WO2021025413A1 - 베타-락탐 항생제에 대한 내성을 가지는 병원성 균주의 직접 검출 방법 - Google Patents

베타-락탐 항생제에 대한 내성을 가지는 병원성 균주의 직접 검출 방법 Download PDF

Info

Publication number
WO2021025413A1
WO2021025413A1 PCT/KR2020/010228 KR2020010228W WO2021025413A1 WO 2021025413 A1 WO2021025413 A1 WO 2021025413A1 KR 2020010228 W KR2020010228 W KR 2020010228W WO 2021025413 A1 WO2021025413 A1 WO 2021025413A1
Authority
WO
WIPO (PCT)
Prior art keywords
ctx
protein
mass spectrometry
mass
beta
Prior art date
Application number
PCT/KR2020/010228
Other languages
English (en)
French (fr)
Inventor
천종기
백제현
양원석
이세영
Original Assignee
(재)씨젠의료재단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (재)씨젠의료재단 filed Critical (재)씨젠의료재단
Priority to US17/632,110 priority Critical patent/US20220276211A1/en
Priority to EP20849882.4A priority patent/EP4009052A4/en
Publication of WO2021025413A1 publication Critical patent/WO2021025413A1/ko

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G01N30/88—Integrated analysis systems specially adapted therefor, not covered by a single one of the groups G01N30/04 - G01N30/86
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B01—PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01D—SEPARATION
    • B01D15/00—Separating processes involving the treatment of liquids with solid sorbents; Apparatus therefor
    • B01D15/08—Selective adsorption, e.g. chromatography
    • B01D15/26—Selective adsorption, e.g. chromatography characterised by the separation mechanism
    • B01D15/36—Selective adsorption, e.g. chromatography characterised by the separation mechanism involving ionic interaction
    • B01D15/361—Ion-exchange
    • B01D15/363—Anion-exchange
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/18—Testing for antimicrobial activity of a material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/96—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation using ion-exchange
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6848—Methods of protein analysis involving mass spectrometry
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N30/00—Investigating or analysing materials by separation into components using adsorption, absorption or similar phenomena or using ion-exchange, e.g. chromatography or field flow fractionation
    • G01N30/02—Column chromatography
    • G01N30/88—Integrated analysis systems specially adapted therefor, not covered by a single one of the groups G01N30/04 - G01N30/86
    • G01N2030/8809—Integrated analysis systems specially adapted therefor, not covered by a single one of the groups G01N30/04 - G01N30/86 analysis specially adapted for the sample
    • G01N2030/8813—Integrated analysis systems specially adapted therefor, not covered by a single one of the groups G01N30/04 - G01N30/86 analysis specially adapted for the sample biological materials
    • G01N2030/8831—Integrated analysis systems specially adapted therefor, not covered by a single one of the groups G01N30/04 - G01N30/86 analysis specially adapted for the sample biological materials involving peptides or proteins
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/914—Hydrolases (3)
    • G01N2333/978—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • G01N2333/986—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in cyclic amides (3.5.2), e.g. beta-lactamase (penicillinase, 3.5.2.6), creatinine amidohydrolase (creatininase, EC 3.5.2.10), N-methylhydantoinase (3.5.2.6)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2560/00—Chemical aspects of mass spectrometric analysis of biological material

