WO2021039951A1

WO2021039951A1 - Injection for mastitis

Info

Publication number: WO2021039951A1
Application number: PCT/JP2020/032534
Authority: WO
Inventors: 佳男菊; 方人大田; 智人林; 謙一郎立松; 光博宮澤; 利広津久井; 義勝猪狩; 友久都丸; 久仁子諏訪
Original assignee: 国立研究開発法人農業・食品産業技術総合研究機構; 日本全薬工業株式会社
Priority date: 2019-08-29
Filing date: 2020-08-28
Publication date: 2021-03-04
Also published as: JPWO2021039951A1; JP7360656B2

Abstract

The present invention addresses the problem of providing a means for improving the diffusibility and dispersibility of an active ingredient in udders, in the case of preparing a formulation of granulocyte-macrophage colony stimulating factor which serves as an alternative to an antibiotic and is usable as a novel therapeutic agent for cow mastitis.　The present invention pertains to an injection for mastitis, said injection containing granulocyte-macrophage colony stimulating factor as an active ingredient together with a medium-chain fatty acid monoglyceride as an additive.

Description

Mastitis injection

The present invention relates to an injectable agent for mastitis, which has excellent diffusibility and dispersibility in the breast and has a long-lasting effect.

Bovine mastitis is a disease in which pathogenic microorganisms such as Staphylococcus aureus and Escherichia coli invade and proliferate in the udder and mammary gland tissue, causing inflammation. This disease is the most common disease in dairy cows, and the damage caused by mastitis is caused by a decrease in milk production, deterioration of milk quality, selection renewal cost, treatment cost, loss of raw milk disposal during the shipping restriction period, etc. Causes serious damage to dairy farming. The number of dairy cows raised in Japan is steadily decreasing year by year, but the number of cases of lactation diseases including mastitis is on the rise, despite the recent improvements in veterinary medical technology and the performance of milking equipment. However, it is still difficult to control mastitis. In addition, when the milk yield and milk quality deterioration due to latent mastitis with no visible clinical symptoms are taken into consideration, the total damage to mastitis is further exacerbated.

When mastitis develops, a treatment method in which an injectable agent for mastitis is administered to the udder of a domestic animal suffering from mastitis has been widely used. Most mastitis injections are made by turbid the main ingredient consisting of antibiotics with an oily base such as rapeseed oil, and by injecting this mastitis injection directly into the breast, many mastitis can be prevented. Healing or alleviation of symptoms. Penicillin antibiotics were used as the main ingredient in mastitis infusions in the olden days, then synthetic penicillin antibiotics were used, and then cephem antibiotics were used, and now cephem antibiotics are the most frequently used. ing.

However, such treatment using antibiotics for mastitis has problems such as the emergence of resistant bacteria, the residual drug in livestock products (milk, etc.) due to the emergence of resistant bacteria, and the chronicity of the disease. .. Moreover, the therapeutic effect using antibiotics is not always satisfactory. One reason for this is that most of the conventional mastitis injections are generally those in which the base material is simply suspended in an oily base, and it is considered that the diffusivity and dispersibility of the base material are insufficient. .. Amid concerns about such antibiotic problems, the development of therapeutic agents aimed at reducing the amount of antibiotics used has been attempted in Japan and overseas in the field of veterinary drugs such as bovine mastitis therapeutic agents. ing. For example, as a next-generation therapeutic agent for mastitis that replaces antibiotics, the use of cytokines, which are biological proteins intended to enhance the immune function in the breast, is being studied.

Granulocyte-macrophage colony stimulating factor (GM-CSF), which is one of the cytokines, has an excellent effect of enhancing phagocytic cell function in milk and producing inflammatory cytokines, and is most expected as a next-generation therapeutic agent for mastitis. There is. So far, a technique for efficiently producing bovine granulocyte-macrophage colony-stimulating factor (bGM-CSF) using recombinant (TG) silkworm has been established (Non-Patent Document 1), and this gene set It has been confirmed that administration of bovine granulocyte-macrophage colony-stimulating factor (TGbGM-CSF) produced in a replacement (TG) silkworm into a dairy tank is effective (Non-Patent Document 2). However, for the practical use of TGbGM-CSF, studies have not been made from the viewpoints of stability as a preparation, improvement of drug delivery and drug efficacy in the breast, and cost reduction.

