WO2021021959A2 - Subcutaneous delivery of multimeric oligonucleotides with enhanced bioactivity - Google Patents
Subcutaneous delivery of multimeric oligonucleotides with enhanced bioactivity Download PDFInfo
- Publication number
- WO2021021959A2 WO2021021959A2 PCT/US2020/044110 US2020044110W WO2021021959A2 WO 2021021959 A2 WO2021021959 A2 WO 2021021959A2 US 2020044110 W US2020044110 W US 2020044110W WO 2021021959 A2 WO2021021959 A2 WO 2021021959A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- oligonucleotide
- multimeric oligonucleotide
- subunits
- multimeric
- subunit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- 0 CC(CC(N1*(C)=C*)=O)C1=O Chemical compound CC(CC(N1*(C)=C*)=O)C1=O 0.000 description 6
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/545—Heterocyclic compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/55—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/317—Chemical structure of the backbone with an inverted bond, e.g. a cap structure
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/318—Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/322—2'-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
- C12N2310/3521—Methyl
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
- C12N2310/3533—Halogen
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/51—Physical structure in polymeric form, e.g. multimers, concatemers
Definitions
- the present disclosure relates to multimeric oligonucleotides having increased bioactivity in a subject when the multimeric oligonucleotide is delivered via subcutaneous administration.
- Oligonucleotides are now a well-established class of therapeutics with multiple applications (e.g., RNA interference, or RNAi) and ongoing clinical trials.
- RNA interference e.g., RNA interference
- many factors still limit oligonucleotide therapeutics, for example, the delivery of the oligonucleotide to a target cell and the subsequent internalization of the oligonucleotide into the target cell in sufficient quantities to achieve a desired therapeutic effect.
- LNPs lipid nanoparticles
- lipid spheroids including positively charged lipids to neutralize the negative charge of the oligonucleotide and to facilitate target cell binding and internalization.
- LNPs can in some cases facilitate delivery and internalization, they suffer from major drawbacks, for example poor targeting and toxicity, resulting in a narrowed therapeutic window.
- GalNAc N- acetylgalactosamine
- ligand-conjugated oligonucleotide therapeutics have some major advantages over LNPs in that they may be delivered by subcutaneous (SC)
- SC administration is simpler and less costly to perform than
- IV injection intravenous injection and may be performed by the patients themselves.
- SC administration is essentially a slow-release system as the active oligonucleotide takes time to permeate through the tissue and reach the blood stream. This effect increases the uptake by the target receptor significantly by enabling the receptor to internalize a first“cargo” and then recycle for a second round.
- These effects have enabled oligonucleotides targeting hepatocytes in the liver using a tri-antennary GalNAc ligand to become the method of choice in targeting these cell types.
- oligonucleotides being taken up by the target hepatocytes, because they are small enough to be easily filtered and excreted via the kidney.
- oligonucleotides containing a large proportion of such groups bind to proteins circulating in the blood, thereby increasing the effective molecular size of the oligonucleotide and decreasing the rate of excretion via the kidney.
- the use of a high number of phosphorothioate groups has many drawbacks.
- phosphorothioate oligonucleotides of the appropriate length can block the binding of biologically relevant proteins to their natural receptors resulting in toxic side effects (Stein, CA. J Clin Invest.2001 Sep 1; 108(5): 641–644).
- the facilitation of protein binding that is an advantage of high levels of thiophosphorylation is
- the use of high levels of phosphorothioate groups to minimize losses of oligonucleotides via kidney filtration is inapplicable to siRNAs and similar double-stranded molecules such as miRNAs, and is limited to a subset of antisense oligonucleotides.
- Multimer or“multimeric oligonucleotide”
- oligonucleotide oligonucleotide
- cleavable linkers oligonucleotide
- Multimers of six or more siRNAs were found to have the maximum half-lives in serum, and a hetero-hexamer was highly active when administered via IV administration.
- the present disclosure relates to compositions and methods to (1) increase the biological activity in a subject of an oligonucleotide agent delivered by subcutaneous (SC) administration, and/or (2) decrease the rate of release from SC tissue into the circulatory system of an oligonucleotide agent delivered to a subject by SC administration.
- SC subcutaneous
- compositions and related methods for increasing the biological activity in a subject of an oligonucleotide agent delivered by SC administration wherein the increase in biological activity is produced by three separate synergistic effects, namely i) a reduced rate of release of the agent from SC tissue; ii) a reduced rate of excretion of the agent from blood serum via the kidneys; and iii) an increased uptake of the agent per internalization event.
- oligonucleotide agents double- stranded and single-stranded, including for example, siRNAs, saRNAs, miRNAs, aptamers, and antisense oligonucleotides.
- the present disclosure provides a multimeric oligonucleotide (“multimer”) comprised of two or more oligonucleotide agents (i.e.,“subunits”; each individually a “subunit”) linked together via covalent linkers, wherein the subunits may be multiple copies of the same subunit or differing subunits, and wherein the biological activity of at least one of the subunits within the multimer is increased relative to the activity of that subunit when administered in monomeric form. In another embodiment, the biological activity of all of the subunits within the multimer are increased relative to the activity of their respective monomeric form or forms.
- the increase in biological activity of the subunit or subunits within the multimer is independent of any phosphorothioate content in the multimer.
- the multimer may contain three, four or five subunits overall, or may contain six or more subunits overall, or may have a molecular weight of at least about 45 kilodaltons (kD), or may have a molecular weight in the range of about 45-60 kD.
- the improved and advantageous properties of the multimers according to the disclosure may be described in terms of increased in vivo biological activity.
- the relative increase in in vivo bioactivity of at least one of the subunits in the multimer as compared to its corresponding monomer may be in the range of greater than or equal to 2-10 times higher; for example, the relative increase may be 2, 5, 10, or more times that of the corresponding monomer.
- the present disclosure also relates to new synthetic intermediates and methods of synthesizing the multimeric oligonucleotides using the synthetic intermediates.
- the present disclosure also relates to methods of using the multimer oligonucleotides, for example in reducing gene expression, biological research, treating or preventing medical conditions, and/or to produce new or altered phenotypes.
- the disclosure provides a multimeric oligonucleotide comprising subunits , wherein: each of the subunits comprises a single- or a double-stranded oligonucleotide, and wherein each of the subunits is joined to another subunit by a covalent linker ; the multimeric oligonucleotide has a molecular weight and/or size configured to increase in vivo activity of one or more subunits within the multimeric oligonucleotide relative to in vivo activity of the same subunit when administered in monomeric form; the multimeric oligonucleotide comprises two subunits to five subunits; and the multimeric oligonucleotide is formulated for subcutaneous administration.
- the multimeric oligonucleotide has a molecular weight and/or size configured to decrease its clearance due to glomerular filtration.
- the molecular weight of the multimeric oligonucleotide is at least about 45 kD, or the molecular weight of the multimeric oligonucleotide is in the range of about 45-60 kD.
- the increase in activity of one or more subunits within the multimeric oligonucleotide is independent of phosphorothioate content in the multimeric oligonucleotide.
- the multimeric oligonucleotide comprises two subunits, three subunits, four subunits, or five subunits.
- At least two subunits are substantially different. In an embodiment, all of the subunits are substantially different.
- At least two subunits are substantially the same or are identical. In an embodiment, all of the subunits are substantially the same or are identical.
- each subunit is independently 10-30, 17-27, 19-26, or 20-25 nucleotides in length.
- one or more subunits are double-stranded. In an embodiment, one or more subunits are single-stranded.
- the subunits comprise a combination of single-stranded and double-stranded oligonucleotides.
- one or more nucleotides within an oligonucleotide is an RNA, a DNA, or an artificial or non-natural nucleic acid analog.
- At least one of the subunits comprises RNA.
- At least one of the subunits comprises a siRNA, a saRNA, or a miRNA.
- At least one of the subunits comprises a siRNA.
- At least one of the subunits comprises a miRNA.
- At east one of the subunits comprises a saRNA.
- At least one of the subunits comprises an antisense oligonucleotide.
- At least one of the subunits comprises a double- stranded siRNA.
- two or more siRNA subunits are joined by covalent linkers attached to the sense strands of the siRNA.
- two or more siRNA subunits are joined by covalent linkers attached to the antisense strands of the siRNA.
- two or more siRNA subunits are joined by covalent linkers attached to the sense strand of a first siRNA and the antisense strand of a second siRNA.
- one or more of the covalent linkers comprise a cleavable covalent linker.
- the cleavable covalent linker contains an acid cleavable bond, a reductant cleavable bond, a bio-cleavable bond, or an enzyme cleavable bond.
- the cleavable covalent linker is cleavable under intracellular conditions.
- At least one covalent linker comprises a disulfide bond or a compound of Formula (I): , wherein: S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit; each R 1 is independently a C 2 -C 10 alkyl, alkoxy, or aryl group; R 2 is a thiopropionate or disulfide
- the compound of Formula (I) comprises
- the compound of Formula (I) comprises
- the compound of Formula (I) comprises , and wherein S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit.
- the covalent linker of Formula (I) is formed from a covalent linking precursor of Formula (II):
- each R 1 is independently a C 2 -C 10 alkyl, alkoxy, or aryl group; and R 2 is a thiopropionate or disulfide group.
- one or more of the covalent linkers comprise a nucleotide linker.
- the nucleotide linker comprises 2-6 nucleotides.
- the nucleotide linker comprises a dinucleotide linker.
- the nucleotide linker comprises a tetranucleotide linker.
- each covalent linker is the same.
- the covalent linkers comprise two or more different covalent linkers.
- At least two subunits are joined by covalent linkers between the 3’ end of a first subunit and the 3’ end of a second subunit.
- At least two subunits are joined by covalent linkers between the 3’ end of a first subunit and the 5’ end of a second subunit.
- At least two subunits are joined by covalent linkers between the 5’ end of a first subunit and the 3’ end of a second subunit.
- At least two subunits are joined by covalent linkers between the 5’ end of a first subunit and the 5’ end of a second subunit.
- the multimeric oligonucleotide further comprises one or more targeting ligands.
- at least one of the subunits is a targeting ligand.
- the targeting ligand is an aptamer.
- a terminus of the multimeric oligonucleotide is covalently bound to a targeting ligand.
- an interior subunit is covalently bound to a targeting ligand.
- at least one terminus of the multimeric oligonucleotide is covalently bound to a targeting ligand and at least one internal subunit of the multimeric oligonucleotide is covalently bound to a targeting ligand.
- each of the termini of the multimeric oligonucleotide are covalently bound, respectively, to a targeting ligand, and each of the internal subunits of the multimeric oligonucleotide are covalently bound, respectively to a targeting ligand.
- the targeting ligand is a protein, antigen-binding protein, peptide, amino acid, nucleic acid (including, e.g., DNA, RNA, and an artificial or non-natural nucleic acid analog), aptamer, lipid, phospholipid, carbohydrate, polysaccharide, N-Acetylgalactosamine (GalNAc), mannose, other mannose receptor- binding ligand, folate, other folate receptor-binding ligand, immunostimulant, other organic compound, and/or inorganic chemical compound.
- nucleic acid including, e.g., DNA, RNA, and an artificial or non-natural nucleic acid analog
- the targeting ligand comprises N-Acetylgalactosamine (GalNAc).
- the targeting ligand is a peptide
- the peptide is APRPG, cNGR (CNGRCVSGCAGRC), F3 (KDEPQRRSARLSAKPAPPKPEPKPKKAPAKK), CGKRK, and/or iRGD (CRGDKGPDC).
- the targeting ligand is an antigen-binding protein
- the antigen binding protein is an ScFv or a VHH.
- the subunit and/or targeting ligand is an immunostimulant
- the immunostimulant comprises a CpG oligonucleotide.
- the CpG oligonucleotide comprises the sequence TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 162).
- the CpG oligonucleotide comprises the sequence GGTGCATCGATGCAGGGGG (SEQ ID NO: 163).
- the multimeric oligonucleotide is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% pure.
- At least one subunit comprises an oligonucleotide with complementarity to transthyretin (TTR) mRNA.
- TTR transthyretin
- every subunit comprises an oligonucleotide with complementarity to TTR mRNA.
- the subunit with complementarity to TTR mRNA comprises increased activity in vivo relative to a monomeric oligonucleotide with complementarity to TTR mRNA.
- the subunit with complementarity to TTR mRNA comprises increased activity in vivo relative to a hexameric or larger oligonucleotide with complementarity to TTR mRNA.
- the oligonucleotide with complementarity to TTR mRNA comprises UUAUAGAGCAAGAACACUGUUUU (SEQ ID NO: 164).
- the multimeric oligonucleotide is administered in vivo by subcutaneous injection and has a molecular weight and/or size configured to increase in vivo activity of one or more subunits within the multimeric oligonucleotide relative to in vivo activity of the same subunit when administered subcutaneously in monomeric form.
- the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 2-fold increase relative to in vivo activity of the same subunit when administered in monomeric form.
- the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 5-fold increase relative to in vivo activity of the same subunit when administered in monomeric form.
- the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 10-fold increase relative to in vivo activity of the same subunit when administered in monomeric form.
- the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 2-fold increase relative to in vivo activity of the same subunit when administered in hexameric form or larger.
- the multimeric oligonucleotide further comprises one or more endosomal escape moieties.
- the disclosure provides a multimeric oligonucleotide comprising subunits , wherein: each of the subunits comprises a single- or a double-stranded oligonucleotide, and wherein each of the subunits is joined to another subunit by a covalent linker ; the multimeric oligonucleotide has a molecular weight and/or size configured to increase in vivo activity of one or more subunits within the multimeric oligonucleotide relative to in vivo activity of the same subunit when administered in monomeric form; the multimeric oligonucleotide comprises six or more subunits; and the multimeric oligonucleotide is formulated for subcutaneous administration.
- the multimeric oligonucleotide is released into a subject’s serum more slowly when administered subcutaneously relative to a monomeric oligonucleotide when administered subcutaneously.
- cellular uptake of the multimeric oligonucleotide is increased when administered subcutaneously relative to a multimeric oligonucleotide when administered intravenously.
- the multimeric oligonucleotide has increased binding to a target receptor when administered subcutaneously relative to a multimeric oligonucleotide when administered intravenously.
- the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, the method comprising subcutaneously administering an effective amount of the multimeric oligonucleotide to the subject, the multimeric oligonucleotide comprising subunits , wherein: each of the subunits comprises a single- or a double-stranded oligonucleotide, and each of the subunits is joined to another subunit by a covalent linker ; the multimeric oligonucleotide has a molecular weight and/or size configured to increase in vivo activity of one or more subunits within the multimeric oligonucleotide relative to in vivo activity of the same subunit when administered in monomeric form; and the multimeric oligonucleotide comprises two subunits to five subunits.
- the multimeric oligonucleotide has a molecular weight and/or size configured to decrease its clearance due to glomerular filtration.
- the molecular weight of the multimeric oligonucleotide is at least about 45 kD, or the molecular weight of the multimeric oligonucleotide is in the range of about 45-60 kD.
- the increase in activity of one or more subunits within the multimeric oligonucleotide is independent of phosphorothioate content in the multimeric oligonucleotide.
- the multimeric oligonucleotide comprises two subunits, three subunits, four subunits, or five subunits. [0083] In an embodiment, at least two subunits are substantially different. In an embodiment, all of the subunits are substantially different.
- At least two subunits are substantially the same or are identical. In an embodiment, all of the subunits are substantially the same or are identical.
- each subunit is independently 10-30, 17-27, 19-26, or 20-25 nucleotides in length.
- one or more subunits are double-stranded. In an embodiment, one or more subunits are single-stranded.
- the subunits comprise a combination of single-stranded and double-stranded oligonucleotides.
- one or more nucleotides within an oligonucleotide is a RNA, a DNA, or an artificial or non-natural nucleic acid analog.
- At least one of the subunits comprises RNA.
- At least one of the subunits comprises a siRNA, a saRNA, or a miRNA.
- At least one of the subunits comprises an antisense oligonucleotide.
- At least one of the subunits comprises a double- stranded siRNA.
- two or more siRNA subunits are joined by covalent linkers attached to the sense strands of the siRNA.
- two or more siRNA subunits are joined by covalent linkers attached to the antisense strands of the siRNA.
- two or more siRNA subunits are joined by covalent linkers attached to the sense strand of a first siRNA and the antisense strand of a second siRNA.
- one or more of the covalent linkers comprise a cleavable covalent linker.
- the cleavable covalent linker contains an acid cleavable bond, a reductant cleavable bond, a bio-cleavable bond, or an enzyme cleavable bond.
- the cleavable covalent linker is cleavable under intracellular conditions.
- at least one covalent linker comprises a disulfide bond or a compound of Formula (I): wherein: S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit; each R 1 is independently a C2-C10 alkyl, alkoxy, or aryl group; R2 is a thiopropionate or disulfide
- each X is selected from: .
- the compound of Formula (I) comprises
- the compound of Formula (I) comprises
- the compound of Formula (I) comprises
- the covalent linker of Formula (I) is formed from a
- one or more of the covalent linkers comprise a nucleotide linker.
- the nucleotide linker comprises 2-6 nucleotides.
- the nucleotide linker comprises a dinucleotide linker. In an embodiment, the nucleotide linker comprises a tetranucleotide linker
- each covalent linker is the same.
- the covalent linkers comprise two or more different covalent linkers.
- At least two subunits are joined by covalent linkers between the 3’ end of a first subunit and the 3’ end of a second subunit.
- At least two subunits are joined by covalent linkers between the 3’ end of a first subunit and the 5’ end of a second subunit.
- At least two subunits are joined by covalent linkers between the 5’ end of a first subunit and the 3’ end of a second subunit.
- At least two subunits are joined by covalent linkers between the 5’ end of a first subunit and the 5’ end of a second subunit.
- the multimeric oligonucleotide further comprises one or more targeting ligands.
- at least one of the subunits is a targeting ligand.
- the targeting ligand is an aptamer.
- a terminus of the multimeric oligonucleotide is covalently bound to a targeting ligand.
- an interior subunit is covalently bound to a targeting ligand.
- at least one terminus of the multimeric oligonucleotide is covalently bound to a targeting ligand and at least one internal subunit of the multimeric oligonucleotide is covalently bound to a targeting ligand.
- each of the termini of the multimeric oligonucleotide are covalently bound, respectively, to a targeting ligand, and each of the internal subunits of the multimeric oligonucleotide are covalently bound, respectively to a targeting ligand.
- the targeting ligand is a protein, antigen-binding protein, peptide, amino acid, nucleic acid (including, e.g., DNA, RNA, and an artificial or non-natural nucleic acid analog), aptamer, lipid, phospholipid, carbohydrate, polysaccharide, N-Acetylgalactosamine (GalNAc), mannose, other mannose receptor- binding ligand, folate, other folate receptor-binding ligand, immunostimulant, other organic compound, and/or inorganic chemical compound.
- nucleic acid including, e.g., DNA, RNA, and an artificial or non-natural nucleic acid analog
- the targeting ligand comprises N-Acetylgalactosamine (GalNAc).
- the targeting ligand is a peptide
- the peptide is APRPG, cNGR (CNGRCVSGCAGRC), F3 (KDEPQRRSARLSAKPAPPKPEPKPKKAPAKK), CGKRK, and/or iRGD (CRGDKGPDC).
- the targeting ligand is an antigen-binding protein
- the antigen-binding protein is an ScFv or a VHH.
- the subunit and/or targeting ligand is an immunostimulant
- the immunostimulant comprises a CpG oligonucleotide.
- the CpG oligonucleotide comprises the sequence TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 162).
- the CpG oligonucleotide comprises the sequence GGTGCATCGATGCAGGGGG (SEQ ID NO: 163).
- the multimeric oligonucleotide is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% pure.
- At least one subunit comprises an oligonucleotide with complementarity to transthyretin (TTR) mRNA.
- TTR transthyretin
- every subunit comprises an oligonucleotide with complementarity to TTR mRNA.
- the subunit with complementarity to TTR mRNA comprises increased activity in vivo relative to a monomeric oligonucleotide with complementarity to TTR mRNA.
- the subunit with complementarity to TTR mRNA comprises increased activity in vivo relative to a hexameric or larger oligonucleotide with complementarity to TTR mRNA.
- the oligonucleotide with complementarity to TTR mRNA comprises UUAUAGAGCAAGAACACUGUUUU (SEQ ID NO: 164).
- the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 2-fold increase relative to in vivo activity of the same subunit when administered in monomeric form.
- the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 5-fold increase relative to in vivo activity of the same subunit when administered in monomeric form.
- the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 10-fold increase relative to in vivo activity of the same subunit when administered in monomeric form.
- the increase in in vivo activity of one or more subunits within the multimeric oligonucleotide is an at least 2-fold increase relative to in vivo activity of the same subunit when administered in hexameric form or larger.
- the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, the method comprising subcutaneously administering an effective amount of the multimeric oligonucleotide to the subject, the multimeric oligonucleotide comprising subunits , wherein: each of the subunits comprises a single- or a double-stranded oligonucleotide, and each of the subunits is joined to another subunit by a covalent linker ; the multimeric oligonucleotide has a molecular weight and/or size configured to increase in vivo activity of one or more subunits within the multimeric oligonucleotide relative to in vivo activity of the same subunit when administered in monomeric form; and the multimeric oligonucleotide comprises six or more subunits.
- the multimeric oligonucleotide is released into a subject’s serum more slowly when administered subcutaneously relative to a monomeric oligonucleotide when administered subcutaneously.
- cellular uptake of the multimeric oligonucleotide is increased when administered subcutaneously relative to a multimeric oligonucleotide when administered intravenously.
- the multimeric oligonucleotide has increased binding to a target receptor when administered subcutaneously relative to a multimeric oligonucleotide when administered intravenously.
- the effective amount is an amount of the multimeric oligonucleotide to mediate silencing of one or more target genes.
- the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 92, Structure 93, Structure 94, or Structure 95: (Structure 92), (Structure 93), (Structure 94), or (Structure 95), wherein each
- the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 92, Structure 93, Structure 94 or Structure 95: (Structure 92), (Structure 93), (Structure 94), or (Structure 95), wherein each
- the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising:
- Structure 93 (Structure 93), or (ii) annealing a first Structure 92 with a second Structure 92, or (iii) annealing a first Structure 93 and a second Structure 93, thereby forming Structure 94, Structure 95, or Structure 96, wherein m is an integer 3 0 and n is an integer 3 0double- stranded.