Definitions

  • the present invention relates to a method of directly detecting a protein related to resistance to beta-lactam antibiotics without pretreatment of a specimen through top-down mass spectrometry.
  • Gene diagnosis technology using real-time PCR is also required to undergo complex and expensive sample preparation in the process of gene extraction and amplification, and prior information on the nucleotide sequence of the target gene is essential, as well as detection of the gene of an enzyme that has already lost antibiotic decomposition activity. For this reason, it has limitations in applying it to rapid and accurate mass diagnosis, such as that inaccurate information on whether or not tolerance is included.
  • Mass spectrometry including MALDI-TOF, is an identification system with low cost and high efficiency compared to sequencing methods such as PCR, and can be an important means necessary for rapid identification of microorganisms.After culturing the strain, it is possible to identify from sample processing to identification within 10 minutes. By comparing the mass data in the database built through mass spectrometry data on unknown strains, strains with matching mass values can be quickly identified.
  • the present inventors select proteins directly involved in beta-lactam antibiotic resistance, measure the exact mass value of their active form in vivo, and then top-down without pretreatment such as enzyme treatment. down)
  • the present inventors have made intensive research efforts to develop an efficient diagnostic method for detecting a beta-lactamase protein, which is involved in beta-lactam antibiotic resistance, with a simple and high reliability.
  • ESBL Extended Spectrum ⁇ -Lactamase proteins of strains having resistance to beta-lactam antibiotics exist in an active form in which the N-terminal residue of a certain length was truncated in vivo after infection.
  • the present invention was completed by discovering that, when these active ESBL proteins are directly identified through mass spectrometry, it is possible to quickly and accurately discriminate not only the antibiotic resistance of the pathogenic strain, but also the type of resistance-related protein.
  • an object of the present invention is to provide a method for detecting pathogenic strains having resistance to beta-lactam antibiotics in a biological sample.
  • Another object of the present invention is to provide a method for identifying a protein related to resistance to beta-lactam antibiotics in a biological sample.
  • a method of detecting a pathogenic strain having resistance to beta-lactam antibiotics in a biological sample comprising the following steps of the present invention:
  • ESBL Extended Spectrum ⁇ -Lactamase proteins of strains having resistance to beta-lactam antibiotics exist in an active form in which the N-terminal residue of a certain length was truncated in vivo after infection.
  • ESBL Extended Spectrum ⁇ -Lactamase
  • the "pathogenic strain” is, for example, Staphylococcus, Streptococcus, Escherichia coli, Pneumococcus, Pseudomonas aeruginosa, Sudomonas aeruginosa, Sudomonas otidis, Micrococcus luteus, Citrobacter Koseri, Protus Mira Including, but not limited to, bilis and Mycobacterium ulcerans, includes all bacteria that act as a cause of infection or disease.
  • the term “having resistance to antibiotics” means a case in which the microorganism can grow even in an environment in which antibiotics against a specific pathogenic microorganism are present at a high concentration or in an effective amount.
  • antibiotic resistance is a protein secreted by pathogenic microorganisms, it can be determined by detecting the presence of a degrading enzyme that decomposes the antibiotic and removes or reduces its activity.
  • a degrading enzyme that decomposes the antibiotic and removes or reduces its activity.
  • penicillin, cephalosporin, monobactam, carbapenem, etc. which are beta-lactam antibiotics that inhibit bacterial cell wall synthesis, are neutralized by beta-lactamase and do not inhibit pathogens that express them. can not do it.
  • the term “tolerance” is used interchangeably with “resistance” or “low therapeutic responsiveness”.
  • treatment refers to (a) inhibition of the development of a disease, disease or condition; (b) alleviation of the disease, disease or condition; Or (c) to eliminate the disease, disease or condition.
  • therapeutic reactivity refers to the degree to which beta-lactam antibiotics act as described above in vivo when administered in a therapeutically effective amount to a patient infected with a pathogenic strain.
  • prevention refers to suppressing the occurrence of a disease or disease in a subject that has not been diagnosed as having a disease or disease, but is likely to have such disease or disease. Therefore, “prophylactic reactivity” refers to the degree to which beta-lactam antibiotics act to inhibit infection in vivo when administered in a prophylactically effective amount to a normal person who has not yet confirmed infection.
  • biological sample is any sample containing or likely to contain a pathogenic strain to be inhibited with beta-lactam antibiotics obtained from mammals including humans, blood, tissues, organs, cells or cells Including, but not limited to, culture medium.
  • the term “subject” provides a sample for examining the presence of a pathogenic strain to be inhibited with a beta-lactam antibiotic or whether the strain is resistant to antibiotics, and whether it is ultimately infected by a pathogenic strain having antibiotic resistance.
  • Subjects include, without limitation, humans, mice, rats, guinea pigs, dogs, cats, horses, cows, pigs, monkeys, chimpanzees, baboons or rhesus monkeys, specifically humans.
  • the subject of the present invention may be a patient infected with the strain or a normal subject whose infection has not yet been confirmed ( healthy subject).
  • top-down mass spectrometry refers to an analysis that directly measures the mass value of a full-length protein without undergoing a process of fragmenting the protein into peptide fragments. It refers to an analysis in which the target protein is not fragmented before the protein sample is injected into the mass spectrometer.
  • Another feature of the present invention is that the procedure is simplified by performing direct mass spectrometry on the full length protein without random degradation of the protein using proteases such as trypsin, and It is possible to determine the presence or absence of a target protein with remarkably high reliability in a much shorter period of time compared to the conventional method of indirectly identifying proteins by collecting mass information about the protein and collecting extensive information on the fragmentation tendency of various proteins. .
  • the mass of a protein is the same
  • the mass value measured through the mass spectrometry method of the present invention and the reference mass value for example, the N-terminus in beta-lactamase whose amino acid sequence and molecular weight are known. It means a case in which the 1-28 amino acid residues of are substantially the same as the value corresponding to the removed mass value.
  • Substantially identical means, for example, if the measured Da value or m/z ⁇ z value exists within ⁇ 10 range of the reference mass value, more specifically within ⁇ 7 range, and more specifically within ⁇ 5 range When it exists within, most specifically, it means a case that exists within ⁇ 3 range.
  • the method of the present invention further comprises the step of performing ion exchange chromatography on the protein isolated in step (a).
  • ion-exchange chromatography refers to a target substance that exhibits a charge from a heterogeneous mixture by using a phenomenon in which an ion or a charged compound is bound to an ion exchange resin by an electrostatic force. It means the separation and purification method to separate the.
  • Ion exchange chromatography has an ion exchange resin in which various functional groups are bonded, and the anion exchange resin has a positively charged functional group, which binds the target material with negative charges in the mixture by electrostatic attraction, and the cation exchange resin Specifically binds to the target substance having a positive charge.
  • the ion exchange chromatography used in the present invention is anion exchange chromatography.
  • the anion exchange resin used in the present invention may have, for example, diethylaminoethyl (DEAE) or a quaternary ammonium functional group, but is not limited thereto and a conventional cationic functional group that provides a positive charge to the support.
  • Ramen can be used without limitation.
  • Strong basic anion exchange groups include, for example, Q Sepharose Fast Flow, Q Sepharose High Performance, Resource Q, Source 15Q, Source 30Q, Mono Q, Mini Q, Capto Q, Capto Q ImpRes, Q HyperCel, Q Cermic HyperD F, Nuvia.
  • beta-lactamase detected by the method of the present invention is a CTX-M protein.
  • CTX-M protein is CTX-M1 to CTX-M7, CTX-M9, CTX-M10, CTX-M12 to CTX-M17, CTX-M19 to CTX-M24, CTX-M27 to CTX-M38, CTX-M40 to CTX-M44, CTX-M46 to CTX-M56, CTX-M58 to CTX-M69, CTX-M71 to CTX-M77, CTX-M79 to CTX-M88, CTX-M90, CTX-M92, CTX- M93, CTX-M95 to CTX-M105, CTX-M110 to CTX-M117, CTX-M121 to CTX-M127, CTX-M129 to CTX-M132, CTX-M134, CTX-M136 to CTX-M139, CTX-M141, CTX-M142, CTX-M144, CTX-M146 to CTX-M148, CTX-M150, CTX-M155
  • CTX-M protein is CTX-M1, CTX-M3, CTX-M10, CTX-M15, CTX-M22, CTX-M23, CTX-M28, CTX-M32 to CTX-M34, CTX- M36, CTX-M42, CTX-M52 to CTX-M55, CTX-M58, CTX-M61, CTX-M62, CTX-M64, CTX-M69, CTX-M71, CTX-M72, CTX-M79, CTX-M80, CTX-M82, CTX-M88, CTX-M101, CTX-M103, CTX-M114, CTX-M116, CTX-M117, CTX-M123, CTX-M127, CTX-M132, CTX-M136, CTX-M138, CTX- M142, CTX-M144, CTX-M146, CTX-M150, CTX-M155 to CTX-M158, CTX-M166, CTX-M
  • CTX-M protein is selected from the group consisting of CTX-M1, M14, M15, M27, M142 and M186.
  • the step (a) of the present invention is achieved by adding a surfactant to the biological sample.
  • the present invention it is possible to perform direct mass spectrometry in a top-down method for full-length proteins without fragmentation using a protease.
  • a surfactant is added to a biological sample to be analyzed, the present inventors are able to quickly and accurately identify a target protein without random protein degradation by enzymes as the intact full-length protein present in the cell membrane or cytoplasm is encapsulated. Found.
  • ionic, nonionic, and zwitterionic surfactants may be used without limitation as long as they are general surfactants capable of forming micelles capable of capturing full-length proteins.
  • Ionic surfactants that can be used in the present invention are, for example, DOC (Sodium Deoxycholate), Medialan A, quaternium-60, cetylpyridinium chloride, cetylpyridinium bromide. ), cetyltrimetylammoniumchloride, cetyltrimetylammonium bromide, and Gardinol, but are not limited thereto.
  • DOC Sodium Deoxycholate
  • Medialan A quaternium-60
  • cetylpyridinium chloride cetylpyridinium bromide.
  • cetyltrimetylammoniumchloride cetyltrimetylammonium bromide
  • Gardinol Gardinol
  • Nonionic surfactants that can be used in the present invention include, for example, OG ( n- octyl- ⁇ -D-glucopyranoside), OTG ( n- octyl- ⁇ -D-thioglucopyranoside), OGNG (Octyl Glucose Neopentyl Glycol) and DDM.
  • OG n- octyl- ⁇ -D-glucopyranoside
  • OTG n- octyl- ⁇ -D-thioglucopyranoside
  • OGNG Octyl Glucose Neopentyl Glycol
  • DDM n- Dodecyl- ⁇ -D-maltopyranoside
  • DDTM n- Dodecyl- ⁇ -D-thiomaltopyranoside
  • the zwitterionic surfactant that can be used in the present invention is, for example, cocamidopropylbetaine, lauramidopropylbetaine, lauryl betaine, coco-betaine, myristylbetaine, cocodimethylcarboxymethylbetaine, Lauryldimethylcarboxymethylbetaine, cocamidopropyl hydroxylsulfatein, coco-hydroxysulfatein, coco-sultaine, erucamidopropyl hydroxylsulfatein, hydroxylsulfatein, lauramidopropyl hydroxylsulfatein, Lauryl hydroxysulfatein, lauryl sultaine, methoxycinnamidopropyl hydroxysulftaine, myristamidopropyl hydroxysulfatein, oleamidopropyl hydroxysulfatein, and tallowamidopropyl hydroxysulfatein Including, but not limited to.
  • the surfactant of the present invention may be used together with a Lysis buffer in the step of lysing cells to separate proteins expressed by pathogenic strains.
  • the step (a) of the present invention is achieved by applying an osmotic pressure to the biological sample.
  • osmotic lysis by applying osmotic pressure stimulation to cells contained in a biological sample lysis) to separate the target protein.
  • osmotic lysis refers to a process of dissolving cells by allowing excess water to diffuse into cells through osmotic imbalance caused by adding a hypotonic solution to cells.
  • the stock solution may be used without limitation as long as it is a low-concentration solution having a concentration difference between cells or a culture solution thereof so that sufficient water for cell lysis can be introduced, and for example, distilled water may be used.
  • the step (b) of the present invention includes a MALDI-TOF (Matrix-Assisted Laser Desorption/ Ionization Time of Flight) mass spectrometry, SELDI-TOF (Sulface Enhanced Laser Desorption/Ionization Time of Flight).
  • MALDI-TOF Microx-Assisted Laser Desorption/ Ionization Time of Flight
  • SELDI-TOF Surface Enhanced Laser Desorption/Ionization Time of Flight
  • Mass spectrometry Electrospray ionisation time-of-flight (ESI-TOF) mass spectrometry, liquid chromatography-Mass Spectrometry (LC-MS) and liquid chromatography-Mass Spectrometry/ Mass Spectrometry (LC-MS/MS) ) Is made using a mass spectrometry method selected from the group consisting of.
  • MALDI-TOF mass spectrometry involves desorption and ionization by irradiating a laser to a sample supported by a matrix, and then measuring the time-of-flight for the generated ions to reach the detector.
  • a method of analyzing it is possible to quickly and accurately measure the mass of a large biomolecule such as a protein because fragmentation of the target material does not occur.
  • m/z mass-to-charge ratio
  • the mass values are mass values from which 28 amino acid residues at the N-terminus have been removed from the 205 CTX-M proteins described above. Therefore, if any one or more of these mass values are detected as a result of mass spectrometry, it is determined that it is infected with a strain expressing one or more of the above 205 CTX-M proteins, that is, a pathogenic strain having resistance to beta-lactam antibiotics. can do.
  • the mass value (m/z ⁇ z) additionally includes a mass value increased by 16 or 32 to each mass value.
  • the present inventors have found that one or two methionine residues in the CTX-M protein may exist in an oxidized state. Therefore, even when the molecular weight increased by one (16) or two (32) oxygen atoms from the mass values listed above is also determined that the strain expressing the CTX-M protein exists in the sample, the present invention Beta-lactam antibiotic resistance of the strain can be detected more thoroughly.
  • the present invention provides a method for identifying a protein related to resistance to beta-lactam antibiotics in a biological sample comprising the following steps:
  • the present invention provides information on whether the strain has beta-lactam antibiotic resistance as well as what kind of resistance protein is expressed by providing a specific reference mass value from which the N-terminus is removed. Through this information, it is possible to establish a more specific antibiotic administration strategy for a patient by referring to the decomposition ability of each resistant protein to beta-lactam antibiotics, in vivo activity, half-life, and whether it is degraded by proteases.
  • the present invention provides a method for detecting a pathogenic strain having resistance to beta-lactam antibiotics in a biological sample, and a method for identifying a beta-lactam antibiotic resistance-related protein contained in a biological sample. to provide.
  • the present invention can quickly and accurately determine whether the pathogenic strain is resistant to antibiotics as well as the type of resistance-related protein by directly confirming the N-terminal truncated ESBL (Extended Spectrum ⁇ -Lactamase) protein through mass spectrometry Therefore, it can be usefully used to quickly establish an appropriate antibiotic administration strategy in the early stages of infection.
  • FIG. 1 is a diagram showing the results of SDS-PAGE analysis of the expression and size of CTX-M protein derived from antibiotic-resistant strains. As representative examples, SDS- of CTX-M1 protein (FIG. Each of the PAGE results is shown.
  • FIG. 2 is a diagram showing the results of SDS-PAGE analysis of protein expression and size in a recombinant strain including a CTX-M protein derived from a clinical strain and a gene derived from a clinical strain, and a nonionic surfactant (FIG. 2a) and an ionic surfactant (Figure 2b) shows the protein difference between the crude extract and the crude enzyme solution according to the addition.
  • FIG. 3 is a diagram showing the result of confirming the expression and size of a target protein through SDS-PAGE analysis in a sample pretreated by osmotic stimulation.
  • FIG. 4 is a diagram showing the results of separation and purification of a target protein using ion chromatography.
  • Figure 5 is a picture showing the peptide of the CTX-M protein identified as MS-GF+, a table showing the location and sequence information of each identified peptide ( Figure 5a) and the identification of representative CTX-M proteins identified in the strain The alignment results (FIG. 5B) are shown by comparing the range (gray) with the oxidized methionine residues (bold underlined).
  • FIG. 6 is an exemplary tandem spectrum result of a peptide identified as N-terminus and C-terminus in a representative subtype peptide of CTX-M, a chromatogram of separation of CTX-M1 peptide (FIG. 6A ), C-terminus of CTX-M1 Peptide identification results (FIG. 6b), N-terminal peptide identification results of CTX-M1 (FIG. 6C), and N-terminal peptide identification results of CTX-M15 (FIG. 6D) are shown, respectively.
  • FIG. 7 is a diagram showing an example of the results of multiple alignment analysis of the amino acid sequence of the CTX-M protein using the Clustal Omega program and the identification of the conservative amino acid sequence.
  • FIG. 8 is a diagram showing the result of protein identification using a high-resolution mass spectrometer, an elution chromatogram of CTX-M protein (elution at 23.63 min.RT) (FIG. 8A), and a mass spectrum of a multi-charged CTX-M protein (single isotope Mass-28,192 m/z ⁇ z, average molecular weight-28,210 m/z ⁇ z) (Fig.
  • FIG. 9 is a diagram showing an example of a CTX-M protein mass spectrometry spectrum using a low-resolution mass spectrometer (MALDI-TOF).
  • Primer 1 5'- AACTGCAGGATGGTTAAAAAATCACTGCGTCAG -3' (33 nt)
  • Primer 2 5'- GGAATTCTCACAAACCGTTGGTGACGATT -3' (29 nt)
  • oligonucleotide For the oligonucleotide, a restriction enzyme site was added for cloning, and an ORF (Open Reading Frame) was tailored to induce expression directly in the cloning vector.
  • ORF Open Reading Frame
  • the target gene was amplified from the CTX-M template DNA through PCR.
  • the reaction solution was made into a total of 50 ⁇ l PCR reaction solution using 3 ⁇ l of template DNA, 1.25 ul of 5'primer, 1.25 ⁇ l of 3'primer, 1 ⁇ l of dNTPs, and 10 ⁇ l of 5X buffer, and then PCR was performed under the following conditions. : 1) Denaturation-10 seconds at 98°C; 2) Annealing-30 seconds at 57°C; 3) Extension-30 seconds at 72°C.
  • Cloning for the construction of a recombinant plasmid containing the target gene was performed as follows; 1) For the transgene and the vector, both ends of the DNA were cut with sticky ends using a restriction enzyme, and 2) the inserted gene was conjugated to the vector using a DNA ligation enzyme. 3) After that, it was transformed into E. coli ( E. coli Top 10), and 4) recombinant E. coli was selected by the White/Blue screen method. 5) Recombinant plasmid was extracted from the selected strain, and 6) the extracted plasmid was treated with a restriction enzyme to confirm the DNA size. 7) Finally, the inserted gene was confirmed through DNA sequencing.
  • E. coli transformed with the plasmid containing the target gene was inoculated into Luria-bertani liquid medium containing 50 mg/L of ampicillin antibiotic, and cultured at 37° C. for 16 hours or longer.
  • the culture medium was centrifuged at 4,000 rpm for 15 minutes, and the supernatant was removed to harvest the cells.
  • the harvested cells were added to the SDS-sample buffer and heated at 95° C. for 5 minutes, followed by centrifugation at 15,000 rpm for 5 minutes.
  • the expression and size of the target protein were confirmed through SDS-PAGE gel analysis (FIG. 1).
  • the culture medium was centrifuged at 4,000 rpm for 15 minutes, and the supernatant was removed to harvest the cells.
  • a buffer solution (0.25 mM Tris-HCl, 2% OG) was treated and reacted at room temperature for 10 minutes.
  • the prepared crude extract was centrifuged at 15,000 rpm at 4° C. for 10 minutes to separate the supernatant (hereinafter, crude enzyme solution) and a precipitate.
  • the expression and size of the target protein were confirmed through SDS-PAGE analysis from the crude enzyme solution (FIG. 2A).
  • Sample preparation was performed in the following steps: 1) 100 ⁇ l of the expressed cell culture solution was centrifuged to recover cells, 2) the supernatant was removed, and then a buffer solution containing 2% of DOC (Sodium Deoxycholate), a nonionic surfactant ( 0.25 mM Tris-HCl, pH 8.0 and 2% DOC) was added. 3) The turbid solution was incubated at room temperature for 10 minutes and 4) centrifuged at 15,000 rpm at 4° C. for 10 minutes to obtain a crude enzyme solution.
  • DOC Sodium Deoxycholate
  • a nonionic surfactant 0.25 mM Tris-HCl, pH 8.0 and 2% DOC
  • the strain culture was added to the washing buffer (pH 8.0 Tris-HCl + 500mM NaCl), and then incubated at room temperature for 10 minutes. After that, centrifugation was performed at 14,000 g for 10 minutes to remove the supernatant, and incubated for 10 minutes by adding third distilled water.
  • the sample thus pretreated was again separated into a supernatant (a crude enzyme solution) and a precipitate through centrifugation. From the crude enzyme solution, the expression and size of the target protein were confirmed through SDS-PAGE analysis (FIG. 3).
  • a strain confirmed as ESBL positive was collected.
  • the collected strains were subjected to colony PCR using primers used for amplifying the CTX-M gene.
  • the PCR product amplified through this was confirmed the size of the target gene through agar gel electrophoresis.
  • the PCR product whose size was confirmed was confirmed to be the correct genotype of the CTX-M gene through DNA sequencing.
  • the strain of which the genotype was confirmed was cultured using LB liquid medium, and the presence or absence of CTX-M protein was confirmed through SDS-PAGE gel analysis.
  • a recombinant strain containing the CTX-M gene derived from the clinical strain was produced in the same manner as the recombinant strain including the vector containing the existing CTX-M gene, and the recombinant strain was actually expressed through SDS-PAGE gel analysis in the same manner as the clinical strain.
  • the size of the CTX-M protein was confirmed (Fig. 3).
  • Ion exchange chromatography was used to separate/purify the target protein.
  • Q-resin was used as the ion exchange resin, and 500 ⁇ l of the crude enzyme solution was loaded on a column containing the Q-resin, and the eluted solution was collected. Washed with 1 ml of 20 mM Tris-HCl, pH 8.0 buffer solution, and eluted with 1 M NaCl, 20 mM Tris-HCl, pH 8.0 buffer solution. Separated/purified compartments were confirmed by using SDS-PAGE gel for the samples collected in stages (FIG. 4). Finally, high-purity CTX-M protein was isolated/purified from the cell lysate using the same method as above.
  • Proteins whose expression and size were confirmed on the SDS-PAGE gel were identified using the In-gel digestion method and the nano-LC-MS/MS method, thereby confirming the type of antibiotic-resistant protein actually expressed in the strain (FIG. 5).
  • Nano liquid chromatography and high-resolution mass spectrometry were performed to confirm the sequence and range of the active protein expressed in the strain (Q-Exactive HF-X mass spectrometer system). After dissolving the desalted peptide sample with 0.1% formic acid solution, the sample was injected into the column. Peptide samples were separated using a C18 column (75 ⁇ m x 70 cm) and nanoflow liquid chromatography. The sample loading and separation gradient conditions used at this time are as follows:
  • the software for identifying peptides and proteins using bottom-up data was the'MS-GF+' search engine developed by San Diego State University, USA, and protein/peptide identification was selected based on FDR (false discovery rate) 1%.
  • FDR false discovery rate
  • Among the proteins derived from E. Coli CTX-M protein was identified, and 143 peptides were identified (total 90.38% coverage).
  • One or two of the six methionine residues (71, 78, 120, 138, 189, 214) in the form of oxidized methionine were also identified simultaneously. Specifically, the N-terminal sequence peptide of residues 1-28 was not detected, and when considering the sequences except for the 1-28, peptides over all sequence ranges were identified and the coverage was confirmed to be 100% (Fig. 5b, gray background).
  • Example 3 Based on the MS2 result of Example 3, a multi-alignment analysis was performed on a total of 205 CTX-M proteins known in the NCBI (National Center for Biotechnology Information) database to date (FIG. 8). As a result, 98 CTX-M proteins with 97.6% or more conserved amino acid sequence were identified, and 82 CTX-M proteins including the same N-terminal peptide (1-28 aa) as CTX-M-1 were identified. . All 82 proteins identified show a characteristic consisting of a sequence of 291 amino acids.
  • Example 8 Target protein identification using mass spectrometry (Top-down method)
  • Top-Down mass spectrometry was performed to confirm the mass value of the active protein expressed in the strain.
  • a crude protein extract derived from a strain was used, and a Top-Down LC-MS/MS system (Nano-LC and Q-Exactive HF-X mass spectrometer system) was used.
  • MS2 1 micro-scan, 1,000 msec, NCE 50, 1 ⁇ 8 ionized substances are excluded from MS2.
  • Mass spectrometry of the CTX-M protein was obtained using the Bruker Biotyper MALDI-TOF MS instrument. First, 1 ⁇ L of a SA (Sinapinic acid, present at 10 mg/mL in 0.1% TFA/50% acetonitrile) matrix and about 100 ng of CTX-M protein were placed on a plate spot, dried completely, and subjected to mass spectrometry. At this time, the energy used at this time was maximum 30%, random position acquisition was performed, and a total of 2,000 shots of laser was irradiated each 40 shots, and each spectral data was accumulated and obtained. Mass spectrometry was obtained for a range of 10,000 to 40,000 m/z, and +1 CTX-M as well as +2 CTX-M protein was simultaneously detected (FIG. 9).
  • SA Seapinic acid, present at 10 mg/mL in 0.1% TFA/50% acetonitrile
  • the exact mass value of the CTX-M protein was confirmed, and the mass value of the active CTX-M protein from which the N-terminal peptide was removed was confirmed based on the confirmed mass value. Therefore, for all CTX-M proteins identified in NCBI, the exact mass value of active protein can be confirmed through high-resolution or low-resolution mass spectrometry, and rapid/accurate analysis of various types of CTX-M proteins through mass spectrometry. Identification is possible (Table 2).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Toxicology (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Other Investigation Or Analysis Of Materials By Electrical Means (AREA)

Abstract

본 발명은 생물학적 시료 내 베타-락탐계 항생제(β-lactam antibiotics)에 대한 내성을 가지는 병원성 균주의 검출 방법과, 생물학적 시료 내 포함된 베타-락탐계 항생제 내성 관련 단백질을 동정하는 방법에 관한 것이다. 본 발명은 질량분석법을 통해 N-말단이 절단된 ESBL(Extended Spectrum β-Lactamase) 단백질을 직접적으로 확인함으로써 병원성 균주의 항생제 내성 여부는 물론 내성관련 단백질의 종류까지 신속하고 정확하게 판별할 수 있다. 이에, 본 발명은 감염 초기에 적절한 항생제 투여전략을 신속하게 수립하는 데에 유용하게 이용될 수 있다.

