항생제 내성 획득 균주의 출현을 유도하기 때문에 상기의 염증성 장 질환과 동일하게 건강인의 대변을 이식하는 방법을 시도하고 있다. 분변 이식, 혹은 대변 이식(Fecal Microbiota Transplantation, FMT)은 상기의 장내 미생물 군집과 인간 질병과의 상관관계를 바탕으로 등장한 개념이다. 현재까지 발표된 600건 이상의 증례 보고와 2개의 무작위 비교연구에 따르면, 건강인의 대변을 정제하여 환자의 장내에 도입했을 때, 클로스트리디움 디피실 감염증으로 인한 염증 증상의 개선과 함께 재발이 없는 완치가 90%에 이르렀다는 2012년의 선행 연구를 포함하여 현재까지 클로스트리디움 디피실 감염증 치료를 대변 이식으로 성공했다는 사례가 계속해서 보고되고 있다. 또한, 기존 항생제 치료 군과 비교했을 때에도 재발률 및 부작용 발생이 적고 안정성 역시 기존의 약물치료에 비해 높다는 사례가 보고되고 있다. 최신의 연구들은 장 질환뿐만 아니라 대사 질환, 신경계 질환 및 심혈관계 질환에까지 적응증을 확대하며 최신의 임상으로 주목 받고 있다.Since such antibiotic prescription induces the emergence of antibiotic-resistant strains, a method of transplanting the feces of a healthy person is attempted in the same manner as the inflammatory bowel disease described above. Fecal Microbiota Transplantation (FMT) is a concept emerged based on the correlation between the intestinal microbiota and human disease. According to more than 600 case reports published to date and two randomized comparative studies, when a healthy person's feces were purified and introduced into the patient's intestine, there was no recurrence with improvement of inflammatory symptoms due to Clostridium difficile infection. There are continued reports of successful treatment of Clostridium difficile infection with stool transplantation to date, including previous studies in 2012 that showed that the cure reached 90%. In addition, it has been reported that the recurrence rate and the occurrence of side effects are less, and the stability is also higher than that of the existing drug treatment, even when compared to the existing antibiotic treatment group. The latest studies are drawing attention as the latest clinical trials, expanding indications not only for intestinal diseases, but also for metabolic diseases, nervous system diseases and cardiovascular diseases.
이러한 대변 이식술은 공여자로부터 공여받은 대변을 생리 식염수에 현탁하고 이를 균질화한 뒤 여과하여 2시간 이내에 근위 공장까지 비위관을 삽입한 환자에게 투여하는 등의 방법을 사용하고 있다. 그러나 일반적으로 각종 장 질환 환자의 증상 개선, 체형 변화 유도 등을 위해서는 수 회에 걸쳐 대변 이식술을 시행해야 하는데, 매회 공여자로부터 대변을 공여받아야 하고 원 대변 시료의 보관이 까다로우며 한 번 사용 후 재사용이 어렵다. 또한 공여자의 식이와 같은 환경적 요인들로 인해 공여받은 대변의 미생물 군집이 항상 일정하지 않아 재현성이 보장되지 않는다는 점, 공여자 대변의 오염 여부를 일일이 점검해야 하는 문제점들이 존재한다.Such stool transplantation involves suspending the stool donated from a donor in physiological saline, homogenizing it, filtering it, and administering it to a patient who has inserted a nasogastric tube to the proximal jejunum within 2 hours. However, in general, stool transplantation should be performed several times to improve symptoms and induce body shape changes in patients with various bowel diseases, but stool must be donated from the donor each time, and the storage of the original stool sample is difficult, and reuse after one use. This is difficult. In addition, due to environmental factors such as the donor's diet, the microbial community of the donor stool is not always consistent, so reproducibility is not guaranteed, and there are problems that must be checked for contamination of the donor stool.
따라서, 상기의 한계점들을 극복하기 위해 현재 대변 이식술 방법을 개선하고자 소량의 원 대변 시료를 캡슐화, 코팅하는 연구들이 시도되고 있으나 현재까지 약의 형태로 개발된 방법은 존재하지 않다. 한편, 위의 문제점들과 함께 사람과 장내 미생물간 상호작용 메커니즘의 본질을 이해하고자 하는 욕구는 장내 환경과 미생물 군집을 모방하려는 시도로 이어졌다.Accordingly, in order to overcome the above limitations, studies of encapsulating and coating a small amount of raw stool samples have been attempted to improve the current stool transplantation method, but there is no method developed in the form of a drug so far. Meanwhile, the desire to understand the nature of the interaction mechanism between human and intestinal microbes along with the above problems has led to an attempt to imitate the intestinal environment and microbial community.
장내 미생물 군집을 모방하는 것은 접근 방법에 따라서 bottom-up 방식과 top-down 방식으로 나눌 수 있다. Bottom-up 방식은 종래의 유산균 제제들과 마찬가지로 건강한 인간의 장에 존재하는 개별 균주를 분리, 대량 배양한 뒤 이들을 혼합하여 장내 미생물 컨소시엄으로 만드는 방식이다. 그러나 이 방식은 시간, 인력 및 비용적 측면에서 비효율적이라는 것이 여러 선행연구에서 밝혀지고 있으며, 특히 배양 가능한 미생물 분류군 역시 극히 제한적이므로 근본적인 기술적 한계에 부딪히고 있다. 이러한 이유로 Bottom-up 방식으로 실험쥐에 처리된 개별 분리 균주의 최대 수는 33종이다(Martz 등 2015).Imitation of the intestinal microbial community can be divided into bottom-up and top-down methods depending on the approach. The bottom-up method, like conventional lactic acid bacteria preparations, is a method of separating and mass-culturing individual strains present in a healthy human intestine and then mixing them to form a consortium of intestinal microorganisms. However, it has been revealed in several previous studies that this method is inefficient in terms of time, manpower, and cost. In particular, since the cultivable microbial taxa is also extremely limited, it faces fundamental technical limitations. For this reason, the maximum number of individual isolates treated in mice in a bottom-up manner is 33 species (Martz et al. 2015).
Top-down 방식은 대변 자체를 배양하여 장내 미생물 군집을 최대로 유지하는 방법이다. 이 방식은 단독 배양이 불가능한 다양한 계통발생학적 분류군들의 배양이 가능하지만, 2016년의 Takagi 등과 2019년의 Yousi 등의 선행연구에서 보고되었듯이 배양하는 과정에서 군집의 조성이 붕괴되는 한계점을 보여주었다.The top-down method is a method of culturing the stool itself to maximize the intestinal microbial community. This method allows cultivation of various phylogenetic taxa that cannot be cultured alone, but as reported in previous studies such as Takagi in 2016 and Yousi in 2019, it showed the limit of the collapse of the composition of the cluster during the cultivation process.
한편, 장내 환경 자체를 모방하려는 시도는 2004년 Parlesak 등의 Transwell, 2014년 Mazorati 등에 의한 Host-Microbiota Interaction (HMI TM), 2017년 Hoek의 Human oxygen Bacteria anaerobic (HoxBan) 공배양 체계 및 2012년 김 등의 gut-on-a-chip 등 지난 10년이 넘는 기간 동안 다양한 시도들이 있어왔다. 그러나, 이들 시도는 미생물 생태학적 재현 보다는 장내의 물리화학적 환경 구축에 중점을 두었으며, 특히 배양체계의 복잡성, 재현성 등 아직까지 극복해야 될 난관들이 존재한다.On the other hand, attempts to imitate the intestinal environment itself include Transwell of Parlesak et al. in 2004, Host-Microbiota Interaction (HMI TM ) by Mazorati et al. in 2014, Human oxygen Bacteria anaerobic (HoxBan) co-culture system of Hoek in 2017 and Kim in 2012. Various attempts have been made over the past 10 years, including the gut-on-a-chip of the company. However, these attempts have focused on the establishment of a physicochemical environment in the intestine rather than microbial ecological reproduction, and in particular, there are challenges to overcome such as the complexity and reproducibility of the culture system.
산업화를 위해서는 구성 성분 혹은 개별적 장내 미생물의 구성이 정확히 알려진, 표준화된 장내 미생물 군집을 대량으로 생산할 수 있어야 하지만 장내 미생물 군집의 복잡성과 구성의 다양한 특징으로 인해 숙주와 장내 미생물 군집 간의 복잡한 상호작용에 대한 기작을 밝히기가 쉽지 않고, 장내 미생물 군집으로부터 개개의 종을 분리하는 것 또한 아직까지 기술적 한계로 어려운 상황이다. 대변이식의 적응증이 장질환 뿐만 아니라 유형2 당뇨병, 비만 등을 포함한 대사질환, 면역질환, 심혈관 질환 및 파킨슨병, 우울증, 알츠하이머 등의 신경계질환까지 그 범위를 확대함에 따라, 장내 미생물 군집 모사 배양의 중요도는 증가하는 실정이다.For industrialization, it is necessary to produce a standardized intestinal microbial community in large quantities, where the constituents or the composition of individual intestinal microbes are accurately known, but the complex interactions between the host and the intestinal microbial community are largely due to the complexity and various characteristics of the composition. It is not easy to clarify the mechanism, and it is still difficult to isolate individual species from the intestinal microbial community due to technical limitations. As the indications for stool transplantation have expanded to not only intestinal diseases, but also metabolic diseases including type 2 diabetes and obesity, immune diseases, cardiovascular diseases, and neurological diseases such as Parkinson's disease, depression, and Alzheimer's, The importance is increasing.
본 발명자들은 장내 미생물 군집을 체외에서 모사 배양하여 원 대변과 동일한 미생물 조성을 갖는 방법들을 탐색하던 중 박테로이데테스, 퍼미큐테스, 프로테오박테리아, 푸소박테리아 및 액티노박테리아 등을 포함하는 장내 미생물 군집을 원대변의 것과 유사하게 배양하는 방법을 발견하였고, 이로부터 수득된 장내 미생물 군집이 장질환에 치료적 효과를 가짐을 확인하였기에 이에 기초하여 본 발명을 완성하였다.The present inventors were searching for methods having the same microbial composition as the original feces by simulating and culturing the intestinal microbial community in vitro, while intestinal microbial communities including bacterioidetes, permicutes, proteobacteria, fusobacteria and actinobacteria, etc. The present invention was completed based on this, because it was found a method of culturing similarly to that of Wondyeon, and it was confirmed that the intestinal microbial community obtained therefrom has a therapeutic effect on intestinal diseases.
이에, 본 발명의 하나의 목적은 인간 장내 미생물 군집 모사 배양용 조성물에 있어서, 상기 조성물은 혐기성인 것인 인간 장내 미생물 군집 모사 배양용 조성물을 제공하는 것이다.Accordingly, one object of the present invention is to provide a composition for cultivating human intestinal microbial communities, wherein the composition is anaerobic.
본 발명의 다른 목적은 피험체의 대변으로부터 미생물 군집 현탁액을 준비하는 단계; 상기 현탁액을 상기조성물에 접종하는 단계; 및 상기 조성물을 배양하는 단계를 포함하는 인간 장내 미생물 군집 모사 배양 방법을 제공하는 것이다.Another object of the present invention is to prepare a microbial community suspension from the feces of a subject; Inoculating the suspension into the composition; And it is to provide a human intestinal microbial community simulation culture method comprising the step of culturing the composition.
본 발명의 또 다른 목적은 상기 방법으로 모사 배양된 미생물 군집의 배양물, 상기 배양물의 농축물 및 상기 배양물의 건조물로 이루어진 군으로부터 선택되는 하나 이상을 유효성분으로 포함하는 미생물 제제를 제공하는 것이다.Another object of the present invention is to provide a microbial preparation comprising as an active ingredient at least one selected from the group consisting of a culture of a microbial community simulated by the above method, a concentrate of the culture, and a dried product of the culture.
본 발명의 또 다른 목적은 상기 미생물 제제를 포함하는 염증성 장질환 또는 클로스트리디움 디피실 감염증 예방 또는 치료용 약학적 조성물을 제공하는 것이다.Another object of the present invention is to provide a pharmaceutical composition for preventing or treating inflammatory bowel disease or Clostridium difficile infection comprising the microbial preparation.
본 발명의 또 다른 목적은 상기 약학적 조성물을 대상체에 투여하는 단계를 포함하는 염증성 장질환(Inflammatory Bowel Disease, IBD) 또는 클로스트리디움 디피실 감염증( Clostridioides difficile infection, CDI)의 치료 방법을 제공하는 것이다.Another object of the present invention is to provide a method for treating Inflammatory Bowel Disease (IBD) or Clostridioides difficile infection (CDI) comprising administering the pharmaceutical composition to a subject. will be.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems that are not mentioned will be clearly understood by those skilled in the art from the following description.
본 발명의 일 양상은 인간 장내 미생물 군집 모사 배양용 조성물에 있어서, 상기 조성물은 혐기성인 것인 인간 장내 미생물 군집 모사 배양용 조성물을 제공한다.One aspect of the present invention provides a composition for cultivating a human intestinal microbial community, wherein the composition is anaerobic.
본 발명의 일 구체예에 따르면, 상기 조성물은 소 뇌 추출물(Calf Brains, infusion), 소 심장 추출물(Beef Heart, infusion) 및 프로테오스 펩톤(Proteose peptone)으로 이루어진 군으로부터 선택되는 하나 이상의 성분을 더 포함할 수 있다.According to an embodiment of the present invention, the composition comprises at least one component selected from the group consisting of a cow brain extract (Calf Brains, infusion), a cow heart extract (Beef Heart, infusion), and a proteose peptone. It may contain more.
본 발명의 일 구체예에 따르면, 상기 조성물은 수용성 녹말(Soluble starch), 피루브산 나트륨(Sodium pyruvate) 및 L-아르기닌(L-Arginine)으로 이루어진 군으로부터 선택되는 하나 이상의 성분을 더 포함할 수 있다.According to one embodiment of the present invention, the composition may further include one or more components selected from the group consisting of water-soluble starch, sodium pyruvate, and L-arginine.
본 발명의 일 구체예에 따르면, 상기 조성물은 카제인의 췌장 소화물(Pancreatic digest of casein) 및 콩의 파파인 소화물(Papaic digest of soybean)로 이루어진 군으로부터 선택되는 하나 이상의 성분을 더 포함할 수 있다.According to one embodiment of the present invention, the composition may further include one or more components selected from the group consisting of Pancreatic digest of casein and Papain digest of soybean.
본 발명의 일 구체예에 따르면, 상기 조성물의 pH는 7.2 내지 7.4일 수 있다.According to an embodiment of the present invention, the pH of the composition may be 7.2 to 7.4.
본 발명의 다른 양상은 피험체의 대변으로부터 미생물 군집 현탁액을 준비하는 단계; 상기 현탁액을 상기 조성물에 접종하는 단계; 및 상기 조성물을 배양하는 단계를 포함하는 인간 장내 미생물 군집 모사 배양 방법을 제공한다.Another aspect of the present invention comprises the steps of preparing a microbial community suspension from feces of a subject; Inoculating the suspension into the composition; And it provides a human intestinal microbial community simulation culture method comprising the step of culturing the composition.
본 발명의 일 구체예에 따르면, 상기 배양하는 단계는 혐기성 조건에서 이루어질 수 있다.According to an embodiment of the present invention, the step of culturing may be performed under anaerobic conditions.
본 발명의 일 구체예에 따르면, 상기 시료를 준비하는 단계는 0ppm 내지 40ppm의 산소 조건에서 이루어질 수 있다.According to an embodiment of the present invention, the step of preparing the sample may be performed under oxygen conditions of 0 ppm to 40 ppm.
본 발명의 일 구체예에 따르면, 상기 배양하는 단계는 24시간 내지 120시간 동안 이루어질 수 있다.According to an embodiment of the present invention, the step of culturing may be performed for 24 to 120 hours.
본 발명의 일 구체예에 따르면, 상기 배양하는 단계는 0.1 내지 3.0 기압에서 이루어질 수 있다.According to one embodiment of the present invention, the step of culturing may be performed at 0.1 to 3.0 atmospheres.
본 발명의 일 구체예에 따르면, 상기 미생물은 박테로이데테스 문(Bacteroides phylum), 퍼미큐테스 문(Firmicutes phylum), 프로테오박테리아 문(Proteobacteria phylum) 및 액티노박테리아 문(Actinobacteria phylum)으로 이루어지는 군으로부터 선택되는 하나 이상의 미생물 문일 수 있다.According to an embodiment of the present invention, the microorganism is made of Bacteroides phylum, Firmicutes phylum, Proteobacteria phylum, and Actinobacteria phylum. It may be one or more microbial phylogenies selected from the group.
본 발명의 또 다른 양상은 상기 방법으로 모사 배양된 미생물 군집의 배양물, 상기 배양물의 농축물 및 상기 배양물의 건조물로 이루어진 군으로부터 선택되는 하나 이상을 유효성분으로 포함하는 미생물 제제를 제공한다.Another aspect of the present invention provides a microbial preparation comprising as an active ingredient at least one selected from the group consisting of a culture of a microbial community simulated by the above method, a concentrate of the culture, and a dried product of the culture.
본 발명의 또 다른 양상은 상기 미생물 제제를 포함하는 염증성 장질환(Inflammatory Bowel Disease, IBD) 또는 클로스트리디움 디피실 감염증( Clostridioides difficile infection, CDI) 예방 또는 치료용 약학적 조성물을 제공한다.Another aspect of the present invention provides a pharmaceutical composition for preventing or treating inflammatory bowel disease (IBD) or Clostridioides difficile infection (CDI) comprising the microbial preparation.
본 발명의 일 구체예에 따르면, 상기 염증성 장질환은 궤양성 대장염(Ulcerative Colitis, UC) 또는 크론병(Crohn's Disease, CD)일 수 있다.According to one embodiment of the present invention, the inflammatory bowel disease may be Ulcerative Colitis (UC) or Crohn's Disease (CD).
본 발명의 일 구체예에 따르면, 클로스트리디움 디피실 감염증은 재발성 클로스트리디움 디피실 감염증(recurrent Clostridioides difficile infection) 또는 난치성 클로스트리디움 디피실 감염증(refractory Clostridioides difficile infection)일 수 있다.According to one embodiment of the present invention, the Clostridium difficile infection may be a recurrent Clostridioides difficile infection or a refractory Clostridioides difficile infection.
본 발명의 또 다른 양상은 상기 약학적 조성물을 대상체에 투여하는 단계를 포함하는 염증성 장질환(Inflammatory Bowel Disease, IBD) 또는 클로스트리디움 디피실 감염증( Clostridioides difficile infection, CDI)의 치료 방법을 제공한다.Another aspect of the present invention provides a method for treating Inflammatory Bowel Disease (IBD) or Clostridioides difficile infection (CDI) comprising administering the pharmaceutical composition to a subject. .
본 발명의 일 구체예에 따르면, 상기 염증성 장질환은 궤양성 대장염(Ulcerative Colitis, UC) 또는 크론병(Crohn's Disease, CD)일 수 있다.According to one embodiment of the present invention, the inflammatory bowel disease may be Ulcerative Colitis (UC) or Crohn's Disease (CD).
본 발명의 일 구체예에 따르면, 클로스트리디움 디피실 감염증은 재발성 클로스트리디움 디피실 감염증(recurrent Clostridioides difficile infection) 또는 난치성 클로스트리디움 According to an embodiment of the present invention, the Clostridium difficile infection is a recurrent Clostridioides difficile infection or a refractory Clostridium.
인간 장내 미생물 군집 모사 배양용 조성물, 혐기 배양 체계를 이용한 인간 장내 미생물 군집의 모사 배양 방법, 이에 의해 제조된 미생물 제제 및 이의 용도에 따르면, 본 발명의 방법에 따라 수득된 미생물 군집은 정상 집단의 대변에 포함된 장내 미생물과 유사한 효능을 나타내므로, 장내 미생물 개선, 기능성 식품 및 화장품의 제조 등 다양한 분야에 효과적으로 활용될 수 있다. According to the composition for replicating human intestinal microbial community, the method for replicating human intestinal microbial community using an anaerobic culture system, the microbial preparation prepared thereby, and its use, the microbial community obtained according to the method of the present invention is the stool of a normal population. Since it exhibits similar efficacy to the intestinal microorganisms contained in, it can be effectively used in various fields such as improving intestinal microorganisms and manufacturing functional foods and cosmetics.
도 1은 본 발명의 인간 장내 미생물 군집의 혐기적 모사 배양 방법을 나타낸 모식도이다.1 is a schematic diagram showing the anaerobic simulation culture method of the human intestinal microbial community of the present invention.
도 2는 본 발명에서 모사 배양을 위해 모집된 98명의 공여자군의 평균(Mean of healthy) 및 최종적으로 선택된 공여자의 원 대변(original stool)에 포함된 미생물 문(phylum)의 상대적 분포도(relative abundance)를 나타낸 그래프이다.Figure 2 is a mean (Mean of healthy) of 98 donors recruited for the simulated culture in the present invention and the relative distribution of the microbial phylum contained in the original stool of the finally selected donor (relative abundance) It is a graph showing.
도 3은 인간 유래 장내 미생물 군집을 본 발명의 일 구체예에 따른 BHI(brain heart infusion), FAB(fastidious anaerobe broth), RCM(reinforces Clostridial media), SAM(Schaedler anaerobe media) 또는 TSB(tryptic soy broth) 배지에서 72시간 동안 배양한 후의 미생물 문(phylum)에서의 상대적 풍부도(relative abundance)를 나타낸 그래프이다.Figure 3 is a human-derived intestinal microbial community according to an embodiment of the present invention BHI (brain heart infusion), FAB (fastidious anaerobe broth), RCM (reinforces Clostridial media), SAM (Schaedler anaerobe media) or TSB (tryptic soy broth ) It is a graph showing the relative abundance in the microbial phylum after culturing in a medium for 72 hours.
도 4는 BHI 배지에서 인간 유래 장내 미생물 군집의 모사 배양 (a) 전 및 (b) 후 배지의 외관을 나타낸 사진이다.4 is a photograph showing the appearance of the medium before (a) and after (b) simulated culture of human-derived intestinal microbial communities in BHI medium.
도 5는 BHI 배지에서 인간 유래 장내 미생물 군집의 모사 배양 (a) 전 및 (b) 후 배지의 현미경 사진이다.5 is a micrograph of a medium before (a) and (b) after simulated culture of human-derived intestinal microbial communities in BHI medium.
도 6은 5개의 혐기배양 배지(BHI, FAB, RCM, SAM, TSB)에서 각각 모사 배양된 인간 유래 장내 미생물 군집의 (a) 시간에 따른 생장 곡선(growth curve) 및 (b) 배양 72시간 후의 각 배지 별 미생물의 양을 나타낸 그래프이다.Figure 6 is a human-derived intestinal microbial community simulated in five anaerobic culture media (BHI, FAB, RCM, SAM, TSB), respectively (a) growth curve over time and (b) 72 hours after culture It is a graph showing the amount of microorganisms for each medium.
도 7은 본 발명의 일 구체예에 따른 방법에 의해 수득된 모사 배양된 건강인 유래의 장내 미생물 군집을 함유하는 미생물 제제로 제형화한 사진이다.7 is a photograph formulated with a microbial preparation containing an intestinal microbial community derived from a simulated healthy person obtained by a method according to an embodiment of the present invention.
도 8은 (a) BHI, (b) FAB, (c) RCM, (d) SAM 및 (e) TSB 배지에서, 인간 유래 장내 미생물 군집의 배양 시간에 따른 군집의 상대적 풍부도의 변화를 나타낸 그래프이다.Figure 8 is a graph showing the change in the relative abundance of the human-derived intestinal microbial community according to culture time in (a) BHI, (b) FAB, (c) RCM, (d) SAM and (e) TSB medium to be.