- At least one terminus of the multimeric oligonucleotide is covalently bound to a targeting ligand.
- At least one internal subunit of the multimeric oligonucleotide is covalently bound to a targeting ligand.
- at least one terminus of the multimeric oligonucleotide is covalently bound to a targeting ligand and at least one internal subunit of the multimeric oligonucleotide is covalently bound to a targeting ligand.
- each of the termini of the multimeric oligonucleotide are covalently bound, respectively, to a targeting ligand, and each of the internal subunits of the multimeric oligonucleotide are covalently bound, respectively, to a targeting ligand.
- each and is 10-30, 17-27, 19-26, or 20- 25 nucleotides in length.
- one or more nucleotides within and is an RNA, a DNA, or an artificial or non-natural nucleic acid analog.
- At least one of and is a RNA is a RNA.
- At least one of and is a siRNA, a saRNA, or a miRNA In an embodiment, at least one of and is a siRNA. In an embodiment, at least one and is a miRNA. In an embodiment, at least one of and is a saRNA. In an embodiment, at least one and is a miRNA. In an embodiment, at least one of is an antisense oligonucleotide.
- two or more siRNA are joined by covalent linkers attached to the sense strands of the siRNA. In an embodiment, two or more siRNA are joined by covalent linkers attached to the antisense strands of the siRNA. In an embodiment, two or more siRNA are joined by covalent linkers attached to the sense strand of a first siRNA and the antisense strand of a second siRNA.
- one or more of the covalent linkers comprise a cleavable covalent linker.
- the cleavable covalent linker contains an acid cleavable bond, a reductant cleavable bond, a bio-cleavable bond, or an enzyme cleavable bond.
- the cleavable covalent linker is cleavable under intracellular conditions.
- the covalent linkers each, independently, comprise a disulfide bond or a compound of Formula (I): wherein: S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of or ; each R 1 is independently a C 2 -C 10 alkyl, alkoxy, or aryl group; R 2 is a thiopropionate or disulfide group; and each X is independently selected from: or
- the compound of Formula (I) is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
- the compound of Formula (I) is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
- the compound of Formula (I) is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
- the covalent linker of Formula (I) is formed from a
- R 2 is a thiopropionate or disulfide group.
- one or more of the covalent linkers comprise a nucleotide linker.
- the nucleotide linker is between 2-6 nucleotides in length.
- the nucleotide linker is a dinucleotide linker.
- the nucleotide linker is a tetranucleotide linker.
- each covalent linker is the same.
- the covalent linkers comprise two or more different covalent linkers.
- two or more adjacent oligonucleotide subunits are joined by covalent linkers between the 3’ end of a first subunit and the 3’ end of a second subunit. In an embodiment, two or more adjacent oligonucleotide subunits are joined by covalent linkers between the 3’ end of a first subunit and the 5’ end of a second subunit. In an embodiment, two or more adjacent oligonucleotide subunits are joined by covalent linkers between the 5’ end of a first subunit and the 3’ end of a subunit. In an embodiment, two or more adjacent oligonucleotide subunits are joined by covalent linkers between the 5’ end of a first subunit and the 5’ end of a second subunit.
- the targeting ligand is a protein, antigen-binding protein, peptide, amino acid, nucleic acid (including, e.g., DNA, RNA, and an artificial or non-natural nucleic acid analog), aptamer, lipid, phospholipid, carbohydrate, polysaccharide, N-Acetylgalactosamine (GalNAc), mannose, other mannose receptor- binding ligand, folate, other folate receptor-binding ligand, immunostimulant, other organic compound, and/or inorganic chemical compound.
- nucleic acid including, e.g., DNA, RNA, and an artificial or non-natural nucleic acid analog
- the targeting ligand comprises N-Acetylgalactosamine (GalNAc).
- the targeting ligand is a peptide
- the peptide is APRPG, cNGR (CNGRCVSGCAGRC), F3 (KDEPQRRSARLSAKPAPPKPEPKPKKAPAKK), CGKRK, and/or iRGD (CRGDKGPDC).
- the targeting ligand is an antigen-binding protein
- the antigen binding protein is an ScFv or a VHH.
- the subunit and/or targeting ligand is an immunostimulant, and the immunostimulant comprises a CpG oligonucleotide.
- the CpG oligonucleotide comprises the sequence TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 162).
- the CpG oligonucleotide comprises the sequence GGTGCATCGATGCAGGGGG (SEQ ID NO: 163).
- the multimeric oligonucleotide is at least 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100% pure.
- At least one of the oligonucleotide subunits comprises an oligonucleotide with complementarity to transthyretin (TTR) mRNA.
- TTR transthyretin
- the oligonucleotide with complementarity to TTR mRNA comprises UUAUAGAGCAAGAACACUGUUUU (SEQ ID NO: X).
- one or more subunits comprise one or more
- one or more subunits comprise 1-3 phosphorothioate modifications at the 5’ and/or 3’ end. In an embodiment, each subunit comprises 1-10 phosphorothioate modifications.
- FIG. 1A presents the chemical structure of a tri-antennary N- acetylgalactosamine ligand.
- FIG.1B presents the chemical structure of a dithio-bis-maleimidoethane.
- FIG. 2 presents a 5’-GalNAc-siFVII canonical control, which is discussed in connection with Example 9.
- FIG. 3 presents a GalNAc-homodimer (XD-06330), which is discussed in connection with Example 10.
- FIG. 4 presents a schematic diagram of a synthesis of a GalNAc- homodimer (XD-06360), which is discussed in connection with Example 11.
- FIG. 5 presents a schematic diagram of a synthesis of a GalNAc- homodimer (XD-06329), which is discussed in connection with Example 12.
- FIG. 6 presents data showing FVII activity in mouse serum (knockdown by FVII homodimeric GalNAc conjugates), which is discussed in connection with Example 13.
- FIGS. 7A, 7B, and 7C present data showing FVII activity in mouse serum (knockdown by FVII homodimeric GalNAc conjugates normalized for GalNAc content), which is discussed in connection with Example 13.
- FIG. 8 presents canonical GalNAc-siRNAs independently targeting FVII, ApoB and TTR, which are discussed in connection with Example 14.
- FIG. 9 presents a GalNAc-heterotrimer (XD-06726), which is discussed in connection with Example 15. Key: In this Example,“GeneA” is siFVII;“GeneB” is siApoB; and“GeneC” is siTTR.
- FIG. 10 presents a schematic diagram for a synthesis strategy for a GalNAc-conjugated heterotrimer (XD-06726), which is discussed in connection with Example 15. Key: In this Example,“GeneA” is siFVII;“GeneB” is siApoB; and “GeneC” is siTTR.
- FIG. 11 presents a GalNAc-heterotrimer conjugate (XD-06727), which is discussed in connection with Example 16. Key: In this Example,“GeneA” is siFVII; “GeneB” is siApoB; and“GeneC” is siTTR.
- FIG. 12 presents a schematic diagram for a synthesis strategy for GalNAc- conjugated heterotrimer (XD-06727), which is discussed in connection with Example 16. Key: In this Example,“GeneA” is siFVII;“GeneB” is siApoB; and“GeneC” is siTTR.
- FIG. 13 presents data for an HPLC analysis of the addition of X20336 to X20366, which is discussed in connection with Example 16.
- FIG. 14 presents data for an HPLC analysis of the further addition of X19580 to the reaction product of X20336 and X20366, which is discussed in connection with Example 16.
- FIG. 15 presents data for an HPLC analysis of the further addition of X18795 (5’-siFVIIantisense-3’) to the reaction product of X20336, X20366, and X19580 to yield XD-06727, which is discussed in connection with Example 16.
- FIGS. 16A and 16B present data for TTR protein levels in serum samples (measured by ELISA), which is discussed in connection with Example 18.
- FIGS. 17A and 17B present data for FVII enzymatic activity in serum samples, which is discussed in connection with Example 18.
- FIGS.18A and 18B present data for ApoB protein levels in serum samples (measured by ELISA), which is discussed in connection with Example 18.
- FIGS. 19A and 19B present target knockdown in liver data, which is discussed in connection with Example 18.
- FIG. 20 presents a GalNAc-heterotetramer conjugate (XD-07140), which is discussed in connection with Example 19. Key: In this Example,“GeneA” is siFVII; “GeneB” is siApoB; and“GeneC” is siTTR. [00191] FIG. 21 presents a schematic diagram for synthesis of a GalNAc- heterotetramer conjugate (XD-07140), which is discussed in connection with Example 19. Key: In this Example,“GeneA” is siFVII;“GeneB” is siApoB; and“GeneC” is siTTR.
- FIG. 22 presents HPLC results of the GalNAc-siFVII-siApoB-siTTR- siFVII heteroetramer (XD-07140), which is discussed in connection with Example 19.
- FIG. 23 presents a schematic diagram illustrating the steps for synthesizing a homohexamer, which is discussed in connection with Example 23.
- FIGS. 24A and 24B present RP-HPLC results showing yield and purity of the single stranded RNA X30835, which are discussed in connection with Example 24.
- FIGS. 24C and 24D present RP-HPLC results showing yield and purity of the single stranded RNA X30837, which are discussed in connection with Example 24.
- FIG. 24E presents RP-HPLC results for X30838, which is discussed in connection with Example 24.
- FIG. 24F presents RP-HPLC results for X30838, X18795 and XD-09795, which are discussed in connection with Example 24.
- FIG. 25 presents data showing serum concentrations of FVII antisense RNA in mice at various times after injection of XD-09795 or XD-09794, which is discussed in connection with Example 25.
- FIGS. 26A-J present data showing serum levels of various cytokines in mice at various times after injection of XD-09795 or XD-09794, which is discussed in connection with Example 26.
- FIG. 27A presents a schematic diagram for a synthesis strategy for monomer of FVII siRNA, which is discussed in connection with Example 28.
- FIG. 27B presents RP-HPLC results for XD-09794, which is discussed in connection with Example 28.
- FIG. 28A presents a schematic diagram for a synthesis strategy for homodimer of FVII siRNA, which is discussed in connection with Example 29.
- FIG. 28B presents RP-HPLC results for XD-10635, which is discussed in connection with Example 29.
- FIG. 29A presents a schematic diagram for a synthesis strategy for homotrimer of FVII siRNA, which is discussed in connection with Example 30.
- FIG. 29B presents RP-HPLC results for XD-10636, which is discussed in connection with Example 30.
- FIG. 30A presents a schematic diagram for a synthesis strategy for a homotetramer of FVII siRNA, which is discussed in connection with Example 31.
- FIG. 30B presents RP-HPLC results for XD-10637, which is discussed in connection with Example 31.
- FIG. 31A presents a schematic diagram for a synthesis strategy for homo- pentamer of FVII siRNA, which is discussed in connection with Example 32.
- FIG. 31B presents RP-HPLC results for XD-10638, which is discussed in connection with Example 32.
- FIG. 32A presents a schematic diagram for a synthesis strategy for a homohexamer of FVII siRNA, which is discussed in connection with Example 33.
- FIG. 32B presents RP-HPLC results for XD-10639, which is discussed in connection with Example 33.
- FIG. 33A presents a schematic diagram for a synthesis strategy for a homohexamer of FVII siRNA via mono-DTME conjugate, which is discussed in connection with Example 34.
- FIG. 33B presents RP-HPLC results for XD-09795, which is discussed in connection with Example 34.
- FIG. 34A presents a schematic diagram for a synthesis strategy for a homo-heptamer of FVII siRNA via mono-DTME conjugate, which is discussed in connection with Example 35.
- FIG. 34B presents RP-HPLC results for XD-10640, which is discussed in connection with Example 35.
- FIG. 35A presents a schematic diagram for a synthesis strategy for a homo-octamer of FVII siRNA via mono-DTME conjugate, which is discussed in connection with Example 36.
- FIG. 35B presents RP-HPLC results for XD-10641, which is discussed in connection with Example 36.
- FIG. 36A presents a smooth line scatter plot of FVII siRNA levels in serum for various FVII siRNA multimers over time which is discussed in connection with Example 37.
- FIG. 36B presents a straight marked scatter plot of FVII siRNA levels in serum for various FVII siRNA multimers over time, which is discussed in connection with Example 37.
- FIGS. 37A-D present bar charts of FVII siRNA levels in serum for FVII siRNA multimers at various times after administration of the respective oligonucleotides, which is discussed in connection with Example 37.
- FIG. 38A presents a bar chart of FVII siRNA exposure levels in serum (area under the curve) for FVII multimers, which is discussed in connection with Example 37.
- FIG. 38B presents a bar chart of total FVII siRNA levels in serum (normalized area under the curve) for FVII multimers normalized to monomer, which is discussed in connection with Example 37.
- FIG. 39 presents a bar chart of time taken for multimers to reach the same FVII siRNA serum concentrations as the monomer at 5 minutes, which is discussed in connection with Example 38.
- FIG. 40 represents a schematic diagram for a synthesis strategy for homotetrameric siRNA, which is discussed in connection with Example 20.
- FIG. 41 represents a schematic diagram for a synthesis strategy for homotetrameric siRNA having linkages on alternating strands, which is discussed in connection with Example 20.
- FIG. 42 represents a schematic diagram showing a synthesis strategy for a heterohexameric siRNA in the format of 4:1:1 siFVII:siApoB:siTTR targeting siRNA.
- FIG. 43 represents a schematic diagram for the preparation of FVII targeting sense strands.
- FIG. 44 depicts RP-HPLC and MS data for the FVII targeting sense strand X39850.
- FIG. 45 depicts RP-HPLC and MS data for the FVII targeting sense strand X39851.
- FIG. 46 depicts RP-HPLC and MS data for the FVII targeting antisense strand X18795.
- FIG. 47 depicts RP-HPLC and MS data for the FVII targeting antisense strand linked to the ApoB targeting antisense strand via a disulfide linkage and designated X39855.
- FIG. 48 depicts RP-HPLC data for the annealed duplex of X39850 and X18795 (X39850-X18795).
- FIG. 49 depicts RP-HPLC data for the product of the conjugation between the FVII duplex X39850-X18795 and the FVII targeting sense strand X39851 (X39850-X18795-X39851).
- FIG. 50 depicts RP-HPLC data for the product of annealing X39850- X18795-X39851 to the dimeric FVII / ApoB targeting antisense strand X39855 (X39850-X18795-X39851-X39855).
- FIG. 51 depicts RP-HPLC and MS data for the FVII targeting sense strand linked to the TTR targeting sense strand via a disulfide linkage and designated X39852.
- FIG. 52 depicts RP-HPLC and MS data for the FVII targeting antisense strand linked to the TTR targeting antisense strand via a disulfide linkage and designated X39854.
- FIG. 53 depicts RP-HPLC and MS data for the FVII targeting sense strand linked to the ApoB targeting sense strand via a disulfide linkage and designated X39853.
- FIG. 54 depicts RP-HPLC data for the product of annealing the dimeric sense strand X39852 to the FVII targeting antisense strand X18795 (X39852-X18795).
- FIG. 55 depicts RP-HPLC data for the product of annealing the dimeric antisense strand X39854 to X39852-X18795 (X39852-X18795-X39854).
- FIG. 56 depicts RP-HPLC data for the product of annealing the dimeric sense strand X39853 to X39852-X18795-X39854 (X39852-X18795-X39854-X39853).
- FIGS. 57A and 57B depict RP-HPLC (FIG. 57A) and MS (FIG. 57B) data for the product of annealing X39852-X18795-X39854-X39853 of FIG. 56 to X39850- X18795-X39851-X39855 of FIG. 50 to form the final hetero-hexameric siRNA (X39850-X18795-X39851-X39855-X39852-X18795-X39854-X39853).
- FIG. 58 depicts knockdown of TTR by 4:1:1 FVII:ApoB:TTR hexamer at 6 mg/kg, equivalent to 1 mg/kg TTR monomer.
- FIG. 59 represents a schematic diagram (Scheme 1) for the synthesis of a homotetrameric siRNA targeting TTR, as described in Example 41.
- FIG. 60 represents a schematic diagram (Scheme 2) for the synthesis of a homotetrameric siRNA targeting TTR, as described in Example 42.
- FIG. 61 represents a schematic diagram (Scheme 3) for the synthesis of a homotetrameric siRNA targeting TTR, as described in Example 43.
- FIG. 62 represents a schematic diagram (Scheme 4) for the synthesis of a homotetrameric siRNA targeting TTR, as described in Example 44.
- FIG. 63 is a depiction of a series of homomultimers from 1- to 8-mer to be administered subcutaneously and evaluated as described in Example 45.
- FIG. 63 is a depiction of a series of homomultimers from 1- to 8-mer to be administered subcutaneously and evaluated as described in Example 45.
- compositions and methods to (1) increase the bioactivity of an oligonucleotide agent administered to a subject via SC
- oligonucleotide agent delivered to a subject by SC administration.
- oligonucleotide agents double- stranded and single stranded, including for example, siRNAs, saRNAs, miRNAs, aptamers, and antisense oligonucleotides.
- oligonucleotides are prepared as multimers having monomeric subunits joined by covalent linkers, wherein the subunits may be multiple copies of the same subunit or differing subunits.
- oligonucleotide has a molecular weight and/or size configured to decrease the rate of release of the multimeric oligonucleotide from the subcutaneous tissue and/or decrease clearance of the multimeric oligonucleotide by the kidney.
- these aspects of the molecular weight and/or size of the multimer may result in increased bioavailability of the multimeric oligonucleotide, increased uptake of the agent per internalization event, and increased in vivo bioactivity of one or more subunits within the multimeric oligonucleotide, in each case relative to in vivo bioactivity of the same subunit when administered in monomeric form.
- the multimeric oligonucleotide when administered to a subject, may have an increased serum half-life, thereby increasing the potential over time for cellular delivery and internalization, and thereby increasing in vivo bioactivity of at least one subunit in the multimeric oligonucleotide relative to a corresponding monomer.
- a siRNA homotetramer administered to a subject via IV administration had a reduced rate of excretion via the kidney resulting in a serum half-life of approximately 10 times that of the corresponding monomer (see FIG.38B), thereby increasing the potential over time for cellular delivery and internalization of the tetramer, which, when internalized, delivers four times the therapeutic payload relative to monomer, thereby increasing in vivo bioactivity of the tetramer relative to monomer.
- a larger effect is seen with a siRNA homopentamer, which, when administered via IV, resulted in a serum half-life of approximately 15 times that of the corresponding monomer (see FIG.38B), and delivery of 5 times the therapeutic payload relative to monomer.
- the multimeric oligonucleotide when given to a subject via SC administration, may have a reduced rate of release of the multimer from the SC tissue relative to monomer, thereby increasing the potential over time for cellular delivery and internalization of the multimer relative to monomer, and thereby increasing in vivo bioactivity of at least one subunit within the multimer relative to a corresponding monomer.
- the rate of release of a multimer from the SC tissue relative to monomer can be determined by SC administration of a multimer without a targeting ligand and determination of the concentration of the multimer in serum over time.
- the multimeric oligonucleotide can have a molecular weight of at least about 45 kD, or can have a molecular weight in the range of about 45-60 kD.
- the improved and advantageous properties of the multimers according to the disclosure can be in terms of increased in vivo bioactivity.
- increased bioactivity may be represented by decreased levels of a target protein or mRNA after administration of the multimeric oligonucleotide. This increased bioactivity may be observed relative to a corresponding monomeric oligonucleotide.
- a multimeric oligonucleotide comprising two or more subunits of the same agent can deliver a higher payload per ligand/receptor binding event than the monomeric equivalent.
- the multimeric oligonucleotide may also be combined with one or more targeting ligands, and optionally with other ligands or moieties designed for other purposes, such as to expedite intracellular release.
- the present disclosure also relates to new synthetic intermediates and methods of synthesizing the multimeric oligonucleotides.
- the present disclosure also relates to methods of using the multimeric oligonucleotides, for example in reducing gene expression, biological research, treating or preventing medical conditions, and/or to produce new or altered phenotypes.
- the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, the method comprising administering subcutaneously an effective amount of the multimeric oligonucleotide to the subject, the multimeric oligonucleotide comprising subunits , wherein: each of the subunits is independently a single- or double-stranded oligonucleotide, and each of the subunits is joined to another subunit by a covalent linker ; the multimeric oligonucleotide has a molecular weight and/or size configured to decrease the rate of release from the subcutaneous tissue and/or decrease clearance of the multimeric oligonucleotide via the kidney.
- Decreased clearance of the multimeric oligonucleotide via the kidney may be a result of decreased glomerular filtration.
- the molecular weight of the multimeric oligonucleotide may be at least about 45 kD, or in the range of about 45-60 kD.
- the disclosure provides a method of subcutaneously administering a multimeric oligonucleotide to a subject in need thereof, wherein the number of subunits contained in the multimeric oligonucleotide is m, m being an integer selected to enable the multimeric oligonucleotide to have the molecular weight and/or size configured to decrease its rate of release from the subcutaneous tissue and/or decrease its clearance via the kidney (e.g., decrease its clearance due to glomerular filtration).
- m is 3 2, 3 3, 3 4, 3 4 and £ 17, 3 4 and £ 8, or 4, 5, 6, 7, or 8.
- the disclosure provides a method of subcutaneously administering a multimeric oligonucleotide to a subject in need thereof, in which the multimeric oligonucleotide comprises Structure 21: (Structure 21) wherein: each of the subunits is independently a single- or double-stranded oligonucleotide; each of the subunits is joined to another subunit by a covalent linker ; and n is an integer > 0. In one embodiment, n is 0, 1, or 2.
- the disclosure provides a method of subcutaneously administering a multimeric oligonucleotide to a subject in need thereof, in which the subunits are single-stranded oligonucleotides.
- the disclosure provides a method of subcutaneously administering a multimeric oligonucleotide to a subject in need thereof, wherein n is 3 1.
- the disclosure provides a method of subcutaneously administering a multimeric oligonucleotide to a subject in need thereof, in which the subunits are double-stranded oligonucleotides.
