WO2021018118A1

WO2021018118A1 - Compounds and methods for the targeted degradation of interleukin-1 receptor-associated kinase 1 proteins

Info

Publication number: WO2021018118A1
Application number: PCT/CN2020/105067
Authority: WO
Inventors: Liqiang Fu; Jing Zhang; Wangyang Tu; Yingtao LIU; Linglong KONG; Bin Shen; Xuedong Dai; Yanping Xu
Original assignee: Janssen Pharmaceutica Nv; Johnson & Johnson (China) Investment Ltd.
Priority date: 2019-07-29
Filing date: 2020-07-28
Publication date: 2021-02-04

Abstract

The present invention relates to compounds comprising an interleukin-1 receptor-associated kinase 1 (IRAK1) protein binding moiety and a Von Hippel-Lindau (VHL) E3 ubiquitin ligase binding moiety, and associated methods of use. The compounds are useful as modulators of targeted ubiquitination, especially with respect to IRAK1, which is degraded by the compounds according to the invention.

Description

COMPOUNDS AND METHODS FOR THE TARGETED DEGRADATION OF INTERLEUKIN-1 RECEPTOR-ASSOCIATED KINASE 1 PROTEINS

FIELD OF THE INVENTION

BACKGROUND OF THE INVENTION

The interleukin-1 receptor-activated kinase 1 (IRAK1) belongs to a family of four serine/threonine kinases implicated in innate immunity and inflammatory responses (Flannery et al., Biochemical Pharmacology 2010, 80 (12) , 1981-1991) . IRAK1, IRAK2 and IRAK4 are expressed in a variety of cell types while IRAK3, also known as IRAK-M, is mainly expressed in cells of monocytic origin (Wesche et al., Journal of Biological Chemistry 1999, 274 (27) , 19403-19410) . Though all four members contain a kinase domain, IRAK4 and IRAK1 have intrinsic kinase activities, whereas IRAK2 and IRAK-M are seemingly pseudo-kinases.

IRAKs are key regulators of pro-inflammatory signaling elicited by Toll-like receptors (TLRs) , interleukin-1 receptor (IL-1R) and interleukin-18 receptor (IL-18R) (Cohen et al., Journal of Cell Science 2014 127 (11) , 2383-2390) . Upon ligand recognition, TLRs or IL-1/-18Rs dimerize and undergo conformational changes, allowing their intracellular domains to recruit the myeloid differentiation primary response 88 (MyD88) adaptor protein. Several MyD88 molecules oligomerize through N-terminal death domains (DD) and recruit DD domain-containing IRAKs, forming a macromolecular signaling complex, termed the Myddosome (Lin et al, Nature 2010, 465, 885-890) . The assembly of the Myddosome first promotes IRAK4 autophosphorylation and activation. Activated IRAK4 phosphorylates IRAK1 and/or IRAK2, followed by the transient recruitment of TNFR-associated factor 6 (TRAF6) to the Myddosome. TRAF6 is thus activated and released to the cytosol, where it triggers the activation of the IκB kinase (IKK) -Nuclear factor-κB (NF-κB) cascades and the MAP kinase (MAPK) signaling pathways, resulting in the transcription of multiple potent pro-inflammatory cytokines such as interleukin-6 (IL-6) and interleukin-10 (IL-10) , as well as the production of various of chemokines (Strickson et al., PNAS 2017, 114 (17) , E3481-E3489) .

Mice lacking IRAK1 are viable and healthy, appeared indistinguishable from wild type and heterozygous littermates. Mice lacking IRAK1 demonstrated normal physiology, with organs normal in size and morphology. No histologic abnormality was detected in lymphoid organs, heart, liver, and kidney. Their peripheral blood showed normal numbers of lymphocytes, macrophages, and granulocytes when analyzed by flow cytometry (Thomas et al., The Journal of Immunology, 1999, 163: 978–984) . When challenged with TLR agonists, deletion of IRAK attenuates, but does not eliminate cytokine responsiveness of mutant mice and cells. (Thomas et al., The Journal of Immunology, 1999, 163: 978–984; Kanakaraj et al., J. Exp. Med. 187: 2073) . Inherited human IRAK1 deficiency appeared to be different from IRAK4 or MyD88 deficient patients, with no evident bacterial infection. The fibroblasts isolated from IRAK1 deficient patient respond poorly to TLR agonists but remained normal response IL-1β. The patient's peripheral blood mononuclear cells responded normally to all TLR agonists and IL-1β. These results suggest human IRAK1 may play a redundant role downstream from TLRs/IL-1Rs and Myd88 in innate immune response (Della et al., Proc Natl Acad Sci USA. 2017 Jan 24; 114 (4) : E514-E523) .

In oncology, MyD88 was found to be mutated in 39%of patients with an aggressive subtype of B cell lymphoma, the active B cell-like diffuse large B cell lymphoma (ABC DLBCL) (Ngo et al. Nature 2010, 470, 115) . The same somatic mutation of MyD88 was also detected in several other types of B cell malignancies, including

macroglobulinemia (86%-100%) , primary central nervous system lymphomas (38%-71%) and IgM-secreting lymphoplasmacytic lymphoma (87%) (Poulain et al., Blood 2013, 121 (22) , 4504-4511; Chakraborty et al., Blood 2016, 127 (23) , 2936-8; Landgren et at., N Engl J Med 2012, 367 (23) , 2255-6; Yamada et al., Leukemia &Lymphoma 2015, 56 (7) , 2141-2145) . Functionally, MyD88 mutation, particularly MyD88 L265P, can undergo spontaneous oligomerization, leading to Myddosome assembly and constitutive activation of downstream NF-κB and MAPK pathways (Weber et al., Cancer Immunology, Immunotherapy 2018, 67 (11) , 1797-1807) . In a genetically engineered mouse model, expression of MyD88L252P, an ortholog of human MyD88 L265P, in B-cell populations led to the development of lymphoma with pathological features resembling those of human ABC DLBCL (Knittel et al., Blood 2016, 127 (22) , 2732-41) . These studies demonstrate that MyD88 L265P is functionally a gain-of-function activating mutation that contributes to lymphomagenesis through Myddosomal signaling and therapeutic strategies targeting the Myddosome complex may be beneficial for patients with MyD88 mutant B-cell malignancy.

Small hairpin RNA (shRNA) -mediated genetic knockdown of IRAK1 led to selective cell killing in ABC DLBCL cells, a comparable phenotype observed in shRNA mediated MyD88 knockdown in ABC DLBCL (Ngo et al. Nature 2010, 470, 115) . However, how IRAK1 functions through enzymatic and scaffolding functions and therefore contributes to NFκB signaling and cell survival in ABC DLBCL remains unclear. Interestingly, the antiproliferation effect of IRAK1 shRNA in ABC DLBCL cells can be fully rescued by ectopic expression of a kinase-dead form of IRAK1 (Ngo et al. Nature 2010, 470, 115) . These results suggesting that the scaffolding function, not enzymatic activity of IRAK1 is essential for ABC DLBCL survival.

IRAK1 scaffolding function is challenging to target using traditional small molecule inhibitors as it is not well-defined which domain of IRAK1 is mainly responsible for its scaffolding function and no reported druggable pocket outside its kinase domain is reported. As such, hetero-bispecific small-molecules that recruit E3 ligase to induce IRAK1 protein degradation would be a viable approach to degrade IRAK1 protein and eliminate its scaffolding function.

Most small molecule drugs bind enzymes or receptors in tight and well-defined pockets. On the other hand, protein-protein interactions are notoriously difficult to target using small molecules due to their large contact surfaces and the shallow grooves or flat interfaces involved. E3 ubiquitin ligases (of which hundreds are known in humans) confer substrate specificity for ubiquitination, and therefore, are more attractive therapeutic targets than general proteasome inhibitors due to their specificity for certain protein substrates. The development of ligands of E3 ligases has proven challenging, in part, due to the fact that they must disrupt protein-protein interactions. However, recent developments have provided specific ligands which bind to these ligases.

Bifunctional compounds such as those that are described in U.S. Patent Application Publication Nos 2015-0291562 and 2014-0356322 (incorporated herein by reference) , function to recruit endogenous proteins to an E3 ubiquitin ligase for degradation. In particular, the publications describe bifunctional or proteolysis targeting chimeric (PROTAC) compounds, which find utility as modulators of targeted ubiquitination of a variety of polypeptides and other proteins, which are then degraded and/or otherwise inhibited by the bifunctional compounds.

Recently, WO2019/099926 and US20190192668 (incorporated herein by reference) , each has disclosed bifunctional compounds functioning to recruit endogenous proteins to an E3 ubiquitin ligase for the degradation of IRAK4.

An ongoing need exists in the art for effective treatments for disease associated with overexpression or aggregation of IRAK1. However, non-specific effects, and the inability to target and modulate IRAK1, remain as obstacles to the development of effective treatments.

As such, small molecule therapeutic agents that leverage E3 ligase mediated protein degradation to target IRAK1 hold promise as therapeutic agents.

SUMMARY OF THE INVENTION

The invention provides compounds having the chemical structure:

PTM―L―VLM,

(I)

including any stereoisomer thereof,

or a pharmaceutically acceptable salt or solvate thereof,

wherein:

the VLM is a small molecule Von Hippel-Lindau (VHL) E3 ubiquitin ligase binding moiety,

the L is a chemical linking moiety connecting the VLM and the PTM,

the PTM is a small molecule comprising an interleukin-1 receptor-associated kinase 1 (IRAK1) protein targeting moiety, and has a chemical structure represented by Formula PTM-I:

wherein

R ₁ is 5-12 member aryl, 5-12 member heteroaryl, or 5-10 member non-aromatic heterocyclyl, each of which is optionally substituted with 1, 2 or 3 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl, C _1-6 alkoxy and =O,

R ₂ is H, halogen, C _1-6 alkyl or C _1-6 alkoxy,

R ₃ is H, halogen, C _1-6 alkyl, C _1-6 alkoxy, 3-12 member carbocyclyl, 3-12 member heterocyclyl, 3-12 member carbocyclyloxy, or 3-12 member heterocyclyloxy, wherein the C _1- ₆ alkyl, C _1-6 alkoxy, 3-12 member carbocyclyl, 3-12 member heterocyclyl, 3-12 member carbocyclyloxy, or 3-12 member heterocyclyloxy are each optionally substituted with 1, 2 or 3 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl, C _1-6 alkoxy, C _3-6 cycloalkyl, hydroxy (C _1-6 alkyl) , amino (C _1-6 alkyl) optionally substituted with 1 or 2 independent C _1-6 alkyl groups on the amino group and -SO ₂- (C _1-6 alkyl) .

In another aspect, the invention provides a compound of formula (I) for use in therapy.

In a further aspect, the invention provides a compound of formula (I) for use in the prophylaxis or treatment, in particular in the treatment, of a disease or disorder mediated by IRAK1.

In a further aspect, the invention provides a compound of formula (I) for use in the prophylaxis or treatment, in particular in the treatment, of a neurodegenerative disease or disorder, an inflammatory disease or disorder and/or a cancer mediated by IRAK1.

In a further aspect, the invention provides a method for the prophylaxis or treatment, in particular in the treatment, of a disease or disorder mediated by IRAK1, which method comprises administering to a subject in need thereof a compound of formula (I) .

In a further aspect, the invention provides a method for the prophylaxis or treatment, in particular in the treatment, of a neurodegenerative disease or disorder, an inflammatory disease or disorder and/or a cancer mediated by IRAK1, which method comprises administering to a subject in need thereof a compound of formula (I) .

In a further aspect, the invention provides the use of a compound of formula (I) for the manufacture of a medicament for the prophylaxis or treatment, in particular in the treatment, of a disease or disorder mediated by IRAK1.

In a further aspect, the invention provides the use of a compound of formula (I) for the manufacture of a medicament for the prophylaxis or treatment, in particular in the treatment, of a neurodegenerative disease or disorder, an inflammatory disease or disorder and/or a cancer mediated by IRAK1.

In a further aspect, the invention provides a composition comprising a pharmaceutically acceptable carrier and an effective amount of at least one compound of formula (I) .

DETAILED DESCRIPTION OF THE INVENTION

The prefix “C _x-y” (where x and y are integers) as used herein refers to the number of carbon atoms in a given group. Thus, a C _1-6 alkyl group contains from 1 to 6 carbon atoms, a C _3-6 cycloalkyl group contains from 3 to 6 carbon atoms, a C _1-4 alkoxy group contains from 1 to 4 carbon atoms, and so on.

The term ‘halo’ or ‘halogen’ as used herein refers to a fluorine, chlorine, bromine or iodine atom.

The term ‘C _1-6 alkyl’ as used herein as a group or part of a group refers to a linear or branched saturated hydrocarbon group containing from 1 to 6 carbon atoms. Examples of C _1-6 alkyl groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl or hexyl and the like.

The term ‘C _1-6 alkoxy’ as used herein as a group or part of a group refers to an -O- (C _1-6 alkyl) group wherein the C _1-6 alkyl is as defined herein. Examples of C _1-6 alkoxy groups include methoxy, ethoxy, propoxy, butoxy, and the like.

The term ‘C _3-6 cycloalkyl’ as used herein refers to a saturated monocyclic hydrocarbon ring of 3 to 6 carbon atoms. Examples of C _3-6 cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.

The term ‘hydroxy (C _1-6 alkyl) ’ as used herein as a group or part of a group refers to a C _1-6 alkyl group as defined herein wherein one or more than one hydrogen atom is replaced with a hydroxyl group. The terms ‘hydroxy (C _1-6 alkyl) ’ therefore include monohydroxy (C _1-6 alkyl) and also polyhydroxy (C _1-6 alkyl) . There may be one, two, three or more hydrogen atoms replaced with a hydroxyl group, so the hydroxy (C _1-6 alkyl) may have one, two, three or more hydroxyl groups. Examples of such groups include hydroxymethyl, hydroxyethyl, hydroxypropyl and the like.

The term ‘amino (C _1-6 alkyl) ’ as used herein as a group or part of a group refers to a C _1-6 alkyl group as defined herein wherein one or more than one hydrogen atom is replaced with an amino group. The terms ‘amino (C _1-6 alkyl) ’ therefore include monoamino (C _1-6 alkyl) and also polyamino (C _1-6 alkyl) . There may be one, two, three or more hydrogen atoms replaced with an amino group, so the amino (C _1-6 alkyl) may have one, two, three or more amino groups. Examples of such groups include aminomethyl, aminoethyl, aminopropyl and the like.

The term ‘halo (C _1-6 alkyl) ’ as used herein as a group or part of a group refers to a C _1-6 alkyl group as defined herein wherein one or more than one hydrogen atom is replaced with a halogen. The term ‘halo (C _1-6 alkyl) ’ therefore include monohalo (C _1-6 alkyl) and also polyhalo (C _1-6 alkyl) . There may be one, two, three or more hydrogen atoms replaced with a halogen, so the halo (C _1-6 alkyl) may have one, two, three or more halogens. Examples of such groups include fluoroethyl, fluoromethyl, trifluoromethyl or trifluoroethyl and the like.

The term ‘heterocyclyl’ as used herein shall, unless the context indicates otherwise, include both aromatic and non-aromatic ring systems. Thus, for example, the term “heterocyclyl” includes within its scope aromatic, non-aromatic, unsaturated, partially saturated and fully saturated heterocyclyl ring systems. In general, unless the context indicates otherwise, such ring systems may be monocyclic or bicyclic or bridged and may contain, for example, 3 to 12 ring members, or 4 to 10 ring members, or more usually 5 to 10 ring members. Reference to 4 to 7 ring members include 4, 5, 6 or 7 atoms in the ring, reference to 3 to 6 ring members include 3, 4, 5, or 6 atoms in the ring and reference to 4 to 6 ring members include 4, 5, or 6 atoms in the ring. Examples of monocyclic heterocyclyl ring systems are ring systems containing 3, 4, 5, 6, 7 or 8 ring members, more usually 3 to 7, and preferably 4, 5, 6 or 7 ring members, more preferably 5 or 6 ring members. Examples of bicyclic heterocyclyl ring systems are those containing 8, 9, 10, 11 or 12 ring members, and more usually 9 or 10 ring members. The heterocyclyl ring systems contain at least one heteroatom typically selected from nitrogen, oxygen or sulphur, in particular contain up to 5, up to 4, up to 3, up to 2, or a single heteroatom. Where reference is made herein to a heterocyclyl ring system, the heterocyclyl ring can, unless the context indicates otherwise, be optionally substituted (i.e. unsubstituted or substituted) by one or more substituents as discussed herein.

The heterocyclyl ring systems can be heteroaryl ring systems having from 5 to 12 ring members, more usually from 5 to 10 ring members. The term “heteroaryl” is used herein to denote a heterocyclyl ring system having aromatic character. The term “heteroaryl” embraces polycyclic (e.g. bicyclic) ring systems wherein one or more rings are non-aromatic, provided that at least one ring is aromatic. In such polycyclic systems, the ring system may be attached to the remainder of the compound by an aromatic ring or by a non-aromatic ring.

Examples of heteroaryl groups are monocyclic and bicyclic groups containing from 5 to 12 ring members, and more usually from 5 to 10 ring members. The heteroaryl group can be, for example, a 5 membered or 6 membered monocyclic ring or a bicyclic structure formed from fused 5 and 6 membered rings or two fused 6 membered rings, or two fused 5 membered rings. The heteroaryl ring system may contain up to about 5 heteroatoms typically selected from nitrogen, oxygen and sulphur. Typically the heteroaryl ring will contain up to 4 heteroatoms, more typically up to 3 heteroatoms, more usually up to 2, for example a single heteroatom. In one embodiment, the heteroaryl ring contains at least one ring nitrogen atom. The nitrogen atoms in the heteroaryl rings can be basic, as in the case of an imidazole or pyridine, or essentially non-basic as in the case of an indole or pyrrole nitrogen. In general the number of basic nitrogen atoms present in the heteroaryl group, including any amino group substituents of the ring, will be less than five.

Examples of 5 membered heteroaryl groups include but are not limited to pyrrolyl, furanyl, thienyl, imidazolyl, oxazolyl, oxadiazolyl, oxatriazole, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, pyrazolyl, triazolyl and tetrazolyl groups. In particular, examples of five membered heteroaryl groups include but are not limited to pyrrolyl, furanyl, thienyl, imidazolyl, oxazolyl, oxadiazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, pyrazolyl and triazolyl groups.

Examples of 6 membered heteroaryl groups include but are not limited to pyridyl, pyrazinyl, pyridazinyl, pyrimidinyl and triazinyl.

A bicyclic heteroaryl group may be, for example, a group selected from:

a) a benzene ring fused to a 5-or 6-membered ring containing 1, 2 or 3 ring heteroatoms;

b) a pyridine ring fused to a 5-or 6-membered ring containing 0, 1, 2 or 3 ring heteroatoms;

c) a pyrimidine ring fused to a 5-or 6-membered ring containing 0, 1 or 2 ring heteroatoms;

d) a pyrrole ring fused to a 5-or 6-membered ring containing 0, 1, 2 or 3 ring heteroatoms;

e) a pyrazole ring fused to a 5-or 6-membered ring containing 0, 1 or 2 ring heteroatoms;

f) an imidazole ring fused to a 5-or 6-membered ring containing 0, 1 or 2 ring heteroatoms;

g) an oxazole ring fused to a 5-or 6-membered ring containing 0, 1 or 2 ring heteroatoms;

h) an isoxazole ring fused to a 5-or 6-membered ring containing 0, 1 or 2 ring heteroatoms;

i) a thiazole ring fused to a 5-or 6-membered ring containing 0, 1 or 2 ring heteroatoms;

j) an isothiazole ring fused to a 5-or 6-membered ring containing 0, 1 or 2 ring heteroatoms;

k) a thiophene ring fused to a 5-or 6-membered ring containing 0, 1, 2 or 3 ring heteroatoms;

l) a furan ring fused to a 5-or 6-membered ring containing 0, 1, 2 or 3 ring heteroatoms;

m) a cyclohexyl ring fused to a 5-or 6-membered aromatic ring containing 1, 2 or 3 ring heteroatoms; and

n) a cyclopentyl ring fused to a 5-or 6-membered aromatic ring containing 1, 2 or 3 ring heteroatoms.

Particular examples of bicyclic heteroaryl groups containing a 5 membered ring fused to another 5 membered ring include but are not limited to imidazothiazolyl (e.g. imidazo [2, 1-b] thiazole) and imidazoimidazolyl (e.g. imidazo [1, 2-a] imidazole) .

Particular examples of bicyclic heteroaryl groups containing a 6 membered ring fused to a 5 membered ring include but are not limited to benzofuranyl, benzothiophenyl, benzimidazolyl, benzoxazolyl, isobenzoxazolyl, benzisoxazolyl, benzthiazolyl, benzisothiazolyl, isobenzofuranyl, indolyl, isoindolyl, indolizinyl, indolinyl, isoindolinyl, purinyl, indazolyl, pyrazolopyrimidinyl (e.g. pyrazolo [1, 5-a] pyrimidine) , triazolopyrimidinyl (e.g. [1, 2, 4] triazolo [1, 5-a] pyrimidine) , benzodioxolyl, imidazopyrazinyl, imidazopyridazinyl, imidazopyridinyl and pyrazolopyridinyl (e.g. pyrazolo [1, 5-a] pyridine) groups.

Particular examples of bicyclic heteroaryl groups containing a 6 membered ring fused to a 5 membered ring include but are not limited to benzofuranyl, benzothiophenyl, benzimidazolyl, benzthiazolyl, indolyl, isoindolyl, indolizinyl, indolinyl groups.

Particular examples of bicyclic heteroaryl groups containing two fused 6 membered rings include but are not limited to quinolizinyl, quinolinyl, isoquinolinyl, cinnolinyl, chromanyl, isochromanyl, thiochromanyl, benzopyranyl, benzodioxanyl, benzoxazinyl, pyridopyridinyl, quinoxalinyl, quinazolinyl, phthalazinyl, naphthyridinyl and pteridinyl groups.

Examples of polycyclic heteroaryl groups containing an aromatic ring and a non-aromatic ring include, tetrahydroisoquinolinyl, tetrahydroquinolinyl, dihydrobenzothienyl, dihydrobenzofuranyl, 2, 3-dihydro-benzo [1, 4] dioxinyl, benzo [1, 3] dioxolyl, 4, 5, 6, 7-tetrahydrobenzofuranyl, tetrahydrotriazolopyrazinyl (e.g. 5, 6, 7, 8-tetrahydro- [1, 2, 4] triazolo [4, 3-a] pyrazinyl) , and indolinyl.

A nitrogen-containing heteroaryl ring must contain at least one ring nitrogen atom. Each ring may, in addition, contain up to about 4 other heteroatoms typically selected from nitrogen, sulphur and oxygen. Typically, the heteroaryl ring will contain up to 3 heteroatoms, for example 1, 2 or 3, more usually up to 2 nitrogens, for example a single nitrogen. The nitrogen atoms in the heteroaryl rings can be basic, as in the case of an imidazole or pyridine, or essentially non-basic as in the case of an indole or pyrrole nitrogen. In general, the number of basic nitrogen atoms present in the heteroaryl group, including any amino group substituents of the ring, will be less than 5.

Examples of nitrogen-containing heteroaryl groups include, but are not limited to, pyridyl, pyrrolyl, imidazolyl, oxazolyl, oxadiazolyl, thiadiazolyl, oxatriazolyl, isoxazolyl, thiazolyl, isothiazolyl, pyrazolyl, pyrazinyl, pyrimidinyl, pyridazinyl, triazinyl, triazolyl (e.g., 1, 2, 3-triazolyl, 1, 2, 4-triazolyl) , tetrazolyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzthiazolyl and benzisothiazole, indolyl, 3H-indolyl, isoindolyl, indolizinyl, isoindolinyl, purinyl, indazolyl, quinolizinyl, benzoxazinyl, pyrido-pyridinyl, quinoxalinyl, quinazolinyl, cinnolinyl, phthalazinyl, naphthyridinyl and pteridinyl.

Examples of nitrogen-containing polycyclic heteroaryl groups containing an aromatic ring and a non-aromatic ring include tetrahydroisoquinolinyl, tetrahydroquinolinyl, and indolinyl.

The term “non-aromatic group” embraces, unless the context indicates otherwise, unsaturated ring systems without aromatic character, partially saturated and fully saturated heterocyclyl ring systems. The terms “unsaturated” and “partially saturated” refer to rings wherein the ring structure (s) contains atoms sharing more than one valence bond i.e. the ring contains at least one multiple bond e.g. a C=C, C≡C or N=C bond. The term “fully saturated” refers to rings where there are no multiple bonds between ring atoms. Saturated heterocyclyl groups include piperidine, morpholine, thiomorpholine, piperazine. Partially saturated heterocyclyl groups include pyrazolines, for example 2-pyrazoline and 3-pyrazoline.

Examples of non-aromatic heterocyclyl groups are groups having from 3 to 12 ring members, more usually 5 to 10 ring members. Such groups can be monocyclic or bicyclic, for example, and typically have from 1 to 5 heteroatom ring members (more usually 1, 2, 3 or 4 heteroatom ring members) , usually selected from nitrogen, oxygen and sulphur. The heterocyclyl groups can contain, for example, cyclic ether moieties (e.g. as in tetrahydrofuran and dioxane) , cyclic thioether moieties (e.g. as in tetrahydrothiophene and dithiane) , cyclic amine moieties (e.g. as in pyrrolidine) , and combinations thereof (e.g. thiomorpholine) .

Particular examples include morpholinyl, thiomorpholinyl, piperidinyl (e.g. 1-piperidinyl, 2-piperidinyl, 3-piperidinyl and 4-piperidinyl) , pyrrolidinyl (e.g. 1-pyrrolidinyl, 2-pyrrolidinyl and 3-pyrrolidinyl) , azetidinyl, pyranyl (2H-pyranyl or 4H-pyranyl) , dihydrothiophenyl, dihydropyranyl, dihydrofuranyl, dihydrothiazolyl, tetrahydrofuranyl, tetrahydrothiophenyl, dioxanyl, dioxolanyl, tetrahydropyranyl, imidazolinyl, oxazolinyl, oxazolidinyl, oxetanyl, thiazolinyl, 2-pyrazolinyl, pyrazolidinyl and piperazinyl. In general, preferred non-aromatic heterocyclyl groups include saturated groups such as piperidinyl, pyrrolidinyl, azetidinyl, morpholinyl and piperazinyl.

In a nitrogen-containing non-aromatic heterocyclyl ring the ring must contain at least one ring nitrogen atom.

Particular examples of nitrogen-containing non-aromatic heterocyclyl groups include aziridinyl, morpholinyl, thiomorpholinyl, piperidinyl (e.g. 1-piperidinyl, 2-piperidinyl, 3-piperidinyl and 4-piperidinyl) , pyrrolidinyl (e.g. 1-pyrrolidinyl, 2-pyrrolidinyl and 3-pyrrolidinyl) , dihydrothiazolyl, imidazolinyl, oxazolinyl, thiazolinyl, 2-pyrazolinyl, 3-pyrazolinyl, pyrazolidinyl and piperazinyl.

Particular examples of 3 to 6 membered monocyclic saturated heterocyclyls include morpholinyl, thiomorpholinyl, dioxanyl, piperidinyl (e.g. 1-piperidinyl, 2-piperidinyl, 3-piperidinyl and 4-piperidinyl) , piperazinyl, pyrrolidinyl (e.g. 1-pyrrolidinyl, 2-pyrrolidinyl and 3-pyrrolidinyl) , imidazolidinyl, pyrazolidinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, isothiazolidinyl, dioxolanyl, dithiolanyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl (e.g. 4-tetrahydro pyranyl) , dithianyl, trioxanyl, trithianyl, aziridinyl, oxiranyl, thiiranyl, diaziridinyl, dioxarinyl, oxetanyl, azetidinyl, thietanyl, dioxetanyl ring systems.

Particular examples of 3 to 6 membered monocyclic heterocyclyls include morpholinyl, thiomorpholinyl, piperidinyl (e.g. 1-piperidinyl, 2-piperidinyl, 3-piperidinyl and 4-piperidinyl) , pyrrolidinyl (e.g. 1-pyrrolidinyl, 2-pyrrolidinyl and 3-pyrrolidinyl) , imidazolidinyl, pyrazolidinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, isothiazolidinyl, dioxolanyl, dithiolanyl, piperazinyl, tetrahydrofuranyl, tetrahydrothiophenyl, dioxanyl, tetrahydropyranyl (e.g. 4-tetrahydro pyranyl) , dithianyl, trioxanyl, trithianyl, aziridinyl, oxiranyl, thiiranyl, diaziridinyl, dioxarinyl, oxetanyl, azetidinyl, thietanyl, dioxetanyl, azirinyl, azetyl, 1, 2-dithietyl, pyrrolyl, furanyl, thiophenyl, imidazolyl, pyrazolyl, oxazolyl, thiazolyl, isothiazolyl, triazolyl, oxadiazolyl, thiadiazolyl, dithiazolyl, pyridinyl, pyranyl, thiopyranyl, pyrimidinyl, thiazinyl, oxazinyl, triazinyl ring systems.

Particular examples of 3 to 12 membered heterocycles include morpholinyl, thiomorpholinyl, piperidinyl (e.g. 1-piperidinyl, 2-piperidinyl, 3-piperidinyl and 4-piperidinyl) , pyrrolidinyl (e.g. 1-pyrrolidinyl, 2-pyrrolidinyl and 3-pyrrolidinyl) , imidazolidinyl, pyrazolidinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, isothiazolidinyl, dioxolanyl, dithiolanyl, piperazinyl, tetrahydrofuranyl, tetrahydrothiophenyl, dioxanyl, tetrahydropyranyl (e.g. 4-tetrahydropyranyl) , dithianyl, trioxanyl, trithianyl, aziridinyl, oxiranyl, thiiranyl, diaziridinyl, dioxarinyl, oxetanyl, azetidinyl, thietanyl, dioxetanyl, azirinyl, azetyl, 1, 2-dithietyl, pyrrolyl, furanyl, thiophenyl, imidazolyl, pyrazolyl, oxazolyl, thiazolyl, isothiazolyl, triazolyl, oxadiazolyl, thiadiazolyl, dithiazolyl, pyridinyl, pyranyl, thiopyranyl, pyrimidinyl, thiazinyl, oxazinyl, triazinyl, azepanyl, oxepanyl, thiepanyl, 1, 2-diazepanyl, 1, 4-diazepanyl, diazepinyl, thiazepinyl, azocanyl, azocinyl, imidazothiazolyl (e.g. imidazo [2, 1-b] thiazolyl) , imidazoimidazolyl (e.g. imidazo [1, 2-a] imidazolyl) , benzofuranyl, benzothiophenyl, benzimidazolyl, benzoxazolyl, isobenzoxazolyl, benzisoxazolyl, benzthiazolyl, benzisothiazolyl, isobenzofuranyl, indolyl, isoindolyl, indolizinyl, indolinyl, isoindolinyl, purinyl, indazolyl, pyrazolopyrimidinyl (e.g. pyrazolo [1, 5-a] pyrimidinyl) , triazolopyrimidinyl (e.g. [1, 2, 4] triazolo [1, 5-a] pyrimidinyl) , benzodioxolyl, imidazopyridinyl and pyrazolopyridinyl (e.g. pyrazolo [1, 5-a] pyridinyl) , quinolinyl, isoquinolinyl, chromanyl, thiochromanyl, isochromanyl, benzodioxanyl, quinolizinyl, benzoxazinyl, pyridopyridinyl, quinoxalinyl, quinazolinyl, cinnolinyl, phthalazinyl, naphthyridinyl, pteridinyl, tetrahydro- isoquinolinyl, tetrahydroquinolinyl, dihydrobenzthienyl, dihydrobenzfuranyl, 2, 3-dihydro-benzo [1, 4] dioxinyl, benzo [1, 3] dioxolyl, 4, 5, 6, 7-tetrahydrobenzofuranyl, tetrahydrotriazolo-pyrazinyl (e.g. 5, 6, 7, 8-tetrahydro- [1, 2, 4] triazolo [4, 3-a] pyrazinyl) , 8-oxa-3-azabicyclo- [3.2.1] octanyl, 2-oxa-5-azabicyclo [2.2.1] heptanyl, 3-oxa-8-azabicyclo [3.2.1] octanyl, 3, 6-diazabicyclo [3.1.1] heptanyl ring systems.

Particular examples of 5 to 6 membered aromatic heterocycles include but are not limited to pyrrolyl, furanyl, thiophenyl, imidazolyl, furazanyl, oxazolyl, oxadiazolyl, oxatriazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, pyrazolyl, triazolyl, tetrazolyl, pyridinyl, pyrazinyl, pyridazinyl, pyrimidinyl and triazinyl ring systems.

The heterocyclyl and carbocyclyl rings include bridged ring systems such as for example bridged cycloalkanes, such as for example norbornane (1, 4-endo-methylene-cyclohexane) , adamantane, oxa-adamantane; bridged morpholine rings such as for example 8-oxa-3-azabicyclo [3.2.1] octane, 2-oxa-5-azabicyclo [2.2.1] heptane, 3-oxa-8-azabicyclo [3.2.1] octane; bridged piperazine rings such as for example 3, 6-diazabicyclo [3.1.1] heptane; bridged piperidine rings such as for example 1, 4-ethylenepiperidine. For an explanation of the distinction between fused and bridged ring systems, see Advanced Organic Chemistry, by Jerry March, 4 ^th Edition, Wiley Interscience, pages 131-133, 1992.

The term “carbocyclyl” as used herein shall, unless the context indicates otherwise, include both aromatic and non-aromatic carbon ring systems. Thus, for example, the term “carbocyclyl” includes within its scope aromatic, non-aromatic, unsaturated, partially saturated and fully saturated carbocyclic ring systems. In general, unless the context indicates otherwise, such ring systems may be monocyclic or bicyclic or bridged and may contain, for example, 3 to 12 ring members, or 4 to 10 ring members, or more usually 5 to 10 ring members. Reference to 4 to 7 ring members include 4, 5, 6 or 7 atoms in the ring and reference to 4 to 6 ring members include 4, 5, or 6 atoms in the ring. Examples of monocyclic carbocyclyl ring systems are ring systems containing 3, 4, 5, 6, 7 and 8 ring members, more usually 3 to 7, and preferably 4, 5, 6 or 7 ring members, more preferably 5 or 6 ring members. Examples of bicyclic carbocyclyl ring systems are those containing 8, 9, 10, 11 and 12 ring members, and more usually 9 or 10 ring members. Where reference is made herein to a carbocyclyl ring system, the carbocyclyl ring can, unless the context indicates otherwise, be optionally substituted (i.e. unsubstituted or substituted) by one or more substituents as discussed herein.

The carbocyclyl ring systems can be aryl ring systems. The term ‘aryl’ as used herein refers to carbocyclyl aromatic groups and embraces polycyclic (e.g. bicyclic) ring systems wherein one or more rings are non-aromatic, provided that at least one ring is aromatic. In such polycyclic systems, the ring system may be attached to the remainder of the compound by an aromatic ring or by a non-aromatic ring. The term ‘aryl’ includes phenyl, naphthyl, indenyl, and tetrahydronaphthyl groups.

Particular examples of 3 to 12 membered carbocycles include cyclopropyl, cyclobutyl, cyclopentyl, cyclyhexyl, cycloheptyl, cyclooctyl, phenyl naphthyl, indenyl, tetrahydro-naphthyl, azulenyl, norbornane (1, 4-endo-methylene-cyclohexane) , adamantane ring systems.

Lines drawn into ring systems indicate that the bond may be attached to any of the suitable and available ring atoms.

In an embodiment wherein two or more heteroatoms are involved, these heteroatoms may be the same or part or all of the two or more heteroatoms may be different.

The term “optional” or “optionally” means the event described subsequent thereto may or may not happen. This term encompasses the cases that the event may or may not happen.

As used herein, the expression “one or more” refers to at least one, for example one, two, three, four, five or more, whenever possible and depending on the context.

The term ‘compound’ , as used herein, unless otherwise indicated, refers to any specific chemical compound disclosed herein and includes tautomers, regioisomers, geometric isomers, and where applicable, stereoisomers, including optical isomers (enantiomers) and other stereoisomers (diastereomers) thereof, as well as pharmaceutically acceptable salts and derivatives, including prodrug and/or deuterated forms thereof where applicable, in context. Deuterated small molecules contemplated are those in which one or more of the hydrogen atoms contained in the drug molecule have been replaced by deuterium.

The term ‘modulator’ refers to a molecule that decreases the level of a target protein through targeted protein degradation.

A dashed line across a bond indicates the position where a moiety is attached to another moiety. For example, the dashed line in the following formula PTM-I indicates the PTM moiety is attached to a linker at the specified position of the phenyl group.

For the avoidance of doubt, when o in (R ₁₆) _o represents 0 (zero) , this means that the R ₁₆ substituent is not present.

For the avoidance of doubt, it is to be understood that each general and specific preference, embodiment and example for one substituent may be combined if chemically possible with each general and specific preference, embodiment and example for one or more, preferably, all other substituents as defined herein and that all such embodiments are embraced by this application.

Exemplary VLMs

In certain embodiments of the compounds as described herein, VLM is represented by Formula VLM-I:

wherein

M of is 5-12 member aryl, 5-12 member heteroaryl containing at least one heteroatom selected from N, O or S, 5-12 member saturated carbocyclyl, 5-12 member saturated heterocyclyl containing at least one heteroatom selected from N, O or S, or

each R ₉ and R ₁₀ is independently H, C _1-6 alkyl, hydroxy (C _1-6 alkyl) , amino (C _1-6 alkyl) , or halo (C _1-6 alkyl) ,

R ₁₁ is 5-12 member heteroaryl containing at least one heteroatom selected from N, O or S, 5-12 member aryl, or

R ₁₂ is H or C _1-6 alkyl,

R ₁₃ is H, C _1-6 alkyl, or (C _1-6 alkyl) carbonyl,

each R ₁₄ is independently H, C _1-6 alkyl, hydroxy (C _1-6 alkyl) , amino (C _1-6 alkyl) , or halo (C _1-6 alkyl) ,

R ₁₅ is halogen, -CN, -C≡CH, 5-12 member heteroaryl, or 5-12 member aryl, wherein the 5-12 member heteroaryl, or 5-12 member aryl are each optionally substituted with 1, 2 or 3 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl and C _1-6 alkoxy,

each R ₁₆ is independently halogen, C _1-6 alkyl, C _1-6 alkoxy, hydroxy (C _1-6 alkyl) , amino (C _1-6 alkyl) or halo (C _1-6 alkyl) ,

R ₁₈ is H or F,

Z ₁, Z ₂, Z ₃, and Z ₄ are independently CH or N,

o is 0, 1, 2, 3, or 4.

In an embodiment, VLM is represented by Formula VLM-Ia:

wherein the variable groups have the same definition as above.

In an embodiment, VLM is represented by Formula VLM-Ib:

wherein

X is O or S,

Y is H or C _1-6 alkyl,

R ₁₇ is H or C _1-6 alkyl,

the other variable groups have the same definition as above.

In an embodiment, VLM is represented by Formula VLM-Ic:

wherein

Y is H or C _1-6 alkyl,

R ₁₇ is H or C _1-6 alkyl,

the other variable groups have the same definition as above.

In an embodiment, VLM is represented by Formula VLM-Id:

wherein:

Y is H, methyl, fluromethyl or ethyl,

R ₁₇ is H or C _1-6 alkyl,

the other variable groups have the same definition as above.

In an embodiment, M of is 5-12 member aryl, 5-12 member heteroaryl containing at least one heteroatom selected from N, O or S, or

In an embodiment, R ₉ is H or C _1-6 alkyl.

In an embodiment, R ₉ is H.

In an embodiment, R ₁₀ is H or C _1-6 alkyl.

In an embodiment, R ₁₀ is isopropyl, tert-butyl, sec-butyl.

In an embodiment, R ₁₁ is 5-12 member heteroaryl containing at least one heteroatom selected from N, O or S, or

In an embodiment, R ₁₁ is 5-12 member nitrogen-containing heteroaryl or

In an embodiment, R ₁₁ is isoxazole or

In an embodiment, R ₁₂ is H.

In an embodiment, R ₁₃ is H.

In an embodiment, R ₁₄ is H or C _1-6 alkyl.

In an embodiment, R ₁₅ is halogen, -CN, -C≡CH, 5-12 member heteroaryl containing at least one heteroatom selected from N, O or S, wherein the 5-12 member heteroaryl is optionally substituted with 1 or 2 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl and C _1-6 alkoxy.

In an embodiment, R ₁₅ is 5-12 member nitrogen-containing heteroaryl optionally substituted with 1 or 2 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl and C _1-6 alkoxy.

In an embodiment, R ₁₅ is selected from the group consisting of the following:

In an embodiment, o is 0, 1, or 2.

In an embodiment, X is S.

In an embodiment, Y is H or C _1-6 alkyl.

In an embodiment, Y is H, methyl or ethyl.

In an embodiment, R ₁₇ is C _1-6 alkyl.

In certain embodiments of the compounds as described herein, VLM is represented by Formula VLM-Ia:

wherein

M is 5-12 member aryl, 5-12 member heteroaryl containing at least one heteroatom selected from N, O or S, or

each R ₉ and R ₁₀ is independently H or C _1-6 alkyl,

R ₁₁ is 5-12 member heteroaryl containing at least one heteroatom selected from N, O or S, or

R ₁₂ is H or C _1-6 alkyl,

R ₁₃ is H or C _1-6 alkyl,

each R ₁₄ is independently H, C _1-6 alkyl or halo (C _1-6 alkyl) ,

R ₁₅ is halogen, -CN, -C≡CH, 5-12 member heteroaryl containing at least one heteroatom selected from N, O or S, wherein the 5-12 member heteroaryl is optionally substituted with 1 or 2 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl and C _1-6 alkoxy,

each R ₁₆ is independently halo or C _1-6 alkyl,

R ₁₈ is H or F,

Z ₂, Z ₃, and Z ₄ are independently CH or N,

o is 0, 1, or 2.

In certain embodiments of the compounds as described herein, VLM is represented by Formula VLM-Ib:

wherein:

X is O or S,

Y is H or C _1-6 alkyl,

R ₁₇ is H or C _1-6 alkyl,

R ₉ is H,

R ₁₀ is C _1-6 alkyl,

R ₁₁ is 5-12 member nitrogen-containing heteroaryl, or

R ₁₂ is H or C _1-6 alkyl,

R ₁₃ is H or C _1-6 alkyl.

In certain embodiments of the compounds as described herein, VLM is represented by Formula VLM-Ic:

wherein:

Y is H, methyl or ethyl,

R ₉ is H,

R ₁₀ is isopropyl, tert-butyl, or sec-butyl,

R ₁₁ is isoxazole or

R ₁₂ is H or C _1-6 alkyl,

R ₁₃ is H or C _1-6 alkyl,

R ₁₇ is H or C _1-6 alkyl.

In certain embodiments of the compounds as described herein, VLM is represented by Formula VLM-Id:

wherein:

Y is H, methyl, fluromethyl or ethyl,

R ₉ is H,

R ₁₀ is isopropyl, tert-butyl, or sec-butyl

R ₁₁ is isoxazole or

R ₁₂ is H or C _1-6 alkyl,

R ₁₃ is H or C _1-6 alkyl,

R ₁₇ is H or C _1-6 alkyl.

In certain embodiments of the compounds as described herein, VLM is attached to the linker (L) at a position selected from the group consisting of the following:

wherein the variable groups have the same definition as above.

In certain embodiments of the compounds as described herein, VLM is selected from the group consisting of the following:

Exemplary Linkers

In certain embodiments of the compounds as described herein, the linker (L) has a chemical structure represented by Formula L-Ia or Formula L-Ib:

-X- (Y ^L1) _n-Z-

L-Ia,

- (Y ^L1) _n-W ^L1- (Y ^L1) _n-Z-

L-Ib,

wherein

X and Z are independently C≡C, CH ₂, O, NH, C=O, or C=S,

W ^L1 is 5-12 membered aryl, 5-12 member saturated carbocyclyl, 5-12 membered saturated heterocyclyl containing at least one heteroatom selected from N, O or S, or 6-12 membered N containing saturated spiro bicycle, each of which is optionally substituted 1, 2 or 3 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl and C _1-6 alkoxy,

each Y ^L1 is independently a linear or branched C _1-6 alkylene wherein optionally one or more C atoms are replaced with O and/or C=O,

each n is independently 0, 1 or 2.

In an embodiment, X is C≡C, CH ₂, O, or NH.

In an embodiment, Z is C=O.

In an embodiment, W ^L1 is 5-12 membered aryl, 5-12 membered saturated carbocyclyl, 5-12 membered N containing saturated heterocyclyl, or 6-12 membered N containing saturated spiro bicycle, each of which is optionally substituted with 1, 2 or 3 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl and C _1-6 alkoxy.

In an embodiment, W ^L1 is selected from the group consisting of the following:

In an embodiment, each Y ^L1 is independently a linear or branched C _1-6 alkylene wherein optionally one or more C atoms are replaced with O and/or C=O,

In an embodiment, each Y ^L1 is a linear or branched C _1-3 alkylene wherein optionally 1 or 2 C atoms is replaced with O and/or C=O.

In an embodiment, each Y ^L1 is a linear or branched C _4-6 alkylene wherein optionally 1 or 2 C atoms are replaced with O and/or C=O.

In an embodiment, Y ^L1 is selected from the group consisting the following:

In certain embodiments of the compounds as described herein, the linker (L) is selected from the group consisting of the following:

Exemplary PTMs

In the present invention, PTM has a chemical structure represented by PTM-I:

In an embodiment, R ₁ is 5-12 member heteroaryl containing at least one heteroatom selected from N, O or S, or 5-10 member nitrogen-containing non-aromatic heterocyclyl, each of which is optionally substituted with 1, 2 or 3 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl, C _1-6 alkoxy and =O.

In an embodiment, R ₁ is 5-12 member nitrogen-containing heteroaryl, or 5-10 member nitrogen-containing non-aromatic heterocyclyl, each of which is optionally substituted with 1 substituent selected from -OH, -NH ₂, F, -CH ₃, -C ₂H ₅ and =O.

In an embodiment, R ₁ is selected from the group consisting of the following:

In an embodiment, R ₂ is H or halogen.

In an embodiment, R ₂ is H or F.

In an embodiment, R ₃ is H, halogen, C _1-6 alkyl, C _1-6 alkoxy, 5-10 member monocyclic saturated carbocyclyl, 5-10 member monocyclic saturated heterocyclyl, 5-10 member monocyclic saturated carbocyclyloxy, or 5-10 member monocyclic saturated heterocyclyloxy, wherein the C _1-6 alkyl, C _1-6 alkoxy, 5-10 member monocyclic saturated carbocyclyl, 5-10 member monocyclic saturated heterocyclyl, 5-10 member monocyclic saturated carbocyclyloxy, or 5-10 member monocyclic saturated heterocyclyloxy are each optionally substituted with 1 or 2 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl, C _1-6 alkoxy, C _3-6 cycloalkyl, hydroxy (C _1-6 alkyl) , amino (C _1-6 alkyl) optionally substituted with 1 or 2 independent C _1-6 alkyl groups on the amino group and -SO ₂- (C _1-6 alkyl) .

In an embodiment, R ₃ is C _1-6 alkyl, C _1-6 alkoxy, 5-10 member monocyclic saturated carbocyclyl, 5-10 member monocyclic saturated heterocyclyl, 5-10 member monocyclic saturated carbocyclyloxy, or 5-10 member monocyclic saturated heterocyclyloxy, each of which is optionally substituted with 1 or 2 substituents, each substituent independently selected from -OH, -NH ₂, F, methyl, ethyl, propyl, cyclopropyl, cyclobutyl, cyclopentyl, (CH ₃) ₂NCH ₂-and CH ₃SO ₂-.

In an embodiment, R ₃ is selected from the group consisting of the following:

In an embodiment, the PTM is attached to the linker (L) at the following position:

wherein the variable groups have the same definition as above.

wherein the variable groups have the same definition as above.

In certain embodiments of the compounds as described herein, PTM is selected from the group consisting of:

Exemplary compounds of the present invention

In certain embodiments of the compounds as described herein, the compounds have a chemical structure selected from the group consisting of the following:

wherein the variable groups have the same definition as above.

wherein the variable groups have the same definition as above.

It is to be understood that any specific embodiment or group as defined above for any of the substituents may be combined with a structure of any one of formulae (Ia) to (It) .

In certain embodiments of the compounds as described herein, the compounds are the Compounds 1-248 described in the experimental part of the present invention.

In an embodiment, the compound is selected from the group consisting of the following:

General Synthetic Approach

With PTMs and VLMs in hand, one skilled in the art can use known synthetic methods for their combination with a linker moiety. Linker moieties can be synthesized with a range of compositions, lengths and flexibility and functionalized such that the PTM and VLM groups can be attached sequentially to distal ends of the linker. Thus a library of molecules can be realized and profiled in in vitro and in vivo pharmacological and ADMET/PK studies.

In some instances, protecting group strategies and/or functional group interconversions (FGIs) may be required to facilitate the preparation of the desired materials. Such chemical processes are well known to the synthetic organic chemist and many of these may be found in texts such as "Greene's Protective Groups in Organic Synthesis" Peter G.M. Wuts and Theodora W. Greene (Wiley) , and "Organic Synthesis: The Disconnection Approach" Stuart Warren and Paul Wyatt (Wiley) .

The following General schemes A and B are for illustrative purpose.

General scheme A

A compound of formula I may be reacted with a reagent II (readily prepared using standard reaction techniques known to one skilled in the art) under amide formation conditions, e.g. HATU, diisopropylethylamine, DMF, room temperature. L represents a linker or a portion of the linker, and PG represents a suitable ester protecting group, e.g. methyl, ethyl, or t-butyl. Compounds of formula III may be converted to a compound of formula IV by treatment with a reagent suitable for the removal of PG, e.g. lithium hydroxide in THF, and water at 40 ℃ when PG is methyl or ethyl, and 4M hydrogen chloride in 1, 4-dioxane at room temperature when PG is t-butyl. A compound of formula IV may be reacted with an intermediate V (readily prepared using standard reaction techniques known to one skilled in the art) under amide-coupling conditions, e.g. as shown in Scheme 1, to produce a compound of formula VI.

General scheme B

A compound of formula I may be reacted with a reagent II (readily prepared using standard reaction techniques known to one skilled in the art) under amide formation conditions, e.g. HATU, diisopropylethylamine, DMF, room temperature. L represents a linker or a portion of the linker, and PG represents a suitable ester protecting group, e.g. methyl, ethyl, or t-butyl. Compounds of formula III may be converted to a compound of formula IV by treatment with a reagent suitable for the removal of PG, e.g. lithium hydroxide in THF, and water at 40 ℃ when PG is methyl or ethyl, and 4M hydrogen chloride in 1, 4-dioxane at room temperature when PG is t-butyl. A compound of formula IV may be reacted with an intermediate VII (readily prepared using standard reaction techniques known to one skilled in the art) under amide-coupling conditions to produce a compound of formula VIII. Compounds of formula VIII may be converted to a compound of formula IX by treatment with a reagent suitable for the removal of methyl, e.g. lithium hydroxide in THF, and water at 40 ℃. A compound of formula IX may then be reacted with a compound of formula X (commercially available or readily prepared using standard reaction techniques known to one skilled in the art) to produce compounds of formula VI under amide formation conditions, e.g. HATU, diisopropylethylamine, DMF, room temperature.

Pharmaceutically Acceptable Salts, Solvates or Derivatives thereof

In this section, as in all other sections of this application, unless the context indicates otherwise, references to formula (I) include references to all other sub-groups, preferences, embodiments and examples thereof as defined herein.

Unless otherwise specified, a reference to a particular compound also includes ionic forms, salts, solvates, isomers, tautomers, and isotopes, for example, preferably, the salts or isomers or solvates thereof. Compounds of formula (I) can exist in the form of salts, for example acid addition salts or, in certain cases salts of organic and inorganic bases such as carboxylate, sulphonate and phosphate salts. All such salts are within the scope of this invention, and references to compounds of formula (I) include the salt forms of the compounds.

The salt forms of the compounds of the invention are typically pharmaceutically acceptable salts, and examples of pharmaceutically acceptable salts are discussed in Berge et al. (1977) "Pharmaceutically Acceptable Salts, " J. Pharm. Sci., Vol. 66, pp. 1 19. However, salts that are not pharmaceutically acceptable may also be prepared as intermediate forms which may then be converted into pharmaceutically acceptable salts. Such non-pharmaceutically acceptable salts forms, which may be useful, for example, in the purification or separation of the compounds of the invention, also form part of the invention.

The salts of the present invention can be synthesized from the parent compound that contains a basic or acidic moiety by conventional chemical methods such as methods described in Pharmaceutical Salts: Properties, Selection, and Use, P. Heinrich Stahl (Editor) , Camille G. Wermuth (Editor) , ISBN: 3-90639-026-8, Hardcover, 388 pages, August 2002. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are used. The compounds of the invention may exist as mono-or di-salts depending upon the pKa of the acid from which the salt is formed.