Therefore, the present invention is a means for improving the diffusivity and dispersibility of the active ingredient in the breast in the formulation of granulocyte-macrophage colony-stimulating factor, which is a new therapeutic agent for bovine mastitis as an alternative to antibiotics. The challenge is to provide.

As a result of diligent research to solve the above problems, the present inventors have added medium-chain fatty acid monoglyceride (MCM) to an injectable agent for mastitis containing granulocyte-macrophage colony-stimulating factor (GM-CSF) as an active ingredient. By doing so, it was found that the dispersibility and diffusivity of GM-CSF in the breast were improved, and a better therapeutic effect on mastitis was obtained as compared with GM-CSF alone, and the present invention was completed.

That is, the present invention includes the following inventions.
(1) An injectable agent for mastitis containing granulocyte-macrophage colony-stimulating factor as an active ingredient and medium-chain fatty acid monoglyceride as an additive.
(2) The mastitis injection agent according to (1), wherein the medium-chain fatty acid monoglyceride is a fatty acid monoglyceride having 8 to 12 carbon atoms.
(3) The mastitis injection agent according to (1) or (2), wherein the granulocyte-macrophage colony-stimulating factor is a recombinant bovine granulocyte-macrophage colony-stimulating factor based on a silk moth expression system.
(4) A method for treating and / or preventing mastitis, which comprises a step of administering the mastitis injection according to any one of (1) to (3) to dairy livestock.
This application claims the priority of Japanese Patent Application No. 2019-157299 filed on August 29, 2019, and includes the contents described in the specification of the patent application.

The injectable for mastitis of the present invention has excellent dispersibility and dispersibility in the breast of granulocyte-macrophage colony stimulating factor (GM-CSF), which is an active ingredient, and therefore is used with a small number of administrations for bovine mastitis. A high therapeutic effect can be obtained with the amount. Therefore, the injectable for mastitis of the present invention can significantly reduce the labor and time of dairy farmers in the treatment and management of bovine mastitis and the economic loss due to bovine mastitis.

The results of the proliferation measurement test of GM-CSF-dependent cells in the presence of MCM are shown. The time course of the linear score change rate after intramammary injection of cephem antibiotic-containing lactation breast injection, GM-CSF alone, and MCM-containing GM-CSF for mastitis-affected cows is shown (●: cephem antibiotics). Substance-containing lactating breast infusion, ◆: GM-CSF alone, ▲: GM-CSF containing MCM).

The mastitis injection agent of the present invention contains granulocyte macrophage colony stimulating factor (GM-CSF) as an active ingredient and medium chain fatty acid monoglyceride (MCM) as an additive.

The "granulocyte macrophage colony stimulating factor" (hereinafter, may be referred to as "GM-CSF" in the present specification) used in the present invention is preferably bovine granulocyte macrophage colony stimulating factor (bGM-CSF). The amino acid sequence of bGM-CSF protein and the base sequence of bGM-CSF mRNA are known (Bos taurus colony stimulating factor 2]: GenBank number: Nucleotide NM_174027, Protein NP_776452), and the base sequence and coding region are shown in SEQ ID NO: 1 in the sequence listing. The amino acid sequence of is shown. As the bGM-CSF used in the present invention, a recombinant protein (TGbGM-CSF) produced in the silk moth expression system is preferable, and it consists of the amino acid sequence shown in SEQ ID NO: 2. The amino acid sequences at positions 1 to 19 of the amino acid sequence of SEQ ID NO: 2 correspond to signal peptides derived from silk moth. Therefore, when TGbGM-CSF is used, only the mature protein portion excluding this signal peptide may be used. In addition, a protein consisting of an amino acid sequence in which 1 to several amino acids are deleted, substituted, inserted, or added in the amino acid sequence shown in SEQ ID NO: 2 (excluding the amino acids at positions 1 to 19), or SEQ ID NO: 2 It may be a protein consisting of an amino acid sequence having 90% or more, preferably 95% or more, more preferably 98% or more sequence identity with respect to the amino acid sequence shown in (excluding the amino acids at positions 1 to 19). , Such homologous proteins can be used as well. In addition, in this specification, the term "several" means preferably 10 or less, more preferably 5, 4, or 3.