도 9는 5개의 혐기 배지(BHI, FAB, RCM, SAM, TSB)에서 72시간 동안 모사 배양된 인간 유래 장내 미생물 군집에 대한 (a) 샤넌 지수(Shannon's index) 및 (b) 관측된 종(observed species)을 나타낸 그래프이다(ns: non-significant, * p < 0.05, ** p < 0.01, *** p < 0.005, 및 **** p < 0.0001).9 shows (a) Shannon's index and (b) observed species for human-derived intestinal microbial communities simulated for 72 hours in five anaerobic media (BHI, FAB, RCM, SAM, TSB). species) (ns: non-significant, * p <0.05, ** p <0.01, *** p <0.005, and **** p <0.0001).
도 10은 (a) 5개의 혐기 배지에서 배양된 시료들의 전체적인 분포 및 (b) 각 배지에서 배양된 시료들의 전체적인 분포를 궤양성 대장염(UC) 환자 및 재발성 CDI 환자의 12개 샘들과 함께 주성분 분석(principal coordinates analysis, PCoA) 2차원 좌표상에 나타낸 그래프 및 (c) 원 대변의 weighted UniFrac 생태학적 거리를 배지별로 나타낸 그래프이다.Figure 10 shows (a) the overall distribution of samples cultured in five anaerobic media and (b) the overall distribution of samples cultured in each media, along with 12 glands of ulcerative colitis (UC) patients and recurrent CDI patients. Analysis (principal coordinates analysis, PCoA) is a graph showing two-dimensional coordinates and (c) a graph showing the weighted UniFrac ecological distance of the original stool by medium.
도 11은 BHI 배지에서 72시간 배양된 인간 유래 장내 미생물 군집을 동일한 조성의 새로운 배지에 재접종하여 연속 계대 배양한 미생물 군집의 전체적인 분포를 주성분 분석 2차원 좌표상에 나타낸 그래프이다.FIG. 11 is a graph showing the overall distribution of microbial communities that were serially subcultured by re-inoculating human-derived intestinal microbial communities cultured in BHI medium for 72 hours in a new medium of the same composition on two-dimensional coordinates for principal component analysis.
도 12는 실험쥐의 (a) 결장(colon) 사진, (b) 결장의 길이 및 (c) 장내 투과도(permeability)를 나타낸 그래프, (d) 비장(spleen) 사진, 및 (e) 비장의 무게를 나타낸 그래프이다.Figure 12 is a (a) colon (colon) photograph, (b) the length of the colon and (c) a graph showing the permeability of the intestine, (d) a picture of the spleen, and (e) the weight of the spleen It is a graph showing.
도 13은 무처리군 실험쥐(Untreated) 및 염증성 장질환이 유도된 실험쥐(DSS)의 (a) TNFα, (b) IL-1β, (c) IFNγ, (d) IL-4, (e) IL-6, (f) IL-10, (g) IL-12 및 (h) IL-17 사이토카인 발현량을 나타낸 그래프이다(ns: non-significant, * p < 0.05, ** p < 0.01, *** p < 0.005, 및 **** p < 0.0001).13 shows (a) TNFα, (b) IL-1β, (c) IFNγ, (d) IL-4, (e) of untreated group mice (Untreated) and inflammatory bowel disease-induced mice (DSS). ) IL-6, (f) IL-10, (g) IL-12 and (h) IL-17 is a graph showing the cytokine expression levels (ns: non-significant, * p <0.05, ** p <0.01 , *** p <0.005, and **** p <0.0001).
도 14는 (a) 15일간의 무처리군(Untreated), DSS처리군(DSS), 일반 실험쥐의 대변을 투여 받은 군(nFMT), 본 발명의 일 구체예에 따른 건강인 대변을 투여 받은 군(hFMT), 본 발명의 일 구체에에 따른 방법으로 모사 배양된 건강인 유래의 장내 미생물 군집을 투여 받은 군(cFMT)의 15일 동안의 체중 변화(body weight)를 나타낸 그래프, (b) 실험 종료 시점(15일차)에서 각 실험군 별 실험쥐들의 체중을 비교한 그래프(ns: non-significant, * p < 0.05, ** p < 0.01, *** p < 0.005, 및 **** p < 0.0001), 및 (c) 실험쥐들의 결장 조직을 헤마톡실린과 에오신 염색(hematoxylin and eosin staining, H&E staining)하여 조직병리학적 소견(검은색 화살표: 정상 및 회복 중인 조직, 붉은색 화살표: 염증 및 손상된 조직)을 관찰한 현미경 사진이다.14 shows (a) 15 days of untreated group (Untreated), DSS-treated group (DSS), group that received stool from general mice (nFMT), and received stool from healthy people according to an embodiment of the present invention. Group (hFMT), a graph showing the body weight for 15 days of the group (cFMT) receiving the intestinal microbial community derived from a healthy person simulated and cultured by the method according to an embodiment of the present invention for 15 days, (b) A graph comparing the weights of the mice for each experimental group at the end of the experiment (day 15) (ns: non-significant, * p <0.05, ** p <0.01, *** p <0.005, and **** p <0.0001), and (c) histopathological findings (black arrow: normal and recovering tissue, red arrow: inflammation) by staining colon tissues of mice with hematoxylin and eosin staining (H&E) And damaged tissue) is observed.
도 15는 염증성 장질환이 유도된 실험쥐에 본 발명의 일 구체예에 따른 방법으로 모사 배양된 건강인 유래의 장내 미생물 군집을 투여한 후, (a) TNFα, (b) IL-1β, (c) IFNγ, (d) IL-4, (e) IL-6, (f) IL-10, (g) IL-12, 및 (h) IL-17 사이토카인 발현량을 나타낸 그래프이다(ns: non-significant, * p < 0.05, ** p < 0.01, *** p < 0.005, 및 **** p < 0.0001).Figure 15 is after administering the intestinal microbial community derived from a healthy person simulated and cultured by the method according to an embodiment of the present invention to the experimental mice induced with inflammatory bowel disease, (a) TNFα, (b) IL-1β, ( c) IFNγ, (d) IL-4, (e) IL-6, (f) IL-10, (g) IL-12, and (h) IL-17 is a graph showing the expression level of cytokine (ns: non-significant, * p <0.05, ** p <0.01, *** p <0.005, and **** p <0.0001).
도 16은 본 발명의 일 구체예에 따른 방법으로 모사 배양된 장내 미생물 군집을 투여한 후, 실험쥐의 장내에서 발견된 (a) 비피도박테리아시아(Bifidobacteriaceae) 및 (b) 아커멘시아시아(Akkermensiaceae) 과(family) 미생물을 나타낸 그래프이다.FIG. 16 shows (a) Bifidobacteriaceae and (b) Akermensi Asia (Bifidobacteriaceae) found in the intestine of mice after administration of a population of intestinal microorganisms simulated by a method according to an embodiment of the present invention. Akkermensiaceae) is a graph showing the family (family) microorganisms.
본 발명의 일 양상은 인간 장내 미생물 군집 모사 배양용 조성물에 있어서, 상기 조성물은 혐기성인 것인 인간 장내 미생물 군집 모사 배양용 조성물을 제공한다.One aspect of the present invention provides a composition for cultivating a human intestinal microbial community, wherein the composition is anaerobic.
본 발명에서 사용되는 용어, "미생물 군집(microbiota)"은 특정 환경, 특히 신체에 존재하고 있는 미생물들의 무리를 말한다. 신체의 부위에 따라 존재하는 미생물 군집의 구성이 다양하게 나타날 수 있다. 미생물 군집은 비교적 균형을 이루며 안정적으로 유지되나, 음식물 섭취, 생활방식, 위생상태, 약물복용 등 외부적 요인에 따라 군집을 이루는 미생물의 비율이 달라질 수 있으며, 이와 같은 외부적 요인에 의한 인체 미생물 군집 균형의 파괴에 의하여 질병이 유발될 수 있다.The term "microbiota" as used in the present invention refers to a group of microorganisms existing in a specific environment, particularly a body. Depending on the part of the body, the composition of the microbial community that exists may vary. The microbial community is relatively balanced and maintained stably, but the proportion of microbes that form the community may vary depending on external factors such as food intake, lifestyle, hygiene, and drug use, and the human microbial community due to such external factors. Disease can be triggered by disruption of balance.
본 발명의 미생물 군집은 예를 들어, 당업계에서 통상적으로 적용되는 기준을 근거로, 알파 다양성, 베타 다양성 및/또는 상대적 풍부도의 검증에 의하여 정상으로 선별되는 인간 유래 장내 미생물 군집일 수 있다.The microbial community of the present invention may be, for example, a human-derived intestinal microbial community that is normally selected by verification of alpha diversity, beta diversity and/or relative abundance based on criteria commonly applied in the art.
본 발명의 배지는 예를 들어, 소 뇌 추출물(Beef brain infusion), 소의 심장 추출물(beef heart infusion), 프로테오스 펩톤(proteose peptone), 포도당(dextrose), 염화 나트륨(sodium chloride), 인산수소이나트륨(disodium phosphate), 카제인의 췌장소화물(pancreatic digest of casein), 우육추출물(beef extract), 효모추출물 (yeast extract), 펩톤(peptone), 수용성 녹말 (soluble starch), 탄산수소나트륨(sodium bicarbonate), 피루브산 나트륨(sodium pyruvate), L-아르기닌( L-arginine), L-시스테인 염산염( L-cysteine hydrochloride), 피로인산 나트륨(sodium pyrophosphate), 숙신산염(sodium succinate), 헤민 (Hemin), 비타민K (vitamin K), 트리스 하이드록시 메틸아미노메탄 (tris hyroxymethyl aminomethane), 녹말(starch), 아세트산 나트륨(sodium acetate), 황화나트륨(sodium sulfide) 및/또는 레사주린(resazurin)를 유효성분으로 포함할 수 있다.The medium of the present invention is, for example, a cow brain extract (Beef brain infusion), a cow heart extract (beef heart infusion), proteose peptone (proteose peptone), glucose (dextrose), sodium chloride (sodium chloride), hydrogen phosphate. Sodium (disodium phosphate), pancreatic digest of casein, beef extract, yeast extract, peptone, soluble starch, sodium bicarbonate , sodium pyruvate (sodium pyruvate), L - arginine (L -arginine), L - cysteine hydrochloride (L -cysteine hydrochloride), sodium pyrophosphate (sodium pyrophosphate), acid salts (sodium succinate), hemin (hemin), vitamin K (vitamin K), tris hyroxymethyl aminomethane, starch, sodium acetate, sodium sulfide and/or resazurin as active ingredients Can include.
본 발명의 일 구체예에 따르면, 상기 조성물은 소 뇌 추출물(Calf Brains, infusion), 소 심장 추출물(Beef Heart, infusion) 및 프로테오스 펩톤(Proteose peptone)으로 이루어진 군으로부터 선택되는 하나 이상의 성분을 더 포함할 수 있다.According to an embodiment of the present invention, the composition comprises at least one component selected from the group consisting of a cow brain extract (Calf Brains, infusion), a cow heart extract (Beef Heart, infusion), and a proteose peptone. It may contain more.
본 발명의 일 구체예에 따르면, 상기 조성물은 수용성 녹말(Soluble starch), 피루브산 나트륨(Sodium pyruvate) 및 L-아르기닌(L-Arginine)으로 이루어진 군으로부터 선택되는 하나 이상의 성분을 더 포함할 수 있다.According to one embodiment of the present invention, the composition may further include one or more components selected from the group consisting of water-soluble starch, sodium pyruvate, and L-arginine.
본 발명의 일 구체예에 따르면, 상기 조성물은 카제인의 췌장 소화물(Pancreatic digest of casein) 및 콩의 파파인 소화물(Papaic digest of soybean)로 이루어진 군으로부터 선택되는 하나 이상의 성분을 더 포함할 수 있다.According to one embodiment of the present invention, the composition may further include one or more components selected from the group consisting of Pancreatic digest of casein and Papain digest of soybean.
특히, 본 발명의 배지는 소 뇌 추출물, 소 심장 추출물 및 프로테오스 펩톤을 유효성분으로 포함하는 brain-heart infusion media(BHI), 녹말, 피루브산 나트륨 및 L-아르기닌을 유효성분으로 포함하는 fastidious anaerobe broth(FAB), 및 카제인의 췌장 소화물 및 콩의 파파인 소화물을 유효성분으로 포함하는 tryptic soy broth(TSB)인 것이 인간 장내 미생물 군집의 비율을 유지하여 배양하는 모사 배양에 더욱 유용하다.In particular, the medium of the present invention is a fastidious anaerobe comprising a brain-heart infusion media (BHI) containing a bovine brain extract, a bovine heart extract and proteose peptone as an active ingredient, starch, sodium pyruvate and L-arginine as an active ingredient. Broth (FAB), and tryptic soy broth (TSB) containing pancreatic digests of casein and papain digests of soybeans as active ingredients is more useful for simulated culture in which the ratio of human intestinal microbial communities is maintained.
본 발명의 배지는 혐기성 배지로써, 배양 배지 내의 산소 농도는 30 ppm 미만인 것이 인간 장내 미생물 군집의 모사 배양에 특히 유용하다.The medium of the present invention is an anaerobic medium, and an oxygen concentration of less than 30 ppm in the culture medium is particularly useful for simulated culture of human intestinal microbial communities.
본 발명의 일 구체예에 따르면, 본 발명의 배지의 혐기성은 질소(N 2), 수소(H 2), 및 이산화탄소(CO 2)가 100 : 0 : 0 내지 100 : 10 : 10의 부피비로 혼합된 혼합가스에 의한 배지 내 산소의 치환에 의하여 조성될 수 있다. 혼합가스에 의한 배지내 산소의 치환은 배지 부피 1mL를 기준으로 30초 이상이 이루어지는 것이 바람직하며, 가장 바람직하게는 2분일 수 있다. 배지에서 산소를 치환하기 위하여 사용하는 혼합가스는 glass copper column로 가열되어, 180℃ 이상인 것이 바람직하며, 가장 바람직하게는 350℃일 수 있다. 이와 같은 배지 내 산소의 치환에 의하여, 배지내 산소의 농도는 30 ppm 미만인 혐기성으로 조성될 수 있다.According to one embodiment of the present invention, the anaerobicity of the medium of the present invention is nitrogen (N 2 ), hydrogen (H 2 ), and carbon dioxide (CO 2 ) mixed in a volume ratio of 100: 0: 0 to 100: 10: 10 It can be formed by substitution of oxygen in the medium by the mixed gas. Substitution of oxygen in the medium by the mixed gas is preferably 30 seconds or more based on 1 mL of the medium volume, and most preferably 2 minutes. The mixed gas used to replace oxygen in the medium is heated with a glass copper column, and is preferably 180°C or higher, and most preferably 350°C. By such substitution of oxygen in the medium, the concentration of oxygen in the medium may be anaerobic and less than 30 ppm.
본 발명의 일 구체예에 따르면, 배지 내의 기압은 1.5 내지 3.0 기압일 수 있으며, 가장 바람직하게는 2.0 기압일 수 있다.According to one embodiment of the present invention, the atmospheric pressure in the medium may be 1.5 to 3.0 atm, most preferably 2.0 atm.
본 발명의 일 구체예에 따르면 상기 조성물의 pH는 7.2 내지 7.4일 수 있다.According to an embodiment of the present invention, the pH of the composition may be 7.2 to 7.4.
본 발명의 다른 양상은 피험체의 대변으로부터 미생물 군집 현탁액을 준비하는 단계; 상기 현탁액을 상기 조성물에 접종하는 단계; 및 상기 조성물을 배양하는 단계를 포함하는 인간 장내 미생물 군집 모사 배양 방법을 제공한다.Another aspect of the present invention comprises the steps of preparing a microbial community suspension from feces of a subject; Inoculating the suspension into the composition; And it provides a human intestinal microbial community simulation culture method comprising the step of culturing the composition.
본 발명의 첫 번째 단계는 대변으로부터 미생물 군집 현탁액을 준비하는 단계이다.The first step of the present invention is to prepare a microbial community suspension from feces.
본 발명의 모사 배양에 의하여 배양된 장내 미생물 군집 미생물의 개체수는 배양된 전체 미생물 개체수 100을 기준으로 1 내지 30일 수 있고, 배양된 장내 미생물 군집을 이루는 미생물은 표 1과 같은 미생물 과의 조합일 수 있으나, 이에 한정되는 것은 아니다. 또한, 유리고세균(Euryarchaeota) 및/또는 프로테오박테리아(Proteobacteria) 과 균주의 개체수는 본 발명의 모사 배양에 의하여 배양된 장내 미생물 군집 미생물 전체 미생물 개체수 100을 기준으로 0 내지 5인 것이 바람직하다.The population of the intestinal microbial community cultivated by the simulated culture of the present invention may be 1 to 30 based on the total number of cultivated microbes 100, and the microorganisms forming the cultured intestinal microbial community are the combination of microorganisms as shown in Table 1. However, it is not limited thereto. In addition, it is preferable that the population of Euryarchaeota and/or Proteobacteria and strains is 0 to 5 based on 100 of the total number of microorganisms in the intestinal microbial community cultivated by the simulated culture of the present invention.
조합Combination 장내 미생물 군집을 이루는 미생물 과(family)The microbial family that makes up the intestinal microbial community
1One Bacteria, Actinobacteria, Coriobacteria, Coriobacteriales, CoriobacteriaceaeBacteria, Actinobacteria, Coriobacteria, Coriobacteriales, Coriobacteriaceae
22 Bacteria, Actinobacteria, Coriobacteria, Coriobacteriales, EggerthellaceaeBacteria, Actinobacteria, Coriobacteria, Coriobacteriales, Eggerthellaceae
33 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, BacteroidaceaeBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Bacteroidaceae
44 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, BarnesiellaceaeBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Barnesiellaceae
55 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, MarinifilaceaeBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Marinifilaceae
66 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, PrevotellaceaeBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Prevotellaceae
77 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, RikenellaceaeBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Rikenellaceae
88 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, TannerellaceaeBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Tannerellaceae
99 Bacteria, Firmicutes, Bacilli, Bacillales, BacillaceaeBacteria, Firmicutes, Bacilli, Bacillales, Bacillaceae
1010 Bacteria, Firmicutes, Bacilli, Bacillales, StaphylococcaceaeBacteria, Firmicutes, Bacilli, Bacillales, Staphylococcaceae
1111 Bacteria, Firmicutes, Bacilli, Lactobcillales, CarnobacteriaceaeBacteria, Firmicutes, Bacilli, Lactobcillales, Carnobacteriaceae
1212 Bacteria, Firmicutes, Bacilli, Lactobcillales, EnterococcaceaeBacteria, Firmicutes, Bacilli, Lactobcillales, Enterococcaceae
1313 Bacteria, Firmicutes, Bacilli, Lactobcillales, LactobacilliaceaeBacteria, Firmicutes, Bacilli, Lactobcillales, Lactobacilliaceae
1414 Bacteria, Firmicutes, Bacilli, Lactobcillales, StreptococcaceaeBacteria, Firmicutes, Bacilli, Lactobcillales, Streptococcaceae
1515 Bacteria, Firmicutes, Clostridia, Clostridales, ChristensenellaceaeBacteria, Firmicutes, Clostridia, Clostridales, Christensenellaceae
1616 Bacteria, Firmicutes, Clostridia, Clostridales, EubacteriaceaeBacteria, Firmicutes, Clostridia, Clostridales, Eubacteriaceae
1717 Bacteria, Firmicutes, Clostridia, Clostridales, Bacillales Family XIBacteria, Firmicutes, Clostridia, Clostridales, Bacillales Family XI
1818 Bacteria, Firmicutes, Clostridia, Clostridales, LachnospiraceaeBacteria, Firmicutes, Clostridia, Clostridales, Lachnospiraceae
1919 Bacteria, Firmicutes, Clostridia, Clostridales, PeptostreptococcaceaeBacteria, Firmicutes, Clostridia, Clostridales, Peptostreptococcaceae
2020 Bacteria, Firmicutes, Clostridia, Clostridales, RuminococcaceaeBacteria, Firmicutes, Clostridia, Clostridales, Ruminococcaceae
2121 Bacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, ErysipelotrichaceaeBacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, Erysipelotrichaceae
2222 Bacteria, Firmicutes, Negativicutes, Selenomonadales, AcidaminococcaceaeBacteria, Firmicutes, Negativicutes, Selenomonadales, Acidaminococcaceae
2323 Bacteria, Firmicutes, Negativicutes, Selenomonadales, VeillonellaceaeBacteria, Firmicutes, Negativicutes, Selenomonadales, Veillonellaceae
2424 Bacteria, Fusobacteria, Fusobacteriia, Fusobacteriales, Fusobacteriaceae, FusobacteriumBacteria, Fusobacteria, Fusobacteriia, Fusobacteriales, Fusobacteriaceae, Fusobacterium
2525 Bacteria, Proteobacteria, Deltaproteobacteria, DesulfovibrionalesBacteria, Proteobacteria, Deltaproteobacteria, Desulfovibrionales
2626 Bacteria, Proteobacteria, Gammaproteobacteria, Betaproteobacteriales, BurkholderiaceaeBacteria, Proteobacteria, Gammaproteobacteria, Betaproteobacteriales, Burkholderiaceae
2727 Bacteria, Proteobacteria, Gammaproteobacteria, Enterobacteriales, EnterobacteriaceaeBacteria, Proteobacteria, Gammaproteobacteria, Enterobacteriales, Enterobacteriaceae
2828 Bacteria, Proteobacteria, Gammaproteobacteria, Pasteurellales, PasteurellaceaeBacteria, Proteobacteria, Gammaproteobacteria, Pasteurellales, Pasteurellaceae
본 단계에서 사용하는 대변은 분쇄기에 의한 균질화 및 거즈에 의한 고형물의 여과로 전처리된 것일 수 있다. The feces used in this step may be pretreated by homogenization by a grinder and filtration of solids by gauze.
본 단계에서 준비되는 현탁액은 대변의 중량을 기준으로 10배의 완충용액에 재현탁된 것일 수 있다. 이와 같이 준비된 미생물 군집 현탁액은 10 9 cells/g 내지 10 11 cells/g의 미생물을 함유할 수 있고, 바람직하게는 10 10 cells/mL의 미생물을 함유할 수 있다.The suspension prepared in this step may be resuspended in a buffer solution of 10 times the weight of feces. The microbial community suspension prepared as described above may contain 10 9 cells/g to 10 11 cells/g of microorganisms, and preferably 10 10 cells/mL of microorganisms.
현탁액을 준비하는데 사용될 수 있는 완충용액은 예를 들어, 식염수, 인산완충생리식염수(phosphate buffered saline, PBS), 글리세린(glycerol), 또는 이들을 혼합하여 제조한 용액일 수 있고, 바람직하게는 20%(v/v) 글리세린을 0.85(w/v)% 농도로 함유하는 식염수일 수 있다.The buffer solution that can be used to prepare the suspension may be, for example, saline, phosphate buffered saline (PBS), glycerol, or a solution prepared by mixing them, preferably 20% ( v/v) It may be a saline solution containing glycerin at a concentration of 0.85 (w/v)%.
본 발명의 두 번째 단계는 상기 현탁액을 상기 조성물에 접종하는 단계이다.The second step of the present invention is the step of inoculating the suspension into the composition.
본 발명의 일 구체예에 따르면, 상기 배양하는 단계는 혐기성 조건에서 이루어질 수 있다.According to an embodiment of the present invention, the step of culturing may be performed under anaerobic conditions.
본 발명의 일 구체예에 따르면, 상기 시료를 준비하는 단계는 0ppm 내지 40ppm의 산소 조건에서 이루어질 수 있다.According to an embodiment of the present invention, the step of preparing the sample may be performed under oxygen conditions of 0 ppm to 40 ppm.
첫 번째 및 두 번째 단계가 수행되는 공간의 수소(hydrogen)는 10000ppm 내지 50000ppm 농도인 것이 바람직하며, 가장 바람직하게는 18000ppm 농도일 수 있다. 첫 번째 및 두 번째 단계가 수행되는 공간의 산소(oxygen) 농도는 0ppm 내지 100ppm인 것이 바람직하며, 가장 바람직하게는 0ppm 내지 30ppm일 수 있다. 현탁액은 외부 대기로부터 완전히 격리되는 것이 바람직하며, 예를 들어, 알루미늄 캡(cap) 및 오픈 캡(open cap)과 브로모부틸고무(bromo-butyl rubber)의 사용에 의하여 외부 대기 유입이 완전히 차단될 수 있다. The hydrogen in the space in which the first and second steps are performed is preferably in a concentration of 10000 ppm to 50000 ppm, and most preferably in a concentration of 18000 ppm. The oxygen concentration in the space in which the first and second steps are performed is preferably 0 ppm to 100 ppm, and most preferably 0 ppm to 30 ppm. It is desirable that the suspension is completely isolated from the outside atmosphere, for example, the use of aluminum caps and open caps and bromo-butyl rubber to completely block the inflow of the outside atmosphere. I can.