- the disclosure provides a method of subcutaneously administering a multimeric oligonucleotide to a subject in need thereof, in which decreased clearance of the multimer via the kidney (e.g., due to glomerular filtration), with or without a reduced rate of release of the multimer from SC tissue, results in increased bioactivity of the multimeric oligonucleotide.
- the decreased clearance of the multimer via the kidney is determined by measuring the in vivo circulation half-life of the multimeric oligonucleotide after administering the multimeric oligonucleotide to the subject.
- the decreased clearance of the multimer via the kidney is determined by measuring the time required for the serum concentration of the multimeric oligonucleotide to decrease to a predetermined value.
- the predetermined value can be 90%, 80%, 70%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, or 1% of the administered dose.
- the decreased clearance via the kidney is determined by measuring the serum concentration of the multimeric oligonucleotide at a predetermined time after administering the multimeric oligonucleotide to the subject.
- the decreased clearance via the kidney is determined by measuring the area under a curve of a graph representing serum concentration of the multimeric oligonucleotide over time after administering the multimeric oligonucleotide to the subject. Effects of Decreased Clearance of Multimeric Oligonucleotide Administered to Subjects
- the disclosure provides a method of subcutaneously administering a multimeric oligonucleotide to a subject in need thereof, in which decreased clearance of the multimer via the kidney (e.g., due to glomerular filtration), with or without a reduced rate of release of the multimer from SC tissue, results in increased in vivo bioavailability of the multimeric oligonucleotide.
- the increased bioavailability of the multimeric oligonucleotide results in an increase in in vivo cellular uptake of the multimeric oligonucleotide.
- the increased bioavailability of the multimeric oligonucleotide results in an increase in the in vivo therapeutic index/ratio of the multimeric oligonucleotide.
- the increased bioavailability of the multimeric oligonucleotide results in an increase in the in vivo bioactivity of at least one subunit of the multimeric oligonucleotide relative to a corresponding monomer.
- the disclosure provides a method of subcutaneously administering a multimeric oligonucleotide to a subject in need thereof, wherein a measured parameter relating to decreased clearance of the multimer via the kidney (e.g., due to glomerular filtration), for example serum half-life of the multimer, and/or a measured parameter relating to rate of release of the multimer from SC tissue, has a sigmoidal relationship with respect to the number of subunits in a monomeric, dimeric, trimeric and higher number multimeric oligonucleotide, for example, as shown in FIGS. 37A-37D.
- the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, wherein the measured parameter for the multimeric oligonucleotide and each of its subunits starting with a monomeric subunit, when plotted, define a sigmoidal curve, for example, as shown in FIGS. 38A-38B.
- Multimeric Oligonucleotide Multimeric Oligonucleotide
- the disclosure provides a multimeric oligonucleotide comprising subunits , wherein: each of the subunits is independently a single- or double-stranded oligonucleotide, and each of the subunits is joined to another subunit by a covalent linker .
- the multimeric oligonucleotide has a molecular weight and/or size configured to decrease the rate of release from the subcutaneous tissue and/or decrease clearance of the multimeric oligonucleotide via the kidney.
- Decreased clearance of the multimeric oligonucleotide via the kidney may be a result of decreased glomerular filtration.
- the molecular weight of the multimeric oligonucleotide may be at least about 45 kD, or in the range of about 45-60 kD.
- the disclosure provides a multimeric oligonucleotide wherein the number of subunits contained in the multimeric oligonucleotide is m, m being an integer selected to enable the multimeric oligonucleotide to decrease its rate of release from the subcutaneous tissue and/or decrease its clearance via the kidney (e.g., decrease its clearance due to glomerular filtration).
- m is 3 2, 3 3, 3 4, 3 4 and £ 17, 3 4 and £ 8, or 4, 5, 6, 7, or 8.
- the disclosure provides a multimeric oligonucleotide comprising Structure 21:
- each of the subunits is independently a single- or double-stranded oligonucleotide; each of the subunits is joined to another subunit by a covalent linker ; wherein at least one of the subunits comprises a single strand having one of the covalent linkers joined to its 3’ terminus and another of the covalent linkers joined to its 5’ terminus, and n is an integer 3 0.
- the disclosure provides a multimeric oligonucleotide in which each subunit is 15-30, 17-27, 19-26, or 20-25 nucleotides in length.
- the disclosure provides a multimeric oligonucleotide wherein n 3 1 and n £ 17.
- the disclosure provides a multimeric oligonucleotide in which n 3 1 and n £ 5.
- the disclosure provides a multimeric oligonucleotide in which n is 1, 2, 3, 4, or 5. [00292] In one aspect, the disclosure provides a multimeric oligonucleotide wherein each subunit is a double-stranded RNA and n 3 1.
- the disclosure provides a multimeric oligonucleotide in which each subunit is a single-stranded oligonucleotide.
- the disclosure provides a multimeric oligonucleotide in which each subunit is a double-stranded oligonucleotide.
- the disclosure provides a multimeric oligonucleotide in which the subunits comprise a combination of single-stranded and double-stranded oligonucleotides.
- the disclosure provides a multimeric oligonucleotide in which each subunit is a RNA, a DNA, or an artificial or non-natural nucleic acid analog.
- the disclosure provides a multimeric oligonucleotide in which each subunit is an RNA.
- the disclosure provides a multimeric oligonucleotide in which each subunit is a siRNA, a saRNA, or a miRNA.
- the disclosure provides a multimeric oligonucleotide in which each subunit is a double-stranded siRNA and each of the covalent linkers joins sense strands of the siRNA.
- the disclosure provides a multimeric oligonucleotide in which the multimeric oligonucleotide comprises a homo-multimer of substantially identical subunits . In some embodiments, all of the oligonucleotide subunits are the same.
- the disclosure provides a multimeric oligonucleotide in which the multimeric oligonucleotide comprises a hetero-multimer of two or more substantially different subunits .
- the multimeric oligonucleotide comprises a hetero-multimer of two or more substantially different subunits .
- at least one oligonucleotide subunit is different from another oligonucleotide subunit .
- all of the subunits are different.
- the disclosure provides a multimeric oligonucleotide in which the multimeric oligonucleotide is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% pure. [00303] In one aspect, the disclosure provides a multimeric oligonucleotide wherein each subunit is independently a double-stranded oligonucleotide , and wherein n is an integer 3 1.
- the disclosure provides a multimeric oligonucleotide wherein each subunit is independently a double-stranded oligonucleotide wherein n is an integer 3 1, and wherein each covalent linker is on the same
- the disclosure provides a multimeric oligonucleotide comprising Structure 22 or 23: (Structure 22); (Structure 23)
- each is a double-stranded oligonucleotide
- each is a covalent linker joining adjacent double-stranded oligonucleotides
- f is an integer 3 1
- g is an integer 3 0.
- the disclosure provides a plurality of a multimeric oligonucleotide wherein substantially all of the multimeric oligonucleotides have a predetermined value of n and/or predetermined molecular weight.
- the disclosure provides a multimeric oligonucleotide in which the multimeric oligonucleotide further comprises a targeting ligand or functional moiety as described below in the section “Conjugates, Functional Moieties, Delivery Vehicles and Targeting Ligands” (hereinafter, collectively,“a Functional Moiety” or “FM”).
- the multimeric oligonucleotide may be represented by Structure A:
- each of the subunits is independently a single- or double-stranded oligonucleotide; each of the subunits is joined to another subunit by a covalent linker , n is greater than or equal to zero, and FM may independently be a functional moiety, a targeting ligand, or absent. In some embodiments, at least two of the FMs are present.
- the disclosure provides a multimeric oligonucleotide in which n is 1, 2, or 3. In another aspect, the disclosure provides a multimeric oligonucleotide in which n is 4, 5, 6, 7, 8, 9, or 10.
- the disclosure provides a multimeric oligonucleotide in which at least one of the subunits is a Functional Moiety or FM.
- At least one terminus of a multimeric oligonucleotide is covalently bound to a Functional Moiety or FM.
- At least one internal subunit of a multimeric oligonucleotide is covalently bound to a Functional Moiety or FM.
- At least one terminus of the multimeric oligonucleotide is covalently bound to a Functional Moiety or FM and at least one internal subunit of the multimeric oligonucleotide is covalently bound to a Functional Moiety or FM.
- each of the termini of the multimeric oligonucleotide is covalently bound, respectively, to a Functional Moiety
- each of the internal subunits of the multimeric oligonucleotide are covalently bound, respectively, to a Functional Moiety.
- At least one of FMs that are present in the multimeric oligonucleotide is different from any other FM that is present in the oligonucleotide.
- all of FM that are present in the multimeric oligonucleotide are the same.
- each FM that is present in the multimeric oligonucleotide is different from any other FM that is present in the oligonucleotide. Thus all the FMs are different.
- the disclosure provides a multimeric oligonucleotide in which one or more of the covalent linkers comprise a cleavable covalent linker and include nucleotide linkers, for example, as discussed in Examples 20, 22B and 27.
- a nucleotide linker is a linker that contains one or more nucleotides and it can be chosen such that it does not carry out any other designated function.
- the disclosure provides a multimeric oligonucleotide in which the cleavable covalent linker contains an acid cleavable bond, a reductant cleavable bond, a bio-cleavable bond, or an enzyme cleavable bond.
- the disclosure provides a multimeric oligonucleotide in which the cleavable covalent linker is cleavable under intracellular conditions.
- the disclosure provides a multimeric oligonucleotide in which each covalent linker is the same.
- the disclosure provides a multimeric oligonucleotide in which all of the covalent linkers are different.
- the disclosure provides a multimeric oligonucleotide in which the covalent linkers comprise two or more different covalent linkers. In other words, at least one of the covalent linkers is different from anther covalent linker.
- the disclosure provides a multimeric oligonucleotide in which each covalent linker joins two monomeric subunits .
- the disclosure provides a multimeric oligonucleotide in which at least one covalent linker joins three or more monomeric subunits .
- the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 51: (Structure 51)
- each is a single stranded oligonucleotide, each is a covalent linker joining adjacent single stranded oligonucleotides, and a is an integer 3 1, the method comprising the steps of:
- Structure 51 (Structure 51) with complementary single stranded oligonucleotides , thereby forming Structure 54: (Structure 54).
- the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 54: (Structure 54) wherein each is a single stranded oligonucleotide, each is a covalent linker joining adjacent single stranded oligonucleotides, and a 3 1, the method comprising the steps of: (i) annealing Structure 51: (Structure 51) with complementary single stranded oligonucleotides , thereby forming Structure 54:
- the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof.
- subjects include, but are not limited to, mammals, such as primates, rodents, and agricultural animals.
- a primate subject includes, but is not limited to, a human, a chimpanzee, and a rhesus monkey.
- a rodent subject includes, but is not limited to, a mouse and a rat.
- Examples of an agricultural animal subject includes, but is not limited to, a cow, a sheep, a lamb, a chicken, and a pig.
- Mouse glomerular filtration rate can be about 0.15 ml/min. - 0.25 ml/min. Human GFR can be about 1.8 ml/min/kg (Mahmood I: (1998) Interspecies scaling of renally secreted drugs. Life Sci 63:2365–2371).
- mice can have about 1.46 ml of blood. Therefore, the time for glomerular filtration of total blood volume in mice can be about 7.3 minutes (1.46/0.2). Humans can have about 5 liters of blood and weigh about 70 kg. Therefore, the time for glomerular filtration of total blood volume in humans can be about 39.7 mins
- a person of ordinary skill in the art would recognize that different species can have different rates of clearance by glomerular filtration, at least for the above reasons.
- a person of ordinary skill in the art can infer that a ratio of rate of clearance by glomerular filtration between human and mouse times can be about 1:5 or 1:6.
- the rate of clearance of a certain substance (e.g., a particular oligonucleotide) by humans can be 5-6 times slower than that of a mouse.
- the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, wherein the in vivo circulation half-life is measured between 30 minutes and 120 minutes after administering the multimeric oligonucleotide to the subject.
- the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, wherein the predetermined time is between 30 minutes and 120 minutes after administering the multimeric oligonucleotide to the subject.
- the disclosure provides a method of administering a multimeric oligonucleotide to a subject in need thereof, wherein the area under the curve is calculated based on serum concentration of the multimeric oligonucleotide between x and y minutes after administering the multimeric oligonucleotide to the subject.
- x can be 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 75, 90, 120, 180, 240, or 300 minutes
- y can be 90, 120, 180, 240, 300, 360, 420, 480, 540, 600, 720, 840, 960, 1080, 1200, 1320, 1440, or 1600 minutes.
- the time range can be about 30 minutes - 120 minutes, about 1minute - 1600 minutes, or about 300 minutes - 600 minutes.
- the disclosure provides a multimeric oligonucleotide or a method for increasing in vivo circulation half-life of the multimeric oligonucleotide, wherein the multimeric oligonucleotide is not formulated in a nanoparticle (NP) or a lipid nanoparticle (LNP).
- NP nanoparticle
- LNP lipid nanoparticle
- the present disclosure also relates to multimeric oligonucleotides having improved pharmacodynamics and/or pharmacokinetics.
- the multimeric oligonucleotides e.g., a multimeric oligonucleotide including 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more siRNA
- a multimeric oligonucleotide having two or more of the same subunits can also deliver a higher oligonucleotide payload per cellular internalization event, or, if the multimeric oligonucleotide comprises a cell targeting ligand, per ligand/receptor binding event, relative to the monomeric equivalent.
- the present disclosure also relates to new synthetic intermediates and methods of synthesizing the multimeric oligonucleotides.
- the present disclosure also relates to methods of using the multimeric oligonucleotides, for example in reducing gene expression, biological research, treating or preventing medical conditions, and/or to produce new or altered phenotypes.
- the oligonucleotide is RNA, DNA, or comprises an artificial or non-natural nucleic acid analog.
- the oligonucleotide is RNA, DNA, or comprises an artificial or non-natural nucleic acid analog.
- oligonucleotide is single stranded. In various embodiments, the oligonucleotide is double-stranded (e.g., antiparallel double-stranded).
- the oligonucleotide is RNA, for example an antisense RNA (aRNA), CRISPR RNA (crRNA), long noncoding RNA (lncRNA), microRNA (miRNA), piwi-interacting RNA (piRNA), small interfering RNA (siRNA), messenger RNA (mRNA), short hairpin RNA (shRNA), small activating (saRNA), or ribozyme.
- aRNA antisense RNA
- crRNA CRISPR RNA
- lncRNA long noncoding RNA
- miRNA microRNA
- piwi-interacting RNA piRNA
- small interfering RNA siRNA
- messenger RNA messenger RNA
- shRNA short hairpin RNA
- small activating saRNA
- ribozyme ribozyme.
- the RNA is siRNA.
- each double- stranded oligonucleotide is an siRNA and/or has a length of about 15-30 base pairs.
- the oligonucleotide is an aptamer.
- siRNA small interfering RNA
- mRNA messenger RNA
- mRNA messenger RNA
- W. Yalcin, A., Weber, K., and Tuschl, T. (2001)
- Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411: 494-8).
- miRNAs are non-coding RNAs that play key roles in post-transcriptional gene regulation. miRNA can regulate the expression of 30% of all mammalian protein- encoding genes. Specific and potent gene silencing by double-stranded RNA (RNAi) was discovered, plus additional small noncoding RNA (Canver, M.C. et al., Nature (2015)). Pre-miRNAs are short stem loops of about 70 nucleotides in length with a 2- nucleotide 3’-overhang that are exported, into mature 19-25 nucleotide duplexes.
- RNAi double-stranded RNA
- the miRNA strand with lower base pairing stability can be loaded onto the RNA-induced silencing complex (RISC).
- RISC RNA-induced silencing complex
- the passenger guide strand can be functional but is usually degraded.
- MiRNAs mimics are described for example, in US Patent No.8,765,709.
- the RNA can be short hairpin RNA (shRNA), for example, as described in US Patent Nos.8,202,846 and 8,383,599.
- shRNA short hairpin RNA
- one or more nucleic acid subunits of the multimeric oligonucleotide can be a CRISPR guide RNA, or other RNA associated with or essential to forming a ribonucleocomplex (RNP) with a Cas nuclease in vivo, in vitro, or ex vivo, or associated with or essential to performing a genomic editing or engineering function with a Cas nuclease, including for example wild-type Cas nuclease, or any of the known modifications of wild-type Cas, such as nickases and dead Cas (dCas).
- CRISPR-Cas systems are described, for example, in US Patent No. 8,771,945; Jinek et al., Science, 337(6096): 816-821 (2012), and International Patent Application Publication No. WO 2013/176772.
- the oligonucleotide is 15-30, 17-27, 19-26, 20- 25, 40-50, 40-150, 100-300, 1000-2000, or up to 10000 nucleotides in length.
- the oligonucleotide is double-stranded and complementary.
- Complementarity can be 100% complementary, or less than 100% complementary where the oligonucleotide nevertheless hybridizes and remains double- stranded under relevant conditions (e.g., physiologically relevant conditions).
- a double-stranded oligonucleotide can be at least about 80%, 85%, 90%, or 95% complementary.
- RNA is long noncoding RNA (lncRNA)
- lncRNAs are a large and diverse class of transcribed RNA molecules with a length of more than 200 nucleotides that do not encode proteins (or lack > 100 amino acid open reading frame).
- lncRNAs are thought to encompass nearly 30,000 different transcripts in humans, hence lncRNA transcripts account for the major part of the non-coding transcriptome (see, e.g., Derrien et al., The GENCODE v7 catalog of human long noncoding RNAs: analysis of their gene structure, evolution, and expression. Genome Res, 22(9): 1775-89 (2012)).
- RNA is messenger RNA (mRNA).
- mRNA messenger RNA
- mRNA and its application as a delivery method for in-vivo production of proteins is described, for example, in International Patent Application Publication No. WO 2013/151736.
- RNA can be small activating (saRNA) (e.g., as described in Chappell et al., Nature Chemical Biology, 11: 214-220 (2015)), or ribozyme (Doherty et al., Ann Rev Biophys Biomo Struct, 30: 457-475 (2001)).
- saRNA small activating
- ribozyme Doherty et al., Ann Rev Biophys Biomo Struct, 30: 457-475 (2001)
- the oligonucleotide is DNA, for example an antisense DNA (aDNA) (e.g., antagomir) or antisense gapmer.
- aDNA antisense DNA
- antagomir antisense gapmer
- examples of aDNA, including gapmers and multimers, are described for example in Subramanian et al., Nucleic Acids Res, 43(19): 9123–9132 (2015) and International Patent Application Publication No. WO 2013/040429.
- antagomirs are described for example, in US Patent No.7,232,806.
- the oligonucleotide has a specific sequence, for example any one of the sequences disclosed herein.
- a general procedure for oligonucleotide synthesis is provided in the examples below. Other methods that can be adapted for use with the disclosure are known in the art. Modifications to Oligonucleotides
- the oligonucleotide according to the disclosure further comprises a chemical modification.
- the chemical modification can comprise a modified nucleoside, modified backbone, modified sugar, and/or modified terminus.
- Modifications include phosphorus-containing linkages, which include, but are not limited to, phosphorothioates, enantiomerically enriched phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3’alkylene phosphonates and enantiomerically enriched phosphonates, phosphinates, phosphoramidates comprising 3’-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3’-5’ linkages, 2’-5’ linked analogs of these, and those having inverted adjacent nucleoside units that are linked 3’-5’ to 5’-3’ or 2’-5’ to 5’-2’.
- the oligonucleotides contained in the multi- conjugate may comprise one or more phosphorothioate groups.
- the oligonucleotides may comprise one to three phosphorothioate groups at the 5’ end.
- the oligonucleotides may comprise one to three phosphorothioate groups at the 3’ end.
- the oligonucleotides may comprise one to three phosphorothioate groups at the 5’ end and the 3’ end.
- each oligonucleotide contained in the multi-conjugate may comprise 1-10 total phosphorothioate groups.
- each oligonucleotide may comprise fewer than 10, fewer than 9, fewer than 8, fewer than 7, fewer than 6, fewer than 5, fewer than 4, or fewer than 3 total phosphorothioate groups.
- the oligonucleotides contained in the multi-conjugate may possess increased in vivo activity with fewer phosphorothioate groups relative to the same oligonucleotides in monomeric form with more phosphorothioate groups.
- oligonucleotides contained in the multi-conjugates of this disclosure may be modified using various strategies known in the art to produce a variety of effects, including, e.g., improved potency and stability in vitro and in vivo.
- artificial nucleic acids e.g., 2’-O-methyl-substituted RNA; 2’- fluro-2’deoxy RNA, peptide nucleic acid (PNA); morpholinos; locked nucleic acid (LNA); Unlocked nucleic acids (UNA); bridged nucleic acid (BNA); glycol nucleic acid (GNA) ; and threose nucleic acid (TNA); or more generally, nucleic acid analogs, e.g., bicyclic and tricyclic nucleoside analogs, which are structurally similar to naturally occurring RNA and DNA but have alterations in one or more of the phosphate backbone, sugar, or nucleobase portions of the naturally-occurring molecule.
- nucleic acid analogs e.g., bicyclic and tricyclic nucleoside analogs, which are structurally similar to naturally occurring RNA and DNA but have alterations in one or more of the phosphate backbone, sugar, or nucleobase portions of
- analogue nucleobases confer, among other things, different base pairing and base stacking properties. Examples include universal bases, which can pair with all four canon bases. Examples of phosphate-sugar backbone analogues include, but are not limited to, PNA. Morpholino-based oligomeric compounds are described in Braasch et al., Biochemistry, 41(14): 4503-4510 (2002) and US Patent Nos.5,539,082; 5,714,331; 5,719,262; and 5,034,506.
- oligonucleotides are modified at a terminal end by substitution with a chemical functional group.
- the substitution can be performed at the 3’ or 5’ end of the oligonucleotide, and may be performed at the 3’ ends of both the sense and antisense strands of the monomer, but is not always limited thereto.
- the chemical functional groups may include, e.g., a sulfhydryl group (-SH), a carboxyl group (-COOH), an amine group (-NH2), a hydroxy group (-OH), a formyl group (-CHO), a carbonyl group (-CO-), an ether group (-O-), an ester group (-COO-), a nitro group (-NO 2 ), an azide group (-N 3 ), or a sulfonic acid group (-SO 3 H).
