WO2021007529A1 - Rna-targeting knockdown and replacement compositions and methods for use - Google Patents

Rna-targeting knockdown and replacement compositions and methods for use Download PDF

Info

Publication number
WO2021007529A1
WO2021007529A1 PCT/US2020/041634 US2020041634W WO2021007529A1 WO 2021007529 A1 WO2021007529 A1 WO 2021007529A1 US 2020041634 W US2020041634 W US 2020041634W WO 2021007529 A1 WO2021007529 A1 WO 2021007529A1
Authority
WO
WIPO (PCT)
Prior art keywords
rna
sequence
seq
protein
disclosure
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2020/041634
Other languages
English (en)
French (fr)
Inventor
David A. Nelles
Ranjan BATRA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Locanabio Inc
Original Assignee
Locanabio Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Locanabio Inc filed Critical Locanabio Inc
Priority to CA3145309A priority Critical patent/CA3145309A1/en
Priority to JP2022500898A priority patent/JP2022540446A/ja
Priority to EP20753516.2A priority patent/EP3997227A1/en
Priority to AU2020310201A priority patent/AU2020310201A1/en
Priority to CN202080061471.7A priority patent/CN114450031A/zh
Publication of WO2021007529A1 publication Critical patent/WO2021007529A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/16Otologicals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • C12N15/861Adenoviral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications

Definitions

  • the disclosure is directed to molecular biology, gene therapy, and compositions and methods for modifying expression and activity of RNA molecules.
  • RNA-targeting systems there has been a long-felt but unmet need in the art for providing effective gain- orloss-of-function gene replacement therapies. There is also a long-felt need in the art for providing effective methods of RNA-targeting systems.
  • the disclosure thus, provides a combination of RNA-targeting and gene replacement strategies.
  • the disclosure provides compositions and methods for specifically targeting and knocking down pathogenic RNA molecules, which lead to toxic gain-or-loss-of-function mutations, in a sequence- specific manner while also replacing the targeted, and knocked down, gene with a therapeutic replacement gene.
  • the disclosure provides a composition comprising a nucleic acid sequence encoding an RNA-guided target RNA knockdown and replacement therapeutic comprising (a) an RNA-binding polypeptide or portion thereof; and (b) a therapeutic protein, wherein the RNA- binding polypeptide binds and cleaves a target RNA when guided by a gRNA sequence, wherein a pathogenic RNA comprises the target RNA, and wherein the therapeutic protein is a replacement of gain-or-loss-of-function mutations encoded by the pathogenic RNA.
  • the disclosure provides a composition comprising a nucleic acid sequence encoding a target RNA knockdown and replacement therapeutic comprising (a) an RNA-binding polypeptide or portion thereof; and (b) a therapeutic protein, wherein the RNA-binding polypeptide binds and cleaves a target RNA or a protein encoded by the target RNA, wherein a pathogenic RNA encoding a pathogenic protein with one or more gain-or-loss-of-function mutations comprises the target RNA, and wherein the therapeutic protein is a replacement protein for the pathogenic protein.
  • the disclosure also provides a composition comprising a nucleic acid sequence encoding a target RNA knockdown and replacement therapeutic for treating retinitis pigmentosa (RP) comprising (a) an RNA-binding polypeptide or portion thereof; and (b) a therapeutic protein, wherein the RNA-binding polypeptide binds and cleaves a target rhodopsin RNA or a protein encoded by the target rhodopsin RNA, wherein a pathogenic rhodopsin RNA encoding a pathogenic rhodopsin protein with one or more gain-or-loss-of- function rhodopsin mutations comprises the target rhodopsin RNA, and wherein the therapeutic protein is a wild-type rhodopsin protein.
  • RP retinitis pigmentosa
  • the RNA-binding polypeptide is a RNA-guided RNA- binding protein.
  • the RNA-guided RNA-binding protein is Casl3a, Casl3b, Casl3c, or Casl3d.
  • the RNA-binding polypeptide is a non- guided RNA-binding polypeptide.
  • the non-guided RNA-binding polypeptide is PUF, or PUMBY protein.
  • the non-guided RNA-binding polypeptide a PUF or PUMBY fusion protein.
  • a PUF or PUMBY-based first RNA-binding protein is fused to a second RNA-bindng protein which is an zinc-finger endonuclease known as ZC3H12A of SEQ ID NO: 358 (also termed herein E17).