현탁액의 접종 부피는 인간 장내 미생물 군집 모사 배양용 조성물의 부피 100을 기준으로 0.1 내지 30인 것이 바람직하며, 가장 바람직하게는 1일 수 있다. The inoculation volume of the suspension is preferably 0.1 to 30, and most preferably 1, based on the volume 100 of the composition for culturing human intestinal microbial populations.
본 발명의 마지막 단계는 상기 조성물을 배양하는 단계이다.The final step of the present invention is the step of culturing the composition.
미생물 군집 현탁액이 접종된 조성물의 배양은 30℃ 내지 37℃에서 이루어질 수 있고, 바람직하게는 36.5℃에서 이루어질 수 있다. 배양시, 미생물 군집 현탁액이 접종된 조성물을 교반할 수 있다. 예를 들어, 배양기의 분당회전속도(rpm)는 80rpm 내지 250rpm일 수 있고, 보다 바람직하게는 180rpm일 수 있으나, 이에 한정되는 것은 아니다. The cultivation of the composition inoculated with the microbial community suspension may be performed at 30°C to 37°C, preferably at 36.5°C. During cultivation, the composition inoculated with the microbial community suspension may be stirred. For example, the rotational speed per minute (rpm) of the incubator may be 80 rpm to 250 rpm, more preferably 180 rpm, but is not limited thereto.
본 발명의 일 구체예에 따르면, 상기 배양하는 단계는 24시간 내지 120시간 동안 이루어질 수 있다.According to an embodiment of the present invention, the step of culturing may be performed for 24 to 120 hours.
미생물 군집 현탁액이 접종된 조성물의 배양은 24시간 내지 120시간 동안 이루어질 수 있고, 바람직하게는 72시간 동안 이루어질 수 있다.Cultivation of the composition inoculated with the microbial community suspension may be performed for 24 to 120 hours, and preferably for 72 hours.
본 발명의 일 구체예에 따르면, 상기 미생물은 박테로이데테스 문(Bacteroides phylum), 퍼미큐테스 문(Firmicutes phylum), 프로테오박테리아 문(Proteobacteria phylum) 및 액티노박테리아 문(Actinobacteria phylum)으로 이루어지는 군으로부터 선택되는 하나 이상의 미생물 문일 수 있다.According to an embodiment of the present invention, the microorganism is made of Bacteroides phylum, Firmicutes phylum, Proteobacteria phylum, and Actinobacteria phylum. It may be one or more microbial phylogenies selected from the group.
본 발명의 배양 방법에 의하여 인간 장내 미생물 군집 중, 특히 박테로이데테스 문, 퍼미큐테스 문, 프로테오박테리아 문 및 액티노박테리아 문의 비율을 유지하며 배양할 수 있으므로, 유용한 인간 장내 미생물 군집을 대량으로 배양하는데 유용하게 활용할 수 있다.By the cultivation method of the present invention, it is possible to cultivate while maintaining the proportion of human intestinal microbial communities, especially Bacteroidetes, Permicutes, Proteobacteria and Actinobacteria, so that a large amount of useful human intestinal microbial communities It can be usefully used for cultivation.
본 발명의 또 다른 양상은 상기 방법으로 모사 배양된 미생물 군집의 배양물, 상기 배양물의 농축물 및 상기 배양물의 건조물로 이루어진 군으로부터 선택되는 하나 이상을 유효성분으로 포함하는 미생물 제제를 제공한다.Another aspect of the present invention provides a microbial preparation comprising as an active ingredient at least one selected from the group consisting of a culture of a microbial community simulated by the above method, a concentrate of the culture, and a dried product of the culture.
본 발명의 미생물 군집은 예를 들어, 당업계에서 통상적으로 적용되는 기준을 근거로, 알파 다양성, 베타 다양성 및/또는 상대적 풍부도의 검증에 의하여 정상으로 선별되는 인간 유래 장내 미생물 군집일 수 있다.The microbial community of the present invention may be, for example, a human-derived intestinal microbial community that is normally selected by verification of alpha diversity, beta diversity and/or relative abundance based on criteria commonly applied in the art.
본 발명의 일 구체예에 따른 미생물 군집 현탁액은 박테로이데테스 문, 퍼미큐테스 문, 프로테오박테리아 문 및 액티노박테리아 문에 해당하는 각 미생물 문에 대항하는 미생물을 포함할 수 있다. 각 문에 대한 하위 미생물 과(family) 및 각 과에 해당하는 미생물의 현탁액 내 함유 비율은 하기 표 2와 같다.The microbial colony suspension according to an embodiment of the present invention may contain microorganisms against each of the microbial phylums corresponding to the bacterioidetes phylum, the Permicutes phylum, the proteobacteria phylum, and the actinobacteria phylum. The sub-microbial families for each phylum and the proportions of the microorganisms corresponding to each family in the suspension are shown in Table 2 below.
미생물 문(Phylum)Microbial Phylum 미생물 과(Family)Microbial Family 전체 미생물 개체수대비 비율(%)Ratio of total microbial population (%)
문door 과and
ActinobacteriaActinobacteria ActinomycetaceaeActinomycetaceae 2.5 내지 102.5 to 10 0 내지 0.030 to 0.03
BifidobacteriaceaeBifidobacteriaceae 2 내지 52 to 5
CoriobacteriaceaeCoriobacteriaceae 0.1 내지 1.50.1 to 1.5
Coriobacteriales Incertae Sedis Coriobacteriales Incertae Sedis 0 내지 0.0550 to 0.055
EggerthellaceaeEggerthellaceae 0.1 내지 10.1 to 1
Bacteroidetes Bacteroidetes BacteroidaceaeBacteroidaceae 15 내지 2515 to 25 12 내지 2012 to 20
Barnesiellaceae Barnesiellaceae 0 내지 0.370 to 0.37
MarinifilaceaeMarinifilaceae 0 내지 0.070 to 0.07
PrevotellaceaePrevotellaceae 0 내지 1.50 to 1.5
RikenellaceaeRikenellaceae 0 내지 1.50 to 1.5
TannerellaceaeTannerellaceae 0.05 내지 7.50.05 to 7.5
FirmicutesFirmicutes BacillaceaeBacillaceae 65 내지 7565 to 75 0 내지 0.010 to 0.01
Bacillales Family XI Bacillales Family XI 0 내지 0.010 to 0.01
CarnobacteriaceaeCarnobacteriaceae 0 내지 0.030 to 0.03
EnterococcaceaeEnterococcaceae 1 내지 41 to 4
Lactobacillaceae Lactobacillaceae 0 내지 50 to 5
Leuconostocaceae Leuconostocaceae 0 내지 0.20 to 0.2
Lactobacillales P5D1-392Lactobacillales P5D1-392 0 내지 0.030 to 0.03
ChristensenellaceaeChristensenellaceae 0 내지 0.50 to 0.5
Clostridiaceae 1Clostridiaceae 1 0.5 내지 150.5 to 15
EubacteriaceaeEubacteriaceae 0.1 내지 1.50.1 to 1.5
Clostridiales Family XI Clostridiales Family XI 0 내지 20 to 2
Clostridiales Family XIII Clostridiales Family XIII 0 내지 0.30 to 0.3
LachnospiraceaeLachnospiraceae 18 내지 2318 to 23
PeptostreptococcaceaePeptostreptococcaceae 0.3 내지 0.80.3 to 0.8
RuminococcaceaeRuminococcaceae 4 내지 8.54 to 8.5
ErysipelotrichaceaeErysipelotrichaceae 0.5 내지 10.5 to 1
Acidaminococcaceae Acidaminococcaceae 0 내지 0.90 to 0.9
VeillonellaceaeVeillonellaceae 5 내지 125 to 12
Fusobacteria Fusobacteria FusobacteriaceaeFusobacteriaceae 0 내지 0.10 to 0.1 0 내지 0.10 to 0.1
ProteobacteriaProteobacteria Rhodospirillales unculturedRhodospirillales uncultured 0 내지 1.50 to 1.5 0 내지 0.40 to 0.4
DesulfovibrionaceaeDesulfovibrionaceae 0 내지 0.350 to 0.35
BurkholderiaceaeBurkholderiaceae 0 내지 0.350 to 0.35
Enterobacteriaceae Enterobacteriaceae 0 내지 10 to 1
　Verrucomicrobia Verrucomicrobia AkkermansiaceaeAkkermansiaceae 0 내지 0.10 to 0.1 0 내지 0.10 to 0.1
본 발명의 일 구체예에 따른 미생물 군집 현탁액에 포함된 각 미생물 군집은 예를 들어, 전체 미생물 개체수 100을 기준으로, 표 3과 같은 비율 및 조합의 미생물 문의 미생물을 포함할 수 있다.Each microbial community included in the microbial community suspension according to an embodiment of the present invention may include, for example, the microbes of the microbial group in the ratio and combination as shown in Table 3 based on the total microbial population 100.
조합Combination 장내 미생물 군집을 이루는 미생물 문(Phylum)Phylum that makes up the intestinal microbial community 비율(전체 미생물 개체수 100 기준)Ratio (based on 100 total microbial population)
1One Bacteria, ActinobacteriaBacteria, Actinobacteria 2.5 - 102.5-10
22 Bacteria, BacteroidetesBacteria, Bacteroidetes 15 - 2515-25
33 Bacteria, FirmicutesBacteria, Firmicutes 65 - 7565-75
44 Bacteria, FusobacteriaBacteria, Fusobacteria 0 - 0.10-0.1
55 Bacteria, ProteobacteriaBacteria, Proteobacteria 0 - 1.50-1.5
66 Bacteria, VerrucomicrobiaBacteria, Verrucomicrobia 0 - 0.10-0.1
본 발명의 일 구체예에 따른 미생물 군집 현탁액에 포함된 각 미생물 군집은 예를 들어, 전체 미생물 개체수 100을 기준으로, 표 4와 같은 비율 및 조합의 미생물 과의 미생물을 포함할 수 있다.Each microbial community included in the microbial community suspension according to an embodiment of the present invention may include, for example, microbes with microbes in the ratio and combination shown in Table 4 based on 100 total microbial populations.
조합Combination 장내 미생물 군집을 이루는 미생물 과(Family)Microbial family that makes up the intestinal microbial community 비율(전체 미생물 개체수 100 기준)Ratio (based on 100 total microbial population)
1One Bacteria, Actinobacteria, Actinomycetales, ActinomycetaceaeBacteria, Actinobacteria, Actinomycetales, Actinomycetaceae 0 - 0.030-0.03
22 Bacteria, Actinobacteria, Bifidobacteriales, BifidobacteriaceaeBacteria, Actinobacteria, Bifidobacteriales, Bifidobacteriaceae 2 - 52-5
33 Bacteria, Actinobacteria, Coriobacteriia, Coriobacteriales, CoriobacteriaceaeBacteria, Actinobacteria, Coriobacteriia, Coriobacteriales, Coriobacteriaceae 0.1 - 1.50.1-1.5
44 Bacteria, Actinobacteria, Coriobacteriia, Coriobacteriales, Coriobacteriales Incertae SedisBacteria, Actinobacteria, Coriobacteriia, Coriobacteriales, Coriobacteriales Incertae Sedis 0 - 0.0550-0.055
55 Bacteria, Actinobacteria, Coriobacteriia, Coriobacteriales, EggerthellaceaeBacteria, Actinobacteria, Coriobacteriia, Coriobacteriales, Eggerthellaceae 0.1 - 10.1-1
66 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, BacteroidaceaeBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Bacteroidaceae 12 - 2012-20
77 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, BarnesiellaceaeBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Barnesiellaceae 0 - 0.370-0.37
88 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, MarinifilaceaeBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Marinifilaceae 0 - 0.070-0.07
99 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, PrevotellaceaeBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Prevotellaceae 0 - 1.50-1.5
1010 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, RikenellaceaeBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Rikenellaceae 0 - 1.50-1.5
1111 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, TannerellaceaeBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Tannerellaceae 0.05 - 7.50.05-7.5
1212 Bacteria, Firmicutes, Bacilli, Bacillales, BacillaceaeBacteria, Firmicutes, Bacilli, Bacillales, Bacillaceae 0 - 0.010-0.01
1313 Bacteria, Firmicutes, Bacilli, Bacillales Family XIBacteria, Firmicutes, Bacilli, Bacillales Family XI 0 - 0.010-0.01
1414 Bacteria, Firmicutes, Bacilli, Lactobacillales, CarnobacteriaceaeBacteria, Firmicutes, Bacilli, Lactobacillales, Carnobacteriaceae 0 - 0.030-0.03
1515 Bacteria, Firmicutes, Bacilli, Lactobacillales, EnterococcaceaeBacteria, Firmicutes, Bacilli, Lactobacillales, Enterococcaceae 1 - 41-4
1616 Bacteria, Firmicutes, Bacilli, Lactobacillales, LactobacillaceaeBacteria, Firmicutes, Bacilli, Lactobacillales, Lactobacillaceae 0 - 50-5
1717 Bacteria, Firmicutes, Bacilli, Lactobacillales, LeuconostocaceaeBacteria, Firmicutes, Bacilli, Lactobacillales, Leuconostocaceae 0 - 0.20-0.2
1818 Bacteria, Firmicutes, Bacilli, Lactobacillales P5D1-392Bacteria, Firmicutes, Bacilli, Lactobacillales P5D1-392 0 - 0.030-0.03
1919 Bacteria, Firmicutes, Clostridia, Clostridiales, ChristensenellaceaeBacteria, Firmicutes, Clostridia, Clostridiales, Christensenellaceae 0 - 0.50-0.5
2020 Bacteria, Firmicutes, Clostridia, Clostridiales, Clostridiaceae 1Bacteria, Firmicutes, Clostridia, Clostridiales, Clostridiaceae 1 0.5 - 150.5-15
2121 Bacteria, Firmicutes, Clostridia, Clostridiales, EubacteriaceaeBacteria, Firmicutes, Clostridia, Clostridiales, Eubacteriaceae 0.1 - 1.50.1-1.5
2222 Bacteria, Firmicutes, Clostridia, Clostridiales Family XIBacteria, Firmicutes, Clostridia, Clostridiales Family XI 0 - 2.00-2.0
2323 Bacteria, Firmicutes, Clostridia, Clostridiales Family XIIIBacteria, Firmicutes, Clostridia, Clostridiales Family XIII 0 - 0.30-0.3
2424 Bacteria, Firmicutes, Clostridia, Clostridiales, LachnospiraceaeBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae 18 - 2318-23
2525 Bacteria, Firmicutes, Clostridia, Clostridiales, PeptostreptococcaceaeBacteria, Firmicutes, Clostridia, Clostridiales, Peptostreptococcaceae 0 - 0.80-0.8
2626 Bacteria, Firmicutes, Clostridia, Clostridiales, RuminococcaceaeBacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae 4 - 8.54-8.5
2727 Bacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, ErysipelotrichaceaeBacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, Erysipelotrichaceae 0.5 - 10.5-1
2828 Bacteria, Firmicutes, Negativicutes, Selenomonadales, AcidaminococcaceaeBacteria, Firmicutes, Negativicutes, Selenomonadales, Acidaminococcaceae 0 - 0.90-0.9
2929 Bacteria, Firmicutes, Negativicutes, Selenomonadales, VeillonellaceaeBacteria, Firmicutes, Negativicutes, Selenomonadales, Veillonellaceae 5 - 125-12
3030 Bacteria, Fusobacteria, Fusobacteriales, FusobacteriaceaeBacteria, Fusobacteria, Fusobacteriales, Fusobacteriaceae 0 - 0.10-0.1
3131 Bacteria, Proteobacteria, Alphaproteobacteria, Rhodospirillales unculturedBacteria, Proteobacteria, Alphaproteobacteria, Rhodospirillales uncultured 0 - 0.40-0.4
3232 Bacteria, Proteobacteria, Deltaproteobacteria, Desulfovibrionales, DesulfovibrionaceaeBacteria, Proteobacteria, Deltaproteobacteria, Desulfovibrionales, Desulfovibrionaceae 0 - 0.350-0.35
3333 Bacteria, Proteobacteria, Gammaproteobacteria, Betaproteobacteriales, BurkholderiaceaeBacteria, Proteobacteria, Gammaproteobacteria, Betaproteobacteriales, Burkholderiaceae 0 - 0.350-0.35
3434 Bacteria, Proteobacteria, Gammaproteobacteria, Enterobacteriales, EnterobacteriaceaeBacteria, Proteobacteria, Gammaproteobacteria, Enterobacteriales, Enterobacteriaceae 0 - 10-1
3535 Bacteria, Verrucomicrobia, Verrucomicrobiae, Verrucomicrobiales, AkkermansiaceaeBacteria, Verrucomicrobia, Verrucomicrobiae, Verrucomicrobiales, Akkermansiaceae 0 - 0.10-0.1
본 발명의 일 구체예에 따른 미생물 군집 현탁액에 포함된 각 미생물 군집은 예를 들어, 전체 미생물 개체수 100을 기준으로, 표 5와 같은 비율 및 조합의 미생물 속의 미생물을 포함할 수 있다.Each microbial community included in the microbial community suspension according to an embodiment of the present invention may include microbes in microbes in the ratio and combination as shown in Table 5, for example, based on 100 total microbial populations.
조합Combination 장내 미생물 군집을 이루는 미생물 속(genus)The genus of microorganisms that make up the intestinal microbial community 비율(전체 미생물 개체수 100 기준)Ratio (based on 100 total microbial population)
1One Bacteria, Actinobacteria, Bifidobacteriales, Bfidobacteriaceae, BifidobacteriumBacteria, Actinobacteria, Bifidobacteriales, Bfidobacteriaceae, Bifidobacterium 2 - 52-5
22 Bacteria, Actinobacteria, Coriobacteriia, Coriobacteriales, Coriobacteriaceae, CollinsellaBacteria, Actinobacteria, Coriobacteriia, Coriobacteriales, Coriobacteriaceae, Collinsella 0.2 - 1.50.2-1.5
33 Bacteria, Actinobacteria, Coriobacteriia, Coriobacteriales, Coriobacteriales Incertae Sedis, RaoultibacterBacteria, Actinobacteria, Coriobacteriia, Coriobacteriales, Coriobacteriales Incertae Sedis, Raoultibacter 0 - 0.0450-0.045
44 Bacteria, Actinobacteria, Coriobacteriia, Coriobacteriales, Eggerthellaceae, EggerthellaBacteria, Actinobacteria, Coriobacteriia, Coriobacteriales, Eggerthellaceae, Eggerthella 0.1 - 10.1-1
55 Bacteria, Actinobacteria, Coriobacteriia, Coriobacteriales, Eggerthellaceae, EnterorhabdusBacteria, Actinobacteria, Coriobacteriia, Coriobacteriales, Eggerthellaceae, Enterorhabdus 0 - 0.020-0.02
66 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Bacteroidaceae, BacteroidesBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Bacteroidaceae, Bacteroides 12 - 2012-20
77 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Barnesiellaceae, BarnesiellaBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Barnesiellaceae, Barnesiella 0 - 0.040-0.04
88 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Barnesiellaceae, CoprobacterBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Barnesiellaceae, Coprobacter 0 - 0.020-0.02
99 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Marinifilaceae, OdoribacterBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Marinifilaceae, Odoribacter 0 - 0.050-0.05
1010 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Prevotellaceae, ParaprevotellaBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Prevotellaceae, Paraprevotella 0 - 0.010-0.01
1111 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Rikenellaceae, AlistipesBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Rikenellaceae, Alistipes 0 - 0.20-0.2
1212 Bacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Tannerellaceae, ParabacteroidesBacteria, Bacteroidetes, Bacteroidia, Bacteroidales, Tannerellaceae, Parabacteroides 6 - 7.56-7.5
1313 Bacteria, Firmicutes, Bacilli, Bacillales, Bacillaceae, BacillusBacteria, Firmicutes, Bacilli, Bacillales, Bacillaceae, Bacillus 0 - 0.010-0.01
1414 Bacteria, Firmicutes, Bacilli, Lactobacillales, Carnobacteriaceae, GranulicatellaBacteria, Firmicutes, Bacilli, Lactobacillales, Carnobacteriaceae, Granulicatella 0 - 0.030-0.03
1515 Bacteria, Firmicutes, Bacilli, Lactobacillales, Enterococcaceae, EnterococcusBacteria, Firmicutes, Bacilli, Lactobacillales, Enterococcaceae, Enterococcus 1 - 41-4
1616 Bacteria, Firmicutes, Bacilli, Lactobacillales P5D1-392, Streptococcus sp. oral clone ASCB12Bacteria, Firmicutes, Bacilli, Lactobacillales P5D1-392, Streptococcus sp. oral clone ASCB12 0 - 0.030-0.03
1717 Bacteria, Firmicutes, Clostridia, Clostridiales, Christensenellaceae, CatabacterBacteria, Firmicutes, Clostridia, Clostridiales, Christensenellaceae, Catabacter 0 - 0.0550-0.055
1818 Bacteria, Firmicutes, Clostridia, Clostridiales, Christensenellaceae, Christensenellaceae R-7 groupBacteria, Firmicutes, Clostridia, Clostridiales, Christensenellaceae, Christensenellaceae R-7 group 0 - 0.010-0.01
1919 Bacteria, Firmicutes, Clostridia, Clostridiales, Clostridiaceae 1, Clostridium sensu stricto 1Bacteria, Firmicutes, Clostridia, Clostridiales, Clostridiaceae 1, Clostridium sensu stricto 1 0.5 - 150.5-15
2020 Bacteria, Firmicutes, Clostridia, Clostridiales, Clostridiaceae 1, Clostridium sensu stricto 3Bacteria, Firmicutes, Clostridia, Clostridiales, Clostridiaceae 1, Clostridium sensu stricto 3 0 - 0.10-0.1
2121 Bacteria, Firmicutes, Clostridia, Clostridiales, Clostridiaceae 1, Clostridium sensu stricto 13Bacteria, Firmicutes, Clostridia, Clostridiales, Clostridiaceae 1, Clostridium sensu stricto 13 0 - 0.030-0.03
2222 Bacteria, Firmicutes, Clostridia, Clostridiales, Clostridiaceae 1, SarcinaBacteria, Firmicutes, Clostridia, Clostridiales, Clostridiaceae 1, Sarcina 0 - 0.030-0.03
2323 Bacteria, Firmicutes, Clostridia, Clostridiales, Eubacteriaceae, AnaerofustisBacteria, Firmicutes, Clostridia, Clostridiales, Eubacteriaceae, Anaerofustis 0 - 0.0550-0.055
2424 Bacteria, Firmicutes, Clostridia, Clostridiales, Eubacteriaceae, EubacteriumBacteria, Firmicutes, Clostridia, Clostridiales, Eubacteriaceae, Eubacterium 0.3 - 1.50.3-1.5
2525 Bacteria, Firmicutes, Clostridia, Clostridiales Family XI, PeptoniphilusBacteria, Firmicutes, Clostridia, Clostridiales Family XI, Peptoniphilus 0.01 - 0.20.01-0.2
2626 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Eubacterium fissicatena groupBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Eubacterium fissicatena group 0 - 0.020-0.02
2727 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Eubacterium hallii groupBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Eubacterium hallii group 0 - 20-2
2828 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Eubacterium ventriosum groupBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Eubacterium ventriosum group 0 - 0.60-0.6
2929 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Ruminococcus gnavus groupBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Ruminococcus gnavus group 0 - 0.080-0.08
3030 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Ruminococcus torques groupBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Ruminococcus torques group 0 - 10-1
3131 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, AgathobacterBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Agathobacter 0 - 0.060-0.06
3232 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, AnaerostipesBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Anaerostipes 0 - 0.50-0.5