Description

베타-락탐 항생제에 대한 내성을 가지는 병원성 균주의 직접 검출 방법
본 발명은 탑-다운(top-down) 질량 분석을 통해 검체 시료에 대한 전처리 없이 베타-락탐 항생제에 대한 내성 관련 단백질을 직접 검출하는 방법에 관한 것이다.
항생제 내성균의 지속적 증가로 인해 상용화된 항생제의 치료효율이 급감하는 상황에서 병원균에 감염된 환자에 대한 적절한 항생제 투여 및 항생제 내성균의 저감화를 동시에 유도함으로써 치료효율을 향상시키기 위한 전략이 활발하게 연구되고 있다. 현재 항생제 내성 여부를 판별하기 위해 최소억제농도(Minimum Inhibition Concentration, MIC) 검사가 시행되고 있으나 필수적 단계인 미생물 배양에 18시간 이상의 시간이 소요되고 정확성도 떨어져 신속한 판별 및 감염 초기의 최적 항생제 선정이 불가능하다. 실시간 PCR 등을 이용한 유전자 진단기술 역시 유전자 추출 및 증폭 과정 등에서 복잡하고 고비용의 시료 전처리를 거쳐야 하고 타켓 유전자의 염기서열에 대한 사전정보가 필수적이라는 점, 이미 항생제 분해 활성을 잃은 효소의 유전자 검출 등으로 인해 내성 여부에 대한 부정확한 정보가 포함되는 점 등 신속, 정확한 대량 진단에 적용하기에는 한계를 가지고 있다.
MALDI-TOF를 비롯한 질량분석법은 PCR 등에 의한 서열분석 방법에 비하여 저비용 고효율의 동정 시스템으로서 미생물의 신속한 동정에 필요한 중요한 수단이 될 수 있는데, 균주 배양 후 시료 처리에서 동정까지 10분 이내에 가능할 뿐 아니라, 미지의 균주에 질량분석 데이터를 통해 구축한 데이터베이스내의 질량 데이터와 비교하여 질량값이 일치되는 균주를 신속하게 동정할 수 있다.
그러나, 종래의 질량 분석법은 정확한 항생제 내성 단백질의 종류를 판별하지 못할 뿐 아니라, 타겟 내성 단백질을 가수분해 효소를 이용하여 펩타이드 단위로 분해한 뒤 이들 절편들의 질량 값을 통해 간접적으로 내성 단백질의 종류를 유추하는 것으로 절차의 번거로움은 물론 신뢰성에서 적지 않은 문제가 있었다.
이에, 본 발명자들은 베타-락탐계 항생제 내성에 직접적으로 관여하는 단백질을 선별하고, 이들의 생체 내 활성형의 정확한 질량값을 측정한 뒤, 이에 대한 효소 처리 등의 전처리 없이 탑-다운(top-down) 질량 분석을 수행하여 신속하면서도 정확하게 베타-락탐계 항생제 내성 균주 및 내성 단백질을 확인할 수 있는 방법을 개발하고자 하였다.
본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 발명자들은 베타-락탐계 항생제 내성에 관여하는 베타-락타마제 단백질을 간단하면서도 높은 신뢰도로 검출하는 효율적 진단방법을 개발하기 위해 예의 연구 노력하였다. 그 결과, 베타-락탐계 항생제 내성을 가지는 균주의 ESBL (Extended Spectrum β-Lactamase) 단백질들이 감염 후 생체 내에서 일정 길이의 N-말단 잔기가 절단된 활성형(active form)으로 존재한다는 사실을 새로이 발견하고, 이들 활성형 ESBL 단백질을 질량분석법을 통해 직접적으로 확인할 경우 병원성 균주의 항생제 내성 여부는 물론 내성관련 단백질의 종류까지 신속하고 정확하게 판별함 수 있음을 발견함으로써, 본 발명을 완성하게 되었다.
따라서 본 발명의 목적은 생물학적 시료 내 베타-락탐계 항생제(β-lactam antibiotics)에 대한 내성을 가지는 병원성 균주의 검출 방법을 제공하는 데 있다.
본 발명의 다른 목적은 생물학적 시료 내 베타-락탐계 항생제 내성 관련 단백질을 동정하는 방법을 제공하는 데 있다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.
본 발명의 일 양태에 따르면, 본 발명 다음의 단계를 포함하는 생물학적 시료 내 베타-락탐계 항생제(β-lactam antibiotics)에 대한 내성을 가지는 병원성 균주의 검출 방법:
(a) 대상체로부터 분리된 생물학적 시료 내에서 병원성 균주가 발현하는 단백질을 분리하는 단계; 및
(b) 상기 분리된 단백질에 대해 탑-다운(top-down) 질량 분석을 수행하는 단계,
상기 질량 분석 결과 N-말단의 28개 아미노산 잔기가 제거된 베타-락타마제(β-lactamase)와 동일한 질량의 단백질이 검출된 경우, 상기 생물학적 시료 내에는 베타-락탐계 항생제에 대한 내성을 가지는 병원성 균주가 존재하는 것으로 판정한다.
본 발명자들은 베타-락탐계 항생제 내성에 관여하는 베타-락타마제 단백질을 간단하면서도 높은 신뢰도로 검출하는 효율적 진단방법을 개발하기 위해 예의 연구 노력하였다. 그 결과, 베타-락탐계 항생제 내성을 가지는 균주의 ESBL (Extended Spectrum β-Lactamase) 단백질들이 감염 후 생체 내에서 일정 길이의 N-말단 잔기가 절단된 활성형(active form)으로 존재한다는 사실을 새로이 발견하고, 이들 활성형 ESBL 단백질을 질량분석법을 통해 직접적으로 확인할 경우 병원성 균주의 항생제 내성 여부는 물론 내성관련 단백질의 종류까지 신속하고 정확하게 판별함으로써, 감염 초기에 적절한 항생제 투여전략을 수립할 수 있음을 발견하였다.
본 명세서에서“병원성 균주”는 예를 들어 포도상구균, 연쇄상구균, 대장균, 폐렴간균, 녹농균, 수도모나스 애루기노사, 수도모나스 오티티디스, 마이크로코커스 루테우스, 시트로박터 코세리, 프로튜스 미라빌리스 및 미코박테리움 울서란스를 포함하나, 이에 제한되지 않고 감염 또는 질환의 원인으로 작용하는 모든 세균을 포함한다.
본 명세서에서“항생세에 대한 내성을 가진다”고 함은 특정 병원성 미생물에 대한 항생제가 고농도로, 또는 유효량으로 존재하는 환경 내에서도 해당 미생물이 생육 가능한 경우를 의미한다. 항생제 내성 여부는 병원성 미생물이 분비하는단백질로서 해당 항생제를 분해하여 그 활성을 제거하거나 저하시키는 분해 효소의 존재를 검출함으로써 판별할 수 있다. 예를 들어, 세균의 세포벽 합성을 억제하는 베타-락탐계 항생제인 페니실린, 세팔로스포린, 모노박탐, 카바페넴 등은 베타-락타마제(β-lactamase)에 의해 무력화되어 이를 발현하는 병원균을 억제하지 못한다. 따라서, 용어“내성”은“저항성” 또는“낮은 치료적 반응성”과 동일한 의미로 사용된다.
본 명세서에서 용어“치료”는 (a) 질환, 질병 또는 증상의 발전의 억제; (b) 질환, 질병 또는 증상의 경감; 또는 (c) 질환, 질병 또는 증상을 제거하는 것을 의미한다. 따라서“치료적 반응성”은 베타-락탐계 항생제가 병원성 균주에 감염된 환자에게 치료적 유효량으로 투여되었을 때 생체 내에서 위와 같은 작용을 하는 정도를 의미한다.
본 명세서에서, 용어“예방”은 질환 또는 질병을 보유하고 있다고 진단된 적은 없으나, 이러한 질환 또는 질병에 걸릴 가능성이 있는 대상체에서 질환 또는 질병의 발생을 억제하는 것을 의미한다. 따라서 “예방적 반응성”은 베타-락탐계 항생제가 아직 감염이 확진되지 않은 정상인에게 예방적 유효량으로 투여되었을 때 생체 내에서 감염을 억제하는 작용을 하는 정도를 의미한다.
본 발명에서 용어“생물학적 시료”는 인간을 포함한 포유동물로부터 얻어지는, 베타-락탐계 항생제로 억제하고자 하는 병원성 균주를 포함하고 있거나 포함할 가능성이 있는 모든 시료로서, 혈액, 조직, 기관, 세포 또는 세포 배양액을 포함하나, 이에 제한되지 않는다.
본 명세서에서 용어“대상체”는 베타-락탐계 항생제로 억제하고자 하는 병원성 균주의 존재 또는 상기 균주의 항생제 내성 여부를 조사하기 위한 시료를 제공하고, 궁극적으로 항생제 내성을 가지는 병원성 균주에 의해 감염되었는지 여부의 분석 대상이 되는 개체를 의미한다. 개체는 제한없이 인간, 마우스, 래트, 기니아 피그, 개, 고양이, 말, 소, 돼지, 원숭이, 침팬지, 비비 또는 붉은털 원숭이를 포함하며, 구체적으로는 인간이다. 본 발명의 조성물은 베타-락탐계 항생제의 치료적 반응성 뿐 아니라 예방적 반응성을 예측하기 위한 정보도 제공하기 때문에, 본 발명의 개체는 균주에 감염된 환자일 수도 있고 아직 감염이 확진되지 않은 정상 개체(healthy subject)일 수도 있다.
본 명세서에서 용어“탑-다운(top-down) 질량 분석”은 단백질을 펩타이드 조각으로 절편화(fragmentation)하는 과정을 거치지 않고도 전장 단백질에 대한 질량값을 직접 측정하는 분석을 의미하며, 구체적으로는 단백질 시료가 질량 분석기에 주입되기 전에 타겟 단백질의 절편화가 이루어지지 않는 분석을 의미한다. 본 발명의 또 다른 특징 중 하나는, 트립신 등의 단백질 분해효소를 이용한 단백질의 무작위적인 분해 없이 전장(full length) 단백질에 대한 직접적인 질량 분석을 수행함으로써 절차가 보다 단순화될 뿐 아니라, 분해된 절편에 대한 질량정보를 수집하고 다양한 단백질들의 절편화 경향에 대한 방대한 정보를 취합하여 간접적으로 단백질을 동정하는 종래 방법에 비해 훨씬 짧은 시간 동안 현저하게 높은 신뢰도로 타겟 단백질의 존재 여부를 판단할 수 있다는 점이다.
본 명세서에서“단백질의 질량이 동일”하다 함은 본 발명의 질량분석 방법을 통해 측정된 질량 값과 참조(reference) 질량 값, 예를 들어 아미노산 서열 및 분자량이 알려진 베타-락타마제에서 N-말단의 1-28 아미노산 잔기가 제거된 질량 값에 해당하는 수치와 실질적으로 동일한 경우를 의미한다. 실질적인 동일이란 예를 들어 측정된 Da 값 또는 m/z × z 값이 참조 질량 값의 ±10 범위 내에 존재하는 경우, 보다 구체적으로는 ±7 범위 내에 존재하는 경우, 보다 더 구체적으로는 ±5 범위 내에 존재하는 경우, 가장 구체적으로는 ±3 범위 내에 존재하는 경우를 의미한다.
본 발명의 구체적인 구현예에 따르면, 본 발명의 방법은 단계 (a)에서 분리된 단백질에 대해 이온교환 크로마토그래피를 수행하는 단계를 추가적으로 포함한다. 본 명세서에서 용어“이온교환 크로마토그래피(ion-exchange chromatography)”는 이온 또는 하전된 화합물이 정전기적인 힘(electrostatic force)에 의해 이온교환수지에 결합하는 현상을 이용하여 비균질성 혼합물로부터 전하를 띄는 목적 물질을 분리해내는 분리 및 정제방법을 의미한다. 이온교환 크로마토그래피는 다양한 작용기가 결합된 이온교환수지(ion exchange resin)를 가지는데, 음이온 교환수지는 양전하를 띄는 작용기를 가져 혼합물 내 음전하를 띄는 목적물질과 정전기적 인력으로 결합하고, 양이온 교환수지는 양전하를 띄는 목적물질과 특이적으로 결합한다.
본 발명의 구체적인 구현예에 따르면, 본 발명에서 이용되는 이온교환 크로마토그래피는 음이온교환 크로마토그래피이다. 본 발명에서 이용되는 음이온교환수지는 예를 들어 디에틸아미노에틸(DEAE) 또는 사차 암모니움(Quaternary ammonium) 작용기를 가질 수 있으나, 이에 제한되지 않고 지지체에 양의 전하를 제공하는 통상적인 양이온성 작용기라면 제한없이 사용될 수 있다. 강염기성의 음이온교환 그룹에는 예를 들어 Q Sepharose Fast Flow, Q Sepharose High Performance, Resource Q, Source 15Q, Source 30Q, Mono Q, Mini Q, Capto Q, Capto Q ImpRes, Q HyperCel, Q Cermic HyperD F, Nuvia Q, UNOsphere Q, Macro-Prep High Q, Macro-Prep 25 Q, Fractogel EMD TMAE(S), Fractogel EMD TMAE Hicap (M), Fractogel EMD TMAE (M), Eshmono Q, Toyopearl QAE-550C, Toyopearl SuperQ-650C, Toyopearl GigaCap Q-650M, Toyopearl Q-600C AR, Toyopearl SuperQ-650M, Toyopearl SuperQ-650S, TSKgel SuperQ-5PW (30), TSKgel SuperQ-5PW (20) 및 TSKgel SuperQ-5PW를 포함하나, 이에 제한되지 않고 당업계에 공지된 모든 음이온교환수지를 사용할 수 있다.
본 발명의 구체적인 구현예에 따르면, 본 발명의 방법으로 검출되는 베타-락타마제는 CTX-M 단백질이다.
보다 구체적으로는 상기 CTX-M 단백질은 CTX-M1 내지 CTX-M7, CTX-M9, CTX-M10, CTX-M12 내지 CTX-M17, CTX-M19 내지 CTX-M24, CTX-M27 내지 CTX-M38, CTX-M40 내지 CTX-M44, CTX-M46 내지 CTX-M56, CTX-M58 내지 CTX-M69, CTX-M71 내지 CTX-M77, CTX-M79 내지 CTX-M88, CTX-M90, CTX-M92, CTX-M93, CTX-M95 내지 CTX-M105, CTX-M110 내지 CTX-M117, CTX-M121 내지 CTX-M127, CTX-M129 내지 CTX-M132, CTX-M134, CTX-M136 내지 CTX-M139, CTX-M141, CTX-M142, CTX-M144, CTX-M146 내지 CTX-M148, CTX-M150, CTX-M155 내지 CTX-M159, CTX-M161 내지 CTX-M184, CTX-M186 내지 CTX-M204, CTX-M206 내지 CTX-M210, CTX-M212 내지 CTX-M216 및 CTX-M218 내지 CTX-M226으로 구성된 군으로부터 선택되는 하나 이상의 단백질이며, 가장 구체적으로는 CTX-M1, CTX-M14, CTX-M15, CTX-M27, CTX-M142 및 CTX-M186으로 구성된 군으로부터 선택되는 하나 이상의 단백질이다.
보다 더 구체적으로는, 상기 CTX-M 단백질은 CTX-M1, CTX-M3, CTX-M10, CTX-M15, CTX-M22, CTX-M23, CTX-M28, CTX-M32 내지 CTX-M34, CTX-M36, CTX-M42, CTX-M52 내지 CTX-M55, CTX-M58, CTX-M61, CTX-M62, CTX-M64, CTX-M69, CTX-M71, CTX-M72, CTX-M79, CTX-M80, CTX-M82, CTX-M88, CTX-M101, CTX-M103, CTX-M114, CTX-M116, CTX-M117, CTX-M123, CTX-M127, CTX-M132, CTX-M136, CTX-M138, CTX-M142, CTX-M144, CTX-M146, CTX-M150, CTX-M155 내지 CTX-M158, CTX-M166, CTX-M167, CTX-M169, CTX-M170, CTX-M172, CTX-M173, CTX-M175 내지 CTX-M184, CTX-M187 내지 CTX-M190, CTX-M193, CTX-M197, CTX-M199, CTX-M201 내지 CTX-M204, CTX-M206 내지 CTX-M209, CTX-M212, CTX-M216, CTX-M218, CTX-M220, CTX-M222 및 CTX-M225로 구성된 군으로부터 선택된다.
가장 구체적으로는, 상기 CTX-M 단백질은 CTX-M1, M14, M15, M27, M142 및 M186으로 구성된 군으로부터 선택된다.
본 발명의 구체적인 구현예에 따르면, 본 발명의 상기 단계 (a)는 상기 생물학적 시료에 계면활성제를 첨가함으로써 이루어진다.
본 발명은 단백질 분해효소를 이용한 절편화(fragmentation) 과정 없이도 전장 단백질에 대한 탑-다운(top-down) 방식의 직접 질량 분석이 가능함은 전술한 바와 같다. 본 발명자들은 분석하고자 하는 생물학적 시료에 계면활성제를 첨가할 경우 세포막 또는 세포질 내에 존재하는 온전한 상태의 전장 단백질이 포집(encapsulation)됨으로써 효소에 의한 무작위적인 단백질 분해 없이도 신속하고 정확하게 타겟 단백질을 동정할 수 있음을 발견하였다.
본 발명에서는 전장 단백질을 포집할 정도의 미포(micelle)를 형성할 수 있는 일반적인 계면활성제라면 이온성, 비이온성 및 양쪽이온성(zwitterionic) 계면활성제 모두 제한 없이 사용될 수 있다.
본 발명에서 이용될 수 있는 이온성 계면활성제는 예를 들어 DOC(Sodium Deoxycholate), 메디알란 A(Medialan A), 쿼터늄-60, 세틸피리디늄 클로라이드(cetylpyridinium chloride), 세틸피리디늄 브로마이드(cetylpyridinium bromide), 세틸트리메틸암모늄 클로라이드(cetyltrimetylammoniumchloride), 세틸트리메틸암모늄 브로마이드(cetyltrimetylammonium bromide) 및 가디놀(Gardinol)을 포함하나 이에 제한되는 것은 아니다.
본 발명에서 이용될 수 있는 비이온성 계면활성제는 예를 들어 OG(n-octyl-β-D-glucopyranoside), OTG(n-octyl-β-D-thioglucopyranoside), OGNG(Octyl Glucose Neopentyl Glycol) 및 DDM(n-Dodecyl-β-D-maltopyranoside), DDTM(n-Dodecyl-β-D-thiomaltopyranoside)을 포함하나, 이에 제한되는 것은 아니다.
본 발명에서 이용될 수 있는 양쪽이온성 계면활성제는 예를 들어 코카미도프로필베타인, 라우라미도프로필베타인, 라우릴 베타인, 코코-베타인, 미리스틸베타인, 코코디메틸카복시메틸베타인, 라우릴디메틸카복시메틸베타인, 코카미도프로필 하이드록시설테인, 코코-하이드록시설테인, 코코-설테인, 에루카미도프로필 하이드록시설테인, 하이드록시설테인, 라우라미도프로필 하이드록시설테인, 라우릴 하이드록시설테인, 라우릴 설테인, 메톡시신나미도프로필 하이드록시설테인, 마이리스타미도프로필 하이드록시설테인, 올레아미도프로필 하이드록시설테인 및 탈로우아미도프로필 하이드록시설테인을 포함하나, 이에 제한되는 것은 아니다.
본 발명의 계면활성제는 병원성 균주가 발현하는 단백질을 분리하기 위해 세포를 용해하는 단계에서 라이시스 완충액과 함께 사용될 수 있다.
본 발명의 구체적인 구현예에 따르면, 본 발명의 상기 단계 (a)는 상기 생물학적 시료에 삼투압을 가함으로서 이루어진다. 본 발명에 따르면, 효율적인 탑-다운(top-down) 방식의 직접 질량 분석을 위해 상술한 계면활성제를 처리하는 방법 외에, 택일적 혹은 추가적으로 생물학적 시료 내 포함된 세포에 삼투압 자극을 가하여 삼투 용해(osmotic lysis)함으로써 목적 단백질을 분리할 수 있다.
본 명세서에서 용어“삼투 용해”는 세포에 저장액(hypotonic solution)을 가하여 야기된 삼투 불균형을 통해 과량의 물이 세포 내부로 확산되도록 함으로써 세포를 용해시키는 과정을 의미한다. 저장액은 세포 용해에 충분한 정도의 물이 유입될 수 있을 만큼 세포 또는 이의 배양액과 농도 차이를 가지는 저농도 용액이라면 제한 없이 사용될 수 있으며, 예를 들어 증류수가 사용될 수 있다.