Acid addition salts may be formed with a wide variety of acids, both inorganic and organic. Examples of acid addition salts include salts formed with an acid selected from the group consisting of acetic, 2, 2-dichloroacetic, adipic, alginic, ascorbic (e.g. L-ascorbic) , L-aspartic, benzenesulphonic, benzoic, 4-acetamidobenzoic, butanoic, (+) camphoric, camphor-sulphonic, (+) - (1S) -camphor-10-sulphonic, capric, caproic, caprylic, cinnamic, citric, cyclamic, dodecylsulphuric, ethane-1, 2-disulphonic, ethanesulphonic, 2-hydroxyethane-sulphonic, formic, fumaric, galactaric, gentisic, glucoheptonic, D-gluconic, glucuronic (e.g. D-glucuronic) , glutamic (e.g. L-glutamic) , α-oxoglutaric, glycolic, hippuric, hydrobromic, hydrochloric, hydriodic, isethionic, lactic (e.g. (+) -L-lactic, (±) -DL-lactic) , lactobionic, maleic, malic, (-) -L-malic, malonic, (±) -DL-mandelic, methanesulphonic, naphthalenesulphonic (e.g. naphthalene-2-sulphonic) , naphthalene-1, 5-disulphonic, 1-hydroxy-2-naphthoic, nicotinic, nitric, oleic, orotic, oxalic, palmitic, pamoic, phosphoric, propionic, L-pyroglutamic, pyruvic, salicylic, 4-amino-salicylic, sebacic, stearic, succinic, sulphuric, tannic, (+) -L-tartaric, thiocyanic, toluenesulphonic (e.g. p-toluenesulphonic) , undecylenic and valeric acids, as well as acylated amino acids and cation exchange resins.

One particular group of salts consists of salts formed from acetic, hydrochloric, hydriodic, phosphoric, nitric, sulphuric, citric, lactic, succinic, maleic, malic, isethionic, fumaric, benzenesulphonic, toluenesulphonic, methanesulphonic (mesylate) , ethanesulphonic, naphthalenesulphonic, valeric, acetic, propanoic, butanoic, malonic, glucuronic and lactobionic acids. Another group of acid addition salts includes salts formed from acetic, adipic, ascorbic, aspartic, citric, DL-Lactic, fumaric, gluconic, glucuronic, hippuric, hydro-chloric, glutamic, DL-malic, methanesulphonic, sebacic, stearic, succinic and tartaric acids.

If the compound is anionic, or has a functional group which may be anionic (e.g., -COOH may be -COO ^-) , then a salt may be formed with a suitable cation. Examples of suitable inorganic cations include, but are not limited to, alkali metal ions such as Na ⁺ and K ⁺, alkaline earth metal cations such as Ca ²⁺ and Mg ²⁺, and other cations such as Al ³⁺. Examples of suitable organic cations include, but are not limited to, ammonium ion (i.e., NH ₄ ⁺) and substituted ammonium ions (e.g., NH ₃R ⁺, NH ₂R ₂ ⁺, NHR ₃ ⁺, NR ₄ ⁺) .

Examples of some suitable substituted ammonium ions are those derived from: ethylamine, diethylamine, dicyclohexylamine, triethylamine, butylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, benzylamine, phenylbenzylamine, choline, meglumine, and tromethamine, as well as amino acids, such as lysine and arginine. An example of a common quaternary ammonium ion is N (CH ₃) ₄ ⁺.

Where the compounds of the formula (I) contain an amine function, these may form quaternary ammonium salts, for example by reaction with an alkylating agent according to methods well known to the skilled person. Such quaternary ammonium compounds are within the scope of formula (I) .

The compounds of the invention may form solvates, for example with water (i.e., hydrates) or common organic solvents. As used herein, the term “solvate” means a physical association of the compounds of the present invention with one or more solvent molecules, as well as pharmaceutically acceptable addition salts thereof. This physical association involves varying degrees of ionic and covalent bonding, including hydrogen bonding. In certain instances the solvate will be capable of isolation, for example when one or more solvent molecules are incorporated in the crystal lattice of the crystalline solid. The term “solvate” is intended to encompass both solution-phase and isolatable solvates. Non-limiting examples of suitable solvates include compounds of the invention in combination with water (hydrate) , isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid or ethanolamine and the like. The compounds of the invention may exert their biological effects whilst they are in solution.

Solvates can be important to the processes for the preparation of a substance (e.g. in relation to their purification, the storage of the substance (e.g. its stability) and the ease of handling of the substance and are often formed as part of the isolation or purification stages of a chemical synthesis. A person skilled in the art can determine by means of standard and long used techniques whether a hydrate or other solvate has formed by the isolation conditions or purification conditions used to prepare a given compound. Examples of such techniques include thermogravimetric analysis (TGA) , differential scanning calorimetry (DSC) , X-ray crystallography (e.g. single crystal X-ray crystallography or X-ray powder diffraction) and Solid State NMR (SS-NMR, also known as Magic Angle Spinning NMR or MAS-NMR) . Such techniques are as much a part of the standard analytical toolkit of the skilled chemist as NMR, IR, HPLC and MS. Alternatively the skilled person can deliberately form a solvate using crystallisation conditions that include an amount of the solvent required for the particular solvate. Thereafter the standard methods described above, can be used to establish whether solvates had formed.

Furthermore, the compounds of the present invention may have one or more polymorph (crystalline) or amorphous forms and these forms as such are intended to be included in the scope of the invention.

Compounds of formula (I) may exist in a number of different geometric isomeric, and tautomeric forms and references to compounds of the formula (I) include all such forms. For the avoidance of doubt, where a compound can exist in one of several geometric isomeric or tautomeric forms and only one is specifically described or shown, all others are nevertheless embraced by formula (I) . Examples of tautomeric forms include, for example, keto-, enol-, and enolate-forms, as in, for example, the following tautomeric pairs: keto/enol (illustrated below) , imine/enamine, amide/imino alcohol, amidine/enediamines, nitroso/oxime, thioketone/enethiol, and nitro/aci-nitro.

Such forms in so far as they may exist, are intended to be included within the scope of the present invention. It follows that a single compound may exist in both stereoisomeric and tautomeric form.

Where compounds of formula (I) contain one or more chiral centres, and can exist in the form of two or more optical isomers, references to compounds of formula (I) include all optical isomeric forms thereof (e.g. enantiomers, epimers and diastereoisomers) , either as individual optical isomers, or mixtures (e.g. racemic mixtures) of two or more optical isomers, unless the context requires otherwise. When a compound of formula (I) has more than one chiral centre, and one chiral centre is indicated as having an absolute stereoconfiguration, the other chiral centre (s) include all optical isomeric forms, either as individual optical isomers, or mixtures (e.g. racemic mixtures) of two or more optical isomers, thereof, unless the context requires otherwise. The optical isomers may be characterized and identified by their optical activity (i.e. as + and –isomers depending on the direction in which they rotate plane polarized light, or d and l isomers) or they may be characterized in terms of their absolute stereochemistry using the “R and S” nomenclature developed by Cahn, Ingold and Prelog, see Advanced Organic Chemistry by Jerry March, 4 ^th Edition, John Wiley &Sons, New York, 1992, pages 109-114, and see also Cahn, Ingold &Prelog (1966) Angew. Chem. Int. Ed. Engl., 5, 385-415. For instance, resolved enantiomers whose absolute configuration is not known can be designated by (+) or (-) depending on the direction in which they rotate plane polarized light.

Optical isomers can be separated by a number of techniques including chiral chromatography (chromatography on a chiral support) and such techniques are well known to the person skilled in the art. As an alternative to chiral chromatography, optical isomers can be separated by forming diastereoisomeric salts with chiral acids such as (+) -tartaric acid, (-) -pyroglutamic acid, (-) -di-toluoyl-L-tartaric acid, (+) -mandelic acid, (-) -malic acid, and (-) -camphorsulphonic, separating the diastereoisomers by preferential crystallisation, and then dissociating the salts to give the individual enantiomer of the free base.

Where compounds of formula (I) exist as two or more isomeric forms, one isomeric form, e.g. one enantiomer in a pair of enantiomers, may exhibit advantages over the other isomeric form, e.g. over the other enantiomer, for example, in terms of biological activity. Thus, in certain circumstances, it may be desirable to use as a therapeutic agent only one of a pair of enantiomers, or only one of a plurality of diastereoisomers.

When a specific stereoisomer is identified, this means that said stereoisomer is substantially free, i.e. associated with less than 50%, preferably less than 20%, more preferably less than 10%, even more preferably less than 5%, in particular less than 2%and most preferably less than 1%, of the other stereoisomers. Thus, when a compound of formula (I) is for instance specified as (S) , this means that the compound is substantially free of the (R) isomer; when a compound of formula (I) is for instance specified as E, this means that the compound is substantially free of the Z isomer; when a compound of formula (I) is for instance specified as cis, this means that the compound is substantially free of the trans isomer.

As used herein, any chemical formula with bonds shown only as solid lines and not as solid wedged or hashed wedged bonds, or otherwise not indicated as having a particular configuration (e.g. R, S) around one or more atoms, contemplates each possible stereoisomer, or mixture of two or more stereoisomers.

The terms “stereoisomers” , “stereoisomeric forms” or “stereochemically isomeric forms” hereinbefore or hereinafter are used interchangeably.

Enantiomers are stereoisomers that are non-superimposable mirror images of each other. A 1: 1 mixture of a pair of enantiomers is a racemate or racemic mixture.

Atropisomers (or atropoisomers) are stereoisomers which have a particular spatial configuration, resulting from a restricted rotation about a single bond, due to large steric hindrance. All atropisomeric forms of the compounds of formula (I) are intended to be included within the scope of the present invention.

Diastereomers (or diastereoisomers) are stereoisomers that are not enantiomers, i.e. they are not related as mirror images. If a compound contains a double bond, the substituents may be in the E or the Z configuration. Substituents on bivalent cyclic (partially) saturated radicals may have either the cis-or trans-configuration; for example if a compound contains a disubstituted cycloalkyl group, the substituents may be in the cis or trans configuration. Therefore, the invention includes enantiomers, atropisomers, diastereomers, racemates, E isomers, Z isomers, cis isomers, trans isomers and mixtures thereof, whenever chemically possible.

The meaning of all those terms, i.e. enantiomers, atropisomers, diastereomers, racemates, E isomers, Z isomers, cis isomers, trans isomers and mixtures thereof are known to the skilled person.

The compounds of the invention include compounds with one or more isotopic substitutions, and a reference to a particular element includes within its scope all isotopes of the element, either naturally occurring or synthetically produced, either with natural abundance or in an isotopically enriched form. For example, a reference to hydrogen includes within its scope ¹H, ²H (D) , and ³H (T) . Similarly, references to carbon and oxygen include within their scope respectively ¹²C, ¹³C and ¹⁴C and ¹⁶O and ¹⁸O. The isotopes may be radioactive or non-radioactive. In one embodiment of the invention, the compounds contain no radioactive isotopes. Such compounds are preferred for therapeutic use. In another embodiment, however, the compound may contain one or more radioisotopes. Compounds containing such radioisotopes may be useful in a diagnostic context. Radiolabeled compounds of formula (I) may comprise a radioactive isotope selected from the group of ²H, ³H, ¹¹C, ¹⁸F, ¹²²I, ¹²³I, ¹²⁵I, ¹³¹I, ⁷⁵Br, ⁷⁶Br, ⁷⁷Br and ⁸²Br. Preferably, the radioactive isotope is selected from the group of ²H, ³H, ¹¹C and ¹⁸F. More preferably, the radioactive isotope is ²H. In particular, deuterated compounds are intended to be included within the scope of the present invention.

Biological Activity and Therapeutic Uses

The compounds of the invention, and subgroups thereof, have IRAK1 protein degrading activity and will be useful in preventing or treating, in particular treating, disease or disorder mediated by IRAK1 described herein. References to the preventing or prophylaxis or treatment of a disease or disorder such as cancer include within their scope alleviating or reducing the incidence of cancer.

As used herein, the term “mediated” , as used e.g. in conjunction with a kinase as described herein (and applied for example to various physiological processes, diseases, states, conditions, therapies, treatments or interventions) is intended to operate limitatively so that the various processes, diseases, states, conditions, treatments and interventions to which the term is applied are those in which the kinase plays a biological role. In cases where the term is applied to a disease state or condition, the biological role played by a kinase may be direct or indirect and may be necessary and/or sufficient for the manifestation of the symptoms of the disease state or condition (or its aetiology or progression) . Thus, kinase activity (and in particular aberrant levels of kinase activity, e.g. kinase over-expression) need not necessarily be the proximal cause of the disease state or condition: rather, it is contemplated that the kinase mediated diseases, states or conditions include those having multifactorial aetiologies and complex progressions in which the kinase in question is only partially involved. In cases where the term is applied to treatment, prophylaxis or intervention, the role played by the kinase may be direct or indirect and may be necessary and/or sufficient for the operation of the treatment, prophylaxis or outcome of the intervention. Thus, a disease or disorder mediated by a kinase includes the development of resistance to any particular cancer drug or treatment.

In any aspect or embodiment described herein, the disease or disorder is a neurodegenerative disease or disorder, an inflammatory disease or disorder and/or a cancer mediated by IRAK1. In any aspect or embodiment described herein, the cancer is squamous-cell carcinoma, basal cell carcinoma, adenocarcinoma, hepatocellular carcinomas, and renal cell carcinomas, cancer of the bladder, bowel, breast, cervix, colon, esophagus, head, kidney, liver, lung, neck, ovary, pancreas, prostate, and stomach; leukemias; benign and malignant lymphomas, particularly Burkitt's lymphoma and Non-Hodgkin's lymphoma; benign and malignant melanomas; myeloproliferative diseases; sarcomas, including Ewing's sarcoma, hemangiosarcoma, Kaposi's sarcoma, liposarcoma, myosarcomas, peripheral neuroepithelioma, synovial sarcoma, gliomas, astrocytomas, oligodendrogliomas, ependymomas, gliobastomas, neuroblastomas, ganglioneuromas, gangliogliomas, medulloblastomas, pineal cell tumors, meningiomas, meningeal sarcomas, neurofibromas, and Schwannomas; bowel cancer, breast cancer, prostate cancer, cervical cancer, uterine cancer, lung cancer, ovarian cancer, testicular cancer, thyroid cancer, astrocytoma, esophageal cancer, pancreatic cancer, stomach cancer, liver cancer, colon cancer, melanoma; carcmosarcoma, Hodgkin's disease, Wilms' tumor and teratocarcinomas. Additional cancers which may be treated using compounds according to the present disclosure include, for example, T-lineage Acute lymphoblastic leukemia (T-ALL) , acute myeloid leukemia (AML) , chronic lymphocytic leukemia (CLL) , mixed lineage leukemias (MLLs) , T-lineage lymphoblastic lymphoma (T-LL) , peripheral T-cell lymphoma, adult T-cell leukemia, Pre-B ALL, Pre-B lymphomas, large B-cell lymphoma, activated B cell-like diffuse large B cell lymphoma (ABC-DLBCL) , Burkitts lymphoma, B-cell ALL,

macroglobulinemia (WM) , myelodysplastic syndromes (MDSs) , Philadelphia chromosome positive ALL and Philadelphia chromosome positive CML.

In any aspect or embodiment described herein, the cancer is selected from the group consisting of benign and malignant lymphomas, particularly Burkitt's lymphoma and Non-Hodgkin's lymphoma.

In any aspect or embodiment described herein, the cancer is selected from the group consisting of T-lineage Acute lymphoblastic leukemia (T-ALL) , acute myeloid leukemia (AML) , chronic lymphocytic leukemia (CLL) , mixed lineage leukemias (MLLs) , T-lineage lymphoblastic lymphoma (T-LL) , peripheral T-cell lymphoma, adult T-cell leukemia, Pre-B ALL, Pre-B lymphomas, large B-cell lymphoma, activated B cell-like diffuse large B cell lymphoma (ABC-DLBCL) , Burkitts lymphoma, B-cell ALL,

In any aspect or embodiment described herein, the inflammatory disease or disorder is selected from the group consisting of ocular allergy, conjunctivitis, keratoconjunctivitis sicca, vernal conjunctivitis, allergic rhinitis, autoimmune hematological disorders (e.g. hemolytic anemia, aplastic anemia, pure red cell anemia and idiopathic thrombocytopenia) , systemic lupus erythematosus, rheumatoid arthritis, polychondritis, scleroderma, Wegener granulamatosis, dermatomyositis, chronic active hepatitis, myasthenia gravis, Steven-Johnson syndrome, idiopathic sprue, autoimmune inflammatory bowel disease (e.g. ulcerative colitis and Crohn's disease) , irritable bowel syndrome, celiac disease, periodontitis, hyaline membrane disease, kidney disease, glomerular disease, alcoholic liver disease, multiple sclerosis, endocrine opthalmopathy, Grave's disease, sarcoidosis, alveolitis, chronic hypersensitivity pneumonitis, primary biliary cirrhosis, uveitis (anterior and posterior) , Sjogren's syndrome, interstitial lung fibrosis, psoriatic arthritis, systemic juvenile idiopathic arthritis, nephritis, vasculitis, diverticulitis, interstitial cystitis, glomerulonephritis (e.g. including idiopathic nephrotic syndrome or minimal change nephropathy) , chronic granulomatous disease, endometriosis, leptospirosis renal disease, glaucoma, retinal disease, headache, pain, complex regional pain syndrome, cardiac hypertrophy, muscle wasting, catabolic disorders, obesity, fetal growth retardation, hypercholesterolemia, heart disease, chronic heart failure, mesothelioma, anhidrotic ecodermal dysplasia, Behcet's disease, incontinentia pigmenti, Paget's disease, pancreatitis, hereditary periodic fever syndrome, asthma, acute lung injury, acute respiratory distress syndrome, eosinophilia, hypersensitivities, anaphylaxis, fibrositis, gastritis, gastroenteritis, nasal sinusitis, ocular allergy, silica induced diseases, chronic obstructive pulmonary disease (COPD) , cystic fibrosis, acid-induced lung injury, pulmonary hypertension, polyneuropathy, cataracts, muscle inflammation in conjunction with systemic sclerosis, inclusion body myositis, myasthenia gravis, thyroiditis, Addison's disease, lichen planus, appendicitis, atopic dermatitis, asthma, allergy, blepharitis, bronchiolitis, bronchitis, bursitis, cervicitis, cholangitis, cholecystitis, chronic graft rejection, colitis, conjunctivitis, cystitis, dacryoadenitis, dermatitis, juvenile rheumatoid arthritis, dermatomyositis, encephalitis, endocarditis, endometritis, enteritis, enterocolitis, epicondylitis, epididymitis, fasciitis, Henoch-Schonlein purpura, hepatitis, hidradenitis suppurativa, immunoglobulin A nephropathy, interstitial lung disease, laryngitis, mastitis, meningitis, myelitis myocarditis, myositis, nephritis, oophoritis, orchitis, osteitis, otitis, pancreatitis, parotitis, pericarditis, peritonitis, pharyngitis, pleuritis, phlebitis, pneumonitis, pneumonia, polymyositis, proctitis, prostatitis, pyelonephritis, rhinitis, salpingitis, sinusitis, stomatitis, synovitis, tendonitis, tonsillitis, ulcerative colitis, vasculitis, vulvitis, alopecia areata, erythema multiforma, dermatitis herpetiformis, scleroderma, vitiligo, hypersensitivity angiitis, urticaria, bullous pemphigoid, pemphigus vulgaris, pemphigus foliaceus, paraneoplastic pemphigus, epidermolysis bullosa acquisita, acute and chronic gout, chronic gouty arthritis, psoriasis, psoriatic arthritis, rheumatoid arthritis, Cryopyrin Associated Periodic Syndrome (CAPS) and osteoarthritis.

Pharmaceutical Compositions

In view of their useful pharmacological properties, the subject compounds may be formulated into various pharmaceutical forms for administration purposes.

In one embodiment the pharmaceutical composition (e.g. formulation) comprises at least one active compound of the invention together with a pharmaceutically acceptable carrier which may include adjuvants, excipients, diluents, fillers, buffers, stabilisers, preservatives, lubricants, or other materials well known to those skilled in the art and optionally other therapeutic or prophylactic agents.

To prepare the pharmaceutical compositions of this invention, an effective amount of a compound of the present invention, as the active ingredient is combined in intimate admixture with a pharmaceutically acceptable carrier, which carrier may take a wide variety of forms depending on the form of preparation desired for administration. The pharmaceutical compositions can be in any form suitable for oral, parenteral, topical, intranasal, ophthalmic, otic, rectal, intra-vaginal, or transdermal administration. These pharmaceutical compositions are desirably in unitary dosage form suitable, preferably, for administration orally, rectally, percutaneously, or by parenteral injection. For example, in preparing the compositions in oral dosage form, any of the usual pharmaceutical media may be employed, such as, for example, water, glycols, oils, alcohols and the like in the case of oral liquid preparations such as suspensions, syrups, elixirs and solutions; or solid carriers such as starches, sugars, kaolin, lubricants, binders, disintegrating agents and the like in the case of powders, pills, capsules and tablets.

Because of their ease in administration, tablets and capsules represent the most advantageous oral dosage unit form, in which case solid pharmaceutical carriers are obviously employed. For parenteral compositions, the carrier will usually comprise sterile water, at least in large part, though other ingredients, to aid solubility for example, may be included. Injectable solutions, for example, may be prepared in which the carrier comprises saline solution, glucose solution or a mixture of saline and glucose solution. Injectable suspensions may also be prepared in which case appropriate liquid carriers, suspending agents and the like may be employed. In the compositions suitable for percutaneous administration, the carrier optionally comprises a penetration enhancing agent and/or a suitable wetting agent, optionally combined with suitable additives of any nature in minor proportions, which additives do not cause a significant deleterious effect to the skin. Said additives may facilitate the administration to the skin and/or may be helpful for preparing the desired compositions. These compositions may be administered in various ways, e.g., as a transdermal patch, as a spot-on, as an ointment. It is especially advantageous to formulate the aforementioned pharmaceutical compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suitable as unitary dosages, each unit containing a predetermined quantity of active ingredient calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. Examples of such dosage unit forms are tablets (including scored or coated tablets) , capsules, pills, powder packets, wafers, injectable solutions or suspensions, teaspoonfuls, tablespoonfuls and the like, and segregated multiples thereof.

Those skilled in the art could determine the effective amount from the test results presented hereinafter. In general, it is contemplated that a therapeutically effective amount would be from 0.005 mg/kg to 100 mg/kg body weight, and in particular from 0.005 mg/kg to 10 mg/kg body weight. It may be appropriate to administer the required dose as single, two, three, four or more sub-doses at appropriate intervals throughout the day. Said sub-doses may be formulated as unit dosage forms, for example, containing 0.5 to 500 mg, in particular 1 mg to 500 mg, more in particular 10 mg to 500 mg of active ingredient per unit dosage form.

Depending on the mode of administration, the pharmaceutical composition will preferably comprise from 0.05 to 99 %by weight, more preferably from 0.1 to 70 %by weight, even more preferably from 0.1 to 50 %by weight of the compound of the present invention, and, from 1 to 99.95 %by weight, more preferably from 30 to 99.9 %by weight, even more preferably from 50 to 99.9 %by weight of a pharmaceutically acceptable carrier, all percentages being based on the total weight of the composition.

Experimental part

Several methods for preparing the compounds of the invention are illustrated in the following examples. Unless otherwise noted, all starting materials were obtained from commercial suppliers and used without further purification.

ABBREVIATIONS:

AcOH acetic acid

AcOK potassium acetate

AcONa sodium acetate

Boc tert-butyloxycarbonyl

(Boc) ₂O di-tert-butyl dicarbonate

BIAB (diacetoxyiodo) benzene

BINAP (±) -2, 2'-Bis (diphenylphosphino) -1, 1'-BINAPhthyl

CDCl ₃ chloroform-d

DBU 1, 8-Diazabicyclo [5, 4, 0] undec-7-ene

DCE 1, 2-dichloroethane

DCM dichloromethane

DIAD Diisopropyl azodicarboxylate

DIBAL-H diisobutylaluminium hydride

DIEA or DIPEA N, N-diisopropylethylamine

DHP 3, 4-dihydro-2H-pyran

DMA N, N-dimethylacetamide

DMAP 4-dimethylaminopyridine

DMF N, N-dimethylformamide

DMP Dess–Martin periodinane

DMSO dimethyl sulfoxide

EDCI 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide

eq equivalent (s)

EtOAc or EA ethyl acetate EtOH ethyl alcohol

FA formic acid

FCC flash column chromatography

HATU 1- [bis (dimethylamino) methylene] -1H-1, 2, 3-triazolo [4, 5-b] pyridinium 3-oxide hexafluorophosphate

HCl hydrochloric acid

HOBt hydroxybenzotriazole

HPLC high performance liquid chromatography

MsCl methanesulfonyl chloride

MeCN or ACN acetonitrile

MeOH methanol

M.W. microwave

NaHCO ₃ sodium bicarbonate

NMP 1-methylpyrrolidin-2-one

NMR nuclear magnetic resonance

OMs mesylate

OTs tosylate

(o-Tol) ₃P tri-o-tolylphosphine

Pd/C palladium on carbon

Pd (PPh ₃) ₄ tetrakis (triphenylphosphine) palladium (0)

PE petroleum ether

PPh ₃ triphenylphosphine

PhSO ₃H benzenesulfonic acid

PPTS pyridinium p-toluenesulfonate

Prep Preparative

R _f retention factor

TBAHS tetrabutylammonium hydrogen sulfate

TBAB Tetrabutylammonium bromide

TBS tert-butyldimethyl (phenoxy) silane

TEA triethylamine

TEMPO 2, 2, 6, 6-tetramethylpiperidinooxy

TFA trifluoroacetic acid

THF tetrahydrofuran

THP 2-phenoxytetrahydro-2H-pyran

TLC thin-layer chromatography

T ₃P 2, 4, 6-tripropyl-1, 3, 5, 2, 4, 6-trioxatriphosphinane 2, 4, 6-trioxide

TsCl 4-toluenesulfonyl chloride

When a stereocenter is indicated with ‘RS’ this means that a mixture of stereoisomers was obtained at the indicated center, unless otherwise indicated. The stereochemical configuration for a stereocenter in some compounds is designated “R” or “S” and/or with a solid wedged or hashed wedged bond indicating the absolute stereoconfiguration is known. For some compounds, the stereochemical configuration at an indicated stereocenter has been designated as “*R” or “*S” with a solid line bond, or a solid wedged or a hashed wedged bond indicating the absolute stereochemistry at the stereocenter is undetermined although it is absolute. So a stereocenter indicated as being *Smeans it is an absolute stereocenter but it is not determined whether it is S or R.

NMR-Methods

NMR experiments were carried out using a Bruker Avance III 400 spectrometer at ambient temperature (298.6 K) , using internal deuterium lock and equipped with 5 mm PABBO BB-probe head with z gradients and operating at 400 MHz for the proton and 100MHz for carbon. Chemical shifts (δ) are reported in parts per million (ppm) . J values are expressed in Hz.

LCMS (Liquid chromatography/Mass spectrometry) Methods

General procedure:

The High-Performance Liquid Chromatography (HPLC) measurement was performed using a LC pump, a diode-array (DAD) or a UV detector and a column as specified in the respective methods. Flow from the column was brought to the Mass Spectrometer (MS) which was configured with an atmospheric pressure ion source. It is within the knowledge of the skilled person to set the tune parameters (e.g. scanning range, dwell time…) to obtain ions allowing the identification of the compound’s nominal monoisotopic molecular weight (MW) . Data acquisition was performed with appropriate software.

Compounds are described by their experimental molecular ions. If not specified differently in the table of data, the reported molecular ion corresponds to the [M+H] ⁺ (protonated molecule) and/or [M-H] ^- (deprotonated molecule) . In case the compound was not directly ionizable the type of adduct is specified (i.e. [M+NH ₄] ⁺, [M+HCOO] ^-, etc ) . For molecules with multiple isotopic patterns (Br, Cl. . ) , the reported value is the one obtained for the lowest isotope mass. All results were obtained with experimental uncertainties that are commonly associated with the method used.

Analytical reverse phase LC-MS for Example compounds was carried out using a X-Bridge Shield RP18, 50 x 2.1 mm x 5 μm column with a flow rate of 0.8 mL/min., eluting with a gradient of 0%to 95%acetonitrile (solvent B) and water with 0.05%NH ₃ (aq) (solvent A) . The eluent composition was kept at 100%A for 1 minute, followed by increasing to 60%B over the course of 4 minutes. The eluent was increased to 95%B over the course of 2 minutes before returning to 100%A over the course of 2 minutes. Total run time was 9.5 minutes.

Synthesis of key intermediates:

Intermediate 1:

Step 1: Synthesis of tert-butyl 4- (3-methoxy-4-nitrophenyl) piperazine-1-carboxylate

A stir bar, 5-fluoro-2-nitroanisole (30.0 g, 175 mmol) , 1-boc-piperazine (35.9 g, 193 mmol) , N, N-diisopropylethylamine (68.0 g, 526 mmol) and n-BuOH (200 mL) was added to a 1 L round-bottom flask. Then the reaction was continued to reaction for 14 hours. Then the mixture was cooled down and EtOH (200 mL) was added to the mixture with yellow solid formed. The precipitation was filtered and washed with EtOH (50 mL x 3) to give the title compound as yellow solids (56.0 g, 90%purity, 94.7%yield) . ¹H NMR (400MHz, DMSO-d ₆) δ 7.94 -7.75 (m, 1H) , 6.61 -6.43 (m, 2H) , 3.94 -3.80 (m, 3H) , 3.37 -3.26 (m, 4H) , 1.37 (s, 4H) , 1.06 -1.00 (m, 9H) .

Step 2: Synthesis of tert-butyl 4- (4-amino-3-methoxyphenyl) piperazine-1-carboxylate

A stir bar, tert-butyl 4- (3-methoxy-4-nitrophenyl) piperazine-1-carboxylate (56.0 g, 166 mmol) , wet Pd/C (5.00 g, 10%on activated carbon) and MeOH (1 L) were added to a 2 L reaction flask. The suspension was degassed under vacuum and purged with H2 3 times. The mixture was stirred under H ₂ (30 psi) at 25℃ for 12 hours. The mixture was filtered through a pad of Celite and the filter cake was washed with MeOH (50 mL) . The filtrate was evaporated to dryness to give the title compound (55.0 g, 90%purity, 97.0%yield) as a purple solid. ¹H NMR (400 MHz, DMSO-d ₆) δ 6.57 -6.47 (m, 2H) , 6.35 -6.26 (m, 1H) , 4.51 -4.10 (m, 2H) , 3.74 (s, 3H) , 3.50 -3.39 (m, 4H) , 2.93 -2.81 (m, 4H) , 1.41 (s, 9H) .

Step 3: Synthesis of tert-butyl 4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperazine-1-carboxylate

A solution of tert-butyl 4- (4-amino-3-methoxyphenyl) piperazine-1-carboxylate (10.0 g, 32.5 mmol) , 6- (1H-pyrazol-5-yl) picolinic acid Intermediate 5 (6.15 g, 32.5 mmol) , HATU (14.8 g, 38.9 mmol) , TEA (13.6 mL, 97.6 mmol) in DMF (100 mL) was stirred at 25℃ for 8 hours. The reaction mixture was diluted with water (200 mL) , extracted with ethyl acetate (300 mL x 2) , washed with brine (200 mL x 3) and dried over Na ₂SO ₄. The organic layer was filtered and concentrated under reduced pressure to give crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate =1: 0 to 0: 1) to give the title compound as a grey solid (11.0 g, 90%purity, 70.7%yield) .

Step 4: Synthesis of N- (2-methoxy-4- (piperazin-1-yl) phenyl) -6- (1H-pyrazol-5-yl) picolinamide hydrochloride

A stir bar, tert-butyl 4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperazine-1-carboxylate (8.50 g, 17.8 mmol) , and HCl/EA (80 mL, 4 M) were added to a 250 mL round bottom flask. The reaction mixture was stirred at room temperature for 2 h. The mixture was concentrated under reduce pressure to give the product as a white solid (7.00 g, 98.9%purity, 93.9%yield) . ¹H NMR (400 MHz, DMSO-d ₆) δ 10.58 (s, 1H) , 9.68 -9.31 (m, 2H) , 8.20 -8.00 (m, 4H) , 7.91 -7.85 (m, 1H) , 7.00 (s, 1H) , 6.87 -6.80 (m, 1H) , 6.69 -6.63 (m, 1H) , 3.96 (s, 3H) , 3.53 -3.39 (m, 4H) , 3.32 -3.12 (m, 4H) ; LCMS (ESI ⁺) : m/z 379.2 [M+H] ⁺.

Intermediate 2:

Step 1: Synthesis of tert-butyl 4- (4-methylthiazol-5-yl) benzylcarbamate

A stir bar, tert-butyl 4-bromobenzylcarbamate (15.0 g, 52.4 mmol) , 4-methylthiazole (10.4 g, 105 mmol) , palladium diacetate (1.18 g, 5.24 mmol) , potassium acetate (12.9 g, 131 mmol) and DMF (200 mL) were added to a 500 mL round-bottomed flask. The reaction mixture was sparged with N ₂ for 1 minute and stirred at 140 ℃ for 5 hours. The reaction mixture was filtered, diluted with water (200 mL) , extracted with ethyl acetate (200 mLx2) , washed with brine and dried over Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude mixture product, which was purified by FCC (eluent: petroleum ether : ethyl acetate=1: 0 to 3: 1) to afford the title compound as a yellow solid (12.5 g, 90.0%purity, 70.5%yield) . ¹H NMR (400 MHz, DMSO-d ₆) δ 8.99 (s, 1H) , 7.49 -7.42 (m, 3H) , 7.33 (d, J = 8.0Hz, 2H) , 4.17 (d, J = 6.4 Hz, 2H) , 2.45 (s, 3H) , 1.40 (s, 9H) .

Step 2: Synthesis of (4- (4-methylthiazol-5-yl) phenyl) methanamine hydrochloride

A stir bar, tert-butyl 4- (4-methylthiazol-5-yl) benzylcarbamate (12.5 g, 41.1 mmol) , HCl in EA (60 mL) and MeOH (100 mL) were added to a 250 mL round-bottomed flask. The reaction mixture was stirred at 25℃ for 2 hours. The reaction mixture was concentrated under vacuum to give the desired compound as a light yellow solid (7.5 g, 90.0%purity, 68.3%yield) . ¹H NMR (400 MHz, DMSO-d ₆) δ 9.16 -9.12 (m, 1H) , 8.63 (br s, 3H) , 7.65 -7.58 (m, 2H) , 7.56 -7.50 (m, 2H) , 4.04 (q, J = 5.6 Hz, 2H) , 2.45 (s, 3H) .

Step 3: Synthesis of (2S, 4R) -tert-butyl 4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidine-1-carboxylate

A stir bar, (2S, 4R) -1- (tert-butoxycarbonyl) -4-hydroxypyrrolidine-2-carboxylic acid (7.20 g, 31.1 mmol) , HATU (14.2 g, 37.3 mmol) , DIPEA (12.1 g, 93.6 mmol) and DMF (150 mL) were added to a 250 mL round-bottomed flask at room-temperature. (4- (4-methylthiazol-5-yl) phenyl) methanamine hydrochloride (7.5 g, 31.2 mmol) was added to the reaction mixture at room-temperature. The mixture was stirred at 25 ℃ for 16 hours. The mixture was concentrated to dryness under reduced pressure to afford the crude product which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 0: 1) to afford compound as a colorless oil (12.0 g, crude) .

Step 4: Synthesis of (2S, 4R) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride

A stir bar, tert-butyl 4- (4-methylthiazol-5-yl) benzylcarbamate (12.0 g, 28.7 mmol) , HCl in EA (60 mL, 4 mol/L) and MeOH (100 mL) were added to a 250 mL round-bottomed flask. The reaction mixture was stirred at 25℃ for 1 hour. The reaction mixture was concentrated under vacuum to give the desired compound as a light yellow solid (8.0 g, crude) .

Step 5: Synthesis of tert-butyl ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) carbamate

A stir bar, (S) -2- ( (tert-butoxycarbonyl) amino) -3, 3-dimethylbutanoic acid (4.75 g, 20.5 mmol) , HATU (9.38 g, 24.7 mmol) , DIPEA (7.97 g, 61.7 mmol) and DMF (60 mL) were added to a 100 mL round-bottomed flask at room temperature. (2S, 4R) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride (8.0 g, 22.6 mmol) was added to the reaction mixture at room temperature. The mixture was stirred at 25 ℃ for 16 hours. The crude product was concentrated to dryness under reduced pressure to afford the crude product which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 0: 1) to afford desired compound as a brown oil (6.0 g, crude) .

Step 6: Synthesis of (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride

A stir bar, tert-butyl ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) carbamate (1 g, 1.884 mmol) , HCl/1, 4-dioxane (4M, 8 mL) were added into a 50 mL round-bottomed flask. The mixture was stirred at 25 ℃ for 30 minutes. The reaction mixture was concentrated to dryness under reduced pressure to afford the Intermediate 2 as a pale white solid (880 mg, crude) .

Intermediate 3:

Step 1: Synthesis of (S) -tert-butyl (1- (4-bromophenyl) ethyl) carbamate

A stir bar, (S) -1- (4-bromophenyl) ethanamine (50.0 g, 250 mmol) and DCM (500 mL) were added to a 1 L round-bottomed flask. TEA (70.0 mL, 504 mmol) was added and the mixture was stirred at 0 ℃ for 30 minutes. Then di-tert-butyl dicarbonate (68.0 mL, 296 mmol) was added and the mixture was stirred at 0 ℃ for 15 minutes. The solution was allowed to warm to room temperature and stirred for 16 hours. The mixture was concentrated to dryness under reduced pressure to give the crude product. The crude product was triturated with H ₂O (500 mL) and filtered, the filter cake was dried to give the product as a white solid (75 g, crude) . ¹H NMR (400 MHz, DMSO-d ₆) δ 7.46 (d, J = 8.4 Hz, 2H) , 7.43 -7.37 (m, 1H) , 7.21 (d, J = 8.4 Hz, 2H) , 4.54 (t, J = 7.4 Hz, 1H) , 1.32 (s, 9H) , 1.23 (d, J = 7.2 Hz, 3H) .

Step 2: Synthesis of (S) -tert-butyl (1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamate

(S) -tert-butyl (1- (4-bromophenyl) ethyl) carbamate (20.0 g, 67 mmol) was stirred in 150 mL DMF. 4-methylthiazole (13.2 g, 133 mmol) and potassium acetate (13.1 g, 133 mmol) was added and the mixture was stirred at 20 ℃ for 5 minutes. Pd (OAc) ₂ (1.5 g, 6.7 mmol) was added and the mixture was stirred at 20 ℃ for 5 minutes. The solution was stirred at 90 ℃ under nitrogen for 16 hours. The mixture was concentrated to dryness under reduced pressure to afford the compound. The residue was partitioned between water (100 mL) and ethyl acetate (150 mL x 3) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered, and concentrated to dryness under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 1: 1) to give the crude product. The crude product was triturated with petroleum ether: ethyl acetate (10: 1 100 mL, V/V= 10: 1) and filtered, the filter cake was dried to give the desired product as a yellow solid (16 g, crude) . ¹H NMR (400 MHz, DMSO-d ₆) δ 8.95 (s, 1H) , 7.46 -7.32 (m, 5H) , 4.79 -4.50 (m, 1H) , 2.42 (s, 3H) , 1.34 (s, 9H) , 1.29 (d, J = 7.2 Hz, 3H) .

Step 3: Synthesis of (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethanamine hydrochloride

A stir bar, (S) -tert-butyl (1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamate (16 g, 50 mmol) , HCl/1, 4-dioxane (126 mL, 504 mmol) and DCM (150 mL) were added to a 1 L round-bottomed flask. The reaction mixture was stirred at room temperature for 16 hours. The reaction mixture was concentrated under reduced pressure to give the product as a yellow solid (17 g, crude) . ¹H NMR (400 MHz, DMSO-d ₆) δ 9.17 (s, 1H) , 8.73 (br. s, 3H) , 7.64 (d, J = 8.2 Hz, 2H) , 7.53 (d, J = 8.4 Hz, 2H) , 4.47 -4.33 (m, 1H) , 2.45 (s, 3H) , 1.52 (d, J = 6.8 Hz, 3H) .

Step 4: Synthesis of tert-butyl ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) carbamate

A stir bar, (2S, 4R) -1- ( (S) -2- ( (tert-butoxycarbonyl) amino) -3, 3-dimethylbutanoyl) -4-hydroxypyrrolidine-2-carboxylic acid Intermediate 21 (31 g, 90 mmol) , (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethanamine hydrochloride (23 g, 90 mmol) , T ₃P (86.0 g, 135 mmol) , TEA (70.5 mL, 506 mmol) and dichloromethane (300 mL) were added to a 1000 mL round-bottomed flask. The reaction mixture was stirred at room temperature for 16 hours. The mixture was poured into water (200 mL) and extracted with dichloromethane (200 mL x 2) . The combined organic extracts were washed with brine (200 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product. The crude product was triturated with ethyl acetate (100 mL) and filtered, the filter cake was dried to give the product as a yellow solid (17 g, 96%purity, 33%yield) . ¹H NMR (400 MHz, DMSO-d ₆) δ 8.95 (s, 1H) , 8.40 (d, J = 7.6 Hz, 1H) , 7.44 -7.38 (m, 2H) , 7.37 -7.27 (m, 2H) , 6.41 (d, J = 9.4 Hz, 1H) , 4.95 -4.79 (m, 1H) , 4.42 (t, J = 8.0 Hz, 1H) , 4.25 (br s, 1H) , 4.15 -4.07 (m, 1H) , 3.08 -2.87 (m, 2H) , 2.44 -2.39 (m, 3H) , 2.08 -1.96 (m, 1H) , 1.82 -1.67 (m, 1H) , 1.35 (s, 9H) , 1.19 -1.05 (m, 3H) , 0.90 (s, 9H) ; LCMS (ESI+) : m/z 545.4 [M+H] ⁺.

Step 5: Synthesis of (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) pyrrolidine-2-carboxamide hydrochloride

A stir bar, tert-butyl ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) carbamate (17 g, 31 mmol) , HCl/1, 4-dioxane (200 mL, 800 mmol) and DCM (200 mL) were added to a 1 L round-bottomed flask. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated under reduced pressure to give the Intermediate 3 as a yellow solid (16 g, crude) . ¹H NMR (400MHz, DMSO-d ₆) δ 9.07 (s, 1H) , 8.58 (d, J = 7.6 Hz, 1H) , 8.09 (br s, 3H) , 7.45 -7.38 (m, 2H) , 7.37 -7.31 (m, 2H) , 4.92 -4.82 (m, 1H) , 4.50 (t, J = 8.4 Hz, 1H) , 4.27 (s, 1H) , 3.48 -3.41 (m, 1H) , , 3.10 -2.89 (m, 2H) , 2.42 (s, 3H) , 2.13 -2.02 (m, 1H) , 1.78 -1.63 (m, 1H) , 1.34 (d, J = 6.8 Hz, 3H) , 1.04 -0.94 (m, 9H) .

Intermediate 4:

Step 1: Synthesis of ethyl 6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinate

A stir bar, ethyl 6-bromopicolinate (10.0 g, 43.5 mmol) , 1-methyl-5- (4, 4, 5, 5-tetramethyl-1, 3, 2-dioxaborolan-2-yl) -1H-pyrazole (13.3 g, 47.8 mmol) and cesium carbonate (42.5 g, 130 mmol) in 1, 4-dioxane (160 mL) and H ₂O (40 mL) were added to a 500 mL round-bottomed flask. The mixture was sparged with nitrogen for three times and then treated with Pd (dppf) Cl ₂ (2.41 g, 4.35 mmol) . Then mixture was sparged with nitrogen for three times and heated at 90 ℃ for 16 hours. The reaction mixture was filtered and diluted with ethyl acetate (50 mL) . The aqueous was acidified to pH = 5-6 by citric acid and extracted with DCM (80 x 5 mL) , washed with brine and dried over Na ₂SO ₄. The organic layer was filtered and concentrated under reduced pressure to give the product as a gray solid (4.0 g, crude) .

Step 2: Synthesis of 6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinic acid

A stir bar, ethyl 6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinate (4.00 g, 13.3 mmol) , NaOH (1.06 g, 26.5 mmol) H ₂O (10 mL) and MeOH (10 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 1 hour. The reaction mixture was concentrated and the residue was dissolved in 20 mL of water and EtOAc (40 mL) was added. The aqueous phase was added citric acid to adjust the pH to 6-7, and extracted with DCM (80 x 5 mL) . The combined dichloromethane extracts were dried over Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the desired product Intermediate 4 as a brown sticky solid (2.0 g, crude) .

Intermediate 5:

Step 1: Synthesis of 6- (1H-pyrazol-5-yl) picolinic acid hydrochloride

A stir bar, 6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinic acid (50.0 g, 183 mmol) , DCM (50 mL) and HCl/dioxane (200 mL, 4M) were added to a 500 mL round-bottomed flask. The reaction mixture was stirred at 25 ℃ for 1 h. TLC (petroleum ether: ethyl acetate = 1: 1, Rf = 0.0) showed A was consumed completely and a new spot was formed. The mixture was filtered, the filter cake was dried to give the pure product as a white solid (41.0 g, 99.0%purity, 98.3%yield) . ¹H NMR (400 MHz, DMSO-d ₆) 8.16 (dd, J = 1.2, 8.0 Hz, 1H) , 8.04 (t, J = 7.6 Hz, 1H) , 8.00 -7.92 (m, 1H) , 7.81 (d, J = 2.4 Hz, 1H) , 7.01 (d, J = 2.4 Hz, 1H) ; LCMS (ESI ⁺) : m/z 190.1 [M+H] ⁺.

Intermediate 6:

Step 1: Synthesis of N- (4-hydroxy-2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide

A stir bar, 6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinic acid Intermediate 4 (1.20 g, 4.39 mmol) , 4-amino-3-methoxyphenol (611 mg, 4.39 mmol) , HATU (2.00 g, 5.26 mmol) , N-ethyl-N-isopropylpropan-2-amine (2.84 g, 22.0 mmol) and DMF (120 mL) were added to a 250 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 1 hour. The mixture was then poured into water (50 mL) and extracted with ethyl acetate (50 mL x 2) . The organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 1: 1) to afford the compound Intermediate 6 as a gray solid (950 mg, 90.0%purity, 49.4%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 10.08 (s, 1H) , 9.47 (s, 1H) , 8.22 -8.14 (m, 3H) , 7.96 (dd, J = 1.6, 7.2 Hz, 1H) , 7.67 (d, J = 1.8 Hz, 1H) , 6.89 (d, J = 2.0 Hz, 1H) , 6.56 (d, J = 2.5 Hz, 1H) , 6.42 (dd, J = 2.5, 8.8 Hz, 1H) , 6.14 (dd, J = 2.1, 9.7 Hz, 1H) , 3.84 (s, 3H) , 3.44 -3.38 (m, 1H) , 3.17 (d, J = 5.0 Hz, 2H) , 2.48 -2.35 (m, 1H) , 2.10 -1.97 (m, 2H) , 1.57 -1.44 (m, 2H) .

Intermediate 7:

Step 1: Synthesis of methyl 7- (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenoxy) heptanoate

A stir bar, methyl 7- (tosyloxy) heptanoate (1.00 g, 3.18 mmol) , N- (4-hydroxy-2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide Intermediate 6 (800 mg, 2.03 mmol) , potassium carbonate (659 mg, 4.77 mmol) and DMF (10 mL) were added to a 100 mL round-bottomed flask. The reaction mixture was stirred at 80 ℃ for 12 hours. The mixture was then poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 0: 1) to afford the title compound as a gray solid (900 mg, crude) .

Step 2: Synthesis of 7- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxy-phenoxy) heptanoic acid

A stir bar, methyl 7- (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-3-yl) picolinamido) phenoxy) heptanoate (900 mg, 1.68 mmol) , NaOH (1 M aqueous) (10.0 mL, 10.0 mmol) and THF (10 mL) were added to a 100 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 1 hour. The reaction mixture was concentrated and adjusted pH to 6-7 with HCl (1 M aqueous) with pale yellow precipitation formed. The precipitate was filtrated, and dried to give the product Intermediate 7 as a gray solid (700 mg, crude) .

Intermediate 8:

Step 1: Synthesis of 2- (3-methoxy-4-nitrophenyl) -4, 4, 5, 5-tetramethyl-1, 3, 2-dioxaborolane

4-bromo-2-methoxy-1-nitrobenzene (500 mg, 2.16 mmol) , 4, 4, 4', 4', 5, 5, 5', 5'-octamethyl-2, 2'-bi (1, 3, 2-dioxaborolane) (657 mg, 2.59 mmol) and AcOK (423 mg, 4.31 mmol) were added in dioxane. The mixture was degassed by N ₂ for 3 times and then Pd (dppf) Cl ₂·CH ₂Cl ₂ (176 mg, 0.22 mmol) was added in the mixture and stirred at 90℃ for 16 hours. The solvent was removed under reduced pressure to give the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate =1: 0 to 10: 1) to give desired product as a yellow solid (450 mg, 90.0%purity, 74.8%yield) . ¹H NMR (400 MHz, CDCl ₃) : δ 7.77 (s, 1H) , 7.39-7.55 (m, 2H) , 3.91-4.07 (m, 3H) , 1.36 (s, 12H) .

Step 2: Synthesis of tert-butyl 4- (3'-methoxy-4'-nitro- [1, 1'-biphenyl] -3-yl) piperazine-1-carboxylate

A stir tert-butyl 4- (3-bromophenyl) piperazine-1-carboxylate (489 mg, 1.43 mmol) , 2- (3-methoxy-4-nitrophenyl) -4, 4, 5, 5-tetramethyl-1, 3, 2-dioxaborolane (400 mg , 1.43 mmol) , K ₂CO ₃ (594 mg, 4.30 mmol) and dioxane/H ₂O (12 mL) were added into a round-bottomed flask before the mixture was degassed by N ₂ for 3 times and then PdCl ₂ (dppf) (105 mg, 0.14 mmol) was added into the mixture which was stirred at 90℃ overnight. And the mixture was poured into water and was extracted by ethyl acetate (50 mLx3) . The combined organic extract were washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to give crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate =1: 0 to 9: 2) to give desired product as black oil (500 mg, 90.0%purity 84.4%yield) . ¹H NMR (400 MHz, CDCl ₃) : δ 7.96 (d, J = 8.4 Hz, 1H) , 7.39 (t, J = 8.2 Hz, 1H) , 7.18-7.23 (m, 2H) , 7.07-7.11 (m, 2H) , 7.00 (d, J = 8.2, 1.6 Hz, 1H) , 3.98-4.11 (m, 3H) , 3.51-3.70 (m, 4H) , 3.05-3.32 (m, 4H) , 1.49 (s, 9H) .

Step 3: Synthesis of tert-butyl 4- (4'-amino-3'-methoxy- [1, 1'-biphenyl] -3-yl) piperazine-1-carboxylate

tert-butyl 4- (3'-methoxy-4'-nitro- [1, 1'-biphenyl] -3-yl) piperazine-1-carboxylate (400 mg, 0.97 mmol) and Pd/C (103 mg, 0.10 mmol) were added in MeOH (10 mL) . The mixture was stirred 30℃ for 16 hours under H ₂ flow. The mixture was then filtered through a pad of

and the filtrate was concentrated under reduced pressure to obtain the product as a brown oil (350 mg, 90%purity, 94.3%yield) . ¹H NMR (400 MHz, CDCl ₃) : δ 7.31 (t, J = 7.8 Hz, 1H) , 7.10 -6.99 (m, 4H) , 6.89 -6.84 (m, 1H) , 6.77 (d, J = 7.6 Hz, 1H) , 3.92 (s, 3H) , 3.64 -3.56 (m, 4H) , 3.22 -3.15 (m, 4H) , 1.49 (s, 9H) .

Step 4: Synthesis of tert-butyl 4- (3'-methoxy-4'- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) - [1, 1'-biphenyl] -3-yl) piperazine-1-carboxylate

6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinic acid Intermediate 4 (249 mg, 0.91 mmol) , HATU (416 mg, 1.10 mmol) , DIEA (597 mg, 4.62 mmol) were added in DMF (5 mL) then the mixture was stirred at 25 ℃ for 1 min, tert-butyl 4- (4'-amino-3'-methoxy- [1, 1'-biphenyl] -3-yl) piperazine-1-carboxylate (350.00 mg, 0.91 mmol) was added. The mixture was stirred at 25℃ for 16 hours, poured into water and was extracted by ethyl acetate (50 mLx3) . The combined organic extracts were washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to give the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate =1: 0 to 1: 2) to give desired product as yellow oil (400 mg, crude) .