3333 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, BlautiaBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Blautia 0 - 0.60-0.6
3434 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Coprococcus 1Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Coprococcus 1 0 - 0.40-0.4
3535 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Coprococcus 2Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Coprococcus 2 0 - 0.020-0.02
3636 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Coprococcus 3Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Coprococcus 3 0 - 0.60-0.6
3737 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, DoreaBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Dorea 3 - 63-6
3838 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, FusicatenibacterBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Fusicatenibacter 0 - 0.020-0.02
3939 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, HungatellaBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Hungatella 0 - 0.30-0.3
4040 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, LachnoclostridiumBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Lachnoclostridium 5 - 105-10
4141 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Lachnoclostridium 5Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Lachnoclostridium 5 0 - 0.250-0.25
4242 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae FCS020 groupBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae FCS020 group 0 - 0.030-0.03
4343 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceaee NK4A136 groupBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceaee NK4A136 group 0 - 0.040-0.04
4444 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae UCG-004Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae UCG-004 0 - 50-5
4545 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae UCG-006Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae UCG-006 0 - 0.30-0.3
4646 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae UCG-008Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae UCG-008 0 - 0.40-0.4
4747 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, RoseburiaBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Roseburia 0 - 0.70-0.7
4848 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, SellimonasBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Sellimonas 0 - 0.350-0.35
4949 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, ShuttleworthiaBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Shuttleworthia 0 - 0.050-0.05
5050 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, TyzzerellaBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae, Tyzzerella 0 - 0.70-0.7
5151 Bacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae unculturedBacteria, Firmicutes, Clostridia, Clostridiales, Lachnospiraceae uncultured 0 - 20-2
5252 Bacteria, Firmicutes, Clostridia, Clostridiales, Peptostreptococcaceae, AsaccharosporaBacteria, Firmicutes, Clostridia, Clostridiales, Peptostreptococcaceae, Asaccharospora 0 - 0.50-0.5
5353 Bacteria, Firmicutes, Clostridia, Clostridiales, Peptostreptococcaceae, IntestinibacterBacteria, Firmicutes, Clostridia, Clostridiales, Peptostreptococcaceae, Intestinibacter 0 - 0.40-0.4
5454 Bacteria, Firmicutes, Clostridia, Clostridiales, Peptostreptococcaceae, ParaclostridiumBacteria, Firmicutes, Clostridia, Clostridiales, Peptostreptococcaceae, Paraclostridium 0 - 0.10-0.1
5555 Bacteria, Firmicutes, Clostridia, Clostridiales, Peptostreptococcaceae, PeptoclostridiumBacteria, Firmicutes, Clostridia, Clostridiales, Peptostreptococcaceae, Peptoclostridium 0 - 0.040-0.04
5656 Bacteria, Firmicutes, Clostridia, Clostridiales, Peptostreptococcaceae, RomboutsiaBacteria, Firmicutes, Clostridia, Clostridiales, Peptostreptococcaceae, Romboutsia 0 - 0.050-0.05
5757 Bacteria, Firmicutes, Clostridia, Clostridiales, Peptostreptococcaceae unculturedBacteria, Firmicutes, Clostridia, Clostridiales, Peptostreptococcaceae uncultured 0 - 0.50-0.5
5858 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, Eubacterium coprostanoligenes groupBacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, Eubacterium coprostanoligenes group 0 - 0.010-0.01
5959 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, AcetanaerobacteriumBacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, Acetanaerobacterium 0 - 0.150-0.15
6060 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, ButyricicoccusBacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, Butyricicoccus 0 - 0.20-0.2
6161 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, Candidatus SoleaferreaBacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, Candidatus Soleaferrea 0 - 0.50-0.5
6262 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, FaecalibacteriumBacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, Faecalibacterium 0 - 0.80-0.8
6363 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, FlavonifractorBacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, Flavonifractor 1 - 21-2
6464 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, IntestinimonasBacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, Intestinimonas 0.1 - 0.30.1-0.3
6565 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, OscillibacterBacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, Oscillibacter 0 - 1.50-1.5
6666 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, OscillospiraBacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, Oscillospira 0 - 0.050-0.05
6767 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, PhoceaBacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, Phocea 0 - 0.010-0.01
6868 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminiclostridium 5Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminiclostridium 5 0 - 0.030-0.03
6969 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae UCG-002Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae UCG-002 0 - 0.150-0.15
7070 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae UCG-003Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae UCG-003 0 - 0.40-0.4
7171 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae UCG-004Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae UCG-004 0 - 0.70-0.7
7272 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae UCG-013Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae UCG-013 0 - 0.350-0.35
7373 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, SubdoligranulumBacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae, Subdoligranulum 0.01 - 0.040.01-0.04
7474 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae UBA1819Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae UBA1819 0.01 - 0.10.01-0.1
7575 Bacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae unculturedBacteria, Firmicutes, Clostridia, Clostridiales, Ruminococcaceae uncultured 2 - 42-4
7676 Bacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, Erysipelotrichaceae, Clostridium innocuum groupBacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, Erysipelotrichaceae, Clostridium innocuum group 0 - 0.150-0.15
7777 Bacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, Erysipelotrichaceae, DielmaBacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, Erysipelotrichaceae, Dielma 0 - 0.070-0.07
7878 Bacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, Erysipelotrichaceae, ErysipelatoclostridiumBacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, Erysipelotrichaceae, Erysipelatoclostridium 0 - 1.50-1.5
7979 Bacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, Erysipelotrichaceae UCG-003Bacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, Erysipelotrichaceae UCG-003 0 - 0.50-0.5
8080 Bacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, Erysipelotrichaceae, HoldemaniaBacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, Erysipelotrichaceae, Holdemania 0 - 0.010-0.01
8181 Bacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, Erysipelotrichaceae, TuricibacterBacteria, Firmicutes, Erysipelotrichia, Erysipelotrichales, Erysipelotrichaceae, Turicibacter 0 - 0.010-0.01
8282 Bacteria, Firmicutes, Negativicutes, Selenomonadales, Acidaminococcaceae, PhascolarctobacteriumBacteria, Firmicutes, Negativicutes, Selenomonadales, Acidaminococcaceae, Phascolarctobacterium 0.3 - 10.3-1
8383 Bacteria, Firmicutes, Negativicutes, Selenomonadales, Veillonellaceae, AllisonellaBacteria, Firmicutes, Negativicutes, Selenomonadales, Veillonellaceae, Allisonella 1.5 - 31.5-3
8484 Bacteria, Firmicutes, Negativicutes, Selenomonadales, Veillonellaceae, MegamonasBacteria, Firmicutes, Negativicutes, Selenomonadales, Veillonellaceae, Megamonas 0 - 100-10
8585 Bacteria, Firmicutes, Negativicutes, Selenomonadales, Veillonellaceae, VeillonellaBacteria, Firmicutes, Negativicutes, Selenomonadales, Veillonellaceae, Veillonella 0 - 0.010-0.01
8686 Bacteria, Fusobacteria, Fusobacteriia, Fusobacteriales, Fusobacteriaceae, FusobacteriumBacteria, Fusobacteria, Fusobacteriia, Fusobacteriales, Fusobacteriaceae, Fusobacterium 0 - 0.10-0.1
8787 Bacteria, Proteobacteria, Deltaproteobacteria, Desulfovibrionales, Desulfovibrionaceae, BilophilaBacteria, Proteobacteria, Deltaproteobacteria, Desulfovibrionales, Desulfovibrionaceae, Bilophila 0 - 0.40-0.4
8888 Bacteria, Proteobacteria, Gammaproteobacteria, Betaproteobacteriales, Burkholderiaceae, ParasutterellaBacteria, Proteobacteria, Gammaproteobacteria, Betaproteobacteriales, Burkholderiaceae, Parasutterella 0 - 0.030-0.03
8989 Bacteria, Proteobacteria, Gammaproteobacteria, Betaproteobacteriales, Burkholderiaceae, SutterellaBacteria, Proteobacteria, Gammaproteobacteria, Betaproteobacteriales, Burkholderiaceae, Sutterella 0 - 0.30-0.3
9090 Bacteria, Verrucomicrobia, Verrucomicrobiae, Verrucomicrobiales, Akkermansiaceae, AkkermansiaBacteria, Verrucomicrobia, Verrucomicrobiae, Verrucomicrobiales, Akkermansiaceae, Akkermansia 0 - 0.10-0.1
본 발명의 미생물 제제의 제형은 예를 들어, 액상 형태일 수 있고, 증량제가 첨가된 분말 형태일 수 있으며, 제형화하여 과립화 또는 캡슐화된 것일 수 있으나, 이에 한정되는 것은 아니다.The formulation of the microbial preparation of the present invention may be, for example, in a liquid form, in a powder form with an extender added thereto, and may be formulated and granulated or encapsulated, but is not limited thereto.
본 발명에서 상기 미생물 제제는, 모사 배양된 미생물 군집의 배양물, 상기 배양물의 농축물 또는 상기 배양물의 건조물에 첨가제, 증량제, 영양제 등의 부가제가 더 첨가되어 제조된 것일 수 있다. 이때, 첨가제로 사용될 수 있는 물질로는 예를 들어, 폴리카복실레이트, 소듐 리그노설포네이트, 칼슘 리그노설포네이트, 소듐 다이알킬 설포석시네이트, 소듐 알킬 아릴 설포네이트, 폴리옥시에틸렌 알킬 페닐 에테르, 소듐 트리폴리포스페이트, 폴리옥시에틸렌 알킬 아릴 포스포릭 에스테르, 폴리옥시에틸렌 알킬 아릴 에테르, 폴리옥시에틸렌 알킬 아릴 폴리머, 폴리옥시알킬온 알킬 페닐 에테르, 폴리옥시에틸렌 노닐 페닐 에테르, 소듐 설포네이트 나프탈렌 포름알데히드, 트리톤 100 및 트윈 80으로 이루어진 군으로부터 선택되는 하나 이상일 수 있다. 증량제 및 영양제로는 skim milk(배지), 콩가루, 쌀, 밀, 황토, 규조토, 벤토나이트(bentonite), 덱스트린, 포도당 및 전분으로 이루어진 군으로부터 선택되는 하나 이상일 수 있다. 붕해제로는 벤토나이트(bentonite), 탈크(talc), 다이아라이트(dialite), 카올린(kaolin) 및 칼슘 카보네이트(calcium carbonate)로 이루어진 군으로부터 선택되는 하나 이상일 수 있다.In the present invention, the microbial preparation may be prepared by further adding an additive, such as an additive, an extender, or a nutrient, to a culture of a microbial community that has been simulated culture, a concentrate of the culture, or a dried product of the culture. At this time, materials that can be used as additives include, for example, polycarboxylate, sodium lignosulfonate, calcium lignosulfonate, sodium dialkyl sulfosuccinate, sodium alkyl aryl sulfonate, polyoxyethylene alkyl phenyl ether , Sodium tripolyphosphate, polyoxyethylene alkyl aryl phosphoric ester, polyoxyethylene alkyl aryl ether, polyoxyethylene alkyl aryl polymer, polyoxyalkylone alkyl phenyl ether, polyoxyethylene nonyl phenyl ether, sodium sulfonate naphthalene formaldehyde, It may be one or more selected from the group consisting of Triton 100 and Tween 80. The extender and nutrient may be one or more selected from the group consisting of skim milk (medium), soy flour, rice, wheat, loess, diatomaceous earth, bentonite, dextrin, glucose, and starch. The disintegrant may be at least one selected from the group consisting of bentonite, talc, dialite, kaolin, and calcium carbonate.
본 발명의 인간 유래 장내 미생물 군집을 모사 배양한 배양물은 혐기적 및 호기적으로 동결건조하여 보관될 수 있고, 식염수, 인산완충생리식염수(phosphate buffered saline; PBS), 글리세린(glycerol) 또는 이들을 혼합에 의하여 제조된 용액의 사용에 의하여 보관될 수 있다. 예를 들어, 20%(v/v) 글리세린을 0.85(w/v)% 농도로 함유하는 식염수 및 인간 유래 장내 미생물 군집을 모사 배양한 배양물을 1 대 1로 혼합하고, -80℃에서 냉동하여 보관될 수 있으나, 이에 한정되는 것은 아니다.The culture obtained by simulating the human-derived intestinal microbial community of the present invention can be stored by lyophilizing anaerobicly and aerobicly, and saline, phosphate buffered saline (PBS), glycerol, or a mixture thereof Can be stored by use of the solution prepared by For example, a saline solution containing 20% (v/v) glycerin at a concentration of 0.85 (w/v)% and a culture obtained by simulating a human-derived intestinal microbial community were mixed one to one, and frozen at -80°C. It may be stored, but is not limited thereto.
본 발명의 미생물 제제는 대변 이식술, 각종 장 질환의 개선, 미생물 감염 개선, 체형 개선, 반려동물과 가축의 장내 미생물 군집 개선용으로 활용될 수 있다. 또한, 본 발명의 미생물 제제를 포함하는 기능성 식품 및 화장품의 제조, 농업용 퇴비 발효용, 축산용 사료 발효용 및 축산용 기능성 미생물 제제로 활용될 수 있다.The microbial preparation of the present invention can be used for stool transplantation, improvement of various intestinal diseases, improvement of microbial infection, improvement of body shape, improvement of intestinal microbial community of companion animals and livestock. In addition, it can be used as a functional microbial preparation for production of functional foods and cosmetics comprising the microbial preparation of the present invention, fermentation of agricultural compost, fermentation of feed for livestock and livestock.
본 발명의 또 다른 양상은 상기 미생물 제제를 포함하는 염증성 장질환(Inflammatory Bowel Disease, IBD) 또는 클로스트리디움 디피실 감염증( Clostridioides difficile infection, CDI) 예방 또는 치료용 약학적 조성물을 제공한다.Another aspect of the present invention provides a pharmaceutical composition for preventing or treating Inflammatory Bowel Disease (IBD) or Clostridioides difficile infection (CDI) comprising the microbial preparation.
본 발명의 약학적 조성물은 약학적으로 허용되는 담체를 포함할 수 있다. 본 발명의 약학적 조성물에 포함되는 약학적으로 허용되는 담체는 약제의 제조에 통상적으로 이용되는 것으로써, 락토오스, 덱스트로스, 수크로오스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산칼슘, 알기네이트, 젤라틴, 규산칼슘, 미세결정성 셀룰로오스, 폴리비닐피롤리돈, 셀룰로오스, 물, 시럽, 메틸 셀룰로오스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약학적으로 허용되는 담체 및 제제는 Remington: the science and practice of pharmacy 22nd edition (2013)에 상세히 기재되어 있다.The pharmaceutical composition of the present invention may contain a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in the manufacture of drugs, lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin. , Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc. It is not limited. The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like in addition to the above components. Suitable pharmaceutically acceptable carriers and agents are described in detail in Remington: the science and practice of pharmacy 22nd edition (2013).
본 발명의 일 구체예에 따른 약학적 조성물은 하나 이상의 염증성 장질환에 대한 예방 또는 치료 활성을 나타내는 물질과 함께 투여될 수 있다.The pharmaceutical composition according to an embodiment of the present invention may be administered together with a substance exhibiting prophylactic or therapeutic activity against one or more inflammatory bowel diseases.
또한, 본 발명의 일 구체예에 따른 약학적 조성물은 염증성 장질환의 예방 또는 치료를 위하여 단독으로, 또는 수술, 호르몬 치료, 약물치료 및/또는 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용될 수 있다.In addition, the pharmaceutical composition according to an embodiment of the present invention may be used alone for the prevention or treatment of inflammatory bowel disease, or in combination with surgery, hormone therapy, drug therapy, and/or methods of using a biological response modifier. have.
본 발명의 약학적 조성물은 그 제형의 제제화에 필요하고 적절한 각종 기제 및/또는 첨가물을 포함할 수 있으며, 그 효과를 떨어트리지 않는 범위 내에서 비이온 계면활성제, 실리콘 폴리머, 체질안료, 향료, 방부제, 살균제, 산화 안정화제, 유기 용매, 이온성 또는 비이온성 증점제, 유연화제, 산화방지제, 자유 라디칼 파괴제, 불투명화제, 안정화제, 에몰리언트(emollient), 실리콘, α-히드록시산, 소포제, 보습제, 비타민, 곤충 기피제, 향료, 보존제, 계면활성제, 소염제, 물질 P 길항제, 충전제, 중합체, 추진제, 염기성화 또는 산성화제, 또는 착색제 등 공지의 화합물을 더 포함하여 제조될 수 있다.The pharmaceutical composition of the present invention may contain various bases and/or additives necessary and appropriate for the formulation of the formulation, and within a range that does not degrade the effect, nonionic surfactants, silicone polymers, extender pigments, flavors, preservatives , Disinfectant, oxidation stabilizer, organic solvent, ionic or nonionic thickener, softening agent, antioxidant, free radical destroying agent, opacifying agent, stabilizer, emollient, silicone, α-hydroxy acid, antifoaming agent, moisturizing agent , Vitamins, insect repellents, flavors, preservatives, surfactants, anti-inflammatory agents, substance P antagonists, fillers, polymers, propellants, basification or acidifying agents, or coloring agents, and other known compounds.
본 발명의 약학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 본 발명의 약학적 조성물의 투여량은 성인 기준으로 0.001 내지 1000㎎/㎏일 수 있다.A suitable dosage of the pharmaceutical composition of the present invention is formulated in various ways depending on factors such as formulation method, mode of administration, age, weight, sex, pathological condition, food, administration time, route of administration, excretion rate and response sensitivity. Can be. The dosage of the pharmaceutical composition of the present invention may be 0.001 to 1000 mg/kg on an adult basis.
본 발명의 일 구체예에 따르면, 상기 염증성 장질환은 궤양성 대장염(Ulcerative Colitis, UC) 또는 크론병(Crohn's Disease, CD)일 수 있다.According to one embodiment of the present invention, the inflammatory bowel disease may be Ulcerative Colitis (UC) or Crohn's Disease (CD).
본 발명의 일 구체예에 따르면, 클로스트리디움 디피실 감염증은 재발성 클로스트리디움 디피실 감염증(recurrent Clostridioides difficile infection) 또는 난치성 클로스트리디움 디피실 감염증(refractory Clostridioides difficile infection)일 수 있다.According to one embodiment of the present invention, the Clostridium difficile infection may be a recurrent Clostridioides difficile infection or a refractory Clostridioides difficile infection.
본 발명의 또 다른 양상은 상기 약학적 조성물을 대상체에 투여하는 단계를 포함하는 염증성 장질환(Inflammatory Bowel Disease, IBD) 또는 클로스트리디움 디피실 감염증( Clostridioides difficile infection, CDI)의 치료 방법을 제공한다.Another aspect of the present invention provides a method for treating Inflammatory Bowel Disease (IBD) or Clostridioides difficile infection (CDI) comprising administering the pharmaceutical composition to a subject. .
본 발명의 약학적 조성물은 정상 집단의 대변에 포함된 장내 미생물과 유사한 효능을 나타내므로, 상기 조성물이 염증성 장질환 및/또는 클로스트리디움 디피실 감염증 환자에 투여됨으로써, 상기 질환의 치료가 가능하다.Since the pharmaceutical composition of the present invention exhibits similar efficacy to the intestinal microorganisms contained in the stool of a normal group, the composition can be administered to patients with inflammatory bowel disease and/or Clostridium difficile infection, thereby treating the disease. .
본 발명의 일 구체예에 따르면, 상기 염증성 장질환은 궤양성 대장염(Ulcerative Colitis, UC) 또는 크론병(Crohn's Disease, CD)일 수 있다.According to one embodiment of the present invention, the inflammatory bowel disease may be Ulcerative Colitis (UC) or Crohn's Disease (CD).
본 발명의 일 구체예에 따르면, 클로스트리디움 디피실 감염증은 재발성 클로스트리디움 디피실 감염증(recurrent Clostridioides difficile infection) 또는 난치성 클로스트리디움 디피실 감염증(refractory Clostridioides difficile infection)일 수 있다.According to one embodiment of the present invention, the Clostridium difficile infection may be a recurrent Clostridioides difficile infection or a refractory Clostridioides difficile infection.