본 발명의 구체적인 구현예에 따르면, 본 발명의 상기 단계 (b)는 MALDI-TOF(Matrix-Assisted Laser Desorption/ Ionization Time of Flight) 질량분석, SELDI-TOF(Sulface Enhanced Laser Desorption/Ionization Time of Flight) 질량분석, ESI-TOF(Electrospray ionisation time-of-flight) 질량분석, 액상 크로마토그래피-질량분석(liquid chromatography-Mass Spectrometry, LC-MS) 및 LC-MS/MS(liquid chromatography-Mass Spectrometry/ Mass Spectrometry)로 구성된 군으로부터 선택되는 질량분석 방법을 이용하여 이루어진다.
보다 구체적으로는 MALDI-TOF 질량분석을 이용하여 이루어진다.
MALDI-TOF 질량분석은 매트릭스(matrix)로 지지되어 있는 시료에 레이져를 조사하여 탈착 및 이온화시킨 후, 생성된 이온들이 검출기에 도달하는데 소요되는 시간(Time-of-Flight)을 측정하여 이온들의 분자량을 분석하는 방법으로, 타겟 물질의 절편화(fragmentation)가 일어나지 않기 때문에 단백질과 같은 거대 생체분자의 질량을 신속하고 정확하게 측정할 수 있다. 이온화된 분자가 전기장에 의해 가속되고 비행시간이 측정되면 질량 대 전하 비율(mass-to-charge ratio)(m/z)이 생성되는데, 이러한 m/z 값을 통해 타겟 물질의 분자량을 측정할 수 있다. 예를 들어 m/z=30000 (z=+1) 또는 15000(z=+2)일 경우 분자량은 m/z × z = 30000이 된다.
본 발명의 구체적인 구현예에 따르면, 상기 질량 분석 결과 28210, 28287, 28166, 28164, 28203, 28116, 27946, 28153, 28089, 27974, 28108, 27888, 27973, 27964, 28321, 27932, 28165, 28197, 28044, 27916, 28107, 28167, 28273, 28152, 28081, 28212, 28277, 28182, 28139, 28043, 27819, 27810, 28170, 28298, 28356, 28027, 28073, 28001, 28099, 28000, 27974, 28184, 28148, 28136, 28314, 28214, 28263, 28181, 28211, 28156, 28046, 28071, 27947, 28180, 28121, 28154, 28067, 28006, 28291, 28261, 28307, 28135, 28194, 27998, 28134, 27983, 27944, 27958, 28008, 28018, 28002, 28317, 27931, 28289, 28095, 28033, 27798, 28005, 28193, 28059, 28024, 27948, 28109, 28229, 28042, 27852, 28345, 28238, 27992, 28053, 28036, 28094, 28050, 27915, 28260, 28014, 28218, 28092, 28138, 28240, 28078, 28151, 28140, 28131, 28150, 27975, 27889, 27985, 28125, 28313, 28023, 28120, 28178, 28198, 28090, 27976, 28025, 28122, 28224, 27917 및 이들 값의 ±5 범위의 값으로 구성된 군으로부터 선택되는 하나 이상의 질량 값(m/z × z)이 검출된 경우, 상기 생물학적 시료 내에는 베타-락탐계 항생제에 대한 내성을 가지는 병원성 균주가 존재하는 것으로 판정한다.
본 발명에 따르면, 상기 질량 값은 상술한 205개 CTX-M 단백질에서 N-말단의 28개 아미노산 잔기가 제거된 질량 값들이다. 따라서, 질량 분석 결과 이들 중 어느 하나 이상의 질량 값이 검출될 경우, 상술한 205개 CTX-M 단백질 중 하나 이상을 발현하는 균주, 즉 베타-락탐계 항생제에 대한 내성을 가지는 병원성 균주에 감염된 것으로 판정할 수 있다.
본 발명의 구체적인 구현예에 따르면, 상기 질량 값(m/z × z)은 각 질량 값에 16 또는 32만큼 증가된 질량 값을 추가적으로 포함한다.
하기 실시예에서 보는 바와 같이, 본 발명자들은 CTX-M 단백질 내 1개 또는 2개의 메티오닌 잔기가 산화된 상태로 존재할 수 있음을 발견하였다. 따라서, 상기 나열된 질량 값에서 산소 원자 1개(16) 또는 2개(32) 만큼 증가된 분자량이 측정된 경우에도 역시 시료 내에 CTX-M 단백질을 발현하는 균주가 존재하는 것으로 판정함으로써, 본 발명은 균주의 베타-락탐계 항생제 내성을 보다 빈틈없이 검출할 수 있다.
본 발명의 다른 양태에 따르면, 본 발명은 다음의 단계를 포함하는 생물학적 시료 내 베타-락탐계 항생제(β-lactam antibiotics) 내성 관련 단백질을 동정하는 방법을 제공한다:
(a) 대상체로부터 분리된 생물학적 시료 내에서 병원성 균주가 발현하는 단백질을 분리하는 단계;
(b) 상기 분리된 단백질을 탑-다운(top-down) 방식을 통해 질량 분석을 수행하는 단계; 및
(c) 상기 질량 분석 결과와 하기 표 1에 나열된 N-말단의 28개 아미노산 잔기가 제거된 베타-락타마제(β-lactamase)의 질량 값(m/z × z), 상기 질량 값의 ±5 범위 내의 값, 상기 질량 값에 16만큼 증가된 값 및 상기 질량 값에 32만큼 증가된 값으로 구성된 군으로부터 선택되는 질량 값을 비교하여 상기 생물학적 시료 내에 포함된 베타-락탐계 항생제 내성 관련 단백질의 종류를 판정하는 단계.
단백질 질량값 단백질 질량값 단백질 질량값
CTX-M1 28210 CTX-M74 28291 CTX-M159 27915
CTX-M2 28287 CTX-M75 28287 CTX-M161 28046
CTX-M3 28166 CTX-M76 28261 CTX-M162 28166
CTX-M4 28164 CTX-M77 28307 CTX-M163 28108
CTX-M5 28203 CTX-M79 28135 CTX-M164 28136
CTX-M6 28116 CTX-M80 28194 CTX-M165 28260
CTX-M7 28166 CTX-M81 27998 CTX-M166 28238
CTX-M9 27946 CTX-M82 28134 CTX-M167 28212
CTX-M10 28166 CTX-M83 27983 CTX-M168 28014
CTX-M12 28153 CTX-M84 27944 CTX-M169 28081
CTX-M13 28089 CTX-M85 27958 CTX-M170 28107
CTX-M14 27974 CTX-M86 28008 CTX-M171 28218
CTX-M15 28108 CTX-M87 28018 CTX-M172 28092
CTX-M16 27888 CTX-M88 28089 CTX-M173 28138
CTX-M17 27973 CTX-M90 28002 CTX-M174 27916
CTX-M19 27964 CTX-M92 28317 CTX-M175 28240
CTX-M20 28321 CTX-M93 27931 CTX-M176 28078
CTX-M21 27932 CTX-M95 28289 CTX-M177 28151
CTX-M22 28165 CTX-M96 28095 CTX-M178 28138
CTX-M23 28197 CTX-M97 28287 CTX-M179 28140
CTX-M24 28044 CTX-M98 27944 CTX-M180 28138
CTX-M27 27916 CTX-M99 28033 CTX-M181 28131
CTX-M28 28107 CTX-M100 27798 CTX-M182 28136
CTX-M29 28108 CTX-M101 28134 CTX-M183 28135
CTX-M30 28167 CTX-M102 27974 CTX-M184 28095
CTX-M31 28273 CTX-M103 28135 CTX-M186 28108
CTX-M32 28152 CTX-M104 28001 CTX-M187 28170
CTX-M33 28081 CTX-M105 28002 CTX-M188 28138
CTX-M34 28212 CTX-M110 28089 CTX-M189 28078
CTX-M35 28277 CTX-M111 28005 CTX-M190 28150
CTX-M36 28182 CTX-M112 27944 CTX-M191 27975
CTX-M37 28139 CTX-M113 28002 CTX-M192 27944
CTX-M38 28043 CTX-M114 28108 CTX-M193 28138
CTX-M40 27819 CTX-M115 28317 CTX-M194 28108
CTX-M41 27810 CTX-M116 28193 CTX-M195 27889
CTX-M42 28170 CTX-M117 28139 CTX-M196 27985
CTX-M43 28298 CTX-M121 27946 CTX-M197 28094
CTX-M44 28356 CTX-M122 28059 CTX-M198 27974
CTX-M46 28027 CTX-M123 28121 CTX-M199 28125
CTX-M47 28073 CTX-M124 28287 CTX-M200 28313
CTX-M48 28001 CTX-M125 28024 CTX-M201 28023
CTX-M49 28099 CTX-M126 27948 CTX-M202 28120
CTX-M50 28000 CTX-M127 28109 CTX-M203 28194
CTX-M51 27974 CTX-M129 27944 CTX-M204 28178
CTX-M52 28184 CTX-M130 28024 CTX-M206 28139
CTX-M53 28148 CTX-M131 28229 CTX-M207 28166
CTX-M54 28197 CTX-M132 28042 CTX-M208 28166
CTX-M55 28136 CTX-M134 27946 CTX-M209 28120
CTX-M56 28314 CTX-M136 28194 CTX-M210 28138
CTX-M58 28214 CTX-M137 27852 CTX-M212 28198
CTX-M59 28263 CTX-M138 28184 CTX-M213 28090
CTX-M60 28181 CTX-M139 28108 CTX-M214 27976
CTX-M61 28211 CTX-M141 28345 CTX-M215 28025
CTX-M62 28156 CTX-M142 28107 CTX-M216 28138
CTX-M63 28046 CTX-M144 28152 CTX-M218 28122
CTX-M64 28081 CTX-M146 28238 CTX-M219 27976
CTX-M65 28071 CTX-M147 27992 CTX-M220 28139
CTX-M66 28166 CTX-M148 28053 CTX-M221 27900
CTX-M67 27947 CTX-M150 28167 CTX-M222 28224
CTX-M68 28180 CTX-M155 28036 CTX-M223 27917
CTX-M69 28121 CTX-M156 28094 CTX-M224 28108
CTX-M71 28154 CTX-M157 28050 CTX-M225 28138
CTX-M72 28067 CTX-M158 28238 CTX-M226 28136
CTX-M73 28006
본 발명의 생물학적 시료, 항생제 내성 관련 단백질 및 이의 질량측정 방법에 대해서는 이미 상술하였으므로, 과도한 중복을 피하기 위해 그 기재를 생략한다.
본 발명은 N-말단이 제거된 특정 기준(reference) 질량 값을 제공함으로써 균주가 베타-락탐계 항생제 내성을 가지는지 여부 뿐 아니라 어떠한 종류의 내성 단백질을 발현하는지에 대한 정보도 제공한다. 이러한 정보를 통해 각 내성 단백질의 베타-락탐계 항생제 분해력, 생체 내 활성, 반감기 및 프로테아제에 의한 분해 여부 등을 참조하여, 환자에 대한 보다 구체적인 항생제 투여전략을 수립할 수 있다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명은 생물학적 시료 내 베타-락탐계 항생제(β-lactam antibiotics)에 대한 내성을 가지는 병원성 균주의 검출 방법과, 생물학적 시료 내 포함된 베타-락탐계 항생제 내성 관련 단백질을 동정하는 방법을 제공한다.
(b) 본 발명은 질량분석법을 통해 N-말단이 절단된 ESBL(Extended Spectrum β-Lactamase) 단백질을 직접적으로 확인함으로써 병원성 균주의 항생제 내성 여부는 물론 내성관련 단백질의 종류까지 신속하고 정확하게 판별할 수 있어, 감염 초기에 적절한 항생제 투여전략을 신속하게 수립하는 데에 유용하게 이용될 수 있다.
도 1은 항생제 내성 균주 유래 CTX-M 단백질의 발현 및 크기에 대한 SDS-PAGE 분석 결과를 보여주는 그림으로, 대표적인 예시로서 CTX-M1 단백질(도 1a) 및 CTX-M15 단백질(도 1b)의 SDS-PAGE 결과를 각각 나타낸다.
도 2는 임상균주 유래 CTX-M 단백질과 임상균주 유래 유전자를 포함한 재조합 균주에서의 단백질 발현 및 크기에 대한 SDS-PAGE 분석 결과를 보여주는 그림으로, 비이온성 계면활성제(도 2a) 및 이온성 계면활성제(도 2b) 첨가에 따른 조추출액과 조효소액의 단백질 차이를 각각 나타낸다.
도 3은 삼투압 자극으로 전처리한 시료에서 SDS-PAGE 분석을 통해 타겟 단백질의 발현과 크기를 확인한 결과를 보여주는 그림이다.
도 4는 이온 크로마토그래피를 사용한 타겟 단백질의 분리와 정제 결과를 보여주는 그림이다.
도 5는 MS-GF+로 동정된 CTX-M 단백질의 펩타이드를 나타내는 그림으로, 동정된 각 펩타이드의 위치 및 서열 정보펩타이드 정보를 나타낸 표(도 5a) 및 균주에서 동정되는 대표적 CTX-M 단백질들의 동정 범위(회색)와 산화되는 메티오닌 잔기들(볼드체 밑줄)을 비교하여 나타낸 정렬 결과(도 5b)를 각각 보여준다.
도 6은 CTX-M의 대표적 아형 펩타이드에서 N-말단 및 C-말단으로 동정된 펩타이드의 예시적 텐덤 스펙트럼 결과로서, CTX-M1 펩타이드의 분리 크로마토그램(도 6a), CTX-M1의 C-말단 펩타이드 동정 결과(도 6b), CTX-M1의 N-말단 펩타이드 동정 결과(도 6c) 및 CTX-M15의 N-말단 펩타이드 동정 결과(도 6d)를 각각 나타낸다.
도 7은 Clustal Omega 프로그램을 사용한 CTX-M 단백질 아미노산 서열의 다중 정렬(multiple alignment) 분석결과와 보존적 아미노산 서열의 동정 결과의 예시를 보여주는 그림이다.
도 8은 고분해능 질량분석기를 이용한 단백질 동정 결과를 보여주는 그림으로, CTX-M 단백질의 용출 크로마토그램 (RT 23.63분에 용출)(도 8a), 다중 전하된 CTX-M 단백질의 질량 스펙트럼(단일 동위원소 질량 - 28,192 m/z × z, 평균분자량 - 28,210 m/z × z)(도 8b) 및 25가의 CTX-M 단백질 이온에 대한 텐덤 스펙트럼과 29-291 서열에 대한 동정 결과 (위/평균분자량 - 28,210 m/z × z: E = 1.3E-27, 아래/평균분자량 28,210+32 m/z × z: E = 2.36E-25)의 일 예(도 8c)를 각각 나타낸다.
도 9는 저분해능 질량분석기(MALDI-TOF)를 이용한 CTX-M 단백질 질량분석 스펙트럼의 일 예를 보여주는 그림이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
실시예 1. ESBL 유전자의 클로닝 및 항생제 내성 균주의 제작
E. coli 유래 ESBL 단백질에 대한 유전자로부터 얻어진 CTX-M 유전자 서열(유럽분자생물학연구소(EMBL) 염기서열데이터베이스 식별번호: CP008736.1, 876nt) (서열목록 제1서열)의 정보를 기반으로 다음과 같은 올리고 뉴클레오티드를 제작하였다.
프라이머 1: 5’- AACTGCAGGATGGTTAAAAAATCACTGCGTCAG -3’(33 nt)
프라이머 2: 5’- GGAATTCTCACAAACCGTTGGTGACGATT -3’(29 nt)
올리고뉴클레오티드는 클로닝을 위해 제한효소 사이트를 추가했고, 클로닝 벡터에서 직접적으로 발현을 유도하기 위하여 ORF(Open Reading Frame)를 맞추어 제작했다.
CTX-M 주형 DNA로부터 PCR을 통해 타겟 유전자를 증폭하였다. PCR 수행시, 반응액은 주형 DNA 3μl, 5’프라이머 1.25 ul, 3’프라이머 1.25μl, dNTPs 1μl, 5X 버퍼 10μl를 사용하여 총 50μl PCR 반응액으로 만든 후, PCR을 다음과 같은 조건에서 수행하였다: 1) 변성(Denaturation)-98℃에서 10초; 2) 어닐링(Annealing)- 57℃에서 30초; 3) 확장(Extension)- 72℃에서 30초. 타겟 유전자를 포함한 재조합 플라스미드 제작을 위한 클로닝은 다음과 같이 시행하였다; 1) 삽입유전자와 벡터는 제한효소를 사용하여 DNA의 양쪽 끝을 점착성 말단(Sticky end)으로 절단하고, 2) DNA 라이게이즈 효소를 사용하여 삽입 유전자를 벡터에 접합하였다. 3) 그 후에, 대장균(E. coli Top10)에 형질전환하고, 4) White/Blue 스크린 방법으로 재조합 대장균을 선별하였다. 5) 선별된 균주로부터 재조합 플라스미드를 추출하였고, 6) 추출된 플라스미드는 제한효소를 처리하여 DNA 크기를 확인하였다. 7) 최종적으로 DNA 염기서열 분석을 통해 삽입 유전자를 확인하였다.
실시예 2. 타겟 단백질 발현 및 크기 확인
타겟 유전자를 포함한 플라스미드의 형질전환한 대장균은 50mg/L의 암피실린 항생제가 포함된 Luria-bertani 액체배지에 접종하고, 37℃에서 16시간이상 배양하였다. 타겟 단백질의 발현과 크기를 확인하기 위해 배양액은 4,000rpm에서 15분간 원심분리하고, 상등액을 제거하여 세포를 수확하였다. 수확한 세포는 SDS-샘플 완충액을 넣고 95℃에서 5분 동안 가열한 뒤, 15,000rpm으로 5분간 원심분리하였다. 준비된 샘플을 사용하여 SDS-PAGE 젤 분석을 통해 타겟 단백질의 발현과 크기를 확인하였다(도 1).
실시예 3. 시료 전처리 방법 및 조효소액으로부터의 타겟 단백질 확인
(1) 비이온성 계면활성제를 이용한 시료 전처리
시료 전처리를 위해 배양액은 4,000rpm에서 15분 동안 원심분리하고, 상등액을 제거하여 세포를 수확하였다. 조추출액을 확보하기 위해 완충용액(0.25 mM Tris-HCl, 2% OG)을 처리하고 상온에서 10분 동안 반응시켰다. 만들어진 조추출액은 4℃에서 15,000rpm으로 10분 동안 원심분리하여 상등액(이하, 조효소액)과 침전물로 분리하였다. 조효소액으로부터 SDS-PAGE 분석을 통해 타겟 단백질의 발현과 크기를 확인하였다(도 2a).
(2) 이온성 계면활성제를 이용한 시료 전처리
다음의 단계로 시료 전처리를 수행하였다: 1) 발현된 세포배양액 100μl를 원심분리하여 세포를 회수하고, 2) 상등액을 제거한 후, 비이온성 계면활성제인 DOC(Sodium Deoxycholate) 2%를 포함한 완충용액(0.25 mM Tris-HCl, pH 8.0 and 2% DOC)을 첨가하였다. 3) 혼탁액은 10분간 상온에서 인큐베이션하고 4) 4℃에서 15,000rpm으로 10분 동안 원심분리하여 조효소액을 확보하였다.