Step 5: Synthesis of

N- (3-methoxy-3'- (piperazin-1-yl) - [1, 1'-biphenyl] -4-yl) -6- (1H-pyrazol-5-yl) picolinamide hydrochloride

4- (3'-methoxy-4'- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) - [1, 1'-biphenyl] -3-yl) piperazine-1-carboxylate (2.30 g, 3.60 mmol) , HCl solution (10 mL, 4M in EtOAc) and EtOAc (30 mL) were added to a 100 mL round-bottomed flask. The reaction mixture was stirred at 20℃ for 2 hours. The reaction mixture was then concentrated under vacuum to give the Intermediate 8 as a light yellow solid (1.75 g, 100%purity, 99.0%yield) ; LCMS (ESI ⁺) : m/z 455.3 [M+H] ⁺

Intermediate 9:

Step 1: Synthesis of 3-methyl-1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazole

A stir bar, 3-methyl-1H-pyrazole (10.0 g, 122 mmol) , 4-methylbenzenesulfonic acid hydrate (2.32 g, 12.2 mmol) and toluene (100 mL) were added to a 250 mL round-bottomed flask. 3, 4-dihydro-2H-pyran (35.9 g, 427 mmol) was dropwise added the mixture before stirred at 110℃ for 4 h. The mixture was diluted into saturated aqueous NaHCO ₃ (60 mL) and DCM (100 mL) then the separated organic phase was washed with brine (80 mL x 3) and dried over anhydrous Na ₂SO ₄ and filtered. The filtered solution was concentrated under reduced pressure to afford the crude product. The crude product was purified by FCC (petroleum ether: ethyl acetate = 1: 0 to 1: 1) to give product as a yellow oil (12.0 g, 90%purity, 53.3%yield) . ¹H NMR (400 MHz, DMSO-d ₆) δ 7.70 (d, J = 2.0 Hz, 1H) , 6.06 (d, J = 2.0 Hz, 1H) , 5.39 -5.14 (m, 1H) , 3.94 -3.83 (m, 1H) , 3.62 -3.52 (m, 1H) , 2.18 -2.12 (m, 3H) , 1.95 -1.80 (m, 2H) , 1.73 -1.50 (m, 4H) .

Step 2: Synthesis of 3-methyl-1- (tetrahydro-2H-pyran-2-yl) -5- (4, 4, 5, 5-tetramethyl-1, 3, 2-dioxaborolan-2-yl) -1H-pyrazole

A stir bar, 3-methyl-1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazole (2.00 g, 12.0 mmol) and dry THF (30 mL) were added to a 100 mL three-necked round-bottomed flask, cooled to -78 ℃ and treated drop-wise with butyllithium (6.3 mL, 15.6 mmol) . The resultant mixture was stirred at -78 ℃ for 5 min. Triisopropyl borate (3.40 g, 18.0 mmol) was added to the mixture before the mixture was allowed to warm to room temperature. The resulting mixture was stirred at room temperature for 1 hour, pinacol (2.13 g, 18.0 mmol) and acetic acid (1.45 g, 24.1 mmol) were added and the mixture was stirred for another 1 hour. The mixture was diluted into water (80 mL) and ethyl acetate (80 mL) and the separated organic phase was washed with brine (50 mL) then dried over anhydrous Na ₂SO ₄ and filtered. The filtrate was concentrated to dryness under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 5: 1) to afford the title product as a pale yellow oil (1.00 g, crude) .

Step 3: Synthesis of ethyl-6- (3-methyl-1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinate

A stir bar, ethyl 6-bromopicolinate (1.5 g, 6.52 mmol) , 3-methyl-1- (tetrahydro-2H-pyran-2-yl) -5- (4, 4, 5, 5-tetramethyl-1, 3, 2-dioxaborolan-2-yl) -1H-pyrazole (2.10 g, 7.17 mmol) and cesium carbonate (6.35 g, 19.5 mmol) in 1, 4-dioxane (40 mL) and H ₂O (10 mL) were added to a 100 mL round-bottomed flask. The mixture was sparged with nitrogen for three times and then treated with [1, 1'-bis (diphenylphosphino) ferrocene] dichloropalladium (II) (0.361 mg, 0.652 mmol) . Then mixture was sparged with nitrogen for three times and heated at 90 ℃ for 16 hours. The reaction mixture was filtered and diluted with ethyl acetate (20 mL) . The aqueous was acidified to pH = 4 by citric acid and extracted with DCM (15 mL x 3) , washed with brine and dried over Na ₂SO ₄. The organic layer was filtered and concentrated under reduced pressure to give crude product which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 0: 1) to afford the title compound as a colorless oil (1.50 g, 90%purity, 65.7%yield) . ¹H NMR (400 MHz, DMSO-d ₆) 8.03 (d, J = 7.6 Hz, 1H) , 8.00 -7.94 (m, 2H) , 6.74 (s, 1H) , 6.67 -6.60 (m, 1H) , 4.41 -4.31 (m, 2H) , 3.83 -3.76 (m, 1H) , 3.63 -3.55 (m, 1H) , 2.37 -2.26 (m, 1H) , 2.19 (s, 3H) , 2.01 -1.92 (m, 1H) , 1.88 (dd, J=2.4, 12.8 Hz, 1H) , 1.65 -1.56 (m, 1H) , 1.50 -1.44 (m, 2H) , 1.34 (t, J = 7.2 Hz, 3H) .

Step 4: Synthesis of 6- (3-methyl-1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinic acid

A stir bar, NaOH (228 mg, 5.71 mmol) and ethyl 6- (3-methyl-1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinate (1.5 g, 4.76 mmol) in MeOH (10 mL) and H ₂O (10 mL) were added to a 50 mL round-bottomed flask. The resultant mixture was stirred at room temperature for 16 h. The reaction mixture was concentrated and adjusted pH to 5-6 with citric acid (6 mL) . The mixture was extracted with DCM (30 mL x 5) . The organic extracts were washed with bine (10 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the product as a brown solid (1.0 g, 90%purity, 65.9%yield) . ¹H NMR (400 MHz, CDCl ₃) : δ 8.19 (d, J = 7.6 Hz, 1H) , 8.03 (t, J = 7.6 Hz, 1H) , 7.86 -7.80 (m, 1H) , 6.46 (s, 1H) , 5.68 (dd, J = 2.8, 9.6 Hz, 1H) , 3.77 -3.71 (m, 1H) , 3.70 -3.62 (m, 1H) , 2.61 -2.50 (m, 1H) , 2.35 (s, 3H) , 2.17 -2.09 (m, 1H) , 1.96 -1.88 (m, 1H) , 1.81 -1.69 (m, 1H) , 1.65 -1.55 (m, 2H) .

Step 5: Synthesis of tert-butyl 4- (3-methoxy-4- (6- (3-methyl-1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenyl) piperazine-1-carboxylate

A stir bar, 6- (3-methyl-1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinic acid (383 mg, 1.33 mmol) , N-ethyl-N-isopropylpropan-2-amine (862 mg, 6.67 mmol) , HATU (760 mg, 2.00 mmol) and DMF (6 mL) were added to a 50 mL round-bottomed flask. tert-butyl 4- (4-amino-3-methoxyphenyl) piperazine-1-carboxylate (410 mg, 1.33 mmol) was added to the mixture. The reaction mixture was stirred at room temperature for 1 hours. The reaction mixture was diluted with water (30 mL) , extracted with ethyl acetate (30 mL x 2) , washed with brine (30 mL x 2) and dried over Na ₂SO ₄. The organic layer was filtered and concentrated under reduced pressure to give crude product which was purified by FCC (petroleum ether: ethyl acetate = 0: 1 to 1: 1) to give the title product as a brown solid (330 mg, crude) ; LCMS (ESI ⁺) : m/z 577.3 [M+H] ⁺.

Step 6: Synthesis of N- (2-methoxy-4- (piperazin-1-yl) phenyl) -6- (3-methyl-1H-pyrazol-5-yl) picolinamide hydrochloride

tert-butyl 4- (3-methoxy-4- (6- (3-methyl-1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenyl) piperazine-1-carboxylate (330 mg, 0.493 mmol) and HCl/EA (20 mL, 4M) were added to a 100 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 2 hours. The reaction mixture was concentrated under reduced pressure to give the Intermediate 9 as a pale yellow solid (200 mg, 95.9%purity, 90.8%yield) ; LCMS (ESI ⁺) : m/z 393.2 [M+H] ⁺.

Intermediate 10:

Step 1: Synthesis of 1- (1- (5-Bromo-2-nitrophenyl) piperidin-4-yl) -N, N-dimethyl-methanamine

A stir bar, 4-bromo-2-fluoro-1-nitrobenzene (500 mg, 2.27 mmol) , N, N-dimethyl-1- (piperidin-4-yl) methanamine hydrochloride (489 mg, 2.27 mmol) , triethylamine (0.95 mL, 6.82 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 80 ℃ for 12 hours before poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 0: 1) to afford the title compound as a brown oil (280 mg, 100%purity, 36.0%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 7.75 (d, J = 8.5 Hz, 1H) , 7.42 (d, J = 2.0 Hz, 1H) , 7.20 (dd, J = 2.0, 8.5 Hz, 1H) , 3.19 (br d, J = 12.5 Hz, 2H) , 2.84 (dt, J = 2.1, 12.1 Hz, 2H) , 2.12 (s, 6H) , 2.08 (d, J = 7.3 Hz, 2H) , 1.74 (br d, J = 11.3 Hz, 2H) , 1.60 (ddd, J = 3.8, 7.2, 11.1 Hz, 1H) , 1.25 -1.13 (m, 2H) ; LCMS (ESI+) : m/z 343.9 [M+H] ⁺.

Step 2: Synthesis of tert-Butyl 4- (3- (4- ( (dimethylamino) methyl) piperidin-1-yl) -4-nitrophenyl) -5, 6-dihydropyridine-1 (2H) -carboxylate

A stir bar, 1- (1- (5-bromo-2-nitrophenyl) piperidin-4-yl) -N, N-dimethylmethanamine (280 mg, 0.818 mmol) , tert-butyl 4- (4, 4, 5, 5-tetramethyl-1, 3, 2-dioxaborolan-2-yl) -5, 6-dihydropyridine-1 (2H) -carboxylate (276 mg, 0.893 mmol) , tris (dibenzylideneacetone) dipalladium (0) (15.0 mg, 0.016 mmol) , potassium phosphate (347 mg, 1.64 mmol) , tricyclohexylphosphine (9.20 mg, 0.033 mmol) , dioxane (3 mL) and water (1 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 100 ℃ for 12 hours before poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 0: 1) to afford the title compound as a yellow solid (200 mg, 99.2%purity, 54.5%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 7.79 (d, J = 8.5 Hz, 1H) , 7.20 (d, J = 1.8 Hz, 1H) , 7.14 -7.08 (m, 1H) , 6.34 (br s, 1H) , 4.03 (br s, 2H) , 3.54 (br t, J = 5.8 Hz, 2H) , 3.20 (br d, J = 11.3 Hz, 2H) , 2.83 (br t, J = 11.2 Hz, 2H) , 2.54 -2.53 (m, 2H) , 2.13 (s, 6H) , 2.10 (d, J = 7.3 Hz, 2H) , 1.75 (br d, J = 10.8 Hz, 2H) , 1.59 (br s, 1H) , 1.43 (s, 9H) , 1.23 -1.15 (m, 2H) ; LCMS (ESI+) : m/z 445.2 [M+H] ⁺.

Step 3: Synthesis of tert-Butyl 4- (4-amino-3- (4- ( (dimethylamino) methyl) piperidin-1-yl) phenyl) piperidine-1-carboxylate

A stir bar, tert-butyl 4- (3- (4- ( (dimethylamino) methyl) piperidin-1-yl) -4-nitrophenyl) -5, 6-dihydropyridine-1 (2H) -carboxylate (200 mg, 0.450 mmol) , Pd/C (200 mg) and methanol (10 mL) were added to a 250 mL round-bottomed flask. The mixture was sparged with H ₂ for 5 minutes before stirred at 25 ℃ under H ₂ (30 psi) for 12 hours. The mixture was then filtered through a pad of

and the filtrate was concentrated under reduced pressure to obtain the product as a gray oil (150 mg, crude) .

Step 4: Synthesis of tert-Butyl 4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3- (4- ( (dimethylamino) methyl) piperidin-1-yl) phenyl) piperidine-1-carboxylate

A stir bar, tert-butyl 4- (4-amino-3- (4- ( (dimethylamino) methyl) piperidin-1-yl) phenyl) piperidine-1-carboxylate (150 mg, 0.360 mmol) , 6- (1H-pyrazol-5-yl) picolinic acid hydrochloride Intermediate 5 (81.3 mg, 0.360 mmol) , HATU (164 mg, 0.431 mmol) , N-ethyl-N-isopropylpropan-2-amine (139 mg, 1.08 mmol) and DMF (5 mL) were added to a 100 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 12 hours before poured into water (20 mL) and extracted with ethyl acetate (20 mL x 2) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: dichloromethane : methanol = 1: 0 to 10: 1) to afford the title compound as a yellow oil (150 mg, crude) .

Step 5: Synthesis of N- (2- (4- ( (dimethylamino) methyl) piperidin-1-yl) -4- (piperidin-4-yl) phenyl) -6- (1H-pyrazol-5-yl) picolinamide 2, 2, 2-trifluoroacetate

A stir bar, tert-butyl 4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3- (4- ( (dimethylamino) methyl) piperidin-1-yl) phenyl) piperidine-1-carboxylate (150 mg, 0.255 mmol) and dichloromethane (5 mL) were added to a 50 mL round-bottomed flask before treated with trifluoroacetic acid (2 mL) dropwise and stirred at 25 ℃ for 1 hour. The mixture was then concentrated to dryness under reduced pressure to afford the desired Intermediate 10 as a yellow oil (150 mg, crude) .

Intermediate 11:

Step 1: Synthesis of 1-benzyl-4- (3-methoxy-4-nitrophenyl) piperidine-4-carbonitrile

A stir bar, sodium hydride (3.93 g, 98.3 mmol) was added to 2- (3-methoxy-4-nitrophenyl) acetonitrile (6.3 g, 32.8 mmol) and DMF (70 mL) in portions at 0 ℃. Then potassium iodide (5.44 g, 32.8 mmol) was added to the mixture dropwise at 0 ℃, and then N-benzyl-2-chloro-N- (2-chloroethyl) ethanamine (9.13 g, 39.3 mmol) was added to the mixture dropwise at 0 ℃. Then the mixture was stirred at 25 ℃ for 16 hours. The aqueous phases NH ₄Cl (30 mL) was added to the mixture to quench the reaction and stirred at 25 ℃ for 0.5 h. The mixture was filtered, the cake washed with ethyl acetate (30 mL x 2) and the resultant solution washed with brine (20 mL x 2) and extracted with ethyl acetate (30 mL x 2) , The combined ethyl acetate extracts were dried over Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude product which was purified by prep-HPLC (Column: Phenomenex Synergi Max-RP 250 x 50 mm x 10 um, Mobile Phase A: water (0.225%FA) , Mobile Phase B: acetonitrile, Flow rate: 100 mL/min, gradient condition from 5%B to 35%) . The pure fractions were collected and evaporated under vacuum to give a residue, which was lyophilized to give the product as a brown oil (2.1 g, 98.7%purity, 18.0%yield) . ¹H NMR (400 MHz, CDCl ₃) : δ 7.87 (d, J = 8.6 Hz, 1H) , 7.37 -7.30 (m, 5H) , 7.30 -7.27 (m, 1H) , 7.15 (dd, J = 1.6, 8.4 Hz, 1H) , 3.99 (s, 3H) , 3.61 (s, 2H) , 3.03 (d, J = 12.4 Hz, 2H) , 2.57 -2.47 (m, 2H) , 2.14 -2.05 (m, 4H) ; LCMS (ESI ⁺) : m/z 352.2 [M+H] ⁺.

Step 2: Synthesis of 4- (4-amino-3-methoxyphenyl) -1-benzylpiperidine-4-carbonitrile

A solution consisting of 1-benzyl-4- (3-methoxy-4-nitrophenyl) piperidine-4-carbonitrile (1.6 g, 4.55 mmol) , Fe powder (1.27 g, 22.7 mmol) , NH ₄Cl (2.44 g, 45.6 mmol) , EtOH (30 mL) , and H ₂O (6 mL) were stirred at 80 ℃ for 4 hours. The reaction mixture was cooled to room temperature and filtered through a pad of

The cake washed with DCM (50 mL x 2) and the resultant solution washed with saturated aqueous NaHCO ₃ (20 mL) and extracted with DCM (50 mL x 2) . The combined organic extracts were dried over Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude product as a green solid (1.5 g, crude) .

Step 3: Synthesis of N- (4- (1-benzyl-4-cyanopiperidin-4-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) nicotinamide

A stir bar, 6- (1H-pyrazol-5-yl) picolinic acid Intermediate 5 (1.0 g, 5.29 mmol) , HATU (2.41 g, 6.34 mmol) , N, N-diisopropylethylamine (2.05 g, 15.9 mmol) and DMF (20 mL) were added to a 50 mL round-bottomed flask at room temperature. 4- (4-amino-3-methoxyphenyl) -1-benzylpiperidine-4-carbonitrile (1.89 g, 5.28 mmol) was added to the reaction mixture at room temperature. The mixture was stirred at 25 ℃ for 2 hours. The crude product was concentrated to dryness under reduced pressure to afford the crude product which was purified by FCC (eluent: petroleum ether: ethyl acetate = 100: 0 to 0: 1) to afford desired compound as a green oil (400 mg, 95.6%purity, 14.7%yield) . LCMS (ESI ⁺) : m/z 493.3 [M+H] ⁺

Step 4: Synthesis of N- (4- (4-cyanopiperidin-4-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) nicotinamide hydrochloride

A stir bar, a solution of N- (4- (1-benzyl-4-cyanopiperidin-4-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide (400 mg, 0.812 mmol) , and THF/i-PrOH=3/1 (20 mL) were added to a 100 mL round-bottomed flask. Then wet Pd/C (0.1 g, 10%purity, 50%of H ₂O) and wet Pd (OH) ₂ (0.1 g, 50%of H ₂O) were added to the solution and the suspension was degassed under vacuum and purged with argon for three times, and then purged with hydrogen for three times. The mixture was stirred under hydrogen (20 psi) at 25 ℃ for 48 hours. The mixture was filtered by Celite and the filtrate was concentrated under reduced to give the crude product which was dissolved in MeOH 10 mL, HCl in EtOAc (5 mL, 4N, 20 mmol) was added, and stirred at 25℃ for 0.5 h, the reaction mixture was concentrated under reduced to give the desired Intermediate 11 (0.2 g, 96.5%purity, 54.1%yield) which was used to the next step without further purification. ¹H NMR (400 MHz, CDCl ₃) (Varian) 10.70 (br s, 1H) , 8.65 -8.55 (m, 1H) , 8.23 -8.16 (m, 1H) , 8.09 -8.00 (m, 1H) , 7.99 -7.91 (m, 1H) , 7.76 -7.68 (m, 1H) , 7.26 (s, 1H) , 7.16 -7.06 (m, 2H) , 7.04 -6.95 (m, 1H) , 4.02 (s, 3H) , 3.27 -3.09 (m, 4H) , 2.17 -2.09 (m, 2H) , 2.04 (dd, J = 4.0, 12.0 Hz, 2H) .

Intermediate 12:

Step 1: Synthesis of tert-Butyl 8- (3-methoxy-4-nitrophenyl) -2, 8-diazaspiro [4.5] decane-2-carboxylate

4-Fluoro-2-methoxy-1-nitrobenzene (250 mg, 1.46 mmol) , tert-butyl 2, 8-diazaspiro [4.5] decane-2-carboxylate (351 mg, 1.46 mmol) , potassium carbonate (606 mg, 4.39 mmol) and DMF (5 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 80 ℃ for 12 hours. The reaction mixture was diluted with water (20 mL) , extracted with ethyl acetate (30 mL x 2) , washed with brine and dried over Na ₂SO ₄. The reaction mixture was filtered and concentrated under reduced pressure to give crude product which was purified by FCC (eluent: dichloromethane: methanol = 10: 1) to afford the title compound as a yellow oil (500 mg, 100%purity, 87.4%yield) . LCMS (ESI ⁺) : m/z 392.1 [M+H] ⁺.

Step 2: Synthesis of tert-Butyl - (4-amino-3-methoxyphenyl) -2, 8-diazaspiro [4.5] decane-2-carboxylate

tert-Butyl 8- (3-methoxy-4-nitrophenyl) -2, 8-diazaspiro [4.5] decane-2-carboxylate (500 mg, 1.28 mmol) , iron powder (357 mg, 6.39 mmol) , ammonium chloride (342 mg, 6.39 mmol) , EtOH (4 mL) and water (1 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 80 ℃ for 1 hour. The reaction mixture was filtered and diluted with ethyl acetate. The reaction mixture was extracted with ethyl acetate (30 mL x 2) , washed with brine and dried over Na ₂SO ₄. The organic layer was filtered and concentrated under reduced pressure to give the product as a colorless oil (400 mg, crude) .

Step 3: Synthesis of tert-Butyl 8- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) -2, 8-diazaspiro [4.5] decane-2-carboxylate

tert-Butyl 8- (4-amino-3-methoxyphenyl) -2, 8-diazaspiro [4.5] decane-2-carboxylate (100 mg, 0.277 mmol) , (6- (1H-pyrazol-3-yl) picolinic acid Intermediate 5 (52.3 mg, 0.276 mmol) , HATU (126 mg, 0.331 mmol) , N, N-diisopropylethylamine (107 mg, 0.828 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 2 hours. The reaction mixture was diluted with water, extracted with dichloromethane (30 mL x 2) , washed with brine and dried over Na ₂SO ₄. The organic layer was filtered and concentrated under reduced pressure to give crude product which was purified by FCC (eluent: dichloromethane : methanol = 1: 0 to 10: 1) to afford the title compound as a yellow oil (120 mg, crude) .

Step 4: Synthesis of N- (2-methoxy-4- (2, 8-diazaspiro [4.5] decan-8-yl) phenyl) -6- (1H-pyrazol-3-yl) picolinamide trifluoroacetate

tert-butyl 8- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) -2, 8-diazaspiro [4.5] decane-2-carboxylate (120 mg, 0.225 mmol) , TFA (2 mL) and DCM (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 1 hour. The reaction mixture was concentrated under reduced pressure to give desired Intermediate 12 as a yellow oil (120 mg, crude) .

Intermediate 13:

Intermediate 13 was synthesized according to similar procedure described for synthesis of Intermediate 10, by using corresponding starting materials and intermediates. ¹H NMR (400 MHz, DMSO-d ₆) δ 10.72 (s, 1H) , 9.12 -8.75 (m, 2H) , 8.25 (br d, J = 8.0 Hz, 1H) , 8.22 -8.18 (m, 1H) , 8.12 (t, J = 7.7 Hz, 1H) , 8.08 -8.04 (m, 1H) , 7.89 (d, J = 2.3 Hz, 1H) , 7.03 -7.00 (m, 1H) , 6.99 (d, J = 2.3 Hz, 1H) , 6.92 -6.87 (m, 1H) , 3.99 (s, 3H) , 3.40 -3.33 (m, 2H) , 3.06 -2.93 (m, 2H) , 2.92 -2.82 (m, 1H) , 1.99 -1.82 (m, 4H) ; LCMS (ESI ⁺) : m/z 378.2 [M+H] ⁺.

Intermediate 14:

Step 1: Synthesis of N- (4-bromo-2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide

HATU (4.50 g, 11.8 mmol) was added to a solution consisting of 4-bromo-2-methoxyaniline (2.00 g, 9.90 mmol) , 6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinic acid Intermediate 4 (2.70 g, 9.88 mmol) , DIPEA (3.50 mL, 20.1 mmol) and DMF (20 mL) . The resultant mixture was stirred at room temperature for 3 hours before poured into water (30 mL) to introduce precipitate. The resultant yellow precipitate was filtered and washed with petroleum ether (20 mL x 3) to afford crude product, which was triturated with mixed solvent (10 mL, petroleum ether and ethyl acetate = 10 : 1) before filtered and washed with mixed solvent (10 mL x 2, petroleum ether: ethyl acetate = 10 : 1) . The obtained solid was dried under reduced pressure to afford the desired Intermediate 14 as a yellow solid (2.20 g, crude) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 10.27 (s, 1H) , 8.37 (d, J = 8.6 Hz, 1H) , 8.20 -8.14 (m, 2H) , 7.96 (dd, J = 1.7, 7.1 Hz, 1H) , 7.65 (d, J = 1.7 Hz, 1H) , 7.32 (d, J = 2.0 Hz, 1H) , 7.23 -7.17 (m, 1H) , 6.86 (d, J = 2.0 Hz, 1H) , 6.07 (dd, J = 2.1, 9.4 Hz, 1H) , 3.90 (s, 3H) , 3.76 -3.70 (m, 1H) , 3.42 -3.32 (m, 1H) , 2.45 -2.28 (m, 1H) , 2.05 -1.94 (m, 2H) , 1.61 -1.37 (m, 3H) .

Intermediate 15:

Step 1: Synthesis of tert-butyl 7- (3-methoxy-4-nitrophenoxy) heptanoate

A mixture of 3-methoxy-4-nitrophenol (600 mg, 3.55 mmol) , tert-butyl 7-bromoheptanoate (1.08 g, 4.07 mmol) , K ₂CO ₃ (1.47 g, 10.6 mmol) in DMF (10 mL) was stirred for 2 hours at 80 ℃ under N ₂. Ethyl acetate (30 mL) was added into the mixture. The mixture was washed with H ₂O (30 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to obtain the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 2: 1) to give the product as a yellow solid (1.10 g, crude) . ¹H NMR (400 MHz, CDCl ₃) : δ 7.99 (d, J = 9.0 Hz, 1H) , 6.58 -6.44 (m, 2H) , 4.02 (br t, J = 6.4 Hz, 2H) , 3.95 (s, 3H) , 2.23 (t, J =7.3 Hz, 2H) , 1.89 -1.77 (m, 2H) , 1.66 -1.57 (m, 2H) , 1.53 -1.37 (m, 13H) .

Step 2: Synthesis of tert-butyl 7- (4-amino-3-methoxyphenoxy) heptanoate

A mixture of tert-butyl 7- (3-methoxy-4-nitrophenoxy) heptanoate (600 mg, 1.70 mmol) , Pd/C (200 mg) in MeOH (10 mL) was stirred at 30 ℃ for 4 hours under H ₂ (40 psi) atmosphere. The mixture was filtered through a pad of Celite and the filter cake was washed with MeOH (30 mL) . The combined filtrate was concentrated under reduced pressure to obtain the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 2: 1) to give Intermediate 15 as pale yellow oil (500 mg, crude) . ¹H NMR (400 MHz, CDCl ₃) : δ 6.64 (d, J = 8.3 Hz, 1H) , 6.45 (d, J = 2.7 Hz, 1H) , 6.34 (dd, J =2.6, 8.4 Hz, 1H) , 3.88 (t, J = 6.5 Hz, 2H) , 3.83 (s, 3H) , 2.92 (br s, 2H) , 2.22 (t, J = 7.5 Hz, 2H) , 1.80 -1.71 (m, 2H) , 1.66 -1.58 (m, 2H) , 1.51 -1.36 (m, 13H) .

Intermediate 16:

Step 1: Synthesis of 1- (5-hydroxy-2-nitrophenyl) piperidin-4-ol

A stir bar, 3-fluoro-4-nitrophenol (1.50 g, 9.55 mmol) , piperidin-4-ol (1.06 g, 10.5 mmol) , potassium carbonate (2.64 g, 11.5 mmol) , and MeCN (10 mL) were added to a 20 mL round-bottomed flask. The reaction mixture was stirred at 110 ℃ under microwave irradiation for 1.5 hours. The reaction mixture was filtered, diluted with EtOAc (50 mL) , washed with brine (10 mL x 2) , and dried over anhydrous Na ₂SO ₄. The organic layer was filtered and concentrated under reduced pressure to give crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 0: 1) to afford the title compound as yellow solids (2.00 g, 97.4%purity, 85.6%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 10.73 -10.42 (m, 1H) , 7.81 (d, J = 8.8 Hz, 1H) , 6.46 (d, J = 2.4 Hz, 1H) , 6.38 (dd, J = 2.4, 9.2 Hz, 1H) , 4.68 (d, J = 3.2 Hz, 1H) , 3.60 (d, J = 2.8 Hz, 1H) , 3.12 -3.02 (m, 2H) , 2.79 -2.69 (m, 2H) , 1.79 (dd, J = 4.0, 9.2 Hz, 2H) , 1.49 (dtd, J = 3.6, 9.2, 12.4 Hz, 2H) .

Step 2: Synthesis of 1- (2-amino-5-hydroxyphenyl) piperidin-4-ol

A stir bar, 1- (5-hydroxy-2-nitrophenyl) piperidin-4-ol (1.20 g, 5.04 mmol) , wet Pd/C (0.2 g) and MeOH (20 mL) were added to a hydrogenated bottle under N ₂ atmosphere. The suspension was degassed under vacuum, purged with N ₂ atmosphere for three times, and then purged with hydrogen for three times. The resulting mixture was stirred under hydrogen (30 Psi) at 25 ℃ for 16 hours. The mixture was filtered through a pad of Celite and the filter cake was washed with methanol (30 mL x 3) . The combined filtrates were concentrated under reduced pressure to give the product as a black solid (700 mg, 92.3%purity, 61.6%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 6.48 (d, J = 8.4 Hz, 1H) , 6.36 (d, J = 2.8 Hz, 1H) , 6.24 (dd, J = 2.4, 8.4 Hz, 1H) , 4.69 (br s, 1H) , 3.58 (td, J = 4.0, 8.4 Hz, 1H) , 3.00 -2.93 (m, 2H) , 2.53 (s, 2H) , 1.86 -1.78 (m, 2H) , 1.59 -1.49 (m, 2H)

Step 3: Synthesis of N- (4-hydroxy-2- (4-hydroxypiperidin-1-yl) phenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide

A stir bar, 6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinic acid (400 mg, 1.46 mmol) , HATU (668 mg, 1.76 mmol) , DIPEA (568 mg, 4.39 mmol) and DMF (8 mL) were added to a 40 mL round-bottomed flask at room-temperature before treated with 1- (2-amino-5-hydroxyphenyl) piperidin-4-ol (430 mg, 2.07 mmol) and stirred at 25 ℃ for 16 hours. The reaction mixture was concentrated to dryness under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 0: 1) to afford the Intermediate 16 as brown oil (800 mg, crude) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 10.49 -10.41 (m, 1H) , 9.37 (s, 1H) , 8.24 -8.21 (m, 1H) , 8.15 (d, J = 8.8 Hz, 1H) , 7.92 (dd, J = 2.0, 6.8 Hz, 1H) , 7.64 (d, J = 1.5 Hz, 1H) , 6.87 (d, J = 1.6 Hz, 1H) , 6.64 (d, J = 2.4 Hz, 1H) , 6.55 (dd, J = 2.4, 8.8 Hz, 1H) , 5.78 (d, J = 8.4 Hz, 1H) , 3.84 -3.75 (m, 1H) , 3.62 (dt, J = 4.0, 6.4 Hz, 3H) , 3.16 -3.11 (m, 2H) , 2.68 -2.61 (m, 2H) , 2.43 -2.29 (m, 1H) , 2.00 -1.93 (m, 2H) , 1.72 (s, 2H) , 1.55 -1.41 (m, 6H)

Intermediate 17:

Step 1: Synthesis of 4'-amino-3'-methoxy- [1, 1'-biphenyl] -3-ol

2-amino-5-bromophenol (3.00 g, 14.8 mmol) , (3-hydroxyphenyl) boronic acid (4.09 g, 29.7 mmol) , Na ₂CO ₃ (10.0 g, 94.4 mmol) , toluene (30 mL) , EtOH (13.5 mL) and H ₂O (15 mL) were added to a 250 mL round-bottomed flask. The mixture was spared with N ₂ for 5 minutes and then treated with Pd (PPh ₃) ₄ (686 mg, 0.594 mmol) . The resultant mixture was spared with N ₂ for another 5 minutes and then stirred while heating at 110 ℃ for 2 hours before cooling to room temperature. The mixture was concentrated to dryness under reduced pressure to afford the crude product, which was diluted with water (30 mL) and extracted with DCM (50 mL x 3) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered, and concentrated to dryness under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 10: 1 to 3: 1) to afford the title compound as a yellow oil (1.90 g, crude) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 9.33 (s, 1H) , 7.19 -7.07 (m, 1H) , 6.99 -6.88 (m, 4H) , 6.68 -6.57 (m, 2H) , 4.81 (s, 2H) , 3.80 (s, 3H) .

Step 2: Synthesis of N- (3'-hydroxy-3-methoxy- [1, 1'-biphenyl] -4-yl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide

HATU (636 mg, 1.67 mmol) was added to a solution consisting of 4'-amino-3'-methoxy- [1, 1'-biphenyl] -3-ol (300 mg, 1.39 mmol) , 6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinic acid (381 mg, 1.39 mmol) , DIPEA (0.5 mL, 3 mmol) and DMF (5 mL) . The resultant mixture was stirred at room temperature for 3 hours before poured into water (10 mL) and extracted with ethyl acetate (30 mL x 3) . The combined organic layers were washed with brine (10 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 10: 1 to 1: 1) to afford the Intermediate 17 as a yellow solid (260 mg, crude) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 10.35 (s, 1H) , 9.51 (s, 1H) , 8.50 (d, J = 8.3 Hz, 1H) , 8.29 -8.12 (m, 2H) , 7.96 (dd, J = 3.4, 5.4 Hz, 1H) , 7.66 (s, 1H) , 7.33 -7.19 (m, 3H) , 7.14 -7.03 (m, 2H) , 6.87 (d, J = 1.5 Hz, 1H) , 6.74 (br d, J =7.6 Hz, 1H) , 6.12 (br d, J = 8.8 Hz, 1H) , 3.97 (s, 3H) , 3.93 -3.70 (m, 2H) , 2.44 -2.22 (m, 1H) , 2.12 -1.97 (m, 2H) , 1.67 -1.34 (m, 3H) .

Intermediate 18:

Step 1: Synthesis of tert-Butyl 2- ( (1- (3-methoxy-4-nitrophenyl) piperidin-4-yl) oxy) acetate

A stir bar, 1- (3-methoxy-4-nitrophenyl) piperidin-4-ol (0.500 g, 1.98 mmol) , and THF (20 mL) were added to a 50 mL round-bottomed flask at 0℃ before treated with sodium hydride (119 mg, 2.97 mmol) and stirred at 0 ℃ for 5 minutes. The reaction mixture was treated with tert-butyl 2-bromoacetate (0.77 g, 3.96 mmol) at 0 ℃, then warmed and stirred at 25 ℃ for 16 hours. Brine (10 mL) was added to the mixture and the mixture was concentrated under reduced pressure to remove THF before diluted with H ₂O (10 ml) and extracted with EtOAc (30 mL x 3) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered, and concentrated to dryness under reduced pressure to give the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 100: 0 to 1: 1) to afford desired compound as brown oil (0.650 g, crude) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 7.87 (d, J = 9.6 Hz, 1H) , 6.59 (dd, J = 2.4, 9.2 Hz, 1H) , 6.52 -6.49 (m, 1H) , 4.05 (s, 2H) , 3.90 (s, 3H) , 3.81 -3.73 (m, 2H) , 3.66 -3.59 (m, 1H) , 3.28 -3.19 (m, 2H) , 1.95 -1.86 (m, 2H) , 1.56 -1.46 (m, 2H) , 1.43 (s, 9H) .

Step 2: Synthesis of tert-Butyl 2- ( (1- (4-amino-3-methoxyphenyl) piperidin-4-yl) -oxy) acetate

A stir bar, tert-butyl 2- ( (1- (3-methoxy-4-nitrophenyl) piperidin-4-yl) oxy) acetate (0.650 g, 1.77 mmol) , wet Pd/C (0.200 g) and MeOH (20 mL) were added to a hydrogenation bottle under N ₂ atmosphere. The suspension was degassed under vacuum, purged with N ₂ for three times, and then purged with hydrogen for another three times. The resulting mixture was stirred under hydrogen (30 Psi) at 25 ℃ for 16 hours. The mixture was filtered through a pad of Celite and the filter cake was washed with methanol (30 mL x 3) . The combined filtrates were concentrated under reduced pressure to give the product as brown oil (450 mg, crude) . ¹H NMR (400MHz, DMSO-d6) : δ 6.52 -6.47 (m, 2H) , 6.31 -6.26 (m, 1H) , 4.26 -4.13 (m, 2H) , 4.01 (s, 2H) , 3.73 (s, 3H) , 3.45 -3.40 (m, 1H) , 3.27 -3.21 (m, 2H) , 2.68 -2.61 (m, 2H) , 1.92 (m, 2H) , 1.60 -1.51 (m, 2H) , 1.43 (s, 9H) .

Step 3: Synthesis of tert-Butyl 2- ( (1- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) acetate

A stir bar, tert-butyl 2- ( (1- (4-amino-3-methoxyphenyl) piperidin-4-yl) oxy) acetate (250 mg, 0.743 mmol) , 6- (1H-pyrazol-5-yl) picolinic acid Intermediate 5 (140 mg, 0.740 mmol) , HATU (171 mg, 0.892 mmol) , DIPEA (301 mg, 2.23 mmol) and DMF (3 mL) were added to a 10 mL round-bottomed flask. The reaction mixture was stirred at 25 ℃ for 2 hours. The reaction mixture was co-treated with another batch (50 mg scale of tert-butyl 2- ( (1- (4-amino-3-methoxyphenyl) piperidin-4-yl) oxy) acetate) . The reaction mixture was concentrated under reduced pressure to obtain a residue, which was diluted with water (30 mL) and extracted with ethyl acetate (50 mL x 3) . The combined organic layer was then dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 4 to 1: 2) to give desired product as brown green oil (216 mg, crude) .

Step 4: Synthesis of 2- ( (1- (4- (6- (1H-Pyrazol-5-yl) picolinamido) -3-methoxy-phenyl) piperidin-4-yl) oxy) acetic acid hydrochloride

A stir bar, tert-Butyl 2- ( (1- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) acetate (210 mg, 0.414 mmol) , HCl (4 mL, 4M in dioxane) were added to a 50 mL round-bottomed flask. The resultant mixture was stirred at 25 ℃ for 2 hours and then concentrated to dryness under reduced pressure to afford the Intermediate 18 as a white solid (250 mg, crude) .

Intermediate 19:

Step 1: Synthesis of tert-butyl 3- (4-amino-3-methoxyphenyl) -5, 6-dihydropyridine-1 (2H) -carboxylate

A mixture of tert-butyl 3 - (4, 4, 5, 5-tetramethyl-1, 3 , 2-dioxaborolan-2-yl) -5, 6-dihydropyridine-1 (2H) -carboxylate (5.00 g, 16.2 mmol) , 4-bromo-2-methoxyaniline (2.97 g, 14.7 mmol) , Pd (dppf) Cl ₂ (1.07 g, 1.47 mmol) , potassium carbonate (4.06 g, 29.4 mmol) in dioxane (30 mL) and water (10 mL) was degassed and purged with N ₂ for three times, then stirred at 80 ℃ for 12 hours. The mixture was cooled to room temperature, poured into water (50 mL) and extracted with ethyl acetate (50 mL x 3) . The combined organic extracts were washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude title product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 5: 1) to give the product as a brown solid (5.00 g, crude) . ¹H NMR (400 MHz, CDCl ₃) : δ 6.80 (s, 2H) , 6.65 (d, J = 8.4 Hz, 1H) , 6.07 -6.01 (m, 1H) , 4.28 -4.16 (m, 2H) , 3.90 -3.74 (m, 5H) , 3.56 -3.48 (m, 2H) , 2.31 -2.22 (m, 2H) , 1.22 (s, 9H) .

Step 2: Synthesis of tert-butyl 3- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -5, 6-dihydropyridine-1 (2H) -carboxylate

6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinic acid Intermediate 5 (3.42 g, 18.1mmol) , HATU (9.37 g, 24.6 mmol) and DIPEA (4.25 g, 32.8 mmol) were dissolved in DMF (15 mL) . The reaction mixture was stirred at 25 ℃ for 15 minutes before treated with tert-butyl 3- (4-amino-3-methoxyphenyl) -5, 6-dihydropyridine-1 (2H) -carboxylate (5.00 g, 16.4 mmol) and stirred at 25 ℃ for 12 hours. The mixture was poured into water (50 mL) and extracted with ethyl acetate (50 mL x 3) . The combined organic extracts were washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude title product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 1: 1) to give the product as a brown solid (4.89 g, crude) . ¹H NMR (400 MHz, CDCl ₃) : δ 10.71 (br. s., 1H) , 8.55 (d, J = 7.8 Hz, 1H) , 8.20 (d, J = 7.6 Hz, 1H) , 8.02 (d, J = 7.6 Hz, 1H) , 7.99 -7.90 (m, 1H) , 7.73 (s, 1H) , 6.99 (t, J = 19.4 Hz, 3H) , 6.21 (s, 1H) , 4.31 (s, 2H) , 4.00 (s, 3H) , 3.58 (s, 2H) , 2.34 (s, 2H) , 1.71 -1.34 (m, 9H) .

Step 3: Synthesis of N- (2-methoxy-4- (1, 2, 5, 6-tetrahydropyridin-3-yl) phenyl) -6- (1H-pyrazol-5-yl) picolinamide hydrochloride

tert-Butyl 3- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -5, 6-dihydropyridine-1 (2H) -carboxylate (4.89 g, 10.3 mmol) was dissollved in HCl solution (12.8 mL, 4M in dioxane) and the reaction mixture was stirred at 25 ℃ for 3 hours. The reaction mixture was concentrated to dryness under reduced pressure to obtain the crude Intermediate 19 as a green solid (4.23 g, crude) , which was used for next step directly without further purification.

Intermediate 20:

Step 1: Synthesis of (2S, 4R) -methyl-1- ( (S) -2- ( (tert-butoxycarbonyl) amino) -3, 3-dimethylbutanoyl) -4-hydroxypyrrolidine-2-carboxylate

To a solution of (S) -2- ( (tert-butoxycarbonyl) amino) -3, 3-dimethylbutanoic acid (12.7 g, 54.9 mmol) in DMF (70 mL) was added HATU (22.1 g, 58.1 mmol) and DIPEA (31.7 mL, 191 mmol, 0.782 g/mL) . The mixture was stirred at room temperature for 30 minutes before treated with (2S, 4R) -methyl 4-hydroxypyrrolidine-2-carboxylate hydrochloride (10.0 g, 54.9 mmol) and stirred at room temperature overnight. The mixture was diluted with water (200 mL) and extracted with ethyl acetate (200 mL x 3) . The combined organic extracts were washed twice with 5% (vol/vol) citric acid (100 mL) , twice with saturated NaHCO ₃ solution (100 mL) , and twice with brine (100 mL) . The organic layer was then dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 0: 1) to afford the title compound as a colorless oil (15.0 g, 86.3%purity, 65.6%yield) . LCMS (ESI ⁺) : m/z 359.3 [M+H] ⁺.

Step 2: Synthesis of

(2S, 4R) -methyl 1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxypyrrolidine-2-carboxylate hydrochloride

A solution consisting of (2S, 4R) -methyl 1- ( (S) -2- ( (tert-butoxycarbonyl) amino) -3, 3-dimethylbutanoyl) -4-hydroxypyrrolidine-2-carboxylate (6.00 g, 16.7 mmol) , and HCl (50 mL, 4M in dioxane) was stirred at room temperature for 2 hours under N ₂. The reaction mixture was then concentrated under reduced pressure to afford the product as a white solid (5.00 g, 92.3%purity, 93.5%yield) . LCMS (ESI+) : m/z 259.1 [M+H] ⁺.

Step 3: Synthesis of (2S, 4R) -methyl 1- ( (S) -2- (2- ( (1- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) acetamido) -3, 3-dimethylbutanoyl) -4-hydroxypyrrolidine-2-carboxylate

A stir bar, (2S, 4R) -methyl 1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxypyrrolidine-2-carboxylate hydrochloride (4.90 g, 16.6 mmol) , 2- ( (1- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) acetic acid (5.00 g, 11.1 mmol) , HOBt (2.25 g, 16.7 mmol) , DIPEA (5.50 mL, 33.3 mmol, 0.782 g/mL) and DMF (20 mL) were added to a 40 mL round-bottomed flask. Then EDCI (3.18 g, 16.6 mmol) was added to the mixture. The reaction mixture was stirred at 40 ℃ for 12 hours before poured into water (50 mL) and extracted with ethyl acetate (50 mL x 3) . The combined organic extracts were washed with brine (50 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude product, which was purified by FCC (eluent: DCM: MeOH = 100: 0 to 90: 10) to give the desired product as a yellow solid (5.00 g, 86.0%purity, 56.1%yield) . LCMS (ESI+) : m/z 692.4 [M+H] ⁺.

Step 4: Synthesis of

(2S, 4R) -1- ( (S) -2- (2- ( (1- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) acetamido) -3, 3-dimethylbutanoyl) -4-hydroxypyrrolidine-2-carboxylic acid

A stir bar, (2S, 4R) -methyl 1- ( (S) -2- (2- ( (1- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) acetamido) -3, 3-dimethylbutanoyl) -4-hydroxypyrrolidine-2-carboxylate (5.00 g, 7.23 mmol) , lithium hydroxide hydrate (1.52 g, 36.2 mmol) and THF/H ₂O (20 mL, V: V = 1: 2) were added to a 50 mL round-bottomed flask. The resultant mixture was stirred at 25 ℃ for 2 hours before concentrated under reduced pressure to obtain a residue. The residue was then acidified with HCl (1N aqueous) to obtain pH = 6～7 to induce precipitate. The precipitate was filtered, washed with water and dried to give the Intermediate 20 as a white solid (3.20 g, 98.7%purity, 64.5%yield) . ¹H NMR (400 MHz, DMSO-d ₆) δ 13.06 (br. s., 1H) , 10.54 (br. s., 1H) , 8.18 -7.99 (m, 4H) , 7.89 -7.77 (m, 1H) , 7.42 (d, J = 9.6 Hz, 1H) , 6.98 (d, J = 2.0 Hz, 1H) , 6.76 (s, 1H) , 6.59 (s, 1H) , 5.34 -5.17 (m, 1H) , 4.56 (d, J = 9.6 Hz, 1H) , 4.39 -4.21 (m, 2H) , 4.03 -3.91 (m, 5H) , 3.69 -3.54 (m, 5H) , 3.03 -2.89 (m, 2H) , 2.21 -2.08 (m, 1H) , 2.03 -1.82 (m, 3H) , 1.70 -1.51 (m, 2H) , 0.95 (s, 9H) ; LCMS (ESI+) : m/z 678.4 [M+H] ⁺.

Intermediate 21:

Step 1: Synthesis of (2S, 4R) -methyl 1- ( (S) -2- ( (tert-butoxycarbonyl) amino) -3, 3-dimethylbutanoyl) -4-hydroxypyrrolidine-2-carboxylate

To a solution of (S) -2- ( (tert-butoxycarbonyl) amino) -3, 3-dimethylbutanoic acid (14.7 g, 55.1 mmol) in DMF (100 mL) was added HATU (22.2 g, 58.4 mmol) and DIPEA (31.6 mL, 193 mmol) . The mixture was then stirred at room temperature for 30 minutes before treated with (2S, 4R) -methyl 4-hydroxypyrrolidine-2-carboxylate hydrochloride (10 g, 55.1 mmol) and stirred at room temperature overnight. The mixture was then diluted with water (100 mL) and extracted with ethyl acetate (100 mL x 3) . The combined organic extracts were washed twice with 5%citric acid aqueous (100 mL) , twice with saturated NaHCO ₃ solution (100 mL) , and twice with brine (100 mL) . The organic layer was then dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the product as colorless oil (19.0 g, crude) . ¹H NMR (400MHz, DMSO-d ₆) : δ 6.61 -6.47 (m, 1H) , 5.22 (d, J = 3.5 Hz, 1H) , 4.39 -4.27 (m, 2H) , 4.20 -4.11 (m, 1H) , 3.75-3.49 (m, 5H) , 2.16 -2.05 (m, 1H) , 1.94 -1.81 (m, 1H) , 1.44 -1.34 (m, 9H) , 0.93 (s, 9H) .

Step 2: Synthesis of (2S, 4R) -1- ( (S) -2- ( (tert-butoxycarbonyl) amino) -3, 3-dimethylbutanoyl) -4-hydroxypyrrolidine-2-carboxylic acid

(2S, 4R) -methyl 1- ( (S) -2- ( (tert-butoxycarbonyl) amino) -3, 3-dimethylbutanoyl) -4-hydroxypyrrolidine-2-carboxylate (19.0 g, 53.0 mmol) and lithium hydroxide hydrate (12.7 g, 530 mmol) were taken into THF (200 mL) and water (100 mL) . The resulting mixture was stirred at ambient temperature for 18 hours. The mixture was then concentrated under reduced pressure to remove THF to obtain a residue, which was diluted with ice water (100 mL) , then adjusted to pH = 2-3 with HCI (3N aqueous) to induce precipitate. The resultant precipitate was filtered, washed with water (60 mL × 2) , then dried to afford the Intermediate 21 as a white solid (14 g, crude) . ¹H NMR (400MHz, DMSO-d ₆) : δ 6.55 -6.27 (m, 1H) , 5.40 -5.01 (m, 1H) , 4.36 -4.03 (m, 3H) , 3.59 (d, J = 3.7 Hz, 2H) , 2.14 -1.98 (m, 1H) , 1.93 -1.73 (m, 1H) , 1.33 (s, 9H) , 0.89 (s, 9H) .

General Scheme 1: Exemplary synthesis of Compound 1

Step 1: Synthesis of tert-Butyl 2- (2- (tosyloxy) ethoxy) acetate

A stir bar, tert-butyl 2- (2-hydroxyethoxy) acetate (500 mg, 2.84 mmol) , p-toluenesulfonyl chloride (809 mg, 4.24 mmol) , triethylamine (1.2 mL, 8.61 mmol) and dichloromethane (5 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at room-temperature for 2 hours. The mixture was then poured into water (10 mL) and extracted with ethyl acetate (10 mL x 2) . The organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 3: 1) to afford the title compound as a brown oil (800 mg, crude) .

Step 2: Synthesis of tert-Butyl 2- (2- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperazin-1-yl) ethoxy) acetate

A stir bar, tert-butyl 2- (2- (tosyloxy) ethoxy) acetate (133 mg, 0.403 mmol) , N- (2-methoxy-4- (piperazin-1-yl) phenyl) -6- (1H-pyrazol-5-yl) picolinamide hydrochloride Intermediate 1 (168 mg, 0.405 mmol) , triethylamine (0.5 mL, 3.59 mmol) and 1-methyl-2-pyrrolidinone (2 mL) were added to a 10 mL of sealed tube. The reaction mixture was stirred at 100 ℃ for 2 hours under M. W. The mixture was then poured into water (2 mL) and extracted with ethyl acetate (3 mL x 2) . The organic extracts were washed with water (2 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by FCC (eluent: dichloromethane : methanol = 1: 0 to 10: 1) to afford the title compound as a brown oil (200 mg, 92.6%yield) .

Step 3: Synthesis of 2- (2- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperazin-1-yl) ethoxy) acetic acid trifluoroacetate

A stir bar, tert-butyl 2- (2- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperazin-1-yl) ethoxy) acetate (200 mg, 0.373 mmol) , dichloromethane (1 mL) and trifluoroacetic acid (1 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at room-temperature for 1 hour. The mixture was concentrated to dryness under reduced pressure to afford the title compound as a yellow oil (200 mg, crude) .

Step 4: Synthesis of N- (4- (4- (2- (2- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethoxy) ethyl) piperazin-1-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 2- (2- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperazin-1-yl) ethoxy) acetic acid trifluoroacetate (200 mg, 0.336 mmol) , HOBt (27.3 mg, 0.202 mmol) , N-ethyl-N-isopropylpropan-2-amine (217 mg, 1.68 mmol) , EDCI (71.0 mg, 0.370 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (157 mg, 0.336 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at room-temperature for 12 hours. The mixture was then poured into water (5 mL) and extracted with ethyl acetate (10 mL x 2) . The organic extracts were washed with brine (5 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by prep-TLC (dichloromethane: methanol = 10 : 1) to give the product. The product was collected and evaporated under vacuum to give a residue, which was lyophilized to give the product Compound 1 as a white solid (68.9 mg, 95.6%purity, 21.9%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.91 (s, 0.2H) , 13.26 (s, 0.8H) , 10.59 (s, 0.8H) , 10.41 (s, 0.2H) , 8.98 -8.95 (m, 1H) , 8.63 (t, J = 6.0 Hz, 1H) , 8.26 -8.15 (m, 2H) , 8.12 -8.07 (m, 1H) , 8.05 -8.01 (m, 1H) , 7.94 (s, 1H) , 7.45 -7.35 (m, 5H) , 6.98 (s, 1H) , 6.71 (s, 1H) , 6.53 (d, J = 7.2 Hz, 1H) , 5.21 (d, J = 3.2 Hz, 1H) , 4.58 (d, J = 9.6 Hz, 1H) , 4.52 -4.33 (m, 4H) , 4.30 -4.22 (m, 1H) , 4.01 (d, J = 3.2 Hz, 2H) , 3.96 (s, 3H) , 3.71 -3.59 (m, 5H) , 3.23 -3.13 (m, 4H) , 2.66 (s, 4H) , 2.43 (s, 3H) , 2.11 -2.04 (m, 1H) , 1.95 -1.87 (m, 1H) , 0.96 (s, 9H) ; LCMS (ESI ⁺) : m/z 893.5 [M+H] ⁺.