The content of GM-CSF with respect to the total amount of the mastitis injection agent of the present invention is usually 0.001 to 0.01% by weight, preferably 0.002 to 0.008% by weight, but may be appropriately increased or decreased depending on the therapeutic effect. You may.

The "medium chain fatty acid monoglyceride" used in the present invention (hereinafter, may be referred to as "MCM" in the present specification) is a monoester of glycerin and a medium chain fatty acid. Examples of the constituent fatty acids of the medium-chain fatty acid monoglyceride include saturated or unsaturated fatty acids having 6 to 12 carbon atoms, preferably 8 to 12 carbon atoms, and specifically, caproic acid, enantic acid, caprylic acid, and pelargonic acid. Corresponds to caproic acid, undecylic acid, and lauric acid. Preferred specific examples of the medium-chain fatty acid monoglyceride used in the present invention include, for example, glycerin monocaproic acid ester, glycerin monocaprylic acid ester, glycerin monocaproic acid ester, glycerin monolauric acid ester and the like. These medium-chain fatty acid monoglycerides may be used alone or in combination of two or more. As the medium-chain fatty acid monoglyceride, a commercially available product may be used. For example, Sunsoft 707 (manufactured by Taiyo Kagaku Co., Ltd.), which is a caprylic acid monoester having 8 carbon atoms, and Sunsoft, which is a lauric acid monoester having 12 carbon atoms. Examples include, but are not limited to, 757 (manufactured by Taiyo Kagaku Co., Ltd.).

The content of MCM with respect to the total amount of the mastitis injection agent of the present invention varies depending on the type of the base, but is, for example, 0.5 to 8% by weight, preferably 1 to 6% by weight, more preferably 2.5 to 5%. By weight%.

The base of the mastitis injection agent of the present invention may be an oil-based base or an aqueous base. Oily bases include fats and oils (rapeseed oil, corn oil, olive oil, soybean oil, peanut oil, sunflower oil, cottonseed oil, palm oil, palm oil, sesame oil, castor oil, lard, head, etc.), waxes (lanolin, honey wax, etc.). , Carnauba wax, etc.), hydrocarbons (liquid paraffin, squalane, squalane, vaseline, etc.), fatty acids (lauric acid, myristic acid, palmitic acid, stearic acid, behenic acid, etc.), esters (isopropyl myristate, isopropyl palmitate, etc.) , Cetyl octanoate, glycerin trioctanoate, octyldodecyl myristate, octyl stearate, stearyl stearate, etc.), and examples of the aqueous base include purified water, physiological saline, and lower alcohols (ethanol, isopropanol, etc.). , Higher alcohols (glycerin, propylene glycol, dipropylene glycol, 1,3-butylene glycol, etc.) and the like.

The content of the base in the mastitis injectable of the present invention should be determined by those skilled in the art in consideration of the type of the base, the concentration of all the components such as the main component and other additives contained in the agent. It can be determined and is not particularly limited, but is usually about 50 to 99.5% by weight, preferably about 70 to 98% by weight, based on the total amount of the injection.

The mastitis injectable of the present invention may contain other ingredients that are acceptable as veterinary medicine and food, for example, isotonic agents, antioxidants, preservatives, etc. Examples include preservatives, colorants, viscosity modifiers and the like.

The injectable for mastitis of the present invention can be produced by a person skilled in the art by a usual method. For example, it can be prepared by adding GM-CSF and MCM to an oily base, heating to dissolve it if necessary, cooling, and then mixing and stirring with a homogenizer. Alternatively, it can be prepared by adding MCM to an aqueous base (water for injection, etc.), mixing and stirring with a homogenizer to form an emulsion, and adding GM-CSF to the emulsion.

The dosage form of the mastitis injection agent of the present invention is a liquid agent suitable for injection into the nipple through the nipple opening, and can be packed in an injection cannula so that injection can be facilitated. The mastitis injection agent of the present invention can also be provided in the form of a kit together with an injection cannula.