이하 본 발명을 하나 이상의 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail through one or more examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.
실시예 1. 대변 시료 준비Example 1. Fecal sample preparation
1-1. 대변 시료 공여자 선발1-1. Selection of stool sample donors
인간 유래 장내 미생물 군집의 모사배양을 위한 전체적인 모식도는 도 1과 같다.An overall schematic diagram for the simulated culture of human-derived intestinal microbial communities is shown in FIG. 1.
모사 배양에 필요한 인간의 장내 미생물 군집의 획득을 위하여, 공여자의 건강상태 및 생활습관을 확인하기 위한 설문을 실시하여 1차 후보군을 선발하고, 선별된 1차 후보군으로부터 총 98개의 대변 시료를 분변 검사용 키트의 사용에 의해 공여 받았다. 공여 받은 대변 시료에 대하여 차세대 염기서열 분석(next generation sequencing, NGS)을 수행하여, 대변 시료의 알파 다양성(α-diversity), 베타 다양성(β-diversity) 및 상대적 풍부도(relative abundance)를 기준으로 1차 건강인 후보군을 선정하였다. 1차 후보군의 장내 미생물 군집 분석을 바탕으로, 2명의 우수한 공여자를 선발하였으며, 혈액검사로 병원성 미생물 및 바이러스의 감염 여부를 확인한 뒤, 최종 1명의 공여자를 선발하였다.In order to obtain the human intestinal microbial community necessary for the simulated culture, a first candidate group was selected by conducting a questionnaire to confirm the health status and lifestyle of the donor, and a total of 98 fecal samples were tested for feces from the selected first candidate group. It was donated by use of the dragon kit. Next generation sequencing (NGS) is performed on the donated stool samples, based on the alpha diversity, beta diversity, and relative abundance of the stool samples. The candidate group of primary health persons was selected. Based on the analysis of the intestinal microbial community of the first candidate group, two excellent donors were selected, and after confirming infection with pathogenic microorganisms and viruses by blood test, the final donor was selected.
98개의 대변 시료에 대한 염기서열을 분석한 결과, 각 시료로부터 평균적으로 28,198±20,657개의 서열 조각(sequence reads)을 얻었으며 희박화 곡선(rarefaction curve)이 모든 시료에서 수렴함을 확인하여, 각 시료에 대한 생물학적 환경이 충분히 반영됨을 확인하였다. 또한, 상기 시료들의 상대적 풍부도는 10% 내지 45% 비율의 박테로이데테스 문, 20% 내지 85% 비율의 퍼미큐테스 문, 및 0% 내지 5% 비율의 프로테오박테리아 문인 것으로 확인되었다. 알파 다양성 지수에서, 샤넌 지수 기준 3.0 이상, 심슨 지수 기준 0.65 이상, 관측된 종(observed species) 기준 250 이상, Chao1 지수 기준 320 이상, 마가레프(Margalef) 지수 25 이상임을 확인하여 공여자들의 장내 미생물 군집이 건강인의 범주에 포함됨을 검증하였으며, 혈액 검사와 병행하여 1차 후보군의 대변 시료 중 가장 평균에 가까운 공여자 1명을 선발하였다(도 2).As a result of nucleotide sequence analysis of 98 fecal samples, on average, 28,198±20,657 sequence reads were obtained from each sample, and it was confirmed that the rarefaction curve converged in all samples. It was confirmed that the biological environment for is sufficiently reflected. In addition, the relative abundance of the samples was confirmed to be 10% to 45% ratio of Bacteroidetes phylum, 20% to 85% ratio of Permicutes phylum, and 0% to 5% ratio of Proteobacteria phylum. In the alpha diversity index, the donor's gut microbial community was confirmed to be 3.0 or higher based on Shannon index, 0.65 or higher based on Simpson index, 250 or higher based on observed species, 320 or higher based on Chao1 index, and 25 or higher Margalef index. It was verified that it was included in the category of this healthy person, and in parallel with the blood test, one donor who was the closest to the average of the fecal samples of the primary candidate group was selected (FIG. 2).
1-2. 대변 시료 처리1-2. Stool sample processing
실시예 1-1에서 선발한 공여자로부터 1개의 시료당 각 최소 120±27g 이상의 대변 시료를 확보하였으며, 확보한 대변 시료 중의 일부는 -80℃에서 냉동보관 하였고, 여분의 시료는 20% 글리세린을 함유한 0.85% 생리식염수로 중량 대비 10배 현탁하였다. 각 대변 시료에서 혈구계수기(hemocytometer)를 사용하여 생균수를 측정한 결과, 각 대변 시료에 그람(gram)당 약 10 9 내지 10 11개의 장내 미생물이 함유되어 있는 것으로 확인되었다. 완충용액에 현탁된 대변 시료는 실험에 사용하기 전까지 -80℃에서 냉동 보관되었다. 대변 시료 전처리 과정은 혐기성 챔버에서 산소(oxygen) 농도 0ppm 내지 40ppm 및 수소(hydrogen) 농도 10000ppm 내지 50000ppm 조건에서 수행되었다.At least 120±27g or more of stool samples were obtained per sample from the donor selected in Example 1-1, and some of the obtained stool samples were stored frozen at -80°C, and the extra sample contained 20% glycerin. It was suspended 10 times by weight in 0.85% physiological saline. As a result of measuring the number of viable cells in each stool sample using a hemocytometer, it was confirmed that each stool sample contained about 10 9 to 10 11 intestinal microorganisms per gram. Fecal samples suspended in a buffer solution were stored frozen at -80°C until use in the experiment. The fecal sample pretreatment process was performed in the anaerobic chamber under conditions of 0 ppm to 40 ppm of oxygen and 10000 ppm to 50000 ppm of hydrogen.
한편, 궤양성 대장염(ulcerative colitis, UC) 및 재발성 클로스트리디움 디피실 감염증(recurrent Clostridioides difficile infection, rCDI) 환자로부터 12개의 대변 시료를 공여받아, 본 발명의 모사 배양 방법에 의해 배양된 인간 유래 장내 미생물 군집 및 건강인 집단의 대변 시료와 비교하였다.Meanwhile, 12 stool samples were donated from patients with ulcerative colitis (UC) and recurrent Clostridioides difficile infection (rCDI), and human-derived cultured by the simulated culture method of the present invention It was compared with the intestinal microbial community and stool samples from the healthy population.
실시예 2. 대변 시료의 모사 배양을 위한 배지 제작Example 2. Preparation of medium for simulated culture of feces sample
대변 시료의 모사 배양을 수행하기 위하여, 표 6의 조성을 갖는 5종의 배지를 제작하였다.In order to perform the simulated culture of the feces sample, five kinds of medium having the composition of Table 6 were prepared.
구체적으로, 질소 공급원 및 에너지 공급원으로써, 소 뇌 추출물(Beef brain infusion), 소의 심장 추출물(beef heart infusion), 프로테오스 펩톤(proteose peptone), 탄소 공급원으로써 포도당(dextrose), 염 농도 조절 목적의 염화 나트륨(sodium chloride), 수소 이온 농도 조절 목적의 인산수소이나트륨(disodium phosphate), 배지 내 산소 제거 목적의 황화나트륨(sodium sulfide), 및/또는 배양액 내의 산소 존재 여부를 확인하기 위한 목적의 레사주린(resazurin) 등이 포함되도록 배지를 제작하였다. 제작한 배지에서 산소를 제거하여 혐기적 조건을 갖도록 하기 위하여, 300 내지 350℃로 가열된 질소(N 2) 가스를 제작된 5종 배지에 1mL 당 30초 이상 처리하여 배지에 포함된 산소를 제거하고, 121℃ 및 15분 조건에서 멸균하여 사용하였다.Specifically, as a nitrogen source and an energy source, beef brain infusion, beef heart infusion, proteose peptone, glucose as a carbon source, and salt concentration control Sodium chloride, disodium phosphate for controlling the concentration of hydrogen ions, sodium sulfide for removing oxygen in the medium, and/or resazurin for checking the presence of oxygen in the culture medium (resazurin) and the like were prepared to contain a medium. In order to remove oxygen from the prepared medium to have anaerobic conditions, nitrogen (N 2 ) gas heated to 300 to 350°C is treated for 30 seconds per 1 mL of the prepared five mediums to remove oxygen contained in the medium. And sterilized at 121° C. and 15 minutes.
성분ingredient %(w/v)%(w/v)
BHIBHI FABFAB RCMRCM SAMSAM TSBTSB
소 뇌 추출물(Calf Brains, infusion)Cerebellar extract (Calf Brains, infusion) 0.770.77 -- -- -- --
소 심장 추출물(Beef Heart, infusion)Beef Heart, infusion 0.980.98 -- -- -- --
카제인의 췌장 소화물(Pancreatic digest of casein)Pancreatic digest of casein -- -- -- 0.560.56 1.71.7
콩의 파파인 소화물(Papaic digest of soybean)Papain digest of soybean -- -- -- 0.10.1 0.30.3
프로테오스 펩톤(Proteose peptone)Proteose peptone 1One -- -- -- --
포도당(Dextrose)Glucose (Dextrose) 0.20.2 0.10.1 0.50.5 0.5820.582 0.250.25
염화 나트륨(Sodium chloride)Sodium chloride 0.50.5 0.50.5 0.50.5 0.170.17 0.50.5
인산 이칼륨(Dipotassium phosphate)Dipotassium phosphate 0.250.25 -- -- -- 0.250.25
인산 칼륨(Potassium phosphate)Potassium phosphate -- -- -- 0.0820.082 --
우육 추출물(Beef extract)Beef extract -- -- 1One 0.50.5 --
효모 추출물(Yeast extract)Yeast extract -- -- 0.30.3 0.50.5 --
펩톤(Peptone)Peptone -- 2.32.3 1One -- --
수용성 녹말(Soluble starch)Soluble starch -- 0.10.1 -- -- --
탄산 수소 나트륨(Sodium bicarbonate)Sodium bicarbonate -- 0.040.04 -- -- --
피루브산 나트륨(Sodium pyruvate)Sodium pyruvate -- 0.10.1 -- -- --
L-아르기닌( L-Arginine)L- arginine (L -Arginine) -- 0.10.1 -- -- --
L-시스테인 염산염(L-Cysteine hydrochloride)L-Cysteine hydrochloride -- 0.050.05 0.050.05 0.040.04 --
피로 인산 나트륨(Sodium pyrophosphate)Sodium pyrophosphate -- 0.0250.025 -- -- --
숙신산 나트륨(Sodium succinate)Sodium succinate -- 0.050.05 -- -- --
헤민(Hemin)Hemin -- 0.0010.001 -- 0.0010.001 --
비타민 K (Vitamin K)Vitamin K -- 0.00010.0001 -- -- --
트리스 하이드록시 메틸아미노메탄(Tris hydroxymethyl aminomethane)Tris hydroxymethyl aminomethane -- -- -- 0.30.3 --
녹말(Starch)Starch -- -- 0.10.1 -- --
아세트산 나트륨(Sodium acetate)Sodium acetate -- -- 0.30.3 -- --
황화 나트륨(Sodium sulfide)Sodium sulfide 0.050.05 0.050.05 0.050.05 0.050.05 0.050.05
레사주린(Resazurin)Resazurin 0.0020.002 0.0020.002 0.0020.002 0.0020.002 0.0020.002
수소이온농도(pH)Hydrogen ion concentration (pH) 7.47.4 7.27.2 6.86.8 7.67.6 7.37.3
실시예 3. 대변 시료의 모사 배양 및 제형화Example 3. Simulated culture and formulation of fecal samples
3-1. 대변 시료의 배양3-1. Incubation of fecal samples
인간 유래 장내 미생물 군집의 모사 배양을 위하여, 실시예 1-2에서 준비한 대변 시료 현탁액을 사용하였으며, 모든 실험군에서 실시예 2에서 제작한 각 배지별로 3반복 수행하였다. 시료 현탁액은 0.1 내지 10%(v/v)가 되도록 접종되었으며, 배지의 배양은 30℃ 내지 37℃ 및 80rpm 내지 250rpm 조건의 배양기에서 이루어졌다.For the simulated culture of human-derived intestinal microbial communities, the stool sample suspension prepared in Example 1-2 was used, and in all experimental groups, each medium prepared in Example 2 was repeated 3 times. The sample suspension was inoculated to be 0.1 to 10% (v/v), and the culture of the medium was performed in an incubator at 30° C. to 37° C. and 80 rpm to 250 rpm.
그 결과, 98명의 공여자군의 평균(Mean of healthy) 및 최종적으로 선택된 공여자의 원 대변(original stool)에 포함된 미생물 문(phylum)의 상대적 분포도(relative abundance)는 도 3과 같이 확인되었다. 인간 유래 장내 미생물 군집의 모사 배양을 확인하기 위하여 육안으로 관찰한 결과, 도 4a 및 도 4b에 나타난 바와 같이, 증식 전 투명하던 배지가 모사 배양 후 불투명하게 된 것으로 나타나, 미생물 군집이 증식된 것으로 확인되었다. 또한, 현미경 관찰 결과, 도 5a 및 5b에 나타난 바와 같이 증식 후 단위 넓이당 미생물이 현저하게 증가한 것으로 확인되었다.As a result, the mean of the 98 donors group (Mean of healthy) and the relative abundance of the microbial phylum included in the original stool of the finally selected donor (relative abundance) was confirmed as shown in FIG. As a result of visual observation to confirm the simulated culture of the human-derived intestinal microbial community, as shown in FIGS. 4A and 4B, the medium that was transparent before growth appeared to become opaque after the simulated culture, confirming that the microbial community was proliferated. Became. In addition, as a result of microscopic observation, it was confirmed that the number of microorganisms per unit area after proliferation significantly increased as shown in FIGS. 5A and 5B.
3-2. 배양에 따른 미생물의 생장 곡선 확인3-2. Check the growth curve of microorganisms according to culture
인간 유래 장내 미생물 군집의 모사 배양에 따른 생장 곡선의 확인을 위하여, 실시예 1-2에서 준비한 대변 시료 현탁액을 실시예 2에서 제작한 각 배지에 0.1 내지 30%(v/v)가 되도록 접종하였으며, 이때 혈구 계수기에 의해 확인된 생균수는 약 10 7 cells/mL였다. 접종 직후부터 대수 증식기가 끝나는 24시간까지 매 3시간 간격으로 생균수를 측정하였으며, 24시간 이후부터는 24시간 간격으로 생균수를 72시간까지 측정하여 생장 곡선(growth curve)을 작성하였다. In order to confirm the growth curve according to the simulated culture of the human-derived intestinal microbial community, the stool sample suspension prepared in Example 1-2 was inoculated at 0.1 to 30% (v/v) in each medium prepared in Example 2 , At this time, the number of viable cells confirmed by the hemocytometer was about 10 7 cells/mL. The number of viable cells was measured every 3 hours from immediately after inoculation to 24 hours after the logarithmic growth period ends, and from 24 hours after, the number of viable cells was measured at 24 hour intervals for up to 72 hours to create a growth curve.
그 결과, 도 6a에 나타난 바와 같이, 초기 균체량은 약 10 7cells/mL로, 배양 24시간 후 약 10 9cells/mL까지 생장하였으며, 배양 종결 시점(72시간)에서 관측된 생균수는 약 10 9cells/mL로 확인되었다. 또한, 배양 종결 시점에서 각 배지 별 장내 미생물의 개수를 관측한 결과, 도 6b에 나타낸 바와 같이, BHI(brain-heart infusion media) 배지, FAB(fastidious anaerobe broth) 배지 및 TSB(tryptic soy broth) 배지에서 다른 2개의 배지 대비 유의미하게( p < 0.05) 높은 생장이 이루어진 것으로 확인되었다.As a result, as shown in FIG. 6A, the initial cell mass was about 10 7 cells/mL, and after 24 hours of culture, the cells were grown to about 10 9 cells/mL, and the number of viable cells observed at the end of culture (72 hours) was about 10. It was identified as 9 cells/mL. In addition, as a result of observing the number of intestinal microorganisms for each medium at the end of culture, as shown in FIG. It was confirmed that the growth was significantly higher ( p <0.05) compared to the other two media.
원 대변(original stool)의 미생물 군집 구성과 가장 유사한 배양 시간을 탐색하기 위하여, 상기 생장 곡선 작성 결과를 바탕으로, 배양된 장내 미생물 군집 접종 후 0시간, 12시간, 24시간, 48시간 및 72시간에 배양액 시료를 시간대별로 회수한 다음, 차세대 염기서열 분석에 사용하기 전까지 회수한 배양액 시료를 -80℃에서 냉동 보관하였다.In order to explore the culture time most similar to the composition of the microbial community of the original stool, based on the result of the growth curve creation, 0 hours, 12 hours, 24 hours, 48 hours and 72 hours after inoculation of the cultured intestinal microbial community After collecting the culture solution samples by time, the collected culture solution samples were stored frozen at -80°C before use for next-generation sequencing.
3-3. 모사 배양된 건강인 유래 장내 미생물 군집의 제형화3-3. Formulation of intestinal microbial community derived from simulated cultured healthy people
모사 배양된 건강인 유래 장내 미생물 군집을 현행 대변이식술과 동일한 방법으로 개체에 투여하기 위하여, 0.85% 생리식염수, 인산완충생리식염수(phosphate buffered saline, PBS), 20% 글리세린(glycerol), 20% 글리세린을 함유한 0.85% 생리식염수 및 50% 글리세린 등으로 이루어진 완충액군으로부터 하나 이상의 완충액을 선택하여 모사 배양된 미생물 군집의 BHI 배지 배양물과 1 대 1로 혼합하여 액상 형태로 제형화하였다(도 7).0.85% physiological saline, phosphate buffered saline (PBS), 20% glycerol, 20% glycerin in order to administer the simulated cultured healthy human-derived intestinal microbial community to an individual in the same way as current fecal transplantation. At least one buffer solution was selected from a buffer group consisting of 0.85% physiological saline and 50% glycerin containing, and mixed 1 to 1 with the BHI medium culture of the simulated microbial community, and formulated in a liquid form (Fig. 7). .
실시예 4. 대변 시료의 최적 모사 배양 배지 확인Example 4. Identification of optimal simulated culture medium of feces sample
4-1. 대변 시료 배양에 따른 상대적 풍부도 평가4-1. Evaluation of relative abundance according to stool sample culture
실시예 1에서 공여 받은 97개의 시료, 배양 접종액으로 선택된 1개의 원 대변 시료(original stool) 및 실시예 3에서 회수한 배양액 시료에 대하여, DNA를 추출하였다.DNA was extracted from 97 samples donated in Example 1, one original stool selected as a culture inoculum, and a culture solution sample recovered in Example 3.
구체적으로, 당업계의 통상적인 방법에 따라 QIAmp Power Fecal DNA Pro Kit(QIAGEN, 독일)를 사용하여 DNA를 추출하였다. 실시예 1의 원 대변 시료 현탁액 및 모사 배양된 인간 유래 장내 미생물 군집 배양액을 해동한 뒤 1.8㎖를 취하였으며, 이를 원심분리로 6배 농축한 다음, 제조사의 지시에 따라 추출하였다. 추출한 DNA로부터 중합효소연쇄반응법으로 16S rRNA 유전자의 V4-V5영역을 표 7의 프라이머를 사용하여 특이적으로 증폭하였다. Specifically, DNA was extracted using QIAmp Power Fecal DNA Pro Kit (QIAGEN, Germany) according to a conventional method in the art. The original stool sample suspension and the simulated cultured human intestinal microbial community culture solution of Example 1 were thawed and then 1.8 ml was taken, which was concentrated 6 times by centrifugation, and then extracted according to the manufacturer's instructions. From the extracted DNA, the V4-V5 region of the 16S rRNA gene was specifically amplified by the polymerase chain reaction method using the primers in Table 7.
프라이머primer 프라이머 염기서열(5'→3')Primer nucleotide sequence (5'→3') 서열번호Sequence number
515F515F GTGNCAGCMGCCGCGGTRAGTGNCAGCMGCCGCGGTRA 서열번호 1SEQ ID NO: 1
907R907R CCGYCWATTYHTTTRAGTTTCCGYCWATTYHTTTRAGTTT 서열번호 2SEQ ID NO: 2
국제 순수 응용 화학 연합(International Union of Pure and Applied Chemistry; IUPAC)의 ambiguity code 표기법에 따라, 상기 표 7의 프라이머 염기서열 중 일반적인 염기 A(adenine), T(thiamine), G(guanine) 및 C(cytosine)을 제외한 염기 서열의 의미는 다음과 같다:According to the ambiguity code notation of the International Union of Pure and Applied Chemistry (IUPAC), common bases A (adenine), T (thiamine), G (guanine) and C ( The meaning of the base sequence except for cytosine) is as follows:
N: A, T, G 또는 CN: A, T, G or C
M: A 또는 CM: A or C
R: A 또는 GR: A or G
Y: C 또는 TY: C or T
W: A 또는 TW: A or T
H: A, C 또는 T.H: A, C or T.
수득된 PCR 산물로부터 AMPure XP(BECKMAN COULTER, 미국)을 이용해 약 550bp 길이의 DNA 절편을 특이적으로 선택하였다. Illumina 사의 MiSeq TM을 이용하여, 2 X 301bp 페어드-엔드(paired-end) 방식으로 염기서열을 획득하였으며, MiSeq TM Control Software(MCS)으로 후처리를 수행하였다.From the obtained PCR product, a DNA fragment of about 550 bp in length was specifically selected using AMPure XP (BECKMAN COULTER, USA). Using Illumina's MiSeq TM , the base sequence was obtained in a 2 X 301 bp paired-end method, and post-treatment was performed with MiSeq TM Control Software (MCS).
수득된 원시 서열 데이터(raw sequence data)는 Quantitative insights into microbial ecology 1(Qiime1, version 1.9.1)을 이용하여 데이터 처리하였다.The obtained raw sequence data was data processed using Quantitative insights into microbial ecology 1 (Qiime1, version 1.9.1).
구체적으로, 염기서열의 정확도를 FastQC로 확인한 다음, Phred quality score 기준으로 최소 Q30(99.9%의 정확도) 이상 및 250bp 이상의 길이를 갖는 서열조각만을 추출하였다. VSEARCH를 이용하여 키메라 서열(chimeric sequence)를 제거하였으며, SILVA 16S rRNA gene 데이터 베이스(release 132)를 이용하여 운영분류단위(operational taxonomic units, OTU)를 분류하였다. 이로부터 획득한 OTU 표(OTU table)는 상대적 분포도와 알파 및 베타 다양성 분석에 사용되었다.Specifically, after confirming the accuracy of the nucleotide sequence by FastQC, only sequence fragments having a length of at least Q30 (99.9% accuracy) or more and 250 bp or more were extracted based on the Phred quality score. The chimeric sequence was removed using VSEARCH, and operational taxonomic units (OTU) were classified using the SILVA 16S rRNA gene database (release 132). The OTU table obtained from this was used to analyze the relative distribution and alpha and beta diversity.
각 시간대별 배양액들의 상대적 풍부도를 차세대 염기서열 분석을 통하여 확인한 결과, 도 2에 나타난 바와 같이, 원 대변 시료는 다른 97개의 정상 대변 시료와 유사한 장내 미생물 군집의 평균적인 구성을 나타내는 것으로 확인되었다. 또한, 도 8에 나타난 바와 같이, 접종 후 약 72시간 경과시 BHI, FAB 및 TSB 배지의 상대적 분포도(relative abundance)가 원래의 군집 구성과 유사하게 회복되는 것으로 확인되었다.As a result of confirming the relative abundance of cultures for each time period through next-generation sequencing analysis, as shown in FIG. 2, it was confirmed that the original stool sample showed an average composition of the intestinal microbial community similar to the other 97 normal stool samples. In addition, as shown in FIG. 8, it was confirmed that the relative abundance of BHI, FAB, and TSB medium recovered similarly to the original cluster composition after about 72 hours after inoculation.
4-2. 대변 시료 배양에 따른 알파 다양성 평가4-2. Assessment of alpha diversity according to stool sample culture
모사 배양된 인간 유래 장내 미생물 군집과 98개의 정상 대변 시료의 생태적 통계학적인 유사도를 평가하기 위하여, 원 대변, 이들의 배양액 및 97개의 정상 대변 시료에 대해 알파 다양성을 조사하였다.In order to evaluate the ecological and statistical similarity between the simulated human-derived intestinal microbial community and 98 normal stool samples, alpha diversity was investigated for the original stool, their culture medium and 97 normal stool samples.
구체적으로, 배양된 미생물 군집의 풍부도를 평가하기 위하여 샤넌 지수(Shannon's index)를 사용하였고(도 9a), 생장한 종의 수를 평가하기 위하여 관측된 종(observed species)을 사용하였다(도 9b).Specifically, Shannon's index was used to evaluate the abundance of the cultured microbial community (Fig. 9a), and observed species to evaluate the number of grown species (Fig. 9b) ).
그 결과, 원 대변의 경우, 다른 97개의 정상 대변 대비 미생물 군집의 풍부도 및 관측된 종의 수가 유사하거나 높은 것으로 확인되었다. 한편, 72시간 동안 원 대변이 배양된 5개의 혐기 배지 중, BHI 배지에서 풍부도 및 관측된 종의 수 모두 원 대변과 유사한 값을 나타내고, FAB 배지 및 TSB 배지 대비 높은 풍부도 및 관측된 종의 수가 확인되어(도 9), 실시예 4-1의 상대적 분포도(relative abundance) 결과와 일치하는 것으로 확인되었다.As a result, in the case of the original feces, it was confirmed that the abundance of the microbial community and the number of observed species were similar or high compared to the other 97 normal feces. On the other hand, of the five anaerobic media in which the original feces were cultured for 72 hours, both the abundance and the number of observed species in the BHI medium showed similar values to those of the original feces, and the abundance and observed species were higher than that of the FAB medium and TSB medium. The number was confirmed (FIG. 9), and it was confirmed that it was consistent with the relative abundance result of Example 4-1.