- a sulfhydryl group e.g., a sulfhydryl group (-SH), a carboxyl group (-COOH), an amine group (-NH2), a hydroxy group (-OH), a formyl group (-CHO), a carbonyl group (-CO-), an ether group (-O-), an ester group (-COO-), a nitro group (-NO 2 ), an azide group (-N 3
- the oligonucleotides contained in the multi-conjugates of this disclosure may be modified to, additionally or alternatively, include nucleobase (referred to in the art simply as“base”) modifications or substitutions.
- Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, 5-methylcytosine (also referred to as 5-methyl-2’ deoxycytosine and often referred to in the art as 5-Me-C), 5- hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2-(methylamino)adenine, 2- (imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-
- Modified nucleobases can include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, such as 5-bromo, 5-trifluoromethyl
- Hydroxy group (—OH) at a terminus of the nucleic acid can be substituted with a functional group such as sulfhydryl group (—SH), carboxyl group (—COOH) or amine group (—NH 2 ).
- a functional group such as sulfhydryl group (—SH), carboxyl group (—COOH) or amine group (—NH 2 ).
- the substitution can be performed at the 3’ end or the 5’ end.
- oligonucleotides are linked covalently.
- Linkers may be cleavable (e.g., under intracellular conditions, to facilitate oligonucleotide delivery and/or action) or non-cleavable.
- linkers including their composition, synthesis, and use are known in the art and may be adapted for use with the disclosure.
- a covalent linker can comprise the reaction product of nucleophilic and electrophilic groups.
- a covalent linker can comprise the reaction product of a thiol and maleimide, a thiol and vinylsulfone, a thiol and pyridyldisulfide, a thiol and iodoacetamide, a thiol and acrylate, an azide and alkyne, or an amine and carboxyl group.
- one of these groups is connected to an oligonucleotide (e.g., thiol (-SH) functionalization at the 3’ or 5’ end) and the other group is encompassed by a second molecule (e.g., linking agent) that ultimately links two oligonucleotides (e.g., maleimide in DTME).
- oligonucleotide e.g., thiol (-SH) functionalization at the 3’ or 5’ end
- a second molecule e.g., linking agent
- a covalent linker can comprise an unmodified di- nucleotide linkage or a reaction product of thiol and maleimide.
- a covalent linker can comprise a nucleotide linker of 2-6 nucleotides in length.
- a covalent linker can comprise a disulfide bond or a compound of Formula (I):
- each R1 is independently a C2-C10 alkyl, alkoxy, or aryl group;
- R2 is a thiopropionate or disulfide group
- each X is independently selected from:
- the compound of Formula (I) is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
- S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit.
- the compound of Formula (I) is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoe-N-(2-a365]
- S is and wherein S is attached by a covalent bond or by a linker to the 3’ or 5’ terminus of a subunit.
- the covalent linker of Formula (I) is formed from a covalent linking precursor of Formula (II):
- each R1 is independently a C2-C10 alkyl, alkoxy, or aryl group
- R2 is a thiopropionate or disulfide group.
- oligonucleotide can comprise two orthogonal types of bio-cleavable linkages.
- the two orthogonal bio-cleavable linkages can comprise an unmodified di- nucleotide and a reaction product of thiol and maleimide.
- the oligonucleotide is connected to the linker via a phosphodiester or thiophosphodiester (e.g., R1 in Structure 1 is a phosphodiester or thiophosphodiester).
- the oligonucleotide is connected to the linker via a C1-8 alkyl, C2-8 alkenyl, C2-8 alkynyl, heterocyclyl, aryl, and heteroaryl, branched alkyl, aryl, halo-aryl, and/or other carbon-based connectors.
- the nucleic acid or oligonucleotide is connected to the linker via a C2- C10, C3-C6, or C6 alkyl (e.g., R2 in Structure 1 is a C2-C10, C3-C6, or C6 alkyl).
- R2 in Structure 1 is a C2-C10, C3-C6, or C6 alkyl.
- the oligonucleotide is connected to the linker via a C6 alkyl.
- these moieties are optional and a direct linkage is possible.
- the oligonucleotide is connected to the linker via the reaction product of a thiol and maleimide group.
- a in Structure 1 is the reaction product of a thiol and maleimide group.
- Select linking agents utilizing such chemistry include DTME (dithiobismaleimidoethane), BM(PEG)2 (1,8- bis(maleimido)diethylene glycol), BM(PEG)3 (1,11-bismaleimido-triethyleneglycol), BMOE (bismaleimidoethane), BMH (bismaleimidohexane), or BMB (1,4- bismaleimidobutane).
- oligonucleotides can be linked together directly, via functional end- substitutions, or indirectly by way of a linking agent.
- the oligonucleotide can be bound directly to a linker (e.g., R1 and R2 of Structure 1 are absent).
- a linker e.g., R1 and R2 of Structure 1 are absent.
- Such bonding can be achieved, for example, through use of 3’-thionucleosides, which can be prepared according to the ordinary skill in the art. See, e.g., Sun et al. “Synthesis of 3’-thioribonucleosides and their incorporation into oligoribonucleotides via phosphoramidite chemistry” RNA.1997 Nov;3(11):1352-63.
- the linking agent may be a non-ionic hydrophilic polymer such as polyethyleneglycol (PEG), polyvinylpyrolidone and polyoxazoline, or a hydrophobic polymer such as PLGA and PLA.
- a polymer linking agent used as a mediator for a covalent bond may be non-ionic hydrophilic polymers including, but not limited to, PEG, Pluronic, polyvinylpyrolidone, polyoxazoline, or copolymers thereof; or one or more
- biocleavable polyester polymers including poly-L-lactic acid, poly-D-lactic acid, poly- D,L-lactic acid, poly-glycolic acid, poly-D-lactic-co-glycolic acid, poly-L-lactic-co- glycolic acid, poly-D,L-lactic-co-glycolic acid, polycaprolactone, polyvalerolactone, polyhydroxybutyrate, polyhydroxyvalerate, or copolymers thereof, but is not always limited thereto.
- the linking agent may have a molecular weight of about 100 Daltons - 10,000 Daltons.
- Examples of such linking agent include, but are not limited to, dithio- bis-maleimidoethane (DTME), 1,8-bis-maleimidodiethyleneglycol (BM(PEG)2), tris- (2-maleimidoethyl)-amine (TMEA), tri-succinimidyl aminotriacetate (TSAT), 3-arm- poly(ethylene glycol) (3-arm PEG), maleimide, N-hydroxysuccinimide (NHS), vinylsulfone, iodoacetyl, nitrophenyl azide, isocyanate, pyridyldisulfide, hydrazide, and hydroxyphenyl azide.
- DTME dithio- bis-maleimidoethane
- BM(PEG)2 1,8-bis-maleimidodiethyleneglycol
- TMEA tris- (2-
- a linking agent having cleavable bonds (such as a reductant bond that is cleaved by the chemical environment of the cytosol) or a linking agent having non- cleavable bonds can be used herein.
- the linking agent of the foregoing aspects of present disclosure can have non-cleavable bonds such as an amide bond or a urethane bond.
- the linking agent of the foregoing aspects of the present disclosure can have cleavable bonds such as an acid cleavable bond (e.g., a covalent bond of ester, hydrazone, or acetal), a reductant cleavable bond (e.g., a disulfide bond), a bio-cleavable bond, or an enzyme cleavable bond.
- the cleavable covalent linker is cleavable under intracellular conditions.
- any linking agent available for drug modification can be used in the foregoing aspects of the disclosure without limitation.
- combinations of functional groups and linking agents may include: (a) where the functional groups are amino and thiol, the linking agent may be Succinimidyl 3-(2-pyridyldithio)propionate, or Succinimydyl 6-([3(2- pyridyldithio)propioamido]hexanoate; (b) where the functional group is amino, the linking agent may be 3,3’dithiodipropionic acid di-(N-succinimidyl ester), Dithio- bis(ethyl 1H-imidazole-1-carboxylate), or Dithio-bis(ethyl 1H-imidazole-1- carboxylate); (c) where the functional groups are amino and alkyne, the linking agent may be Sulfo-N-succinimidyl3-[[2-(p-azidosalicylamido)ethyl]-1,3’-dithio]prop
- an additional step of activating the functional groups can be included.
- Compounds that can be used in the activation of the functional groups include but are not limited to 1-ethyl-3,3- dimethylaminopropyl carbodiimide, imidazole, N-hydroxysuccinimide,
- the disclosure provides an oligonucleotide coupled to a covalent linker, which can be used, for example, in the synthesis of defined multi- conjugate oligonucleotides having predetermined sizes and compositions.
- the disclosure provides a compound according to Structure 1:
- X is a nucleic acid bonded to R1 through its 3’ or 5’ terminus;
- R1 is a derivative of phosphoric acid, a derivative of thiophosphoric acid, a sulfate, amide, glycol, or is absent;
- R2 is a C2-C10 alkyl, alkoxy, or aryl group, or is absent;
- A is the reaction product of a nucleophile and an electrophile
- R3 is a C2-C10 alkyl, alkoxy, aryl, alkyldithio group, ether, thioether, thiopropionate, or disulfide;
- B is a nucleophile or electrophile used in the formation of A (e.g., a thiol, maleimide, vinylsulfone, pyridyldisulfide, iodoacetamide, acrylate, azide, alkyne, amine, or carboxyl group).
- A e.g., a thiol, maleimide, vinylsulfone, pyridyldisulfide, iodoacetamide, acrylate, azide, alkyne, amine, or carboxyl group.
- the disclosure provides a compound according to Structure 2:
- X is a nucleic acid bonded to R1 via a phosphate or derivative thereof, or thiophosphate or derivative thereof at its 3’ or 5’ terminus;
- each R1 is independently a C2-C10 alkyl, alkoxy, or aryl group
- R2 is a thiopropionate or disulfide group.
- the disclosure provides a compound according to Structure 3:
- X is a nucleic acid bonded to R1 through its 3’ or 5’ terminus
- R1 is a derivative of phosphoric acid such as phosphate, phosphodiester, phosphotriester, phosphonate, phosphoramidate and the like, a derivative of thiophosphoric acid such as thiophosphate, thiophosphodiester, thiophosphotriester, thiophosphoramidate and the like, a sulfate, amide, glycol, or is absent;
- R2 is a C2-C10 alkyl, alkoxy, or aryl group, or is absent;
- A is the reaction product of a first and a second reactive moiety
- R3 is an C2-C10 alkyl, alkoxy, aryl, alkyldithio group, ether, thioether, thiopropionate, or disulfide;
- B is a third reactive moiety.
- the disclosure also provides methods for synthesizing an oligonucleotide coupled to a covalent linker.
- the disclosure provides a method for synthesizing a compound according to Structure 1 (or adapted for synthesizing a compounds according to Structure 2 or 3), the method comprising:
- X is a nucleic acid bonded to R1 through its 3’ or 5’ terminus
- R1 a phosphodiester, thiophosphodiester, sulfate, amide, glycol, or is absent;
- R2 is a C2-C10 alkyl, alkoxy, or aryl group, or is absent;
- A is the reaction product of a nucleophile and an electrophile
- R3 is a C2-C10 alkyl, alkoxy, aryl, alkyldithio group, ether, thioether, thiopropionate, or disulfide;
- B is a nucleophile or electrophile (e.g., a thiol, maleimide, vinylsulfone, pyridyldisulfide, iodoacetamide, acrylate, azide, alkyne, amine, or carboxyl group).
- a nucleophile or electrophile e.g., a thiol, maleimide, vinylsulfone, pyridyldisulfide, iodoacetamide, acrylate, azide, alkyne, amine, or carboxyl group.
- the method can further comprise the step of synthesizing the functionalized nucleic acid X - R1 - R2 - A', wherein A' comprises a thiol (-SH) by (i) introducing the thiol during solid phase synthesis of the nucleic acid using phosphoramidite oligomerization chemistry or (ii) reduction of a disulfide introduced during the solid phase synthesis.
- A' comprises a thiol (-SH) by (i) introducing the thiol during solid phase synthesis of the nucleic acid using phosphoramidite oligomerization chemistry or (ii) reduction of a disulfide introduced during the solid phase synthesis.
- the method for synthesizing the compound of Structure 1 further comprises synthesizing the compound of Structure 2.
- the oligonucleotide coupled to a covalent linker can include any one or more of the features described herein, including in the Examples.
- the compounds can include any one or more of the nucleic acids (with or without modifications), targeting ligands, and/or linkers described herein, or any of the specific structures or chemistries shown in the summary, description, or Examples.
- Example 1 provides an example methodology for generating thiol terminated oligonucleotides.
- Example 2 provides an example methodology for preparing an oligonucleotide coupled to a linker.
- the method for synthesizing the compound of Structure 1, 2 or 3 is carried out under conditions that substantially favor the formation of Structure 1, 2 or 3 and substantially prevent dimerization of X.
- the conditions can improve the yield of the reaction (e.g., improve the purity of the product).
- the method for synthesizing the compound of Structure 1, 2 or 3 the step of reacting the functionalized nucleic acid X - R1 - R2 - A' and the covalent linker A'' - R3 - B is carried out at a X - R1 - R2 - A' concentration of below about 1 mM, 500 mM, 250 mM, 100 mM, or 50 mM.
- the X - R1 - R2 - A' concentration can be about 1 mM, 500 mM, 250 mM, 100 mM, or 50 mM.
- the method for synthesizing the compound of Structure 1, 2 or 3 the step of reacting the functionalized nucleic acid X - R1 - R2 - A' and the covalent linker A'' - R3 - B is carried out with a molar excess of A'' - R3 - B of at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or 100.
- the molar excess of A'' - R3 - B can be about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, or 100.
- the method for synthesizing the compound of Structure 1, 2 or 3 the step of reacting the functionalized nucleic acid X - R1 - R2 - A' and the covalent linker A'' - R3 - B is carried out at a pH of below about 7, 6, 5, or 4.
- the pH can be about 7, 6, 5, or 4.
- the method for synthesizing the compound of Structure 1, 2 or 3 the step of reacting the functionalized nucleic acid X - R1 - R2 - A' and the covalent linker A'' - R3 - B is carried out in a solution comprising water and a water miscible organic co-solvent.
- the water miscible organic co-solvent can comprise DMF (dimethylformamide), NMP (N-methyl-2-pyrrolidone), DMSO (dimethyl sulfoxide), or acetonitrile.
- the water miscible organic co-solvent can comprise about 10%, 15%, 20%, 25%, 30%, 40%, or 50 %V (v/v) of the solution.
- the oligonucleotide compound is isolated or substantially pure.
- the compound can be at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100 % pure.
- the oligonucleotide compound is about 85%-95 % pure.
- the methods for synthesizing the oligonucleotide compounds and compositions according to the disclosure can result in a product that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100 % pure.
- the oligonucleotide product is about 85%-95 % pure.
- Preparations can be greater than or equal to 50% pure; greater than or equal to 75% pure; greater than or equal to 85 % pure; and greater than or equal to 95% pure.
- the term“isolated” includes oligonucleotide compounds that are separated from other, unwanted substances.
- the isolated oligonucleotide compound can be synthesized in a substantially pure state or separated from the other components of a crude reaction mixture, except that some amount of impurities, including residual amounts of other components of the crude reaction mixture, may remain.
- pure or substantially pure means sufficiently free from impurities to permit its intended use (e.g., in a pharmaceutical formulation or as a material for a subsequent chemical reaction).
- X% pure means that the compound is X% of the overall composition by relevant measure, which can be for example by analytical methods such as HPLC.
- the disclosure provides dimeric oligonucleotides. These compounds include homodimers (e.g., two oligonucleotides that are substantially the same, for example targeting the same gene in vivo) and heterodimers (e.g., two oligonucleotides that are substantially different, for example different sequences or targeting different genes in vivo)
- homodimers e.g., two oligonucleotides that are substantially the same, for example targeting the same gene in vivo
- heterodimers e.g., two oligonucleotides that are substantially different, for example different sequences or targeting different genes in vivo
- the disclosure provides an isolated compound according to Structure 4:
- each is a double-stranded oligonucleotide designed to react with the same molecular target in vivo, and is a covalent linker joining single strands of adjacent single stranded oligonucleotides at their 3’ or 5’ termini, and having the structure - R1 - R2 - A - R3 - A - R2 - R1 - wherein:
- each R1 is a derivative of phosphoric acid such as phosphate, phosphodiester, phosphotriester, phosphonate, phosphoramidate and the like, a derivative of thiophosphoric acid such as thiophosphate, thiophosphodiester, thiophosphotriester, thiophosphoramidate and the like,
- each R2 is independently a C2-C10 alkyl, alkoxy, or aryl group, or is absent;
- each A is independently the reaction product of a nucleophile and an electrophile
- R3 is a C2-C10 alkyl, alkoxy, aryl, alkyldithio group, ether, thioether, thiopropionate, or disulfide.
- the disclosure provides an isolated compound according to Structure 5:
- each R1 is a derivative of phosphoric acid such as phosphate, phosphodiester, phosphotriester, phosphonate, phosphoramidate and the like, a derivative of thiophosphoric acid such as thiophosphate, thiophosphodiester, thiophosphotriester, thiophosphoramidate and the like,
- each R2 is independently a C2-C10 alkyl, alkoxy, or aryl group, or is absent;
- each A is independently the reaction product of a thiol and maleimide, a thiol and vinylsulfone, a thiol and pyridyldisulfide, a thiol and iodoacetamide, a thiol and acrylate, an azide and alkyne, or an amine and carboxyl group, and
- R3 is an C2-C10 alkyl, alkoxy, aryl, alkyldithio group, ether, thioether, thiopropionate, or disulfide.
- oligonucleotide is a second double-stranded oligonucleotide having a different sequence from the first
- each R1 is a derivative of phosphoric acid such as phosphate, phosphodiester, phosphotriester, phosphonate, phosphoramidate and the like, a derivative of thiophosphoric acid such as thiophosphate, thiophosphodiester, thiophosphotriester, thiophosphoramidate and the like, a sulfate, amide, or glycol;
- each R2 is independently a C2-C10 alkyl, alkoxy, or aryl group, or is absent;
- each A is independently the reaction product of a thiol and maleimide, a thiol and vinylsulfone, a thiol and pyridyldisulfide, a thiol and iodoacetamide, a thiol and acrylate, an azide and alkyne, or an amine and carboxyl group, and
- R3 is an C2-C10 alkyl, alkoxy, aryl, alkyldithio group, ether, thioether, thiopropionate, or disulfide.
- the disclosure provides an isolated compound according to Structure 11:
- the disclosure provides methods for synthesizing dimeric oligonucleotides.
- the disclosure provides a method for synthesizing a compound of Structure 5:
- the method can further comprise the step of annealing complementary and to yield Structure 6:
- the disclosure provides a method for synthesizing an isolated compound of Structure 4:
- each is a double-stranded oligonucleotide and is a covalent linker joining single strands of adjacent single stranded oligonucleotides at their 3’ or 5’ termini, the method comprising the steps of:
- the disclosure provides a method for synthesizing an isolated compound of Structure 4: (Structure 4) wherein each is a double-stranded oligonucleotide and is a covalent linker joining single strands of adjacent single stranded oligonucleotides at their 3’ or 5’ termini, the method comprising the steps of: (i) forming by:
- This methodology can be adapted for synthesizing an isolated compound according to (Structure 11), for example by omitting step (ii).
- the disclosure provides a method for synthesizing an isolated compound of Structure 4: (Structure 4) wherein each is a double-stranded oligonucleotide and is a covalent linker joining single strands of adjacent single stranded oligonucleotides at their 3’ or 5’ termini, the method comprising the steps of:
- dimeric compounds and intermediates can include any one or more of the features described herein, including in the Examples.
- the compounds can include any one or more of the nucleic acids (with or without modifications), targeting ligands, and/or linkers described herein, or any of the specific structures or chemistries shown in the summary, description, or Examples.
- Example 3 provides an example methodology for preparing dimerized oligonucleotides and Example 4 provides an example methodology for annealing single stranded oligonucleotides to form double-stranded oligonucleotides.
- Example 7 provides an example methodology for preparing various oligonucleotide precursors useful in the syntheses above.
- Example 8 provides an example methodology for preparing various oligonucleotide multimers, which are also useful in the syntheses above.
- R1, R2, and the bifunctional linking moiety can form a covalent linker as described and shown herein.
- R1 and R2 can each independently comprise a reactive moiety, for example an electrophile or nucleophile.
- R1 and R2 can each independently be a thiol, maleimide, vinylsulfone, pyridyldisulfide, iodoacetamide, acrylate, azide, alkyne, amine, or carboxyl group.
- the bifunctional linking moiety comprises two reactive moieties that can be sequentially reacted according to steps (i) and (ii) above, for example a second
- bifunctional linking moieties include, but are not limited to, DTME, BM(PEG)2, BM(PEG)3, BMOE, BMH, or BMB.
- Example 6 provides an example methodology for adding a targeting ligand (e.g., GalNAc). Additional methods for adding targeting ligands are known in the art and can be adapted for the present disclosure by those skilled in the art. Multimeric Compounds and Intermediates
- the disclosure provides multimeric (n>2) defined multi- conjugate oligonucleotides, including defined tri-conjugates and defined
- the disclosure provides a compound according to Structure 7 or 8:
- each is a double-stranded oligonucleotide
- each is a covalent linker joining single strands of adjacent single stranded oligonucleotides
- n is an integer 3 0.
- the disclosure provides a compound according to Structure 12, 13, 14, or 15:
- each is a double-stranded oligonucleotide
- each is a single stranded oligonucleotide
- each is a covalent linker joining single strands of adjacent single stranded oligonucleotides, and m is an integer 3 1 and n is an integer 3 0.
- the disclosure provides methods for synthesizing multimeric (n > 2) oligonucleotides, including for example trimers and tetramers. [00417] In one aspect, the disclosure provides a method for synthesizing a compound according to Structure 7 or 8:
- each is a double-stranded oligonucleotide, each is a covalent linker joining single strands of adjacent single stranded oligonucleotides, and m is an integer 3 1 and n is an integer 3 0, the method comprising the steps of:
- step (iii) annealing a fourth single stranded oligonucleotide to the product of step (ii), thereby forming Structure 7 or 8.