  • the therapeutic replacement gene (corresponding disease) is selected from the group consisting of: rhodopsin (Retinitis Pigmentosa), PRPF3 (Retinitis Pigmentosa), PRPF31 (autosomal dominant Retinitis Pigmentosa), GRN (FTD), SOD1 (ALS), PMP22 (Charcot Marie Tooth Disease), PABPN1 (Oculopharangeal Muscular Dystrophy), KCNQ4 (Hearing Loss), CLRN1 (Usher Syndrome), APOE2 (Alzheimer’s Disease), APOE4 (Alzheimer’s Disease), BEST1 (Eye Disease), MYBPC3 (Familial Cardiomyopathy), TNNT2 (Familial Cardiomyopathy), and TNNI3 (Familial
  • the therapeutic protein is rhodopsin or wild-type rhodopsin.
  • the therapeutic protein is human rhodopsin. In some embodiments, the therapeutic protein is“hardened” rhodopsin.
  • the pathogenic rhodopsin RNA comprises or encodes at least one gain-or-loss-of-function mutation.
  • the rhodopsin target RNA comprises
  • the rhodopsin target RNA comprises CAACGAGTCTTTTGTCATCTACATGT (SEQ ID NO: 462), CGCCAGCGTGGCATTCTACATCTTCA (SEQ ID NO: 463), or
  • the target RNA encodes an amino acid sequence comprising ASVAFYIF (SEQ ID NO: 407) at positions 269 to 276. In some embodiments, the target RNA encodes an amino acid comprising YASVAFYIFT (SEQ ID NO: 486) at positions 268 to 277.
  • the“hardened” rhodopsin is encoded by a nucleic acid sequence which does not comprise the rhodopsin target RNA comprising
  • the“hardened” rhodopsin is encoded by a nucleic acid sequence comprising GCTTCCGTAGCTTTTTATATTTTT (SEQ ID NO: 408).
  • the nucleic acid sequence comprises at least one promoter.
  • the at least one promoter is a constitutive promoter or a tissue-specific promoter. In some embodiments, the at least one promoter is selected from the group consisting of an opsin promoter, an EFS promoter, and a combination thereof.
  • the nucleic acid sequence comprises two promoters. In one embodiment, the two promoters are an opsin promoter driving expression of the replacement rhodopsin protein and an EFS promoter driving expression of the PUF or PUMBY-based RNA-binding protein fused to a second RNA-binding protein which is an effector protein such as ZC3H12A. [017] In some embodiments disclosed herein is a vector comprising the knockdown replacement compositions disclosed herein.
  • the vector is selected from the group consisting of: adeno-associated virus, retrovirus, lentivirus, adenovirus, nanoparticle, micelle, liposome, lipoplex, polymersome, polyplex, and dendrimer.
  • a cell comprising the vectors disclosed herein.
  • the RNA-binding polypeptide is a first RNA-binding polypeptide, and the nucleic acid sequence encodes a second RNA-binding polypeptide which binds RNA in a manner in which it associates with RNA.
  • the second RNA-binding polypeptide associates with RNA in a manner in which it cleaves RNA.
  • the second RNA-binding polypeptide is selected from the group consisting of: RNAsel, RNAse4, RNAse6, RNAse7, RNAse8, RNAse2, RNAse6PL, RNAseL, RNAseT2, RNAsel 1, RNAseT2-like, NOB1, ENDOV, ENDOG, ENDOD1, hFENl, hSLFN14, hLACTB2, APEX2, ANG, HRSP12, ZC3H12A, RIDA, PDL6, NTHL, KIAA0391, APEXl, AG02, EXOG, ZC3H12D, ERN2, PELO, YBEY, CPSF4L, hCG_2002731, ERCC1, RAC1, RAA1, RABl, DNA2, FLJ35220, FLJ13173, ERCC4, Rnasel(K41R), Rnasel(K41R, D121E
  • the second RNA-binding polypeptide is ZC3H12A.
  • the sequence comprising the gRNA further comprises a sequence encoding a promoter capable of expressing the gRNA in a eukaryotic cell.
  • the gRNA comprises a spacer sequence comprising ACATGTAGATGACAAAAGACTCGTTG (SEQ ID NO: 465), T GAAGATGT AGAAT GCC ACGCTGGCG (SEQ ID NO: 409), or
  • the eukaryotic cell is an animal cell.