4-3. 대변 시료 배양에 따른 베타 다양성 평가4-3. Evaluation of beta diversity according to stool sample culture
대변 시료 간의 거리가 생태학 및 통계적으로 얼마나 유사한지를 평가하기 위하여, 베타 다양성을 조사하였다.To assess how ecologically and statistically similar distances between fecal samples were, beta diversity was investigated.
구체적으로, 통계 분석을 위하여, 당업계의 통상적인 방법에 따라 주성분 분석(principal coordinates analysis, PCoA)하고, weighted UniFrac을 사용하여 각 시료 간의 거리 산출하였으며, 계통 분류학상 종(species) 수준에서 확인하였다.Specifically, for statistical analysis, principal component analysis (PCoA) was performed according to a conventional method in the art, and the distance between each sample was calculated using weighted UniFrac, and it was confirmed at the level of species in phylogeny. .
그 결과, 도 10a와 도 10c에 나타난 바와 같이, 원 대변이 건강인 집단의 범주에 포함됨과 동시에, BHI 배지에서 모사 배양된 장내 미생물 군집이 FAB 배지 및 TSB 배지 대비 원 대변과 가장 유사한 것으로 확인되어, 실시예 4-1의 상대적 분포도 결과 및 실시예 4-2의 알파 다양성 결과와 일치하는 것으로 확인되었다. 또한, 환자 집단의 시료는 도 10b에 나타난 바와 같이, 건강인, 원 대변 시료, 및 발명의 모사 배양 방법으로 배양된 인간 유래 장내 미생물 군집과 구별되는 것으로 확인되었다.As a result, as shown in FIGS. 10A and 10C, it was confirmed that the original stool was included in the category of the healthy population, and the intestinal microbial community simulated in BHI medium was most similar to the original stool compared to FAB medium and TSB medium. , It was confirmed that the relative distribution of Example 4-1 and the alpha diversity result of Example 4-2 were consistent with the results. In addition, as shown in FIG. 10B, the sample of the patient population was confirmed to be distinguished from the human-derived intestinal microbial community cultured by the healthy person, the original stool sample, and the simulated culture method of the present invention.
이와 같은 결과를 통하여, 원 대변으로부터 BHI, FAB 및 TSB 배지에서 모사 배양된 인간 유래 장내 미생물 군집은 배양 48시간 이후부터 정상 집단의 범주에 포함되어 모사 배양 후에도 정상 집단의 대변과 생태적 및 통계적으로 유사한 것으로 확인되었고, 특히, 모사 배양을 수행하는데 있어서, BHI 배지가 최적 배지인 것으로 확인되었다.Through these results, the human-derived intestinal microbial community simulated in BHI, FAB and TSB medium from the original feces was included in the category of the normal group after 48 hours of incubation, and was ecologically and statistically similar to the feces of the normal group even after the simulated culture. It was confirmed that, in particular, in performing the simulated culture, it was confirmed that the BHI medium is the optimal medium.
실시예 5. 공여 받은 대변으로부터 모사 배양된 시료의 재현성 검증Example 5. Verification of reproducibility of samples simulated cultured from donated feces
실시예 3에서 모사 배양된 인간 유래의 장내 미생물 군집의 미생물 조성 재현성을 확인하기 위하여, 실시예 3의 방법과 동일한 방법으로 BHI 배지의 72시간 배양액을 사용하여 수 회 연속적인 배양을 수행하였다. 배양 후, 배양액으로부터 미생물 군집의 핵산을 추출하고, 차세대 염기서열 분석을 수행하였다.In order to confirm the microbial composition reproducibility of the human-derived intestinal microbial community simulated in Example 3, continuous culture was performed several times using a 72-hour culture solution of BHI medium in the same manner as in Example 3. After cultivation, nucleic acids of the microbial community were extracted from the culture solution, and next-generation sequencing was performed.
구체적으로, 확보된 염기서열의 정보들은 상기 실시예 1과 동일한 방법으로 처리하였으며, 통계 분석을 위하여, 당업계의 통상적인 방법에 따라 주성분 분석하고, weighted UniFrac을 사용하여 각 시료 간의 거리 산출하였으며, 계통 분류학상 종(species) 수준에서 확인하였다.Specifically, the obtained nucleotide sequence information was processed in the same manner as in Example 1, for statistical analysis, principal component analysis was performed according to a conventional method in the art, and the distance between each sample was calculated using weighted UniFrac, It was identified at the species level in phylogeny.
그 결과, 도 11에서 나타난 바와 같이 수 차례 연속적으로 모사 배양된 인간 장내 미생물 군집이 정상 집단의 범주에 포함된 것으로 확인되어, 원 대변의 미생물 군집을 모사하여 대변 시료의 연속적 모사 배양이 가능한 것으로 확인되었다.As a result, as shown in FIG. 11, it was confirmed that the human intestinal microbial community, which was continuously simulated and cultured several times, was included in the category of the normal group, and it was confirmed that continuous simulated culture of the stool sample was possible by simulating the microbial community of the original stool Became.
실시예 6. 실험쥐의 염증성 장질환 유도Example 6. Induction of inflammatory bowel disease in mice
6-1. 염증성 장질환 모델 제작6-1. Production of inflammatory bowel disease model
실험쥐의 대면, 사람의 대변 및 실시예 3-3의 모사 배양된 건강인 유래 장내 미생물 군집 제형의 염증성 장질환 치료 효과를 확인하기 위하여, 실험쥐에 염증성 장질환을 유도하였다.In order to confirm the therapeutic effect of the intestinal microbial community formulation derived from the face-to-face, human feces and the simulated cultured healthy person of Example 3-3, inflammatory bowel disease was induced in the experimental mice.
실험쥐로는 총 43마리의 C57BL/6J strain을 사용하였으며, 23±3℃ 및 습도 60±5%의 일반적인 조건에서 총 15일간 사육하였다. 염증성 장질환은 2%(w/v) 덱스트란 설페이트 소듐(dextran sulfate sodium, DSS) 수용액을 대장에 투여하여 유도하였다. 실험군은 다음과 같이 설정하였다: 무처리군(Untreated) 11마리, 음성 대조군으로써 2% DSS만을 처리한 군(DSS) 11마리, 양성 대조군으로써 2% DSS 처리 후 무처리군의 실험쥐 대변을 이식받은 군(normal mouse fecal microbiota transplantation, nFMT) 7마리, 실시예 1의 건강인 유래 원 대변(original stool)을 이식받은 군(human fecal microbiota transplantation, hFMT) 7마리 및 실험군으로써 실시예 3-3에서 모사 배양된 건강인 유래 장내 미생물 군집을 투여 받은 군(cultured human fecal microbiota transplantation, cFMT) 7마리로, 총 5개의 실험군으로 나누어 실험하였다.A total of 43 C57BL/6J strains were used as experimental mice, and were reared for a total of 15 days under normal conditions of 23±3℃ and 60±5% humidity. Inflammatory bowel disease was induced by administering a 2% (w/v) aqueous solution of dextran sulfate sodium (DSS) to the large intestine. The experimental group was set as follows: 11 untreated animals, 11 DSS treated with only 2% DSS as a negative control, and transplanted feces from the untreated group after 2% DSS treatment as a positive control. In Example 3-3 as a group (normal mouse fecal microbiota transplantation, nFMT) 7 mice, the human fecal microbiota transplantation (hFMT) 7 mice (human fecal microbiota transplantation, hFMT) transplanted from the original stool of Example 1. The experiment was conducted by dividing into a total of 5 experimental groups, consisting of 7 mice receiving the cultured human fecal microbiota transplantation, cFMT.
실험쥐는 약 열흘 간의 안정화 기간을 거친 뒤, 무처리군을 제외한 나머지 4개의 군(DSS, nFMT, hFMT 및 cFMT)에 7일간 2%의 DSS를 투여하였고, 실험 9일차부터 11일차까지 대조물질 및 실험물질로써, 실험쥐의 대면, 사람의 대변 또는 실시예 3-3의 모사 배양된 건강인 유래 장내 미생물 군집 제형을 실시예 4-2의 방법으로 실험쥐에 투여하였다.After a stabilization period of about 10 days, the mice were administered 2% DSS for 7 days to the remaining 4 groups (DSS, nFMT, hFMT, and cFMT) excluding the untreated group. As the test substance, the intestinal microbial community formulation derived from the face of the mice, human feces, or the simulated healthy person of Example 3-3 was administered to the mice by the method of Example 4-2.
6-2. 모사 배양된 건강인 유래 장내 미생물 군집 배양체의 투여6-2. Administration of intestinal microbial community cultures derived from simulated healthy individuals
염증성 장질환이 유도된 실험쥐의 대변이식은 실험 9일차부터 11일차까지 실험쥐 당 10㎕/g/day 용량으로 1일 1회 투여하였다.Fecal transplantation of mice induced with inflammatory bowel disease was administered once a day at a dose of 10 μl/g/day per mouse from day 9 to day 11 of the experiment.
구체적으로, DSS 군에는 위약효과 및 제형화에 사용된 완충액의 효과를 판단하기 위한 모의처리(mock treatment)로써, 실시예 3-3에서 모사 배양된 미생물 군집의 배양물을 액상 형태로 제형화할 때 사용한 것과 동일한 조성의 완충액을 투여하였다. nFMT 군에는 일반 쥐 유래의 대변을 균질화하여 완충액에 10%(w/v) 농도로 현탁한 현탁액을 투여하였다. hFMT 군에는 실시예 1의 건강인 유래의 원 대변 현탁액을 투여하였다. cFMT 군에는 상기 실시예 3-3에서 제조한 모사 배양된 미생물 군집 배양물의 액상 제형을 투여하였다.Specifically, in the DSS group, as a mock treatment to determine the placebo effect and the effect of the buffer used in formulation, when formulating the culture of the microbial community simulated in Example 3-3 in a liquid form A buffer solution having the same composition as used was administered. To the nFMT group, a suspension of 10% (w/v) concentration in a buffer solution was administered by homogenizing feces derived from ordinary mice. The hFMT group was administered the original stool suspension derived from healthy persons of Example 1. To the cFMT group, a liquid formulation of the simulated microbial community culture prepared in Example 3-3 was administered.
6-3. 염증성 장질환 모델 검증6-3. Inflammatory bowel disease model validation
실시예 6-1에서 덱스트란 설페이트 소듐 처리된 실험쥐의 염증성 장질환 유도 여부를 확인하였다.In Example 6-1, it was confirmed whether dextran sulfate sodium-treated mice induce inflammatory bowel disease.
구체적으로, 실험 7일차에 무처리군(Untreated) 및 2% DSS를 처리한 군(DSS)으로부터 각 4마리의 실험쥐를 무작위로 선택하여 희생(sacrifice)을 하였다. 실험 7일차에, 각 실험쥐에 케타민(ketamine) 및 자일라진(xylazine) 칵테일을 10㎕/㎏의 투여량으로 복강내 주사(intraperitoneal injection)하여 마취한 다음, 혈액을 회수하고, 경추탈골하여 안락사하였다. 그 후, 실험쥐로부터 결장(colon)과 비장(spleen)을 획득하여 결장의 길이 비교, 비장의 크기 및 무게, 장내 투과도(intestinal permeability) 및 RT-qPCR 분석에 따른 사이토카인의 발현양을 분석하였다. RT-qPCR은 Power SYBR TM PCR Master Mix(ThermoFisher, 미국)를 사용하여 제조사에서 권장하는 조성에 따라 수행되었으며, 표 8에 기재된 프라이머를 사용하여 각 사이토카인 유전자들의 발현양을 정량하였다. 사이토카인들의 상대적 발현량을 정하기 위한 표준 유전자(reference gene)로써 eukaryote elongation factor 2(EEF2)를 사용하였다.Specifically, on the 7th day of the experiment, 4 mice were randomly selected from the untreated group and the group treated with 2% DSS (DSS) and sacrificed. On the 7th day of the experiment, each rat was anesthetized by intraperitoneal injection of a cocktail of ketamine and xylazine at a dose of 10 μl/kg, and then blood was collected, cervical dislocation and euthanasia. I did. Thereafter, colon and spleen were obtained from the mice and analyzed for the length of the colon, the size and weight of the spleen, the intestinal permeability, and the amount of cytokine expression according to RT-qPCR analysis. . RT-qPCR was performed according to the composition recommended by the manufacturer using Power SYBR TM PCR Master Mix (ThermoFisher, USA), and the amount of expression of each cytokine gene was quantified using the primers shown in Table 8. Eukaryote elongation factor 2 (EEF2) was used as a reference gene for determining the relative expression levels of cytokines.
프라이머primer 프라이머 염기서열(5'→3')Primer nucleotide sequence (5'→3') 서열번호Sequence number
Tnfa(TNFα) Tnfa (TNFα) forwardforward AGCCGATGGGTTGTACCTTGAGCCGATGGGTTGTACCTTG 서열번호 3SEQ ID NO: 3
reversereverse ATAGCAAATCGGCTGACGGTATAGCAAATCGGCTGACGGT 서열번호 4SEQ ID NO: 4
Ifng(IFNγ) Ifng (IFNγ) forwardforward CAGCAACAGCAAGGCGAAAACAGCAACAGCAAGGCGAAAA 서열번호 5SEQ ID NO: 5
reversereverse TGGACCTGTGGGTTGTTGACTGGACCTGTGGGTTGTTGAC 서열번호 6SEQ ID NO: 6
Il1b(IL-1β) Il1b (IL-1β) forwardforward GAGCACCTTCTTTTCCTTCATCTTGAGCACCTTCTTTTCCTTCATCTT 서열번호 7SEQ ID NO: 7
reversereverse TCACACACCAGCAGGTTATCATCTCACACACCAGCAGGTTATCATC 서열번호 8SEQ ID NO: 8
Il4(IL-4) Il4 (IL-4) forwardforward TAGGGCTTCCAAGGTGCTTCTAGGGCTTCCAAGGTGCTTC 서열번호 9SEQ ID NO: 9
reversereverse GGCATCGAAAAGCCCGAAAGGGCATCGAAAAGCCCGAAAG 서열번호 10SEQ ID NO: 10
Il6(IL-6) Il6 (IL-6) forwardforward CTTGGGACTGATGCTGGTGACTTGGGACTGATGCTGGTGA 서열번호 11SEQ ID NO: 11
reversereverse GGTCTGTTGGGAGTGGTATCCGGTCTGTTGGGAGTGGTATCC 서열번호 12SEQ ID NO: 12
Il10(IL-10) Il10 (IL-10) forwardforward CTGCTATGCTGCCTGCTCTTCTGCTATGCTGCCTGCTCTT 서열번호 13SEQ ID NO: 13
reversereverse GCAGTTATTGTCTTCCCGGCGCAGTTATTGTCTTCCCGGC 서열번호 14SEQ ID NO: 14
Il12b(IL-12) Il12b (IL-12) forwardforward TTGCCATCGTTTTGCTGGTGTTGCCATCGTTTTGCTGGTG 서열번호 15SEQ ID NO: 15
reversereverse CACTGTTTCTCCAGGGGCATCACTGTTTCTCCAGGGGCAT 서열번호 16SEQ ID NO: 16
Il17a(IL-17) Il17a (IL-17) forwardforward TCCTGGTCCTGAAGAGGGAGTCCTGGTCCTGAAGAGGGAG 서열번호 17SEQ ID NO: 17
reversereverse CACACCCACCAGCATCTTCTCACACCCACCAGCATCTTCT 서열번호 18SEQ ID NO: 18
Eef2(EEF2) Eef2 (EEF2) forwardforward TGTCAGTCATCGCCCATGTGTGTCAGTCATCGCCCATGTG 서열번호 19SEQ ID NO: 19
reversereverse CATCCTTGCGAGTGTCAGTGACATCCTTGCGAGTGTCAGTGA 서열번호 20SEQ ID NO: 20
그 결과, 2% 덱스트란 설페이트 소듐 처리군(DSS)군에서 결장 길이 감소(도 12a 및 도 12b), 장내 투과도 증가(도 12c), 비장의 크기 및 무게 증가(도 12d 및 도 12e)가 관찰되었다. 또한, 무처리군(Untreated) 대비 2% 덱스트란 설페이트 소듐 처리군(DSS)군에서 전체적인 사이토카인의 발현량 상승이 나타나(도 13a 내지 도 13h), 실험쥐에 염증성 장질환이 유도된 것으로 확인되었다.As a result, in the 2% dextran sulfate sodium treatment group (DSS) group, a decrease in colon length (FIGS. 12A and 12B ), an increase in intestinal permeability (FIG. 12C ), and an increase in the size and weight of the spleen (FIGS. 12D and 12E) were observed. Became. In addition, compared to the untreated group (Untreated) 2% dextran sulfate sodium treatment group (DSS) showed an increase in the overall cytokine expression level (Figs. 13A to 13H), it was confirmed that inflammatory bowel disease was induced in the experimental mice. Became.
실시예 7. 모사 배양된 장내 미생물 군집 배양물 제제의 염증성 장질환 치료 효과 확인Example 7. Confirmation of the therapeutic effect of inflammatory bowel disease of the simulated cultured intestinal microbial community culture formulation
7-1. 체중, 조직학적 평가 및 사이토카인 발현량 분석에 따른 염증성 장질환 치료 효과 확인7-1. Confirmation of the treatment effect of inflammatory bowel disease according to body weight, histological evaluation and analysis of cytokine expression levels
실시예 6의 동물 실험 후, 실시예 3-3의 모사 배양된 건강인 유래 장내 미생물 군집 배양물 제제가 염증성 장질환에서 치료 효과를 나타내는지 확인하였다.After the animal experiment of Example 6, it was confirmed whether the simulated cultured healthy person-derived intestinal microbial community culture formulation of Example 3-3 exhibited a therapeutic effect in inflammatory bowel disease.
구체적으로, 실험쥐는 대변이식 과정 종결 직후, 대변이식의 즉각적인 효과를 관찰하기 위하여, 실험 12일차에 실시예 4-3과 동일한 방법으로 실험쥐를 희생하였다. 대변이식 사후 경과를 추적하기 위하여, 실험 12일차부터 15일차까지 자연적인 회복(spontaneous recovery)을 유도한 뒤, 15일 차에 추가로 희생하여 사이토카인의 발현양을 분석하였다. 또한, 15일의 실험기간 동안 실험쥐의 체중변화를 추적하였다.Specifically, the rats were sacrificed on the 12th day of the experiment in the same manner as in Example 4-3 in order to observe the immediate effect of the fecal transplant immediately after the completion of the fecal transplant process. In order to follow the post-stool transplantation, spontaneous recovery was induced from the 12th to the 15th day of the experiment, and the amount of cytokine expression was analyzed by additional sacrifice on the 15th day. In addition, the weight change of the mice was tracked during the 15-day experiment.
한편, 염증의 정도를 조직병리학적으로 평가하기 위하여, 당업계에서 최적 표준(gold standard)으로 사용되는 헤마톡실린 및 에오신 염색(hematoxylin and eosin staining, H&E staining)을 수행하였다. 회수된 결장(colon)은 0.5cm 길이의 절편으로 횡단면을 절개한 뒤, 점막면이 바깥을 향하게 하여 스위스 롤(swiss-rolling) 방식으로 시료를 준비하고 10%(v/v) 포르말린(formalin) 용액에 침지하여 4℃에서 16시간동안 고정(fixation)하였다. 이후 Wirtz 등 2017의 방법에 따라, 헤마톡실린과 에오신으로 염색하고 현미경으로 관찰하였다.Meanwhile, in order to evaluate the degree of inflammation histopathologically, hematoxylin and eosin staining (H&E staining), which is used as a gold standard in the art, was performed. The recovered colon was incised in a cross section with a section of 0.5 cm in length, and the sample was prepared by swiss-rolling with the mucosal surface facing outward, and 10% (v/v) formalin. It was immersed in the solution and fixed at 4°C for 16 hours. Thereafter, according to the method of Wirtz et al. 2017, staining with hematoxylin and eosin was observed under a microscope.
그 결과, 실험쥐의 체중이 실험 5일차부터 감소한 뒤, 대변 이식이 종결된 12일차부터 다시 증가한 것으로 나타났고, cFMT 군의 15일차 체중은 무처리군 대비 유의적인 차이가 없는 것으로 확인되었다(도 14a 및 도 14b). 또한, 대변 이식을 받은 nFMT 군, hFMT 군 및 cFMT 군 모두에서, DSS 군 대비 결장 조직의 손상 정도가 완화된 것으로 확인되었다(도 14c).As a result, it was found that the weight of the mice decreased from the 5th day of the experiment and then increased again from the 12th day when the stool transplant was terminated, and it was confirmed that the weight of the cFMT group on the 15th day was not significantly different compared to the untreated group (Fig. 14a and 14b). In addition, in all of the nFMT group, hFMT group, and cFMT group that received stool transplantation, it was confirmed that the degree of damage to the colon tissue was alleviated compared to the DSS group (FIG. 14C).
한편, 사이토카인의 발현량을 분석한 결과, 대변 이식을 받은 nFMT 군, hFMT 군 및 cFMT 군에서 항염증성 사이토카인으로 알려진 IL-4와 IL-10의 발현량이 DSS 군 대비 증가한 반면, (전)염증성 사이토카인의 양은 DSS 군 대비 감소한 것으로 확인되었다(도 15a 내지 도 15h). 또한, nFMT 군, hFMT 군 및 cFMT 군 간의 사이토카인 발현양은 대부분 통계적으로 유의미하지 않은 것으로 나타나, 일반 쥐의 대변, 건강인 유래의 대변 및 실시예 3-3에서 모사 배양된 장내 미생물 군집 배양물 제제의 치료적 효과가 유사한 것으로 확인되었다.On the other hand, as a result of analyzing the expression level of cytokines, the expression levels of IL-4 and IL-10, known as anti-inflammatory cytokines, in the nFMT group, hFMT group and cFMT group that received feces transplantation increased compared to the DSS group, whereas (before) It was confirmed that the amount of inflammatory cytokines decreased compared to the DSS group (FIGS. 15A to 15H ). In addition, the amount of cytokine expression between the nFMT group, hFMT group, and cFMT group appeared to be mostly not statistically significant, and the feces of general rats, feces derived from healthy persons, and intestinal microbial community culture formulations simulated in Example 3-3 It was found that the therapeutic effect of is similar.
7-2. 장내 미생물 군집 분석에 따른 염증성 장질환 치료 효과 확인7-2. Confirmation of inflammatory bowel disease treatment effect by analysis of intestinal microbial community
실시예 6 실험군의 장내 미생물 군집을 미생물 생태학적으로 분석하기 위하여, 차세대 염기서열 분석장치(next generation sequencing, NGS)를 사용하여 실험쥐 대변의 미생물 변화를 추적하였다.Example 6 In order to microbiologically analyze the intestinal microbial community of the experimental group, a next generation sequencing (NGS) was used to track microbial changes in the feces of the experimental mice.
구체적으로, 대변이식이 종결된 직후인 12일차와 실험 종료 시점인 15일차에 실험쥐의 대변을 회수하고, 실시예 4-1과 동일한 방법으로 핵산을 추출한 다음, 중합효소연쇄반응법으로 16S rRNA 유전자 영역의 염기서열 중 일부를 특이적으로 증폭하였고, PCR 산물을 정제하여 차세대 염기서열 분석에 사용하였다. 또한, 실시예 4-1과 동일한 방법으로 분석된 서열 정보를 처리하였다.Specifically, on the 12th day immediately after the completion of the stool transplantation and on the 15th day at the end of the experiment, the feces of the mice were recovered, nucleic acids were extracted in the same manner as in Example 4-1, and then 16S rRNA was carried out by polymerase chain reaction. Part of the nucleotide sequence of the gene region was specifically amplified, and the PCR product was purified and used for next-generation sequencing. In addition, sequence information analyzed in the same manner as in Example 4-1 was processed.
상기 차세대 염기서열 분석결과로부터 각 실험군 별 12 일차 및 15 일차의 실험쥐 장내 미생물의 개별 계통분류학적 분류군을 과(family) 수준에서 추적한 결과, nFMT 군 및 cFMT 군에서 대표적인 장내 유익균으로 알려진 Bifidobacteriaceae 및 Akkermensiaceae의 증가가 나타나(16a 및 도 16b), 모사 배양된 건강인 유래 장내 미생물 군집 배양물 제제의 치료 효과를 확인하였다.From the results of the next-generation sequencing, the individual phylogenetic taxa of the mice intestinal microbes on the 12th and 15th days of each experimental group were tracked at the family level.As a result, Bifidobacteriaceae, which are known as representative intestinal beneficial bacteria in the nFMT group and cFMT group, and The increase in Akkermensiaceae appeared (16a and 16b), confirming the therapeutic effect of the intestinal microbial community culture preparation derived from a simulated healthy person.
이제까지 본 발명에 대하여 그 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.So far, the present invention has been looked at around the examples. Those of ordinary skill in the art to which the present invention pertains will be able to understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative point of view rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the above description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