- the disclosure provides a method for synthesizing a compound according to Structure 7 or 8:
- each is a double-stranded oligonucleotide, each is a covalent linker joining single strands of adjacent single stranded oligonucleotides, and m is an integer 3 1 and n is an integer 3 0, the method comprising the steps of:
- step (iii) annealing a second single stranded oligonucleotide to the product of step (ii), thereby forming Structure 7 or 8.
- the disclosure provides a method for synthesizing a compound of Structure 9: (Structure 9), wherein each is a double-stranded oligonucleotide, each is a covalent linker joining single strands of adjacent single stranded oligonucleotides, the method comprising the steps of:
- the disclosure provides a method for synthesizing a compound of Structure 10: (Structure 10), wherein each is a double-stranded oligonucleotide, each is a covalent linker joining single strands of adjacent single stranded oligonucleotides, the method comprising the steps of:
- R1 and R2 are chemical moieties capable of reacting directly or indirectly to form a covalent linker , thereby forming ;
- multimeric compounds and intermediates thereof can include any one or more of the features described herein, including in the Examples.
- the compounds can include any one or more of the nucleic acids (with or without modifications), targeting ligands, and/or linkers described herein, or any of the specific structures or chemistries shown in the summary, description, or Examples.
- Example 7 provides an example methodology for preparing various oligonucleotide precursors useful in the syntheses above.
- Example 8 provides an example methodology for preparing various oligonucleotide multimers, which are also useful in the syntheses above.
- R1, R2, and the bifunctional linking moiety can form a covalent linker as described and shown herein.
- R1 and R2 can each independently comprise a reactive moiety, for example an electrophile or nucleophile.
- R1 and R2 can each independently be a thiol, maleimide, vinylsulfone, pyridyldisulfide, iodoacetamide, acrylate, azide, alkyne, amine, or carboxyl group.
- the bifunctional linking moiety comprises two reactive moieties that can be sequentially reacted according to steps (i) and (ii) above, for example a second
- bifunctional linking moieties include, but are not limited to, DTME, BM(PEG)2, BM(PEG)3, BMOE, BMH, or BMB.
- the linkers are all the same.
- the compound or composition can comprise two or more different covalent linkers .
- each may independently comprise two sense or two antisense oligonucleotides.
- a may comprise two active strands or two passenger strands.
- each may independently comprise one sense and one antisense oligonucleotide.
- a may comprise one active strand and one passenger strand.
- the compound or composition comprises a homo- multimer of substantially identical double-stranded oligonucleotides.
- the substantially identical double-stranded oligonucleotides can each comprise an siRNA targeting the same molecular target in vivo.
- the compound or composition comprises a hetero-multimer of two or more substantially different double-stranded
- the substantially different double-stranded oligonucleotides can each comprise an siRNA targeting different genes.
- the compound can further comprise a targeting ligand.
- the compound can further comprise 2 or 3 substantially different double- stranded oligonucleotides each comprising an siRNA targeting a different molecular target in vivo.
- the compound can further comprise a targeting ligand, one comprising a first siRNA guide strand targeting Factor VII and a first passenger strand hybridized to the guide strand, one comprising a second siRNA guide strand targeting Apolipoprotein B and a second passenger strand hybridized to the second guide strand, and one comprising a third siRNA guide strand targeting TTR and a third passenger strand hybridized to the third guide strand.
- the targeting ligand can comprise N-Acetylgalactosamine (GalNAc).
- Examples of trimeric oligonucleotides are provided in Examples 17, 18, and 20.
- the compound can further comprise a targeting ligand.
- the compound can further comprise 2, 3, or 4 substantially different double-stranded oligonucleotides each comprising an siRNA targeting a different molecular target in vivo.
- the compound can further comprise a targeting ligand, one comprising a first siRNA guide strand targeting Factor VII and a first passenger strand hybridized to the guide strand, one comprising a second siRNA guide strand targeting Apolipoprotein B and a second passenger strand hybridized to the second guide strand, and one comprising a third siRNA guide strand targeting TTR and a third passenger strand hybridized to the third guide strand.
- the targeting ligand can comprise N-Acetylgalactosamine (GalNAc).
- Example 21 Examples of tetrameric oligonucleotides are provided in Example 21.
- each double-stranded oligonucleotide e.g., a double-stranded oligonucleotide
- Structure 4 comprises an siRNA guide strand targeting Factor VII and a passenger strand hybridized to the guide strand.
- the compound further comprises a targeting ligand
- each double-stranded oligonucleotide e.g., ) comprises an siRNA guide strand and a passenger strand hybridized to the guide strand
- the compound is at least 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100 % pure.
- At least one double-stranded oligonucleotide (e.g., , for example in Structure 6) comprises a first siRNA guide strand targeting Factor VII and a first passenger strand hybridized to the guide strand, and at least one double-stranded oligonucleotide (e.g., for example in Structure 6) comprises a second siRNA guide strand targeting Apolipoprotein B and a second passenger strand hybridized the second guide strand.
- the disclosure provides multimeric oligonucleotides having increased circulation half-life and/or activity in vivo, as well as compositions including the multimeric oligonucleotides and methods for their synthesis and use.
- the disclosure provides a multimeric oligonucleotide comprising Structure 21:
- each monomeric subunit is independently a single- or double-stranded oligonucleotide
- m is an integer 3 1
- each is a covalent linker joining adjacent monomeric subunits
- at least one of the monomeric subunits comprises a single strand having one of the covalent linkers joined to its 3’ terminus and another of the covalent linkers joined to its 5’ terminus.
- the disclosure provides a multimeric oligonucleotide comprising Structure 21:
- each monomeric subunit is independently a single- or double- stranded oligonucleotide, each is a covalent linker joining adjacent monomeric subunits , and m is an integer 3 0 selected to (a) increase in vivo circulation half-life of the multimeric oligonucleotide relative to that of the individual monomeric subunits and/or (b) increase in vivo activity of the multimeric oligonucleotide relative to that of the individual monomeric subunits .
- the disclosure provides a multimeric oligonucleotide comprising Structure 21: wherein each monomeric subunit is independently a single- or double- stranded oligonucleotide, each is a covalent linker joining adjacent monomeric subunits , m is an integer 3 0, and
- the multimeric oligonucleotide has molecular size and/or weight configured to (a) increase in vivo circulation half-life of the multimeric oligonucleotide relative to that of the individual monomeric subunits and/or (b) increase in vivo activity of the multimeric oligonucleotide relative to that of the individual monomeric subunits .
- the disclosure provides a method for increasing in vivo circulation half-life and/or in vivo activity of one or more oligonucleotides, the method comprising administering to a subject the one or more oligonucleotides in the form of a multimeric oligonucleotide comprising Structure 21:
- each monomeric subunit is independently a single- or double- stranded oligonucleotide, each is a covalent linker joining adjacent monomeric subunits , and m is an integer 3 0 selected to (a) increase in vivo circulation half- life of the multimeric oligonucleotide relative to that of the individual monomeric subunits and/or (b) increase in vivo activity of the multimeric oligonucleotide relative to that of the individual monomeric subunits .
- the disclosure provides a method for increasing in vivo circulation half-life and/or in vivo activity of one or more oligonucleotides, the method comprising administering to a subject the one or more oligonucleotides in the form of a multimeric oligonucleotide comprising Structure 21:
- each monomeric subunit is independently a single- or double- stranded oligonucleotide, each is a covalent linker joining adjacent monomeric subunits , m is an integer 3 0, and
- the multimeric oligonucleotide has molecular size and/or weight configured to (a) increase in vivo circulation half-life of the multimeric oligonucleotide relative to that of the individual monomeric subunits and/or (b) increase in vivo activity of the multimeric oligonucleotide relative to that of the individual monomeric subunits .
- the disclosure provides a multimeric oligonucleotide comprising m monomeric subunits , wherein each of the monomeric subunits is independently a single- or double-stranded oligonucleotide, each of the monomeric subunits is joined to another monomeric subunit by a covalent linker , and m is an integer 3 3 selected to (a) increase in vivo circulation half-life of the multimeric oligonucleotide relative to that of the individual monomeric subunits and/or (b) increase in vivo activity of the multimeric oligonucleotide relative to that of the individual monomeric subunits .
- the disclosure provides a multimeric oligonucleotide comprising m monomeric subunits , wherein each of the monomeric subunits is independently a single- or double-stranded oligonucleotide, each of the monomeric subunits is joined to another monomeric subunit by a covalent linker , m is an integer 3 3, and the multimeric oligonucleotide has molecular size and/or weight configured to (a) increase in vivo circulation half-life of the multimeric oligonucleotide relative to that of the individual monomeric subunits and/or (b) increase in vivo activity of the multimeric oligonucleotide relative to that of the individual monomeric subunits .
- the increase is relative to the circulation half-life and/or activity for a monomeric subunit of the multimeric oligonucleotide. Circulation half-life (and its relationship to other properties such as glomerular filtration) is discussed in further detail in the Oligonucleotide Uptake and Clearance section and in Examples 25 and 37 below.
- the in vivo circulation half-life increases by a factor of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 500, or 1,000.
- the in vivo circulation half-life can increase by a factor of at least 2.
- the in vivo circulation half-life can increase by a factor of at least 10.
- the increase in in vivo activity is measured as the ratio of in vivo activity at t max .
- the in vivo activity increases by a factor of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 500, or 1,000.
- the in vivo activity can increase by a factor of at least 2.
- the in vivo activity can increase by a factor of at least 10.
- the increase is in a mouse.
- the increase is in a human.
- m is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12.
- m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12.
- each of the monomeric subunits comprises an siRNA and each of the covalent linkers joins sense strands of the siRNA.
- each of the covalent linkers joins two monomeric subunits .
- At least one of the covalent linkers joins three or more monomeric subunits .
- each monomeric subunit is independently a double-stranded oligonucleotide , and m is 1:
- each monomeric subunit is independently a double-stranded oligonucleotide , m is 1, and each covalent linker is on the same strand:
- each monomeric subunit is independently a double-stranded oligonucleotide , and m is 2:
- each monomeric subunit is independently a double-stranded oligonucleotide , and m is 2, and each covalent linker is on the same strand:
- each monomeric subunit is independently a double-stranded oligonucleotide and m is 3, 4, 5, 6, 7, 8, 9,
- each monomeric subunit is independently a double-stranded oligonucleotide
- m is 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12
- each covalent linker is on the same strand.
- each monomeric subunit is independently a double-stranded oligonucleotide , and m is 3 13.
- each monomeric subunit is independently a double-stranded oligonucleotide , m is 3 13, and each covalent linker is on the same strand.
- Structure 21 is Structure 22 or 23:
- each is a double-stranded oligonucleotide
- each is a covalent linker joining adjacent double-stranded oligonucleotides
- m is an integer 3 1
- n is an integer 3 0.
- Structure 21 is not a structure disclosed in PCT/US2016/037685.
- each oligonucleotide is a single stranded oligonucleotide.
- each oligonucleotide is a double- stranded oligonucleotide.
- the oligonucleotides comprise a combination of single and double-stranded oligonucleotides.
- the multimeric oligonucleotide comprises a linear structure wherein each of the covalent linkers joins two monomeric subunits .
- the multimeric oligonucleotide comprises a branched structure wherein at least one of the covalent linkers joins three or more monomeric subunits .
- Structure 21 could be
- each monomeric subunit is independently a single stranded oligonucleotide .
- m is independently a single stranded oligonucleotide .
- m is 6, 7, 8, 9, 10, 11, or 12. In some such embodiments, m is an integer 3 13. In one such embodiment, at least one single stranded oligonucleotide is an antisense oligonucleotide. In one such embodiment, each single stranded oligonucleotide is independently an antisense oligonucleotide.
- the multimeric oligonucleotide comprises a homo-multimer of substantially identical oligonucleotides.
- the substantially identical oligonucleotides can be siRNA targeting the same molecular target in vivo.
- the substantially identical oligonucleotides can be miRNA targeting the same molecular target in vivo.
- the substantially identical oligonucleotides can be antisense RNA targeting the same molecular target in vivo.
- the substantially identical oligonucleotides can be a combination of siRNA, miRNA, and/or or antisense RNA targeting the same molecular target in vivo.
- the multimeric oligonucleotide comprises a hetero-multimer of two or more substantially different oligonucleotides.
- the substantially different oligonucleotides can be siRNA targeting different molecular targets in vivo.
- the substantially different oligonucleotides can be miRNA targeting different molecular targets in vivo.
- the substantially different oligonucleotides can be antisense RNA targeting different molecular targets in vivo.
- the substantially different oligonucleotides can be a combination of siRNA, miRNA, and/or or antisense RNA targeting different molecular targets in vivo.
- Polymer linkers such as polyethylene glycol (PEG) may be useful for increasing the circulation half-life of certain drugs.
- PEG polyethylene glycol
- Such approaches can have drawbacks, including“diluting” the therapeutic agent (e.g., less active agent per unit mass).
- the present disclosure can be distinguished from such approaches.
- the multimeric oligonucleotide does not comprise PEG.
- the multimeric oligonucleotide does not comprise a polyether compound.
- the multimeric oligonucleotide does not comprise a polymer other than the oligonucleotides.
- Nanoparticles such as lipid nanoparticles (LNP) have been used in attempts to increase the circulation half-life of certain drugs.
- Such approaches can have drawbacks, including increased toxicity (e.g., from cationic lipids).
- the present disclosure can be distinguished from such approaches.
- the multimeric oligonucleotide is not formulated in an NP or LNP.
- phosphorothioate groups have been used to increase the circulation half-life of certain drugs.
- Such approaches can have the drawbacks, including lower activity (e.g., due to oligonucleotide/plasma protein aggregation).
- the present disclosure can be distinguished from such approaches.
- the multimeric oligonucleotide does not comprise a phosphorothioate.
- the multimeric oligonucleotide further comprises a targeting ligand.
- the multimeric oligonucleotide consists essentially of Structure 21 and an optional targeting ligand.
- the multimeric oligonucleotide can comprise any of the targeting ligands discussed herein (see, e.g., the Targeting Ligands section below).
- the targeting ligand is conjugated to an oligonucleotide, for example, the targeting ligand can be conjugated to the oligonucleotide through its 3’ or 5’ terminus.
- the multimeric oligonucleotide can comprise any of the linkers discussed herein (see, e.g., the Linkers section above).
- each covalent linker is the same.
- the multimeric oligonucleotide comprises two or more different covalent linkers .
- one or more of the covalent linkers comprises a cleavable covalent linker. Cleavable linkers can be particularly advantageous in some situations.
- intracellular cleavage can convert a single multimeric oligonucleotide into multiple biologically active oligonucleotides after cellular targeting and entry (e.g., a single siRNA construct can deliver four or more active siRNA), increasing potency and decreasing undesired side effects.
- one or more of the covalent linkers comprise a nucleotide linker (e.g., a cleavable nucleotide linker such as UUU).
- the multimeric oligonucleotide expressly excludes nucleotide linkers.
- the compound is isolated or substantially pure.
- the compound can be at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% pure. In one embodiment, the compound is about 85%-95 % pure.
- the methods for synthesizing the compounds and compositions according to the disclosure can result in a product that is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100 % pure. In one embodiment, the product is about 85-95 % pure. Preparations can be greater than or equal to 50% pure; greater than or equal to 75% pure; greater than or equal to 85% pure; and greater than or equal to 95% pure.
- each oligonucleotide is RNA, DNA, or comprises an artificial or non-natural nucleic acid analog.
- at least one oligonucleotide is an siRNA, miRNA, or antisense oligonucleotide.
- siRNA siRNA
- miRNA miRNA
- antisense oligonucleotide Various other possible oligonucleotides and substitutions are discussed, for example, in the Nucleic Acids section above.
- each oligonucleotide is 15-30, 17-27, 19-26, or 20-25 nucleotides in length. In various embodiments, the oligonucleotide is 15-30, 17- 27, 19-26, 20-25, 40-50, 40-150, 100-300, 1000-2000, or up to 10000 nucleotides in length.
- the multimeric oligonucleotides comprising Structure 21 have a molecular weight of at least about 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, or 65 kD. In various embodiments, the multimeric oligonucleotides comprising structure 21 have a molecular weight of at least about 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, or 70-75 kD. Molecular weight can include everything covalently bound to the multimeric oligonucleotide, such a targeting ligands and linkers.
- the multimeric oligonucleotides comprising Structure 21 can be synthesized by various methods (e.g., those described herein for making tetrameric or greater multimers), certain results may call for specific methodologies. For example, the following method (as well as those shown in Example 22) is designed to efficiently produce multimers having each covalent linker on the same strand. [00478] For example, in one aspect, the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 34:
- each is a single stranded oligonucleotide and each is a covalent linker joining adjacent single stranded oligonucleotides, the method comprising the steps of: (i) reacting , wherein is a linking moiety and R 1 is a chemical group capable of reacting with the linking moiety , thereby forming (Structure 34), and
- the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 35:
- each is a single stranded oligonucleotide and each is a covalent linker joining adjacent single stranded oligonucleotides
- the method comprising the steps of: (i) reacting wherein is a linking moiety and R 1 is a chemical group capable of reacting with the linking moiety , thereby forming (Structure 35), and (ii) optionally annealing (Structure 35) with complementary single stranded oligonucleotides, thereby forming (Structure 36).
- the disclosure provides a method of synthesizing a multimeric oligonucleotide comprising Structure 37:
- the disclosure also provides methods for synthesizing single stranded multimeric oligonucleotides, for example wherein m is
- the multimeric compounds can include any one or more of the features disclosed herein.
- the compounds can include any one or more of the nucleic acids (with or without modifications), targeting ligands, and/or linkers described herein, or any of the specific structures or chemistries shown in the summary, description, or Examples.
- the compounds can be prepared in an of the compositions (e.g., for experimental or medical use) shown in the summary, description, or Examples. Illustrative examples are provided in the Pharmaceutical Compositions section below. Oligonucleotide Uptake and Clearance
- the bioavailability of a drug in the blood stream can be characterized as the balance between target cell uptake versus kidney clearance. From a practical perspective, in vivo circulation half-life and/or in vivo activity are good proxies for kidney clearance/glomerular filtration because they can be readily quantified and measured and because their improvement (e.g., increase) can correlate with improved pharmacodynamics and/or pharmacokinetics.
- Rate of Uptake f ⁇ (ONT Concentration) x (Rate Blood Flow) x (Receptor Copy Number/cell) x (Number of Cells) x (equilibrium dissociation constant K d ) x (Internalization Rate) ⁇ .
- Rate of Uptake f ⁇ (ONT Concentration) x (Rate Blood Flow) x (Receptor Copy Number/cell) x (Number of Cells) x (equilibrium dissociation constant K d ) x (
- Rate of Clearance f ⁇ (Blood Flow Rate) x (Kidney Filtration Rate) x (Other clearance mechanisms) ⁇ .
- oligonucleotides leading to a lower rate of clearance, resulting in a higher concentration of ONT in circulation at a given time t (e.g., increased serum half-life, higher overall uptake, and higher activity).
- the concentration (e.g., in urine) of a therapeutic agent such as an siRNA at a specific time point may not necessarily be representative of the glomerular filtration rate.
- serum half-life which is related to glomerular filtration and which is directly measurable, may be considered to be a suitable proxy for glomerular filtration.
- Table 1 below shows the dramatic effect increasing the circulation half- life (t 1/2 ) of a component can have on the resulting concentration of the component at time t:
- a typical siRNA (e.g., double-stranded monomer) has a molecular weight of about 15kD.
- a siRNA tetramer according to the disclosure can have a molecular weight of about 60 kD.
- Such multimers tetramers, pentamers, etc.
- Such multimers can be configured to have a molecular size and/or weight resulting in decreased glomerular filtration in vivo, and thus would have an increased circulation half-life.
- multimers according to the disclosure can be configured to have increased in vivo circulation half- life and/or increased in vivo activity, relative to that of the individual monomeric subunits.
- the multimer e.g., tetramer
- the multimer would deliver many (e.g., four) times the payload per ligand/receptor binding event than the monomeric equivalent.
- these effects can lead to a dramatic increase in the bio-availability and uptake of the therapeutic agent. This can be advantageous where some combination of the copy number, KD, number of target cells and internalization rate of a given ligand/receptor pair is sub-optimal.
- the multimeric oligonucleotide has a structure selected to (a) increase in vivo circulation half-life of the multimeric oligonucleotide relative to that of the individual monomeric subunits and/or (b) increase in vivo activity of the multimeric oligonucleotide relative to that of the individual monomeric subunits.
- the multimeric oligonucleotide can have a molecular size and/or weight configured for this purpose.
- the disclosure provides pharmaceutical compositions or formulations including any one or more of the oligonucleotide compounds or compositions described above.
- pharmaceutical compositions or formulations include oligonucleotide compositions of matter, other than foods, that can be used to prevent, diagnose, alleviate, treat, or cure a disease.
- the various oligonucleotide compounds or compositions according to the disclosure should be understood as including embodiments for use as a medicament and/or for use in the manufacture of a medicament.
- a pharmaceutical composition or formulation can include an
- oligonucleotide compound or composition according to the disclosure and a
- an excipient can be a natural or synthetic substance formulated alongside the active ingredient. Excipients can be included for the purpose of long-term stabilization, increasing volume (e.g., bulking agents, fillers, or diluents), or to confer a therapeutic enhancement on the active ingredient in the final dosage form, such as facilitating drug absorption, reducing viscosity, or enhancing solubility. Excipients can also be useful manufacturing and distribution, for example, to aid in the handling of the active ingredient and/or to aid in vitro stability (e.g., by preventing denaturation or aggregation). As will be understood by those skilled in the art, appropriate excipient selection can depend upon various factors, including the route of administration, dosage form, and active ingredient(s).
- Oligonucleotides can be delivered locally or systemically, and thus the pharmaceutical compositions of the disclosure can vary accordingly.
- Administration is not limited to any particular delivery system and may include, without limitation, parenteral (including subcutaneous, intravenous, intramedullary, intraarticular, intramuscular, or intraperitoneal injection), rectal, topical, transdermal, or oral.