The method of administering the mastitis injection agent of the present invention is preferably a method of injecting into the mammary gland from the papilla mouth of a domestic animal such as a cow by an injection cannula. When the injectable agent for mastitis of the present invention is infused by the above method, the dose thereof can be appropriately determined by those skilled in the art, but usually, once per 1 bunch of bovine udder, for example, 50 μg to 500 μg of GM-CSF. The amount can be preferably 100 μg to 400 μg. Further, the number of administrations can be appropriately determined by those skilled in the art, but usually only one administration is sufficient.

The timing of administration can also be appropriately set by those skilled in the art. For example, it may be administered during the lactation period, and since the drug can be allowed to act in the breast for a long period of time, it can be administered during the dry period when there is no milking.

The injectable agent for mastitis of the present invention can be used as a therapeutic agent for improving mastitis to a normal state and / or as a preventive agent for suppressing the onset of mastitis. In the present invention, "mastitis" includes both clinical mastitis and latent mastitis (also referred to as non-clinical mastitis). Clinical mastitis has macroscopic abnormalities such as red swelling, fever, pain, or lumps in the milk, whereas latent mastitis is clinical mastitis. Inflammation occurs in the mammary gland without such abnormalities.

The target of administration of the mastitis injection agent of the present invention is dairy livestock (milking livestock) that secrete and produce milk, and examples thereof include cows (dairy cows), goats, sheep, and buffaloes. Dairy cows include normal cows, cows with a possibility of developing mastitis, cows with mastitis, or cows with a history of mastitis. The injectable agent for mastitis of the present invention is used as a therapeutic agent for dairy cows developing mastitis, and for normal dairy cows, dairy cows with a possibility of developing mastitis, or normal dairy cows with a history of developing mastitis. Is effective as a preventive agent.

The therapeutic effect of the mastitis injection agent of the present invention can be determined by measuring the number of milk somatic cells because the number of milk somatic cells increases when the mammary gland is inflamed. Here, the "number of somatic cells in milk" is a general term for leukocytes and deciduous epithelial cells in milk. The number of somatic cells in the milk can be measured by a standard method by those skilled in the art. For example, milk collected from the mammary gland can be diluted if necessary and / or stained with a fluorescent dye or the like, and measured with a dedicated automatic somatic cell number measuring device such as a flow cytometer. When the number of somatic cells in the milk is used as a reference, the level at which the therapeutic effect can be said to be obtained is usually 300,000 / ml or less, more preferably 200,000 / ml or less, and further preferably 100,000 / ml or less. Is. In addition, a "linear score" obtained by logarithmically converting the number of somatic cells in the milk can be used to determine the therapeutic effect. The linear score is an index of mastitis that reflects the mastitis prevalence of the entire herd including healthy cattle, and the number of somatic cells in the milk or the linear score may be used alone for the judgment. Well, or you may combine the number of milk somatic cells with the linear score.

The therapeutic effect can also be determined by measuring the number of pathogens that cause mastitis. A person skilled in the art can measure the number of pathogenic bacteria by a conventional method. For example, milk collected from the mammary gland is diluted stepwise with sterilized physiological saline, applied to a blood agar medium by a flat plate smear method, cultured at 37 ° C. for 48 hours, and then colonies formed on the medium. Count the number to calculate the number of bacteria in milk collection (cfu / ml).

Hereinafter, the present invention will be described in more detail with reference to Examples. However, the present invention is not limited thereto.

(Reference Example) Preparation of Recombinant Bovine Granulocyte Macrophage Colony Stimulating Factor (rbGM-CSF) The recombinant bovine granulocyte macrophage colony stimulating factor (rbGM-CSF) used in the examples was prepared as follows.