  • the animal cell is a mammalian cell.
  • the animal cell is a human cell.
  • the promoter is a constitutively active promoter.
  • the promoter sequence is isolated or derived from a promoter capable of driving expression of an RNA polymerase.
  • the promoter sequence is a Pol II promoter.
  • the promoter sequence is isolated or derived from a U6 promoter.
  • the promoter is a sequence isolated or derived from a promoter capable of driving expression of a transfer RNA (tRNA).
  • tRNA transfer RNA
  • the promoter is isolated or derived from an alanine tRNA promoter, an arginine tRNA promoter, an asparagine tRNA promoter, an aspartic acid tRNA promoter, a cysteine tRNA promoter, a glutamine tRNA promoter, a glutamic acid tRNA promoter, a glycine tRNA promoter, a histidine tRNA promoter, an isoleucine tRNA promoter, a leucine tRNA promoter, a lysine tRNA promoter, a methionine tRNA promoter, a phenylalanine tRNA promoter, a proline tRNA promoter, a serine tRNA promoter, a threonine tRNA promoter, a tryptophan tRNA promoter, a tyrosine tRNA promoter, or a valine tRNA promoter. In some embodiments, the promoter is isolated or
  • the sequence comprising the gRNA further comprises a spacer sequence that specifically binds to the target RNA sequence.
  • the spacer sequence has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 87%, 90%, 95%, 97%, 99% or any percentage in between of complementarity to the target RNA sequence.
  • the spacer sequence has 100% complementarity to the target RNA sequence.
  • the spacer sequence comprises or consists of 20 nucleotides.
  • the spacer sequence comprises or consists of 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, or 29 nucleotides. In some embodiments, the spacer sequence comprises or consists of 26 nucleotides. In some embodiments, the spacer sequence is non-processed and comprises or consists of 30 nucleotides. In some embodiments the non-processed spacer sequence comprises or consists of 30-36 nucleotides.
  • the sequence comprising the gRNA further comprises a spacer sequence that specifically binds to the target RNA sequence.
  • the spacer sequence has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 87%, 90%, 95%, 97%, 99% or any percentage in between of complementarity to the target RNA sequence.
  • the sequence comprising the gRNA further comprises a spacer sequence that specifically binds to the target RNA sequence.
  • the spacer sequence has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 87%, 90%, 95%, 97%, 99% or any percentage in between of complementarity to the target RNA sequence.
  • the gRNA does not bind or does not selectively bind to a second sequence within the RNA molecule.
  • an RNA genome or an RNA transcriptome comprises the RNA molecule.
  • the first RNA binding protein comprises a CRISPR-Cas protein.
  • the CRISPR-Cas protein is a Type II CRISPR-Cas protein.
  • the first RNA binding protein comprises a Cas9 polypeptide or an RNA-binding portion thereof.
  • the CRISPR-Cas protein comprises a native RNA nuclease activity.
  • the native RNA nuclease activity is reduced or inhibited.
  • the native RNA nuclease activity is increased or induced.
  • the CRISPR-Cas protein comprises a native DNA nuclease activity and the native DNA nuclease activity is inhibited. In some embodiments, the CRISPR-Cas protein comprises a mutation. In some embodiments, a nuclease domain of the CRISPR-Cas protein comprises the mutation. In some
  • the mutation occurs in a nucleic acid encoding the CRISPR-Cas protein. In some embodiments, the mutation occurs in an amino acid encoding the CRISPR-Cas protein. In some embodiments, the mutation comprises a substitution, an insertion, a deletion, a frameshift, an inversion, or a transposition. In some embodiments, the mutation comprises a deletion of a nuclease domain, a binding site within the nuclease domain, an active site within the nuclease domain, or at least one essential amino acid residue within the nuclease domain.
  • the pathogenic RNA comprises the target RNA, and/or the target RNA is associated with the pathogenic RNA. In some embodiments, the pathogenic RNA encodes gain-or-loss-of-function mutations.
  • the RNA binding protein comprises a CRISPR-Cas protein.
  • the CRISPR-Cas protein is a Type V CRISPR-Cas protein.
  • the RNA binding protein comprises a Cpfl polypeptide or an RNA-binding portion thereof.