- Administration to an individual may occur in a single dose or in repeat administrations, and in any of a variety of physiologically acceptable salt forms, and/or with an acceptable pharmaceutical carrier and/or additive as part of a pharmaceutical composition.
- Physiologically acceptable formulations and standard pharmaceutical formulation techniques, dosages, and excipients are well known to persons skilled in the art (see, e.g., Physicians’ Desk Reference (PDR®) 2005, 59th ed., Medical Economics Company, 2004; and Remington: The Science and Practice of Pharmacy, eds. Gennado et al.21th ed., Lippincott, Williams & Wilkins, 2005).
- compositions include an effective amount of the oligonucleotide compound or composition according to the disclosure.
- “effective amount” can be a concentration or amount that results in achieving a particular stated purpose, or more amount means an amount adequate to cause a change, for example in comparison to a placebo.
- the effective amount is a “therapeutically effective amount,” it can be an amount adequate for therapeutic use, for example and amount sufficient to prevent, diagnose, alleviate, treat, or cure a disease.
- An effective amount can be determined by methods known in the art. An effective amount can be determined empirically, for example by human clinical trials.
- Effective amounts can also be extrapolated from one animal (e.g., mouse, rat, monkey, pig, dog) for use in another animal (e.g., human), using conversion factors known in the art. See, e.g., Freireich et al., Cancer Chemother Reports 50(4):219-244 (1966). Conjugates, Functional Moieties, Delivery Vehicles and Targeting Ligands
- the multimeric oligonucleotides may comprise one or more conjugates, functional moieties, delivery vehicles, and targeting ligands.
- the various conjugated moieties are designed to augment or enhance the activity or function of the multimeric oligonucleotide.
- the disclosure provides any one or more of the oligonucleotide compounds or compositions described above formulated in a delivery vehicle.
- the delivery vehicle can be a lipid nanoparticle (LNP), exosome, microvesicle, or viral vector.
- the disclosure provides any one or more of the oligonucleotide compounds or compositions described above and further comprising a targeting ligand or functional moiety.
- the targeting ligand comprises a lipophilic moiety, such as a phospholipid, aptamer, peptide, antigen-binding protein, small molecules, vitamins, N-Acetylgalactosamine (GalNAc), cholesterol, tocopherol, folate and other folate receptor-binding ligands, mannose and other mannose receptor- binding ligands, 2-[3-(1,3-dicarboxypropyl)-ureido]pentanedioic acid (DUPA), anisamide, an endosomal escape moiety (EEM), or an immunostimulant.
- GalNAc moiety may be a mono-antennary GalNAc, a di-antennary GalNAc, or a tri-antennary GalNAc.
- the peptide targeting ligand may comprise tumor-targeting peptides, such as APRPG, cNGR (CNGRCVSGCAGRC), F3 (KDEPQRRSARLSAKPAPPKPEPKPKKAPAKK), CGKRK, and iRGD (CRGDKGPDC).
- APRPG a tumor-targeting peptides
- CNGRCVSGCAGRC CNGRCVSGCAGRC
- F3 KDEPQRRSARLSAKPAPPKPEPKPKKAPAKK
- CGKRK CGKRK
- iRGD CRGDKGPDC
- the immunostimulant may be a CpG oligonucleotide, for example, the CpG oligonucleotides of TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: X) or GGTGCATCGATGCAGGGGG (SEQ ID NO: Y).
- the antigen-binding protein may comprise a single chain variable fragment (ScFv) or a VHH antigen-binding protein.
- the lipophilic moiety may be a ligand that includes a cationic group.
- the lipophilic moiety is a cholesterol, vitamin E, vitamin K, vitamin A, folic acid, or a cationic dye (e.g., Cy3).
- lipophilic moieties include cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3- Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3- (oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine.
- the targeting ligand or functional moiety is a fatty acid, such as cholesterol, Lithocholic acid (LCA), Eicosapentaenoic acid (EPA),
- Docosahexaenoic acid DHA
- Docosanoic acid DCA
- steroid secosteroid
- lipid ganglioside or nucleoside analog
- endocannabinoid endocannabinoid
- vitamin such as choline, vitamin A, vitamin E, and derivatives or metabolites thereof, or a vitamin such as retinoic acid and alpha-tocopheryl succinate.
- the endosomal escape moiety may be used to facilitate endosomal escape of a multimeric oligonucleotide that has been endocytosed by a cell.
- Endosomal escape moieties are generally lipid-based or amino acid-based, but may comprise other chemical entities that disrupt an endosome to release the multimeric oligonucleotide.
- EEMs include, but are not limited to, chloroquine, peptides and proteins with motifs containing hydrophobic amino acid R groups, and influenza virus hemagglutinin (HA2). Further EEMs are described in Lonn et al., Scientific Reports, 6: 32301, 2016.
- the targeting ligand can be bound (e.g., directly) to the nucleic acid, for example through its 3’ or 5’ terminus.
- two targeting ligands are conjugated to the oligonucleotide, where one ligand is conjugated through the 3’ terminus and the other ligand is conjugated through the 5’ terminus of the
- One or more targeting ligands can be conjugated to the sense strand or the anti-sense strand of the oligonucleotide, or both the sense-strand and the anti-sense strand. Additional examples that may be adapted for use with the disclosure are discussed below.
- therapeutic oligonucleotides must overcome a series of physiological hurdles to access the target cell in an organism (e.g., animal, such as a human, in need of therapy).
- a therapeutic oligonucleotide generally must avoid clearance in the bloodstream, enter the target cell type, and then enter the cytoplasm, all without eliciting an undesirable immune response. This process is generally considered inefficient, for example, 95% or more of siRNA that enters the endosome in vivo may be degraded in lysosomes or pushed out of the cell without affecting any gene silencing.
- RNA delivery vehicles have been designed to overcome these obstacles. These vehicles have been used to deliver therapeutic RNAs, small molecule drugs, protein drugs, and other therapeutic molecules. Drug delivery vehicles have been made from materials as diverse as sugars, lipids, lipid-like materials, proteins, polymers, peptides, metals, hydrogels, conjugates, and peptides. Many drug delivery vehicles incorporate aspects from combinations of these groups, for example, some drug delivery vehicles can combine sugars and lipids. In some other examples, drugs can be directly hidden in“cell like” materials that are meant to mimic cells, while in other cases, drugs can be put into, or onto, cells themselves. Drug delivery vehicles can be designed to release drugs in response to stimuli such as pH change, biomolecule concentration, magnetic fields, and heat.
- stimuli such as pH change, biomolecule concentration, magnetic fields, and heat.
- oligonucleotides such as siRNA
- the dose required for effective siRNA delivery to hepatocytes in vivo has decreased by more than 10,000 fold in the last ten years– whereas delivery vehicles reported in 2006 could require more than 10 mg/kg siRNA to target protein production, with new delivery vehicles target protein production can now be reduced after a systemic injection of 0.001 mg/kg siRNA.
- the increase in oligonucleotide delivery efficiency can be attributed, at least in part, to developments in delivery vehicles.
- helper components can include chemical structures added to the primary drug delivery system. Often, helper components can improve particle stability or delivery to a specific organ. For example, nanoparticles can be made of lipids, but the delivery mediated by these lipid nanoparticles can be affected by the presence of hydrophilic polymers and/or hydrophobic molecules.
- hydrophilic polymers One important hydrophilic polymer that influences nanoparticle delivery is poly(ethylene glycol). Other hydrophilic polymers include non-ionic surfactants.
- Hydrophobic molecules that affect nanoparticle delivery include cholesterol, 1-2-Distearoyl-sn- glyerco-3-phosphocholine (DSPC), 1-2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA), 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), and others.
- DSPC 1-2-Distearoyl-sn- glyerco-3-phosphocholine
- DOTMA 1,2-dioleoyl-3-trimethylammonium-propane
- DOTAP 1,2-dioleoyl-3-trimethylammonium-propane
- Drug delivery systems have also been designed using targeting ligands or conjugate systems.
- oligonucleotides can be conjugated to cholesterols, sugars, peptides, and other nucleic acids, to facilitate delivery into hepatocytes and/or other cell types.
- conjugate systems may facilitate delivery into specific cell types by binding to specific receptors.
- delivery vehicles and targeting ligands can generally be adapted for use according to the present disclosure.
- delivery vehicles and targeting ligands can be found in Sahay, G., et al. Efficiency of siRNA delivery by lipid nanoparticles is limited by endocytic recycling. Nat Biotechnol, 31: 653-658 (2013); Wittrup, A., et al. Visualizing lipid-formulated siRNA release from endosomes and target gene knockdown. Nat Biotechnol (2015); Whitehead, K.A., Langer, R. & Anderson, D.G. Knocking down barriers: advances in siRNA delivery. Nature reviews.
- Multivalent N- acetylgalactosamine-conjugated siRNA localizes in hepatocytes and elicits robust RNAi-mediated gene silencing. J Am Chem Soc, 136: 16958-16961 (2014);
- the compounds and compositions of the disclosure can be conjugated to or delivered with other chemical or biological moieties, including, e.g., biologically active moieties.
- a biologically active moiety is any molecule or agent that has a biological effect, such as a measurable biological effect.
- Chemical or biological moieties include, e.g., proteins, peptides, amino acids, nucleic acids (including, e.g., DNA, RNA of all types, RNA and DNA aptamers, antisense oligonucleotides, and antisense miRNA inhibitors), targeting ligands, carbohydrates, polysaccharides, lipids, organic compounds, and inorganic chemical compounds.
- targeting ligand can include a moiety that can be made accessible on the surface of a nanoparticle or as part of a delivery conjugate (e.g., multi-conjugate oligonucleotide, multimeric oligonucleotide) for the purpose of delivering the payload of the nanoparticle or delivery conjugate to a specific target, such as a specific bodily tissue or cell type, for example, by enabling cell receptor attachment of the nanoparticle or delivery conjugate.
- a delivery conjugate e.g., multi-conjugate oligonucleotide, multimeric oligonucleotide
- Suitable targeting ligands include, but are not limited to, cell specific peptides or proteins (e.g., transferrin and monoclonal antibodies), aptamers, cell growth factors, vitamins (e.g., folic acid), monosaccharides (e.g., galactose and mannose), polysaccharides, arginine-glycine- aspartic acid (RGD), and asialoglycoprotein receptor ligands derived from N- acetylgalactosamine (GalNac).
- cell specific peptides or proteins e.g., transferrin and monoclonal antibodies
- aptamers e.g., cell growth factors
- cell growth factors e.g., transferrin and monoclonal antibodies
- aptamers e.g., cell growth factors
- cell growth factors e.g., transferrin and monoclonal antibodies
- aptamers e.g., cell growth factors
- cell growth factors e
- the ligand may be incorporated into the foregoing compounds of the disclosure using a variety of techniques known in the art, such as via a covalent bond such as a disulfide bond, an amide bond, or an ester bond, or via a non- covalent bond such as biotin-streptavidin, or a metal-ligand complex.
- a covalent bond such as a disulfide bond, an amide bond, or an ester bond
- a non- covalent bond such as biotin-streptavidin, or a metal-ligand complex.
- Additional biologically active moieties within the scope of the disclosure are any of the known gene editing materials, including for example, materials such as oligonucleotides, polypeptides and proteins involved in CRISPR/Cas systems, TALES, TALENs, and zinc finger nucleases (ZFNs).
- materials such as oligonucleotides, polypeptides and proteins involved in CRISPR/Cas systems, TALES, TALENs, and zinc finger nucleases (ZFNs).
- the compounds and compositions of the disclosure can be encapsulated in a carrier material to form nanoparticles for intracellular delivery.
- carrier materials include cationic polymers, lipids or peptides, or chemical analogs thereof. Jeong et al., BIOCONJUGATE CHEM., Vol.20, No.1, pp.5-14 (2009).
- Examples of a cationic lipid include dioleyl
- phosphatidylethanolamine cholesterol dioleyl phosphatidylcholine
- DOTAP 1,2-dioleoyloxy- 3-(trimethylammonio)propane
- DOB 1,2-dioleoyl-3-(4’-trimethyl- ammonio)butanoyl-sn-glycerol
- DAP 1,2-diacyl-3-dimethylammonium-propane
- TAP 1,2-diacyl-3-trimethylammonium-propane
- 1,2-diacyl-sn-glycerol-3- ethylphosphocholin 3 beta-[N-(N’,N’-dimethylaminoethane)-carbamoyl]cholesterol (DC-Cholesterol), dimethyldioctadecylammonium bro
- a cationic polymer examples include polyethyleneimine, polyamine, polyvinylamine, poly(alkylamine hydrochloride), polyamidoamine dendrimer, diethylaminoethyl-dextran, polyvinylpyrrolidone, chitin, chitosan, and poly(2- dimethylamino)ethyl methacrylate.
- the carrier contains one or more acylated amines, the properties of which may be better suited for use in vivo as compared to other known carrier materials.
- the carrier is a cationic peptide, for example KALA (a cationic fusogenic peptide), polylysine, polyglutamic acid or protamine.
- the carrier is a cationic lipid, for example dioleyl
- the carrier is a cationic polymer, for example polyethyleneimine, polyamine, or polyvinylamine.
- the compounds and compositions of the disclosure can be encapsulated in exosomes.
- Exosomes are cell-derived vesicles having diameters between 30 and 100 nm that are present in biological fluids, including blood, urine, and cultured medium of cell cultures.
- Exosomes, including synthetic exsosomes and exosome mimetics can be adapted for use in drug delivery according to the skill in the art. See, e.g.,“A comprehensive overview of exosomes as drug delivery vehicles - endogenous nanocarriers for targeted cancer therapy” Biochim Biophys Acta.
- the compounds and compositions of the disclosure can be encapsulated in microvesicles.
- Microvesicles (sometimes called, circulating microvesicles, or microparticles) are fragments of plasma membrane ranging from 100 nm to 1000 nm shed from almost all cell types and are distinct from smaller intracellularly generated extracellular vesicles known as exosomes.
- Microvesicles play a role in intercellular communication and can transport mRNA, miRNA, and proteins between cells.
- Microvesicles, including synthetic microvesicles and microvesicle mimetics can be adapted for use in drug delivery according to the skill in the art. See, e.g.,“Microvesicle- and exosome-mediated drug delivery enhances the cytotoxicity of Paclitaxel in autologous prostate cancer cells” Journal of Controlled Release, 220: 727-737 (2015);“Therapeutic Uses of Exosomes” J Circ Biomark, 1:0 (2013).
- the compounds and compositions of the disclosure can be delivered using a viral vector.
- Viral vectors are tools commonly used by molecular biologists to deliver genetic material into cells. This process can be performed inside a living organism (in vivo) or in cell culture (in vitro). Viral vectors can be adapted for use in drug delivery according to the skill in the art. See, e.g., “Viruses as nanomaterials for drug delivery” Methods Mol Biol, 26: 207-21 (2011); “Viral and nonviral delivery systems for gene delivery” Adv Biomed Res, 1:27 (2012); and“Biological Gene Delivery Vehicles: Beyond Viral Vectors” Molecular Therapy, 17(5): 767-777 (2009).
- the disclosure provides methods for using multimeric oligonucleotides in, for example, medical treatments, research, or for producing new or altered phenotypes in animals and plants.
- the disclosure provides a method for treating a subject comprising administering an effective amount of a compound or composition according to the disclosure to a subject in need thereof.
- the oligonucleotide will be a therapeutic oligonucleotide, for example an siRNA, saRNA, miRNA, aptamer, or antisense oligonucleotide.
- compositions and compounds of the disclosure can be administered in the form of a pharmaceutical composition, in a delivery vehicle, or coupled to a targeting ligand.
- the disclosure provides a method for silencing or reducing gene expression comprising administering an effective amount of a compound or composition according to the disclosure to a subject in need thereof.
- the oligonucleotide will be an oligonucleotide that silences or reduces gene expression, for example an siRNA or antisense oligonucleotide.
- the disclosure provides a method for silencing or reducing expression of two or more genes comprising administering an effective amount of a compound or composition according to the disclosure to a subject in need thereof, wherein the compound or composition comprises oligonucleotides targeting two or more genes.
- the compound or composition can comprise oligonucleotides targeting two, three, four, or more genes.
- the disclosure provides a method for delivering two or more oligonucleotides to a cell per targeting ligand binding event comprising administering an effective amount of a compound or composition according to the disclosure to a subject in need thereof, wherein the compound or composition comprises a targeting ligand.
- the disclosure provides a method for delivering a predetermined stoichiometric ratio of two or more oligonucleotides to a cell comprising administering an effective amount of a compound or composition according to the disclosure to a subject in need thereof, wherein the compound or composition comprises the predetermined stoichiometric ratio of two or more oligonucleotides.
- subject includes a cell or organism subject to the treatment or administration.
- the subject can be an animal, for example a mammal such a laboratory animal (mouse, monkey) or veterinary patient, or a primate such as a human.
- a subject in need of the treatment or administration can include a subject having a disease (e.g., that may be treated using the compounds and
- compositions of the disclosure or a subject having a condition (e.g., that may be addressed using the compounds and compositions of the disclosure, for example one or more genes to be silenced or have expression reduced).
- Oligoribonucleotides were assembled on ABI 394 and 3900 synthesizers (Applied Biosystems) at the 10 mmol scale, or on an Oligopilot 10 synthesizer at 28 mmol scale, using phosphoramidite chemistry.
- Solid supports were polystyrene loaded with 2’-deoxythymidine (Glen Research, Sterling, Virginia, USA), or controlled pore glass (CPG, 520 ⁇ , with a loading of 75 mmol/g, obtained from Prime Synthesis, Aston, PA, USA).
- Phosphorothioate linkages were introduced using 50 mM 3-((Dimethylamino- methylidene)amino)-3H-1,2,4-dithiazole-3-thione (DDTT, AM Chemicals, Oceanside, California, USA) in a 1:1 (v/v) mixture of pyridine and Acetonitrile.
- DDTT dimethylamino- methylidene
- Acetonitrile a 1:1 (v/v) mixture of pyridine and Acetonitrile.
- DMT off synthesis oligonucleotides were cleaved from the solid support and deprotected using a 1:1 mixture consisting of aqueous methylamine (41 %) and concentrated aqueous ammonia (32 %) for 3 hours at 25°C according to published methods (Wincott, F. et al: Synthesis, deprotection, analysis and purification of RNA and ribozymes. Nucleic Acids Res, 23: 2677-2684 (1995).
- 1,2-distearoyl-3-phosphatidylcholine was purchased from Avanti Polar Lipids (Alabaster, Alabama, USA).
- a-[3'-(1,2-dimyristoyl-3-propanoxy)- carboxamide-propyl]-w-methoxy-polyoxyethylene was obtained from NOF (Bouwelven, Belgium).
- Cholesterol was purchased from Sigma-Aldrich (Taufkirchen, Germany).
- KL22 and KL52 are disclosed in the patent literature (Constien et al.“Novel Lipids and Compositions for Intracellular Delivery of Biologically Active Compounds” US 2012/0295832 A1).
- Stock solutions of KL52 and KL22 lipids, DSPC, cholesterol, and PEG-c-DOMG were prepared at concentrations of 50 mM in ethanol and stored at -20°C. The lipids were combined to yield various molar ratios (see individual Examples below) and diluted with ethanol to a final lipid concentration of 25 mM.
- siRNA stock solutions at a concentration of 10 mg/mL in H 2 O were diluted in 50 mM sodium citrate buffer, pH 3.
- KL22 and KL52 are sometimes referred to as XL 7 and XL 10, respectively, in the Examples that follow.
- the lipid nanoparticle (LNP) formulations were prepared by combining the lipid solution with the siRNA solution at total lipid to siRNA weight ratio of 7:1.
- the lipid ethanolic solution was rapidly injected into the aqueous siRNA solution to afford a suspension containing 33 % ethanol.
- the solutions were injected by the aid of a syringe pump (Harvard Pump 33 Dual Syringe Pump Harvard Apparatus Holliston, MA).
- the formulations were dialyzed 2 times against phosphate buffered saline (PBS), pH 7.4 at volumes 200-times that of the primary product using a Slide-A-Lyzer cassettes (Thermo Fisher Scientific Inc. Rockford, IL) with a MWCO of 10 kD (RC membrane) to remove ethanol and achieve buffer exchange.
- the first dialysis was carried out at room temperature for 3 hours and then the formulations were dialyzed overnight at 4°C.
- the resulting nanoparticle suspension was filtered through 0.2 mm sterile filter (Sarstedt, Nümbrecht, Germany) into glass vials and sealed with a crimp closure.
- General Procedure 3 LNP Characterization
- Particle size and zeta potential of formulations were determined using a Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) in 1X PBS and 15 mM PBS, respectively.
- the siRNA concentration in the liposomal formulation was measured by UV-vis. Briefly, 100 mL of the diluted formulation in 1X PBS was added to 900 mL of a 4:1 (v/v) mixture of methanol and chloroform. After mixing, the absorbance spectrum of the solution was recorded between 230 nm and 330 nm on a DU 800 spectrophotometer (Beckman Coulter, Beckman Coulter, Inc., Brea, CA). The siRNA concentration in the liposomal formulation was calculated based on the extinction coefficient of the siRNA used in the formulation and on the difference between the absorbance at a wavelength of 260 nm and the baseline value at a wavelength of 330 nm.
- Encapsulation of siRNA by the nanoparticles was evaluated by the Quant- iTTM RiboGreen® RNA assay (Invitrogen Corporation Carlsbad, CA). Briefly, the samples were diluted to a concentration of approximately 5 mg/mL in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.5). 50 mL of the diluted samples were transferred to a polystyrene 96 well plate, then either 50 mL of TE buffer or 50 mL of a 2 % Triton X- 100 solution was added. The plate was incubated at a temperature of 37 °C for 15 minutes.
- TE buffer 10 mM Tris-HCl, 1 mM EDTA, pH 7.5
- 50 mL of the diluted samples were transferred to a polystyrene 96 well plate, then either 50 mL of TE buffer or 50 mL of a 2 % Triton X- 100 solution was added. The plate was incuba
- the RiboGreen reagent was diluted 1:100 in TE buffer, 100 mL of this solution was added to each well.