The following Compounds 2 and 3 were prepared according to similar procedure as described for Compound 1.

General Scheme 2: Exemplary synthesis of Compound 4

Step 1: Synthesis of tert-Butyl 2- (2- (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenoxy) ethoxy) acetate

A stir bar, tert-butyl 2- (2- (tosyloxy) ethoxy) acetate (80.0 mg, 0.242 mmol) , N- (4-hydroxy-2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide Intermediate 6 (95.5 mg, 0.242 mmol) , potassium carbonate (50.2 mg, 0.363 mmol) and DMF (2 mL) were added to a 10 mL round-bottomed flask. The reaction mixture was stirred at 80 ℃ for 12 hours. The mixture was then poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 0: 1) to afford the title compound as a brown oil (120 mg, crude) .

Step 2: Synthesis of 2- (2- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxy-phenoxy) ethoxy) acetic acid hydrochloride

A stir bar, tert-butyl 2- (2- (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenoxy) ethoxy) acetate (120 mg, 0.217 mmol) , HCl/ethyl acetate (0.5 mL, 2.00 mmol) and ethyl acetate (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 1 hour. The mixture was concentrated under reduced pressure to afford the title compound as a yellow solid (100 mg, crude) .

Step 3: Synthesis of N- (4- (2- (2- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethoxy) ethoxy) -2-methoxyphenyl) -6- (1H-pyrazol-3-yl) picolinamide formate

A stir bar, 2- (2- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenoxy) ethoxy) acetic acid hydrochloride (100 mg, 0.223 mmol) , HOBt (18.1 mg, 0.134 mmol) , N-ethyl-N-isopropylpropan-2-amine (144 mg, 1.11 mmol) , EDCI (46.9 mg, 0.245 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (104 mg, 0.223 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 40 ℃ for 12 hours. The mixture was then poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.225%FA) , Mobile Phase B: ACN, Flow rate: 25 mL/min, gradient condition from 32%B to 62%) . The pure fractions were collected and evaporated under vacuum to give a residue, which was lyophilized to give the product Compound 4 as a white solid (37.0 mg, 98.0%purity, 18.7%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.89 (s, 0.3H) , 13.23 (s, 0.7H) , 10.64 -10.39 (m, 1H) , 8.99 -8.91 (m, 1H) , 8.59 (t, J = 5.6 Hz, 1H) , 8.63 -8.57 (m, 1H) , 8.32 -8.00 (m, 4H) , 7.92 (s, 1H) , 7.56 (d, J = 9.2 Hz, 1H) , 7.46 -7.34 (m, 4H) , 7.05 -6.91 (m, 2H) , 6.69 -6.60 (m, 1H) , 5.18 (s, 1H) , 4.64 (d, J = 9.6 Hz, 1H) , 4.46 (t, J = 8.4 Hz, 1H) , 4.39 -4.27 (m, 3H) , 4.23 -4.11 (m, 1H) , 4.22 -4.11 (m, 1H) , 4.09 -4.01 (m, 2H) , 3.97 -3.83 (m, 5H) , 3.73 -3.60 (m, 2H) , 2.40 (s, 3H) , 2.13 -2.05 (m, 1H) , 1.94 -1.87 (m, 1H) , 0.98 (s, 9H) ; LCMS (ESI ⁺) : m/z 825.3 [M+H] ⁺.

The following Compounds 5, 6, 7, 8 and 9 were prepared according to similar procedure as described for Compound 4.

General Scheme 3: Exemplary synthesis of Compound 10

Step 1: Synthesis of Ethyl 10- (4- (4'- (6- (1H-pyrazol-5-yl) picolinamido) -3'-methoxy- [1, 1'-biphenyl] -3-yl) piperazin-1-yl) -10-oxodecanoate

A stir bar, 10-ethoxy-10-oxodecanoic acid (94.0 mg, 0.407 mmol) , HATU (186 mg, 0.488 mmol) , DIPEA (158 mg, 1.22 mmol) and DMF (3 mL) were added to a 50 mL round-bottomed flask at room temperature. Then, N- (3-methoxy-3'- (piperazin-1-yl) - [1, 1'-biphenyl] -4-yl) -6- (1H-pyrazol-5-yl) picolinamide hydrochloride Intermediate 8 (200 mg, 0.407 mmol) was added to the reaction mixture and stirred at room temperature for 16 hours. The mixture was concentrated to dryness under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 0: 1) to afford the title compound as a brown oil (0.110 g, 90.9%purity, 36.8%yield) . LCMS (ESI ⁺) : m/z 667.4 [M+H] ⁺.

Step 2: Synthesis of 10- (4- (4'- (6- (1H-pyrazol-5-yl) picolinamido) -3'-methoxy- [1, 1'-biphenyl] -3-yl) piperazin-1-yl) -10-oxodecanoic acid hydrochloride

A stir bar, ethyl 10- (4- (4'- (6- (1H-pyrazol-5-yl) picolinamido) -3'-methoxy- [1, 1'-biphenyl] -3-yl) piperazin-1-yl) -10-oxodecanoate (110 mg, 0.165 mmol) and LiOH (26.0 mg, 0.626 mmol) , H ₂O (1 mL) and MeOH (1 mL) were added to a 25 mL round-bottomed flask. The reaction mixture was stirred at 50 ℃ for 2 hours. The resultant mixture was concentrated to dryness under reduced pressure to afford the crude product before treated with HCl solution (0.5 mL, 4M in EtOAc) and concentrated to dryness under reduced pressure to afford the crude product as a white solid (90 mg, crude) .

Step 3: Synthesis of N- (3'- (4- (10- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -10-oxodecanoyl) piperazin-1-yl) -3-methoxy- [1, 1'-biphenyl] -4-yl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 10- (4- (4'- (6- (1H-pyrazol-5-yl) picolinamido) -3'-methoxy- [1, 1'-biphenyl] -3-yl) piperazin-1-yl) -10-oxodecanoic acid hydrochloride (90.0 mg, 0.141 mmol) , HOBt (11.0 mg, 0.0850 mmol) , EDCI (32.0 mg, 0.169 mmol) , DIPEA (55.0 mg, 0.423 mmol) and DMF (3 mL) were added to a 50 mL round-bottomed flask at room temperature before treated with (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (66.0 mg, 0.141 mmol) at room temperature. The mixture was then stirred at room temperature for 3 hours. The reaction mixture was concentrated to dryness under reduced pressure to afford the crude product, which was purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.04%NH ₃H ₂O+10mM NH ₄HCO ₃) , Mobile Phase B: ACN, Flow rate: 25 mL/min, gradient condition from 43%B to 73%) . The pure fractions were collected and evaporated under vacuum to give a residue, which was lyophilized to give the product Compound 10 as a white solid (67.7 mg, 100%purity, 45.7%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.97 -13.89 (m, 0.14H) , 13.28 (br s, 0.78H) , 10.94 -10.83 (m, 0.80H) , 10.71 -10.62 (m, 0.14H) , 8.98 (s, 1H) , 8.62 -8.47 (m, 2H) , 8.29 -8.19 (m, 1H) , 8.16 -8.07 (m, 2H) , 8.00 -7.91 (m, 1H) , 7.85 (d, J = 9.2 Hz, 1H) , 7.39 (s, 5H) , 7.34 (d, J = 7.6 Hz, 2H) , 7.28 -7.21 (m, 1H) , 7.21 -7.12 (m, 1H) , 7.01 (s, 1H) , 6.96 (d, J = 6.4 Hz, 1H) , 5.15 (br s, 1H) , 4.56 (d, J = 8.8 Hz, 1H) , 4.45 (d, J = 6.8 Hz, 2H) , 4.36 (s, 1H) , 4.27 -4.18 (m, 1H) , 4.16 -4.00 (m, 3H) , 3.66 (s, 2H) , 3.63 (s, 4H) , 3.29 -3.13 (m, 4H) , 2.45 (s, 3H) , 2.35 (s, 2H) , 2.30 -2.21 (m, 1H) , 2.18 -2.09 (m, 1H) , 2.03 (d, J = 8.0 Hz, 1H) , 1.91 (s, 1H) , 1.51 (s, 4H) , 1.32 -1.23 (m, 8H) , 0.94 (s, 9H) ; LCMS (ESI ⁺) : m/z 1051.4 [M+H] ⁺.

The following Compounds 11, 12, 13, and 14 were prepared according to similar procedure as described for Compound 10 using similar amine intermediate.

General Scheme 4: Exemplary synthesis of Compound 15

Step 1: Synthesis of methyl 3- (4- (3-methoxy-4- (6- (3-methyl-1H-pyrazol-5-yl) picolinamido) phenyl) piperazin-1-yl) propanoate

Methyl 3-bromopropanoate (49.0 mg, 0.293 mmol) , N- (2-methoxy-4- (piperazin-1-yl) phenyl) -6- (3-methyl-1H-pyrazol-5-yl) picolinamide hydrochloride (100 mg, 0.233 mmol) , triethylamine (0.12 mL, 0.861 mmol) , KI (144 mg, 0.867 mmol) and NMP (2 mL) were added to a 10 mL sealed tube. The mixture was heated and stirred at 100 ℃ under microwave radiation for 2 hours. The mixture was then poured into water (8 mL) and extracted with ethyl acetate (15 mL x 2) . The organic extracts were washed with water (10 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by FCC (eluent: dichloromethane: methanol = 1: 0 to 10: 1) to afford the title compound as a yellow oil (100 mg, 91.2%purity, 65.0%yield) . LCMS (ESI ⁺) : m/z 479.2 [M+H] ⁺.

Step 2: Synthesis of 3- (4- (3-methoxy-4- (6- (3-methyl-1H-pyrazol-5-yl) -picolinamido) phenyl) piperazin-1-yl) propanoic acid

A stir bar, NaOH (1 M aqueous) (2 mL, 1 M) and methyl 3- (4- (3-methoxy-4- (6- (3-methyl-1H-pyrazol-5-yl) picolinamido) phenyl) piperazin-1-yl) propanoate (100 mg, 0.209 mmol) in THF (2 mL) were added to a 50 mL round-bottomed flask. The resultant mixture was stirred at room temperature for 1 h. The reaction mixture was concentrated and adjusted pH to 6-7 with HCl (1 M aqueous) . The mixture was extracted with ethyl acetate (30 mL x 5) . The organic extracts were washed with water (15 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the product as a yellow solid (80.0 mg, crude) .

Step 3: Synthesis of N- (4- (4- (3- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -3-oxopropyl) piperazin-1-yl) -2-methoxyphenyl) -6- (3-methyl-1H-pyrazol-5-yl) picolinamide

A stir bar, 3- (4- (3-methoxy-4- (6- (3-methyl-1H-pyrazol-5-yl) picolinamido) phenyl) piperazin-1-yl) propanoic acid (80.0 mg, 0.172 mmol) , 1-hydroxybenzotriazole (35.0 mg, 0.259 mmol) , N-ethyl-N-isopropylpropan-2-amine (112 mg, 0.867 mmol) , 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (50.0 mg, 0.261 mmol) and DMF (3 mL) were added to a 50 mL round-bottomed flask. (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine -2-carboxamide hydrochloride Intermediate 2 (80.0 mg, 0.171 mmol) was added to the mixture. The reaction mixture was stirred at room tempurater for 8 hours. The mixture was then poured into water (8 mL) and extracted with ethyl acetate (15 mL x 5) . The organic extracts were washed with brine (8 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by prep-HPLC (Column: Xbridge 150 x 30 mm x 10 um, Mobile Phase A: water (10 mM NH ₄HCO ₃) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 35%B to 65%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue which was lyophilized to give the product Compound 15 as a yellow powder (39.7 mg, 97.6%purity, 25.7%yield) . ¹H NMR (400 MHz, DMSO-d6) : δ 13.46 (br. s., 0.2H) , 12.91 (br. s., 0.8H) , 10.74 -10.18 (m, 1H) , 9.01 -8.84 (m, 1H) , 8.71 -8.41 (m, 2H) , 8.30 -7.91 (m, 4H) , 7.60 -7.26 (m, 4H) , 6.84 -6.63 (m, 2H) , 6.52 (dd, J = 2.0, 8.8 Hz, 1H) , 5.16 (d, J = 3.2 Hz, 1H) , 4.63 -4.13 (m, 5H) , 4.03 -3.76 (m, 3H) , 3.71 -3.59 (m, 2H) , 3.28 -3.10 (m, 4H) , 2.70 -2.53 (m, 6H) , 2.48 -2.21 (m, 8H) , 2.09 -1.99 (m, 1H) , 1.95 -1.84 (m, 1H) , 0.95 (s, 9H) ; LCMS (ESI ⁺) : m/z 439.3 [M/2+H] ⁺.

The following Compounds 16, 17, 18, 19, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126 and 127 were prepared according to similar procedure as described for Compound 15.

General Scheme 5: Exemplary synthesis of Compound 20

Step 1: Synthesis of Methyl 4- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperazin-1-yl) cyclohexanecarboxylate

A stir bar, N- (2-methoxy-4- (piperazin-1-yl) phenyl) -6- (1H-pyrazol-5-yl) picolinamide hydrochloride Intermediate 1 (0.200 g, 0.482 mmol) , methyl 4-oxocyclohexanecarboxylate (0.075 g, 0.482 mmol) , acetic acid (0.058 g, 0.964 mmol) and DCM (5 mL) were added to a 10 mL reaction vial. Sodium triacetoxyborohydride (0.307 g, 1.45 mmol) was added to the mixture in portions. Then the mixture was stirred at 25℃ for 12 hours. The mixture was diluted with water (10 mL) , adjusted pH to 8 with saturated sodium bicarbonate solution. Then the mixture was extracted with DCM (20 mL x 3) . The combined organic phases were washed with brine (10 mL) , dried over anhydrous Na ₂SO ₄ and filtered. The filtrate was concentrated to dryness which was purified by FCC (eluent: EtOAc) to give a mixture of cis and trans isomers of the title compound as a yellow solid (110 mg, crude) .

Step 2: Synthesis of 4- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -piperazin-1-yl) cyclohexanecarboxylic acid

A solution of methyl 4- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperazin-1-yl) cyclohexanecarboxylate (110 mg, 0.212 mmol) in 1 M LiOH (aq. ) (10 mL) was stirred at 25 ℃ for 1 hour. Then the mixture was neutralized by 1 M HCl until pH < 7 with yellow precipitation formed. The precipitation was collected to give the title compound as a yellow solid (76.0 mg crude) , which was used for next step directly.

Step 3: Synthesis of N- (4- (4- (4- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2- yl) carbamoyl) cyclohexyl) piperazin-1-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A solution of 4- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperazin-1-yl) cyclohexanecarboxylic acid (76.0 mg, 0.151 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (70.3 mg, 0.151 mmol) , 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (43.3 mg, 0.226 mmol) , 1-hydroxybenzotriazole (30.5 mg, 0.226 mmol) and triethylamine (0.063 mL, 0.452 mmol) in DMF (2 mL) was stirred at 25℃ for 12 hours. Then the mixture was extracted with DCM (10 mL x 3) . The combined organic layers were washed with brine (10 mL) , dried over Na ₂SO ₄ and filtered. The filtrated was evaporated to dryness which was further purified by prep. HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.225%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 18%B 48%) . The pure fractions were collected and the solvent was evaporated under vacuum to give the title Compound 20 as a yellow powder (15.2 mg, 10.7%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.24 (br. s., 1H) , 10.58 (br. s., 1H) , 8.98 (s, 1H) , 8.64 -8.54 (m, 1H) , 8.24 -8.17 (m, 1H) , 8.12 -8.06 (m, 1H) , 8.05 -8.00 (m, 1H) , 7.93 (br. s., 1H) , 7.71 -7.61 (m, 1H) , 7.44 -7.35 (m, 5H) , 7.00 -6.94 (m, 1H) , 6.76 -6.66 (m, 1H) , 6.55 (d, J = 8.8 Hz, 1H) , 5.16 (d, J = 3.2 Hz, 1H) , 4.57 -4.51 (m, 1H) , 4.47 -4.39 (m, 2H) , 4.35 (s, 1H) , 4.25 -4.16 (m, 1H) , 4.02 -3.80 (m, 3H) , 3.70 -3.60 (m, 2H) , 3.19 -3.11 (m, 4H) , 2.62 -2.55 (m, 4H) , 2.44 (s, 3H) , 2.26 -2.15 (m, 1H) , 2.09 -2.00 (m, 1H) , 1.96 -1.77 (m, 5H) , 1.57 -1.31 (m, 5H) , 0.95 -0.89 (m, 9H) ; LCMS (ESI ⁺) : m/z 459.3 [M/2+H] ⁺.

The following Compounds 21 and 22 were prepared according to similar procedure as described for Compound 20.

General Scheme 6: Exemplary synthesis of Compound 23

Step 1: Synthesis of Methyl 7- ( (3-methoxy-4-nitrophenyl) (methyl) amino) heptanoate

A stir bar, methyl 7- ( (3-methoxy-4-nitrophenyl) amino) heptanoate (300 mg, 0.967 mmol) , sodium hydride (38.7 mg, 0.968 mmol, 60%in mineral oil) and THF (5 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 30 minutes before treated with iodomethane (500 mg, 3.52 mmol) at 20 ℃ and stirred for 4 hours. The mixture was then poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.225%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 45%B to 75%) . The pure fractions were lyophilized to give the product as a yellow solid (130 mg, crude) .

Step 2: Synthesis of Methyl 7- ( (4-amino-3-methoxyphenyl) (methyl) amino) heptanoate

A stir bar, methyl 7- ( (3-methoxy-4-nitrophenyl) (methyl) amino) heptanoate (130 mg, 0.401 mmol) , Pd/C (200 mg) and methanol (10 mL) were added to a 50 mL round-bottomed flask. The mixture was sparged with H ₂ for 5 minutes before stirred at 25 ℃ under H ₂ (15 psi) for 12 hours. The mixture was then filtered through a pad of

and the filtrate was concentrated under reduced pressure to obtain the product as a gray oil (110 mg, crude) .

Step 3: Synthesis of Methyl 7- ( (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenyl) (methyl) amino) heptanoate

A stir bar, methyl 7- ( (4-amino-3-methoxyphenyl) (methyl) amino) heptanoate (110 mg, 0.374 mmol) , 6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinic acid Intermediate 4 (102 mg, 0.373 mmol) , HATU (170 mg, 0.447 mmol) , N-ethyl-N-isopropylpropan-2-amine (145 mg, 1.12 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 2 hours before poured into water (20 mL) and extracted with ethyl acetate (20 mL x 2) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 1: 1) to afford the title compound as a yellow oil (110 mg, crude) .

Step 4: Synthesis of 7- ( (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) (methyl) amino) heptanoic acid

A stir bar, methyl 7- ( (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenyl) (methyl) amino) heptanoate (110 mg, 0.200 mmol) , NaOH (2.0 mL, 2.0 mmol, 1 M aqueous) and THF (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 1 hour before concentrated and adjusted to obtain pH = 6-7 with HCl (1 M aqueous) . The pale yellow precipitate formed, filtrated, and dried to give the product as a white solid (80.0 mg, crude) .

Step 5: Synthesis of N- (4- ( (7- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -7-oxoheptyl) (methyl) amino) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 7- ( (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) (methyl) -amino) heptanoic acid (80.0 mg, 0.177 mmol) , HOBt (14.4 mg, 0.107 mmol) , DIPEA (114 mg, 0.882 mmol) , EDCI (37.3 mg, 0.195 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (82.8 mg, 0.177 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 25 ℃ for 12 hours before poured into water (5 mL) and extracted with ethyl acetate (10 mL x 2) . The combined organic extracts were washed with brine (5 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by prep-HPLC (Column: Waters Xbridge Prep OBD C18 150*30 5u, Mobile Phase A: water (10mM NH ₄HCO ₃) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 38%B to 68%) . The pure fractions were lyophilized to give the product Compound 23 as a yellow solid (14.6 mg, 92.6%purity, 8.83%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.86 (s, 0.3H) , 13.20 (s, 0.7H) , 10.45 (s, 1H) , 8.94 (s, 1H) , 8.55 (s, 1H) , 8.19 -7.93 (m, 4H) , 7.93 -7.80 (m, 2H) , 7.41 -7.32 (m, 4H) , 6.95 (s, 1H) , 6.37 (s, 1H) , 6.27 (dd, J = 2.4, 9.2 Hz, 1H) , 5.11 (s, 1H) , 4.51 (d, J = 9.2 Hz, 1H) , 4.44 -4.35 (m, 2H) , 4.31 (s, 1H) , 4.17 (dd, J = 5.6, 16.0 Hz, 1H) , 3.99 -3.79 (m, 3H) , 3.67 -3.57 (m, 2H) , 3.28 -3.25 (m, 2H) , 2.87 (s, 3H) , 2.40 (s, 3H) , 2.27 -2.19 (m, 1H) , 2.13 -2.05 (m, 1H) , 2.03 -1.94 (m, 1H) , 1.90 -1.81 (m, 1H) , 1.53 -1.38 (m, 4H) , 1.29 -1.23 (m, 4H) , 0.90 (s, 9H) ; LCMS (ESI ⁺) : m/z 864.4 [M+H] ⁺.

General Scheme 7: Exemplary synthesis of Compound 24

Step 1: Synthesis of methyl 3- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-1-yl) propanoate

A stir bar, methyl 3-bromopropanoate (50.0 mg, 0.299 mmol) , N- (2-methoxy-4- (piperidin-4-yl) phenyl) -6- (1H-pyrazol-5-yl) picolinamide hydrochloride Intermediate 13 (124 mg, 0.300 mmol) , triethylamine (0.4 mL, 2.87 mmol) , potassium iodide (49.5 mg, 0.298 mmol) and 1-methyl-2-pyrrolidinone (1 mL) were added to a 10 mL of sealed tube. The mixture was heated and stirred at 100 ℃ under microwave radiation for 2 hours. The mixture was then poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by FCC (eluent: dichloromethane : methanol = 1: 0 to 10: 1) to afford the title compound as a brown oil (80.0 mg, 92.5%purity, 53.3%yield) . LCMS (ESI ⁺) : m/z 464.1 [M+H] ⁺.

Step 2: Synthesis of 3- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -piperidin-1-yl) propanoic acid

A stir bar, methyl 3- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-1-yl) propanoate (80.0 mg, 0.173 mmol) , NaOH (1 M aqueous) (3 mL, 1 M) and THF (3 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 8 hours. The reaction mixture was concentrated and adjusted pH to 6-7 with HCl (1 M aqueous) with pale yellow precipitation formed. The precipitate was filtrated, and dried to afford the title compound as a white solid (70.0 mg, crude) .

Step 3: Synthesis of N- (4- (1- (3- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -3-oxopropyl) piperidin-4-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide formate

A stir bar, 3- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-1-yl) propanoic acid (70.0 mg, 0.156 mmol) , HOBt (12.7 mg, 0.094 mmol) , N-ethyl-N-isopropylpropan-2-amine (100 mg, 0.774 mmol) , EDCI (32.8 mg, 0.171 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (72.6 mg, 0.155 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 30 ℃ for 12 hours. The mixture was then poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.225%FA) , Mobile Phase B: ACN, Flow rate: 25 mL/min, gradient condition from 16%B to 46%) . The pure fractions were collected and evaporated under vacuum to give a residue, which was lyophilized to give the product Compound 24 as a white solid (40.1 mg, 96.0%purity, 27.2%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.26 (br s, 1H) , 10.65 (s, 1H) , 9.02 -8.86 (m, 1H) , 8.82 (d, J = 9.6 Hz, 1H) , 8.60 (t, J = 6.0 Hz, 1H) , 8.27 -8.03 (m, 5H) , 7.88 (br s, 1H) , 7.43 -7.31 (m, 4H) , 7.02 -6.95 (m, 2H) , 6.90 -6.86 (m, 1H) , 5.17 (br s, 1H) , 4.59 (d, J = 9.6 Hz, 1H) , 4.49 -4.41 (m, 2H) , 4.37 (br s, 1H) , 4.25 (dd, J = 5.2, 16.0 Hz, 1H) , 3.92 (s, 3H) , 3.73 -3.59 (m, 2H) , 3.15 -2.98 (m, 2H) , 2.65 -2.54 (m, 3H) , 2.47 -2.39 (m, 2H) , 2.36 (s, 3H) , 2.12 -1.99 (m, 3H) , 1.95 -1.86 (m, 2H) , 1.85 -1.75 (m, 3H) , 1.00 (s, 9H) ; LCMS (ESI ⁺) : m/z 862.4 [M+H] ⁺.

The following Compounds 25 and 26 were prepared according to similar procedure as described for Compound 24.

General Scheme 8: Exemplary synthesis of Compound 27

Step 1: Synthesis of methyl 3- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -4-cyanopiperidin-1-yl) propanoate

Methyl 3-bromopropanoate (25.8 mg, 0.154 mmol) , N- (4- (4-cyanopiperidin-4-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide hydrochloride Intermediate 11 (50.0 mg, 0.114 mmol) , triethylamine (48.0 mg, 0.474 mmol) , potassium iodide (76.7 mg, 0.462 mmol) and NMP (2 mL) were added to a 10 mL sealed tube. The mixture was heated and stirred at 100 ℃ under microwave radiation for 2 hours. The mixture was then poured into water (8 mL) and extracted with ethyl acetate (15 mL x 2) . The organic extracts were washed with water (10 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 0: 1) to afford the title compound as a colorless oil (65 mg, 91.8%purity, 79.1%yield) . LCMS (ESI ⁺) : m/z 489.2 [M+H] ⁺.

Step 2: Synthesis of 3- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -4-cyanopiperidin-1-yl) propanoic acid

A stir bar, LiOH (1 M aqueous) (2 mL, 1 M) and methyl 3- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -4-cyanopiperidin-1-yl) propanoate (65.0 mg, 0.122 mmol) in THF (2 mL) were added to a 50 mL round-bottomed flask. The resultant mixture was stirred at room temperature for 20 min. The reaction mixture was concentrated and adjusted pH to 6-7 with HCl (1 M aqueous) with brown precipitation formed. The precipitate was filtrated, and dried to give the product as a white solid (45.0 mg, crude) .

Step 3: Synthesis of N- (4- (4-cyano-1- (3- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin -1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -3-oxopropyl) piperidin-4-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 3- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -4-cyanopiperidin-1-yl) propanoic acid (45.0 mg, 0.095 mmol) , 1-hydroxybenzotriazole (19.2 mg, 0.142 mmol) , N-ethyl-N-isopropylpropan-2-amine (62.0 mg, 0.480 mmol) , 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (27.3 mg, 0.142 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask. (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine -2-carboxamide hydrochloride Intermediate 2 (44.3 mg, 0.095 mmol) was added to the mixture. The reaction mixture was stirred at 40 ℃ for 12 hours. The mixture was then poured into water (8 mL) and extracted with ethyl acetate (15 mL x 2) . The organic extracts were washed with brine (8 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by prep-HPLC (Column: Xbridge 150 x 30 mm x 10 um, Mobile Phase A: water (10 mM NH ₄HCO ₃) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 34%B to 54%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue which was lyophilized to give the product Compound 27 as a white powder (12.1 mg, 99.9%purity, 14.4%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.89 (br. s , 0.2H) , 13.25 (br. s., 0.8H) , 10.78 (s, 0.8H) , 10.59 (s, 0.2H) , 9.01 -8.84 (m, 1H) , 8.80 -8.52 (m, 2H) , 8.40 (d, J = 8.4 Hz, 1H) , 8.27 -7.86 (m, 4H) , 7.48 -7.13 (m, 6H) , 7.06 -6.92 (m, 1H) , 5.18 (d, J = 3.6 Hz, 1H) , 4.59 (d, J = 9.6 Hz, 1H) , 4.50 -4.23 (m, 4H) , 4.13 -3.84 (m, 3H) , 3.75 -3.53 (m, 2H) , 3.24 -2.95 (m, 2H) , 2.75 -2.54 (m, 3H) , 2.40 -2.01 (m, 11H) , 1.94 -1.85 (m, 1H) , 1.03 -0.90 (m, 9H) ; LCMS (ESI ⁺) : m/z 444.3 [M/2+H] ⁺.

The following Compound 28 was prepared according to similar procedure as described for Compound 27.

General Scheme 9: Exemplary synthesis of Compound 29

Step 1: Synthesis of tert-Butyl 2- (8- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) -2, 8-diazaspiro [4.5] decan-2-yl) acetate

N- (2-methoxy-4- (2, 8-diazaspiro [4.5] decan-8-yl) phenyl) -6- (1H-pyrazol-3-yl) picolinamide trifluoroacetate (120 mg, 0.220 mmol) , N, N-diisopropylethylamine (142 mg, 1.10 mmol) and DCM (4 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 12 hours after treating with tert-butyl bromoacetate (42.8 mg, 0.219 mmol) . The reaction mixture was extracted with dichloromethane (30 mL x 2) , washed with brine and dried over Na ₂SO ₄. The reaction mixture was filtered and concentrated under reduced pressure to give crude product which was purified by FCC (eluent: dichloromethane : methanol = 1: 0 to 10: 1) to afford the title compound as a yellow oil (80.0 mg, 100%by HPLC, 66.7%yield) .

Step 2: Synthesis of 2- (8- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) -2, 8-diazaspiro [4.5] decan-2-yl) acetic acid trifluoroacetate

tert-Butyl 2- (8- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) -2, 8-diazaspiro [4.5] decan-2-yl) acetate (80.0 mg, 0.146 mmol) , TFA (1 mL) and DCM (1 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 2 hours. The reaction mixture was concentrated under reduced pressure to give the product as a yellow oil (80.0 mg, crude) .

Step 3: Synthesis of N- (4- (2- (2- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethyl) -2, 8-diazaspiro [4.5] decan-8-yl) -2-methoxyphenyl) -6- (1H-pyrazol-3-yl) picolinamide

2- (8- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) -2, 8-diazaspiro [4.5] decan-2-yl) acetic acid (80.0 mg, 0.132 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (61.8 mg, 0.132 mmol) , HATU (60.4 mg, 0.159 mmol) , N, N-diisopropylethylamine (85.5 mg, 0.662 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 2 hours. The reaction mixture was diluted with water, extracted with dichloromethane (20 mLx2) , washed with brine and dried over Na ₂SO ₄. The organic layer was filtered and concentrated under reduced pressure to give crude product by prep-HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.225%FA) , Mobile Phase B: ACN, Flow rate: 25 mL/min, gradient condition from 22%B to 52%) . The pure fractions were collected and evaporated under vacuum to give a residue, which was lyophilized to give the product as a yellow solid (42.6 mg, 97.0%purity, 33.2%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 10.53 (br. s., 1H) , 8.96 (s, 1H) , 8.67 -8.59 (m, 1H) , 8.19 -8.13 (m, 1H) , 8.10 (t, J = 7.8 Hz, 1H) , 8.05 -8.02 (m, 1H) , 7.86 (s, 1H) , 7.75 (d, J = 9.8 Hz, 1H) , 7.48 -7.35 (m, 5H) , 6.99 (d, J = 2.0 Hz, 1H) , 6.69 (s, 1H) , 6.51 (d, J = 8.8 Hz, 1H) , 4.55 -4.23 (m, 6H) , 3.91 (s, 3H) , 3.72 -3.58 (m, 4H) , 3.15 -3.00 (m, 4H) , 2.75 -2.65 (m, 2H) , 2.60 -2.55 (m, 1H) , 2.45 (s, 3H) , 2.12 -2.00 (m, 1H) , 1.95 -1.86 (m, 1H) , 1.71 -1.63 (m, 6H) , 0.96 (s, 9H) ; LCMS (ESI ⁺) : m/z 903.5 [M+H] ⁺.

General Scheme 10: Exemplary synthesis of Compound 30

Step 1: Synthesis of methyl 8-azaspiro [4.5] decane-2-carboxylate hydrochloride

A stir bar, 8-tert-butyl 2-methyl 8-azaspiro [4.5] decane-2, 8-dicarboxylate (200 mg, 0.673 mmol) , and HCl/EtOAc (10 mL, 4 M) were added to a 50 mL round bottom flask. The reaction vessel was stirred at room temperature for 2 hours. The mixture was concentrated under reduce pressure to give the product as a white solid (155 mg, crude) .

Step 2: Synthesis of methyl 8- (3-methoxy-4-nitrophenyl) -8-azaspiro [4.5] decane-2-carboxylate

Methyl 8-azaspiro [4.5] decane-2-carboxylate hydrochloride (155 mg, 0.663 mmol) , 4-fluoro-2-methoxy-1-nitrobenzene (170 mg, 0.993 mmol) and potassium carbonate (229 mg, 1.66 mmol) in DMSO (4 mL) mixture. The reaction mixture was stirred at 90 ℃ for 16 hours. The reaction mixture was cooled to room temperature, and then poured into water (15 mL) and extracted with dichloromethane (20 mL x 2) . The organic extracts were washed with water (15 mL x 2) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by prep. TLC (eluent: petroleum ether: ethyl acetate = 1: 1) to afford the title compound as a yellow solid (225 mg, 100%purity, 97.4%yield) . LCMS (ESI ⁺) : m/z 349.2 [M+H] ⁺.

Step 3: Synthesis of methyl 8- (4-amino-3-methoxyphenyl) -8-azaspiro [4.5] decane-2-carboxylate

A solution consisting of methyl 8- (3-methoxy-4-nitrophenyl) -8-azaspiro [4.5] decane-2-carboxylate (225 mg, 0.646 mmol) , iron powder (180 mg, 3.22 mmol) , NH ₄Cl (518 mg, 9.68 mmol) , EtOH (10 mL) , and H ₂O (2.5 mL) were stirred at 80 ℃ for 1 hour. The reaction mixture was cooled to room temperature and filtered through a pad of

The filtrate was comcentrated and extracted with ethyl acetate (70 mL x 3) and the combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the title title product as a black soild (180 mg, crude) .

Step 4: Synthesis of methyl 8- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) -8-azaspiro [4.5] decane-2-carboxylate

A stir bar, 6- (1H-pyrazol-3-yl) picolinic acid Intermediate 5 (88.0 mg, 0.465 mmol) , N-ethyl-N-isopropylpropan-2-amine (301 mg, 2.33 mmol) , HATU (265 mg, 0.697 mmol) and dichloromethane (3 mL) were added to a 50 mL round-bottomed flask. methyl 8- (4-amino-3-methoxyphenyl) -8-azaspiro [4.5] decane-2-carboxylate (180 mg, 82.4%purity, 0.466 mmol) was added to the mixture. The reaction mixture was stirred at room tempurature for 1 hour. The mixture was then poured into water (10 mL) and extracted with dichloromethane (15 mL x 2) . The organic extracts were washed with brine (8 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1 : 0 to 0 : 1) to afford the title compound as a yellow solid (180 mg, crude) .

Step 5: Synthesis of 8- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) -8-azaspiro [4.5] decane-2-carboxylic acid

A stir bar, LiOH (1 M aqueous) (3 mL, 3 M) and methyl 8- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) -8-azaspiro [4.5] decane-2-carboxylate (180 mg, 0.368 mmol) in THF (3 mL) were added to a 50 mL round-bottomed flask. The resultant mixture was stirred at room temperature for 1.5 hours. The reaction mixture was concentrated and adjusted pH to 6-7 with HCl (1 M aqueous) with brown precipitation formed. The precipitate was filtrated, and dried to give the product as a brown solid (170 mg, crude) .

Step 6: Synthesis of 8- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) -N- ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) -8-azaspiro [4.5] decane-2-carboxamide

A stir bar, 8- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) -8-azaspiro [4.5] decane-2-carboxylic acid (100 mg, 0.210 mmol) , 1-hydroxybenzotriazole (42.6 mg, 0.315 mmol) , N-ethyl-N-isopropylpropan-2-amine (137 mg, 1.06 mmol) , 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (60.5 mg, 0.316 mmol) and DMF (3 mL) were added to a 50 mL round-bottomed flask. (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine -2-carboxamide hydrochloride Intermediate 2 (98.2 mg, 0.210 mmol) was added to the mixture. The reaction mixture was stirred at room temperature for 8 hours. The mixture was then poured into water (8 mL) and extracted with ethyl acetate (15 mL x 2) . The organic extracts were washed with brine (8 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by prep-HPLC (Column: DuraShell 150 x 25 mm x 5 um, Mobile Phase A: water (10 mM NH ₄HCO ₃) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 38%B to 58%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue which was lyophilized to give the product as a yellow powder (51.6 mg, 97.8%purity, 27.0%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.85 (br. s., 0.3H) , 13.21 (br. s., 0.7H) , 10.67 -10.26 (m, 1H) , 8.95 (s, 1H) , 8.70 -8.45 (m, 1H) , 8.29 -7.72 (m, 5H) , 7.71 -7.10 (m, 5H) , 7.05 -6.86 (m, 1H) , 6.74 -6.61 (m, 1H) , 6.52 (d, J = 8.8 Hz, 1H) , 5.20 -5.06 (m, 1H) , 4.58 -4.13 (m, 5H) , 4.01 -3.74 (m, 3H) , 3.70 -3.55 (m, 2H) , 3.22 -3.03 (m, 4H) , 3.02 -2.91 (m, 1H) , 2.41 (s, 3H) , 2.26 -1.93 (m, 2H) , 1.91 -1.37 (m, 10H) , 1.00 -0.82 (m, 9H) . LCMS (ESI ⁺) : m/z 888.2 [M+H] ⁺.

The following Compounds 128, 129, 130, 131, 132, 133, 134, 135, 136 and 137 were prepared according to similar procedure as described for Compound 30.

General Scheme 11: Exemplary synthesis of Compound 31

Step 1: Synthesis of tert-Butyl 3- (3-hydroxypropoxy) propanoate

A stir bar, propane-1, 3-diol (1.00 g, 13.1 mmol) and DMSO (10 mL) were added to a 50 mL round-bottomed flask. The mixture was stirred at 80 ℃ for 10 minutes. Then sodium hydroxide (0.210 g, 5.26 mmol) and H ₂O (2 mL) were added to the mixture. Then tert-butyl acrylate (2.02 g, 15.8 mmol) was added dropwise to the solution and allowed to stir for 12 hours at 80 ℃. The reaction mixture was diluted with water (20 mL) , extracted with dichloromethane (50 mL x 2) , washed with brine and dried over Na ₂SO ₄. The organic layer was filtered and concentrated under reduced pressure to give crude product as a yellow oil (2.00 g, crude) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 3.49 (t, J = 6.1 Hz, 2H) , 3.43 -3.35 (m, 5H) , 2.38 -2.31 (m, 2H) , 1.60 -1.51 (m, 2H) , 1.35 (s, 9H) .

Step 2: Synthesis of tert-Butyl 3- (3- (tosyloxy) propoxy) propanoate

A stir bar, tert-butyl 3- (3-hydroxypropoxy) propanoate (1.50 g, 7.34 mmol) , 4-methylbenzene-1-sulfonyl chloride (2.10 g, 11.0 mmol) , triethylamine (2.23 g, 22.0 mmol) and DCM (15 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at room temperature for 2 hours. The resultant mixture was poured into water (30 mL) and extracted with dichloromethane (20 mL x 3) . The combined organic extracts were washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude title product, which was purified by FCC (eluent: petroleum ether : ethyl acetate = 6 : 1 to 3 : 1) to afford the title compound as a yellow oil (520 mg, 95.4%purity, 18.8%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 7.87 -7.75 (m, 1H) , 7.40 -7.31 (m, 2H) , 4.16 -4.08 (m, 2H) , 3.59 -3.53 (m, 2H) , 3.47 -3.41 (m, 2H) , 2.47 -2.43 (m, 3H) , 2.42 -2.35 (m, 2H) , 1.93 -1.84 (m, 2H) , 1.45 -1.42 (m, 9H) . LCMS (ESI ⁺) : m/z 381.2 [M+23] ⁺.

Step 3: Synthesis of tert-Butyl 3- (3- (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenoxy) propoxy) propanoate

A stir bar, tert-butyl 3- (3- (tosyloxy) propoxy) propanoate (0.182 g, 0.507 mmol) , N- (4-hydroxy-2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide Intermediate 6 (0.200 g, 0.507 mmol) , potassium carbonate (0.210 g, 1.52 mmol) and DMF (5 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 85 ℃ for 2 hours. The resultant mixture was poured into ethyl acetate (30 mL) and washed with water (10 mL x 3) and the organic layer was dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude mixture product, which was purified by FCC (eluent: petroleum ether : ethyl acetate=2: 1 to 1: 1) to afford the title compound as a yellow oil (107 mg, 88.8 %purity, 32.3%yield) .

Step 4: Synthesis of 3- (3- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) propoxy) propanoic acid hydrochloride

A stir bar, tert-butyl 3- (3- (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenoxy) propoxy) propanoate (107 mg, 0.164 mmol) , HCl/EtOAc (5.0 mL, 20 mmol) and EtOAc (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at room temperature for 12 hours. The resultant mixture was concentrated under reduced pressure to afford the crude product (87.9 mg, crude) . The resultant mixture was used in the next step without further purification.

Step 5: Synthesis of N- (4- (3- (3- ( ( (S) -1- ( (2S, 4R) -4-Hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -3-oxopropoxy) propoxy) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 3- (3- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) propoxy) propanoic acid hydrochloride (87.9 mg, 0.184 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (86.2 mg, 0.185 mmol) , HATU (84.1 mg, 0.221 mmol) , DIPEA (95.3 mg, 0.737 mmol) and DMF (2 mL) were added to the mixture. The reaction mixture was stirred at room temperature for 2 hours. The resultant mixture was poured into ethyl acetate (30 mL) and washed with water (10 mL x 3) and the organic layer was dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude mixture, which was purified by prep-HPLC (Column: Xtimate C18 150 x 25mm x 5um, Mobile Phase A: water (0.225%FA) -ACN, Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 38 %B to 68 %) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue which was lyophilized to give the product as a white powder (20.0 mg, 100 %purity, 12.7 %yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 10.55 (s, 1H) , 8.97 (s, 1H) , 8.61 -8.53 (m, 1H) , 8.18 -8.14 (m, 1H) , 8.09 (t, J = 7.6 Hz, 2H) , 8.04 -8.01 (m, 1H) , 7.95 (d, J = 9.5 Hz, 1H) , 7.84 (s, 1H) , 7.43 -7.35 (m, 4H) , 7.01 -6.96 (m, 1H) , 6.75 -6.68 (m, 1H) , 6.61 -6.54 (m, 1H) , 4.56 (d, J = 9.5 Hz, 1H) , 4.46 -4.38 (m, 2H) , 4.35 (s, 1H) , 4.25 -4.18 (m, 1H) , 4.06 -4.01 (m, 2H) , 3.93 (s, 3H) , 3.68 -3.56 (m, 6H) , 2.61 -2.53 (m, 1H) , 2.43 (s, 3H) , 2.39 -2.32 (m, 1H) , 2.09 -1.85 (m, 4H) , 0.98 -0.89 (m, 9H) ; LCMS (ESI ⁺) : m/z 853.4 [M+H] ⁺.

The following Compound 32 was prepared according to similar procedure as described for Compound 31.

General Scheme 12: Exemplary synthesis of Compound 33

Step 1: Synthesis of 5-Fluoro-N- (2-methoxy-4- (piperidin-4-yl) phenyl) -6- (1H-pyrazol-5-yl) picolinamide hydrochloride

A stir bar, tert-butyl 4- (4- (5-fluoro-6- (1H-pyrazol-3-yl) picolinamido) -3-methoxy-phenyl) piperidine-1-carboxylate (114 mg, 0.230 mmol) , HCl/MeOH (5.0 mL, 20 mmol, 4M) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at room temperature for 1 h. The resultant mixture was concentrated to dryness under reduced pressure to afford the title product as a yellow solid (90 mg, 99.8%purity, 90.4%yield) . LCMS (ESI ⁺) : m/z 396.2 [M+H] ⁺.

Step 2: Synthesis of tert-Butyl 2- (4- (4- (5-fluoro-6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-1-yl) acetate

A stir bar, 5-fluoro-N- (2-methoxy-4- (piperidin-4-yl) phenyl) -6- (1H-pyrazol-3-yl) picolinamide hydrochloride (45.0 mg, 0.104 mmol) , tert-butyl 2-bromoacetate (20.3 mg, 0.104 mmol) and triethylamine (31.6 mg, 0.312 mmol) in THF (1 mL) was added to a 50 mL round-bottomed flask. The reaction mixture was stirred at room temperature for 12 hours. The reaction mixture was diluted with water, extracted with dichloromethane (20 mL x 2) , washed with brine and dried over Na ₂SO ₄. The organic layer was filtered and concentrated under reduced pressure to afford the title compound as a yellow solid (62.0 mg, crude) and was used into the next step without further purification.

Step 3: Synthesis of 2- (4- (4- (5-Fluoro-6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-1-yl) acetic acid trifluoroacetate

A stir bar, tert-butyl 2- (4- (4- (5-fluoro-6- (1H-pyrazol-3-yl) picolinamido) -3-methoxy-phenyl) piperidin-1-yl) acetate (62.0 mg, 0.122mmol) , 2, 2, 2-trifluoroacetic acid (1 mL) and DCM (1 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at room temperature for 1 hour. The mixture was concentrated to dryness under reduced pressure to afford the title compound as a yellow solid (55.0 mg, crude) .

Step 4: Synthesis of 5-Fluoro-N- (4- (1- (2- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethyl) piperidin-4-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 2- (4- (4- (5-fluoro-6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-1-yl) acetic acid trifluoroacetate (55.0 mg, crude) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (45.3 mg, 0.097 mmol) , 1-hydroxybenzotriazole (19.6 mg, 0.145 mmol) , triethylamine (29.4 mg, 0.291 mmol) and DMF (1.5 mL) were added to a 50 mL round-bottomed flask. Then 1- (3-dimethylaminopropyl) -3-ethylcarbodimide hydrochloride (27.9 mg, 0.146 mmol) was added to the mixture. The reaction mixture was stirred at 30 ℃ for 12 hours. The resultant mixture was poured into ethyl acetate (30 mL) and washed with water (10 mL x 3) and the organic layer was dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude mixture product. The crude mixture product was purified by prep-HPLC (Column: Xbridge 150*30mm*10um, Mobile Phase A: water (10mM NH ₄HCO ₃) -ACN, Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 45%B to 75%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue which was lyophilized to give the Compound 33 as a white powder (11.6 mg, 95.7 %purity, 13.2 %yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 14.08 (br. S., 0.5H) , 13.38 (br. S., 0.5H) , 10.57 -10.37 (m, 1H) , 9.00 -8.90 (m, 1H) , 8.73 -8.57 (m, 1H) , 8.33 -7.94 (m, 3H) , 7.88 -7.49 (m, 2H) , 7.45 -7.36 (m, 4H) , 7.05 -6.85 (m, 3H) , 5.21 -5.00 (m, 1H) , 4.61 -4.49 (m, 1H) , 4.49 -4.21 (m, 4H) , 4.03 -3.78 (m, 3H) , 3.71 -3.57 (m, 2H) , 3.18 -2.89 (m, 4H) , 2.45 -2.38 (m, 3H) , 2.34 -2.21 (m, 2H) , 2.12 -1.60 (m, 7H) , 1.01 -0.91 (m, 9H) ; LCMS (ESI ⁺) : m/z 433.7 [M/2+H] ⁺.

General Scheme 13: Exemplary synthesis of Compound 34

Step 1: Synthesis of tert-butyl 4- (2-hydroxyethoxy) butanoate

To a solution of ethane-1, 2-diol (4.18 g, 67.3 mmol) in DMF (50 mL) at 0 ℃ was added NaH (1.35 g, 33.8 mmol, 60%in mineral oil) . The resulting mixture was stirred at 0 ℃ for 20 minutes and tert-butyl 4-bromobutanoate (5.00 g, 22.4 mmol) . The resulting reaction system reaction at 80 ℃ for 8 hours. The reaction was quenched by water (100 mL) , then extracted with ethyl acetate (150 mL × 2) . The organic extracts were washed with brine (100 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by FCC (eluent: petroleum ether: ethyl acetate from 1: 0 to 1: 1) to give the title compound as a coloueless oil (500 mg, crude) .

Step 2: Synthesis of tert-butyl 4- (2- (tosyloxy) ethoxy) butanoate

A stir bar, tert-butyl 4- (2-hydroxyethoxy) butanoate (500 mg, 2.45 mmol) , triethylamine (1.02 mL, 7.32 mmol) and dichoromethane (5 mL) were added to a 100 mL round-bottomed flask. After treating with 4-methylbenzene-1-sulfonyl chloride (466 mg, 2.44 mmol) , the reaction mixture was stirred at room temperature for 1 h. The reaction mixture was diluted with water (20 mL) , extracted with dichoromethane (20 mL x 2) , washed with brine (20 mL) and dried over Na ₂SO ₄. The organic layer was filtered and concentrated under reduced pressure to give crude product which was purified by FCC (petroleum ether: ethyl acetate from 1: 0 to 4: 1) to give the crude product. The crude product was purified by prep. HPLC (Column: Agela Durashell C18 150 x 25 5 u, Mobile Phase A: water (0.225%FA) , Mobile Phase B: acetonitrile, gradient condition from 55%B to 85%) . The pure fractions were collected and the solvent was evaporated under vacuum, and then lyophilized to give the title compound as a white solid (120 mg, 98.4%purity, 13.5%yield) .

LCMS (ESI ⁺) : m/z 381.2 [M+H] ⁺

Step 3: Synthesis of tert-butyl 4- (2- (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenoxy) ethoxy) butanoate

A stir bar, tert-butyl 4- (2- (tosyloxy) ethoxy) butanoate (120 mg, 0.335 mmol) , N- (4-hydroxy-2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide Intermediate 6 (131 mg, 0.332 mmol) , potassium carbonate (139 mg, 1.01 mmol) and DMF (3 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 85 ℃ for 10 hours. The resultant mixture was poured into ethyl acetate (20 mL) and washed with water (20 mL x 3) and the organic layer was dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude mixture product, which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1/0 to 1/1) to afford the title compound as a pale yellow solid (100 mg, crude) .

Step 4: Synthesis of 4- (2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxy-phenoxy) ethoxy) butanoic acid hydrochloride

tert-butyl 4- (2- (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenoxy) ethoxy) butanoate (100 mg, 0.172 mmol) and HCl/dioxane (10 mL, 4M) were added to a 100 mL round-bottomed flask. The reaction mixture was stirred at 25 ℃ for 1.5 hours. The reaction mixture was concentrated under redcued pressrure to give the product as a pale yellow solid (76.0 mg, crude) .

Step 5: Synthesis of N- (4- (2- (4- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -4-oxobutoxy) ethoxy) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 4- (2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) ethoxy) butanoic acid hydrochloride (76.0 mg, 65.1%purity, 0.104 mmol) , 1-hydroxybenzotriazole (21.0 mg, 0.155 mmol) , N-ethyl-N-isopropylpropan-2-amine (67.0 mg, 0.518 mmol) , 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (29.8 mg, 0.155 mmol) and DMF (3 mL) were added to a 50 mL round-bottomed flask. (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (48.5 mg, 0.104 mmol) was added to the mixture. The reaction mixture was stirred at room tempurater for 8 hours. The mixture was then poured into water (15 mL) and extracted with ethyl acetate (25 mL x 3) . The organic extracts were washed with brine (15 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by prep-HPLC (Column: Agela Durashell C18 150 x 25 5 u, Mobile Phase A: water (0.225%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 36%B to 66%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue which was lyophilized to give the product. The residue was purified SFC (separation condition: DAICEL CHIRALPAK AS-H (250 mm x 30 mm, 5 um) ; Mobile phase: A: Supercritical CO ₂, B: 0.1%NH ₃ ·H ₂O EtOH, A: B = 55: 45 at 50 mL/min) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue which was lyophilized to give the Compound 34 as a white powder (23.1 mg, 99.4%purity, 25.9%yield) .