(1) Expression system and extraction of rbGM-CSF Using pBGMCSF (prepared by inserting the PCR product of GM-CSF into pGEM-5Zf (-) EcoRV) as a template, GM-CSF SersigBsmU primer (TCGTCTCAAGCTGCACCTACTCGCCCACCC: SEQ ID NO: 3) And BsmBIboGM-CSFL primer (TCGTCTCCCTAGGTCACTTCTGGGCTGGTT: SEQ ID NO: 4) was PCR amplified. The obtained PCR product was cleaved with the restriction enzyme BsmBI and inserted into the BsmBI site of pBac [SerUAS_Ser1intron_hr5 / 3xP3-EYFP_A3-Bla], and the obtained plasmid was used as a UAS construct. Using this UAS construct, a UAS transgenic silk moth strain was created according to the method of Tamura et al. (Tamura T. et al., 2000, Nature Biotechnology, 18, 81-84). As the host strain, the w1-pnd strain of white-eyed, white-egg, and non-diapausing strains maintained by the National Research and Development Corporation, National Agriculture and Food Research Organization was used. The obtained UAS transgenic silk moth line was crossed with a line expressing GAL4 in the central silk gland. Among the obtained next-generation silk moths, individuals having both GAL4 construct and UAS construct were selected by selection markers. The larvae of the 5th instar and 6th day were dissected, and the central silk gland was removed. The target protein was extracted by shaking at 4 ° C. for 2 hours with an extract of 1 mL of 100 mM phosphate buffer (pH 7.2) per central silk gland.

(2) Purification of rbGM-CSF The extract containing the target protein was once freeze-thawed to remove some contaminating proteins. The supernatant is salted out with an ammonium sulfate solution having a concentration of about 60% to remove contaminating proteins as a precipitate, and then salted out with an ammonium sulfate solution having a concentration of about 90% to obtain the target product, GM-CSF. Recovered the concentrated precipitate. The precipitate containing GM-CSF was dissolved in phosphate buffer and purified by hydrophobic interaction liquid chromatography and ion exchange liquid chromatography. When the properties of the sample were observed by electrophoresis for the eluted fraction, two bands, GM-CSF with added sugar chains and GM-CSF without sugar chain modification, could be clearly observed. The sample was further subjected to liquid chromatography using hydroxyapatite as a carrier for the purpose of buffer exchange and endotoxin removal, and the eluted fraction was collected to obtain purified rbGM-CSF.

(Example 1) Effect of medium-chain fatty acid monoglyceride (MCM) on the biological activity of GM-CSF An injection for mammitis containing recombinant GM-CSF as an active ingredient using medium-chain fatty acid monoglyceride (MCM) as an additive. In formulating this product, the effect of MCM on the biological activity of recombinant GM-CSF was evaluated by measuring the in vitro activity of recombinant GM-CSF mixed with MCM. As the recombinant GM-CSF, the purified rbGM-CSF prepared in the reference example was used, and as the medium-chain fatty acid monoglyceride (MCM), Sunsoft 707 (manufactured by Taiyo Kagaku Co., Ltd.), which is a caprylic acid monoester having 8 carbon atoms, was used. ..

The activity of recombinant GM-CSF was confirmed using a GM-CSF-dependent cell line. TF-1, a human GM-CSF-dependent cell line, was passaged into TF-1B in the presence of bovine GM-CSF for more than 20 generations. After washing this TF-1B with Dalveco's phosphate buffered saline (D-PBS), GM-CSF (400 pg / mL) has a cell density of ^{0.5x10 5} cells / mL or 1.0x10 ^{5 cells / mL.} And each concentration of MCM (0%, 0.001% 0.002%, 0.004%, 0.008%) was cultured in a culture medium for 2 days. For MCM, a D-PBS solution containing 0.8% MCM was prepared and mixed with the cell culture medium to the above concentrations. Four hours before the end of culturing, cell proliferation was measured by measuring the absorbance using CellCountigKit-8 (Dojin Chemical Laboratory Co., Ltd.), a reagent for measuring cell proliferation.

The measurement results are shown in Fig. 1. As shown in FIG. 1, it was confirmed that when the MCM concentration was 0.008% or less, the biological activity of GM-CSF was not affected and cell proliferation could be measured.