- the fluorescence intensity was measured using a fluorescence plate reader (Wallac Victor 1420 Multilabel Counter; Perkin Elmer, Waltham, MA) at an excitation wavelength of ⁇ 480 nm and an emission wavelength of ⁇ 520 nm.
- the fluorescence values of the reagent blank were subtracted from that of each of the samples and the percentage of free siRNA was determined by dividing the fluorescence intensity of the intact sample (without addition of Triton X-100) by the fluorescence value of the disrupted sample (caused by the addition of Triton X-100).
- Mouse strain C57BL/6N was used for all in vivo experiments. Animals were obtained from Charles River (Sulzfeld, Germany) and were between 6 and 8 weeks old at the time of experiments. Intravenously administered formulations were injected by infusion of 200 mL into the tail vein. Subcutaneously administered compounds were injected in a volume of 100-200 mL. Blood was collected by submandibular vein bleed the day before injection (“prebleed”) and during the experiment post injection at times indicated. Serum was isolated with serum separation tubes (Greiner Bio-One, Frickenhausen, Germany) and kept frozen until analysis. 7 days after compound administration, mice were anaesthetized by CO 2 inhalation and killed by cervical dislocation. Blood was collected by cardiac puncture and serum isolated as described above. Tissue for mRNA quantification was harvested and immediately snap frozen in liquid nitrogen. General Procedure 5: Measurement of Gene Knockdown
- ApoB protein in serum was measured by ELISA (CloudClone Corp. / Hoelzel Diagnostics, Cologne, Germany, #SEC003Mu). A 1:5000 dilution of mouse serum was processed according to the manufacturer’s instructions and absorbance at 450 nm measured using a Victor 3 multilabel counter (Perkin Elmer, Wiesbaden, Germany).
- Transthyretin (TTR, also known as prealbumin) protein in serum was measured by ELISA (#KA2070, Novus Biologicals, / Biotechne, Wiesbaden, Germany). A 1:4000 dilution of mouse serum was processed according to the manufacturer’s instructions and absorbance at 450 nm measured using a Victor 3 multilabel counter (Perkin Elmer, Wiesbaden, Germany).
- mRNA levels were quantified using either QuantiGene 1.0 (FVII, ApoB and GAPDH) or Quantigene 2.0 (TTR) branched DNA (bDNA) Assay Kit (Panomics, Fremont, Calif., USA, Cat-No: QG0004) according to the manufacturer’s recommendations.
- As assay readout the chemiluminescence signal was measured in a Victor 2 Light luminescence counter (Perkin Elmer, Wiesbaden, Germany) as relative light units (RLU). The signal for the corresponding mRNA was divided by the signal for GAPDH mRNA from the same lysate. Values are reported as mRNA expression normalized to GAPDH. Additional General Procedure 1: Single Chain Oligonucleotide Synthesis
- Oligoribonucleotides were assembled on ABI 394 and 3900 synthesizers (Applied Biosystems) at the 10 mmol scale, or on an Oligopilot 10 synthesizer at 28 mmol scale, using phosphoramidite chemistry.
- Solid supports were polystyrene loaded with 2’-deoxythymidine (Glen Research, Sterling, Virginia, USA), or controlled pore glass (CPG, 520 ⁇ , with a loading of 75 mmol/g, obtained from Prime Synthesis, Aston, PA, USA).
- oligonucleotides were cleaved from the solid support and deprotected using a 1:1 mixture consisting of aqueous methylamine (41 %) and concentrated aqueous ammonia (32 %) for 3 hours at 25°C according to published methods (Wincott, F. et al: Synthesis, deprotection, analysis and purification of RNA and ribozymes. Nucleic Acids Res, 23: 2677-2684 (1995).
- each disulfide containing oligomer was reduced using Dithiothreitol (DTT) (0.1 M DTT stock solution (Sigma-Aldrich Chemie GmbH, Kunststoff, Germany, #646563) in Triethylammonium bicarbonate buffer (TEABc, 0.1M, pH 8.5, Sigma, #90360).
- DTT Dithiothreitol
- TEABc Triethylammonium bicarbonate buffer
- the oligonucleotide was dissolved in TEABc buffer (100mM, pH 8.5) to yield a 1 mM solution.
- TEABc buffer 100mM, pH 8.5
- dsRNAs were generated from RNA single strands by mixing a slight excess of the required complementary antisense strand(s) relative to sense strand and annealing in 20 mM NaCl/4 mM sodium phosphate pH 6.8 buffer. Successful duplex formation was confirmed by native size exclusion HPLC using a Superdex 75 column (10 x 300 mm) from GE Healthcare. Samples were stored frozen until use. [00556] In the sequences described herein upper case letters“A”,“C”,“G” and “U” represent RNA nucleotides.
- Duplex titration was monitored using a Dionex Ultimate 3000 HPLC system equipped with a XBride C18 Oligo BEH (2.5 mm; 2.1x50 mm, Waters) column equilibrated to 20°C. The diagnostic wavelength was 260 nm.
- Buffer A was 100 mM hexafluoro-isopropanol (HFIP), 16.3 mM triethylamine (TEA) containing 1 % methanol.
- Buffer B had the same composition except MeOH was 95 %.
- a gradient from 5 % to 70 % buffer B in 30 minutes was applied at a flow rate of 250 mL/min. The two complementary strands were run independently to establish retention times.
- Example 1 Generation of Thiol-terminated siRNA [00559] Where necessary 3’- or 5’-terminal thiol groups were introduced via 1-O- Dimethoxytrityl-hexyl-disulfide,1'-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite linker (NucleoSyn, Olivet Cedex, France).
- oligonucleotides Upon completion of the solid phase synthesis and final removal of the DMT group (“DMT off synthesis”) oligonucleotides were cleaved from the solid support and deprotected using a 1:1 mixture consisting of aqueous methylamine (41 %) and concentrated aqueous ammonia (32 %) for 6 hours at 10°C. Subsequently, the crude oligonucleotides were purified by anion-exchange high-performance liquid chromatography (HPLC) on an AKTA Explorer System (GE Healthcare, Freiburg, Germany). Purified (C 6 SSC 6 )- oligonucleotides were precipitated by addition of ethanol and overnight storage in the freezer. Pellets were collected by centrifugation.
- HPLC anion-exchange high-performance liquid chromatography
- Oligonucleotides were reconstituted in water and identity of the oligonucleotides was confirmed by electrospray ionization mass spectrometry (ESI-MS). Purity was assessed by analytical anion-exchange and RP HPLC.
- Each disulfide containing oligomer was then reduced using a 100 mM DL- Dithiothreitol (DTT) solution.
- DTT DL- Dithiothreitol
- 1.0 M DTT stock solution (Sigma-Aldrich Chemie GmbH, Kunststoff, Germany, #646563) was diluted with Triethylammonium bicarbonate buffer (TEABc, 1M, pH 8.5, Sigma, #90360) and water to give a solution 100 mM each in DTT and TEABc.
- TEABc buffer 100mM, pH 8.5
- the DTME modified oligonucleotide prepared according to the procedure in Example 2 was reacted with another oligonucleotide equipped with a thiol linker. This reaction could either be carried out on the single stranded sequence or after prior annealing of the complementary oligonucleotide of one of the reaction partners. Consequently, if desired, the DTME modified oligonucleotide was reacted with the thiol modified oligonucleotide directly, or was annealed with its complementary strand and the resulting duplex reacted with the thiol modified oligonucleotide.
- ssRNAs Single-Stranded RNAs
- dsRNA Double-Stranded RNA
- dsRNAs were generated from RNA single strands by mixing equimolar amounts of complementary sense and antisense strands and annealing in 20 mM NaCl/4 mM sodium phosphate pH 6.8 buffer. Successful duplex formation was confirmed by native size exclusion HPLC using a Superdex 75 column (10 x 300 mm) from GE Healthcare. Samples were stored frozen until use.
- Example 5 General Procedure for Preparation of 3’- or 5’- NH2 Derivatized Oligonucleotides
- RNA equipped with a C-6-aminolinker at the 5 ⁇ -end of the sense strand was produced by standard phosphoramidite chemistry on solid phase at a scale of 140 mmol using an ⁇ KTA Oligopilot 100 (GE Healthcare, Freiburg, Germany) and controlled pore glass (CPG) as solid support (Prime Synthesis, Aston, PA, USA). Oligomers containing 2 ⁇ -O-methyl and 2’-F nucleotides were generated employing the corresponding 2’-OMe-phosphoramidites, 2 ⁇ -F-methyl phosphoramidites.
- the 5’- aminohexyl linker at the 5’-end of the sense strand was introduced employing the TFA- protected hexylaminolinker phosphoramidite (Sigma-Aldrich, SAFC, Hamburg, Germany).
- TFA- protected hexylaminolinker phosphoramidite Sigma-Aldrich, SAFC, Hamburg, Germany.
- a phtalimido protected hexylamino-linker immobilized on CPG (Prime Synthesis, Aston, PA, USA) was used. Cleavage and deprotection was accomplished using a mixture of 41 % methylamine in water and concentrated aqueous ammonia (1:1 v/v).
- Crude oligonucleotides were purified using anion exchange HPLC and a column (2.5 x 18 cm) packed with Source 15Q resin obtained from GE Healthcare.
- Example 6 General Method for GalNAc Ligand Conjugation
- the trivalent GalNAc ligand was prepared as outlined in Hadwiger et al., patent application US2012/0157509 A1.
- the corresponding carboxylic acid derivative was activated using NHS chemistry according to the following procedure:
- the pellet was dissolved in 1 mL concentrated aqueous ammonia and agitated for 4 hours at room temperature in order to remove the O-acetates from the GalNAc sugar residues.
- the material was diluted with 100 mM Triethyl ammonium acetate (TEAA) and the crude reaction mixture was purified by RP HPLC using an XBridge Prep C18 (5 mm, 10x 50 mm, Waters) column at 60 °C on an ⁇ KTA explorer HPLC system.
- Solvent A was 100 mM aqueous TEAA and solvent B was 100 mM TEAA in 95 % CAN, both heated to 60 °C by means of a buffer pre-heater. A gradient from 5 % to 25 % B in 60 min with a flow rate of 3.5 mL/min was employed. Elution of compounds was observed at 260 and 280 nm. Fractions with a volume of 1.0 mL were collected and analyzed by analytical RP HPLC/ESI-MS. Fractions containing the target conjugate with a purity of more than 85 % were combined. The correct molecular weight was confirmed by ESI/MS.
- Example 7 Oligonucleotide Precursors
- Tables 2-7 below describes the single-stranded monomers, dimers and GalNAc tagged monomers and dimers that were prepared: Table 2: Oligonucleotide Precursors– Single Strands (“X”)
- (BMPEG2) represents the non-cleavable homobifunctional crosslinker 1,8-bismaleimido- diethyleneglycol.
- “C6NH2” and“C6NH” are used interchangeably to represent the aminohexyl linker.
- “C6SSC6” represents the dihexyldisulfide linker.
- “GalNAc3” and “GalNAc” are used interchangeably to represent the tri-antennary N- acetylgalactosamine ligand, whose chemical structure is shown in FIG. 1A.
- “SPDP” represents the reaction product of the reaction of succinimidyl 3-(2- pyridyldithio)propionate with the aminolinker equipped RNA.“InvdT” means inverted thymidine.
- a stepwise annealing procedure was performed. The annealing was performed in water and utilized stepwise addition of complementary strands. No heating/cooling of the solution was required. After each addition, an aliquot of the annealing solution was removed and monitored for duplex formation using analytical RP HPLC under native conditions (20°C). The required amounts to combine equimolar amounts of complementary single strands were calculated based on the extinction coefficients for the individual single strands computed by the nearest neighbor method. If the analytical RP HPLC trace showed excess single strand, additional amounts of the corresponding complementary strand were added to force duplex formation (“duplex titration”).
- Duplex titration was monitored using a Dionex Ultimate 3000 HPLC system equipped with a XBride C18 Oligo BEH (2.5 mm; 2.1x50 mm, Waters) column equilibrated to 20°C.
- the diagnostic wavelength was 260 nm.
- Buffer A was 100 mM hexafluoro-isopropanol (HFIP), 16.3 mM triethylamine (TEA) containing 1 % methanol.
- Buffer B had the same composition except MeOH was 95 %.
- a gradient from 5 % to 70 % buffer B in 30 minutes was applied at a flow rate of 250 mL/min. The two complementary strands were run independently to establish retention times.
- GalNAc-conjugated homodimeric siRNA XD-06330 targeting FVII (FIG. 3) was prepared (10mg, 323 nmol) by combining the single stranded dimer X19819 stepwise with X18788 and X19571 according to the duplex titration method described in Example 8. The isolated material was essentially pure by HPLC analysis. Table 9: Stoichiometry of Oligomers Used in Synthesis of GalNAc-FVII-DTME- FVII Homodimer (XD-06330)
- GalNAc-conjugated homodimeric siRNA XD-06360 targeting FVII was prepared (11 mg, 323 nmol) by combining single strands stepwise using the synthesis strategy depicted in FIG.4 and the methodology described in Example 8.
- Example 12 Preparation of 5’-GalNAc-FVII-DTME-FVII Homodimer with Cleavable Linker Joining 3’ Antisense Strands and GalNAc Conjugated to Internal 5’ end of Sense Strand (XD-06329)
- FIG. 7A Factor VII serum values at each time point are normalized to control mice injected with 1X PBS. The bars at each datapoint correspond, left to right, to saline, XD-06328, XD-06329, XD-06330, and XD-06360, respectively.
- FIG. 7B Factor VII serum values at each time point are normalized to the prebleed value for each individual group.
- the bars at each data point correspond, left to right, to saline, XD-06328, XD-06329, XD-06330, and XD-06360, respectively.
- Example 14 Preparation of Canonical GalNAc-siRNAs independently targeting FVII (XD-06328), ApoB (XD-06728) and TTR (XD-06386).
- the complementary antisense strands (X18795, X19583, and X19584, respectively) were synthesized by standard procedures provided above, followed by annealing to the GalNAc conjugated single strands to yield siRNAs targeting FVII (XD-06328), ApoB (XD-06728) and TTR (XD-06386) in 99.7, 93.1 and 93.8 % purity respectively.
- Table 11 GalNAc-siRNA Conjugates
- a heterotrimer of siRNA targeting FVII, ApoB and TTR conjugated to GalNAc was synthesized using a hybrid strategy of solid phase and solution phase, as depicted in FIG. 10.
- the dimer X19581 was made using solid phase chemistry with an aminohexyl linker on the 5’-end using the corresponding commercially available TFA protected phosphoramidite (SAFC Proligo, Hamburg, Germany). The sequence was cleaved from the solid support, deprotected and purified according to the conditions outlined above. In order to install an additional disulfide linker, the oligonucleotide’s 5’-aminohexyllinker was reacted with SPDP (succinimidyl
- Solvent A was 100 mM aqueous TEAA and solvent B was 100 mM TEAA in 95 % ACN. Solvents were heated to 60 °C by means of a buffer pre-heater and the column was kept in an oven at the same temperature. A gradient from 0 % to 35 % B in 45 min with a flow rate of 4 mL/min was employed. Elution of compounds was observed at 260 and 280 nm. Fractions with a volume of 1.5 mL were collected and analyzed by analytical RP HPLC/ESI-MS. Suitable fractions were combined and the oligonucleotide X19582 precipitated at minus 20 °C after addition of ethanol and 3M NaOAc (pH 5.2).
- the reaction mixture was purified using the same conditions as described in the previous paragraph, with the exception that the gradient was run from 0 % B to 30 % B in 45 min.
- the single-stranded heterotrimer X20256 (containing linked sense strands of siFVII, siApoB and siTTR) was obtained in high purity.
- the sequence of X20256 is shown in Table 12.
- the heterotrimeric duplex construct (XD-06726), simultaneously targeting FVII, ApoB and TTR, 7 mg (150 nmol), was prepared by sequentially adding the antisense single strands stepwise to the sense-strand heterotrimeric intermediate (X20256) according to the duplex titration method described in Example 8. 7 mg of material was obtained which was essentially pure by HPLC.
- Table 13 Stoichiometry of Oligomers Used in Synthesis of GalNAc-FVII-ApoB-TTR Trimer (XD-06726).
- Example 16 Preparation of GalNAc-FVII-ApoB-TTR Trimer with Cleavable Linkages on Alternating Sense and Antisense Strands (XD-06727).
- Trimeric siRNA XD-06727 (see FIG. 11), simultaneously targeting FVII, ApoB and TTR, was prepared in high purity by combining single strands stepwise as depicted in FIG. 12, using the methodology described in Example 8.
- Table 14 Stoichiometry of Oligomers used in synthesis of GalNAc-siFVII-siApoB- siTTR Trimer (XD-06727)
- the heterotrimers XD-06726 and XD-06727 as well as a pool of 3 monomeric GalNAc-conjugated siRNAs were injected subcutaneously (0.1 mL volume) at a concentration of 50 mg/kg total RNA for the trimers and 17 mg/kg for each of the monomeric conjugates.
- a pool of LNP-formulated siRNAs (NPA-741-1) directed against the same targets (FVII (XD- 00030), ApoB (XD-01078) and TTR (XD-06729) was injected intravenously at 0.5 mg/kg per siRNA.
- ApoB serum levels show a high variation, both within the animals of one group and between the different time-points of the saline control.
- Multimeric oligonucleotide according to the disclosure can be synthesized by any of the methods disclosed herein. Two example methods are provided below for homo-tetramers. These Examples can be readily adapted to synthesize longer multimers (e.g., pentamers, hexamers, etc.)
- a homo-tetrameric siRNA with linkages on a single strand can be synthesized by preparing a tetramer of the sense strand, each sense strand linked via a cleavable linker, on a synthesizer and then subsequently adding a targeting ligand and annealing the anti-sense strands, as shown in FIG. 40.
- the cleavable linkers of the sense strand may be disulfides (as shown) or other labile linkages (e.g., chemically unmodified nucleic acid sequences such as UUU/Uridine-Uridine-Uridine).
- Variations on the scheme shown in FIG. 40 can include using alternative linkers, linking anti-sense strands and annealing sense strands, synthesizing longer multimers, or where the technical limits of machine-based synthesis are reached, synthesizing one or more multimers and then joining said multimers together using one or more solution phase chemical reactions (e.g., synthesizing two tetramers per scheme 1, one with ligand, the other without, one or both strands modified, as appropriate, with a functional group to facilitate linking, and then linking the two tetramers together via the formation of a covalent bond, with or without the addition of a linking moiety such as, e.g., DTME).
- a linking moiety such as, e.g., DTME
- the homo-tetramer could be assembled as shown in FIG. 41 with linkages on alternating strands.
- the ligand conjugate shown in FIG.41 can be synthesized as follows:
- a portion of the sense-strand maleimide derivative thus obtained is then treated with a sulfhydryl derivative of the targeting ligand of choice:
- Multimeric oligonucleotide according to the disclosure can be synthesized by any of the methods disclosed herein or adapted from the art. Example methods are provided below for homo-multimers, but the present synthesis can also be readily adapted to synthesize hetero-multimers.
- Examples can also be adapted to synthesize multimers of different lengths. For example, one can use essentially the same synthesis and linking chemistry to combine a tetramer and monomer (or trimer and dimer) to produce a pentamer. Likewise, one can combine a tetramer and a trimer to produce a septamer, etc. Complementary linking chemistries (e.g., click chemistry) can be used to assemble larger multimers. [00611]
- Example 22A Synthesis of Homo-Tetramer of siRNA Via Pre- Synthesized Homodimers
- Step 1 A sense strand homodimer is synthesized wherein the two sense strands are linked by a nuclease cleavable oligonucleotide (NA) and terminated with an amino function and a disulfide moiety.
- NA nuclease cleavable oligonucleotide
- Step 2 A tri-antennary GalNAc ligand is then added to the terminal amino function of one part of the sense strand homo-dimer via reaction with an acyl activated triantennary GalNAc ligand.
- Step 3 The remainder of the sense strand homodimer is treated with a molar excess of dithiothreitol to cleave the disulfide group to generate a thiol terminated sense strand homodimer.
- Step 4 This material is mono-derivatized with dithiobismaleimidoethane (DTME) according to the procedure used to prepare hetero-multimers (see above).
- DTME dithiobismaleimidoethane
- Step 5 The disulfide group of the GalNAc derivitized homodimer is also cleaved by treatment with a molar excess of dithiothreitol.
- Step 6 The GalNAc terminated homodimer is then linked to the mono- DTME derivatized homodimer via reaction of the terminal thiol-group to yield single stranded homo-tetramer.
- “-S-CL-S-” represents the cleavable disulfide group in DTME, e.g., a Cleavable linker (CL).
- Step 7 This material is then annealed with 4 molecular equivalents of antisense monomer to yield the desired double-stranded homo-tetramer (this annealing step is optional and can be omitted, for example to prepare single stranded multimers such as antisense oligonucleotides).
- Step 1 A sense strand homo-tetramer is synthesized wherein the four sense strands are linked by a nuclease cleavable oligonucleotide and terminated with an amino function and a disulfide moiety.
- Step 2 This material is treated with a molar excess of dithiothreitol to cleave the disulfide group
- Step 3 This material is monoderivatized with dithiobismaleimidoethane (DTME) according to the procedure used to prepare hetero-multimers (see above).
- DTME dithiobismaleimidoethane
- Step 4 This material is reacted with the thiol terminated GalNAc homodimer to yield the single stranded homo-hexamer.
- Step 5 This material is then annealed with 6 molecular equivalents of antisense monomer to yield the desired double-stranded homo-hexamer (this annealing step is optional and can be omitted, for example to prepare single stranded multimers such as antisense oligonucleotides).
- Step 1 One part of the amino-terminal homo-tetramer synthesized above is converted to the corresponding GalNAc derivative by reaction with an acyl activated triantennary GalNAc ligand. (Structure 79)
- Step 2 This material is treated with a molar excess of dithiothreitol to cleave the disulfide group
- Step 3 This material is reacted with the mono-DTME derivatized tetramer to yield the terminal GalNAc derivatized single-stranded octamer.