  • the CRISPR- Cas protein comprises a native RNA nuclease activity.
  • the native RNA nuclease activity is reduced or inhibited.
  • the native RNA nuclease activity is increased or induced.
  • the CRISPR-Cas protein comprises a native DNA nuclease activity and the native DNA nuclease activity is inhibited. In some embodiments, the CRISPR-Cas protein comprises a mutation. In some embodiments, a nuclease domain of the CRISPR-Cas protein comprises the mutation. In some
  • the mutation occurs in a nucleic acid encoding the CRISPR-Cas protein. In some embodiments, the mutation occurs in an amino acid encoding the CRISPR-Cas protein. In some embodiments, the mutation comprises a substitution, an insertion, a deletion, a frameshift, an inversion, or a transposition. In some embodiments, the mutation comprises a deletion of a nuclease domain, a binding site within the nuclease domain, an active site within the nuclease domain, or at least one essential amino acid residue within the nuclease domain.
  • the RNA binding protein comprises a CRISPR-Cas protein.
  • the CRISPR-Cas protein is a Type VI CRISPR-Cas protein.
  • the RNA binding protein comprises a Casl3 polypeptide or an RNA-binding portion thereof.
  • the RNA binding protein comprises a Casl3d polypeptide or an RNA-binding portion thereof.
  • the CRISPR-Cas protein comprises a native RNA nuclease activity.
  • the native RNA nuclease activity is reduced or inhibited.
  • the native RNA nuclease activity is increased or induced.
  • the CRISPR-Cas protein comprises a native DNA nuclease activity and the native DNA nuclease activity is inhibited.
  • the CRISPR-Cas protein comprises a mutation.
  • a nuclease domain of the CRISPR-Cas protein comprises the mutation.
  • the mutation occurs in a nucleic acid encoding the CRISPR-Cas protein.
  • the mutation occurs in an amino acid encoding the CRISPR-Cas protein.
  • the mutation comprises a substitution, an insertion, a deletion, a frameshift, an inversion, or a transposition.
  • the mutation comprises a deletion of a nuclease domain, a binding site within the nuclease domain, an active site within the nuclease domain, or at least one essential amino acid residue within the nuclease domain.
  • the RNA binding protein is a non-guided RNA binding protein.
  • the non-guided RNA binding protein comprises a Pumilio and FBF (PUF) protein or an RNA binding portion thereof.
  • the RNA binding protein comprises a Pumilio-based assembly (PUMB Y) protein or an RNA binding portion thereof.
  • the RNA binding protein does not require multimerization for RNA-binding activity.
  • the RNA binding protein is not a monomer of a multimer complex.
  • a multimer protein complex does not comprise the RNA binding protein.
  • the RNA binding protein selectively binds to a target sequence within the RNA molecule.
  • the RNA binding protein does not comprise an affinity for a second sequence within the RNA molecule. In some embodiments, the RNA binding protein does not comprise a high affinity for or selectively bind a second sequence within the RNA molecule.
  • compositions of the disclosure an RNA genome or an RNA genome
  • RNA transcriptome comprises the RNA molecule.
  • the RNA binding protein comprises between 2 and 1300 amino acids, inclusive of the endpoints.
  • the sequence encoding the RNA binding protein further comprises a sequence encoding a nuclear localization signal (NLS), a nuclear export signal (NES) or tag.
  • NLS nuclear localization signal
  • NES nuclear export signal
  • the sequence encoding a nuclear localization signal (NLS) is positioned at the N-terminus of the sequence encoding the RNA binding protein.
  • the RNA binding protein comprises an NLS at a C-terminus of the protein.
  • the sequence encoding the RNA binding protein further comprises a first sequence encoding a first NLS and a second sequence encoding a second NLS.
  • the sequence encoding the first NLS or the second NLS is positioned at the N-terminus of the sequence encoding the RNA binding protein.
  • the RNA binding protein comprises the first NLS or the second NLS at a C-terminus of the protein.
  • the composition further comprises a second RNA binding protein.
  • the second RNA binding protein comprises or consists of a nuclease domain.
  • the second RNA binding protein binds RNA in a manner in which it associates with RNA.
  • the second RNA binding protein associates with RNA in a manner in which it cleaves RNA.
  • the sequence encoding the second RNA binding protein comprises or consists of an RNAse.