비이온성 계면활성제(OG)와 이온성 계면활성제(DOC)를 처리한 조추출액과 조효소액은 각각 SDS-PAGE 젤 분석을 통하여 단백질의 발현 및 크기를 확인하였다(도 2b).
(3) 삼투압을 이용한 세포파쇄법
균주 배양액을 세척 완충액(pH 8.0 Tris-HCl + 500mM NaCl)에 넣어준 후, 상온에서 10분 동안 배양하였다. 그 후 14,000g에서 10분 간 원심분리하여 상층액을 제거하고 3차 증류수를 넣어 10분 동안 배양하였다. 이렇게 전처리한 시료를 다시 원심분리를 통해 상층액(조효소액)과 침전물로 분리하였다. 조효소액으로부터, SDS-PAGE 분석을 통해 타겟 단백질의 발현과 크기를 확인하였다(도 3).
실시예 4. 임상균주 유래 CTX-M의 유전형 확인 및 단백질 확인
임상균주 유래 CTX-M을 확인하기 위해 ESBL 양성으로 확인된 균주를 수집하였다. 수집된 균주는 CTX-M 유전자 증폭에 사용한 프라이머를 이용하여 콜로니 PCR을 수행하였다. 이를 통해 증폭된 PCR 산물은 한천젤 전기영동을 통해 타겟 유전자의 크기를 확인하였다. 크기가 확인된 PCR산물은 DNA 염기서열분석을 통하여 정확한 CTX-M 유전자의 유전형을 확인하였다.
유전형이 확인된 균주는 LB 액체배지를 사용하여 배양하였고, SDS-PAGE 겔 분석을 통해 CTX-M 단백질의 발현유무를 확인하였다. 또한 기존의 CTX-M 유전자를 내포하는 백터를 포함한 재조합 균주와 동일하게 임상균주 유래 CTX-M 유전자를 포함하는 재조합균주를 제작하고 재조합 균주도 임상균주와 동일하게 SDS-PAGE 젤 분석을 통하여 실제 발현된 CTX-M 단백질의 크기를 확인하였다(도 3).
실시예 5. 타겟 단백질 분리/정제
타겟 단백질을 분리/정제하기 위해 이온교환 크로마토그래피를 사용하였다. 이온교환 수지는 Q-레진을 사용하였고, Q-레진이 포함된 컬럼에 조효소액 500μl를 로딩한 뒤 용출되는 용액을 수집하였다. 20 mM Tris-HCl, pH 8.0 완충용액 1 ml을 사용하여 세척하고, 1M NaCl, 20 mM Tris-HCl, pH 8.0 완충용액으로 용출하였다. 단계별 수집된 샘플을 SDS-PAGE 젤을 사용하여 분리/정제된 구획을 확인하였다(도 4). 최종적으로, 위와 같은 방법을 사용하여 세포 파쇄액으로부터 순도 높은 CTX-M 단백질을 분리/정제하였다.
실시예 6. 타겟 단백질의 확인 발현 및 크기 확인
SDS-PAGE 겔에서 발현과 크기가 확인된 단백질은 In-gel digestion 방법과 nano-LC-MS/MS 방법을 사용하여 동정함으로써 실제로 균주에서 발현된 항생제 내성 단백질의 종류를 확인하였다(도 5).
(1) In-Gel Digestion
SDS-PAGE 겔에서 타겟 단백질 크기에 해당하는 밴드부분만 확보하고, 염색되어 있는 겔을 탈색(destain)하였다. 탈색된 겔은 환원/알킬화(Reduction/ alkylation) 과정을 거친 후, 트립신 효소를 사용하여 단백질을 선택적으로 절단(digestion)하였다. 절단된 펩타이드를 회수하고 DK-Tip(C18 Tip)을 사용하여 탈염하였다.
(2) nano-LC-MS/MS
균주 내에서 발현되는 활성 단백질(Active protein)의 서열 및 범위를 확인하기 위해 나노액체크로마토그래피 및 고분해능 질량분석을 수행하였다(Q-Exactive HF-X 질량분석기 시스템). 탈염된 펩타이드 시료를 0.1% 포름산 용액으로 용해시킨 후, 컬럼에 시료를 주입하였다. C18 컬럼(75μm x 70cm)과 나노유속 액상 크로마토그래피를 이용하여 펩타이드 시료를 분리하였다. 이때 사용한 시료 로딩 및 분리용 구배(gradient) 조건은 다음과 같다:
- 버퍼 A: 물 내의 0.1% 포름산/ 버퍼 B: 아세토니트릴 내의 0.1% 포름산
- 시료 로딩: 0 - 5분, 5%(B), 유속 5μL/min
- 분리 농도 구배:
5 - 7분, 5%에서 10%(B), 유속 300nL/min
7 - 38분, 10%에서 40%(B), 유속 300nL/min
38 - 38.5분, 40%에서 80%(B), 유속 300nL/min
38.5 - 39.5분, 80%(B), 유속 300nL/min
39.5 - 40분, 80%에서 5%(B), 유속 300nL/min
40 - 60분, 5%(B), 유속 300nL/min
이때 사용된 질량분석기의 파라미터는 다음과 같다:
-분해능: Full MS 60,000, MS2 30,000
-Full MS: 350~2,000 m/z, 100 msec
-MS2: 50 msec, NCE 28, 1, >6가로 이온화 물질은 MS2 대상에서 제외
Bottom-up 데이터로 펩타이드 및 단백질을 동정하기 위한 소프트웨어는 미국 샌디에이고 주립대에서 개발한‘MS-GF+’서치엔진을 활용하였으며, 단백질/펩타이드 동정은 FDR(false discovery rate) 1%를 기준으로 선별하였다. E. Coli 유래 단백질 중에서 CTX-M 단백질이 동정되었으며, 143개의 펩타이드가 동정되었다(총 90.38% 커버리지). 6개의 메티오닌 잔기(71, 78, 120, 138, 189, 214) 중 1개 또는 2개의 메티오닌이 산화된 형태의 펩타이드도 동시에 동정되었다. 특이하게도, 1-28번 잔기의 N-말단 서열 펩타이드는 검출되지 않았으며, 이 1-28번을 제외한 서열을 고려했을 때 모든 서열 범위에 걸친 펩타이드가 동정되어 커버리지는 100%로 확인되었다 (도 5b, 회색 바탕).
(3) N-말단 및 N-말단 서열의 동정 (도 7)
- N말단 서열: (A)/QTADVQQK (semi-tryptic)
- C말단 서열: (R)/RDVLASAAKIVTNGL- (semi-tryptic)
실시예 7. CTX-M 단백질의 아미노산서열 분석 및 특성 확인
상기 실시예 3의 MS2 결과를 바탕으로, 현재까지 NCBI(National Center for Biotechnology Information) 데이터베이스에서 알려진 전체 205개의 CTX-M 단백질에 대한 다중정렬 분석을 수행하였다(도 8). 그 결과, 전체 아미노산 서열이 97.6%이상 보존된 CTX-M 단백질은 98개로 확인되었고, CTX-M-1과 동일한 N-말단 펩타이드(1-28 a.a)를 포함한 CTX-M 단백질은 82개로 확인되었다. 확인된 82개의 단백질은 모두 291개 아미노산 서열로 구성된 특징을 보여준다.
실시예 8. 질량 분석법을 이용한 타겟 단백질 동정 (Top-down 방법)
균주에서 발현되는 활성 단백질(Active protein)의 질량값을 확인하기 위한 Top-Down 질량분석을 진행하였다. 정확한 단백질의 질량 값을 확인하기 위해서 균주 유래 조 단백질 추출액을 사용하였으며 Top-Down용 LC-MS/MS 시스템(Nano-LC 및 Q-Exactive HF-X 질량분석기 시스템)을 활용하였다.
(1) 조 단백질 추출액의 분리
단백질 시료 약 0.1μg을 1% 포름산 용액과 1:1로 혼합하여 대략 pH3으로 조절한 뒤, 컬럼에 시료를 주입하였다. PLRP-S 레진을 충진한 컬럼(150μm x 20cm)과 나노유속 액상 크로마토그래피법을 이용하여 조 단백질 추출액을 분리하였다. 이때 사용한 시료 로딩 및 분리용 구배(gradient) 조건은 다음과 같다.
- 버퍼 A: 물 내의 0.1% 포름산/ 버퍼 B: 아세토니트릴 내의 0.1% 포름산
- 시료 로딩: 0 - 10분, 5%(B), 유속 5μL/min
- 분리 농도 구배:
10 - 10.01분, 5%에서 10%(B), 유속 300nL/min
10.01- 40분, 10%에서 40%(B), 유속 300nL/min
40 - 41분, 40%에서 80%(B), 유속 300nL/min
41 - 42분, 80%(B), 유속 300nL/min
42 - 43분, 80%에서 5%(B), 유속 300nL/min
43 - 60분, 5%(B), 유속 300nL/min
(2) 고분해능 질량분석기를 이용한 CTX-M 단백질 질량분석
Q-Exactive HF-X 질량분석기의 Protein Mode Analysis 방법을 이용하여 온전한(Intact) 단백질의 질량값과 단백질들의 텐덤 스펙트럼을 얻어 동정하였다(도 5). 이때 사용된 파라미터는 다음과 같다.
- 분해능: Full MS 240,000, MS2 120,000으로 사용
- Full MS: 620~2,400 m/z, 100 msec
- MS2: 1 마이크로스캔 사용, 1,000 msec, NCE 50, 1~8가로 이온화 물질은 MS2 대상에서 제외함.
Top-Down 데이터로 단백질을 동정하기 위한 소프트웨어는 미국 PNNL (Pacific Northwest National Laboratory)에서 개발한‘Informed Proteomics’를 활용하였다. 23.63분경에 다중 하전된 CTX-M 단백질 피크들이 여럿 확인되었으며 (도 5), 해당 피크를 역합성곱(deconvolution)하여 수득한 대표적 질량값은 평균분자량 28,209.69 m/z × z, 단일 동위원소 질량(Monoisotopic mass)으로는 28,192.69 m/z × z로 확인되었다. 또한, 메티오닌 산화로 발생한 다른 피크들이 관측되었다(예를 들어, 2개의 메티오닌이 산화된 폴리펩타이드의 경우 평균분자량 28,210+32 m/z × z로 나타남). 이들은 In-Gel Digestion(Bottom-up방식)을 통해 얻은 CTX 단백질 범위(29-291 a.a.) 내 산화된 메티오닌 잔기위치(71, 78, 120, 138, 189, 214)와 부분적으로 일치하였다. Top-down 방식의 분석에서도 1-29의 N말단 서열을 포함한 폴리펩타이드는 관측되지 않았다.
(3) 저분해능 질량분석기를 이용한 CTX-M 단백질 질량분석
Bruker Biotyper MALDI-TOF MS 장비를 활용하여 CTX-M 단백질의 질량분석 스펙트럼을 얻었다. 먼저, SA(Sinapinic acid, 0.1% TFA/50% 아세토니트릴 내 10mg/mL으로 존재) 매트릭스 1μL와 약 100ng의 정도의 CTX-M 단백질을 플레이트 spot 위에 올려놓고, 완전 건조시켜 질량분석을 실시하였다. 이때 사용한 에너지는 최대 30%, 무작위 위치 수득(random position acquisition)을 수행하였으며, 40 shot씩 총 2,000 shot의 레이저를 조사하고 각 스펙트럼 데이터를 누적하여 수득하였다. 10,000에서부터 40,000 m/z 구간의 범위에 대하여 질량분석 스펙트럼을 얻었으며, +1가의 CTX-M은 물론 +2가의 CTX-M 단백질도 동시에 검출하였다(도 9).
(4) CTX-M 단백질들의 질량값 비교
상기의 방법을 통하여 CTX-M 단백질의 정확한 질량값을 확인하였고, 확인된 질량값을 바탕으로 N-말단 펩타이드가 제거된 활성 CTX-M 단백질의 질량값을 확인할 수 있었다. 따라서 NCBI에서 확인된 모든 CTX-M 단백질은 고분해능 또는 저분해능 질량분석기를 통하여 활성 단백질(Active protein)의 정확한 질량값을 확인할 수 있고, 질량분석을 통하여 다양한 종류의 CTX-M 단백질에 대한 신속/정확한 동정이 가능하다(표 2).
CTX-M 단백질의 질량 데이터
CTX -M 전장 CTX-M 단백질 활성형 단백질
Da 평균 분자량 단일동위원소질량 PI Da 평균 분자량 단일동위원소질량 PI 제거된 N 말단
1 31246 31245.69 31226.29 9.25 28210 28209.95 28192.58 8.63 1-28aa
2 31378 31377.79 31358.23 8.91 28287 28287.02 28269.62 7.99 1-28aa
3 31202 31201.64 3118.26 9.25 28166 28165.90 28148.55 8.63 1-28aa
4 31255 31254.52 31235.00 7.86 28164 28163.75 28146.39 6.59 1-28aa
5 31294 31293.67 31274.17 9.12 28203 28202.90 28185.57 8.60 1-28aa
6 31207 31206.51 31187.07 8.61 28116 28115.74 28098.46 7.15 1-28aa
7 31202 31201.64 31182.25 9.10 28166 28165.90 28148.54 7.99 1-28aa
9 30951 30951.32 30932.03 9.09 27946 27945.57 27928.42 8.02 1-28aa
10 31202 31201.64 31182.25 9.10 28166 28165.90 28148.54 7.99 1-28aa
12 31159 31158.61 31139.26 9.25 28153 28152.90 28135.55 8.63 1-28aa
13 31127 31126.57 31107.10 9.07 28089 28088.76 28071.52 8.01 1-28aa
14 30979 30979.38 30960.06 9.09 27974 27973.62 27959.46 8.02 1-28aa
15 31144 31143.60 31124.26 9.38 28108 28107.86 28090.54 8.95 1-28aa
16 30893 30893.29 30874.28 9.27 27888 27887.53 27870.42 8.70 1-28aa
17 30978 30978.43 30959.11 9.39 27973 27972.68 27955.51 9.02 1-28aa
19 30969 30969.34 30950.04 9.09 27964 27963.58 27946.44 8.02 1-28aa
20 31412 31411.81 31392.21 8.91 28321 28321.04 28303.61 7.99 1-28aa
21 30897 30897.17 30877.98 9.21 27932 27931.54 27914.41 8.02 1-28aa
22 31201 31200.65 31181.28 9.38 28165 28164.91 28147.57 8.95 1-28aa
23 31233 31232.70 31213.30 9.38 28197 28196.96 28179.59 8.95 1-28aa
24 31048 31048.48 31029.13 9.27 28044 28043.73 28025.53 8.70 1-28aa
27 30921 30921.34 30902.06 9.27 27916 27915.59 27898.45 8.70 1-28aa
28 31143 31142.62 31123.27 9.49 28107 28106.88 28089.56 9.16 1-28aa
29 31114 31113.58 31094.25 9.38 28108 28107.86 28090.54 8.95 1-28aa
30 31173 31172.60 31153.24 9.10 28167 28166.88 28149.53 7.99 1-28aa
31 31364 31363.76 31344.21 8.91 28273 28272.99 28255.61 7.99 1-28aa
32 31188 31187.66 31168.28 9.38 28152 28151.92 28134.57 8.95 1-28aa
33 31117 31116.58 31097.25 9.28 28081 28080.84 28063.53 8.95 1-28aa
34 31248 31247.72 31228.24 9.00 28212 28211.98 28194.53 7.91 1-28aa
35 31368 31367.75 31348.21 8.91 28277 28276.98 28259.60 7.99 1-28aa
36 31218 31217.64 31198.26 9.25 28182 28181.90 28164.54 8.63 1-28aa
37 31149 31148.53 31129.20 8.90 28139 28138.83 28121.49 6.95 1-28aa
38 31048 31048.48 31029.13 9.27 28043 28042.73 28025.53 8.70 1-28aa
40 31065 31065.43 31046.01 8.45 27819 27819.40 27802.30 5.97 1-28aa
41 31046 31045.52 31025.98 8.96 27810 27810.46 27793.28 6.95 1-28aa
42 31206 31205.63 31186.26 9.25 28170 28169.89 28152.54 8.63 1-28aa
43 31389 31388.86 31369.29 9.27 28298 28298.09 28280.69 8.91 1-28aa
44 31447 31446.90 31427.30 9.12 28356 28356.13 28338.69 8.60 1-28aa
46 31032 31032.44 31013.09 9.09 28027 28026.69 28009.48 8.02 1-28aa
47 31079 31078.51 31059.14 9.27 28073 28072.76 28055.54 8.70 1-28aa
48 31006 31006.40 30987.07 9.09 28001 28000.65 27983.47 8.02 1-28aa
49 31105 31104.55 31085.16 9.27 28099 28098.80 28081.55 8.70 1-28aa
50 31005 31005.41 30986.08 9.09 28000 27999.66 27982.47 8.02 1-28aa
51 30979 30979.38 30960.06 9.09 27974 27973.62 27956.46 8.02 1-28aa
52 31220 31219.65 31200.27 9.25 28184 28183.91 28166.56 8.63 1-28aa
53 31184 31183.71 31164.31 9.25 28148 28147.97 28130.60 8.63 1-28aa
54 31233 31232.65 31213.27 9.25 28197 28196.91 28179.56 8.63 1-28aa
55 31172 31171.66 31152.29 9.38 28136 28135.92 28118.58 8.95 1-28aa
56 31405 31404.81 31385.24 8.91 28314 28314.05 28296.63 7.99 1-28aa
58 31250 31249.68 31230.28 9.25 28214 28213.94 28196.57 8.63 1-28aa
59 31354 31353.81 31334.25 8.91 28263 28263.04 28245.65 7.99 1-28aa
60 31187 31186.67 31167.29 9.25 28181 28180.95 28163.59 8.63 1-28aa
61 31247 31246.68 31227.27 9.10 28211 28210.94 28193.56 7.99 1-28aa
62 31192 31191.60 31172.24 9.25 28156 28155.86 28138.53 8.63 1-28aa