- Step 4 This material is then annealed with 8 molecular equivalents of antisense monomer to yield the desired double-stranded homo-octamer (this annealing step is optional and can be omitted, for example to prepare single stranded multimers such as antisense oligonucleotides).
- Example 22D Synthesis of Homo-Dodecamer of Anti-Sense Oligonucleotide via Pre-synthesized Homo-tetramers Using Combination of Thiol/maleimide and Azide/acetylene (“Click”) Linkers
- Step 1 A homo-tetramer of anti-sense oligonucleotides is synthesized containing 3 nuclease cleavable oligonucleotide linkers and terminal disulfide and amino groups.
- Step 2 This material is converted to the corresponding GalNAc derivative by reaction with an acyl activated triantennary GalNAc ligand.
- Step 3 This material is treated with a molar excess of dithiothreitol to cleave the disulfide group
- Step 4 Separately, a homo-tetramer of anti-sense oligonucleotides is synthesized containing 3 nuclease cleavable oligonucleotide linkers and terminal disulfide and azide groups.
- Step 5 This material is treated with a molar excess of dithiothreitol to cleave the disulfide group
- Step 6 This material is mono-derivatized with dithiobismaleimidoethane (DTME) according to the procedure used to prepare siRNA hetero-multimers (see above).
- DTME dithiobismaleimidoethane
- Step 7 This material is reacted with the thiol-terminated GalNAc derivatized tetramer to yield the terminal GalNAc derivatized single-stranded anti-sense octamer.
- Step 8 Separately, a third homo-tetramer of anti-sense oligonucleotides is synthesized containing 3 nuclease cleavable oligonucleotide linkers and a terminal acetylene group.
- the latter can be underivatized or a sterically strained derivative such as dibenzocyclooctyne (DBCO, Glen Research, VA, USA)
- Step 9 This material is then reacted with the azide-terminated octamer prepared in Step 7 to yield the desired Anti-Sense Homo-Dodecamer. If the terminal acetylene on the tetramer is underivatized a metal salt catalyst such as copper 1 chloride will be required to effect the linking. By contrast if the terminal acetylene is DBCO then the coupling reaction will be spontaneous.
- a metal salt catalyst such as copper 1 chloride
- a homo-hexamer of FVII siRNA was constructed containing two orthogonal types of bio-cleavable linkages, i) an unmodified di-nucleotide linkage easily introduced on the synthesizer, and ii) the thiol/maleimide derivative that was introduced post-synthesis.
- the FVII homo-hexamer (XD-09795) was assembled by combining a homodimer (X30835) and a homo-tetramer (X30837) as illustrated in FIG. 23. Both the homodimer and homo-tetramer synthesized on solid support via standard techniques with an amino- and disulfide group at each terminus.
- Example 25 Comparison of in vivo Circulation Half-life Between Homo-hexamer siRNA and Corresponding Monomer
- the serum half-lives of the FVII homo-hexamer XD-09795 and the corresponding FVII monomer XD-09794 were determined in mice. Briefly, the homo- hexamer or the corresponding monomer were administered via intravenous (IV) bolus injection into 3 cohorts of 4 C57/BL6N female mice aged approximately 11 weeks per cohort. Dosage was 20mg/kg for both FVII monomer and FVII hexamer and blood samples were drawn 5, 30, 60 and 120 minutes after the IV bolus injection. The concentration of FVII antisense was determined at various time-points via a fluorescent PNA probe complementary to the antisense strand and the results are shown in FIG.25.
- FVII sense 5‘-gcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT)-3‘ (SEQ ID NO:35)
- FVII anti-sense 5‘-UfsGfaGfuUfgGfcAfcGfcCfuUfuGfcusu-3‘ (SEQ ID NO:26), linked via the endonuclease cleavable linkers dCdA and the reductively cleavable linker DTME as follows:
- Example 28 Synthesis of FVII Monomer XD-09794
- Monomeric sense strand X18789 of FVII siRNA with amino function at the 5’-terminus on the sense strand was synthesized and purified as shown in FIGS. 27A and 27B. Yield, 48.3 mg, 6.694 mmol, 18.6%.
- the corresponding antisense strand X18795 was likewise synthesized to yield 46.3mg, 6.35 mmol, 31.9%.
- Disulfide group was cleaved from X30833 and X30836 using DTT to give the corresponding 5-thiol derivatives X30834 and X30837 in 97.6% and 91.9% yield respectively.
- X30834 was then converted to 10.6 mg (700.5 nmol, 71.0%) of the corresponding mono-DTME derivative X30835 which was reacted with one equivalent of X30837 to give 4.2mg (90.7 nmol, 64%) of the single stranded homo-hexamer X30838.
- homo-heptameric sense-strand of FVII siRNA X34009 with amino groups at both of the 3’ termini and containing five dCdA cleavable linkers was synthesized and purified via the homo-dimeric sense-strand of FVII siRNA X30833 and the homo-pentameric sense-strand of FVII siRNA X34004.
- Disulfide group was cleaved from X30833 and X34004 using DTT to give the corresponding 5-thiol derivatives X30834 (28.3mg, 1877.9 nmol, 86.7%) and X34006 (21.8 mg, 572.2 nmol), respectively.
- X30834 was then converted to the corresponding mono-DTME derivative X30835 (22.6 mg, 1465.2 nmol, 78.1%). 8.8 mg (572.2 nmol) of X30835 was reacted with X34006 (21.8mg, 572.2 nmol) to give the single stranded homo-heptamer X34009 (8.96 mg, 167.3 nmol, 29.2%).
- Disulfide group was cleaved from X34005 using DTT to give the corresponding 5-thiol derivative X34007 (11.5mg, 251nmol, 99.7%) which was reacted with the previously obtained mono-DTME homo-dimer derivative X30835 (3.85mg, 250.2 nmol) to give the single stranded homo-octamer X34010 (5.2 mg, 85.0 nmol, 34.0%).
- the serum half-lives of the homo-multimers XD-10635, XD-10636, XD- 10637, XD-10638, XD-10639, XD-10640 and XD-10641 and the corresponding monomer XD-09794 were determined by iv bolus injection of test material at a concentration of 1ng/ml in x1 PBS via tail vein into 3 cohorts of 4 C57/BL6N female mice aged approx. 11 weeks per cohort. Dosage was 20mg/kg for both FVII monomer and FVII multimers and blood samples were drawn at 5, 30, 60, 120 and 360 minutes.
- the serum samples were digested with proteinase K and a specific complementary Atto425-Peptide Nucleic Acid-fluorescent probe was hybridized to the antisense strand. Subsequent AEX-HPLC analysis enabled discrimination of intact antisense strand from metabolites leading to high specificity of the method. Only values for the intact parent compound are shown in Table 17, below and illustrated in FIGS. 36A and 36B as smooth line scatter plot and straight marked scatter plot of FVII siRNA levels in serum for FVII multimers over time, respectively. Table 20: FVII siRNA levels in serum for FVII homo-multimers over time.
- FIGS. 37A, 37B, 37C, and 37D show bar chart graphs of FVII siRNA levels in serum for FVII multimers at 5 minutes, 30 minutes, 60 minutes, and 120 minutes, respectively.
- FIGS. 38A and 38B show total FVII siRNA levels in serum, as represented by area under the curve, for FVII multimers, in ng*min/mL and normalized to monomer AUC value.
- 34245 (231173 - 0) * e ⁇ (-kx) + 0, where x is minutes
- a GalNAc 4:1:1 FVII:ApoB:TTR Hetero-hexamer was prepared via the reaction sequence shown in FIG. 42. Oligos in the gray boxes were prepared on the synthesizer according to the methods above under“Additional General Procedure 1: Single Chain Oligonucleotide Synthesis”, the remainder being prepared according to the procedures in Examples 1-6. Sequences prepared were as shown in the Key wherein“X”,“x”, and“Xf” represent a ribonucleotide, 2’-O-methylribonucleotide and 2’-fluoro-2’-deoxyribonucleotide, respectively.
- “InvdT” represents inverted deoxythymidine residues and“s” represents phosphorothioate linkages.
- “(SHC 6 )” and “(C 6 SSC 6 )” represent thiohexyl and dihexyldisulfide linkers, respectively.“C 6 NH 2 ” and “C6NH” are used interchangeably to represent the aminohexyl linker.
- “(DTME)” represents dithiobismaleimidoethane.
- Table 24 Sequences of oligonucleotides in Example 39
- Step-wise annealing was performed to obtain the desired heterodimeric duplex with an ApoB antisense overhang.
- the GalNAc-conjugated FVII sense strand X39850 was annealed with 1 mole equivalent of antisense X18795 to form the duplex X39850-X18795.
- RP-HPLC confirmed a duplex purity of 78.2% (FIG. 48).
- the FVII duplex X39850-X18795 was then conjugated with the FVII sense strand X39851
- RP-HPLC confirmed a duplex purity of 87.0% (FIG. 49).
- 1 mole equivalent of the dimeric antisense strand X39855 was added to the X39850-X18795-X39851 duplex to form X39850-X18795-X39851-X39855.
- RP-HPLC confirmed a duplex purity of 97.6% (FIG.50).
- X39852 a FVII sense strand linked to TTR sense strand via a disulfide linkage
- X39854 a FVII antisense strand linked to TTR antisense strand via a disulfide linkage
- RP-HPLC and MS were used to confirm the purity of X39852, X39854, and X39853 (FIG.51 - FIG.53).
- Step-wise annealing was performed to obtain the desired heterotrimeric duplex with an ApoB sense overhang.
- the dimeric sense strand X39852 was annealed with 1 mole equivalent of antisense X18795 to form the duplex X39852- X18795.
- RP-HPLC confirmed a duplex purity of 99.5% (FIG. 54).
- 1 mole equivalent of the dimeric antisense strand X39854 was added to the X39852-X18795 duplex to form X39852-X18795-X39854.
- RP-HPLC confirmed a duplex purity of 94.9% (FIG. 55).
- a homo-tetramer of siRNA targeting TTR is synthesized by linking two double-stranded homodimers ex synthesizer according to Scheme 1 (FIG. 59).
- the dimers are prepared as single strands linked by the nuclease cleavable linker dTdTdTdT with terminal alkylamino and disulfide groups at either end.
- the tetrameric single stranded sense strand is prepared via addition of DTME.
- Addition of 4 equivalents of TTR antisense strand affords the bis(triantennary GalNAc) homo-tetrameric siTTR.
- a monomeric siRNA targeting TTR is administered via SC and compared against the results of the homo-tetramer.
- the level of TTR protein in blood sample from mice administered the multimeric siRNA may be about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100% lower when compared to the level of TTR protein in blood samples from mice administered the monomeric siRNA.
- (GalNAc) 3 -NH- -dTdTdTdT- -S-CL-S- -dTdTdT- -NH-(GalNAc) 3 wherein (GalNAc) 3 is tri-antennary GalNAc; NH is a secondary amine; dT is a deoxythymidine residue; and -S-CL-S- is
- a homo-tetramer of siRNA targeting TTR is synthesized by linking two ds homodimers ex synthesizer according to Scheme 2 (FIG. 60).
- the dimers are prepared as single strands linked by the nuclease cleavable linker dTdTdTdT with terminal alkylamino and disulfide groups at either end.
- a triantennary GalNAc ligand is added to the amino terminus of one portion of the strands and after cleavage of the disulfide to yield the corresponding thiol, is converted to corresponding mono-DTME derivative as described previously.
- the bioactivity of this material is assessed by SC administration into mice and blood samples are taken at various time points. Levels of TTR protein at these time points are determined.
- a monomeric siRNA targeting TTR is administered subcutaneously and compared against the results of the homo-tetramer.
- the level of TTR protein in blood samples from mice administered the multimeric siRNA may be about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower when compared to the level of TTR protein in blood samples from mice administered the monomeric siRNA.
- the method described herein may be used to make the multimeric oligonucleotide represented by Structure C: (GalNAc) 3 -NH- -dTdTdTdT- -S-Cl-S- -dTdTdT- -NH 2 ; wherein (GalNAc) 3 is tri-antennary GalNAc; NH 2 is a primary amine; NH is a secondary amine; dT is a deoxythymidine residue; and -S-CL-S- is
- a homo-tetramer of siRNA targeting TTR is synthesized by linking two ds homodimers ex synthesizer according to Scheme 3 (FIG. 61).
- the dimers are prepared as single strands linked by the nuclease cleavable linker dTdTdTdT with terminal alkylamino and disulfide groups at either end.
- the tetrameric single stranded sense strand is prepared via addition of DTME.
- Addition of 4 equivalents of TTR antisense strand each conjugated to a monomeric GalNAc ligand affords the homo-tetrameric siTTR ligated to six monomeric GalNAc ligands.
- the bioactivity of this material is assessed by SC administration into mice and blood samples are taken at various time points. Levels of TTR protein at these time points are determined.
- a monomeric siRNA targeting TTR is administered subcutaneously and compared against the results of the homo-tetramer.
- the level of TTR protein in blood samples from mice administered the multimeric siRNA may be about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower when compared to the level of TTR protein in blood samples from mice administered the monomeric siRNA.
- (GalNAc) 3 is mono-antennary GalNAc; NH is a secondary amine; dT is a deoxythymidine residue; and -S-CL-S- is
- a homo-tetramer of siRNA targeting TTR is synthesized by linking two ds homodimers ex synthesizer according to Scheme 4 (FIG. 62).
- the dimers are prepared as single strands linked by the nuclease cleavable linker dTdTdTdT with terminal alkylamino and disulfide groups at either end.
- a triantennary GalNAc ligand is added to the amino terminus of one portion of the single stranded dimer and after cleavage of the disulfide to yield the corresponding thiol, is converted to the corresponding mono-DTME derivative as described previously.
- An endosome escape ligand is added to the amino terminus of the remaining portion of the strands and after cleavage of the disulfide to yield the corresponding thiol is reacted with the previously obtained mono-DTME derivative. Subsequent annealing with 4 equivalents of TTR antisense strand affords the mono-(triantennary GalNAc) homo-tetrameric siTTR conjugated with an endosome escape ligand.
- the bioactivity of this material is assessed by SC administration into mice and blood samples are taken at various time points. Levels of TTR protein at these time points are determined.
- a monomeric siRNA targeting TTR is administered subcutaneously and compared against the results of the homo-tetramer.
- the level of TTR protein in blood samples from mice administered the multimeric siRNA may be about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% lower when compared to the level of TTR protein in blood samples from mice administered the monomeric siRNA.
- (GalNAc) 3 NH- -dTdTdTdT- -S-Cl-S- -dTdTdT- -NH-EEM; wherein (GalNAc) 3 is tri-antennary GalNAc; NH is a secondary amine; EEM is an endosomal escape moiety; dT is a deoxythymidine residue; and -S-CL-S- is .
- Example 45 Determination of the Effect of Size of Multimer on Rate of Release from Subcutaneous Tissue
- a range of FVII siRNA oligomers from monomer to octamer was prepared. 1-6-mers were obtained directly from the synthesizer and 7- and 8-mers via a pentamer and hexamer, respectively, being linked to a dimer via a mono-DTME derivative to give the disulfide linked products as before (FIG.63).
- Each of the 1- to 8-mers was separately administered to C57BL/6N mice at 20 mg/kg via SC administration and blood samples taken at 5, 30, 60, 240, 600 and 1440 minutes.
- the samples were digested with proteinase K and a specific complementary Atto425-Peptide Nucleic Acid-fluorescent probe was added and hybridized to the FVII siRNA antisense strand.
- the concentration of siFVII at the various timepoints was determined by subsequent AEX-HPLC analysis. The results are plotted and analyzed as per the methodology in Example 37.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicinal Preparation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2022502227A JP2022543191A (ja) | 2019-07-30 | 2020-07-29 | 増強された生理活性を有する多量体オリゴヌクレオチドの皮下送達 |
| CN202080068000.9A CN114466929A (zh) | 2019-07-30 | 2020-07-29 | 具有增强的生物活性的多聚体寡核苷酸的皮下递送 |
| EP20848521.9A EP4004205A4 (en) | 2019-07-30 | 2020-07-29 | SUBCUTANEOUS ADMINISTRATION OF MULTIMER OLIGONUCLEOTIDES WITH INCREASED BIOACTIVITY |
| AU2020319911A AU2020319911A1 (en) | 2019-07-30 | 2020-07-29 | Subcutaneous delivery of multimeric oligonucleotides with enhanced bioactivity |
| US17/631,087 US20230114023A1 (en) | 2019-07-30 | 2020-07-29 | Subcutaneous delivery of multimeric oligonucleotides with enhanced bioactivity |
| CA3144467A CA3144467A1 (en) | 2019-07-30 | 2020-07-29 | Subcutaneous delivery of multimeric oligonucleotides with enhanced bioactivity |
| IL289801A IL289801A (en) | 2019-07-30 | 2022-01-12 | Subcutaneous administration of multimeric oligonucleotides with enhanced biological activity |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201962880591P | 2019-07-30 | 2019-07-30 | |
| US62/880,591 | 2019-07-30 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2021021959A2 true WO2021021959A2 (en) | 2021-02-04 |
| WO2021021959A3 WO2021021959A3 (en) | 2021-03-04 |
Family
ID=74228530
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2020/044110 Ceased WO2021021959A2 (en) | 2019-07-30 | 2020-07-29 | Subcutaneous delivery of multimeric oligonucleotides with enhanced bioactivity |
Country Status (8)
| Country | Link |
|---|---|
| US (1) | US20230114023A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4004205A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2022543191A (cg-RX-API-DMAC7.html) |
| CN (1) | CN114466929A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2020319911A1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA3144467A1 (cg-RX-API-DMAC7.html) |
| IL (1) | IL289801A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2021021959A2 (cg-RX-API-DMAC7.html) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023225650A1 (en) * | 2022-05-19 | 2023-11-23 | Olix Us, Inc. | Linkers coupling functional ligands to macromolecules |
| US11859184B2 (en) | 2009-03-13 | 2024-01-02 | Kip Co., Ltd. | Multi-conjugate of siRNA and preparing method thereof |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IL316159A (en) | 2015-06-15 | 2024-12-01 | Mpeg La Llc | Defined Oligonucleotide Multimers and Methods for Manufacture Thereof |
| SG11201906728TA (en) | 2017-02-06 | 2019-08-27 | Mpeg La Llc | Multimeric oligonucleotides having decreased kidney clearance |
| WO2025100427A1 (ja) * | 2023-11-06 | 2025-05-15 | 国立研究開発法人国立循環器病研究センター | 肺高血圧症の予防および/または治療用医薬 |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060035815A1 (en) * | 2004-05-04 | 2006-02-16 | Nastech Pharmaceutical Company Inc. | Pharmaceutical compositions for delivery of ribonucleic acid to a cell |
| SI2539451T1 (sl) * | 2010-02-24 | 2016-04-29 | Arrowhead Research Corporation | Sestavki za ciljano dostavo sirna |
| US20150247141A1 (en) * | 2012-09-14 | 2015-09-03 | Rana Therapeutics, Inc. | Multimeric oligonucleotide compounds |
| CN104837996A (zh) * | 2012-11-15 | 2015-08-12 | 罗氏创新中心哥本哈根有限公司 | 抗apob反义缀合物化合物 |
| AU2014211406B2 (en) * | 2013-01-30 | 2019-07-18 | Roche Innovation Center Copenhagen A/S | LNA oligonucleotide carbohydrate conjugates |
| IL316159A (en) * | 2015-06-15 | 2024-12-01 | Mpeg La Llc | Defined Oligonucleotide Multimers and Methods for Manufacture Thereof |
| SG11201906728TA (en) * | 2017-02-06 | 2019-08-27 | Mpeg La Llc | Multimeric oligonucleotides having decreased kidney clearance |
-
2020
- 2020-07-29 JP JP2022502227A patent/JP2022543191A/ja not_active Withdrawn
- 2020-07-29 AU AU2020319911A patent/AU2020319911A1/en not_active Abandoned
- 2020-07-29 US US17/631,087 patent/US20230114023A1/en not_active Abandoned
- 2020-07-29 WO PCT/US2020/044110 patent/WO2021021959A2/en not_active Ceased
- 2020-07-29 CA CA3144467A patent/CA3144467A1/en active Pending
- 2020-07-29 EP EP20848521.9A patent/EP4004205A4/en not_active Withdrawn
- 2020-07-29 CN CN202080068000.9A patent/CN114466929A/zh active Pending
-
2022
- 2022-01-12 IL IL289801A patent/IL289801A/en unknown
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11859184B2 (en) | 2009-03-13 | 2024-01-02 | Kip Co., Ltd. | Multi-conjugate of siRNA and preparing method thereof |
| WO2023225650A1 (en) * | 2022-05-19 | 2023-11-23 | Olix Us, Inc. | Linkers coupling functional ligands to macromolecules |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4004205A4 (en) | 2023-11-08 |
| EP4004205A2 (en) | 2022-06-01 |
| JP2022543191A (ja) | 2022-10-11 |
| IL289801A (en) | 2022-03-01 |
| CN114466929A (zh) | 2022-05-10 |
| WO2021021959A3 (en) | 2021-03-04 |
| US20230114023A1 (en) | 2023-04-13 |
| AU2020319911A1 (en) | 2022-02-24 |
| CA3144467A1 (en) | 2021-02-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11767531B2 (en) | Defined multi-conjugates oligonucleotides | |
| US12378551B2 (en) | Multimeric oligonucleotides having decreased kidney clearance | |
| JP2018518186A5 (cg-RX-API-DMAC7.html) | ||
| US20230114023A1 (en) | Subcutaneous delivery of multimeric oligonucleotides with enhanced bioactivity | |
| WO2021026476A1 (en) | Complement targeting with multimeric oligonucleotides | |
| WO2021026490A1 (en) | Cns targeting with multimeric oligonucleotides | |
| US20230287406A1 (en) | Multimeric oligonucleotides with enhanced bioactivity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20848521 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2022502227 Country of ref document: JP Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 3144467 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2020319911 Country of ref document: AU Date of ref document: 20200729 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2020848521 Country of ref document: EP Effective date: 20220228 |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20848521 Country of ref document: EP Kind code of ref document: A2 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 289801 Country of ref document: IL |