  • compositions disclosed herein are used in a method for reducing the level of expression of a pathogenic target RNA molecule or a protein encoded by the pathogenic RNA molecule and replacing gain-or-loss-of-function mutations caused by the pathogenic target RNA with a therapeutic replacement protein, the method comprising contacting the compositions disclosed herein and the pathogenic target RNA molecule comprising a target RNA sequence under conditions suitable for binding of the RNA binding protein to the target RNA sequence, wherein the level of expression of the pathogenic target RNA is reduced, and wherein the expression of the pathogenic target RNA is replaced with expression of a therapeutic replacement protein.
  • FIGS. 1 A-1E are schematic diagrams of exemplary embodiments of compositions of the disclosure that depict nucleic acid sequence designs that promote simultaneous knockdown and replacement of pathogenic RNAs.
  • Nucleic acid sequences A-E each describe exemplary vector sequences.
  • a polymerase II (“Pol II”) promoter drives expression of the RNA-targeting protein
  • a polymerase III promoter (“Pol III”) drives expression of the optional single guide RNA (“sgRNA”) in vectors that also encode a CRISPR-associated (Cas) RNA-targeting protein.
  • the replacement protein is provided either by a second polymerase II promoter or via the same promoter that drives the RNA-targeting protein.
  • the replacement gene and the RNA knockdown system are separated by either a 2A site or an internal ribosome entry site (IRES).
  • IRS internal ribosome entry site
  • FIG. 2 is a schematic diagram of embodiments of therapeutic compositions and methods of the disclosure involving the knockdown and replace vector.
  • Certain schematic vector designs are packaged in a delivery vehicle such as adeno-associated virus (AAV) and delivered to target tissue in a manner determined by AAV serotype and administration method. Once present in the target tissue, the therapeutic simultaneously replaces the mutated RNA and encoded protein while destroying the mutated RNA.
  • AAV adeno-associated virus
  • FIG. 3 is a plasmid map showing an exemplary configuration of pmirGlo designed for a luciferase reporter assay for detecting knockdown effect of the compositions disclosed herein.
  • FIG. 4 is a plasmid map showing a PUMBY-based knockdown and replacement embodiment of the compositions disclosed herein.
  • FIG. 5 is a plasmid map showing a PUF-based knockdown and replacement embodiment of the compositions disclosed herein
  • FIG. 6A-6C show embodiments of the compositions disclosed herein.
  • FIG. 6A shows a schematic diagram of exemplary embodiments of compositions of the disclosure that depict nucleic acid sequence designs encoding PUF or PUMBY-based RNA-binding - effector fusion proteins.
  • FIGS. 6B-6C show knockdown of Rhodopsin target RNA and replacement of the target RNA with“hardened” rhodopsin.
  • FIGS. 7A-7B show knockdown of Rhodopsin target RNA and replacement of the target RNA with“hardened” rhodopsin.
  • FIG. 8 shows a luciferase assay PUF -targeting Rhodopsin knockdown screen compared to no targeting.
  • the disclosure provides a therapeutic combination of RNA-targeting and gene replacement.
  • the disclosure provides compositions and methods for specifically targeting and knocking down pathogenic RNA molecules which lead to toxic gain-or-loss-of- function mutations in a sequence-specific manner while also replacing the targeted, and knocked down, gene with the corresponding therapeutic gene.
  • the pathogenic RNA comprises a target RNA sequence.
  • the pathogenic RNA comprises a target RNA sequence but the target RNA sequence does not comprise the gain- or-loss-of-function mutations.
  • the target RNA is in non-coding RNA.
  • the pathogenic RNA comprises one or more additional target RNAs.
  • the disclosure provides a composition comprising a nucleic acid sequence encoding a target RNA knockdown and replacement therapeutic comprising (a) an RNA-binding polypeptide or portion thereof; and (b) a therapeutic protein, wherein the RNA- binding polypeptide binds and cleaves a target RNA, wherein a pathogenic RNA comprises the target RNA, and wherein the therapeutic protein is a wild-type replacement of the pathogenic RNA or protein encoded by the pathogenic RNA.
  • the disclosure provides vectors, compositions and cells comprising the knockdown and replacement compositions.