(Example 2) Evaluation of therapeutic effect of MCM-containing GM-CSF on mastitis-affected cows Using a mastitis injection (MCM-containing GM-CSF) containing medium-chain fatty acid monoglyceride (MCM) as a base together with GM-CSF. The therapeutic effect on mastitis was evaluated. The evaluation was based on the rate of change in the linear score when MCM-containing GM-CSF was intramammarily injected into lactating cows, and the GM-CSF alone or a commercially available cephem antibiotic-containing lactating breast infusion was used in the breast. This was done by comparing with the linear score change rate at the time of internal injection. GM-CSF containing MCM is added to 5 ml of water for injection with MCM (Sunsoft 707: manufactured by Taiyo Kagaku Co., Ltd.) to a concentration of 5% by weight, and then mixed and stirred with a homogenizer to obtain an MCM emulsion. , Prepared by adding 5 ml of water for injection in which 100 μg of purified rbGM-CSF was dissolved (final MCM concentration: 2.5% by weight). The GM-CSF single agent was prepared by dissolving 100 μg of purified rbGM-CSF in 5 ml of water for injection.

The number of somatic cells was measured for milk samples collected from the breasts of 12 lactating cows, and 15 breasts with high logarithmic linear scores were tested (mean ± standard deviation: 6.34 ± 2.27). Breast infusion containing cephem antibiotic (cefazolin) (trade name: cefazolin Z (registered trademark), cefazolin 150 mg), GM-CSF single agent (100 μg / 5 ml / breast) and MCM combination GM-CSF (100 μg /) 5 ml / breast) was injected into 7 breasts, 4 breasts, and 4 breasts, respectively. Cephem antibiotic-containing mammary infusions were injected intramammally for 3 consecutive days according to the usage, and GM-CSF alone and GM-CSF containing MCM were each infused once. The test observation period was -1,0 (immediately before), 0.25, 1,2,3,7,14,21 and 28 days after injection of each drug. The therapeutic effect of each drug was evaluated by determining the relative ratio of the linear scores of the milk on each observation day (linear score change rate) based on the linear score of the milk on the 0th day after injection (set to 1).

The results are shown in Fig. 2. In the group injected with the cephem antibiotic-containing breast injection, the linear score change rate showed a maximum value of 1.23 on 0.25 days after injection, and then reached a minimum value of 0.69 14 days after injection. Then, 28 days after the injection, it showed 0.75. In the group injected with GM-CSF monotherapy, the linear score change rate showed a maximum value of 1.31 on 0.25 days after injection, and then reached a minimum value of 0.80 7 days after injection. Then, 28 days after the injection, it showed 1.12. In contrast, in the group injected with MCM-containing GM-CSF, the linear score change rate showed a maximum value of 1.14 1 day after injection and then gradually decreased to a minimum value of 0.69 28 days after injection. From these results, MCM-containing GM-CSF has a lower minimum linear score change rate than GM-CSF alone, and the 28-day linear score change rate gradually and constantly decreases and rises again. It was shown that the efficacy of GM-CSF was enhanced and that it was long-lasting by adding MCM as a base of GM-CSF. In addition, since the maximum value of the linear score change rate of GM-CSF containing MCM is the lowest, an excessive inflammatory reaction after injection is not induced and side reactions are small, so that it can be said to be excellent in terms of safety. In addition, since GM-CSF containing MCM has the same effect as the conventional continuous administration of cephem antibiotic-containing breast infusion for 3 days, the number of administrations of GM-CSF containing MCM is small. It is possible to reduce the labor and time burden of the user.

The present invention can be used in the field of manufacturing veterinary medicine.
All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety.

Claims

An injection agent for mastitis containing granulocyte-macrophage colony-stimulating factor as an active ingredient and medium-chain fatty acid monoglyceride as an additive.
The injection agent for mastitis according to claim 1, wherein the medium-chain fatty acid monoglyceride is a fatty acid monoglyceride having 8 to 12 carbon atoms.
The mastitis injection according to claim 1 or 2, wherein the granulocyte-macrophage colony-stimulating factor is a recombinant bovine granulocyte-macrophage colony-stimulating factor based on a silk moth expression system.
A method for treating and / or preventing mastitis, which comprises a step of administering the mastitis injection according to any one of claims 1 to 3 to dairy livestock.