63 31092 31092.46 31073.02 8.45 28046 28045.63 28028.41 5.97 1-28aa
64 31117 31116.61 31097.31 9.30 28081 28080.86 28063.60 8.66 1-28aa
65 31077 31076.54 31057.16 9.27 28071 28070.79 28053.56 8.70 1-28aa
66 31229 31228.67 31209.27 9.25 28166 28165.90 28148.55 8.63 1-28aa
67 30952 30952.35 30933.05 9.09 27947 27946.60 27929.45 8.02 1-28aa
68 31190 31189.63 31170.27 9.27 28180 28179.93 28162.57 8.63 1-28aa
69 31157 31156.60 31137.25 9.40 28121 28120.86 28103.54 8.97 1-28aa
71 31190 31189.69 31170.24 9.30 28154 28153.95 28136.53 8.84 1-28aa
72 31103 31102.50 31083.18 9.10 28067 28066.76 28049.47 7.99 1-28aa
73 31011 31011.44 30992.03 9.09 28006 28005.68 27988.43 8.02 1-28aa
74 31382 31381.78 31362.22 8.91 28291 28291.01 28273.62 7.99 1-28aa
75 31368 31367.75 31348.21 8.91 28287 28287.02 28269.62 7.99 1-28aa
76 31352 31351.71 31332.18 8.91 28261 28260.94 28243.57 7.99 1-28aa
77 31398 31397.86 31378.29 9.25 28307 28307.09 28289.69 8.89 1-28aa
79 31171 31170.67 31151.30 9.49 28135 28134.93 28117.59 9.16 1-28aa
80 31230 31229.69 31210.29 9.25 28194 28193.95 28176.58 8.63 1-28aa
81 31003 31003.31 30983.99 7.77 27998 27997.56 27980.38 5.97 1-28aa
82 31170 31169.64 31150.27 9.38 28134 28133.90 28116.56 8.95 1-28aa
83 30988 30988.39 30969.06 9.09 27983 27982.63 27965.46 8.03 1-28aa
84 30949 30949.35 30930.05 9.09 27944 27943.60 27926.45 8.02 1-28aa
85 30963 30963.33 30944.03 9.09 27958 27957.58 27940.42 8.02 1-28aa
86 31013 31013.39 30994.05 9.09 28008 28007.64 27990.44 8.02 1-28aa
87 31023 31023.47 31004.12 9.09 28018 28017.72 28000.52 8.02 1-28aa
88 31125 31124.56 31105.21 9.25 28089 28088.82 28071.50 8.63 1-28aa
90 31007 31007.43 30988.09 9.09 28002 28001.68 27984.49 8.02 1-28aa
92 31408 31407.82 31388.24 8.91 28317 28317.05 28299.63 7.99 1-28aa
93 30936 30936.31 30917.03 9.27 27931 27930.56 27913.43 8.70 1-28aa
95 31380 31379.76 31360.20 8.58 28289 28288.99 28271.59 7.15 1-28aa
96 31101 31100.58 31081.25 9.38 28095 28094.86 28077.55 8.95 1-28aa
97 31279 31278.65 31259.15 8.58 28287 28287.02 28269.62 7.99 1-28aa
98 30949 30949.39 30930.09 9.27 27944 27943.64 27926.48 8.70 1-28aa
99 31038 31038.45 31019.11 9.27 28033 28032.69 28015.50 8.70 1-28aa
100 31033 31033.47 31013.94 8.96 27798 27798.40 27781.25 6.95 1-28aa
101 31170 31169.68 31150.31 9.38 28134 28133.94 28116.60 8.95 1-28aa
102 30979 30979.38 30960.06 9.09 27974 27973.62 27956.46 8.02 1-28aa
103 31171 31170.63 31151.27 9.38 28135 28134.89 28117.55 8.95 1-28aa
104 31006 31006.40 30987.07 9.09 28001 28000.65 27983.47 8.02 1-28aa
105 31007 31007.43 30988.09 9.09 28002 28001.68 27984.49 8.02 1-28aa
110 31094 31094.42 31075.05 8.53 28089 28088.67 28071.45 6.20 1-28aa
111 31010 31010.39 30991.07 9.09 28005 28004.64 27987.46 8.02 1-28aa
112 30949 30949.35 30930.05 9.09 27944 27943.60 27926.45 8.02 1-28aa
113 31007 31007.43 30988.10 9.27 28002 28001.68 27984.50 8.70 1-28aa
114 31144 31143.60 31124.26 9.38 28108 28107.86 28090.54 8.95 1-28aa
115 31408 31407.82 31388.24 8.91 28317 28317.05 28299.63 7.99 1-28aa
116 31229 31228.71 31209.31 9.38 28193 28192.97 28175.60 8.95 1-28aa
117 31175 31174.62 31155.26 9.38 28139 28138.88 28121.55 8.95 1-28aa
121 30951 30951.37 30932.07 9.27 27946 27945.61 27928.46 8.70 1-28aa
122 31064 31064.48 31045.12 9.27 28059 28058.73 28041.52 8.70 1-28aa
123 31157 31156.58 31137.31 9.40 28121 28120.84 28103.59 8.97 1-28aa
124 31378 31377.79 31358.23 8.91 28287 28287.02 28269.62 7.99 1-28aa
125 31029 31029.44 31010.09 9.09 28024 28023.69 28006.48 8.03 1-28aa
126 30953 30953.34 30934.05 9.09 27948 27947.59 27930.44 8.02 1-28aa
127 31145 31144.59 31125.24 9.25 28109 20108.85 28091.53 8.63 1-28aa
129 30949 30949.35 30930.06 9.30 27944 27943.60 27926.46 8.72 1-28aa
130 31029 31029.44 31010.09 9.09 28024 28023.69 28006.48 8.03 1-28aa
131 31320 31319.75 31300.22 9.12 28229 28228.98 28211.62 8.60 1-28aa
132 31078 31077.54 31058.23 9.38 28042 28041.80 28024.52 8.95 1-28aa
132 30951 30951.37 30932.07 9.27 27946 27945.61 27928.46 8.70 1-28aa
136 31230 31229.69 31210.29 9.25 28194 28193.95 28176.58 8.63 1-28aa
137 30857 30857.39 30838.05 9.32 27852 27851.64 27834.44 8.95 1-28aa
138 31220 31219.61 31200.24 9.25 28184 28183.87 28166.52 8.63 1-28aa
139 31128 31127.60 31108.26 9.40 28108 28107.86 28090.54 8.95 1-28aa
141 31436 31435.83 31416.24 8.58 28345 28345.06 28327.63 7.15 1-28aa
142 31143 31142.62 31123.27 9.49 28107 28106.88 28089.56 9.16 1-28aa
144 31188 31187.70 31168.32 9.38 28152 28151.96 28134.61 8.95 1-28aa
146 31274 31273.71 31254.29 9.27 28238 28237.97 28220.58 8.64 1-28aa
147 30997 30997.39 30978.07 9.09 27992 27991.64 27974.47 8.02 1-28aa
148 31059 31058.51 31039.20 9.27 28053 28052.75 28035.60 8.70 1-28aa
150 31203 31202.68 31183.28 9.38 28167 28166.94 28149.57 8.95 1-28aa
155 31072 31071.54 31052.24 9.49 28036 28035.80 28018.52 9.16 1-28aa
156 31130 31129.53 31110.20 9.27 28094 28093.79 28076.49 8.64 1-28aa
157 31086 31085.57 31066.25 9.49 28050 28049.83 28032.54 9.16 1-28aa
158 31274 31273.75 31254.32 9.25 28238 28238.01 28220.61 8.63 1-28aa
159 30920 30920.40 30901.11 9.51 27915 27914.64 27897.50 9.24 1-28aa
161 31051 31051.44 31032.08 8.86 28046 28045.69 28028.48 6.96 1-28aa
162 31133 31132.53 3113.19 9.10 28166 28165.90 28148.55 8.63 1-28aa
163 31074 31074.49 31055.19 9.25 28108 28107.86 28090.54 8.95 1-28aa
164 31172 31171.70 31152.32 9.47 28136 28135.92 28118.58 8.95 1-28aa
165 31351 31350.76 31331.22 8.91 28260 28259.99 28242.61 7.99 1-28aa
166 31274 31273.75 31254.32 9.25 28238 28238.01 28220.61 8.63 1-28aa
167 31248 31247.73 31228.25 9.16 28212 28211.99 28194.54 8.51 1-28aa
168 31019 31019.40 31000.07 9.09 28014 28013.65 27996.46 8.03 1-28aa
169 31117 31116.58 31097.25 9.38 28081 28080.84 28063.53 8.95 1-28aa
170 31143 31142.62 31123.27 9.49 28107 28106.88 28089.56 9.16 1-28aa
171 31309 31308.68 31289.16 8.58 28218 28217.91 28200.55 7.15 1-28aa
172 31128 31127.56 31108.22 9.38 28092 28091.82 28074.51 8.95 1-28aa
173 31174 31173.63 31154.27 9.38 28138 28137.89 28120.55 8.95 1-28aa
174 30906 30906.37 30887.08 9.27 27916 27915.59 27898.45 8.70 1-28aa
175 31276 31275.72 31256.30 9.25 28240 28239.98 28222.59 8.63 1-28aa
176 31114 31113.58 31094.25 9.38 28078 28077.84 28060.53 8.95 1-28aa
177 31187 31186.67 31167.29 9.25 28151 28150.93 28133.57 8.63 1-28aa
178 31174 31173.63 31154.27 9.38 28138 28137.89 28120.55 8.95 1-28aa
179 31176 31175.65 31156.28 9.38 28140 28139.90 28122.57 8.95 1-28aa
180 31174 31173.63 31154.27 9.38 28138 28137.89 28120.55 8.95 1-28aa
181 31167 31166.64 31147.27 9.38 28131 28130.90 28113.56 8.95 1-28aa
182 31172 31171.62 31152.26 9.40 28136 28135.88 28118.55 8.97 1-28aa
183 31171 31170.67 31151.30 9.47 28135 28134.93 28117.59 9.14 1-28aa
184 31131 31130.60 31111.26 9.38 28095 28094.86 28077.55 8.95 1-28aa
186 31118 31117.52 31098.20 9.38 28108 28107.86 28090.54 8.95 1-28aa
187 31206 31205.58 31186.22 9.25 28170 28169.84 28152.51 8.63 1-28aa
188 31174 31173.63 31154.27 9.38 28138 28137.89 28120.55 8.95 1-28aa
189 31114 31113.58 31094.25 9.38 28078 28077.84 28060.53 8.95 1-28aa
190 31186 31185.68 31166.30 9.38 28150 28149.94 28132.59 8.95 1-28aa
191 30980 30980.36 30961.04 8.86 27975 27974.61 27957.44 6.95 1-28aa
192 30949 30949.35 30930.06 9.30 27944 27943.60 27926.46 8.72 1-28aa
193 31174 31173.63 31154.27 9.38 28138 28137.89 28120.55 8.95 1-28aa
194 31125 31124.56 31105.21 9.25 28108 28107.86 28090.54 8.95 1-28aa
195 30894 30894.31 30875.04 9.27 27889 27888.56 27871.44 8.70 1-28aa
196 30990 30990.45 30971.12 9.42 27985 27984.70 27967.52 9.04 1-28aa
197 31130 31129.58 31110.24 9.38 28094 28093.84 28076.53 8.95 1-28aa
198 30953 30953.34 30934.05 9.09 27974 27973.62 27956.46 8.02 1-28aa
199 31161 31160.66 31141.34 9.30 28125 28124.92 28107.63 8.66 1-28aa
200 31404 31403.87 31384.28 8.91 28313 28313.10 28295.68 7.99 1-28aa
201 31208 31028.45 31009.08 9.07 28023 28022.70 28005.48 8.01 1-28aa
202 31156 31155.66 31136.29 9.38 28120 28119.92 28102.58 8.95 1-28aa
203 31230 31229.65 31210.27 9.27 28194 28193.91 28176.56 8.64 1-28aa
204 31214 31213.69 31194.30 9.25 28178 28177.95 28160.59 8.63 1-28aa
206 31175 31174.61 31155.25 9.25 28139 28138.87 28121.54 8.63 1-28aa
207 31202 31201.68 31182.30 9.38 28166 28165.94 28148.59 8.95 1-28aa
208 31202 31201.64 31182.26 9.25 28166 28165.90 28148.55 8.63 1-28aa
209 31156 31155.66 31136.29 9.38 28120 28119.92 28102.58 8.95 1-28aa
210 31174 31173.63 31154.27 9.38 28138 28137.89 28120.55 8.95 1-28aa
212 31234 31233.68 31214.29 9.25 28198 28197.94 28180.58 8.63 1-28aa
213 31128 31127.51 31108.04 8.51 28090 28089.70 28072.47 6.21 1-28aa
214 30981 30981.35 30962.04 9.09 27976 27975.60 27958.44 8.02 1-28aa
215 31030 31030.42 31011.07 8.86 28025 28024.67 28007.47 7.04 1-28aa
216 31174 31173.63 31154.27 9.38 28138 28137.89 28120.55 8.95 1-28aa
218 31158 31157.63 31138.27 9.38 28122 28121.89 28104.56 8.95 1-28aa
219 30981 30981.39 30962.08 9.09 27976 27975.64 27958.47 8.02 1-28aa
220 31175 31174.61 31155.25 9.25 28139 28138.87 28121.54 8.63 1-28aa
221 30905 30905.39 30886.03 9.18 27900 27899.64 27882.43 8.63 1-28aa
222 31260 31259.72 31240.30 9.25 28224 28223.98 28206.59 8.63 1-28aa
223 30922 30922.37 30903.08 9.27 27917 27916.61 27899.47 8.70 1-28aa
224 31015 31015.47 30996.20 9.38 28108 28107.86 28090.54 8.95 1-28aa
225 31174 31173.63 31154.27 9.38 28138 28137.89 28120.55 8.95 1-28aa
226 31176 31175.65 31156.28 9.38 28136 28135.92 28118.58 8.95 1-28aa
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (20)