Claims (18)

  1. 인간 장내 미생물 군집 모사 배양용 조성물에 있어서,In the composition for cultivating mimic human intestinal microbial community,
    상기 조성물은 혐기성인 것인 인간 장내 미생물 군집 모사 배양용 조성물.The composition is an anaerobic composition for cultivating a human intestinal microbial community.
  2. 제 1 항에 있어서, 상기 조성물은 소 뇌 추출물(Calf Brains, infusion), 소 심장 추출물(Beef Heart, infusion) 및 프로테오스 펩톤(Proteose peptone)으로 이루어진 군으로부터 선택되는 하나 이상의 성분을 더 포함하는 것인 인간 장내 미생물 군집 모사 배양용 조성물.The method of claim 1, wherein the composition further comprises at least one component selected from the group consisting of a cow brain extract (Calf Brains, infusion), a cow heart extract (Beef Heart, infusion), and a proteose peptone. The human intestinal microbial community simulation composition for cultivation.
  3. 제 1 항에 있어서, 상기 조성물은 수용성 녹말(Soluble starch), 피루브산 나트륨(Sodium pyruvate) 및 L-아르기닌(L-Arginine)으로 이루어진 군으로부터 선택되는 하나 이상의 성분을 더 포함하는 것인 인간 장내 미생물 군집 모사 배양용 조성물.The human gut microbial community according to claim 1, wherein the composition further comprises at least one component selected from the group consisting of water-soluble starch, sodium pyruvate, and L-arginine. Composition for simulated culture.
  4. 제 1 항에 있어서, 상기 조성물은 카제인의 췌장 소화물(Pancreatic digest of casein) 및 콩의 파파인 소화물(Papaic digest of soybean)로 이루어진 군으로부터 선택되는 하나 이상의 성분을 더 포함하는 것인 인간 장내 미생물 군집 모사 배양용 조성물.The method of claim 1, wherein the composition further comprises at least one component selected from the group consisting of Pancreatic digest of casein and Papain digest of soybean. Composition for culture.
  5. 제 1 항에 있어서, 상기 조성물의 pH는 7.2 내지 7.4인 것인 인간 장내 미생물 군집 모사 배양용 조성물.The composition of claim 1, wherein the composition has a pH of 7.2 to 7.4.
  6. 피험체의 대변으로부터 미생물 군집 현탁액을 준비하는 단계;Preparing a microbial community suspension from the subject's feces;
    상기 현탁액을 제 1 항의 조성물에 접종하는 단계; 및Inoculating the suspension into the composition of claim 1; And
    상기 조성물을 배양하는 단계Culturing the composition
    를 포함하는 인간 장내 미생물 군집 모사 배양 방법.Human intestinal microbial community simulation culture method comprising a.
  7. 제 6 항에 있어서, 상기 배양하는 단계는 혐기성 조건에서 이루어지는 것인 인간 장내 미생물 군집 모사 배양 방법.The method of claim 6, wherein the culturing is performed under anaerobic conditions.
  8. 제 6 항에 있어서, 상기 시료를 준비하는 단계는 0ppm 내지 40ppm의 산소 조건에서 이루어지는 것인 인간 장내 미생물 군집 모사 배양 방법.The method of claim 6, wherein the preparing of the sample is performed under an oxygen condition of 0 ppm to 40 ppm.
  9. 제 6 항에 있어서, 상기 배양하는 단계는 24시간 내지 120시간 동안 이루어지는 것인 인간 장내 미생물 군집 모사 배양 방법.The method of claim 6, wherein the culturing step is performed for 24 to 120 hours.
  10. 제 6 항에 있어서, 상기 배양하는 단계는 0.1 내지 3.0 기압에서 이루어지는 것인 인간 장내 미생물 군집 모사 배양 방법.The method of claim 6, wherein the culturing step is performed at 0.1 to 3.0 atmospheres.
  11. 제 6 항에 있어서, 상기 미생물은 박테로이데테스 문(Bacteroides phylum), 퍼미큐테스 문(Firmicutes phylum), 프로테오박테리아 문(Proteobacteria phylum) 및 액티노박테리아 문(Actinobacteria phylum)으로 이루어지는 군으로부터 선택되는 하나 이상의 미생물 문인 것인 인간 장내 미생물 군집 모사 배양 방법.The method of claim 6, wherein the microorganism is selected from the group consisting of Bacteroides phylum, Firmicutes phylum, Proteobacteria phylum, and Actinobacteria phylum. The human intestinal microbial community simulation culture method that is one or more microbial phylum.
  12. 제 6 항의 방법으로 모사 배양된 미생물 군집의 배양물, 상기 배양물의 농축물 및 상기 배양물의 건조물로 이루어진 군으로부터 선택되는 하나 이상을 유효성분으로 포함하는 미생물 제제.A microbial preparation comprising as an active ingredient at least one selected from the group consisting of a culture of a microbial community simulated by the method of claim 6, a concentrate of the culture, and a dried product of the culture.
  13. 제 12 항의 미생물 제제를 포함하는 염증성 장질환(Inflammatory Bowel Disease, IBD) 또는 클로스트리디움 디피실 감염증( Clostridioides difficile infection, CDI) 예방 또는 치료용 약학적 조성물.Inflammatory Bowel Disease (IBD) or Clostridioides difficile infection (CDI) prevention or treatment pharmaceutical composition comprising the microbial preparation of claim 12.
  14. 제 13 항에 있어서, 상기 염증성 장질환은 궤양성 대장염(Ulcerative Colitis, UC) 또는 크론병(Crohn's Disease, CD)인 것인 약학적 조성물.The pharmaceutical composition of claim 13, wherein the inflammatory bowel disease is Ulcerative Colitis (UC) or Crohn's Disease (CD).
  15. 제 13 항에 있어서, 클로스트리디움 디피실 감염증은 재발성 클로스트리디움 디피실 감염증(recurrent Clostridioides difficile infection) 또는 난치성 클로스트리디움 디피실 감염증(refractory Clostridioides difficile infection)인 것인 약학적 조성물.The pharmaceutical composition of claim 13, wherein the Clostridium difficile infection is a recurrent Clostridioides difficile infection or a refractory Clostridioides difficile infection.
  16. 제 13 항의 조성물을 대상체에 투여하는 단계를 포함하는 염증성 장질환(Inflammatory Bowel Disease, IBD) 또는 클로스트리디움 디피실 감염증( Clostridioides difficile infection, CDI)의 치료 방법.A method of treating Inflammatory Bowel Disease (IBD) or Clostridioides difficile infection (CDI) comprising administering the composition of claim 13 to a subject.
  17. 제 16 항에 있어서, 상기 염증성 장질환은 궤양성 대장염(Ulcerative Colitis, UC) 또는 크론병(Crohn's Disease, CD)인 것인 치료 방법.The method of claim 16, wherein the inflammatory bowel disease is Ulcerative Colitis (UC) or Crohn's Disease (CD).
  18. 제 16 항에 있어서, 클로스트리디움 디피실 감염증은 재발성 클로스트리디움 디피실 감염증(recurrent Clostridioides difficile infection) 또는 난치성 클로스트리디움 디피실 감염증(refractory Clostridioides difficile infection)인 것인 치료 방법.The method of claim 16, wherein the Clostridium difficile infection is a recurrent Clostridioides difficile infection or a refractory Clostridioides difficile infection.
PCT/KR2020/002710 2019-03-04 2020-02-25 Composition for culturing human gut microbiome mimic, method for culturing human gut microbiome mimic by using anaerobic culture system, microbial agent prepared thereby, and use thereof WO2020180037A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2019-0024956 2019-03-04
KR10-2019-0024957 2019-03-04
KR1020190024957A KR20200106419A (en) 2019-03-04 2019-03-04 The imitative culture method of the animal gut microbiome
KR20190024956 2019-03-04