  • RNA-guided such as CRISPR/Cas-based
  • PEF or PUMBY-based RNA-binding proteins fusions
  • gRNAs guide RNAs
  • compositions and cells of the disclosure to treat a disease or disorder also provide particular target RNA sequences or particular targeting RNA sequences (e.g., a particular gRNA spacer sequence).
  • compositions and methods of the disclosure provide a combined knockdown and therapeutic effect.
  • the compositions comprise a nucleic acid sequence encoding 1) an RNA-binding polypeptide (RBP) or RNA-binding domain (RBD), capable of cleavage of a pathogenic RNA comprising a target RNA sequence, and 2) a replacement therapeutic protein.
  • the replacement therapeutic protein is the wild- type protein of the pathogenic target RNA or protein.
  • the therapeutic (e.g., wild-type) replacement protein replaces gain-or-loss-of-function mutations encoded by the pathogenic target RNA.
  • the RNA-binding polypeptide is an RNA-guided RNA- binding polypeptide.
  • the RNA-guided RNA-binding polypeptide is a CRISPR/Cas protein and the nucleic acid sequence further comprises an gRNA sequence which corresponds to the target RNA and the CRISPR/Cas protein.
  • the RNA-binding polypeptide is not an RNA-guided RNA-binding polypeptide.
  • the non-RNA-guided RNA-binding polypeptide is a PUF protein or a PUMB Y protein or portion thereof.
  • the pathogenic RNA comprising the target RNA encodes gain-or-loss-of-function mutations.
  • the pathogenic RNA encodes gain-or-loss-of- functionmutations in the rhodopsin gene and the replacement gene encodes human rhodopsin.
  • the pathogenic rhodopsin RNA comprises a rhodopsin target RNA.
  • the rhodopsin target RNA sequence comprises
  • the rhodopsin target RNA comprises CAACGAGTCTTTTGTCATCTACATGT (SEQ ID NO: 462), CGCCAGCGTGGCATTCTACATCTTCA (SEQ ID NO: 463), or
  • the rhodopsin target RNA encodes an amino acid comprising ASVAFYIF (SEQ ID NO: 407). In one embodiment, the rhodopsin target RNA encodes an amino acid comprising ASVAFYIF (SEQ ID NO: 407) at e.g., position 269 to 276. In another embodiment, the target RNA encodes an amino acid comprising
  • the target RNA encodes an amino acid comprising YASVAFYIFT (SEQ ID NO: 486) at e.g., positions 268 to 277.
  • the replacement gene encodes“hardened” rhodopsin.
  • “Hardened” rhodopsin is an engineered wild-type rhodopsin the expression of which is engineered to be incapable of knockdown using the compositions disclosed herein.
  • a“hardened” rhodopsin nucleic acid sequence comprising at least one mismatch.
  • a“hardened” rhodopsin nucleic acid sequence comprising two or more mismatches.
  • the“hardened” rhodopsin is encoded by a nucleic acid sequence which does not comprise the rhodopsin target RNA comprising GCCAGCGTGGCATTCTACATCTTC SEQ ID NO: 406.
  • the“hardened” rhodopsin is encoded by a nucleic acid sequence comprising GCTTCCGTAGCTTTTTATATTTTT (SEQ ID NO: 408).
  • the spacer sequence of the gRNA is a sequence which is complementary to the rhodopsin target RNA.
  • the spacer sequence targeting the rhodopsin target RNA is
  • gRNA guide RNA
  • sgRNA single guide RNA
  • Guide RNAs (gRNAs) of the disclosure may comprise of a spacer sequence and a scaffolding and/or a“direct repeat” (DR) sequence.
  • a guide RNA is a single guide RNA (sgRNA) comprising a contiguous spacer sequence and scaffolding sequence.
  • the spacer sequence and the scaffolding sequence are not contiguous.
  • a scaffold sequence comprises a“direct repeat” (DR) sequence.
  • the gRNA comprises a DR sequence.
  • DR sequences refer to the repetitive sequences in the CRISPR locus (naturally-occurring in a bacterial genome or plasmid) that are interspersed with the spacer sequences.
  • a guide RNA comprises a direct repeat (DR) sequence and a spacer sequence.
  • a sequence encoding a guide RNA or single guide RNA of the disclosure comprises or consists of a spacer sequence and a scaffolding sequence and/or a DR sequence, that are separated by a linker sequence.
  • the linker sequence may comprise or consist of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 or any number of nucleotides in between.