  1. 다음의 단계를 포함하는 생물학적 시료 내 베타-락탐계 항생제(β-lactam antibiotics)에 대한 내성을 가지는 병원성 균주의 검출 방법:
    (a) 대상체로부터 분리된 생물학적 시료 내에서 병원성 균주가 발현하는 단백질을 분리하는 단계; 및
    (b) 상기 분리된 단백질에 대해 탑-다운(top-down) 질량 분석을 수행하는 단계,
    상기 질량 분석 결과 N-말단의 28개 아미노산 잔기가 제거된 베타-락타마제(β-lactamase)와 동일한 질량의 단백질이 검출된 경우, 상기 생물학적 시료 내에는 베타-락탐계 항생제에 대한 내성을 가지는 병원성 균주가 존재하는 것으로 판정한다.
  2. 제 1 항에 있어서, 상기 방법은 상기 단계 (a)에서 분리된 단백질에 대해 이온교환 크로마토그래피를 수행하는 단계를 추가적으로 포함하는 것을 특징으로 하는 방법.
  3. 제 2 항에 있어서, 상기 방법은 이온교환 크로마토그래피는 음이온교환 크로마토그래피인 것을 특징으로 하는 방법.
  4. 제 1 항에 있어서, 상기 베타-락타마제는 CTX-M 단백질인 것을 특징으로 하는 방법.
  5. 제 4 항에 있어서, 상기 CTX-M 단백질은 CTX-M1 내지 CTX-M7, CTX-M9, CTX-M10, CTX-M12 내지 CTX-M17, CTX-M19 내지 CTX-M24, CTX-M27 내지 CTX-M38, CTX-M40 내지 CTX-M44, CTX-M46 내지 CTX-M56, CTX-M58 내지 CTX-M69, CTX-M71 내지 CTX-M77, CTX-M79 내지 CTX-M88, CTX-M90, CTX-M92, CTX-M93, CTX-M95 내지 CTX-M105, CTX-M110 내지 CTX-M117, CTX-M121 내지 CTX-M127, CTX-M129 내지 CTX-M132, CTX-M134, CTX-M136 내지 CTX-M139, CTX-M141, CTX-M142, CTX-M144, CTX-M146 내지 CTX-M148, CTX-M150, CTX-M155 내지 CTX-M159, CTX-M161 내지 CTX-M184, CTX-M186 내지 CTX-M204, CTX-M206 내지 CTX-M210, CTX-M212 내지 CTX-M216 및 CTX-M218 내지 CTX-M226으로 구성된 군으로부터 선택되는 하나 이상의 단백질인 것을 특징으로 하는 방법.
  6. 제 5 항에 있어서, 상기 CTX-M 단백질은 CTX-M1, CTX-M3, CTX-M10, CTX-M15, CTX-M22, CTX-M23, CTX-M28, CTX-M32 내지 CTX-M34, CTX-M36, CTX-M42, CTX-M52 내지 CTX-M55, CTX-M58, CTX-M61, CTX-M62, CTX-M64, CTX-M69, CTX-M71, CTX-M72, CTX-M79, CTX-M80, CTX-M82, CTX-M88, CTX-M101, CTX-M103, CTX-M114, CTX-M116, CTX-M117, CTX-M123, CTX-M127, CTX-M132, CTX-M136, CTX-M138, CTX-M142, CTX-M144, CTX-M146, CTX-M150, CTX-M155 내지 CTX-M158, CTX-M166, CTX-M167, CTX-M169, CTX-M170, CTX-M172, CTX-M173, CTX-M175 내지 CTX-M184, CTX-M187 내지 CTX-M190, CTX-M193, CTX-M197, CTX-M199, CTX-M201 내지 CTX-M204, CTX-M206 내지 CTX-M209, CTX-M212, CTX-M216, CTX-M218, CTX-M220, CTX-M222 및 CTX-M225으로 구성된 군으로부터 선택되는 하나 이상의 단백질인 것을 특징으로 하는 방법.
  7. 제 5 항에 있어서, 상기 CTX-M 단백질은 CTX-M1, CTX-M14, CTX-M15, CTX-M27, CTX-M142 및 CTX-M186으로 구성된 군으로부터 선택되는 하나 이상의 단백질인 것을 특징으로 하는 방법.
  8. 제 1 항에 있어서, 상기 단계 (a)는 상기 생물학적 시료에 계면활성제를 첨가함으로써 이루어지는 것을 특징으로 하는 방법.
  9. 제 1 항에 있어서, 상기 단계 (a)는 상기 생물학적 시료에 삼투압을 가함으로서 이루어지는 것을 특징으로 하는 방법.
  10. 제 1 항에 있어서, 상기 단계 (b)는 MALDI-TOF(Matrix-Assisted Laser Desorption/ Ionization Time of Flight) 질량분석, SELDI-TOF(Sulface Enhanced Laser Desorption/Ionization Time of Flight) 질량분석, ESI-TOF(Electrospray ionisation time-of-flight) 질량분석, 액상 크로마토그래피-질량분석(liquid chromatography-Mass Spectrometry, LC-MS) 및 LC-MS/MS(liquid chromatography-Mass Spectrometry/ Mass Spectrometry)로 구성된 군으로부터 선택되는 질량분석 방법을 이용하여 이루어지는 것을 특징으로 하는 방법.
  11. 제 10 항에 있어서, 상기 단계 (b)는 MALDI-TOF(Matrix Desorption/ Ionization Time of Flight) 질량분석을 이용하여 이루어지는 것을 특징으로 하는 방법.
  12. 제 1 항에 있어서, 상기 질량 분석 결과 28210, 28287, 28166, 28164, 28203, 28116, 27946, 28153, 28089, 27974, 28108, 27888, 27973, 27964, 28321, 27932, 28165, 28197, 28044, 27916, 28107, 28167, 28273, 28152, 28081, 28212, 28277, 28182, 28139, 28043, 27819, 27810, 28170, 28298, 28356, 28027, 28073, 28001, 28099, 28000, 27974, 28184, 28148, 28136, 28314, 28214, 28263, 28181, 28211, 28156, 28046, 28071, 27947, 28180, 28121, 28154, 28067, 28006, 28291, 28261, 28307, 28135, 28194, 27998, 28134, 27983, 27944, 27958, 28008, 28018, 28002, 28317, 27931, 28289, 28095, 28033, 27798, 28005, 28193, 28059, 28024, 27948, 28109, 28229, 28042, 27852, 28345, 28238, 27992, 28053, 28036, 28094, 28050, 27915, 28260, 28014, 28218, 28092, 28138, 28240, 28078, 28151, 28140, 28131, 28150, 27975, 27889, 27985, 28125, 28313, 28023, 28120, 28178, 28198, 28090, 27976, 28025, 28122, 28224, 27917 및 이들 값의 ±5 범위 내의 값으로 구성된 군으로부터 선택되는 하나 이상의 질량 값(m/z × z)이 검출된 경우, 상기 생물학적 시료 내에는 베타-락탐계 항생제에 대한 내성을 가지는 병원성 균주가 존재하는 것으로 판정하는 것을 특징으로 하는 방법.
  13. 제 12 항에 있어서, 상기 질량 값(m/z × z)은 각 질량 값에 16 또는 32만큼 증가된 질량 값을 추가적으로 포함하는 것을 특징으로 하는 방법.
  14. 다음의 단계를 포함하는 생물학적 시료 내 베타-락탐계 항생제(β-lactam antibiotics) 내성 관련 단백질을 동정하는 방법:
    (a) 대상체로부터 분리된 생물학적 시료 내에서 병원성 균주가 발현하는 단백질을 분리하는 단계;
    (b) 상기 분리된 단백질을 탑-다운(top-down) 방식을 통해 질량 분석을 수행하는 단계; 및
    (c) 상기 질량 분석 결과와 표 1에 나열된 N-말단의 28개 아미노산 잔기가 제거된 베타-락타마제(β-lactamase)의 질량 값(m/z × z), 상기 질량 값의 ±5 범위 내의 값, 상기 질량 값에 16만큼 증가된 값 및 상기 질량 값에 32만큼 증가된 값으로 구성된 군으로부터 선택되는 질량 값을 비교하여 상기 생물학적 시료 내에 포함된 베타-락탐계 항생제 내성 관련 단백질의 종류를 판정하는 단계.
  15. 제 14 항에 있어서, 상기 방법은 상기 단계 (a)에서 분리된 단백질에 대해 이온교환 크로마토그래피를 수행하는 단계를 추가적으로 포함하는 것을 특징으로 하는 방법.
  16. 제 15 항에 있어서, 상기 방법은 이온교환 크로마토그래피는 음이온교환 크로마토그래피인 것을 특징으로 하는 방법.
  17. 제 14 항에 있어서, 상기 단계 (a)는 상기 생물학적 시료에 계면활성제를 첨가함으로써 이루어지는 것을 특징으로 하는 방법.
  18. 제 14 항에 있어서, 상기 단계 (a)는 상기 생물학적 시료에 삼투압을 가함으로서 이루어지는 것을 특징으로 하는 방법.
  19. 제 14 항에 있어서, 상기 단계 (b)는 MALDI-TOF(Matrix Desorption/ Ionization Time of Flight) 질량분석, SELDI-TOF(Sulface Enhanced Laser Desorption/Ionization Time of Flight) 질량분석, 액상 크로마토그래피-질량분석(liquid chromatography-Mass Spectrometry, LC-MS) 및 LC-MS/MS(liquid chromatography-Mass Spectrometry/ Mass Spectrometry)로 구성된 군으로부터 선택되는 질량분석 방법을 이용하여 이루어지는 것을 특징으로 하는 방법.
  20. 제 19 항에 있어서, 상기 단계 (b)는 MALDI-TOF(Matrix Desorption/ Ionization Time of Flight) 질량분석을 이용하여 이루어지는 것을 특징으로 하는 방법.
PCT/KR2020/010228 2019-08-02 2020-08-03 베타-락탐 항생제에 대한 내성을 가지는 병원성 균주의 직접 검출 방법 WO2021025413A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US17/632,110 US20220276211A1 (en) 2019-08-02 2020-08-03 Method for directly detecting pathogenic strain having resistance to beta-lactam antibiotics
EP20849882.4A EP4009052A4 (en) 2019-08-02 2020-08-03 METHOD FOR DIRECTLY DETECTING A PATHOGENIC STRAIN EXHIBITING RESISTANCE TO BETA-LACTAM ANTIBIOTICS