¹H NMR (400 MHz, DMSO-d ₆) : δ 13.39 (br. s., 1H) , 10.55 (s, 1H) , 8.97 (s, 1H) , 8.69 -8.52 (m, 1H) , 8.21 -7.79 (m, 6H) , 7.46 -7.32 (m, 4H) , 6.99 (d, J = 2.0 Hz, 1H) , 6.75 (d, J = 2.4 Hz, 1H) , 6.60 (dd, J = 2.4, 8.8 Hz, 1H) , 5.38 -4.96 (m, 1H) , 4.54 (d, J = 9.2 Hz, 1H) , 4.47 -4.31 (m, 3H) , 4.21 (dd, J = 5.6, 16.0 Hz, 1H) , 4.15 -4.06 (m, 2H) , 3.98 -3.89 (m, 3H) , 3.74 -3.61 (m, 4H) , 3.47 -3.44 (m, 2H) , 2.43 (s, 3H) , 2.37 -2.17 (m, 2H) , 2.07 -1.86 (m, 2H) , 1.82 -1.66 (m, 2H) , 0.94 (s, 9H) ; LCMS (ESI ⁺) : m/z 853.4 [M+H] ⁺.

The following Compounds 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47 were prepared according to similar procedure as described for Compound 34.

General Scheme 14: Exemplary synthesis of Compound 48

Step 1: Synthesis of tert-Butyl 2- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3- (4- ( (dimethylamino) methyl) piperidin-1-yl) phenyl) piperidin-1-yl) acetate

A stir bar, N- (2- (4- ( (dimethylamino) methyl) piperidin-1-yl) -4- (piperidin-4-yl) phenyl) -6- (1H-pyrazol-5-yl) picolinamide trifluoroacetate Intermediate 13 (150 mg, 0.249 mmol) , tert-butyl 2-bromoacetate (48.6 mg, 0.249 mmol) , triethylamine (0.2 mL, 1.44 mmol) and tetrahydrofuran (3 mL) were added to a 10 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 12 hours. The mixture was then poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by FCC (dichloromethane : methanol = 1: 0 to 10: 1) to afford the title compound as brown oil (50.0 mg, crude) .

Step 2: Synthesis of 2- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3- (4- ( (dimethylamino) methyl) piperidin-1-yl) phenyl) piperidin-1-yl) acetic acid trifluoroacetate

A stir bar, tert-butyl 2- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3- (4- ( (dimethyl-amino) methyl) piperidin-1-yl) phenyl) piperidin-1-yl) acetate (50.0 mg, 0.083 mmol) and dichloromethane (2 mL) were added to a 50 mL round-bottomed flask. To the mixture was added trifluoroacetic acid (2 mL) dropwise with stirring at 25 ℃ for 1 hour. The mixture was concentrated to dryness under reduced pressure to afford the title compound as yellow oil (50.0 mg, crude) .

Step 3: Synthesis of N- (2- (4- ( (dimethylamino) methyl) piperidin-1-yl) -4- (1- (2- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethyl) piperidin-4-yl) phenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 2- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3- (4- ( (dimethylamino) -methyl) piperidin-1-yl) phenyl) piperidin-1-yl) acetic acid trifluoroacetate (50.0 mg, 0.076 mmol) , HATU (34.6 mg, 0.091 mmol) , N-ethyl-N-isopropylpropan-2-amin (49.0 mg, 0.379 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (35.4 mg, 0.076 mmol) and N, N-dimethylformamide (2 mL) were added to a 50 mL round-bottomed flask before stirred at 25 ℃ for 2 hours. The mixture was diluted with water (10 mL) and extracted with ethyl acetate (20 mLx2) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by prep-HPLC (Column: Waters Xbridge Prep OBD C18 150*30 5u, Mobile Phase A: water (10mM NH ₄HCO ₃) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 40%B to 70%) . The pure fractions were lyophilized to give the Compound 48 as a white solid (14.0 mg, 95.1%purity, 18.3%yield) . ¹H NMR (400MHz, DMSO-d ₆) : δ 13.22 (s, 1H) , 10.81 -10.75 (m, 1H) , 8.89 (s, 1H) , 8.59 (t, J = 6.0 Hz, 1H) , 8.34 -8.27 (m, 1H) , 8.21 -8.15 (m, 1H) , 8.11 -8.05 (m, 2H) , 7.93 -7.87 (m, 1H) , 7.79 (d, J = 9.6 Hz, 1H) , 7.41 -7.34 (m, 4H) , 7.09 (s, 1H) , 7.05 -6.98 (m, 2H) , 5.12 (d, J = 3.6 Hz, 1H) , 4.50 (d, J = 9.6 Hz, 1H) , 4.42 (t, J = 8.0 Hz, 1H) , 4.38 -4.31 (m, 2H) , 4.28 -4.20 (m, 1H) , 3.67 -3.55 (m, 2H) , 3.10 -3.02 (m, 1H) , 2.99 -2.89 (m, 6H) , 2.61 -2.54 (m, 2H) , 2.37 (s, 3H) , 2.27 -2.17 (m, 2H) , 2.01 (s, 6H) , 1.98 -1.92 (m, 2H) , 1.91 -1.86 (m, 1H) , 1.85 -1.81 (m, 1H) , 1.81 -1.74 (m, 2H) , 1.73 -1.62 (m, 4H) , 1.53 -1.45 (m, 1H) , 1.41 -1.32 (m, 2H) , 0.92 (s, 9H) ; LCMS (ESI ⁺) : m/z 958.5 [M+H] ⁺.

General Scheme 15: Exemplary synthesis of Compound 49

Step 1: Synthesis of N- (4- (3- (4-hydroxybutoxy) prop-1-yn-1-yl) -2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide

N- (4-bromo-2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide (300 mg, 0.656 mmol) , 4- (prop-2-yn-1-yloxy) butan-1-ol (420 mg, 3.28 mmol) , TEA (1.5 mL) and DMF (1.5 mL) were added to a microwave tube before sparged with Ar for 5 min, then treated with PdCl ₂ (Cy*Phine) ₂ (84.0 mg, 0.065 mmol) and CuI (25.2 mg, 0.132 mmol) . The mixture was sparged with Ar for another 5 minutes and then stirred at 100 ℃ under microwave irradiation for 0.5 hour. The mixture was cooled to room temperature, filtered and the filtrate was concentrated to dryness under reduced pressure to afford the crude product. The residue was diluted with ethyl acetate (50 mL) and washed by brine (30 mL x 3) . The organic layer was dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude product as a black oil, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 1: 1) to afford the title compound as a yellow solid (200 mg, crude) .

Step 2: Synthesis of 4- ( (3- (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenyl) prop-2-yn-1-yl) oxy) butanoic acid

N- (4- (3- (4-hydroxybutoxy) prop-1-yn-1-yl) -2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide (160 mg, 0.317 mmol) was dissolved in DCM/H ₂O (2 mL/1 mL) and stirred before treated with (diacetoxyiodo) benzene (306 mg, 0.950 mmol) and 2, 2, 6, 6-tetramethylpiperidinooxy (14.9 mg, 0.095 mmol) at 0 ℃. The reaction mixture was then stirred at room-temperature for 3.5 hours before quenched by aqueous Na ₂S ₂O ₃ (20 mL) . The reaction mixture was extracted with DCM (20 mL) , washed with aqueous Na ₂CO ₃ (20 mL x 3) . The organic layer was dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to give crude product as a pale yellow oil (160 mg, crude) .

Step 3: Synthesis of 4- ( (3- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) prop-2-yn-1-yl) oxy) butanoic acid

4- ( (3- (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) -picolinamido) phenyl) prop-2-yn-1-yl) oxy) butanoic acid (160 mg, 0.309 mmol) and formic acid (2 mL) were added to a 100 mL round-bottomed flask before stirred at 20 ℃ for 8 hours. The reaction mixture was then concentrated under reduced pressure to give the crude product as a brown oil, which was purified by prep-HPLC (Column: Xtimate C18 150 x 25 mm x 5 um, Mobile Phase A: water (0.2%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 30%B to 60%) . The pure fractions were lyophilized to give the product as a yellow powder (50 mg, 92.9%purity, 34.7%yield) . LCMS (ESI ⁺) : m/z 435.2 [M+H] ⁺

Step 4: Synthesis of N- (4- (3- (4- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -4-oxobutoxy) prop-1-yn-1-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 4- ( (3- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) prop-2-yn-1-yl) oxy) butanoic acid (50.0 mg, 0.115 mmol) , 1-hydroxybenzotriazole (23.4 mg, 0.173 mmol) , N-ethyl-N-isopropylpropan-2-amine (74.8 mg, 0.579 mmol) , 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (33.4 mg, 0.174 mmol) and DMF (3 mL) were added to a 50 mL round-bottomed flask before treated with (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (53.8 mg, 0.115 mmol) . The reaction mixture was stirred at room temperature for 5 hours and then stirred at 40℃ for another 12 hours. The mixture was poured into water (8 mL) and extracted with ethyl acetate (15 mL x 5) . The combined organic extracts were washed with brine (8 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by prep-HPLC (Column: DuraShell 150 x 25 mm x 5 um, Mobile Phase A: water (0.225%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 38%B to 68%) . The pure fractions were lyophilized to give the Compound 49 as a gray powder (8.30 mg, 94.66%purity, 8.06%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 14.17 -12.92 (m, 1H) , 10.88 (br. s., 1H) , 8.97 (s, 1H) , 8.69 -8.52 (m, 1H) , 8.48 -8.20 (m, 1H) , 8.16 -8.03 (m, 2H) , 7.99 -7.78 (m, 2H) , 7.49 -7.31 (m, 5H) , 7.25 -7.10 (m, 2H) , 7.01 -6.59 (m, 1H) , 5.14 (s, 1H) , 4.54 (d, J = 9.2 Hz, 1H) , 4.48 -4.30 (m, 5H) , 4.27 -4.16 (m, 1H) , 4.02 (s, 3H) , 3.84 -3.61 (m, 3H) , 3.56 -3.47 (m, 1H) , 2.46 -2.41 (m, 3H) , 2.38 -2.18 (m, 2H) , 2.09 -1.86 (m, 2H) , 1.84 -1.70 (m, 2H) , 1.01 -0.88 (m, 9H) ; LCMS (ESI ⁺) : m/z 847.4 [M+H] ⁺.

The following Compounds 50, 51, 52 and 53 were prepared according to similar procedure as described for Compound 49.

General Scheme 16: Exemplary synthesis of Compound 54

Step 1: Synthesis of tert-butyl (3- (3-methoxy-4-nitrophenoxy) -2, 2-dimethyl-propoxy) dimethylsilane

A solution of 3-methoxy-4-nitrophenol (4.00 g, 23.7 mmol) , 3- ( (tert-butyldimethylsilyl) oxy) -2, 2-dimethylpropan-1-ol (7.75 g, 35.5 mmol) , PPh ₃ (6.20 g, 23.7 mmol) , diisopropyl azodicarboxylate (4.78 g, 23.7 mmol) and THF (100 mL) was stirred at 80 ℃ for 8 hours under N ₂ atmosphere before cooled down and extracted with EtOAc (100 mL x 3) . The combined organic layers were washed with brine (100 mL) , dried over anhydrous Na ₂SO ₄, filtered and evaporated to dryness under reduced pressure to obtain the crude product, which was further purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 5: 1) to give the title compound as a colorless oil (7.50 g, crude) .

Step 2: Synthesis of 3- (3-methoxy-4-nitrophenoxy) -2, 2-dimethylpropan-1-ol

A stir bar, tert-butyl (3- (3-methoxy-4-nitrophenoxy) -2, 2-dimethylpropoxy) dimethylsilane (5.30 g, 14.3 mmol) , tetrabutylammonium fluoride (14.3 mL, 14.3 mmol, 1M in THF) , and THF (40 mL) were added to a 250 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 12 hours before poured into water (50 mL) and extracted with ethyl acetate (30 mL x 4) . The organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 1: 1) to give the product as a yellow solid (2.60 g, 99.7%purity, 70.8%yield) .

LCMS (ESI ⁺) : m/z 256.1 [M+H] ⁺.

Step 3: Synthesis of tert-butyl 3- (3- (3-methoxy-4-nitrophenoxy) -2, 2-dimethyl-propoxy) propanoate

A stir bar, 3- (3-methoxy-4-nitrophenoxy) -2, 2-dimethylpropan-1-ol (2.60 g, 10.2 mmol) , tert-butyl acrylate (1.44 g, 11.2 mmol) , potassium tert-butoxide (114 mg, 1.02 mmol) and dry THF (20 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 25 ℃ for 12 hours before diluted with water (40 mL) and extracted with dichloromethane (30 mL x 4) . The combined organic layers were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to give a residue, which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 3: 1) to give the product as colorless oil (950 mg, 96.2%purity, 23.4%yield) .

¹H NMR (400 MHz, DMSO-d ₆) : δ 7.95 (d, J = 9.3 Hz, 1H) , 6.78 (d, J = 2.5 Hz, 1H) , 6.65 (dd, J = 2.5, 9.3 Hz, 1H) , 3.94 (s, 3H) , 3.84 (s, 2H) , 3.58 (t, J = 6.0 Hz, 2H) , 3.26 (s, 2H) , 2.40 (t, J = 5.9 Hz, 2H) , 1.36 (s, 9H) , 0.97 (s, 6H) ; LCMS (ESI ⁺) : m/z 328 [M-t-Bu+H] ⁺.

Step 4: Synthesis of tert-butyl 3- (3- (4-amino-3-methoxyphenoxy) -2, 2-dimethylpropoxy) propanoate

A stir bar, tert-butyl 3- (3- (3-methoxy-4-nitrophenoxy) -2, 2-dimethylpropoxy) propanoate (460 mg, 1.20 mmol) , wet Pd/C (100 mg, 10 wt. %) and MeOH (30 mL) were added to a 250 mL hydrogenation bottle. The suspension was degassed under vacuum and purged with H ₂ for 3 times, then stirred under H ₂ (30 psi) atmosphere at 25℃ for 12 hours. The mixture was filtered through a pad of

and the pad was washed with MeOH (10 mL) . The filtrate was evaporated to dryness under reduced pressure to give the crude product as black oil (400 mg, crude) , which was used for next step without further purification.

Step 5: Synthesis of tert-butyl 3- (3- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) -2, 2-dimethylpropoxy) propanoate

A stir bar, 6- (1H-pyrazol-5-yl) picolinic acid intermediate 5 (214 mg, 1.13 mmol) , HATU (646 mg, 1.70 mmol) , DIEA (585 mg, 4.53 mmol) , and dry DMF (5 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 25℃ for 30 minutes before treated with tert-butyl 3- (3- (4-amino-3-methoxyphenoxy) -2, 2-dimethylpropoxy) propanoate (400 mg, 1.13 mmol) . The reaction mixture was then stirred at 25 ℃ for further 12 hours before poured into water (20 mL) and extracted with EtOAc (20 mL x 3) . The combined organic layers were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to give a residue, which was purified by FCC (eluent: etroleum ether : ethyl acetate = 1: 0 to 3: 1) to give the product as a black oil (300 mg, 100 %purity, 50.5%yield) . LCMS (ESI ⁺) : m/z 525.3 [M+H] ⁺

Step 6: Synthesis of 3- (3- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) -2, 2-dimethylpropoxy) propanoic acid trifluoroacetate

A solution of tert-butyl 3- (3- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) -2, 2-dimethylpropoxy) propanoate (300 mg, 0.572 mmol) , DCM (10 mL) and TFA (3mL) was stirred at 25 ℃ for 2 hours. The reaction mixture was concentrated under redcued pressrure to give the product as a black oil (250 mg, crude) .

Step 7: Synthesis of N- (4- (3- (3- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -3-oxopropoxy) -2, 2-dimethylpropoxy) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 3- (3- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) -2, 2-dimethylpropoxy) propanoic acid trifluoroacetate (87.1 mg, 0.150 mmol) , HOBt (37.7 mg, 0.279 mmol) , EDCI (53.4 mg, 0.279 mmol) , DIEA (72.0 mg, 0.557 mmol) and dry DMF (2mL) were added a 50 mL round-bottomed flask. The reaction mixture was stirred at 25 ℃ for 30 minutes before treated with (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (86.8 mg, 0.186 mmol) . The reaction mixture was stirred at 25 ℃ for further 8 hours before diluted with water (20 mL) and extracted with dichloromethane (30 mL x 3) . The combined organic layers were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to give a residue, which was purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.2%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 35%to 65%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue, which was lyophilized to give the Compound 54 as a white powder (15.7 mg, 100%purity, 11.9%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.95 -13.04 (m, 1H) , 10.60 (br s, 1H) , 8.96 (s, 1H) , 8.56 (t, J = 6.1 Hz, 1H) , 8.30 -7.86 (m, 5H) , 7.61 (br d, J = 9.3 Hz, 1H) , 7.39 (q, J =8.3 Hz, 4H) , 6.98 (br s, 1H) , 6.71 (br s, 1H) , 6.57 (dd, J = 2.3, 8.9 Hz, 1H) , 5.16 (d, J=3.4 Hz, 1H) , 4.56 (d, J=9.3 Hz, 1H) , 4.45 -4.33 (m, 3H) , 4.21 (dd, J = 5.3, 15.8 Hz, 1H) , 3.98 (br s, 3H) , 3.77 -3.60 (m, 5H) , 3.58 -3.50 (m, 1H) , 3.30 -3.23 (m, 2H) , 2.61 -2.54 (m, 1H) , 2.43 (s, 3H) , 2.38 -2.27 (m, 1H) , 2.06 -1.86 (m, 2H) , 1.00 -0.89 (m, 15H) ; LCMS (ESI ⁺) : m/z 882.5 [M+H] ⁺.

General Scheme 17: Exemplary synthesis of Compound 55

Step 1: Synthesis of tert-Butyl 6- (2-oxo-2, 3-dihydro-1H-imidazol-1-yl) picolinate

To a solution of tert-butyl 6-bromopicolinate (2.15 g, 8.33 mmol) in DMF (25 mL) was added 1H-imidazol-2 (3H) -one (1.40 g, 16.7 mmol) , CuI (638 mg, 3.33 mmol) , KOAc (4.90 g, 50.0 mmol) at 20 ℃ under N ₂. The mixture was stirred at 150 ℃ for 0.5 h under N ₂ with microwave. The mixture was purified by prep-HPLC (Column: DYA C18 300*50mm*5um, Mobile Phase A: water (10mM NH ₄HCO ₃) , Mobile Phase B: ACN, Flow rate: 25 mL/min, gradient condition from 55%B to 75%) . The pure fractions were collected and evaporated under vacuum to give a residue, which was lyophilized to give the product as a white solid (80.0 mg, crude) .

Step 2: Synthesis of 6- (2-oxo-2, 3-dihydro-1H-imidazol-1-yl) picolinic acid trifluoroacetate

To a solution of tert-butyl 6- (isoxazol-4-yl) picolinate (60.0 mg, 0.230 mmol) in DCM (5 mL) was added TFA (1 mL) at 20 ℃ under N ₂. The mixture was stirred at 20 ℃ for 1 hour under N ₂. The mixture was concentrated to give desired compound as a yellow solid (100 mg, crude) .

Step 3: Synthesis of tert-Butyl 7- (3-methoxy-4- (6- (2-oxo-2, 3-dihydro-1H-imidazol-1-yl) picolinamido) phenoxy) heptanoate

To a solution of 6- (2-oxo-2, 3-dihydro-1H-imidazol-1-yl) picolinic acid trifluoroacetate (100 mg, 0.313 mmol) in DCM (10 mL) was added HATU (179 mg, 0.470 mmol) , DIEA (0.22 mL, 1.25 mmol) at 0 ℃ under N ₂. The mixture was stirred at 0 ℃ for 10 minutes under N ₂. Then tert-butyl 7- (4-amino-3-methoxyphenoxy) heptanoate Intermediate 15 (101 mg, 0.313 mmol) was added into the mixture at 0 ℃, the mixture was stirred at 20 ℃ for 12 hours under N ₂. The mixture was concentrated. The crude product was purified by FCC (eluent: dichloromethane : methanol = 1: 0 to 10: 1) to afford the title compound as a white solid (20.0 mg, crude) .

Step 4: Synthesis of 7- (3-methoxy-4- (6- (2-oxo-2, 3-dihydro-1H-imidazol-1-yl) picolinamido) phenoxy) heptanoic acid formate

A solution of tert-butyl 3- ( (3- (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenyl) prop-2-yn-1-yl) oxy) propanoate (12.0 mg, 0.024 mmol) in HCOOH (8 mL) was stirred at 20 ℃ for 1 hour. The mixture was concentrated to give crude desired compound as a yellow solid (50.0 mg, crude) .

Step 5: Synthesis of N- (4- ( (7- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -7-oxoheptyl) oxy) -2-methoxyphenyl) -6- (2-oxo-2, 3-dihydro-1H-imidazol-1-yl) picolinamide

A stir bar, 7- (3-methoxy-4- (6- (2-oxo-2, 3-dihydro-1H-imidazol-1-yl) picolinamido) phenoxy) heptanoic acid formate (20.0 mg, 0.040 mmol) , HOBT (3.60 mg, 0.027 mmol) , N-ethyl-N-isopropylpropan-2-amin (28.4 mg, 0.220 mmol) , EDCI (9.30 mg, 0.049 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (20.6 mg, 0.044 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 25 ℃ for 12 hours. The mixture was then poured into water (5 mL) and extracted with ethyl acetate (10 mL x 2) . The organic extracts were washed with brine (5 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.225%FA) , Mobile Phase B: ACN, Flow rate: 25 mL/min, gradient condition from 35%B to 65%) . The pure fractions were collected and evaporated under vacuum to give a residue, which was lyophilized to give the Compound 55 as a white solid (7.70 mg, 99.2%purity, 22.0%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 10.57 (s, 1H) , 10.23 (s, 1H) , 8.98 (s, 1H) , 8.63 -8.55 (m, 2H) , 8.17 -8.11 (m, 1H) , 8.04 (d, J = 8.8 Hz, 1H) , 7.95 -7.86 (m, 2H) , 7.48 -7.46 (m, 1H) , 7.44 -7.36 (m, 4H) , 6.78 (t, J = 2.8 Hz, 1H) , 6.71 (d, J = 2.4 Hz, 1H) , 6.57 (dd, J = 2.4, 8.8 Hz, 1H) , 5.14 (d, J = 3.6 Hz, 1H) , 4.55 (d, J = 9.6 Hz, 1H) , 4.47 -4.33 (m, 3H) , 4.21 (dd, J = 5.2, 16.0 Hz, 1H) , 3.97 (t, J = 6.4 Hz, 2H) , 3.91 (s, 3H) , 3.70 -3.62 (m, 2H) , 2.44 (s, 3H) , 2.31 -2.24 (m, 1H) , 2.18 -2.10 (m, 1H) , 2.07 -1.98 (m, 1H) , 1.95 -1.86 (m, 1H) , 1.75 -1.66 (m, 2H) , 1.58 -1.48 (m, 2H) , 1.47 -1.40 (m, 2H) , 1.36 -1.29 (m, 2H) , 0.94 (s, 9H) ; LCMS (ESI ⁺) : m/z 867.4 [M+H] ⁺.

General Scheme 18: Exemplary synthesis of Compound 56

Step 1: Synthesis of methyl 7- (3- (4-hydroxypiperidin-1-yl) -4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenoxy) heptanoate

A stir bar, methyl 7-bromoheptanoate (80.0 mg, 0.359 mmol) , N- (4-hydroxy-2- (4-hydroxypiperidin-1-yl) phenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide Intermediate 16 (100 mg, 0.216 mmol) , potassium carbonate (99.4 mg, 0.719 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 80 ℃ for 12 hours. The mixture was then poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 0: 1) to afford the title compound as brown oil (50.0 mg, crude) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 10.52 (s, 1H) , 8.29 -8.19 (m, 3H) , 7.93 (dd, J = 2.0, 6.8 Hz, 1H) , 7.64 (d, J = 1.8 Hz, 1H) , 6.87 (d, J = 1.8 Hz, 1H) , 6.78 (d, J = 2.8 Hz, 1H) , 6.73 (dd, J = 2.5, 9.0 Hz, 1H) , 5.77 (br d, J = 9.5 Hz, 1H) , 4.56 (d, J = 3.3 Hz, 1H) , 3.95 (t, J = 6.4 Hz, 2H) , 3.79 (br d, J = 11.5 Hz, 1H) , 3.59 (s, 3H) , 2.94 (br s, 2H) , 2.69 -2.59 (m, 2H) , 2.35 -2.30 (m, 3H) , 2.02 -1.92 (m, 2H) , 1.79 -1.64 (m, 5H) , 1.57 -1.53 (m, 2H) , 1.51 -1.38 (m, 7H) , 1.37 -1.27 (m, 3H) .

Step 2: Synthesis of 7- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3- (4-hydroxypiperidin-1-yl) phenoxy) heptanoic acid

A stir bar, methyl 7- (3- (4-hydroxypiperidin-1-yl) -4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenoxy) heptanoate (50.0 mg, 0.083 mmol) , NaOH (1 M aqueous) (2.0 mL, 2.0 mmol) and tetrahydrofuran (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 1 hour. The reaction mixture was concentrated and adjusted pH to 6-7 with HCl (1 M aqueous) with pale yellow precipitation formed. The precipitate was filtrated, and dried to give the product as a white solid (40.0 mg, crude) .

Step 3: Synthesis of N- (4- ( (7- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -7-oxoheptyl) oxy) -2- (4-hydroxypiperidin-1-yl) phenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 7- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3- (4-hydroxypiperidin-1-yl) phenoxy) heptanoic acid (40.0 mg, 0.079 mmol) , HOBT (13.8 mg, 0.102 mmol) , N-ethyl-N-isopropylpropan-2-amin (30.6 mg, 0.237 mmol) , EDCI (19.6 mg, 0.102 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (36.8 mg, 0.079 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 2 hours. The mixture was then poured into water (5 mL) and extracted with ethyl acetate (10 mL x 2) . The organic extracts were washed with brine (5 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.225%FA) , Mobile Phase B: ACN, Flow rate: 25 mL/min, gradient condition from 35%B to 65%) . The pure fractions were collected and evaporated under vacuum to give a residue, which was lyophilized to give the Compound 56 as a white solid (19.1 mg, 99.6%purity, 26.2%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.23 (br s, 1H) , 10.72 (br s, 1H) , 8.98 (s, 1H) , 8.59 (t, J = 5.6 Hz, 1H) , 8.38 -8.31 (m, 1H) , 8.25 -8.18 (m, 1H) , 8.12 -8.08 (m, 2H) , 7.93 -7.87 (m, 2H) , 7.44 -7.37 (m, 4H) , 7.09 (s, 1H) , 6.84 -6.79 (m, 1H) , 6.77 -6.71 (m, 1H) , 5.16 (d, J = 3.6 Hz, 1H) , 4.70 -4.66 (m, 1H) , 4.55 (d, J = 9.6 Hz, 1H) , 4.47 -4.40 (m, 2H) , 4.38 -4.33 (m, 1H) , 4.25 -4.17 (m, 1H) , 3.98 -3.91 (m, 2H) , 3.72 -3.63 (m, 3H) , 3.05 -2.96 (m, 2H) , 2.75 -2.68 (m, 2H) , 2.44 (s, 3H) , 2.32 -2.22 (m, 1H) , 2.18 -2.10 (m, 1H) , 2.07 -2.00 (m, 1H) , 1.95 -1.88 (m, 2H) , 1.74 -1.65 (m, 4H) , 1.60 -1.47 (m, 3H) , 1.45 -1.38 (m, 2H) , 1.35 -1.28 (m, 2H) , 0.94 (s, 9H) ; LCMS (ESI ⁺) : m/z 920.4 [M+H] ⁺.

The following Compound 57 and 58 were prepared according to similar procedure as described for Compound 56.

General Scheme 19: Exemplary synthesis of Compound 59

Step 1: Synthesis of tert-butyl 4- ( (3'-methoxy-4'- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) - [1, 1'-biphenyl] -3-yl) oxy) butanoate

N- (3'-hydroxy-3-methoxy- [1, 1'-biphenyl] -4-yl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide Intermediate 17 (200 mg, 0.425 mmol) , KI (70.6 mg, 0.425 mmol) and K ₂CO ₃ (117 mg, 0.850 mmol) were added in DMF (3 mL) then added tert-butyl 4-bromobutanoate (142 mg, 0.64 mmol) . The mixture was stirred for 16 hours at 80 ℃. The mixture was poured into H ₂O (5 mL) and exacted with EA (10 mL x 3) . The crude product was purified by FCC (eluent: petroleum ether: ethyl acetate =1: 0 to 1: 1) to give desired product as a yellow solid (200 mg, crude) .

Step 2: Synthesis of 4- ( (4'- (6- (1H-pyrazol-5-yl) picolinamido) -3'-methoxy- [1, 1'-biphenyl] -3-yl) oxy) butanoic acid hydrochloride

tert-butyl 4- ( (3'-methoxy-4'- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) - [1, 1'-biphenyl] -3-yl) oxy) butanoate (150 mg, 0.245 mmol) was added in dioxane (2 mL) and HCl/dioxane (1 mL) was added in the mixture. The mixture was stirred at room temperature for 2 hours. The solvent was removed under reduced pressure to give desired product as a yellow solid (150 mg, crude) .

Step 3: Synthesis of N- (3'- (4- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -4-oxobutoxy) -3-methoxy- [1, 1'-biphenyl] -4-yl) -6- (1H-pyrazol-5-yl) picolinamide

4- ( (4'- (6- (1H-pyrazol-5-yl) picolinamido) -3'-methoxy- [1, 1'-biphenyl] -3-yl) oxy) butanoic acid hydrochloride (150 mg, 0.295 mmol) , EDCI (91.3 mg, 0.476 mmol) , HOBt (64.4 mg, 0.476 mmol) and DIEA (205 mg, 1.59 mmol) were added in DMF (5 mL) after stirred for 5 minutes, (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (137 mg, 0.293 mmol) was added in the mixture. The mixture was stirred at 35 ℃ for 16 hours. The residue was purified by prep-HPLC (Column: Waters Xbridge 50*25 5u, Mobile Phase A: water (10mM NH ₄HCO ₃) -ACN, Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 35%B to 65%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue which was lyophilized to give the Compound 59 as white powder (13.10 mg, 95.8%purity, 4.81%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.28 (s, 1H) , 10.88 (s, 1H) , 8.98 (s, 1H) , 8.66 -8.58 (m, 2H) , 7.96 -7.88 (m, 1H) , 8.23 -8.00 (m, 3H) , 7.44 -7.31 (m, 10H) , 7.01 -6.92 (m, 2H) , 5.15 (d, J = 3.6 Hz, 1H) , 4.58 (d, J = 9.6 Hz, 1H) , 4.46 -4.33 (m, 3H) , 4.25 -4.20 (m, 1H) , 4.12 -4.07 (m, 5H) , 3.68 -3.66 (m, 2H) , 2.48 -2.39 (m, 5H) , 2.07 –1.89 (m, 4H) , 0.95 (s, 9H) ; LCMS (ESI ⁺) : m/z 885.4 [M+H] ⁺

The following Compounds 60, 61, 62, and 63 were prepared according to similar procedure as described for Compound 59.

General Scheme 20: Exemplary synthesis of Compound 64

Step 1: Synthesis of N- (4- (4- (2- ( ( (S) -1- ( (2S, 4R) -4-Hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethoxy) piperidin-1-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 2- ( (1- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) acetic acid hydrochloride Intermediate 18 (100 mg, 0.205 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (95.7 mg, 0.205 mmol) , 1-hydroxybenzotriazole (41.5 mg, 0.307 mmol) , DIEA (79.5 mg, 0.615 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask. Then 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (58.9 mg, 0.307 mmol) was added to the mixture. The reaction mixture was stirred at 40 ℃ for 2 hours. The residue was purified by prep-HPLC (Column: Agela Durashell C18 150*25 5u, Mobile Phase A: water (10 mM NH ₄HCO ₃) -ACN, Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 30%B to 60%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue which was lyophilized to give the Compound 64 as a yellow powder (20.7 mg, 100 %purity, 11.7 %yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.87 (br. S., 0.3H) , 13.22 (br. S., 0.8H) , 10.66 -10.30 (m, 1H) , 9.03 -8.92 (m, 1H) , 8.77 -8.55 (m, 1H) , 8.23 -7.92 (m, 4H) , 7.68 -7.17 (m, 6H) , 7.04 -6.93 (m, 1H) , 6.78 -6.65 (m, 1H) , 6.60 -6.49 (m, 1H) , 5.17 (d, J = 3.2 Hz, 1H) , 4.56 (d, J = 9.5 Hz, 1H) , 4.49 -4.21 (m, 4H) , 4.09 -3.91 (m, 4H) , 3.84 (br. S., 1H) , 3.73 -3.46 (m, 5H) , 3.04 -2.85 (m, 2H) , 2.47 -2.40 (m, 3H) , 2.13 -1.83 (m, 4H) , 1.73 -1.54 (m, 2H) , 0.99 -0.91 (m, 9H) ; LCMS (ESI ⁺) : m/z 864.2 [M+H] ⁺.

The following Compounds 65, 66, 67, 68, 69, 70, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165 , 166, 167, 168 169, 170, 171, 172, 173, 174, 175, 176, 177 and 178 were prepared according to similar procedure as described for Compound 64.

General Scheme 21: Exemplary synthesis of Compound 71

Step 1: Synthesis of tert-Butyl 3- ( (1- (3-methoxy-4-nitrophenyl) piperidin-4-yl) -oxy) propanoate

A stir bar, 1- (3-methoxy-4-nitrophenyl) piperidin-4-ol (0.500 g, 1.98 mmol) , sodium hydroxide (0.119 g, 2.97 mmol) , tetrabutylammonium hydrogen sulfate (0.202 g, 0.595 mmol) , DCM (16 mL) and H ₂O (2 mL) were added to a 50 mL round-bottomed flask at 10℃. The mixture was stirred at 10 ℃ for 5 minutes before treated with tert-butyl acrylate (0.381 g, 2.97 mmol) and stirred at 25 ℃ for 16 hours. The crude product was concentrated to dryness under reduced pressure to obtain a residue, which was diluted with H ₂O (10 ml) and EtOAc (30 mL) were added. The aqueous layer was extracted with EtOAc (30 mL × 2) . The combined organic extracts were dried over Na ₂SO ₄, filtered, and concentrated to dryness under reduced pressure to give the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 100: 0 to 1: 1) to afford the compound as a brown oil (550 mg, 93.9%purity, 68.5%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 7.87 (d, J = 9.2 Hz, 1H) , 6.58 (dd, J = 2.4, 9.6 Hz, 1H) , 6.49 (d, J = 2.4 Hz, 1H) , 3.89 (s, 3H) , 3.75 -3.67 (m, 2H) , 3.63 (t, J = 6.0 Hz, 2H) , 3.60 -3.53 (m, 1H) , 3.30 -3.22 (m, 2H) , 2.41 (t, J = 6.0 Hz, 2H) , 1.87 (ddd, J = 3.2, 6.4, 9.6 Hz, 2H) , 1.54 -1.44 (m, 2H) , 1.39 (s, 9H) ; LCMS (ESI ⁺) : m/z 381.2 [M+H] ⁺.

Step 2: Synthesis of tert-Butyl 3- ( (1- (4-amino-3-methoxyphenyl) piperidin-4-yl) -oxy) propanoate

A stir bar, tert-butyl 3- ( (1- (3-methoxy-4-nitrophenyl) piperidin-4-yl) oxy) propanoate (0.550 g, 1.45 mmol) , wet Pd/C (0.200 g, 10 wt. %) and dry MeOH (20 mL) were added to a hydrogenation bottle under N ₂ atmosphere. The suspension was degassed under vacuum and purged with N ₂ for three times, then purged with hydrogen and stirred under hydrogen atmosphere (30 psi) at 25 ℃ for 16 hours. The mixture was filtered through a pad of

and the pad was washed with methanol (30 mL x 3) . The combined filtrates were concentrated under reduced pressure to give the product as a brown oil (0.400 g, crude) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 6.54 -6.46 (m, 2H) , 6.33 -6.26 (m, 1H) , 4.20 (s, 2H) , 3.76 -3.70 (m, 3H) , 3.63 (t, J = 6.0 Hz, 2H) , 3.43 -3.37 (m, 1H) , 3.26 -3.17 (m, 2H) , 2.73 -2.63 (m, 2H) , 2.41 (t, J = 6.0 Hz, 2H) , 1.95 -1.83 (m, 2H) , 1.60 -1.48 (m, 2H) , 1.41 (s, 9H) .

Step 3: Synthesis of tert-Butyl 3- ( (1- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) propanoate

A stir bar, tert-butyl 3- ( (1- (4-amino-3-methoxyphenyl) piperidin-4-yl) oxy) propanoate (250 mg, 0.713 mmol) , 6- (1H-pyrazol-5-yl) picolinic acid Intermediate 5 (135 mg, 0.714 mmol) , HATU (164 mg, 0.855 mmol) , DIPEA (289 mg, 2.14 mmol) and DMF (3 mL) were added to a 10 mL round-bottomed flask. The reaction mixture was stirred at 25 ℃ for 2 hours. The reaction was concentrated and co-treated with another batch (50 mg scale of tert-butyl 3- ( (1- (4-amino-3-methoxyphenyl) piperidin-4-yl) oxy) propanoate) . The reaction mixture was diluted with water (30 mL) and extracted with EtOAc (50 mL x 3) . The combined organic layer was dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 4 to 1: 2) to give the product as a brown green oil (260 mg, 95.3%purity, 55.4%%yield) . LCMS (ESI ⁺) : m/z 522.1 [M+H] ⁺.

Step 4: Synthesis of

3- ( (1- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) propanoic acid hydrochloride

A stir bar, tert-butyl ( (S) -1- ( (2S, 4S) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) carbamate (260 mg, 0.498 mmol) , HCl solution (4 mL, 4M in dioxane) were added to a 50 mL round-bottomed flask. The resultant mixture was stirred at 25 ℃ for 2 hours before concentrated to dryness under reduced pressure to afford the product as a white solid (232 mg, 93.7%purity, 86.9%yield) . LCMS (ESI ⁺) : m/z 466.3 [M+H] ⁺.

Step 5: Synthesis of

N- (4- (4- (3- ( ( (S) -1- ( (2S, 4R) -4-Hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) -carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -3-oxopropoxy) -piperidin-1-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 2- ( (1- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) acetic acid hydrochloride (120 mg, 0.239 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (112 mg, 0.240 mmol) , HATU (55.0 mg, 0.287 mmol) , DIPEA (96.8 mg, 0.716 mmol) and DMF (2 mL) were added to a 10 mL round-bottomed flask. The reaction mixture was stirred at 25 ℃ for 2 hours before purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.225 %FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 40%B to 70%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue, which was lyophilized to give the Compound 71 as a yellow powder (22.9 mg, 98.5 %purity, 10.7 %yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.73 -12.63 (m, 1H) , 10.54 (br. s., 1H) , 8.96 (s, 1H) , 8.62 -8.52 (m, 1H) , 8.29 -7.63 (m, 6H) , 7.49 -7.30 (m, 4H) , 7.02 -6.94 (m, 1H) , 6.71 (br. s., 1H) , 6.59 -6.51 (m, 1H) , 5.33 -4.99 (m, 1H) , 4.58 (d, J = 9.3 Hz, 1H) , 4.49 -4.38 (m, 2H) , 4.36 (br. s., 1H) , 4.28 -4.14 (m, 1H) , 4.01 -3.87 (m, 3H) , 3.70 -3.61 (m, 4H) , 3.49 -3.46 (m, 3H) , 2.98 -2.84 (m, 2H) , 2.60 -2.54 (m, 1H) , 2.46 -2.41 (m, 3H) , 2.39 -2.31 (m, 1H) , 2.08 -1.86 (m, 4H) , 1.61 -1.49 (m, 2H) , 0.94 (s, 9H) ; LCMS (ESI ⁺) : m/z 878.4 [M+H] ⁺.

General Scheme 22: Exemplary synthesis of Compound 72

Step 1: Synthesis of

tert-Butyl 4- (3- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -5, 6-dihydropyridin-1 (2H) -yl) butanoate

N- (2-methoxy-4- (1, 2, 5, 6-tetrahydropyridin-3-yl) phenyl) -6- (1H-pyrazol-5-yl) picolinamide hydrochloride Intermediate 19 (200 mg, 0.486 mmol) , tert-butyl 4-bromobutanoate (119 mg, 0.533 mmol) and K ₂CO ₃ (134 mg, 0.970 mmol) were dissovled in DMF (6 mL) and stirred at 25 ℃ for 12 hours. The reaction mixture was combined with another batch (50 mg scale of Intermediate 19) , then poured into water (10 mL) and extracted with ethyl acetate (10 mL x 3) . The combined organic extracts were washed with water (10 mL x 3) , brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude title product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 5: 1) to give the product as a brown solid (250 mg, crude) . ¹H NMR (400 MHz, CDCl ₃) : δ 10.68 (s, 1H) , 8.47 (d, J = 8.3 Hz, 1H) , 8.14 (d, J = 7.6 Hz, 1H) , 8.04 -7.96 (m, 1H) , 7.91 -7.84 (m, 1H) , 7.66 (d, J = 2.2 Hz, 1H) , 7.00 -6.91 (m, 2H) , 6.86 (d, J = 1.7 Hz, 1H) , 6.07 (br. s., 1H) , 3.94 (s, 3H) , 3.34 (br. s., 2H) , 2.67 -2.59 (m, 2H) , 2.58 -2.50 (m, 2H) , 2.35 (d, J = 2.9 Hz, 2H) , 2.29 (t, J = 7.3 Hz, 2H) , 1.94 -1.81 (m, 2H) , 1.42 (s, 9H) .

Step 2: Synthesis of

4- (3- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -5, 6-dihydropyridin-1 (2H) -yl) butanoic acid trifluoroacetate

A stir bar, tert-butyl 4- (3- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -5, 6-dihydropyridin-1 (2H) -yl) butanoate (250 mg, 0.483 mmol) , dichloromethane (6 mL) and trifluoroacetic acid (6 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at room temperature for 1 hour. The mixture was concentrated to dryness under reduced pressure to afford the crude title compound as yellow oil (222 mg, crude) .

Step 3: Synthesis of

N- (4- (1- (4- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) -carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -4-oxobutyl) -1, 2, 5, 6-tetrahydropyridin-3-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

4- (3- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -5, 6-dihydropyridin-1 (2H) -yl) butanoic acid trifluoroacetate (222 mg, 0.386 mmol) , HATU (274 mg, 0.721 mmol) and DIPEA (186 mg, 1.44 mmol) were dissolved in DMF (5 mL) . The reaction mixture was stirred at 25 ℃ for 15 minutes before treated with (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (247 mg, 0.529 mmol) and stirred at 25 ℃ for 8 hours. The mixture was purified by prep-HPLC (Column: Waters Xbridge Prep OBD C18 150*30 5u, Mobile Phase A: water (10mM NH ₄HCO ₃) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 40%B to 70%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue, which was lyophilized to give the Compound 72 as a white solid (30 mg, 100%purity, 8.90%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.22 (br. s., 1H) , 10.78 (br. s., 1H) , 8.94 (s, 1H) , 8.54 (t, J = 5.6 Hz, 1H) , 8.34 (d, J = 8.4 Hz, 1H) , 8.18 (d, J = 7.6 Hz, 1H) , 8.10 -8.06 (m, 1H) , 8.04 -8.01 (m, 1H) , 7.95 -7.83 (m, 2H) , 7.36 (q, J = 8.4 Hz, 4H) , 7.11 (s, 1H) , 7.01 (d, J = 8.4 Hz, 1H) , 6.93 (s, 1H) , 6.19 (s, 1H) , 5.13 (d, J = 2.8 Hz, 1H) , 4.52 (d, J = 9.2 Hz, 1H) , 4.45 -4.35 (m, 2H) , 4.32 (s, 1H) , 4.18 (dd, J = 5.6, 16.0 Hz, 1H) , 4.05 -3.95 (m, 3H) , 3.69 -3.60 (m, 2H) , 3.24 (s, 1H) , 2.72 -2.55 (m, 1H) , 2.42 -2.38 (m, 6H) , 2.31 -2.13 (m, 5H) , 2.04 -1.95 (m, 1H) , 1.86 (ddd, J = 4.4, 8.8, 12.8 Hz, 1H) , 1.78 -1.69 (m, 2H) , 0.93 -0.88 (m, 9H) ; LCMS (ESI ⁺) : m/z 437.8 [M/2+H] ⁺.

The following Compound 73 was prepared according to similar procedure as described for Compound 72.

General Scheme 23: Exemplary synthesis of Compound 74

Step 1: Synthesis of tert-butyl 4- ( (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenoxy) methyl) piperidine-1-carboxylate

A stir bar, tert-butyl 4- ( (tosyloxy) methyl) piperidine-1-carboxylate (225 mg, 0.608 mmol) , N- (4-hydroxy-2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide Intermediate 6 (200 mg, 0.507 mmol ) , K ₂CO ₃ (140 mg, 1.01mmol) , DMF (5 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 25 ℃ for 16 hours before poured into water and extracted with ethyl acetate (20 ml x 3) . The combined organic extracts were washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to obtain a residue, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 3: 1) to give the product as a yellow solid (350 mg, crude) .

Step 2: Synthesis of N- (2-methoxy-4- (piperidin-4-ylmethoxy) phenyl) -6- (1H-pyrazol-5-yl) picolinamide hydrochloride

A stir bar, tert-butyl 4- ( (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenoxy) methyl) piperidine-1-carboxylate (350 mg, 0.592 mmol) and dioxane (2 mL) were added to a 100 mL round-bottomed flask. HCl solution (2 mL, 4M in dioxane) was added dropwise to the mixture and stirred at 25 ℃ for 3 hours. The mixture was concentrated under reduced pressure to give the desired product as a yellow solid (300 mg, crude) .

Step 3: Synthesis of tert-butyl 2- (4- ( (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) methyl) piperidin-1-yl) acetate

A stir bar, N- (2-methoxy-4- (piperidin-4-ylmethoxy) phenyl) -6- (1H-pyrazol-5-yl) picolinamide hydrochloride (190 mg, 0.428 mmol) , tert-butyl 2-bromoacetate (91.0 mg, 0.466 mmol) , triethylamine (142 mg, 1.40 mmol) and THF (5 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at room temperature for 12 hours before poured into ethyl acetate (100 mL) and washed with water (30 mL x 3) . The organic layer was dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the product as colorless liquids (124 mg, crude) . ¹H NMR (400MHz, CDCl ₃) : δ 10.50 (s, 1H) , 8.48 (d, J = 8.8 Hz, 1H) , 8.26 -8.17 (m, 1H) , 8.05 -7.90 (m, 2H) , 7.77 -7.68 (m, 1H) , 7.01 -6.92 (m, 1H) , 6.59 -6.47 (m, 2H) , 3.99 (s, 3H) , 3.83 (d, J = 6.0 Hz, 2H) , 3.15 (s, 2H) , 3.07 -2.94 (m, 2H) , 2.27 -2.18 (m, 2H) , 1.90 -1.80 (m, 2H) , 1.54 -1.42 (m, 12H) .

Step 4: Synthesis of 2- (4- ( (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxy-phenoxy) methyl) piperidin-1-yl) acetic acid hydrochloride

A stir bar, tert-butyl 2- (4- ( (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) -methyl) piperidin-1-yl) acetate (124 mg, 0.238 mmol) and dioxane (3 mL) were added to a 50 mL round-bottomed flask. HCl solution (3 mL, 4M in dioxane) was added dropwise to the mixture and stirred at 25 ℃ for 4 hours. The mixture was then concentrated to dryness under reduced pressure to afford the title compound as a yellow solid (110 mg, crude) .

Step 5: Synthesis of

N- (4- ( (1- (2- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) -carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethyl) piperidin-4-yl) methoxy) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

To a solution of 2- (4- ( (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) -methyl) piperidin-1-yl) acetic acid hydrochloride (100.00 mg, 0.199 mmol) in DMF (2 mL) was added EDCI (53.5 mg, 0.279 mmol) , HOBt (37.7 mg, 0.279 mmol) and DIPEA (55.5 mg, 0.430 mmol) . The mixture was stirred at room temperature for 10 minutes before treated with (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (110 mg, 0.236 mmol) and stirred at 25 ℃ for 12 hours. The mixture was then poured into water and extracted by DCM (10 mL x 3) . The combined organic extracts were washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude title product, which was purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.225%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 29%to 39%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue, which was lyophilized to give the Compound 74 as a white powder (30.2 mg, 95.6%purity, 16.5%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.27 (br. s., 1H) , 10.56 (br. s., 1H) , 8.94 (s, 1H) , 8.62 (t, J = 6.0 Hz, 1H) , 8.32 -8.01 (m, 4H) , 7.96 -7.77 (m, 2H) , 7.50 -7.33 (m, 4H) , 7.00 (d, J = 2.0 Hz, 1H) , 6.79 -6.68 (m, 1H) , 6.63 -6.51 (m, 1H) , 5.19 (s, 1H) , 4.60 -4.20 (m, 5H) , 4.03 -3.82 (m, 5H) , 3.71 -3.62 (m, 2H) , 3.06 (d, J = 16.0 Hz, 1H) , 2.98 -2.81 (m, 3H) , 2.48 -2.38 (m, 3H) , 2.25 -2.03 (m, 3H) , 1.97 -1.71 (m, 4H) , 1.40 -1.29 (m, 2H) , 1.02 -0.90 (m, 9H) ; LCMS (ESI ⁺) : m/z 878.3 [M+H] ⁺.

The following Compound 75 was prepared according to similar procedure as described for Compound 74.

General Scheme 24: Exemplary synthesis of Compound 76

Step 1: Synthesis of ethyl 2- ( (phenoxycarbonyl) oxy) acetate

Phenyl carbonochloridate (1.00 g, 6.39 mmol) was slowly added to a mixture of ethyl 2-hydroxyacetate (0.67 g, 6.39 mmol) and DIPEA (1.37 mL, 8.30 mmol) in toluene (20 mL) at 30℃ before stirred at 30℃ for 2 hours. The resultant precipitate was filtered and the filtrate was concentrated under reduce pressure to obtain a residue, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 1: 9) to give the product as a yellow oil (1 g, >98%purity based on HNMR, 69.8%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 7.38-7.48 (m, 2H) , 7.24-7.33 (m, 1H) , 7.17-7.22 (m, 2H) , 4.81 (s, 2H) , 4.16 (q, J = 7.2 Hz, 2H) , 1.19 (t, J =7.2 Hz, 3H) .

Step 2: Synthesis of 2-ethoxy-2-oxoethyl 4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperazine-1-carboxylate

N- (2-methoxy-4- (piperazin-1-yl) phenyl) -6- (1H-pyrazol-5-yl) picolinamide hydrochloride (500 mg, 1.21 mmol) and ethyl 2- ( (phenoxycarbonyl) oxy) acetate (326 mg, 1.45 mmol) were dissolved in toluene (10 mL) and stirred at 80 ℃ for 16 hours before concentrated under reduced pressure to obtain a residue, which was purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um A: water (0.225%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 32%B to 62%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue, which was lyophilized to give the product as a yellow powder (200 mg, crude) .

Step 3: Synthesis of 2- ( (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperazine-1-carbonyl) oxy) acetic acid

2-ethoxy-2-oxoethyl 4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperazine-1-carboxylate (150 mg, 0.295 mmol) was dissolved in mixed solvent (12 mL, EtOH: H ₂O: THF = 1: 1: 1) . Then, LiOH·H ₂O (35.3 mg, 1.48 mmol) was added to the mixture and stirred at 35 ℃ for 2 hours before adjusted with aq. HCl (1M) to obtain pH = 7-8 and extracted with EtOAc (10 mL x 2) . The combined organic layers were dried with anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to give the product as a yellow oil (120 mg, crude) .

Step 4: Synthesis of 2-ethoxy-2-oxoethyl 2- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethyl 4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperazine-1-carboxylate

2- ( (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperazine-1-carbonyl) oxy) acetic acid (60.0 mg, 0.125 mmol) , EDCI (35.9 mg, 0.187 mmol) , HOBt (25.3 mg, 0.187 mmol) and DIPEA (80.7 mg, 0.624 mmol) were dissolved in DMF (2 mL) and stirred for 5 minutes before treated with (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (53.8 mg, 0.115 mmol) . The mixture was stirred at 35 ℃ for 16 hours before purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um A: water (0.225%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 32%B to 62%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue, which was lyophilized to give the product as a yellow powder. The product was further purified by SFC (DAICEL CHIRALPAK ASH (250mm*30mm, 5um) (eluent: 45%to 45% (v/v) supercritical CO ₂ in EtOH and H ₂O with 0.1%NH ₃) . The pure fractions were collected and the volatiles were removed under reduced pressure to obtain a residue, which was then lyophilized to dryness to afford the Compound 76 as a yellow solid (18.4 mg, 100%purity, 16.8%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.25 (s, 1H) , 10.61 (s, 1H) , 8.97 (s, 1H) , 8.64 -8.61 (m, 1H) , 8.26 -8.19 (m, 1H) , 8.12 -7.94 (m, 4H) , 7.65 -7.58 (m, 1H) , 7.43 -7.34 (m, 4H) , 7.23 -6.98 (m, 1H) , 6.82 -6.74 (m, 1H) , 6.58 (d, J = 2, 2.0 Hz, 1H) , 5.19 (d, J = 3.2 Hz, 1H) , 4.63 -4.54 (m, 3H) , 4.50 -4.40 (m, 3H) , 4.26 -4.20 (m, 1H) , 3.98 (s, 2H) , 3.86 (s, 1H) , 3.71 -3.49 (m, 6H) , 3.18 (s, 4H) , 2.44 (s, 3H) , 2.11 -2.04 (m, 1H) , 1.94 -1.90 (m, 1H) , 0.95 (s, 9H) ; LCMS (ESI ⁺) : m/z 893.4 [M+H] ⁺.