Publications (1)

Publication Number Publication Date
WO2020180037A1 true WO2020180037A1 (en) 2020-09-10

Family

ID=72337299

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/002710 WO2020180037A1 (en) 2019-03-04 2020-02-25 Composition for culturing human gut microbiome mimic, method for culturing human gut microbiome mimic by using anaerobic culture system, microbial agent prepared thereby, and use thereof

Country Status (1)

Country Link
WO (1) WO2020180037A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11680257B2 (en) 2015-05-11 2023-06-20 Mybiotics Pharma Ltd. Systems and methods for growing a biofilm of probiotic bacteria on solid particles for colonization of bacteria in the gut
US11679136B2 (en) 2016-05-25 2023-06-20 Mybiotics Pharma Ltd. Composition and methods for microbiota therapy

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR19990075377A (en) * 1998-03-20 1999-10-15 유주현 Novel Basophils and Microorganisms Producing the Same
KR20120121100A (en) * 2011-04-26 2012-11-05 건국대학교 산학협력단 Novel non-selective media composition for anaerobic bacteria and method for preparing the same
KR20140082964A (en) * 2011-10-11 2014-07-03 아힘 바이오테라퓨틱스 에이비 Composition comprising anaerobically cultivated human intestinal microbiota
KR20180041144A (en) * 2015-08-25 2018-04-23 이뮨바이오테크 메디컬 스웨덴 아베 Compositions and methods for the treatment and prevention of intestinal infections and inflammation
KR20190004586A (en) * 2017-07-04 2019-01-14 (주)바이오일레븐 The method of stool suggestion for FMT

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR19990075377A (en) * 1998-03-20 1999-10-15 유주현 Novel Basophils and Microorganisms Producing the Same
KR20120121100A (en) * 2011-04-26 2012-11-05 건국대학교 산학협력단 Novel non-selective media composition for anaerobic bacteria and method for preparing the same
KR20140082964A (en) * 2011-10-11 2014-07-03 아힘 바이오테라퓨틱스 에이비 Composition comprising anaerobically cultivated human intestinal microbiota
KR20180041144A (en) * 2015-08-25 2018-04-23 이뮨바이오테크 메디컬 스웨덴 아베 Compositions and methods for the treatment and prevention of intestinal infections and inflammation
KR20190004586A (en) * 2017-07-04 2019-01-14 (주)바이오일레븐 The method of stool suggestion for FMT

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHANG, S. E.: "Role of Intestinal Microbiota in Inflammatory Bowel Diseases", INTESTINAL RESEARCH., vol. 11, no. 3, 2013, pages 161 - 168 *
KIM, JUNG MOGG.: "Inflammatory Bowel Diseases and Enteric Microbiota", THE KOREAN JOURNAL OF GASTROENTEROLOGY, vol. 55, 2010, pages 4 - 18, XP055737026 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11680257B2 (en) 2015-05-11 2023-06-20 Mybiotics Pharma Ltd. Systems and methods for growing a biofilm of probiotic bacteria on solid particles for colonization of bacteria in the gut
US11679136B2 (en) 2016-05-25 2023-06-20 Mybiotics Pharma Ltd. Composition and methods for microbiota therapy

Similar Documents

Publication Publication Date Title
Kitahara et al. Bacteroides plebeius sp. nov. and Bacteroides coprocola sp. nov., isolated from human faeces
Pridgeon et al. Molecular identification and virulence of three Aeromonas hydrophila isolates cultured from infected channel catfish during a disease outbreak in west Alabama (USA) in 2009
WO2020075949A1 (en) Novel lactobacillus plantarum strain atg-k2, atg-k6 or atg-k8, and composition for preventing or treating vaginitis comprising same
Bakir et al. Bacteroides dorei sp. nov., isolated from human faeces
WO2020180037A1 (en) Composition for culturing human gut microbiome mimic, method for culturing human gut microbiome mimic by using anaerobic culture system, microbial agent prepared thereby, and use thereof
Wang et al. Isolation of a Lysinibacillus fusiformis strain with tetrodotoxin-producing ability from puffer fish Fugu obscurus and the characterization of this strain
Gupta et al. Ignatzschineria indica sp. nov. and Ignatzschineria ureiclastica sp. nov., isolated from adult flesh flies (Diptera: Sarcophagidae)
WO2019088379A1 (en) Novel lactic acid bacteria and use thereof
WO2014133323A1 (en) Novel bacteriophage and antibacterial composition comprising the same
WO2014133322A1 (en) Novel bacteriophage and antibacterial composition comprising the same
WO2013157813A1 (en) Novel bacteriophage, and antibacterial composition containing same
Demirkan et al. Isolation and characterisation of a novel spirochaete from severe virulent ovine foot rot
WO2017179766A1 (en) Method for preparing gram-positive bacterial ghosts by hydrochloric acid treatment
Tsang et al. Gordonia hongkongensis sp. nov., isolated from blood culture and peritoneal dialysis effluent of patients in Hong Kong
WO2015088227A1 (en) Novel lactic acid bacteria and composition containing same for preventing or treating infant diarrhea
WO2019004668A1 (en) Nanovesicle derived from proteus genus bacteria, and use thereof
US20230407241A1 (en) A novel probiotic streptococcus salivarius strain and its uses
WO2022039561A1 (en) Composition for treating or preventing clostridium difficile infection
Downes et al. Propionibacterium acidifaciens sp. nov., isolated from the human mouth
Everest et al. Nocardia rhamnosiphila sp. nov., isolated from soil
Lawhon et al. Update on novel taxa and revised taxonomic status of bacteria isolated from nondomestic animals described in 2018 to 2021
Qin et al. Promicromonospora xylanilytica sp. nov., an endophytic actinomycete isolated from surface-sterilized leaves of the medicinal plant Maytenus austroyunnanensis
WO2022231178A1 (en) Novel lactobacillus fermentum atg-v5 strain, or composition for enhancing immunity, comprising same
Tuo et al. Friedmanniella endophytica sp. nov., an endophytic actinobacterium isolated from bark of Kandelia candel
WO2019117427A1 (en) Composition comprising flavobacteriaceae bacterium trm1-10 or closely related strain for controlling plant disease and promoting plant growth

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20766756

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20766756

Country of ref document: EP

Kind code of ref document: A1