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0094321 2019-08-02
KR1020190094321A KR20210015450A (ko) 2019-08-02 2019-08-02 베타-락탐 항생제에 대한 내성을 가지는 병원성 균주의 직접 검출 방법

Publications (1)

Publication Number Publication Date
WO2021025413A1 true WO2021025413A1 (ko) 2021-02-11

Family

ID=74502500

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/010228 WO2021025413A1 (ko) 2019-08-02 2020-08-03 베타-락탐 항생제에 대한 내성을 가지는 병원성 균주의 직접 검출 방법

Country Status (4)

Country Link
US (1) US20220276211A1 (ko)
EP (1) EP4009052A4 (ko)
KR (1) KR20210015450A (ko)
WO (1) WO2021025413A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120196309A1 (en) * 2011-01-28 2012-08-02 Yale University Methods and Kits for Detection of Antibiotic Resistance
US20130244230A1 (en) * 2010-08-19 2013-09-19 Theo M. Luider Methods and means for characterizing antibiotic resistance in microorganisms
EP2816357A1 (en) * 2013-06-20 2014-12-24 Univerzita Karlova V Praze Method of detection of Gram-negative bacteria periplasmic space and cell wall outer membrane proteins by mass spectrometry
KR20160091602A (ko) * 2015-01-26 2016-08-03 대한민국(농림축산식품부 농림축산검역본부장) 신속한 베타-락탐계 항생제 내성 정량 분석법 및 이를 이용한 내성 평가 방법

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170205426A1 (en) * 2016-01-20 2017-07-20 Thermo Finnigan Llc Rapid mass spectrometry methods for antimicrobial susceptibility testing using top-down mass spectrometry
AR112775A1 (es) * 2017-08-17 2019-12-11 Consejo Nacional De Investigaciones Cientificas Y Tecn Conicet Detección directa de mecanismos de resistencia por espectrometría de masa maldi-tof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130244230A1 (en) * 2010-08-19 2013-09-19 Theo M. Luider Methods and means for characterizing antibiotic resistance in microorganisms
US20120196309A1 (en) * 2011-01-28 2012-08-02 Yale University Methods and Kits for Detection of Antibiotic Resistance
EP2816357A1 (en) * 2013-06-20 2014-12-24 Univerzita Karlova V Praze Method of detection of Gram-negative bacteria periplasmic space and cell wall outer membrane proteins by mass spectrometry
KR20160091602A (ko) * 2015-01-26 2016-08-03 대한민국(농림축산식품부 농림축산검역본부장) 신속한 베타-락탐계 항생제 내성 정량 분석법 및 이를 이용한 내성 평가 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
See also references of EP4009052A4 *
TADROS MANAL, GONEAU LEE, ROMASCHIN ALEXANDER, JARVIS MICHAEL, MATUKAS LARISSA: "Rapid detection of resistance to carbapenems and cephalosporins in Enterobacteriaceae using liquid chromatography tandem mass spectrometry", PLOS ONE, vol. 13, no. 11, e0206842, 9 November 2018 (2018-11-09), pages 1 - 10, XP055778265, DOI: 10.1371/journal.pone.0206842 *

Also Published As

Publication number Publication date
US20220276211A1 (en) 2022-09-01
KR20210015450A (ko) 2021-02-10
EP4009052A1 (en) 2022-06-08
EP4009052A4 (en) 2023-08-16

Similar Documents

Publication Publication Date Title
Calvo et al. Analysis of the Listeria cell wall proteome by two‐dimensional nanoliquid chromatography coupled to mass spectrometry
EP1651962B1 (en) Analytical method for pancreatin and comparable compositions
Wu et al. Proteomic analysis of spore wall proteins and identification of two spore wall proteins from Nosema bombycis (Microsporidia)
Nilsson Fingerprinting of Helicobacter pylori strains by matrix‐assisted laser desorption/ionization mass spectrometric analysis
Medzihradszky et al. The advantages and versatility of a high-energy collision-induced dissociation-based strategy for the sequence and structural determination of proteins
Lim et al. Characterization of a cathepsin D protease from CHO cell‐free medium and mitigation of its impact on the stability of a recombinant therapeutic protein
Castanha et al. Rapid discrimination of Bacillus anthracis from other members of the B. cereus group by mass and sequence of “intact” small acid soluble proteins (SASPs) using mass spectrometry
WO2012030068A2 (ko) 1-데옥시노지리마이신 합성관련 폴리펩타이드 및 이의 용도
Naenna et al. Detection of outer membrane porin protein, an imipenem influx channel, in Pseudomonas aeruginosa clinical isolates
WO2021137645A1 (ko) 카바페넴 항생제에 대한 내성을 가지는 병원성 균주의 직접 검출 방법
Fu et al. Comparative proteomic analysis of the sun-and freeze-dried earthworm Eisenia fetida with differentially thrombolytic activities
WO2021025413A1 (ko) 베타-락탐 항생제에 대한 내성을 가지는 병원성 균주의 직접 검출 방법
CN111094580A (zh) 检测方法
Veith et al. Characterization of the O-Glycoproteome of Tannerella forsythia
Serafim et al. Rapid identification of E. coli bacteriophages using mass spectrometry
Gargis et al. Use of 4-sulfophenyl isothiocyanate labeling and mass spectrometry to determine the site of action of the streptococcolytic peptidoglycan hydrolase zoocin A
Wang et al. Comparative proteomic analyses of Streptococcus suis serotype 2 cell wall-associated proteins
US20100311114A1 (en) Preparation of samples for proteome analysis
US20040091901A1 (en) Immunogenic Mycoplasma hyopneumoniae polypeptides
Kirchner et al. Development, validation and application of a selective and sensitive LC-MS/MS method for the quantification of daptomycin in a suspension of Mammaliicoccus sciuri in Mueller-Hinton broth
WO2024072083A1 (ko) 질량 보정을 위한 신규한 내부표준물질
Gowd et al. Identification of Conus amadis disulfide isomerase: minimum sequence length of peptide fragments necessary for protein annotation
WO2022164224A2 (ko) 그람 음성균 유래 원형 단백질의 분리 방법
Haddow et al. Identification of midgut proteins that are differentially expressed in trypanosome-susceptible and normal tsetse flies (Glossina morsitans morsitans)
WO2012077849A1 (ko) 세포표면에서 발현되는 항균 펩타이드 다중합체

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20849882

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2020849882

Country of ref document: EP

Effective date: 20220302