The following Compounds 77 and 78 were prepared according to similar procedure as described for Compound 76.

General Scheme 25: Exemplary synthesis of Compound 79

Step 1: Synthesis of 1- (3- (benzyloxy) -5-bromophenyl) -4-methylpiperazine

1- (benzyloxy) -3, 5-dibromobenzene (3.00 g, 8.77 mmol) , 1-methylpiperazine (791 mg, 7.90 mmol) , BINAP (55.0 mg, 0.0880 mmol) , Pd ₂ (dba) ₃ (80.0 mg, 0.0870 mmol) , sodium tert-butoxide (1.26 g, 13.2 mmol) and DBU (1068 mg, 7.02 mmol) were dissolved in toluene (20 mL) . The reaction mixture was stirred at 100 ℃ under N ₂ atmosphere for 8 hours before poured into water (10 mL) and extracted with ethyl acetate (10 mL x 3) . The combined organic extracts were washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the title product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 1: 3) to give the product as a brown solid (1.40 g, crude) .

Step 2: Synthesis of 1- (5- (benzyloxy) -3'-methoxy-4'-nitro- [1, 1'-biphenyl] -3-yl) -4-methylpiperazine

1- (3- (benzyloxy) -5-bromophenyl) -4-methylpiperazine (1.29 g, 3.58 mmol) , 2- (3-methoxy-4-nitrophenyl) -4, 4, 5, 5-tetramethyl-1, 3, 2-dioxaborolane (1.00 g, 3.58 mmol) , Pd (PPh ₃) ₄ (414 mg, 0.358 mmol) and Na ₂CO ₃ (1.44 g, 13.6 mmol) were dissolved in toluene (9 mL) , MeOH (3 mL) and H ₂O (3 mL) . The reaction mixture were stirred at 90 ℃ under N ₂ atmosphere for 8 hours before poured into water (10 mL) and extracted with ethyl acetate (10 mL x 3) . The combined organic extracts were washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude title product, which was purified by FCC (eluent: DCM: MeOH = 1: 0 to 5: 1) to give the product as a brown solid (1000 mg, 58.5%yield) . ¹H NMR (400 MHz, CDCl ₃) : δ 7.91 (d, J = 9.0 Hz, 1H) , 7.46 -7.31 (m, 6H) , 7.19 -7.13 (m, 2H) , 6.69 -6.60 (m, 2H) , 5.10 (s, 2H) , 3.98 (s, 3H) , 3.32 -3.22 (m, 4H) , 2.62 -2.54 (m, 4H) , 2.35 (s, 3H) .

Step 3: Synthesis of 4'-amino-3'-methoxy-5- (4-methylpiperazin-1-yl) - [1, 1'-biphenyl] -3-ol

To a solution of 1- (5- (benzyloxy) -3'-methoxy-4'-nitro- [1, 1'-biphenyl] -3-yl) -4-methylpiperazine (1.00 g, 2.31 mmol) in MeOH (10 mL) was added Pd/C (1.00 g, 10wt. %) . The suspension was degassed under vacuum and purged with H ₂ for several times. The mixture was then stirred under H ₂ (15 psi) atmosphere at 25 ℃ for 2 hours. The suspension was filtered through a pad of

and the pad was washed with methanol. The filtrate was concentrated to dryness under reduced pressure to afford the crude title product, which was purified by FCC (eluent: DCM: MeOH = 1: 0 to 10: 1) to give the product as a brown solid (600 mg, crude) . ¹H NMR (400 MHz, CDCl ₃) : δ 6.99 -6.95 (m, 2H) , 6.74 (d, J = 8.4 Hz, 1H) , 6.62 (s, 1H) , 6.53 (d, J = 1.6 Hz, 1H) , 6.32 (t, J = 2.0 Hz, 1H) , 4.63 (br. s., 1H) , 3.88 (s, 3H) , 3.28 -3.24 (m, 4H) , 2.69 -2.66 (m, 4H) , 2.41 (s, 3H) .

Step 4: Synthesis of N- (3'-hydroxy-3-methoxy-5'- (4-methylpiperazin-1-yl) - [1, 1'-biphenyl] -4-yl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide

6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinic acid Intermediate 4 (576 mg, 2.11 mmol) , HATU (1.09 g, 2.87 mmol) and DIPEA (495 mg, 3.83 mmol) were dissolved in DMF (8 mL) and stirred at 25 ℃ for 15 minutes before treated with 4'-amino-3'-methoxy-5- (4-methylpiperazin-1-yl) - [1, 1'-biphenyl] -3-ol (600 mg, 1.92 mmol) and stirred at 25 ℃ for 8 hours. The mixture was then poured into water (10 mL) and extracted with ethyl acetate (10 mL x 3) . The combined organic extracts were washed with water (10 mL x 3) , brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude title product, which was purified by FCC (eluent: DCM : MeOH = 1: 0 to 10: 1) to give the product as a brown oil (800 mg, crude) .

Step 5: Synthesis of tert-butyl 4- ( (3'-methoxy-5- (4-methylpiperazin-1-yl) -4'- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) - [1, 1'-biphenyl] -3-yl) oxy) butanoate

N- (3'-hydroxy-3-methoxy-5'- (4-methylpiperazin-1-yl) - [1, 1'-biphenyl] -4-yl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide (300 mg, 0.528 mmol) , tert-butyl 4-bromobutanoate (141 mg, 0.632 mmol) and K ₂CO ₃ (146 mg, 1.06 mmol) were dissolved in DMF (6 mL) and stirred at 25 ℃ for 8 hours. The mixture was poured into water (10 mL) and extracted with ethyl acetate (10 mL x 3) . The combined organic extracts were washed with water (10 mL x 3) , brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude title product, which was purified by FCC (eluent: DCM: MeOH = 1: 0 to 10: 1) to give the product as a brown oil (141 mg, crude) . ¹H NMR (400 MHz, CDCl ₃) : δ 10.44 (s, 1H) , 8.68 -8.62 (m, 1H) , 8.27 (d, J = 7.6 Hz, 1H) , 7.98 (t, J = 7.6 Hz, 1H) , 7.74 (d, J = 7.6 Hz, 1H) , 7.65 (d, J = 1.6 Hz, 1H) , 7.22 -7.13 (m, 1H) , 7.07 (d, J = 1.6 Hz, 1H) , 6.68 (s, 1H) , 6.63 (d, J = 1.6 Hz, 2H) , 6.43 (s, 1H) , 6.07 -6.00 (m, 1H) , 4.01 (t, J = 6.0 Hz, 2H) , 3.95 (s, 4H) , 3.50 -3.36 (m, 10H) , 2.91 (d, J = 4.8 Hz, 4H) , 2.54 (s, 4H) , 2.43 -2.37 (m, 2H) , 2.16 -2.10 (m, 1H) , 1.46 (d, J = 14.4 Hz, 1H) , 1.41 (s, 9H) .

Step 6: Synthesis of 4- ( (4'- (6- (1H-pyrazol-5-yl) picolinamido) -3'-methoxy-5- (4-methylpiperazin-1-yl) - [1, 1'-biphenyl] -3-yl) oxy) butanoic acid hydrochloride

tert-Butyl 4- ( (3'-methoxy-5- (4-methylpiperazin-1-yl) -4'- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) - [1, 1'-biphenyl] -3-yl) oxy) butanoate (141 mg, 0.198 mmol) were dissolved in HCl solution (2 mL, 4M in dioxane) and stirred at 25 ℃ for 3 hours. The reaction mixture was concentrated under reduced pressure to obtain crude product as a brown oil (112 mg, crude) , which was used for next step directly without further purification.

Step 7: Synthesis of

N- (3'- (4- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) c-arbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -4-oxobutoxy) -3-methoxy-5'- (4-methylpiperazin-1-yl) - [1, 1'-biphenyl] -4-yl) -6- (1H-pyrazol-5-yl) picolinamide

4- ( (4'- (6- (1H-pyrazol-5-yl) picolinamido) -3'-methoxy-5- (4-methylpiperazin-1-yl) - [1, 1'-biphenyl] -3-yl) oxy) butanoic acid hydrochloride (112 mg, 0.184 mmol) , HATU (112 mg, 0.295 mmol) and DIPEA (51 mg, 0.395 mmol) were dissolved in DMF (6 mL) . The reaction mixture was stirred at 25 ℃ for 15 minutes before treated with (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (92.0 mg, 0.197 mmol) and stirred at 25 ℃ for further 8 hours. The mixture was purified by prep-HPLC (Column: Waters Xbridge Prep OBD C18 150*30 5u, Mobile Phase A: water (10mM NH ₄HCO ₃) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 47%B to 62%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue, which was lyophilized to give the Compound 79 as a white solid (10.15 mg, 90.8%purity, 5.08%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.23 (br. s., 1H) , 10.82 (br. s., 1H) , 8.94 (s, 1H) , 8.54 (s, 1H) , 8.44 (s, 1H) , 8.26 -7.81 (m, 5H) , 7.41 -7.25 (m, 6H) , 6.96 (s, 1H) , 6.77 (s, 1H) , 6.64 (s, 1H) , 6.43 (s, 1H) , 5.11 (br. s., 1H) , 4.54 (d, J = 9.2 Hz, 1H) , 4.45 -4.37 (m, 2H) , 4.32 (s, 1H) , 4.18 (dd, J = 5.6, 16.0 Hz, 1H) , 4.07 (s, 3H) , 3.99 (t, J = 6.0 Hz, 2H) , 3.64 (s, 2H) , 3.18 (s, 4H) , 2.42 -2.37 (m, 7H) , 2.35 -2.28 (m, 2H) , 2.22 -2.12 (m, 3H) , 2.05 -1.79 (m, 4H) , 0.98 -0.85 (m, 9H) ; LCMS (ESI ⁺) : m/z 492.2 [M/2+H] ⁺.

General Scheme 26: Synthesis of Compound 80

Step 1: Synthesis of tert-Butyl methyl (4- (4-methylthiazol-5-yl) benzyl) carbamate

Iodomethane (560 mg, 3.94 mmol) was added dropwise to a solution of tert-butyl 4- (4-methylthiazol-5-yl) benzylcarbamate (1.00 g, 3.29 mmol) and sodium hydride (158 mg, 3.94 mmol, 60%in mineral oil) in DMF (10 mL) . The mixture was then stirred at 25℃ for 1 hour before treated with water (20 mL) to induce precipitate. The precipitate was collected and washed with water (10 mL) to give the title compound as a grey solid (1.00 g, crude) .

Step 2: Synthesis of N-methyl-1- (4- (4-methylthiazol-5-yl) phenyl) methanamine hydrochloride

A solution of tert-butyl methyl (4- (4-methylthiazol-5-yl) benzyl) carbamate (1.00 g, 3.14 mmol) and HCl solution (20 mL, 4M in MeOH) was stirred at 25℃ for 1 hour. The mixture was then concentrated under reduced pressure to give the title compound as a white solid (800 mg, crude) .

Step 3: Synthesis of

(2S, 4R) -tert-butyl 4-hydroxy-2- (methyl (4- (4-methylthiazol-5-yl) benzyl) -carbamoyl) pyrrolidine-1-carboxylate

A solution of N-methyl-1- (4- (4-methylthiazol-5-yl) phenyl) methanamine hydrochloride (400 mg, 1.83 mmol) , (2S, 4R) -1- (tert-butoxycarbonyl) -4-hydroxypyrrolidine-2-carboxylic acid (424 mg, 1.83 mmol) , HATU (697 mg, 1.83 mmol) , triethylamine (556 mg, 5.50 mmol) and DMF (10 mL) was stirred at 25℃ for 1 hour. Then the mixture was diluted with water (20 mL) and extracted with ethyl acetate (10 mL x 3) . The combined organic layers were washed with brine (10 mL) , dried over anhydrous Na ₂SO ₄, filtered and evaporated under reduced pressure to obtain a residue, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 2: 1) to give the title compound as a grey solid (300 mg, crude) .

Step 4: Synthesis of (2S, 4R) -4-hydroxy-N-methyl-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride

A solution of (2S, 4R) -tert-butyl 4-hydroxy-2- (methyl (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidine-1-carboxylate (300 mg, 0.695 mmol) and HCl solution (5 mL, 4M in MeOH) was stirred at 25℃ for 1 hour. Then the mixture was concentrated under reduced pressure to give the title compound as a grey solid (300 mg, crude) .

Step 5: Synthesis of tert-Butyl ( (S) -1- ( (2S, 4R) -4-hydroxy-2- (methyl (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) carbamate

A stir bar, (S) -2- ( (tert-butoxycarbonyl) amino) -3, 3-dimethylbutanoic acid (125 mg, 0.540 mmol) , N-ethyl-N-isopropylpropan-2-amine (350 mg, 2.71 mmol) , HATU (309 mg, 0.813 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask before treated with (2S, 4R) -4-hydroxy-N-methyl-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride (200 mg, 0.544 mmol) . The reaction mixture was stirred at room temperature for 2 hours. The mixture was then poured into water (8 mL) and extracted with ethyl acetate (15 mL x 5) . The combined organic extracts were washed with brine (8 mL x 3) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by prep-TLC (eluent: petroleum ether: ethyl acetate = 1: 1) to afford the title compound as a yellow solid (97.0 mg, crude) .

Step 6: Synthesis of

(2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N-methyl-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride

tert-butyl ( (S) -1- ( (2S, 4R) -4-hydroxy-2- (methyl (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) carbamate (97.0 mg, 0.178 mmol) and HCl solution (8 mL, 4 M in dioxane) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 25 ℃ for 40 minutes. The reaction mixture was then concentrated under reduced pressure to afford the title product as a pale yellow oil (85.0 mg, crude) .

Step 7: Synthesis of

N- (4- ( (7- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- (methyl (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -7-oxoheptyl) oxy) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 7- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) heptanoic acid Intermediate 7 (75.0 mg, 0.171 mmol) , 1-hydroxybenzotriazole (34.7 mg, 0.257 mmol) , N-ethyl-N-isopropylpropan-2-amine (111 mg, 0.859 mmol) , 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (49.2 mg, 0.257 mmol) and DMF (3 mL) were added to a 50 mL round-bottomed flask before treated with (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N-methyl-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride (85.0 mg, 0.177 mmol) . The reaction mixture was stirred at room temperature for 8 hours. The mixture was then poured into water (15 mL) and extracted with ethyl acetate (25 mL x 3) . The combined organic extracts were washed with brine (15 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by prep-HPLC (Column: Agela Durashell C18 150 x 25 5 u, Mobile Phase A: water (0.225%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 44%B to 74%) . The pure fractions were lyophilized to give the Compound 80 as a white powder (40.5 mg, 100%purity, 27.4%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.87 (br. s., 0.3H) , 13.23 (br. s., 0.7H) , 10.76 -10.20 (m, 1H) , 9.05 -8.85 (m, 1H) , 8.35 -7.55 (m, 6H) , 7.48 (s, 1H) , 7.38 (s, 3H) , 6.99 (s, 1H) , 6.80 -6.66 (m, 1H) , 6.61 -6.52 (m, 1H) , 5.24 -5.06 (m, 1H) , 4.95 -4.72 (m, 2H) , 4.67 -4.53 (m, 1H) , 4.46 -4.28 (m, 1H) , 4.20 (d, J = 15.2 Hz, 1H) , 4.02 -3.82 (m, 5H) , 3.73 -3.64 (m, 2H) , 3.09 (s, 2H) , 2.79 (s, 1H) , 2.47 -2.42 (m, 3H) , 2.35 -2.23 (m, 1H) , 2.19 -2.07 (m, 2H) , 2.04 -1.80 (m, 1H) , 1.76 -1.64 (m, 2H) , 1.59 -1.27 (m, 6H) , 1.03 -0.89 (m, 9H) ; LCMS (ESI ⁺) : m/z 433.3 [M/2+H] ⁺.

General Scheme 27: Exemplary synthesis of Compound 81

Step 1: Synthesis of tert-Butyl (2- (3-methoxy-4-nitrophenoxy) ethyl) (methyl) carbamate

A solution consisting of 4-fluoro-2-methoxy-1-nitrobenzene (1.95 g, 11.4 mmol) , tert-butyl (2-hydroxyethyl) (methyl) carbamate (2.00 g, 11.4 mmol) , tetrabutylammonium bromide (368 mg, 1.14 mmol) , KOH (1.28 g, 22.8 mmol) , and toluene/H ₂O (16 mL/4 mL) was stirred overnight at 90 ℃. The mixture was then poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 1: 1) to afford the title compound as yellow oil (3.20 g, crude) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 7.95 (d, J = 8.8 Hz, 1H) , 6.79 (br. s., 1H) , 6.67 (d, J = 8.8 Hz, 1H) , 4.30 -4.16 (m, 2H) , 3.92 (s, 3H) , 3.62 -3.49 (m, 2H) , 2.87 (d, J = 12.8 Hz, 3H) , 1.46 -1.27 (m, 9H) .

Step 2: Synthesis of tert-Butyl (2- (4-amino-3-methoxyphenoxy) ethyl) (methyl) carbamate

A stir bar, tert-butyl (2- (3-methoxy-4-nitrophenoxy) ethyl) (methyl) carbamate (1.00 g, 3.06 mmol) , Pd/C (300 mg) and MeOH (15 mL) were added to a 100 mL round-bottomed flask. The mixture was spared with H ₂ for 5 minutes and then stirred at room temperature under H ₂ (30 psi) for 16 hours. The suspension was filtered through a pad of

and the pad was washed with MeOH (20 mL) . The combined filtrate was concentrated under reduced pressure to afford the title product as brown oil (1 g, crude) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 6.53 (d, J = 8.4 Hz, 1H) , 6.45 (br. s., 1H) , 6.30 (dd, J = 2.4, 8.4 Hz, 1H) , 4.24 (s, 2H) , 4.01 -3.90 (m, 2H) , 3.79 -3.70 (m, 3H) , 3.46 (t, J = 5.8 Hz, 2H) , 2.86 (d, J = 12.4 Hz, 3H) , 1.39 (d, J = 8.8 Hz, 9H) .

Step 3: Synthesis of tert-Butyl (2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) ethyl) (methyl) carbamate

A stir bar, tert-butyl (2- (4-amino-3-methoxyphenoxy) ethyl) (methyl) carbamate (500 mg, 1.69 mmol) , 6- (1H-pyrazol-5-yl) picolinic acid Intermediate 5 (383 mg, 2.03 mmol) , HATU (770 mg, 2.03 mmol) , DIPEA (1.09 g, 8.44 mmol) and DMF (10 mL) were added to a 100 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 2 hours. The mixture was co-treated with another batch (500 mg scale of tert-butyl (2- (4-amino-3-methoxyphenoxy) ethyl) (methyl) carbamate) . The combined mixture was poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude as brown oil (1.5 g, crude) .

Step 4: Synthesis of N- (2-methoxy-4- (2- (methylamino) ethoxy) phenyl) -6- (1H-pyrazol-5-yl) picolinamide hydrochloride

A solution consisting of tert-butyl (2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) ethyl) (methyl) carbamate (750 mg, crude) and HCl solution (5 mL, 4M in dioxane) was stirred at room temperature for 12 hours. The reaction mixture was then concentrated under reduced pressure to afford the crude product as a white solid (740 mg, crude) .

Step 5: Synthesis of tert-Butyl 4- ( (2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) ethyl) (methyl) amino) butanoate

A stir bar, N- (2-methoxy-4- (2- (methylamino) ethoxy) phenyl) -6- (1H-pyrazol-5-yl) picolinamide hydrochloride (360 mg, crude) , tert-butyl 4-bromobutanoate (239 mg, 1.07 mmol) , K ₂CO ₃ (370 mg, 2.67 mmol) , KI (296 mg, 1.78 mmol) and DMF (5 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 80 ℃ for 4 hours and then poured into water (600 mL) to induce precipitate. The precipitate was filtered and dried to afford the crude product as a yellow solid (400 mg, crude) .

Step 6: Synthesis of 4- ( (2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) ethyl) (methyl) amino) butanoic acid hydrochloride

A solution consisting of tert-Butyl 4- ( (2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) ethyl) (methyl) amino) butanoate (200 mg, crude) and HCl solution (5 mL, 4M in dioxane) was stirred at room temperature for 12 hours. The reaction mixture was concentrated under reduced pressure to afford the crude product as a white solid (200 mg, crude) .

Step 7:

Synthesis of N- (4- (2- ( (4- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -4-oxobutyl) (methyl) amino) ethoxy) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A solution consisting of 4- ( (2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) ethyl) (methyl) amino) butanoic acid hydrochloride (100 mg, crude) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (103 mg, 0.221 mmol) , EDCI (63.4 mg, 0.331 mmol) , HOBt (44.7 mg, 0.331 mmol) , triethylamine (66.9 mg, 0.662 mmol) and DMF (2 mL) was stirred at room-temperature for 12 hours. The reaction mixture was then concentrated under reduced pressure to afford the crude product, which was purified prep-HPLC (Column Xtimate C18 150 x 25mm x 5um, Mobile Phase A: water (0.2%FA) , Mobile Phase B: ACN, Flow rate: 25 mL/min, gradient from 21%to 51%) . The pure fractions were lyophilized to afford the Compound 81 as a pink solid (26.8 mg, 97.3%purity, 15.0%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 10.56 (br. s., 1H) , 8.98 (s, 1H) , 8.61 -8.56 (m, 1H) , 8.29 (s, 1H) , 8.20 -8.14 (m, 1H) , 8.13 -8.07 (m, 1H) , 8.06 -8.01 (m, 1H) , 7.93 -7.81 (m, 2H) , 7.46 -7.36 (m, 4H) , 7.00 (d, J = 2.0 Hz, 1H) , 6.74 (d, J = 2.4 Hz, 1H) , 6.60 (dd, J = 2.4, 8.8 Hz, 1H) , 4.56 (d, J = 9.2 Hz, 1H) , 4.47 -4.39 (m, 2H) , 4.38 -4.33 (m, 1H) , 4.26 -4.18 (m, 1H) , 4.08 (t, J = 5.8 Hz, 2H) , 3.94 (s, 3H) , 3.73 -3.62 (m, 2H) , 2.72 (t, J = 5.8 Hz, 2H) , 2.44 (s, 3H) , 2.39 (t, J = 7.2 Hz, 2H) , 2.34 -2.27 (m, 1H) , 2.25 (s, 3H) , 2.22 -2.14 (m, 1H) , 2.08 -2.00 (m, 1H) , 1.95 -1.86 (m, 1H) , 1.73 -1.59 (m, 2H) , 0.97 -0.92 (m, 9H) ; LCMS (ESI ⁺) : m/z 866.3 [M+H] ⁺.

The following Compound 82 was prepared according to similar procedure as described for Compound 81.

General Scheme 28: Exemplary synthesis of Compound 83

Step 1: Synthesis of tert-Butyl 4- (3-methoxy-4-nitrophenoxy) piperidine-1-carboxylate

A solution consisting of 4-fluoro-2-methoxy-1-nitrobenzene (5.00 g, 29.2 mmol) , tert-butyl 4-hydroxypiperidine-1-carboxylate (11.8 g, 58.4 mmol) , tetrabutylammonium bromide (1.88 g, 5.84 mmol) , aqueous KOH (20 ml, 25%wt. %) , and toluene (20 mL) was stirred at 60 ℃ for 12 hours. The mixture was then poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 70: 30) to afford the title compound as yellow oil (7.30 g, 90.8%purity, 59%yield) . LCMS (ESI ⁺) : m/z 253.1 [M-100] ⁺.

Step 2: Synthesis of 4- (3-Methoxy-4-nitrophenoxy) piperidine hydrochloride

A solution consisting of tert-butyl 4- (3-methoxy-4-nitrophenoxy) piperidine-1-carboxylate (3.60 g, 10.2 mmol) and HCl solution (30 mL, 4M in dioxane) was stirred at room temperature for 2 hours. The reaction mixture was concentrated under reduced pressure to afford the product as a yellow solid (2.60 g, 98.5%purity, 86.9%yield) . LCMS (ESI ⁺) : m/z 252.9 [M+H] ⁺.

Step 3: Synthesis of tert-Butyl 3- (4- (3-methoxy-4-nitrophenoxy) piperidin-1-yl) -propanoate

A stir bar, 4- (3-methoxy-4-nitrophenoxy) piperidine hydrochloride (1.37 g, 4.76 mmol) , tert-butyl acrylate (915 mg, 7.14 mmol) , DBU (362 mg, 2.38 mmol) and MeCN (10 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at room temperature for 18 hours. The mixture was then poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product as a yellow solid (4.30 g, crude) .

Step 4: Synthesis of tert-Butyl 3- (4- (4-amino-3-methoxyphenoxy) piperidin-1-yl) -propanoate

A stir bar, tert-butyl 3- (4- (3-methoxy-4-nitrophenoxy) piperidin-1-yl) propanoate (2.00 g, crude) , Pd/C (400 mg) and MeOH (20 mL) were added to a 100 mL round-bottomed flask. The mixture was spared with H ₂ for 5 minutes, then stirred at room temperature under H ₂ (15 psi) for 16 hours. The suspension was filtered through a pad of

and the pad was washed with methanol (20 mL) . The combined filtrate was concentrated to dryness under reduced pressure to afford the title product as a brown oil (250 mg, 95.4%purity, 12.9%yield) . LCMS (ESI ⁺) : m/z 351.3 [M+H] ⁺.

Step 5: Synthesis of tert-Butyl 3- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) piperidin-1-yl) propanoate

A stir bar, tert-butyl 3- (4- (4-amino-3-methoxyphenoxy) piperidin-1-yl) propanoate (125 mg, 0.357 mmol) , 6- (1H-pyrazol-5-yl) picolinic acid Intermediate 5 (81.0 mg, 0.428 mmol) , HATU (163 mg, 0.428 mmol) , DIPEA (230 mg, 1.78 mmol) and DMF (5 mL) were added to a 100 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 2 hours. The reaction mixture was co-treated with another batch (125 mg scale of tert-butyl 3- (4- (4-amino-3-methoxyphenoxy) piperidin-1-yl) propanoate) . The combined mixture was poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product as brown oil (500 mg, crude) .

Step 6: Synthesis of 3- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) piperidin-1-yl) propanoic acid hydrochloride

A stir bar, tert-butyl 3- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) piperidin-1-yl) propanoate (250 mg, 0.479 mmol) and HCl solution (5 mL, 4M in dioxane) were added to a 100 mL round-bottomed flask. The mixture was stirred at 25 ℃ for 10 minutes. The reaction mixture was co-treated with another batch (250 mg scale of tert-butyl 3- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) piperidin-1-yl) propanoate) and concentrated under reduced pressure to afford the crude product as a white solid (300 mg, crude) .

Step 7: Synthesis of

N- (4- ( (1- (3- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) -carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -3-oxopropyl) piperidin-4-yl) oxy) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A solution consisting of 3- (4- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) piperidin-1-yl) propanoic acid hydrochloride (100 mg, crude) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (92.5 mg, 0.197 mmol) , EDCI (61.8 mg, 0.322 mmol) , HOBt (43.5 mg, 0.322 mmol) , triethylamine (65.2 mg, 0.644 mmol) and DMF (2 mL) was stirred at room temperature for 12 hours. The reaction mixture was concentrated under reduced pressure to afford the crude product, which was successively purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 0: 1) and prep-HPLC (Column Waters Xbridge Prep OBD C18 150 x 30mm x 5um, Mobile Phase A: water (10mM NH ₄HCO ₃) , Mobile Phase B: ACN, Flow rate: 25 mL/min, gradient from 30%to 60%) . The pure fractions were lyophilized to afford the Compound 83 as an off-white solid (15.0 mg, 97.2%purity, 8.5%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.25 (br. s., 1H) , 10.56 (br. s., 1H) , 8.94 (s, 1H) , 8.77 (d, J = 9.2 Hz, 1H) , 8.67 -8.60 (m, 1H) , 8.32 -8.07 (m, 3H) , 8.06 -8.01 (m, 1H) , 7.91 (br. s., 1H) , 7.48 -7.43 (m, 2H) , 7.42 -7.37 (m, 2H) , 6.99 (s, 1H) , 6.69 -6.63 (m, 1H) , 6.56 (dd, J = 2.4, 8.8 Hz, 1H) , 5.18 (d, J = 3.2 Hz, 1H) , 4.58 (d, J = 9.6 Hz, 1H) , 4.48 -4.42 (m, 2H) , 4.39 -4.34 (m, 1H) , 4.28 -4.17 (m, 1H) , 3.95 -3.83 (m, 3H) , 3.72 -3.61 (m, 3H) , 2.86 -2.72 (m, 2H) , 2.69 -2.59 (m, 2H) , 2.44 (s, 3H) , 2.37 -2.23 (m, 3H) , 2.08 -1.90 (m, 4H) , 1.82 -1.66 (m, 2H) , 1.26 -1.21 (m, 1H) , 0.97 (s, 9H) ; LCMS (ESI ⁺) : m/z 878.3 [M/2+H] ⁺.

General Scheme 29: Synthesis of Compound 84

Step 1: Synthesis of (E) -methyl 3- (2- (2-hydroxyethyl) phenyl) acrylate

A stir bar, 2- (2-bromophenyl) ethanol (3.00 g, 14.9 mmol) , methyl acrylate (2.04 g, 23.7 mmol) , TEA (7.55 g, 74.6 mmol) , Pd (OAc) ₂ (167 mg, 0.746 mmol) , tri-o-tolylphosphine (454 mg, 1.49 mmol) and DMF (20 mL) were added to a 100 mL round-bottomed flask at room-temperature. The reaction mixture was stirred at 95 ℃ for 16 hours under N ₂. The reaction mixture was then filtered and the filtrate was concentrated under reduced pressure to afford the crude compound, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 100: 0 to 80: 20) to afford the title compound as yellow oil (2.40 g, crude) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 7.96 (d, J = 16.0 Hz, 1H) , 7.73 (d, J = 7.6 Hz, 1H) , 7.39 -7.32 (m, 1H) , 7.31 -7.21 (m, 2H) , 6.53 (d, J = 16.0 Hz, 1H) , 4.80 (t, J = 5.2 Hz, 1H) , 3.73 (s, 3H) , 3.58 -3.50 (m, 2H) , 2.88 (t, J = 7.2 Hz, 2H) .

Step 2: Synthesis of methyl 3- (2- (2-hydroxyethyl) phenyl) propanoate

A stir bar, (E) -methyl 3- (2- (2-hydroxyethyl) phenyl) acrylate (1.20 g, 5.82 mmol) , Pd/C (400 mg) and MeOH (15 mL) were added to a 100 mL round-bottomed flask. The mixture was spared with H ₂ for 5 minutes, then stirred at room temperature under H ₂ (30 psi) for 16 hours. The suspension was filtered through a pad of

and the filtrate was concentrated to dryness under reduced pressure to afford the title product as black liquids (900 mg, 100% purity by ¹HNMR, 74%%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 7.20 -7.08 (m, 4H) , 4.72 (t, J = 4.8 Hz, 1H) , 3.59 (s, 3H) , 3.58 -3.50 (m, 2H) , 2.88 (t, J = 8.0 Hz, 2H) , 2.75 (t, J = 7.2 Hz, 2H) , 2.62 -2.55 (m, 2H) .

Step 3: Synthesis of methyl 3- (2- (2- ( (methylsulfonyl) oxy) ethyl) phenyl) propanoate

A stir bar, methyl 3- (2- (2-hydroxyethyl) phenyl) propanoate (700 mg, 3.36 mmol) , TEA (680 mg, 6.72 mmol) and DCM (15 mL) were added to a 50 mL round-bottomed flask at room-temperature before treated with methanesulfonyl chloride (590 mg, 5.15 mmol) . The reaction mixture was stirred for 5 hours, then diluted with water (15 mL) and extracted with dichloromethane (30 mL x 2) . The combined organic layers were washed with brine (30 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to give crude product as a white solid (780 mg, crude) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 7.27 -7.23 (m, 1H) , 7.22 -7.13 (m, 3H) , 4.38 (t, J = 6.8 Hz, 2H) , 3.59 (s, 3H) , 3.10 (s, 3H) , 3.04 (t, J = 6.8 Hz, 2H) , 2.92 -2.85 (m, 2H) , 2.64 -2.57 (m, 2H) .

Step 4: Synthesis of methyl 3- (2- (2- (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenoxy) ethyl) phenyl) propanoate

A stir bar, methyl 3- (2- (2- ( (methylsulfonyl) oxy) ethyl) phenyl) propanoate (300 mg, 1.05 mmol) , N- (4-hydroxy-2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide Intermediate 6 (413 mg, 1.05 mmol) , K ₂CO ₃ (290 mg, 2.10 mmol) and DMF (5 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 85 ℃ for 16 hours, then poured into water and was extracted with EtOAc (50 ml x 3) . The combined organic layer was washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to obtain a residue, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 3: 1) to give desired product as colorless oil (200 mg, crude) .

Step 5: Synthesis of

3- (2- (2- (3-Methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenoxy) ethyl) phenyl) propanoic acid

A stir bar, methyl 3- (2- (2- (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenoxy) ethyl) phenyl) propanoate (100 mg, 0.171 mmol) , sodium hydroxide (43.5 mg, 1.09 mmol) , THF (2 mL) and H ₂O (2 mL) were added to a 25 mL round-bottomed flask. Then the reaction mixture was stirred at room temperature for 3 hours before acidified with HCl (1M aqueous) to pH = 3 and extracted with DCM (10 mL x 3) . The combined organic layers were washed with brine (10 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated to afford the crude product as a white solid (100 mg, 92.6%purity, 94.7%yield) . LCMS (ESI ⁺) : m/z 571.1 [M+H] ⁺.

Step 6: Synthesis of 3- (2- (2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) ethyl) phenyl) propanoic acid hydrochloride

A stir bar, 3- (2- (2- (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenoxy) ethyl) phenyl) propanoic acid (100 mg, 0.175 mmol) , HCl solution (2 mL, 4M in dioxane) were added to a 25 mL round-bottomed flask. Then the reaction mixture was stirred at room temperature for 3 hours. The reaction mixture was concentrated under reduced pressure to afford the crude product as a white solid (200 mg, crude) .

Step 7: Synthesis of

N- (4- (2- (3- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) -carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -3-oxopropyl) phenethoxy) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A solution consisting of 3- (2- (2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenoxy) ethyl) phenyl) propanoic acid hydrochloride (107 mg, 0.206 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (96.0 mg, 0.206 mmol) , EDCI (59.1 mg, 0.308 mmol) , HOBt (41.7 mg, 0.308 mmol) , triethylamine (62.4 mg, 0.617 mmol) and DMF (2 mL) was stirred at room temperature for 12 hours. The reaction mixture was concentrated under reduced pressure to afford the crude product, which was purified prep-HPLC (Column: Xtimate C18 250 x 50mm x 10um, Mobile Phase A: water (0.04%NH ₃H ₂O+10mM NH ₄HCO ₃) , Mobile Phase B: ACN, Flow rate: 25 mL/min, gradient from 38%to 68%) . The pure fractions were lyophilized to afford the Compound 84 as a white solid (20.4 mg, 99.1%purity, 11.0%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 14.03 -13.14 (m, 1H) , 10.59 (br. s., 1H) , 8.97 (s, 1H) , 8.61 -8.54 (m, 1H) , 8.42 -8.18 (m, 1H) , 8.11 -8.00 (m, 3H) , 7.92 (br. s., 1H) , 7.81 -7.54 (m, 1H) , 7.43 -7.37 (m, 4H) , 7.31 -7.27 (m, 1H) , 7.25 -7.21 (m, 1H) , 7.18 -7.14 (m, 2H) , 6.99 (br. s., 1H) , 6.75 (br. s., 1H) , 6.62 (dd, J = 2.4, 8.8 Hz, 1H) , 5.17 (br. s., 1H) , 4.57 (d, J = 9.2 Hz, 1H) , 4.48 -4.40 (m, 2H) , 4.36 (br. s., 1H) , 4.26 -4.18 (m, 3H) , 3.97 (br. s., 2H) , 3.71 -3.64 (m, 2H) , 3.10 (t, J = 6.8 Hz, 2H) , 2.98 -2.84 (m, 2H) , 2.69 -2.58 (m, 2H) , 2.44 (s, 3H) , 2.36 -2.30 (m, 1H) , 2.10 -2.00 (m, 1H) , 1.96 -1.87 (m, 1H) , 0.90 (s, 9H) ; LCMS (ESI ⁺) : m/z 899.4 [M+H] ⁺.

The following Compounds 179, 180, 181, 182 and 183 were prepared according to similar procedure as described for Compound 84.

General Scheme 30: Exemplary synthesis of Compound 85

Step 1: Synthesis of methyl 2- (3-methoxy-4-nitrophenyl) acetate

A stir bar, 2- (3-methoxy-4-nitrophenyl) acetic acid (100 mg, 0.474 mmol) and MeOH (5 mL) were added to a 50 mL round-bottomed flask before treated with sulfuric acid (0.1 mL, 1.88 mmol) . The reaction mixture was stirred at 75 ℃ for 1 hour before cooling to room temperature. The reaction mixture was then concentrated under reduced pressure to afford the crude product, which was diluted with H ₂O (10 mL) and basified with solid NaHCO ₃ to obtain pH = 8. The resultant mixture was extracted with dichloromethane (25 mL x 3) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered, and concentrated under reduced pressure to afford the title compound as colorless oil (99.5 mg, 98.1 %purity, 91.5%yield) . LCMS (ESI ⁺) : m/z 226.1 [M+1] ⁺.

Step 2: Synthesis of methyl 2- (4-amino-3-methoxyphenyl) acetate

Wet Pd/C (50.0 mg) was added to a solution consisting of methyl 2- (3-methoxy-4-nitrophenyl) acetate (99.0 mg, 0.440 mmol) and MeOH (5 mL) . The mixture was degassed with H ₂ for three times, then stirred at room temperature under H ₂ (15 psi) for 12 hours. The reaction mixture was filtered through a pad of

and the filtrate was concentrated under reduced pressure to afford the title product as a yellow oil (90.0 mg, crude) .

Step 3: Synthesis of methyl 2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) acetate

A stir bar, methyl 2- (4-amino-3-methoxyphenyl) acetate (75.8 mg, 0.388 mmol) , 6- (1H-pyrazol-5-yl) picolinic acid Intermediate 5 (87.6 mg, 0.388 mmol) , 1-hydroxybenzotriazol (78.6 mg, 0.582 mmol) , DIPEA (151 mg, 1.168 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask. Then 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (112 mg, 0.584 mmol) was added to the mixture and the reaction mixture was stirred at 40 ℃ for 12 hours. The reaction was poured into water (20 mL) and extracted with ethyl acetate (30 mL x 3) . The combined organic extracts were washed with brine (30 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude residue, which was purified by prep-TLC (eluent: petroleum ether: ethyl acetate = 1: 2) to afford the title compound as a brown oil (77.0 mg, crude) .

Step 4: Synthesis of 2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) acetic acid

A stir bar, methyl 2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) acetate (77 mg, 0.210 mmol) , NaOH (4 mL, 1M aqueous) and THF (1 mL) were added to a 10 mL round-bottomed flask before stirred at 25 ℃ for 2 hours. The reaction mixture was concentrated and adjusted to pH = 3-4 with HCl (1 M aqueous) to induce precipitate. The precipitate was filtrated and dried to give the product as a brown solid (55.0 mg, 100%purity, 74.3 %yield) . LCMS (ESI ⁺) : m/z 353.1 [M+H] ⁺.

Step 5: Synthesis of tert-Butyl (5- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -5-oxopentyl) carbamate

5- ( (tert-Butoxycarbonyl) amino) pentanoic acid (70.0 mg, 0.322 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (150 mg, 0.321 mmol) , 1-hydroxybenzotriazol (65.3 mg, 0.483 mmol) , DIPEA (125 mg, 0.967 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask before treated with 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (92.6 mg, 0.483 mmol) . The reaction mixture was stirred at 40 ℃ for 12 hours, then poured into water (30 mL) and extracted with ethyl acetate (30 mL x 3) . The combined organic extracts were washed with brine (30 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude title product, which was purified by prep-TLC (eluent: dichloromethane: methanol = 10: 1) to afford the title compound as a brown solid (54.0 mg, crude) .

Step 6: Synthesis of

(2S, 4R) -1- ( (S) -2- (5-aminopentanamido) -3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride

A stir bar, tert-butyl (5- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -5-oxopentyl) carbamate (54.0 mg, 0.087 mmol) and HCl solution (3 mL, 4M in dioxane) were added to a 50 mL round-bottomed flask. The resultant mixture was stirred at 25 ℃ for 2 hours and concentrated under reduced pressure to afford the product as a brown solid (66.0 mg, crude) . LCMS (ESI ⁺) : m/z 530.3 [M+H] ⁺.

Step 7: Synthesis of

N- (4- (2- ( (5- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) -carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -5-oxopentyl) amino) -2-oxoethyl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, (2S, 4R) -1- ( (S) -2- (5-aminopentanamido) -3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride (66.0 mg, 0.117 mmol) , 2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) acetic acid (41.1 mg, 0.117 mmol) , 1-hydroxybenzotriazol (23.6 mg, 0.175 mmol) , DIPEA (45.3 mg, 0.350 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask before treated with 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (33.7 mg, 0.176 mmol) . The reaction mixture was stirred at 40 ℃ for 12 hours, then poured into water (20 mL) and extracted with ethyl acetate (30 mL x 3) . The combined organic layers were washed with brine (30 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated udner reduced pressure to obtain a residue, which was purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.2%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 30%B to 60%) . The pure fractions were lyophilized to give the Compound 85 as a white solid (10.1 mg, 100 %purity, 10.0 %yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 14.06 -13.13 (m, 1H) , 10.85 -10.47 (m, 1H) , 8.98 (s, 1H) , 8.74 -8.51 (m, 1H) , 8.40 -7.50 (m, 7H) , 7.48 -7.31 (m, 4H) , 7.12 -6.82 (m, 3H) , 5.15 (d, J = 3.2 Hz, 1H) , 4.54 (d, J = 9.2 Hz, 1H) , 4.48 -4.38 (m, 2H) , 4.34 (br. s., 1H) , 4.27 -4.12 (m, 1H) , 4.06 -3.80 (m, 3H) , 3.70 -3.60 (m, 2H) , 3.41 -3.39 (m, 2H) , 3.12 -2.98 (m, 2H) , 2.43 (s, 3H) , 2.31 -2.20 (m, 1H) , 2.20 -2.08 (m, 1H) , 2.08 -1.95 (m, 1H) , 1.95 -1.84 (m, 1H) , 1.60 -1.44 (m, 2H) , 1.44 -1.27 (m, 2H) , 0.92 (s, 9H) ; LCMS (ESI ⁺) : m/z 864.4 [M+H] ⁺.

General Scheme 31: Exemplary synthesis of Compound 86

Step 1: Synthesis of N- (4-cyano-2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide

A stir bar, 6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinic acid Intermediate 4 (2.80 g, 10.2 mmol) , 4-amino-3-methoxybenzonitrile (1.50 g, 10.1 mmol) , HATU (4.73 g, 12.4 mmol) , DIPEA (4.09 g, 30.3 mmol) and DMF (28 mL) were added to a 100 mL round-bottomed flask. The reaction mixture was stirred at 25 ℃ for 2 hours. The mixture was poured into water (30 mL) and extracted by ethyl acetate (50 mL x 3) . The combined organic extracts were washed with brine (30 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude title product which was purified by FCC (petroleum ether: ethyl acetate = 2: 1 to 1: 1) to give the product as pale brown solids (840 mg, crude) .

Step 2: Synthesis of N- (4- (aminomethyl) -2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide

To a stirred solution of N- (4-cyano-2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide (500 mg, 1.24 mmol) in absolute ethanol (5 mL) and conc. HCl (0.5 mL) , 10 %palladium on carbon (450 mg) was added under N ₂ atmosphere. The mixture was degassed and emerged with H ₂ for three times before stirred overnight under H ₂ atmosphere (15 Psi) . The mixture was then filtered through a pad of

and the filtrate was concentrated under reduced pressure to obtain a residue, which was poured into water (30 mL) , basified with Sat. Na ₂CO ₃ to obtain pH = 9, and extracted by ethyl acetate (50 mL x 3) . The combined organic extracts were washed with brine (30 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude, which was purified by FCC (dichloromethane: methanol = 20: 1 to 10: 1, 0.1%NH ₄OH) to give the product as a pale brown solid (82.0 mg, crude) .

Step 3: Synthesis of methyl 6- ( (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) benzyl) amino) -6-oxohexanoate

A stir bar, N- (4- (aminomethyl) -2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide (60.0 mg, 0.147 mmol) , 6-methoxy-6-oxohexanoic acid (23.3 mg, 0.145 mmol) , HATU (68.1 mg, 0.179 mmol) , DIPEA (58.8 mg, 0.435 mmol) and DMF (1 mL) were added to a 10 mL round-bottomed flask. The reaction mixture was stirred at 25 ℃ for 2 hours. The reaction was mixture was poured into water (30 mL) and extracted by ethyl acetate (50 mL x 3) . The combined organic extracts were washed with brine (30 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the residue, which was purified by prep. TLC (petroleum ether: ethyl acetate = 0: 1) to afford the title compound as a brown solid (62.0 mg, crude) .

Step 4: Synthesis of methyl 6- ( (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxybenzyl) amino) -6-oxohexanoate

A stir bar, methyl 6- ( (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) benzyl) amino) -6-oxohexanoate (62.0 mg, 0.113 mmol) , HCl solution (3 mL, 4M in dioxane) were added to a 50 mL round-bottomed flask and the resultant mixture was stirred at 25 ℃ for 2 hours. The mixture was concentrated to dryness under reduced pressure to afford the product as a brown solid (55.0 mg, crude) .

Step 5: Synthesis of 6- ( (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxybenzyl) amino) -6-oxohexanoic acid

A stir bar, methyl 6- ( (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxybenzyl) amino) -6-oxohexanoate (55.0 mg, 0.118 mmol) , NaOH (2 mL, 1M aqueous) and THF (1 mL) were added to a 10 mL round-bottomed flask and the resultant mixture was stirred at 25 ℃ for 2 hours. The reaction mixture was then concentrated and adjusted to pH = 3-4 with HCl (1 M aqueous) to induce precipitate. The resultant suspension was stirred at room temperature for 0.5 hour and filtrated to obtain precipitate, which was dried to give the product as a brown solid (50.0 mg, 94.2%purity, 93.7%yield) . LCMS (ESI ⁺) : m/z 452.2 [M+H] ⁺.

Step 6: Synthesis of

N ¹- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxybenzyl) -N ⁶- ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) adipamide

A stir bar, 6- ( (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxybenzyl) amino) -6-oxohexanoic acid (55.5 mg, 0.123 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (57.4 mg, 0.123 mol) , 1-hydroxybenzotriazol (24.9 mg, 0.184 mmol) , DIPEA (47.8 mg, 0.370 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask before treated with 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (35.5 mg, 0.185 mmol) . The reaction mixture was stirred at 40 ℃ for 12 hours, then poured into water (10 mL) and extracted with ethyl acetate (30 mL x 3) . The combined organic extratcts were concentarted under reduced pressure to obtain a residue, which was purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.2%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 31 %to 61 %) . The pure fractions were lyophilized to give the Compound 86 as a white solid (25.4 mg, 100 %purity, 23.9 %yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.24 (br. s., 1H) , 10.73 (br. s., 1H) , 8.96 (s, 1H) , 8.71 -8.50 (m, 1H) , 8.36 -7.99 (m, 5H) , 7.87 (d, J = 9.2 Hz, 2H) , 7.45 -7.30 (m, 4H) , 7.05 -6.82 (m, 3H) , 5.15 (br. s., 1H) , 4.57 -4.15 (m, 7H) , 3.95 (br. s., 3H) , 3.74 -3.57 (m, 2H) , 2.43 (s, 3H) , 2.36 -1.82 (m, 6H) , 1.61 -1.41 (m, 4H) , 0.92 (s, 9H) ; LCMS (ESI ⁺) : m/z 864.5 [M+H] ⁺.

General Scheme 32: Exemplary synthesis of Compound 87

Step 1: Synthesis of methyl 7- ( (3-methoxy-4-nitrophenyl) amino) heptanoate

A mixture of 4-fluoro-2-methoxy-1-nitrobenzene (2.00 g, 11.7 mmol) , methyl 7-aminoheptanoate hydrochloride (3.43 g, 17.5 mmol) , potassium carbonate (4.88 g, 35.3 mmol) and DMF (20 mL) were added to a 40 mL of sealed tube. The mixture was heated and stirred at 100 ℃ under microwave irradiation for 2 hours. The resulting solution was diluted with water and extracted with ethyl acetate (50 mL x 3) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered, and concentrated in vacuo to obtain a residue, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 100: 0 to 30: 70) to give the product as yellow oil (1.80 g, crude) .

Step 2: Synthesis of methyl 7- ( (tert-butoxycarbonyl) (3-methoxy-4-nitrophenyl) -amino) heptanoate

A mixture of methyl 7- ( (3-methoxy-4-nitrophenyl) amino) heptanoate (1.80 g, 5.80 mmol) , di-tert-butyl dicarbonate (1.52 g, 6.97 mmol) , 4-dimethylaminopyridine (2.13 g, 17.4 mmol) and DCM (20 mL) were added to a 100 mL round-bottomed flask. The mixture was stirred at room tempurature for 2 hours. The resulting solution was then diluted with water and extracted with ethyl acetate (50 mL x 3) . The combined organic layers were dried over anhydrous Na ₂SO ₄, filtered, and concentrated in vacuo to obtain a residue, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 100: 0 to 30: 70) to give the product as yellow oil (1.60 g, crude) .

Step 3: Synthesis of methyl 7- ( (4-amino-3-methoxyphenyl) (tert-butoxycarbonyl) -amino) heptanoate

A stir bar, methyl 7- ( (tert-butoxycarbonyl) (3-methoxy-4-nitrophenyl) amino) heptanoate (1.00 g, 2.44 mmol) , Pd/C (500 mg) and MeOH (20 mL) were added to a 50 mL round-bottomed flask. The mixture was sparged with H ₂ for 5 minutes and then stirred at room temperature under H ₂ (15 psi) for 12 hours. The mixture was filtered through a pad of

and the filtrate was concentrated under reduced pressure to obtain the title product as black oil (900 mg, crude) .

Step 4: Synthesis of

Methyl 7- ( (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) (tert-butoxycarbonyl) amino) heptanoate

A stir bar, methyl 7- ( (4-amino-3-methoxyphenyl) (tert-butoxycarbonyl) amino) heptanoate (500 mg, 1.31 mmol) , 6- (1H-pyrazol-3-yl) picolinic acid hydrochloride Intermediate 5 (298 mg, 1.32 mmol) , HATU (945 mg, 2.63 mmol) , N-ethyl-N-isopropylpropan-2-amine (341 mg, 2.64 mmol) and DMF (5 mL) were added to a 40 mL round-bottomed flask. The reaction mixture was stirred at room temperature for 2 hours before diluted with water and extracted with ethyl acetate (10 mL x 3) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered, and concentrated in vacuo to obtain a residue, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 0: 1) to give the product as brown oil (600 mg, crude) .

Step 5: Synthesis of 7- ( (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) (tert-butoxycarbonyl) amino) heptanoic acid

A stir bar, methyl 7- ( (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) (tert-butoxycarbonyl) amino) heptanoate (100 mg, 0.181 mmol) , sodium hydroxide (3 mL, 3.00 mmol, 1M aqueous) and THF (1 mL) were added into a 100 mL round-bottomed flak and stirred for 4 hours. The mixture was concentrated under reduced pressure, the residue was acidified to pH<6 with HCl (1M aqueous) and extracted with ethyl acetate (10 mL x 3) . The combined organic layers were dried over anhydrous Na ₂SO ₄, filtered, and concentrated in vacuo to give the product as a colorless oil (90.0 mg, crude) .

Step 6:

Synthesis of tert-Butyl (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) (7- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -7-oxoheptyl) carbamate

A stir bar, 7- ( (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) (tert-butoxycarbonyl) amino) heptanoic acid (90.0 mg, 0.167 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (72.4 mg, 0.155 mmol) , HATU (120 mg, 0.334 mmol) , N-ethyl-N-isopropylpropan-2-amine (43.4 mg, 0.336 mmol) and DMF (1 mL) were added to a 40 mL round-bottomed flask. The reaction mixture was stirred at room temperature for 2 hours. The resulting solution was then diluted with water (10 mL) and extracted with ethyl acetate (10 mL x 3) . The combined organic layers were dried over anhydrous Na ₂SO ₄, filtered, and concentrated under reduced pressure to give a residue, which was purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (10mM NH ₄HCO ₃) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 40%B to 70%) to afford the title compound as a white solid (44.9 mg, 96.9%purity, 27.4%yield) . ¹H NMR (400MHz, DMSO-d ₆) : δ 13.91 -13.81 (m, 0.2H) , 13.24 (s, 0.8H) , 10.80 -10.52 (m, 1H) , 8.97 (s, 1H) , 8.58 -8.52 (m, 1H) , 8.40 -8.31 (m, 1H) , 8.25 -8.18 (m, 1H) , 8.14 -8.08 (m, 1H) , 8.08 -8.03 (m, 1H) , 7.96 -7.90 (m, 1H) , 7.84 (d, J = 9.2 Hz, 1H) , 7.44 -7.34 (m, 4H) , 6.99 (d, J = 6.0 Hz, 2H) , 6.90 -6.84 (m, 1H) , 5.11 (d, J = 3.2 Hz, 1H) , 4.53 (d, J = 9.2 Hz, 1H) , 4.47 -4.38 (m, 2H) , 4.37 -4.30 (m, 1H) , 4.26 -4.16 (m, 1H) , 4.01 -3.83 (m, 3H) , 3.67 -3.55 (m, 4H) , 2.44 (s, 3H) , 2.30 -2.20 (m, 1H) , 2.13 -1.98 (m, 2H) , 1.95 -1.84 (m, 1H) , 1.48 -1.42 (m, 3H) , 1.39 (s, 9H) , 1.30 -1.20 (m, 5H) , 0.91 (s, 9H) ; LCMS (ESI ⁺) : m/z 972.5 [M+Na] ⁺.

Step 7: Synthesis of

N- (4- ( (7- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) -carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -7-oxoheptyl) amino) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A mixture of tert-butyl (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) (7- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -7-oxoheptyl) carbamate (30 mg, 0.032 mmol) and HCl solution (2 mL, 4M in dioxane) was added into a 100 mL round-bottommed flask and stirred at romm tempuriture for 2 hours. The resulting solution was diluted with water (10 mL) and extracted with ethyl acetate (10 mL x 3) . The combined organic layer was dried over anhydrous Na ₂SO ₄, filtered, and concentrated under reduced pressure to obtain a residue, which was purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.2%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 25%B to 55%) . The pure fractions were lyophilized to dryness to afford the Compound 87 as white solids (21.4 mg, 100%purity, 79.7%yield) . ¹H NMR (400MHz, DMSO-d ₆) : δ 13.96 -13.76 (m, 0.2H) , 13.32 -13.11 (m, 0.8H) , 10.45 (s, 1H) , 8.98 (s, 1H) , 8.59 -8.53 (m, 1H) , 8.20 -8.12 (m, 1H) , 8.07 (t, J = 7.6 Hz, 2H) , 8.02 -7.98 (m, 1H) , 7.96 -7.90 (m, 1H) , 7.87 (d, J = 9.2 Hz, 1H) , 7.40 (q, J = 8.4 Hz, 4H) , 7.01 -6.96 (m, 1H) , 6.38 -6.33 (m, 1H) , 6.17 (dd, J = 2.0, 8.4 Hz, 1H) , 5.61 -5.53 (m, 1H) , 5.17 -5.10 (m, 1H) , 4.55 (d, J = 9.6 Hz, 1H) , 4.47 -4.39 (m, 2H) , 4.37 -4.32 (m, 1H) , 4.21 (dd, J = 5.6, 16.0 Hz, 1H) , 3.94 -3.73 (m, 3H) , 3.70 -3.61 (m, 2H) , 3.04 -2.97 (m, 2H) , 2.44 (s, 3H) , 2.31 -2.24 (m, 1H) , 2.18 -2.09 (m, 1H) , 2.07 -1.99 (m, 1H) , 1.95 -1.86 (m, 1H) , 1.56 -1.48 (m, 4H) , 1.37 -1.28 (m, 4H) , 0.92 (s, 9H) ; LCMS (ESI ⁺) : 425.8 [M/2+H] ⁺.

General Scheme 33: Exemplary synthesis of Compound 88

Step 1: Synthesis of 4- (3- ( (tert-Butyldimethylsilyl) oxy) propoxy) -2-chloropyrimidine

A stir bar, 3- ( (tert-butyldimethylsilyl) oxy) propan-1-ol (25.5 g, 134 mmol) in THF was added t-BuOK (134 mL, 1M in THF, 134 mmol) . The reaction mixture was stirred at 0 ℃ for 30 minutes, then to above mixture was added 2, 4-dichloropyrimidine (20 g, 134 mmol) over for 30 minutes. The reaction mixture was stirred at room temperature for 16 hours. The mixture was poured into water and was extracted by ethyl acetate (150 mL x 3) . The combined organic extracts were washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure. The residue was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 20: 1) to give afford the title compound as a colorless oil (2.96 g, 92.2%purity, 3.35%yield) . LCMS (ESI ⁺) : m/z 303.1 [M+H] ⁺.

Step 2: Synthesis of 4- (3- ( (tert-Butyldimethylsilyl) oxy) propoxy) -2- (3-methoxy-4-nitrophenyl) pyrimidine

4- (3- ( (tert-butyldimethylsilyl) oxy) propoxy) -2-chloropyrimidine (2.26 g, 3.73 mmol) , 2- (3-methoxy-4-nitrophenyl) -4, 4, 5, 5-tetramethyl-1, 3, 2-dioxaborolane (1.04 g, 3.73 mmol) , and K ₂CO ₃ (1.54 g, 11.2 mmol) were added in dioxane/H ₂O (45 mL, V: V = 3: 1) . The mixture was added Pd (dppf) Cl ₂·CH ₂Cl ₂ (609. mg, 0.745 mmol) under N ₂ atmosphere. The mixture was stirred at 90 ℃ for 12 hours. The mixture was poured into water and was extracted by ethyl acetate (50 mL *3) . The combined organic extracts were washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure. The residue was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 5: 1) to afford the title compound as a colorless oil (1.03 g, crude) .

Step 3: Synthesis of 4- (4- (3- ( (tert-Butyldimethylsilyl) oxy) propoxy) pyrimidin-2-yl) -2-methoxyaniline

A stir bar, 4- (3- ( (tert-butyldimethylsilyl) oxy) propoxy) -2- (3-methoxy-4-nitrophenyl) pyrimidine (300 mg, 0.72 mmol) , Pd/C (100 mg) and MeOH (20 mL) were added to a hydrogenated bottle under N ₂ atmosphere. The suspension was degassed under vacuum and purged with N ₂ atmosphere for three times, and then purged with hydrogen for three times. The resulting mixture was stirred under hydrogen (15 psi) at 25 ℃ for 12 hours. The mixture was filtered, through a pad of

and the pad washed with MeOH (30 mL) , the filtrate was concentrated to give desired compound as a yellow oil (158 mg, crude) .

Step 4: Synthesis of

N- (4- (4- (3- ( (tert-butyldimethylsilyl) oxy) propoxy) pyrimidin-2-yl) -2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide

To a solution of 6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinic acid Intermediate 4 (138 mg, 0.446 mmol) in DMF (10 mL) was added EDCI (101 mg, 0.527 mmol) , HOBt (71.2 mg, 0.527 mmol) and DIPEA (262 mg, 2.03 mmol) . The mixture was stirred at room temperature for 10 minutes. 4- (4- (3- ( (tert-butyldimethylsilyl) oxy) propoxy) pyrimidin-2-yl) -2-methoxyaniline (158 mg, 0.406 mmol) was added. The mixture was stirred at 25 ℃ overnight. The mixture was poured into water and extracted by DCM (50 mL x 3) . The combined organic extracts were washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure. The residue was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 1: 1) to give desired product as yellow oil (120 mg, crude) . ¹H NMR (400MHz, CDCl ₃) : δ 10.62 (s, 1H) , 8.78 (d, J = 8.8 Hz, 1H) , 8.50 (d, J = 5.6 Hz, 1H) , 8.35 -8.32 (m, 1H) , 8.19 (dd, J = 1.6, 8.4 Hz, 1H) , 8.13 -8.08 (m, 1H) , 8.03 (t, J = 7.6 Hz, 1H) , 7.80 (d, J = 8.0 Hz, 1H) , 7.70 (d, J = 1.6 Hz, 1H) , 6.69 (d, J = 1.6 Hz, 1H) , 6.61 (d, J = 5.6 Hz, 1H) , 6.09 (dd, J = 2.0, 9.6 Hz, 1H) , 4.63 (t, J = 6.4 Hz, 2H) , 4.06 (s, 3H) , 4.03 -3.96 (m, 1H) , 3.84 (t, J = 6.0 Hz, 2H) , 3.55 -3.48 (m, 1H) , 2.67 -2.57 (m, 1H) , 2.23 -2.16 (m, 1H) , 2.14 -2.06 (m, 3H) , 1.80 -1.64 (m, 2H) , 1.55 -1.47 (m, 1H) , 0.91 (s, 9H) , 0.07 (s, 6H) .

Step 5: Synthesis of

N- (4- (4- (3-hydroxypropoxy) pyrimidin-2-yl) -2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide

A stir bar, N- (4- (4- (3- ( (tert-butyldimethylsilyl) oxy) propoxy) pyrimidin-2-yl) -2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide (120.00 mg, 0.186 mmol) , TBAF (0.74 mL, 0.744 mmol, 1M in THF) and THF (3 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 2 hours. The mixture was then poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The organic extracts were dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 1: 1) to afford the title compound as light yellow oil (70.0 mg, crude) .

Step 6: Synthesis of

3- ( (2- (3-Methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) -picolinamido) phenyl) pyrimidin-4-yl) oxy) propanoic acid

N- (4- (4- (3-hydroxypropoxy) pyrimidin-2-yl) -2-methoxyphenyl) -6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamide (50.0 mg, 0.094 mmol) was dissolved in DCM/H ₂O (2 mL/1 mL) . Tempo (4.42 mg, 0.028 mmol) and BIAB (91.1 mg, 0.283 mol) were added to the reaction mixture at 0 ℃. The reaction mixture was stirred at room temperature for 18 hours. The reaction mixture was quenched by aqueous Na ₂S ₂O ₃ (5 mL) . The organic layer was subsequently extracted with aqueous Na ₂CO ₃ (20 mL x 3) . The combined aqueous phase was acidified to pH = 6-7 with HCl (1M aqueous) and extracted with DCM (30 mL x 3) . The combined organic layers were concentrated to give desired product as a yellow solid (50 mg, crude) .

Step 7: Synthesis of

3- ( (2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) pyrimidin-4-yl) oxy) propanoic acid hydrochloride

A stir bar, 3- ( (2- (3-methoxy-4- (6- (1- (tetrahydro-2H-pyran-2-yl) -1H-pyrazol-5-yl) picolinamido) phenyl) pyrimidin-4-yl) oxy) propanoic acid (50.0 mg, 0.092 mmol) and dioxane (3 mL) were added to a 50 mL round-bottomed flask. To the mixture was added HCl solution (3 mL, 4M in dioxane) dropwise with stirring at 25 ℃ for 3 hours. The mixture was concentrated to dryness under reduced pressure to afford the title compound (50 mg, crude) .

Step 8: Synthesis of

N- (4- (4- (3- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) -carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -3-oxo-propoxy) pyrimidin-2-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

To a solution of 3- ( (2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) pyrimidin-4-yl) oxy) propanoic acid hydrochloride (45.0 mg, 0.0910 mmol) in DMF (2 mL) was added EDCI (24.4 mg, 0.130 mmol) , HOBt (17.2 mg, 0.280 mmol) and DIPEA (25.3 mg, 0.200 mmol) . The mixture was stirred at room temperature for 10 min. (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (50.2 mg, 0.108 mmol) was added. The mixture was stirred at 30 ℃ overnight. The mixture was poured into water and was extracted by DCM (10 mL x 3) . The combined organic extracts were washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude title product. The residue was purified by prep-HPLC (Column: Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.225%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 39%B to 69%) . The pure fractions were lyophilized to give the Compound 88 as white powder (16.0 mg, 95.8%purity, 16.8%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.27 (s, 1H) , 11.01 (s, 1H) , 8.97 (s, 1H) , 8.65 -8.50 (m, 3H) , 8.30 -8.06 (m, 6H) , 7.96 (s, 1H) , 7.49 -7.29 (m, 4H) , 7.00 (s, 1H) , 6.82 -6.74 (m, 1H) , 5.17 (d, J = 3.4 Hz, 1H) , 4.77 -4.66 (m, 2H) , 4.61 (d, J = 9.4 Hz, 1H) , 4.49 -4.40 (m, 2H) , 4.36 (s, 1H) , 4.22 (m, 1H) , 4.16 -4.00 (m, 3H) , 3.74 -3.61 (m, 2H) , 2.94 -2.84 (m, 1H) , 2.78 -2.69 (m, 1H) , 2.44 (s, 3H) , 2.10 -2.00 (m, 1H) , 1.91 (m, 1H) , 1.03 -0.88 (m, 9H) ; LCMS (ESI ⁺) : m/z 873.4 [M+H] ⁺.

General Scheme 34: Exemplary synthesis of Compound 89

Step 1: Synthesis of tert-Butyl ( (S) -1- ( (2S, 4R) -2- ( ( (R) -1- (4-bromophenyl) -2, 2, 2-trifluoroethyl) carbamoyl) -4-hydroxypyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) carbamate

A stir bar, (2S, 4R) -1- ( (S) -2- ( (tert-butoxycarbonyl) amino) -3, 3-dimethylbutanoyl) -4-hydroxypyrrolidine-2-carboxylic acid Intermediate 21 (610 mg, 1.77 mmol) , 1-hydroxybenzotriazole (240 mg, 1.78 mmol) , N-ethyl-N-isopropylpropan-2-amine (1.05 mL, 5.90 mmol) , 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (340 mg, 1.77 mmol) and DMF (8 mL) were added to a 50 mL round-bottomed flask before treated with (R) -1- (4-bromophenyl) -2, 2, 2-trifluoroethanamine (300 mg, 1.18 mmol) . The reaction mixture was stirred at room temperature for 8 hours. The mixture was then poured into water (30 mL) and extracted with ethyl acetate (50 mL x 2) . The combined organic extracts were washed with brine (30 mL x 2) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 1: 1) to afford the product as a white solid (220 mg, 100%purity by ¹HNMR, 32.1%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 9.27 (d, J = 9.2 Hz, 1H) , 7.63 (d, J = 8.4 Hz, 2H) , 7.50 (d, J = 8.4 Hz, 2H) , 6.48 (d, J = 9.2 Hz, 1H) , 5.98 -5.56 (m, 1H) , 5.15 (d, J = 2.8 Hz, 1H) , 4.56 (t, J = 8.0 Hz, 1H) , 4.27 (s, 1H) , 4.13 (d, J = 8.8 Hz, 1H) , 3.67 -3.48 (m, 2H) , 2.05 -1.98 (m, 1H) , 1.75 -1.61 (m, 1H) , 1.38 (s, 9H) , 0.92 (s, 9H) .

Step 2: Synthesis of tert-Butyl ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( ( (R) -2, 2, 2-trifluoro-1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) carbamate

A stir bar, tert-butyl ( (S) -1- ( (2S, 4R) -2- ( ( (R) -1- (4-bromophenyl) -2, 2, 2-trifluoroethyl) -carbamoyl) -4-hydroxypyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) carbamate (220 mg, 0.379 mmol) , 4-methylthiazole (75.2 mg, 0.758 mmol) , Pd (OAc) ₂ (8.50 mg, 0.038 mmol) , potassium acetate (93.0 mg, 0.948 mmol) and DMF (3 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was sparged with N ₂ for three times and stirred at 130 ℃ for 12 hours. The reaction mixture was filtered, diluted with water (30 mL) and extracted with ethyl acetate (30 mL x 2) . The combined organic extracts were washed with brine (30 mL) , dried over Na ₂SO ₄, filtered and concentrated under reduced pressure to give the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 1: 1) to give the title product as a white solid (180 mg, crude) .

Step 3: Synthesis of

(2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- ( (R) -2, 2, 2-trifluoro-1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) pyrrolidine-2-carboxamide hydrochloride

tert-butyl ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( ( (R) -2, 2, 2-trifluoro-1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) carbamate (40.0 mg, 0.067 mmol) and HCl solution (5 mL, 4M in dioxane) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 20 ℃ for 20 minutes. The reaction mixture was concentrated under reduced pressure to give the product as a pale yellow solid (30.0 mg, crude) .

Step 4: Synthesis of

N- (4- (4- (2- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( ( (R) -2, 2, 2-trifluoro-1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethoxy) piperidin-1-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 2- ( (1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) acetic acid hydrochloride Intermediate 18 (27.3 mg, 0.056 mmol) , 1-hydroxybenzotriazole (11.4 mg, 0.084 mmol) , N-ethyl-N-isopropylpropan-2-amine (36.3 mg, 0.281 mmol) , 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (16.2 mg, 0.085 mmol) and DMF (2 mL) were added to a 50 mL round-bottomed flask before treated with (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- ( (R) -2, 2, 2-trifluoro-1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) pyrrolidine-2-carboxamide hydrochloride (30.0 mg, 0.056 mmol) . The reaction mixture was stirred at room temperature for 8 hours. The mixture was then poured into water (8 mL) and extracted with ethyl acetate (15 mL x 5) . The combined organic extracts were washed with brine (8 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by prep-HPLC (Column: Waters Xbridge Prep OBD C18 150 x 30 5 u, Mobile Phase A: water (10mM NH ₄HCO ₃) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 35%B to 65%) to give the Compound 89 as a pale yellow powder (10.21 mg, 96.14%purity, 18.8%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.89 (br. s., 0.3H) , 13.24 (br. s., 0.7H) , 10.59 (s, 0.7H) , 10.40 (s, 0.3H) , 9.36 (d, J = 9.2 Hz, 1H) , 9.03 (s, 1H) , 8.25 -7.90 (m, 4H) , 7.68 -7.49 (m, 4H) , 7.44 (d, J = 9.6 Hz, 1H) , 7.06 -6.94 (m, 1H) , 6.80 -6.67 (m, 1H) , 6.58 (d, J = 9.2 Hz, 1H) , 5.90 -5.80 (m, 1H) , 5.19 (d, J = 3.2 Hz, 1H) , 4.69 -4.49 (m, 1H) , 4.34 -4.20 (m, 1H) , 4.15 -3.93 (m, 4H) , 3.85 (s, 1H) , 3.68 -3.43 (m, 5H) , 3.16 (d, J = 5.2 Hz, 1H) , 3.00 -2.86 (m, 2H) , 2.47 (s, 3H) , 2.13 -1.91 (m, 3H) , 1.77 -1.55 (m, 3H) , 0.95 (s, 9H) ; LCMS (ESI ⁺) : m/z 932.3 [M+H] ⁺.

The following Compound 90 was prepared according to similar procedure as described for Compound 89.

General Scheme 35: Exemplary synthesis of Compound 91

Step 1: Synthesis of (3R, 4S) -3-Fluoropiperidin-4-ol hydrochloride

A mixture of (3R, 4S) -tert-butyl 3-fluoro-4-hydroxypiperidine-1-carboxylate (1.00 g, 4.56 mmol) in HCl solution (5 mL, 4M in dioxane) was stirred for 12 hours at 20 ℃ under N ₂ flow. The mixture was concentrated to dryness to afford the product as a yellow solid (700 mg, crude) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 9.87 (br s, 1H) , 8.94 (br s, 1H) , 5.36 (br s, 1H) , 4.95 -4.65 (m, 1H) , 3.98 -3.73 (m, 1H) , 3.40 -3.28 (m, 1H) , 3.26 -3.01 (m, 2H) , 2.92 (br s, 1H) , 1.79 (br d, J = 4.9 Hz, 2H) .

Step 2: Synthesis of (3R, 4S) -3-Fluoro-1- (3-methoxy-4-nitrophenyl) piperidin-4-ol

A mixture of 4-fluoro-2-methoxy-1-nitrobenzene (660 mg, 3.86 mmol) , (3R, 4S) -3-Fluoropiperidin-4-ol hydrochloride (600 mg, 3.86 mmol) and K ₂CO ₃ (1.07 g, 7.71 mmol) in DMF (5 mL) was stirred for 12 hours at 80 ℃ under N ₂ flow. The solvent was concentrated under reduced pressure to afford the crude product which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 1: 3) to afford the title compound as a yellow solid (700 mg, crude) . ¹H NMR (400 MHz, CDCl ₃) : δ 8.01 (s, 1H) , 7.99 (s, 1H) , 6.46 (dd, J = 2.4, 9.3 Hz, 1H) , 6.37 (d, J = 2.4 Hz, 1H) , 4.87 -4.65 (m, 1H) , 4.10 (dtd, J = 3.2, 7.1, 10.3 Hz, 1H) , 3.96 (s, 3H) , 3.85 (td, J = 6.8, 13.7 Hz, 1H) , 3.69 -3.45 (m, 2H) , 3.38 -3.25 (m, 1H) , 2.16 (br s, 1H) , 2.06 -1.85 (m, 2H) .

Step 3: Synthesis of tert-Butyl 2- ( ( (3R, 4S) -3-fluoro-1- (3-methoxy-4-nitrophenyl) piperidin-4-yl) oxy) acetate

A stirred solution of (3R, 4S) -3-fluoro-1- (3-methoxy-4-nitrophenyl) piperidin-4-ol (600 mg, 2.22 mmol) in DCM (20 mL) containing rhodium acetate dimer (100 mg, 0.226 mmol) was refluxed while tert-butyl 2-diazoacetate (950 mg, 6.68 mmol) in CH ₂CI ₂ (10 mL) was added dropwise. After the addition was completed, then the mixture was stirred for 2 hours at 40 ℃ under N ₂ flow. The solvent was concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 1: 3) to give desired compound as a yellow solid (450 mg, crude) .

Step 4: Synthesis of tert-Butyl 2- ( ( (3R, 4S) -1- (4-amino-3-methoxyphenyl) -3-fluoropiperidin-4-yl) oxy) acetate

A mixture of tert-butyl 2- ( ( (3R, 4S) -3-fluoro-1- (3-methoxy-4-nitrophenyl) piperidin-4-yl) oxy) acetate (220 mg, 0.57 mmol) , Pd/C (50 mg, wet) in ethyl acetate (10 mL) was stirred for 2 hours at 20 ℃ under H ₂ (15 psi) . The suspension was filtered through a pad of

and the pad was washed with ethyl acetate (30 mL) . The filtrate was concentrated to dryness under reduced pressure to afford the crude product (170 mg, crude) . ¹H NMR (400 MHz, CDCl ₃) : δ 6.63 (d, J = 8.3 Hz, 1H) , 6.53 (d, J = 2.4 Hz, 1H) , 6.42 (dd, J = 2.4, 8.3 Hz, 1H) , 4.98 -4.72 (m, 1H) , 4.19 -4.14 (m, 2H) , 3.89 -3.74 (m, 4H) , 3.51 -3.43 (m, 1H) , 3.30 -3.04 (m, 2H) , 3.01 -2.85 (m, 1H) , 2.26 -2.12 (m, 1H) , 1.96 -1.83 (m, 1H) , 1.49 (s, 9H) .

Step 5: Synthesis of tert-Butyl 2- ( ( (3R, 4S) -1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) -3-fluoropiperidin-4-yl) oxy) acetate

To a solution of 6- (1H-pyrazol-3-yl) picolinic acid Intermediate 5 (100 mg, 0.529 mmol) , DIPEA (0.520 mL, 2.94 mmol) and tert-butyl 2- ( ( (3R, 4S) -1- (4-amino-3-methoxyphenyl) -3-fluoropiperidin-4-yl) oxy) acetate (150 mg, 0.423 mmol) in DMF (3 mL) was added HATU (251 mg, 0.66 mmol) . The mixture was stirred at 20 ℃ for 12 hours. Ethyl acetate (50 mL) was added into the mixture. The mixture was washed with H ₂O (30 mL) at 0 ℃, dried over Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: dichloromethane: methanol = 1: 0 to 50: 1) to give desired compound as a brown oil (170 mg, crude) . ¹H NMR (400 MHz, CDCl ₃) : δ 10.53 (s, 1H) , 8.49 -8.38 (m, 1H) , 8.18 (dd, J = 0.7, 7.6 Hz, 1H) , 8.02 (s, 2H) , 7.95 -7.86 (m, 1H) , 7.71 (d, J = 2.2 Hz, 1H) , 6.97 (d, J = 2.0 Hz, 1H) , 6.62 -6.55 (m, 2H) , 4.98 -4.75 (m, 1H) , 4.20 -4.12 (m, 2H) , 3.97 (s, 3H) , 3.88 -3.81 (m, 1H) , 3.67 -3.57 (m, 1H) , 3.43 -3.21 (m, 2H) , 3.11 -3.01 (m, 1H) , 2.25 -2.14 (m, 1H) , 1.93 (dt, J = 4.0, 8.6 Hz, 1H) , 1.50 (s, 9H) .

Step 6: Synthesis of 2- ( ( (3R, 4S) -1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) -3-fluoropiperidin-4-yl) oxy) acetic acid formate

A solution of tert-butyl 2- ( ( (3R, 4S) -1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) -3-fluoropiperidin-4-yl) oxy) acetate (170 mg, 0.323 mmol) in HCOOH (5 mL) was stirred at 40 ℃ for 12 hours under N ₂. The mixture was concentrated to give desired compound as a brown solid (180 mg, crude) .

Step 7: Synthesis of N- (4- ( (3R, 4S) -3-fluoro-4- (2- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethoxy) piperidin-1-yl) -2-methoxyphenyl) -6- (1H-pyrazol-3-yl) picolinamide

To a solution of 2- ( ( (3R, 4S) -1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) -3-fluoropiperidin-4-yl) oxy) acetic acid formate (150 mg, 0.291 mmol) and (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 3 (170 mg, 0.353 mmol) in DMF (5 mL) was added EDCI (70.0 mg, 0.365 mmol) , HOBt (50.0 mg, 0.370 mmol) and DIPEA (0.5 mL, 2.82 mmol) . The mixture was stirred at 30 ℃ for 12 hours. The mixture was directly purified by prep-HPLC (Column: Welch Xtimate C18 150*25mm*5um, Mobile Phase A: water (0.22%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 36%B to 64%) . The pure fractions were lyophilized to give the product as a white solid (44.7 mg, 97.2%purity, 16.5%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 14.04 -12.99 (m, 1H) , 10.60 (s, 1H) , 8.98 (s, 1H) , 8.48 (d, J = 7.6 Hz, 1H) , 8.31 -7.89 (m, 4H) , 7.74 -7.19 (m, 6H) , 6.98 (s, 1H) , 6.77 (s, 1H) , 6.60 (dd, J = 2.0, 8.8 Hz, 1H) , 5.17 (s, 1H) , 5.07 -4.83 (m, 2H) , 4.56 (d, J = 9.8 Hz, 1H) , 4.45 (t, J = 8.0 Hz, 1H) , 4.34 -4.21 (m, 1H) , 4.19 -4.03 (m, 2H) , 3.99 (s, 2H) , 3.91 -3.75 (m, 2H) , 3.68 (s, 1H) , 3.63 -3.53 (m, 2H) , 3.45 (m, 1H) , 3.22 (m, 1H) , 3.02 (m, 1H) , 2.45 (s, 3H) , 2.13 -1.70 (m, 4H) , 1.37 (d, J = 6.8 Hz, 3H) , 0.95 (s, 9H) . LCMS (ESI ⁺) : m/z 896.4 [M+H] ⁺.

The following Compounds 92, 93, 94, 95, 96, 97, 98-01, 98-02, and 184 were prepared according to similar procedure as described for Compound 91.

General Scheme 36: Exemplary synthesis of Compound 99

Step 1: Synthesis of tert-Butyl 2- ( (1- (3-methoxy-4-nitrophenyl) piperidin-4-yl) oxy) propanoate

To a solution of 1- (3-methoxy-4-nitrophenyl) piperidin-4-ol (1.00 g, 3.96 mmol) in xylene (10 mL) were added KOH (667 mg, 11.9 mmol) , tert-butyl 2-bromopropanoate (4.14 g, 19.8 mmol) and TBAB (256 mg, 0.793 mmol) . The mixture was heated and stirred at 100 ℃ under microwave irradiation for 30 minutes. The mixture was washed with water (20 mL) and extracted with ethyl acetate (10 mL x 3) . The combined organic extracts were concentrated under reduced pressure to obtain a residue, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 1: 1) to give the product as a yellow solid (1.2 g, crude) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 7.88 (d, J = 9.5 Hz, 1H) , 6.60 (dd, J = 2.4, 9.4 Hz, 1H) , 6.51 (d, J = 2.3 Hz, 1H) , 3.91 (s, 3H) , 3.83 -3.70 (m, 2H) , 3.62 (qt, J = 3.7, 7.9 Hz, 1H) , 3.33 -3.21 (m, 2H) , 1.99 (s, 2H) , 1.57 -1.31 (m, 12H) , 1.25 (d, J = 6.8 Hz, 3H) .

Step 2: Synthesis of tert-Butyl 2- ( (1- (4-amino-3-methoxyphenyl) piperidin-4-yl) oxy) propanoate

To a solution of tert-butyl 2- ( (1- (3-methoxy-4-nitrophenyl) piperidin-4-yl) oxy) propanoate (1.20 g, 3.15 mmol) in ethyl acetate (50 mL) was added Pd/C (500 mg) . The resultant solution was stirred under H ₂ (15 Psi) at 25℃ for 16 hours. The suspension was filtered through a pad of

and the pad washed with ethyl acetate (50 mL x 3) . The filtrate was concentrated to dryness under reduced pressure to afford the crude product as a brown solid (1.1 g, crude) .

Step 3 and 4: Synthesis of

(*R) -tert-butyl 2- ( (1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) propanoate and (*S) -tert-butyl 2- ( (1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) propanoate

To a solution of 6- (1H-pyrazol-3-yl) picolinic acid Intermediate 5 (540 mg, 2.85 mmol) in DMF (20 mL) was added EDCI (820 mg, 4.28 mmol) , HOBt (578 mg, 4.28 mmol) and DIPEA (2.54 mL, 14.3 mmol) . tert-butyl 2- ( (1- (4-amino-3-methoxyphenyl) piperidin-4-yl) oxy) propanoate (1.00 g, 2.85 mmol) was added. The mixture was stirred at 25 ℃ overnight. The mixture was poured into water and was extracted by ethyl acetate (50 ml x 3) . The combined organic extracts were washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the crude product, which was purified by FCC (petroleum ether: ethyl acetate = 1: 0 to 1: 1) to give desired racemate product as a yellow solid (1.1 g, crude) , which was further purified by prep. SFC (Column: DAICEL CHIRALPAK AD-H (250 mm x 30 mm, 10 um) , Mobile Phase A: 0.1%NH ₃ ·H ₂O EtOH, Mobile Phase B: CO ₂, Flow rate: 70 mL/min, gradient condition from 40%to 40%) . The pure fractions were collected and the solvent was evaporated under vacuum to give (*R) -compound as yellow oil (250 mg, crude) and (*S) -compound as yellow oil (260 mg, crude) .

Step 5a: Synthesis of (*R) -2- ( (1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) propanoic acid trifluoroacetate

(*R) -tert-butyl 2- ( (1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) propanoate (230 mg, 0.441 mmol) in DCM (5 mL) was added TFA (2 mL) , then the solution was stirred at 25 ℃ for 12 hours. The mixture was concentrated under reduced pressure to obtain the title product as a white solid (190 mg, crude) .

Step 5b: Synthesis of (*S) -2- ( (1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) propanoic acid trifluoroacetate

(*S) -tert-butyl 2- ( (1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) propanoate (250 mg, 0.48 mmol) in DCM (5 mL) was added TFA (2 mL) , then the solution was stirred at 25 ℃ for 12 hours. The mixture was concentrated under reduced pressure to obtain the title product as a white solid (210 mg crude) .

Step 6a: Synthesis of

N- (4- (4- ( ( (*R) -1- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -1-oxopropan-2-yl) oxy) piperidin-1-yl) -2-methoxyphenyl) -6- (1H-pyrazol-3-yl) picolinamide

To a solution of (*R) -2- ( (1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) propanoic acid trifluoroacetate (100 mg, 0.178 mmol) in DCM (5 mL) was added T ₃P (0.256 mL, 0.859 mmol) and TEA (0.09 mL, 0.644 mmol) . (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 3 (95.5 mg, 0.199 mmol) was added. The mixture was stirred at 25 ℃ overnight. The reaction mixture was diluted with water (15 mL) and extracted with dichloromethane (30 mL x 3) . The organic layer was dried over anhydrous Na ₂SO ₄, filtered, and concentrated under reduced pressure to afford the crude product, which was purified by prep-HPLC (Column: Phenomenex Gemini 150*25mm*10um, Mobile Phase A: water (0.225%FA) , Mobile Phase B: acetonitrile, Flow rate: 30 mL/min, gradient condition from 37%B to 57%) . The pure fractions were lyophilized to give Compound 99-01 as a yellow powder (5.20 mg, 99.1%purity, 4.52%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ13.24 (s, 1H) , 10.59 (s, 1H) , 8.98 (s, 1H) , 8.45 (d, J = 7.4 Hz, 1H) , 8.28 -7.99 (m, 4H) , 7.93 (s, 1H) , 7.50 -7.33 (m, 5H) , 6.98 (s, 1H) , 6.75 (s, 1H) , 6.64 -6.51 (m, 1H) , 5.17 (s, 1H) , 4.94 -4.86 (m, 1H) , 4.54 -4.43 (m, 2H) , 4.36 -4.23 (m, 1H) , 4.12 -3.93 (m, 3H) , 3.65 -3.51 (m, 5H) , 2.99 -2.82 (m, 2H) , 2.61 (s, 1H) , 2.45 (s, 3H) , 2.12 -2.04 (m, 1H) , 2.02 -1.89 (m, 2H) , 1.85 -1.69 (m, 1H) , 1.66 -1.54 (m, 2H) , 1.38 (d, J = 6.8 Hz, 3H) , 1.28 (d, J = 6.6 Hz, 3H) , 0.95 (s, 9H) ; LCMS (ESI ⁺) : m/z 892.3 [M+H] ⁺.

Step 6b: Synthesis of

N- (4- (4- ( ( (*S) -1- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -1-oxopropan-2-yl) oxy) piperidin-1-yl) -2-methoxyphenyl) -6- (1H-pyrazol-3-yl) picolinamide

To a solution of (*S) -2- ( (1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) propanoic acid trifluoroacetate (100 mg, 0.178 mmol) in DCM (5 mL) was added T ₃P (0.256 mL, 0.859 mmol) and TEA (0.09 mL, 0.644 mmol) . (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 3 (95.5 mg, 0.199 mmol) was added. The mixture was stirred at 25 ℃ overnight. The reaction mixture was diluted with water (15 mL) and extracted with dichloromethane (30 mL x 3) . The organic layer was filtered, dried over anhydrous Na ₂SO ₄ and concentrated under reduced pressure to afford the crude product, which was purified by prep-HPLC (Column: Phenomenex Gemini 150*25mm*10um, Mobile Phase A: water (10mM NH ₄HCO ₃) , Mobile Phase B: acetonitrile, Flow rate: 30 mL/min, gradient condition from 45%B to 75%) . The pure fractions were lyophilized to give the Compound 99-02 as a yellow powder (10.00 mg, 91.93 %purity, 4.80%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.25 (s, 1H) , 10.73 -10.40 (m, 1H) , 9.10 -8.91 (m, 1H) , 8.47 (d, J = 7.8 Hz, 1H) , 8.31 -8.00 (m, 4H) , 7.99 -7.88 (m, 1H) , 7.54 -7.41 (m, 3H) , 7.40 -7.30 (m, 2H) , 6.99 (s, 1H) , 6.75 (s, 1H) , 6.60 -6.57 (m, 1H) , 5.17 (d, J = 3.4 Hz, 1H) , 4.96 -4.83 (m, 1H) , 4.57 -4.42 (m, 2H) , 4.30 (s, 1H) , 4.22 -4.10 (m, 1H) , 3.98 (s, 2H) , 3.65 -3.48 (m, 5H) , 3.05 -2.86 (m, 2H) , 2.53 (s, 1H) , 2.47 -2.43 (m, 3H) , 2.13 -1.91 (m, 3H) , 1.80 -1.73 (m, 1H) , 1.72 -1.56 (m, 2H) , 1.48 (d, J = 6.8 Hz, 1H) , 1.38 (d, J = 7.0 Hz, 3H) , 1.25 (d, J = 6.6 Hz, 3H) , 0.96 (s, 9H) ; LCMS (ESI ⁺) : m/z 892.5 [M+H] ⁺.

General Scheme 37: Synthesis of Compound 100

Step 1: Synthesis of

N- (4- (4- (2- ( ( (S) -1- ( (2S, 4R) -2- ( ( (S) -1- (4-chlorophenyl) ethyl) carbamoyl) -4-hydroxypyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethoxy) piperidin-1-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, (2S, 4R) -1- ( (S) -2- (2- ( (1- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-4-yl) oxy) acetamido) -3, 3-dimethylbutanoyl) -4-hydroxypyrrolidine-2-carboxylic acid Intermediate 20 (50.0 mg, 0.0740 mmol) , EDCI (21.0 mg, 0.110 mmol) , HOBt (15.0 mg, 0.111 mmol) , DIPEA (48.0 mg, 0.371 mmol) and DMF (1 mL) were added to a 50 mL round-bottomed flask before treated with (S) -1- (4-chlorophenyl) ethanamine (11.0 mg, 0.071 mmol) . The reaction mixture was stirred at 30 ℃ for 6 hours and then diluted with water (10 mL) , extracted with ethyl acetate (20 mL x 3) . The combined organic extracts were dried over anhydrous Na ₂SO ₄, filtered, and concentrated to dryness under reduced pressure to afford the crude product, which was purified by prep-HPLC (Column: Xtimate C18 150 x 40 mm 10 um, Mobile Phase A: water (0.2%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 36%B to 66%) to give the Compound 100 as a yellow powder (10.0 mg, 100%purity, 16.6%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 14.02 -12.93 (m, 1H) , 10.67 -10.24 (m, 1H) , 8.44 (d, J = 7.6 Hz, 1H) , 8.33 -7.48 (m, 5H) , 7.42 -7.24 (m, 5H) , 7.05 -6.92 (m, 1H) , 6.79 -6.67 (m, 1H) , 6.57 (d, J = 9.2 Hz, 1H) , 5.15 (d, J = 3.2 Hz, 1H) , 4.91 -4.78 (m, 1H) , 4.54 (d, J = 9.6 Hz, 1H) , 4.42 (t, J = 8.4 Hz, 1H) , 4.32 -4.20 (m, 1H) , 4.11 -3.81 (m, 5H) , 3.61 -3.47 (m, 5H) , 3.02 -2.85 (m, 2H) , 2.11 -1.91 (m, 3H) , 1.74 -1.55 (m, 3H) , 1.46 -1.27 (m, 3H) , 1.02 -0.82 (m, 9H) ; LCMS (ESI ⁺) : m/z 815.4 [M+H] ⁺.

The following Compounds 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238 and 239 were prepared according to similar procedure as described for Compound 100.

General Scheme 38: Synthesis of Compound 240

Step 1: 1- (3-methoxy-4-nitrophenyl) azetidin-3-yl methanesulfonate

A stir bar, 1- (3-methoxy-4-nitrophenyl) azetidin-3-ol (1.00 g, 4.46 mmol) , triethylamine (1.90 mL, 13.6 mmol) and DCM (15 mL) were added to a 100 mL round-bottomed flask. After treating with methanesulfonyl chloride (0.730 g, 6.37 mmol) , the reaction mixture was stirred at room temperature for 20 min. The reaction mixture was quenched with water (10 mL) , extracted with DCM (15 mL) , washed with water (10 mL x 3) and dried over Na ₂SO ₄. The organic layer was filtered and concentrated under reduced pressure to give product as yellow solids (1.40 g, 90%purity, 93.5%yield) .

¹H NMR (400 MHz, DMSO-d ₆) : δ 7.90 (d, J = 9.6 Hz, 1H) , 6.15 -6.06 (m, 2H) , 5.53 -5.40 (m, 1H) , 4.50 -4.38 (m, 2H) , 4.19 -4.08 (m, 2H) , 3.89 (s, 3H) , 3.31 (s, 3H) ; LCMS (ESI ⁺) : m/z 303.0 [M+H] ⁺.

Step 2: ethyl 1- (1- (3-methoxy-4-nitrophenyl) azetidin-3-yl) -1H-pyrazole-3-carboxylate

A stir bar, 1- (3-methoxy-4-nitrophenyl) azetidin-3-yl methanesulfonate (1.10 g, 3.64 mmol) , ethyl 1H-pyrazole-3-carboxylate (0.612 g, 4.37 mmol) , K ₂CO ₃ (1.51 g, 10.9 mmol) , KI (1.21 g, 7.29 mmol) and DMF (10 mL) were added to a 50 mL round-bottomed flask. The reaction mixture was stirred at 120 ℃ for 2 hours. The mixture was poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The combined organic extracts were washed with brine (20 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: MeOH : DCM = 0: 1 to 1: 10) to afford the title compound as a yellow solid (400 mg, purity: 93.3%, yield: 29.6%) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 8.08 (d, J = 2.0 Hz, 1H) , 7.95 -7.91 (m, 1H) , 6.85 -6.80 (m, 1H) , 6.16 -6.11 (m, 2H) , 5.58 -5.51 (m, 1H) , 4.56 -4.51 (m, 2H) , 4.37 -4.32 (m, 2H) , 4.31 -4.23 (m, 2H) , 3.90 (s, 3H) , 1.28 (t, J = 7.2 Hz, 3H) ; LCMS (ESI ⁺) : m/z 303.0 [M+H] ⁺. 347.1

Step 3: Synthesis of ethyl 1- (1- (4-amino-3-methoxyphenyl) azetidin-3-yl) -1H-pyrazole-3-carboxylate

A stir bar, ethyl 1- (1- (3-methoxy-4-nitrophenyl) azetidin-3-yl) -1H-pyrazole-3-carboxylate (400 mg, 1.156 mmol) , wet Pd/C (100 mg) and THF (5 mL) were added to a 50 mL round-bottomed flask. The mixture was spared with H ₂ for 5 minutes, then stirred at room temperature under H ₂ (15 psi) for 2 hours. The suspension was filtered through a pad of

and the pad washed with THF (20 mL) . The filtrate was concentrated to dryness under reduced pressure to afford the product as a brown solid (350 mg, crude) .

Step 4: Synthesis of ethyl 1- (1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) azetidin-3-yl) -1H-pyrazole-3-carboxylate

A stir bar, ethyl 1- (1- (4-amino-3-methoxyphenyl) azetidin-3-yl) -1H-pyrazole-3-carboxylate (350 mg, 1.11 mmol) , Intermediate 5 (300 mg, 1.33 mmol) , HOBt (225 mg, 1.67 mmol) , DIEA (0.549 mL, 3.32 mmol, 0.782 g/mL) and DMF (5 mL) were added to a 50 mL round-bottomed flask. Then EDCI (318 mg, 1.66 mmol) was added to the mixture. The reaction mixture was stirred at 40 ℃ for 12 hours. The mixture was poured into water (10 mL) and extracted by ethyl acetate (10 mL x 3) . The combined organic extracts were washed with brine, dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the title product which was purified by FCC (eluent: petroleum ether: ethyl acetate from 100: 0 to 0: 100) to give the desired product as a yellow solid (480 mg, 97.9%purity, 87.1%yield) . LCMS (ESI ⁺) : m/z 488.2 [M+H] ⁺

Step 5: Synthesis of 1- (1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) azetidin-3-yl) -1H-pyrazole-3-carboxylic acid

A stir bar, ethyl 1- (1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) azetidin-3-yl) -1H-pyrazole-3-carboxylate (200 mg, 0.410 mmol) , lithium hydroxide hydrate (86.1 mg, 2.05 mmol) and THF/H ₂O= (3 mL, V/V=1: 2) were added to a 50 mL round-bottomed flask, the resultant mixture was stirred at 25 ℃ for 2 hours. The reaction mixture was concentrated and adjusted to pH=7 by aq. HCl solution, then extracted by ethyl acetate (20 mL x 2) . The combined organic extracts were washed with brine (10 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated to dryness under reduced pressure to afford the desired product as a yellow solid (170 mg, 97.8%purity, 88.2%yield) . LCMS (ESI ⁺) : m/z 460.2 [M+H] ⁺

Step 6: Synthesis of N- (4- (3- (3- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) carbamoyl) -1H-pyrazol-1-yl) azetidin-1-yl) -2-methoxyphenyl) -6- (1H-pyrazol-3-yl) picolinamide

A stir bar, 1- (1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenyl) azetidin-3-yl) -1H-pyrazole-3-carboxylic acid (150 mg, 0.326 mmol) , Intermediate 25 (152 mg, 0.325 mmol) , HOBT (66.3 mg, 0.491 mmol) , DIEA (0.162 mL, 0.979 mmol, 0.782 g/mL) and DMF (5 mL) were added to a 25 mL round-bottomed flask. Then EDCI (93.8 mg, 0.489 mmol) was added to the mixture. The reaction mixture was stirred at 40 ℃ for 1.5 h. The mixture was poured into water (10 mL) and extracted with ethyl acetate (20 mL x 2) . The combined organic extracts were washed with brine (20 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by prep-HPLC (Column: YMC-Triart Prep C18 150 x 40 mm x 7 um, Mobile Phase A: water (0.225%FA) , Mobile Phase B: acetonitrile, Flow rate: 60 mL/min, gradient condition from 40%B to 70%) . The pure fractions were lyophilized to give the Compound 240 as a yellow solid (99.6 mg, 98.7%purity, 34.5%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 14.07 -13.08 (m, 1H) , 10.71 -10.26 (m, 1H) , 9.01 -8.91 (m, 1H) , 8.68 -8.57 (m, 1H) , 8.25 -7.92 (m, 5H) , 7.78 -7.25 (m, 6H) , 7.05 -6.94 (m, 1H) , 6.77 (d, J = 2.0 Hz, 1H) , 6.40 -6.26 (m, 1H) , 6.21 -6.12 (m, 1H) , 5.52 -5.39 (m, 1H) , 5.17 (d, J = 3.2 Hz, 1H) , 4.71 (d, J = 9.6 Hz, 1H) , 4.47 -4.15 (m, 8H) , 4.01 -3.92 (m, 2H) , 3.89 -3.78 (m, 1H) , 3.73 -3.59 (m, 2H) , 2.45 -2.38 (m, 3H) , 2.13 -2.01 (m, 1H) , 1.95 -1.83 (m, 1H) , 0.98 (s, 9H) ; LCMS (ESI ⁺) : m/z 872.3 [M+H] ⁺.

General Scheme 39: Synthesis of Compound 241

Step 1: Synthesis of 1- (3-methoxy-4-nitrophenyl) azetidin-3-ol

A stir bar, 4-fluoro-2-methoxy-1-nitrobenzene (5.0 g, 29.2 mmol) , azetidin-3-ol hydrochloride (3.52 g, 32.1 mmol) , potassium carbonate (6.06 g, 43.8 mmol) , and DMSO (20 mL) were added to a 100 mL round-bottomed flask. The reaction mixture was stirred at 90 ℃ for 16 hours. The reaction mixture was allowed to cool to room temperature and water (100 mL) was added. The resultant precipitates were collected by vacuum filtration to give the title product as a yellow solid (6.0 g, 95%purity, 87.0%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 7.88 (d, J = 9.0 Hz, 1H) , 6.04 -5.95 (m, 2H) , 5.84 (br. s., 1H) , 4.68 -4.54 (m, 1H) , 4.29 -4.17 (m, 2H) , 3.87 (s, 3H) , 3.75 (dd, J = 4.4, 9.6 Hz, 2H)

Step 2: Synthesis of (ethyl 1- (1- (3-methoxy-4-nitrophenyl) azetidin-3-yl) -1H-pyrazole-5-carboxylate

A solution of 1- (3-methoxy-4-nitrophenyl) azetidin-3-ol (600 mg, 2.68 mmol) , ethyl 1H-pyrazole-4-carboxylate (0.313 g, 2.23 mmol) and 2- (tributylphosphoranylidene) acetonitrile (0.646 g, 2.68 mmol) in toluene (20 ml) was stirred at 85℃ for 8 hours. The solvent was removed and the crude mixture was purified by FCC (eluent: petroleum ether: ethyl acetate from 1: 0 to 3: 1) to afford the compound (300 mg, crude) as brown oil. LCMS (ESI ⁺) : m/z 347.1 [M+H] ⁺.

Step 3: Synthesis of ethyl 1- (1- (4-amino-3-methoxyphenyl) azetidin-3-yl) -1H-pyrazole-5-carboxylate

To a solution of ethyl 1- (1- (3-methoxy-4-nitrophenyl) azetidin-3-yl) -1H-pyrazole-5-carboxylate (300 mg, 89.75%purity, 0.777 mmol) in EtOAc (20 mL) was added wet Pd/C (50.0 mg) under argon. The suspension was purged with hydrogen for three times. The mixture was stirred under hydrogen (15 psi) at room temperature for 2 hours. The suspension was filtered through a pad of

The filtrate was concentrated to dryness under reduced pressure to afford the product as a black oil (200 mg, crude) .

Step 4: Synthesis of ethyl 1- (1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxy-phenyl) azetidin-3-yl) -1H-pyrazole-5-carboxylate

1-propanephosphonic anhydride (0.483 g, 0.759 mmol) was dropwised to a solution of 6- (1H-pyrazol-5-yl) picolinic acid hydrochloride Intermediate 5 (0.157 mg, 0.695 mmol) , ethyl 1- (1- (4-amino-3-methoxyphenyl) azetidin-3-yl) -1H-pyrazole-5-carboxylate (200 mg, 0.632 mmol) and triethylamine (0.44 mL, 3.16 mmol) in anhydrous DCM (5 mL) . The reaction was stirred at room temperature for 1 h. The reaction mixture was diluted with water (20 mL) , extracted with DCM (30 mL x 2) , The combined organic extracts were washed with brine (30 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate = 1: 0 to 0: 1) to afford the title compound as a yellow solid (200 mg, 95.0%purity, 61.6%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.97 -13.01 (m, 1H) , 10.66 -10.21 (m, 1H) , 8.31 -7.46 (m, 6H) , 7.05 -6.91 (m, 2H) , 6.38 -6.23 (m, 1H) , 6.16 (d, J = 8.4 Hz, 1H) , 5.95 (t, J = 6.0 Hz, 1H) , 4.41 -4.29 (m, 4H) , 4.27 -4.19 (m, 2H) , 4.01 -3.77 (m, 3H) , 1.33 (t, J = 7.2 Hz, 3H)

Step 5: Synthesis of 1- (1- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxy-phenyl) azetidin-3-yl) -1H-pyrazole-5-carboxylic acid

To a solution of lithium hydroxide monohydrate (4.1 mL, 4.1 mmol, 1M in H ₂O) in MeOH (3 mL) was added ethyl 1- (1- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) azetidin-3-yl) -1H-pyrazole-5-carboxylate (200 mg, 0.410 mmol) . The mixture was stirred at room temperature for 8 hours. The mixture was acidified with HCl (1N) to pH = 3～4, and filtered. The filter cake was washed with water (10 mL x 3) and dried to give the product as yellow solids (150 mg, crude) . LCMS (ESI ⁺) : m/z 460.1 [M+H] ⁺

Step 6: Synthesis of N- (4- (3- (5- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( (4- (4-methylthiazol-5-yl) benzyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) carbamoyl) -1H-pyrazol-1-yl) azetidin-1-yl) -2-methoxyphenyl) -6- (1H-pyrazol-3-yl) picolinamide

A stir bar, 1- (1- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) azetidin-3-yl) -1H-pyrazole-5-carboxylic acid (150 mg, 68.1%purity, 0.222 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- (4- (4-methylthiazol-5-yl) benzyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 2 (125 mg, 0.268 mmol) , TEA (0.15 mL, 1.08 mmol) , and DMF (3 mL) were added to a 50 mL round-bottomed flask. 1-propanephosphonic anhydride (212 mg, 0.333 mmol) was added to the mixture. The reaction mixture was stirred at room temperature for 8 hours. The mixture was then poured into water (10 mL) and extracted with ethyl acetate (15 mL x 3) . The combined organic extracts were washed with brine (10 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by prep-HPLC (Column: Welch Xtimate C18 150*30mm*5um, Mobile Phase A: water (0.225%FA) , Mobile Phase B: acetonitrile, Flow rate: 25 mL/min, gradient condition from 43%B to 63%) . The pure fractions were lyophilized to give the product as yellow powder. The product was purified by prep. TLC (eluent: DCM: MeOH = 10: 1) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue which was lyophilized to give the Compound 241 as yellow powder (20.78 mg, 100%purity, 10.7%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 14.05 -12.99 (m, 1H) , 10.70 -10.19 (m, 1H) , 8.99 (s, 1H) , 8.62 (t, J = 6.0 Hz, 1H) , 8.37 -7.67 (m, 6H) , 7.65 -7.57 (m, 1H) , 7.46 -7.34 (m, 4H) , 7.12 (d, J = 1.6 Hz, 1H) , 6.99 (br. s., 1H) , 6.39 -6.23 (m, 1H) , 6.15 (dd, J = 2.0, 8.4 Hz, 1H) , 5.94 (quin, J = 6.4 Hz, 1H) , 5.23 (d, J = 3.6 Hz, 1H) , 4.79 (d, J = 9.2 Hz, 1H) , 4.54 -4.13 (m, 8H) , 4.06 -3.81 (m, 3H) , 3.78 -3.66 (m, 2H) , 2.45 (s, 3H) , 2.14 -2.03 (m, 1H) , 1.99 -1.88 (m, 1H) , 1.13 -0.95 (m, 9H) ; LCMS (ESI ⁺) : m/z 872.2 [M+H] ⁺.

The following Compounds 242, 243 and 244 were prepared according to similar procedure as described for Compound 241.

General Scheme 40: Synthesis of Compound 245

Step 1: Synthesis of 4- (2-bromoethoxy) -2-methoxy-1-nitrobenzene

To a solution of 3-Methoxy-4-nitrophenol (2 . 00 g, 11.8 mmol) in acetonitrile (40 mL) was added Potassium carbonate (3.27 g, 23.7 mmol) and 1, 2-dibromoethane (6.66 g, 35.5 mmol) . The reaction was heated to 80 ℃ with stirring for 8 hours. The mixture was allowed to cool to room temperature and poured into water (10 mL) , extracted with ethyl acetate (20 mL x 2) . The combined organic extracts were washed with brine (20 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (petroleum ether: ethyl acetate = 5: 1) to give the title compound as a pale yellow solid (1.5 g, crude) .

Step 2: Synthesis of ethyl 1- (2- (3-methoxy-4-nitrophenoxy) ethyl) -1H-pyrazole-3-carboxylate

A stir bar, 4- (2-bromoethoxy) -2-methoxy-1-nitrobenzene (1.00 g, 3.62 mmol) , ethyl 1H-pyrazole-3-carboxylate (0.609 g, 4.35 mmol) , K ₂CO ₃ (1.50 g, 10.9 mmol) and DMF (10 mL) were added to a 100 mL round-bottomed flask. The reaction mixture was stirred at 100℃ for 8 hours. The mixture was allowed to cool to room temperature and poured into water (30 mL) , extracted with ethyl acetate (50 mL x 3) . The combined organic extracts were washed with brine (50 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by prep-HPLC (Column: Xtimate C18 150*40mm*5um, Mobile Phase A: water (10 mM NH ₄HCO ₃) -ACN, Mobile Phase B: acetonitrile, Flow rate: 60 mL/min, gradient condition from 47%B to 67%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue which was lyophilized to give the P1 as a white power (350 mg, 98.4%purity, 28.8%yield) . ¹H NMR (400MHz, DMSO-d ₆) : δ 8.02 -7.86 (m, 2H) , 6.76 (dd, J = 2.4, 6.7 Hz, 2H) , 6.65 (dd, J = 2.4, 9.1 Hz, 1H) , 4.71 -4.59 (m, 2H) , 4.56 -4.40 (m, 2H) , 4.25 (q, J = 7.2 Hz, 2H) , 3.91 (s, 3H) , 1.27 (t, J = 7.1 Hz, 3H) .

Step 3: Synthesis of ethyl 1- (2- (4-amino-3-methoxyphenoxy) ethyl) -1H-pyrazole-3-carboxylate

To a solution of ethyl 1- (2- (3-methoxy-4-nitrophenoxy) ethyl) -1H-pyrazole-3-carboxylate (150 mg, 0.447 mmol) in THF/H ₂O (5 mL) was added Zn (293 mg, 4.47 mmol) and NH ₄Cl (479 mg, 8.95 mmol) . The mixture was stirred at 60 ℃ for 8 hours. The mixture was filtered. The filtrate and exacted with EA (50 mL*3) and water (20 mL*3) . The organic layers were concentrated to dryness under reduced pressure to afford the product as brown solid (250 mg, 59.7%purity, crude) , which was used for next reaction without purification.

Step 4: Synthesis of ethyl 1- (2- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenoxy) ethyl) -1H-pyrazole-3-carboxylate

T ₃P (0.191 mL, 0.328 mmol) was dropwise to a solution of ethyl 1- (2- (4-amino-3-methoxyphenoxy) ethyl) -1H-pyrazole-3-carboxylate (100 mg, 0.328 mmol) , 6- (1H-pyrazol-5-yl) picolinic acid hydrochloride Intermediate 5 (88.7 mg, 0.393 mmol) and TEA (0.228 mL, 1.64 mmol) in anhydrous DMF (3 mL) . The reaction was stirred at room temperature for 8 hours. The reaction mixture was diluted with water (30 mL) , extracted with ethyl acetate (30 mL x 2) , washed with brine (20 mL) and dried over Na ₂SO ₄. The organic layer was filtered and concentrated under reduced pressure to give crude product, which was purified by FCC (H ₂O: ACN from 1: 0 to 1: 1) to give the desired product as a brown oil (70 mg, crude) .

Step 5: Synthesis of 1- (2- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenoxy) ethyl) -1H-pyrazole-3-carboxylic acid

A stir bar, ethyl 1- (2- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenoxy) ethyl) -1H-pyrazole-3-carboxylate (120 mg, 0.252 mmol) , lithium hydroxide monohydrate (52.8 mg, 1.26 mmol) , THF: H ₂O (4 mL, V/V=1: 1) were added to a100 mL round-bottomed flask. The reaction was stirred at room temperature for 4 hours. The mixture was acidified with HCl (1M aqueous) to pH = 5～6, which was lyophilized to give the product as a white solid (231 mg, crude) . The crude product was used directly in the next step without further purification.

Step 6: Synthesis of N- (4- (2- (3- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) carbamoyl) -1H-pyrazol-1-yl) ethoxy) -2-methoxyphenyl) -6- (1H-pyrazol-3-yl) picolinamide

A mixture of 1- (2- (4- (6- (1H-pyrazol-3-yl) picolinamido) -3-methoxyphenoxy) ethyl) -1H-pyrazole-3-carboxylic acid (100 mg, 0.223 mmol) , HATU (102 mg, 0.268 mmol) and DIPEA (72.1 mg, 0.557 mmol) were added in DMF (2 mL) after stirred for 10 min, (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 3 (129 mg, 0.268 mmol) was added in the mixture. The mixture was stirred at 25 ℃ for 8 hours. The mixture was poured into water (20 mL) and extracted with ethyl acetate (20 mL x 3) . The organic extracts were washed with NH ₃H ₂O (20 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by prep-HPLC (Column: Phenomenex Gemini-NX 80*40mm*3um, Mobile Phase A: water (0.05%NH ₃H ₂O+10mM NH ₄HCO ₃) -ACN, Mobile Phase B: acetonitrile, Flow rate: 30 mL/min, gradient condition from 34%B to 47%) . The pure fractions were collected and the solvent was evaporated under vacuum to give a residue which was lyophilized to give the Compound 245 as white power (16.83 mg, 100%purity, 8.625%yield) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.22 (s, 1H) , 10.77 -10.04 (m, 1H) , 9.05 -8.91 (m, 1H) , 8.46 (d, J = 8.0 Hz, 1H) , 8.33 -8.15 (m, 1H) , 8.13 -7.99 (m, 2H) , 7.98 -7.88 (m, 2H) , 7.78 -7.15 (m, 5H) , 6.97 (s, 1H) , 6.77 -6.66 (m, 2H) , 6.65 -6.54 (m, 1H) , 5.13 (d, J = 3.2 Hz, 1H) , 5.03 -4.83 (m, 1H) , 4.74 -4.54 (m, 3H) , 4.50 -4.36 (m, 3H) , 4.28 (s, 1H) , 4.07 -3.77 (m, 3H) , 3.62 (s, 2H) , 2.45 (s, 3H) , 2.14 -1.95 (m, 1H) , 1.83 -1.68 (m, 1H) , 1.37 (d, J = 6.8 Hz, 3H) , 0.98 (s, 9H) ; LCMS (ESI ⁺) : m/z 875.3 [M+H] ⁺.

General Scheme 41: Synthesis of Compound 246&247

Step 1: Synthesis of 5- ( (tert-butyldiphenylsilyl) oxy) piperidin-2-one

A stir bar, 5-hydroxypiperidin-2-one (5.00 g, 43.4 mmol) , imidazole (8.87 g, 130 mmol) and DMF (80 mL) were added to a 250 mL round-bottomed flask. The reaction mixture was treated with TBDPSCl (12.3 mL, 48.0 mmol) at 0 ℃. The reaction mixture was stirred at 20 ℃ for 8 hours. The reaction mixture was diluted with water (120 mL) , extracted with ethyl acetate (150 mL x 2) , washed with Na ₂CO ₃ aqueous solution (120 mL x 2) , brine (120 mL x 2) and dried over Na ₂SO ₄. The organic layer was filtered and concentrated under reduced pressure to give crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate from 1: 0 to 1: 1) to afford the title compound as colorless oil (14.2 g, 90%purity, 83.2%yield) .

¹H NMR (400 MHz, CHLOROFORM-d) : δ 7.69 -7.61 (m, 4H) , 7.50 -7.35 (m, 6H) , 6.19 (br s, 1H) , 4.12 -4.05 (m, 1H) , 3.29 -3.12 (m, 2H) , 2.73 -2.59 (m, 1H) , 2.27 (td, J = 6.0, 17.6 Hz, 1H) , 1.96 -1.85 (m, 1H) , 1.84 -1.73 (m, 1H) , 1.07 (s, 9H) .

Step 2: Synthesis of tert-butyl 5- ( (tert-butyldiphenylsilyl) oxy) -2-oxopiperidine-1-carboxylate

A stir bar, 5- ( (tert-butyldiphenylsilyl) oxy) piperidin-2-one (11.2 g, 31.7 mmol) , DABCO (3.93 g, 35.0 mmol) and dry THF (180 mL) were added to a 500 mL three-necked round-bottomed flask, cooled to -78 ℃ and treated dropwise with n-BuLi (16.5 mL, 41.3 mmol, 2.5 M in THF) . The resultant mixture was stirred at -78 ℃ for 1 h. di-tert-butyl dicarbonate (8.7 mL, 37.8 mmol) was dissolved in anhydrous THF (20 mL) was added to the mixture. The resulting mixture was stirred at -78 ℃ for 2 hours. The mixture was diluted into NaHCO ₃ (sat. 250 mL) and ethyl acetate (300 mL) and the separated organic phase was washed with NH ₄Cl solution (250 mL x 3) then dried over anhydrous Na ₂SO ₄ and filtered. The filtrate was concentrated to dryness under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate from 1: 0 to 10: 1) to afford the title compound as colourless oil (11.0 g, 98%purity, 75.0%yield) .

¹H NMR (400 MHz, CHLOROFORM-d) : δ 7.65 (d, J = 7.6 Hz, 4H) , 7.49 -7.34 (m, 6H) , 4.18 -4.08 (m, 1H) , 3.75 -3.65 (m, 1H) , 3.45 (dd, J = 3.2, 13.2 Hz, 1H) , 2.79 (ddd, J = 7.2, 9.2, 16.9 Hz, 1H) , 2.40 (td, J = 6.0, 17.2 Hz, 1H) , 1.96 -1.79 (m, 2H) , 1.50 (s, 9H) , 1.07 (s, 9H) .

Step 3: Synthesis of tert-butyl 3- ( (tert-butyldiphenylsilyl) oxy) -6- ( ( (trifluoro-methyl) sulfonyl) oxy) -3, 4-dihydropyridine-1 (2H) -carboxylate

A pale yellow solution of 1.0 M KHMDS in THF (40.0 mL, 40.0 mmol, 1 M in THF) was cooled to -78 ℃ under N ₂ and a colorless solution of tert-butyl 5- ( (tert-butyldiphenylsilyl) oxy) -2-oxopiperidine-1-carboxylate (9.00 g, 19.8 mmol) in THF (100 mL) was added drop wise between -78 ℃ and -70 ℃. The pale yellow solution was stirred at -78 ℃ for 2 hours. Then a brown solution of PhNTf ₂ (14.2 g, 39.7 mmol) in THF (100 mL) was added dropwise between -78 ℃ and -70 ℃. Then the resulting solution was stirred at from -78 ℃ to room temperature for 8 hours. The reaction mixture was diluted with EtOAc (300 mL) and quenched by saturated NH ₄Cl (150 mL) . The combined organic layers was washed with brine (150 mL) , dried over Na ₂SO ₄, filtered and concentrated to give the crude product as brown oil (11.0 g, crude) , which was directly used in next step. ¹H NMR (400 MHz, CHLOROFORM-d) : δ 7.71 -7.62 (m, 4H) , 7.48 -7.36 (m, 6H) , 5.12 (t, J = 3.6 Hz, 1H) , 4.03 -3.97 (m, 2H) , 3.33 (d, J = 11.6 Hz, 1H) , 2.21 -2.11 (m, 1H) , 2.10 -2.06 (m, 1H) , 1.47 (s, 9H) , 1.07 (s, 9H) .

Step 4: Synthesis of tert-butyl 3- ( (tert-butyldiphenylsilyl) oxy) -6- (3-methoxy-4-nitrophenyl) -3, 4-dihydropyridine-1 (2H) -carboxylate

A stir bar, tert-butyl 3- ( (tert-butyldiphenylsilyl) oxy) -6- ( ( (trifluoromethyl) sulfonyl) oxy) -3, 4-dihydropyridine-1 (2H) -carboxylate (11.0 g, 16.0 mmol) , 2- (3-methoxy-4-nitrophenyl) -4, 4, 5, 5-tetramethyl-1, 3, 2-dioxaborolane (4.46 g, 16.0 mmol) , sodium carbonate (32 mL, 64.0 mmol, 2M in ) and THF (130 mL) were added to a 100 mL round-bottomed flask. The mixture was sparged with N ₂ for three times and then treated with bis(triphenylphosphine) palladium (II) dichloride (1.12 g, 1.60 mmol) . The mixture was sparged with N ₂ for three times and then heated at 70 ℃ for 8 hours. The reaction mixture was cooled to room temperature, and then diluted with water (250 mL) , extracted with EtOAc (400 mL x 2) , washed with brine (250 mL x 3) and dried over Na ₂SO ₄. The organic layer was filtered and concentrated under reduced pressure to give crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate from 1: 0 to 4: 1) to afford the title compound as brown oil (8.50 g, 90%purity, 81.4%yield) . ¹H NMR (400 MHz, CHLOROFORM-d) : δ 7.87 (d, J = 8.4 Hz, 1H) , 7.71 (dd, J = 1.2, 7.6 Hz, 4H) , 7.49 -7.40 (m, 6H) , 7.04 -6.89 (m, 2H) , 5.31 (s, 1H) , 4.20 -4.16 (m, 1H) , 3.95 (s, 3H) , 3.94 -3.82 (m, 1H) , 3.73 -3.56 (m, 1H) , 2.34 -2.22 (m, 1H) , 2.19 -2.09 (m, 1H) , 1.20 -0.98 (m, 18H) .

Step 5: Synthesis of tert-butyl 3-hydroxy-6- (3-methoxy-4-nitrophenyl) -3, 4-dihydropyridine-1 (2H) -carboxylate

A stir bar, tert-butyl 3- ( (tert-butyldiphenylsilyl) oxy) -6- (3-methoxy-4-nitrophenyl) -3, 4-dihydropyridine-1 (2H) -carboxylate (8.50 g, 13.0 mmol) , tetrabutylammonium fluoride (39 mL, 39.0 mmol) and THF (50 mL) were added to a 100 mL round-bottomed flask. The reaction mixture was stirred at room-temperature for 8 hours. The mixture was concentrated under reduced pressure to give crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate from 1: 0 to 1: 1) to afford the compound as a brown oil (5.0 g, crude) . ¹H NMR (400 MHz, CHLOROFORM-d) : δ 7.88 (d, J = 8.4 Hz, 1H) , 7.07 -6.93 (m, 2H) , 5.48 (t, J = 3.6 Hz, 1H) , 4.28 (d, J = 5.6 Hz, 1H) , 4.04 -3.97 (m, 1H) , 3.96 (s, 3H) , 3.58 (d, J = 12.8 Hz, 1H) , 3.02 -2.91 (m, 1H) , 2.69 -2.55 (m, 1H) , 2.31 (td, J = 3.6, 19.6 Hz, 1H) , 1.17 (s, 9H) .

Step 6: Synthesis of tert-butyl 3- (2-ethoxy-2-oxoethoxy) -6- (3-methoxy-4-nitrophenyl) -3, 4-dihydropyridine-1 (2H) -carboxylate

A stir bar, tert-butyl 3-hydroxy-6- (3-methoxy-4-nitrophenyl) -3, 4-dihydropyridine-1 (2H) -carboxylate (5.00 g, 11.4 mmol) , Rhodium (II) acetate dimer (0.505 g, 1.14 mmol) , and DCM (50 mL) were added to a 100 mL round-bottomed flask. A solution of ethyl diazoacetate (6.51 g, 57.1 mmol) in DCM (10 mL) was added dropwise to the mixture at room temperature. The mixture was stirred at room temperature for 1 hour. The mixture was concentrated under reduced pressure to give crude product, which was purified by FCC (eluent: petroleum ether: ethyl acetate from 1: 0 to 3: 1) to afford the title compound as a brown oil (4.70 g, crude) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 7.90 -7.81 (m, 1H) , 7.18 (s, 1H) , 7.03 -6.94 (m, 1H) , 5.60 (s, 1H) , 4.26 -4.05 (m, 6H) , 3.97 -3.82 (m, 4H) , 2.64 -2.54 (m, 1H) , 2.31 -2.19 (m, 1H) , 1.24 -1.19 (m, 3H) , 1.17 -0.83 (m, 9H) .

Step 7: Synthesis of tert-butyl 2- (4-amino-3-methoxyphenyl) -5- (2-ethoxy-2-oxoethoxy) piperidine-1-carboxylate

A stir bar, tert-butyl 3- (2-ethoxy-2-oxoethoxy) -6- (3-methoxy-4-nitrophenyl) -3, 4-dihydropyridine-1 (2H) -carboxylate (4 g, 9.17 mmol) , Pd/C (1 g, 10%wet) and EtOAc (100 mL) were added to a 250 mL round-bottomed flask. The mixture was sparged with H ₂ for 5 minutes before stirred at 25 ℃ under H ₂ (30 psi) for 12 hours. The mixture was then filtered through a pad of

and the filtrate was concentrated under reduced pressure to obtain the product as a colorless oil (3.80 g, crude)

Step 8: Synthesis of tert-butyl 2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -5- (2-ethoxy-2-oxoethoxy) piperidine-1-carboxylate

A stir bar, 6- (1H-pyrazol-5-yl) picolinic acid hydrochloride (2.15 g, 9.53 mmol) , tert-butyl 2- (4-amino-3-methoxyphenyl) -5- (2-ethoxy-2-oxoethoxy) piperidine-1-carboxylate (3.86 g, 9.45 mmol) , triethylamine (6.63 mL, 47.6 mmol) and DMF (50 mL) were added to a 100 mL round-bottomed flask before treated with 1-propanephosphonic anhydride (12.1 g, 19.0 mmol, 50%in EtOAc) . The reaction mixture was stirred at 25 ℃ for 12 hours. The mixture was poured into water (100 mL) and extracted with ethyl acetate (100 mL x 2) . The combined organic extracts were washed with brine (200 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by FCC (eluent: petroleum ether : ethyl acetate = 1: 0 to 1: 3) to give the product as a colorless oil (2.93 g, purity: 99.1%, yield: 52.5%) . ¹H NMR (400MHz, CHLOROFORM-d) : δ 10.60 (s, 1H) , 8.51 -8.44 (m, 1H) , 8.13 (dd, J=1.0, 7.6 Hz, 1H) , 8.01 -7.91 (m, 1H) , 7.88 (d, J=7.6 Hz, 1H) , 7.63 (d, J=2.1 Hz, 1H) , 6.91 (d, J=2.1 Hz, 1H) , 6.86 -6.79 (m, 1H) , 6.69 (s, 1H) , 4.27 -4.10 (m, 3H) , 4.06 (s, 2H) , 3.89 -3.85 (m, 3H) , 3.47 -3.34 (m, 1H) , 2.63 -2.50 (m, 1H) , 2.33 (br dd, J=2.5, 14.3 Hz, 1H) , 1.96 (br d, J=4.8 Hz, 1H) , 1.91 -1.77 (m, 1H) , 1.53 -1.34 (m, 10H) , 1.20 (d, J=7.9 Hz, 3H) .

Step 9: Synthesis of ethyl 2- ( (6- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-3-yl) oxy) acetate hydrochloride

A stir bar, tert-butyl 2- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -5- (2-ethoxy-2-oxoethoxy) piperidine-1-carboxylate (2.93 g, 5.06 mmol) and DCM (3 mL) were added to a 100 mL round-bottomed flask before treated with HCl/dioxane (20 mL, 80 mmol, 4M in dioxane) . The reaction mixture was stirred at 25 ℃ for 1 hour. The mixture was concentrated under reduced pressure to give the crude product as a colorless oil (2.8 g, crude) .

Step 10: Synthesis of 2- ( (6- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -1-methylpiperidin-3-yl) oxy) acetic acid

A stir bar, ethyl 2- ( (6- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) piperidin-3-yl) oxy) acetate hydrochloride (2.7 g, 5.63 mmol) , triethylamine (0.785 mL, 5.63 mmol) , HCHO aqueous solution (2.29 g, 28.2 mmol) and MeOH (15 mL) were added to a 100 mL round-bottomed flask before treated with sodium cyanoborohydride (531 mg, 8.46 mmol) . The reaction mixture was stirred at 25 ℃ for 12 hours. The mixture was poured into water (50 mL) and extracted with ethyl acetate (20 mL x 2) . The water phase was purified by Prep-HPLC (Column: YMC-Triart Prep C18 250*50mm*10um, Mobile Phase A: water (0.225%FA) , Mobile Phase B: acetonitrile, Flow rate: 100 mL/min, gradient condition from 2%B to 40%) to give the product as a white solid (290 mg, purity: 93.577%, yield: 10.354%) . ¹H NMR (400MHz, DMSO-d ₆) : δ 10.78 (br d, J=8.3 Hz, 1H) , 8.31 (br s, 1H) , 8.25 -8.04 (m, 4H) , 7.89 (br s, 1H) , 7.20 (s, 1H) , 7.09 -6.96 (m, 2H) , 4.05 -3.96 (m, 5H) , 3.84 (br s, 1H) , 3.56 (br d, J=9.9 Hz, 1H) , 3.40 (br d, J=13.0 Hz, 1H) , 2.69 -2.60 (m, 1H) , 2.23 -2.10 (m, 4H) , 1.92 (br d, J=11.9 Hz, 1H) , 1.74 -1.63 (m, 2H) .

Step 11: Synthesis of N- (4- ( (2R, 5R) -5- (2- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethoxy) -1-methylpiperidin-2-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide and N- (4- ( (2S, 5S) -5- (2- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethoxy) -1-methylpiperidin-2-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A stir bar, 2- ( (6- (4- (6- (1H-pyrazol-5-yl) picolinamido) -3-methoxyphenyl) -1-methylpiperidin-3-yl) oxy) acetic acid (270 mg, 0.580 mmol) , (2S, 4R) -1- ( (S) -2-amino-3, 3-dimethylbutanoyl) -4-hydroxy-N- ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) pyrrolidine-2-carboxamide hydrochloride Intermediate 3 (420 mg, 0.873 mmol) , triethylamine (0.5 mL, 3.59 mmol) and DMF (8 mL) were added to a 40 mL round-bottomed flask before treated with 1-propanephosphonic anhydride (750 mg, 1.18 mmol, 50%in EtOAc) . The reaction mixture was stirred at 25 ℃ for 12 hours. The mixture was poured into water (50 mL) and extracted with ethyl acetate (50 mL x 2) . The combined organic extracts were washed with brine (50 mL) , dried over anhydrous Na ₂SO ₄, filtered and concentrated under reduced pressure to afford the crude product, which was purified by prep-HPLC (Column: Boston Green ODS 150*30mm*5um, Mobile Phase A: water (0.2%FA) , Mobile Phase B: acetonitrile, Flow rate: 35 mL/min, gradient condition from 22%B to 52%) to give the product 1 as a white solid (120 mg, purity: 100%, yield: 23.2%) and product 2 as a white solid (120 mg, purity: 98.014%, yield: 22.7%) .

Step 12a: Synthesis of N- (4- ( (2*R, 5*R) -5- (2- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethoxy) -1-methylpiperidin-2-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A (N- (4- ( (2*R, 5*R) -5- (2- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethoxy) -1-methylpiperidin-2-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide, 120 mg, 0.135 mmol) was purified by SFC (Column: DAICEL CHIRALCEL OD-H (250mm*30mm, 5um) , Condition: 0.1%NH ₃H ₂O MeOH, Begin B: 45%, Flow rate: 50 mL/min) to afford the Compound 246 as a white solid (95.44 mg, purity: 100%, yield: 79.5%) . ¹H NMR (400 MHz, DMSO-d ₆) : δ 13.96 -13.10 (m, 1H) , 10.93 -10.56 (m, 1H) , 9.01 -8.95 (m, 1H) , 8.50 (d, J = 7.6 Hz, 1H) , 8.35 (d, J = 7.6 Hz, 1H) , 8.22 (d, J = 7.2 Hz, 1H) , 8.16 -8.03 (m, 2H) , 7.96 (s, 1H) , 7.74 (d, J = 10.0 Hz, 1H) , 7.48 -7.26 (m, 4H) , 7.24 -7.16 (m, 1H) , 7.13 -6.97 (m, 2H) , 5.18 (d, J = 2.8 Hz, 1H) , 5.03 -4.86 (m, 1H) , 4.64 (d, J = 9.6 Hz, 1H) , 4.49 (t, J = 8.0 Hz, 1H) , 4.29 (s, 1H) , 4.12 -3.87 (m, 5H) , 3.70 (s, 1H) , 3.63 -3.53 (m, 2H) , 3.18 (d, J = 12.8 Hz, 1H) , 2.90 -2.79 (m, 1H) , 2.48 -2.41 (m, 3H) , 2.20 -2.05 (m, 2H) , 2.01 -1.87 (m, 5H) , 1.78 -1.68 (m, 1H) , 1.62 -1.47 (m, 2H) , 1.32 (d, J = 6.8 Hz, 3H) , 0.99 (s, 9H) ; LCMS (ESI ⁺) : m/z 892.4 [M+H] ⁺.

Step 12b: Synthesis of N- (4- ( (2*S, 5*S) -5- (2- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethoxy) -1-methylpiperidin-2-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide

A (N- (4- ( (2*S, 5*S) -5- (2- ( ( (S) -1- ( (2S, 4R) -4-hydroxy-2- ( ( (S) -1- (4- (4-methylthiazol-5-yl) phenyl) ethyl) carbamoyl) pyrrolidin-1-yl) -3, 3-dimethyl-1-oxobutan-2-yl) amino) -2-oxoethoxy) -1-methylpiperidin-2-yl) -2-methoxyphenyl) -6- (1H-pyrazol-5-yl) picolinamide, 120 mg, 0.135 mmol) was purified by SFC (Column: DAICEL CHIRALPAK IG (250mm*30mm, 10um) , Condition: 0.1%NH ₃H ₂O MeOH, Begin B: 55%, Flow rate: 80 mL/min) to afford the Compound 247 as a white solid (97.11 mg, purity: 99.775%, yield: 80.743%) . ¹H NMR (400MHz, DMSO-d ₆) : δ 13.30 (br s, 1H) , 10.71 (s, 1H) , 8.98 -8.87 (m, 1H) , 8.42 (br d, J = 7.6 Hz, 1H) , 8.27 -8.11 (m, 2H) , 8.10 -7.96 (m, 2H) , 7.83 (br s, 1H) , 7.55 (d, J = 9.2 Hz, 1H) , 7.45 -7.24 (m, 4H) , 7.15 -7.07 (m, 1H) , 7.01 -6.88 (m, 2H) , 5.46 -4.96 (m, 1H) , 4.95 -4.83 (m, 1H) , 4.56 (d, J = 10.0 Hz, 1H) , 4.43 (t, J = 8.0 Hz, 1H) , 4.25 (s, 1H) , 4.07 -3.89 (m, 5H) , 3.64 (s, 1H) , 3.58 (s, 2H) , 3.11 (d, J = 12.4 Hz, 1H) , 2.81 (d, J = 10.8 Hz, 1H) , 2.43 -2.35 (m, 3H) , 2.15 -2.01 (m, 2H) , 1.97 -1.81 (m, 5H) , 1.77 -1.66 (m, 1H) , 1.55 -1.43 (m, 2H) , 1.31 (d, J = 7.2 Hz, 3H) , 0.94 (s, 9H) ; LCMS (ESI ⁺) : m/z 892.3 [M+H] ⁺.

The following Compound 248 was prepared according to similar procedure as described for Compound 246.

Biological assay

Method A: Western Blot Assay for Assessing IRAK1 protein Degradation

HEK293T cells were seeded in 12-well plates at a density of 6 × 10 ⁵ cells per mL per well in Dulbecco`s Modified Eagle Media (DMEM, Gibco) supplemented with 10%fetal bovine serum (FBS) and 1%penicillin/streptomycin (Gibco) and incubated overnight. The next day, old medium was replaced with fresh medium added with candidate compounds at serial diluted 9 concentrations starting from 10μM with 3-fold serial dilution (final DMSO concentration is 0.1%) , followed by incubation overnight. After 24 hours, culture medium was removed and cells were rinsed once with ice cold DPBS (Dulbecco's phosphate-buffered saline, ThermoFisher) and collected in 1mL DPBS by pipetting, transferred into 1.5mL Eppendorf tubes, centrifuged at 1,000 rpm for 5min, followed by aspiration of the supernatant and lysed in 60μL RIPA lysis buffer (Sigma) . The RIPA lysis buffer was added with Protease Inhibitor Cocktail (Sigma) , Phosphatase Inhibitor Cocktail 2 (Sigma) and Phosphatase Inhibitor Cocktail 3 (Sigma) , on ice for 15 minutes.

The cell lysates were then centrifugated at 14,000 rpm for 15 minutes at 4℃. Protein concentrations of the cell lysates were determined by BCA Protein Assay Kit (ThermoFisher) according to the manual. IRAK1 protein level was assessed by western blot. For each sample, 60μL cell lysate were added to 20μL of 4X LDS sample loading buffer (ThermoFisher) , then denatured at 95℃ for 10 minutes in the block heater and placed on ice. 30μg total protein was loaded in Bio-Rad Precast 4%-15%gradient gel (Bio-Rad) in 1X Tris/Glycine buffer (Bio-Rad) at 100 volts till protein marker can be visibly well separated. Protein was transferred from gels to PVDF membrane using a Bio-Rad Turbo transfer unit with the program of constant 2A, 20V for 7min. All the blots were rinsed with double-distilled water and blocked for 1 hour at room temperature in 5%Non-fat milk in tris-buffered saline -Tween 20 (TBST) (0.1%) on rocker. The blots were separately exposed to IRAK1 primary antibody (cat. #: CST4504S, Cell Signaling Technology, Danvers, MA) ; GAPDH primary antibody (cat. #: CST5174S, Cell Signaling Technology, Danvers, MA) ; Vinculin primary antibody (cat. #: CST13901S, Cell Signaling Technology, Danvers, MA) in blocking buffer (5%Non-fat milk in TBST) overnight at 4℃ on a rocker. The next day, the blots were then washed with TBST three times for 10 minutes on a rocker at room temperature. A goat anti-rabbit antibody (1: 3000, cat. #: 1706515, Bio-Rad) was then added, and the blots were incubated at room temperature on a rocker for 1 hour. The blots were then washed with TBST three times for 10 minutes at room temperature on a rocker. Signal was developed with Clarity Max Western ECL Substrate for 1 minute and the blots were read on a ChemiDoc ^TM XRS system (Bio-Rad) . Protein bands were quantified with Image Lab ^TM Software (Bio-Rad) . Percentage of degradation was assessed by comparing IRAK1 signal in compound treated groups versus DMSO treated group.

Method B: HiBit Assay for Assessing IRAK1 protein Degradation

1) Cell line generation:

HEK293T cells were infected with TetOn-LgBit lentivirus and cultured for one week. Then a single cell was seeded into one well of 96-w plate and expanded to generate monoclonal cells. Clone #3 was further transfected with Cas9 encoding plasmid, gRNA plasmid (sequence: CAGAGCTGATGTGTTCACCT) and HiBit temperate (sequence: GTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGC) . One week later, a single cell was seeded into one well of 96-w plate and expanded to generate monoclonal cells. Clone #3.2 was chosen for further use and designated as 293T-LgBit (TetOn) -IRAK1cHiBit#3.2 monoclonal cells.

2) End-point assay:

Candidate compounds were 3-fold serially diluted for 11 concentrations starting from 10 mM. Then dispense 25 nl/well compounds and 100 nl/well DMSO to the 384-well plate (Cat. #356661, Corning) , final DMSO concentration was 0.5%. 293T-LgBit (TetOn) _IRAK1cHiBit#3.2 monoclonal cells were suspended to 4×10 ⁵ cells/mL in culture medium Dulbecco`s Modified Eagle Media (DMEM, Gibco) supplemented with 10%fetal bovine serum (FBS) and 1%penicillin/streptomycin (Gibco) . Then 25 μl/well cells were dispensed into the compound containing 384-well plate and sealed with

Sealing Film (Cat. #P7543, Sigma) followed by incubating for 24 hours at 37℃ and 5%CO ₂.25 μl/well Nano-Glo HiBiT lytic detection solution (Cat. #N3040, Promega) was dispensed into the plate that was shaken for 10 minutes and centrifuged at 4000×g for 5 minutes. Luminescence was captured on Envision 2104 (PerkinElmer) . Percentage of degradation was assessed by the following formula: %inhibition = (RLU _compound -RLU _DMSO) / (RLU _Reference -RLU _DMSO) ×100. Curves of %inhibition vs concentration was plotted and fitted by four-parameter regression to return EC ₅₀ value. Compound 65 (2 uM) was served as the positive control/high control and DMSO is the negative control/low control, which means RLU reference is RLU positive control.

The following Table 1 summarizes the IRAK1 protein Degradation of the exemplary compounds of the present disclosure.

D _max is the maximal level of IRAK1 protein degradation after compound treatment at 10μM for 24 hours.

DC ₅₀ is the concentration at which 50%IRAK1 degradation was observed after compound treatment at the indicated concentrations for 24 hours.

Table 1

Compound No.	IRAK1 D _max (%)	IRAK1 DC ₅₀ (nM)	Method
1	93	1125	A
2	83	NA	A
3	59	>10000	A
4	42	1024	A
5	54	>10000	A
6	55	NA	A
7	74	661	A
8	96	82	A
9	64	314	A
10	65	294	A
11	60	5600	A
12	64	2500	A
14	37	NA	A
13	69	5413	A
15	95	100	A
16	88	134	A
17	54	NA	A
18	83	407	A

Compound No.	IRAK1 D _max (%)	IRAK1 DC ₅₀ (nM)	Method
19	81	NA	A
20	39	NA	A
21	89	461	A
22	50	NA	A
23	77	927	A
24	91	1031	A
25	69	NA	A
26	100	190	A
27	80	411	A
28	80	664	A
29	72	3430	A
30	71	NA	A
31	78	55	A
32	81	262	A
33	93	180	A
34	87	532	A
35	85	213	A
36	67	NA	A
37	90	3856	A
38	67	NA	A
39	81	NA	A
40	81	554	A
41	99	287	A
42	73	2089	A
43	87	164	A
44	97	43	A
45	73	NA	A
46	99	38	A
47	89	339	A
48	54	NA	A
49	96	56	A
50	99	60	A
51	90	31	A
52	89	203	A
53	84	NA	A
54	88	421	A

Compound No.	IRAK1 D _max (%)	IRAK1 DC ₅₀ (nM)	Method
55	91	62	A
56	82	96	A
57	72	143	A
58	97	274	A
59	93	316	A
60	50	NA	A
61	95	190	A
62	52	NA	A
63	92	NA	A
64	95	16	A
65	96	3	A
66	90	42	A
67	92	NA	A
68	85	NA	A
69	61	NA	A
70	96	NA	A
71	62	275	A
72	29	NA	A
73	53	NA	A
74	93	132	A
75	75	537	A
76	97	16	A
77	90	9	A
78	93	NA	A
79	92	144	A
80	72	2061	A
81	83	NA	A
82	86	NA	A
83	56	NA	A
84	80	NA	A
85	69	NA	A
86	59	NA	A
87	83	NA	A
88	79	NA	A
89	89	NA	A
90	96	13	A

Compound No.	IRAK1 D _max (%)	IRAK1 DC ₅₀ (nM)	Method
91	97	52	A
92	94	54	A
93	92	NA	A
94	94	43	A
95	97	44	A
96	94	13	A
97	53	NA	A
98-1	96	21	A
98-2	95	NA	A
99-1	96	NA	A
99-2	95	NA	A
100	96	111	A
101	110	94	B
102	107	52	B
103	110	53	B
104	108	47	B
105	106	54	B
106	6	>10000	B
107	101	137	B
108	100	197	B
109	95	201	B
110	109	36	B
111	104	50	B
112	105	75	B
113	105	114	B
114	102	48	B
115	109	42	B
116	107	93	B
117	105	42	B
118	109	32	B
119	108	22	B
120	108	99	B
121	106	50	B
122	106	35	B
123	59	287	B
124	98	113	B

Compound No.	IRAK1 D _max (%)	IRAK1 DC ₅₀ (nM)	Method
125	34	>10000	B
126	85	4752	B
127	100	129	B
128	90	134	B
129	105	122	B
130	86	111	B
131	106	89	B
132	NA	NA
133	NA	NA
134	NA	NA
135	NA	NA
136	NA	NA
137	NA	NA
138	100	44	B
139	100	4078	B
140	85	294	B
141	85	144	B
142	97	131	B
143	93	70	B
144	17	>10000	B
145	67	220	B
146	105	24	B
147	94	43	B
148	109	83	B
149	83	126	B
150	104	39	B
151	86	64	B
152	104	56	B
153	NA	NA
154	NA	NA
155	13	>10000	B
156	102	46	B
157	98	48	B
158	104	33	B
159	105	67	B
160	104	70	B

Compound No.	IRAK1 D _max (%)	IRAK1 DC ₅₀ (nM)	Method
161	109	31	B
162	106	227	B
163	105	45	B
164	106	34	B
165	108	56	B
166	94	136	B
167	64	219	B
168	92	93	B
169	27	>10000	B
170	NA	NA
171	99	27	B
172	NA	NA	B
173	103	58	B
174	NA	NA
175	NA	NA
176	NA	NA
177	NA	NA
178	NA	NA
178	NA	NA
179	99	218	B
180	63	362	B
181	24	>10000	B
182	98	294	B
183	98	156	B
184	53	1569	B
185	80	542	B
186	64	3693	B
187	68	378	B
188	72	4212	B
189	55	8480	B
190	107	142	B
191	71	4218	B
192	59	4717	B
193	102	494	B
194	23	>10000	B
195	95	87	B

Compound No.	IRAK1 D _max (%)	IRAK1 DC ₅₀ (nM)	Method
196	59	1914	B
197	96	51	B
198	53	9927	B
199	107	141	B
200	100	527	B
201	104	930	B
202	54	1933	B
203	NA	NA
204	93	346	B
205	110	198	B
206	108	116	B
207	55	9603	B
208	64	7524	B
209	21	>10000	B
210	98	234	B
211	61	814	B
212	98	84	B
213	104	96	B
214	95	150	B
215	108	105	B
216	62	7369	B
217	NA	NA
218	NA	NA
219	56	738	B
220	85	2703	B
221	103	80	B
222	91	89	B
223	73	3372	B
224	109	158	B
225	107	285	B
226	80	2077	B
227	85	2462	B
228	109	631	B
229	107	421	B
230	43	>10000	B
231	102	370	B

Compound No.	IRAK1 D _max (%)	IRAK1 DC ₅₀ (nM)	Method
232	110	715	B
233	72	5351	B
234	36	>10000	B
235	33	>10000	B
236	107	133	B
237	5	>10000	B
238	109	194	B
239	102	37	B
240	91	656	B
241	42	>10000	B
242	43	>10000	B
243	45	>10000	B
244	81	448	B
245	NA	NA
246	52	1595	B
247	94	1319	B
248	75	232	B

Claims

A compound having the chemical structure:

PTM―L―VLM,

(I)

including any stereoisomer thereof, or

a pharmaceutically acceptable salt or solvate thereof,

wherein:

the VLM is a small molecule Von Hippel-Lindau (VHL) E3 ubiquitin ligase binding moiety,

the L is a chemical linking moiety connecting the VLM and the PTM,

the PTM is a small molecule comprising an interleukin-1 receptor-associated kinase 1 (IRAK1) protein targeting moiety, and has a chemical structure represented by Formula PTM-I:

wherein

R ₁ is 5-12 member aryl, 5-12 member heteroaryl, or 5-10 member non-aromatic heterocyclyl, each of which is optionally substituted with 1, 2 or 3 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl, C _1-6 alkoxy and =O,

R ₂ is H, halogen, C _1-6 alkyl or C _1-6 alkoxy,

R ₃ is H, halogen, C _1-6 alkyl, C _1-6 alkoxy, 3-12 member carbocyclyl, 3-12 member heterocyclyl, 3-12 member carbocyclyloxy, or 3-12 member heterocyclyloxy, wherein the C _1-6 alkyl, C _1-6 alkoxy, 3-12 member carbocyclyl, 3-12 member heterocyclyl, 3-12 member carbocyclyloxy, or 3-12 member heterocyclyloxy are each optionally substituted with 1, 2 or 3 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl, C _1-6 alkoxy, C _3-6 cycloalkyl, hydroxy (C _1-6 alkyl) , amino (C _1-6 alkyl) optionally substituted with 1 or 2 independent C _1-6 alkyl groups on the amino group and -SO ₂- (C _1-6 alkyl) .
The compound according to claim 1, wherein PTM has a chemical structure represented by PTM-I:

wherein

R ₁ is 5-12 member heteroaryl containing at least one heteroatom selected from N, O or S, or 5-10 member nitrogen-containing non-aromatic heterocyclyl, each of which is optionally substituted with 1, 2 or 3 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl, C _1-6 alkoxy and =O,

R ₂ is H or halogen,

R ₃ is H, halogen, C _1-6 alkyl, C _1-6 alkoxy, 5-10 member monocyclic saturated carbocyclyl, 5-10 member monocyclic saturated heterocyclyl, 5-10 member monocyclic saturated carbocyclyloxy, or 5-10 member monocyclic saturated heterocyclyloxy, wherein the C _1-6 alkyl, C _1-6 alkoxy, 5-10 member monocyclic saturated carbocyclyl, 5-10 member monocyclic saturated heterocyclyl, 5-10 member monocyclic saturated carbocyclyloxy, or 5-10 member monocyclic saturated heterocyclyloxy are each optionally substituted with 1 or 2 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl, C _1-6 alkoxy, C _3-6 cycloalkyl, hydroxy (C _1-6 alkyl) , amino (C _1-6 alkyl) optionally substituted with one or two independent C _1-6 alkyl groups on the amino group, and -SO ₂-(C _1-6 alkyl) .
The compound according to any one of the preceding claims, wherein PTM has a chemical structure represented by Formula PTM-I:

wherein

R ₁ is 5-12 member nitrogen-containing heteroaryl, or 5-10 member nitrogen-containing non-aromatic heterocyclyl, each of which is optionally substituted with 1 substituent selected from -OH, -NH ₂, F, -CH ₃, -C ₂H ₅ and =O,

R ₂ is H or F,

R ₃ is C _1-6 alkyl, C _1-6 alkoxy, 5-10 member monocyclic saturated carbocyclyl, 5-10 member monocyclic saturated heterocyclyl, 5-10 member monocyclic saturated carbocyclyloxy, or 5-10 member monocyclic saturated heterocyclyloxy, each of which is optionally substituted with 1 or 2 substituents, each substituent independently selected from -OH, -NH ₂, F, methyl, ethyl, propyl, cyclopropyl, cyclobutyl, cyclopentyl, (CH ₃) ₂NCH ₂-and CH ₃SO ₂-.
The compound of any one of the preceding claims, wherein PTM is attached to the linker (L) at the following position:
The compound according to any one of the preceding claims, wherein VLM has a chemical structure represented by Formula VLM-I:

wherein

M is 5-12 member aryl, 5-12 member heteroaryl containing at least one heteroatom selected from N, O or S, 5-12 member saturated carbocyclyl, 5-12 member saturated heterocyclyl containing at least one heteroatom selected from N, O or S, or
each R ₉ and R ₁₀ is independently H, C _1-6 alkyl, hydroxy (C _1-6 alkyl) , amino (C _1-6 alkyl) , or halo (C _1-6 alkyl) ,

R ₁₁ is 5-12 member heteroaryl containing at least one heteroatom selected from N, O or S, 5-12 member aryl, or

R ₁₂ is H or C _1-6 alkyl,

R ₁₃ is H, C _1-6 alkyl, or (C _1-6 alkyl) carbonyl,

each R ₁₄ is independently H, C _1-6 alkyl, hydroxy (C _1-6 alkyl) , amino (C _1-6 alkyl) , or halo (C _1- ₆ alkyl) ,

R ₁₅ is halogen, -CN, -C≡CH, 5-12 member heteroaryl, or 5-12 member aryl, wherein the 5-12 member heteroaryl, or 5-12 member aryl are each optionally substituted with 1, 2 or 3 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl and C _1-6 alkoxy,

each R ₁₆ is independently halogen, C _1-6 alkyl, C _1-6 alkoxy, hydroxy (C _1-6 alkyl) , amino (C _1-6 alkyl) or halo (C _1-6 alkyl) ,

R ₁₈ is H or F,

Z ₁, Z ₂, Z ₃, and Z ₄ are independently CH or N,

o is 0, 1, 2, 3, or 4.
The compound according to any one of the preceding claims, wherein VLM has a chemical structure represented by Formula VLM-Ia:

wherein

M is 5-12 member aryl, 5-12 member heteroaryl containing at least one heteroatom selected from N, O or S, or

each R ₉ and R ₁₀ is independently H or C _1-6 alkyl,

R ₁₁ is 5-12 member heteroaryl containing at least one heteroatom selected from N, O or S,

R ₁₂ is H or C _1-6 alkyl,

R ₁₃ is H or C _1-6 alkyl,

each R ₁₄ is independently H, C _1-6 alkyl or halo (C _1-6 alkyl) ,

R ₁₅ is halogen, -CN, -C≡CH, 5-12 member heteroaryl containing at least one heteroatom selected from N, O or S, wherein the 5-12 member heteroaryl is optionally substituted with 1 or 2 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl and C _1-6 alkoxy,

each R ₁₆ is independently halo or C _1-6 alkyl,

R ₁₈ is H or F,

Z ₂, Z ₃, and Z ₄ are independently CH or N,

o is 0, 1, or 2.
The compound of any one of the preceding claims, wherein the VLM has a chemical structure represented by Formula VLM-Ib:

wherein:

X is O or S,

Y is H or C _1-6 alkyl,

R ₁₇ is H or C _1-6 alkyl,

R ₉ is H,

R ₁₀ is C _1-6 alkyl,

R ₁₁ is 5-12 member nitrogen-containing heteroaryl, or

R ₁₂ is H or C _1-6 alkyl,

R ₁₃ is H or C _1-6 alkyl.
The compound according to any one of the preceding claims, wherein the VLM has a chemical structure represented by Formula VLM-Ic:

wherein:

Y is H, methyl or ethyl,

R ₉ is H,

R ₁₀ is isopropyl, tert-butyl, or sec-butyl

R ₁₁ is isoxazole or

R ₁₂ is H or C _1-6 alkyl,

R ₁₃ is H or C _1-6 alkyl,

R ₁₇ is H or C _1-6 alkyl.
The compound according to any one of the preceding claims 1-6, wherein the VLM has a chemical structure represented by Formula VLM-Id:

wherein:

Y is H, methyl, fluromethyl or ethyl,

R ₉ is H,

R ₁₀ is isopropyl, tert-butyl, or sec-butyl

R ₁₁ is isoxazole or

R ₁₂ is H or C _1-6 alkyl,

R ₁₃ is H or C _1-6 alkyl,

R ₁₇ is H or C _1-6 alkyl.
The compound of any one of Claims 5-9, wherein VLM is attached to the linker (L) at a position selected from the group consisting of the following:

wherein the variable groups have the same definition as above.
The compound according to any one of the preceding claims, wherein the linker (L) has a chemical structure represented by Formula L-Ia or Formula L-Ib:

-X- (Y ^L1) _n-Z-

L-Ia,

- (Y ^L1) _n-W ^L1- (Y ^L1) _n-Z-

L-Ib,

wherein

X and Z are independently C≡C, CH ₂, O, NH, C=O, or C=S,

W ^L1 is 5-12 membered aryl, 5-12 member saturated carbocyclyl, 5-12 membered saturated heterocyclyl containing at least one heteroatom selected from N, O or S, or 6-12 membered N containing saturated spiro bicycle, each of which is optionally substituted with 1, 2 or 3 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl and C _1-6 alkoxy,

each Y ^L1 is independently a linear or branched C _1-6 alkylene wherein optionally one or more C atoms are replaced with O and/or C=O,

each n is independently 0, 1 or 2.
The compound according to any one of the preceding claims, wherein the linker (L) has a chemical structure represented by Formula (IVa) or Formula (IVb) :

-X- (Y ^L1) _n-Z-

L-Ia,

- (Y ^L1) _n-W ^L1- (Y ^L1) _n-Z-

L-Ib,

wherein

X is C≡C, CH ₂, O, or NH,

Z is C=O,

W ^L1 is 5-12 membered aryl, 5-12 membered saturated carbocyclyl, 5-12 membered N containing saturated heterocyclyl, or 6-12 membered N containing saturated spiro bicycle, each of which is optionally substituted with 1, 2 or 3 substituents, each substituent independently selected from -OH, -NH ₂, halogen, C _1-6 alkyl and C _1-6 alkoxy, each Y ^L1 is independently a linear or branched C _1-3 or C _4-6 alkylene wherein optionally 1 or 2 C atoms are replaced with O and/or C=O,

each n is independently 0, 1 or 2.
The compound according to any one of the preceding claims, wherein the VLM is selected from the group consisting of:

or, the PTM is selected from the group consisting of:

or, the linker (L) is selected from the group consisting of:

or a combination thereof.
The compound of any one of the preceding claims, wherein the compound is selected from the group consisting of the following compounds:
The compound of any one of the preceding claims for use in therapy.
The compound of any one of the preceding claims for use in the prophylaxis or treatment, in particular in the treatment, of a disease or disorder mediated by IRAK1.
The compound of any one of the preceding claims for use in the prophylaxis or treatment, in particular in the treatment, of a neurodegenerative disease or disorder, an inflammatory disease or disorder and/or a cancer mediated by IRAK1.
A method for the prophylaxis or treatment, in particular in the treatment, of a disease or disorder mediated by IRAK1, which method comprises administering to a subject in need thereof a compound as defined in any one of Claims 1-14.
A method for the prophylaxis or treatment, in particular in the treatment, of a neurodegenerative disease or disorder, an inflammatory disease or disorder and/or a cancer mediated by IRAK1, which method comprises administering to a subject in need thereof a compound as defined in any one of Claims 1-14.
Use of a compound as defined in any one of Claims 1-14 for the manufacture of a medicament for the prophylaxis or treatment, in particular in the treatment, of a disease or disorder mediated by IRAK1.
Use of a compound as defined in any one of Claims 1-14 for the manufacture of a medicament for the prophylaxis or treatment, in particular in the treatment, of a neurodegenerative disease or disorder, an inflammatory disease or disorder and/or a cancer mediated by IRAK1.
A composition comprising a pharmaceutically acceptable carrier and an effective amount of at least one compound of any one of Claims 1-14.