  • the linker sequence may comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 or any number of nucleotides in between.
  • the scaffold sequence is a Cas9 scaffold sequence.
  • the DR sequence is a Casl3d sequence.
  • the gRNA that hybridizes with the one or more target RNA molecules in a Cas 13d-mediated manner includes one or more direct repeat (DR) sequences, one or more spacer sequences, such as, e.g., one or more sequences comprising an array of DR-spacer-DR-spacer.
  • DR direct repeat
  • spacer sequences such as, e.g., one or more sequences comprising an array of DR-spacer-DR-spacer.
  • a plurality of gRNAs are generated from a single array, wherein each gRNA can be different, for example target different RNAs or target multiple regions of a single RNA, or combinations thereof.
  • an isolated gRNA includes one or more direct repeat (DR) sequences, such as an unprocessed (e.g., about 36 nt) or processed DR (e.g., about 30 nt).
  • a gRNA can further include one or more spacer sequences specific for (e.g., is complementary to) the target RNA.
  • multiple pol III promoters can be used to drive multiple gRNAs, spacers and/or DRs.
  • a guide array comprises a DR (about 36nt)- spacer (about 30nt)-DR (about 36nt)-spacer (about 30nt)-DR (about 36nt).
  • Guide RNAs (gRNAs) of the disclosure may comprise non-naturally occurring nucleotides.
  • a guide RNA of the disclosure or a sequence encoding the guide RNA comprises or consists of modified or synthetic RNA nucleotides.
  • Exemplary modified RNA nucleotides include, but are not limited to, pseudouridine (Y), dihydrouridine (D), inosine (I), and 7-methylguanosine (m7G), hypoxanthine, xanthine, xanthosine, 7- methylguanine, 5, 6-Dihydrouracil, 5-methylcytosine, 5-methylcytidine, 5- hydropxymethylcytosine, isoguanine, and isocytosine.
  • Guide RNAs (gRNAs) of the disclosure may bind modified RNA within a target sequence.
  • guide RNAs (gRNAs) of the disclosure may bind modified or mutated (e.g., pathogenic) RNA.
  • exemplary epigenetically or post- transcriptionally modified RNA include, but are not limited to, 2’-0-Methylation (2’-OMe) (2’-0-methylation occurs on the oxygen of the free 2’-OH of the ribose moiety), N6- methyladenosine (m6A), and 5-methylcytosine (m5C).
  • a guide RNA of the disclosure comprises at least one sequence encoding a non-coding C/D box small nucleolar RNA (snoRNA) sequence.
  • the snoRNA sequence comprises at least one sequence that is complementary to the target RNA, wherein the target sequence of the RNA molecule comprises at least one 2’-OMe.
  • the snoRNA sequence comprises at least one sequence that is complementary to the target RNA, wherein the at least one sequence that is complementary to the target RNA comprises a box C motif
  • Spacer sequences of the disclosure bind to the target sequence of an RNA molecule. In some embodiments, spacer sequences of the disclosure bind to pathogenic target RNA.
  • Spacer sequences of the disclosure may comprise a CRISPR RNA (crRNA). Spacer sequences of the disclosure comprise or consist of a sequence having sufficient
  • a sequence having sufficient complementarity to a target sequence of an RNA molecule to bind selectively to the target sequence has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96, 97%, 98%, 99%, or any percentage identity in between to the target sequence.
  • a sequence having sufficient complementarity to a target sequence of an RNA molecule to bind selectively to the target sequence has 100% identity the target sequence.
  • Scaffolding sequences of the disclosure bind the first RNA-binding polypeptide of the disclosure.
  • Scaffolding sequences of the disclosure may comprise a trans acting RNA (tracrRNA).
  • Scaffolding sequences of the disclosure comprise or consist of a sequence having sufficient complementarity to a target sequence of an RNA molecule to bind selectively to the target sequence.
  • the scaffolding sequence may guide a fusion protein to the RNA molecule.
  • a sequence having sufficient complementarity to a target sequence of an RNA molecule to bind selectively to the target sequence has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96, 97%, 98%, 99%, or any percentage identity in between to the target sequence.
  • a sequence having sufficient complementarity to a target sequence of an RNA molecule to bind selectively to the target sequence has 100% identity the target sequence.
  • scaffolding sequences of the disclosure comprise or consist of a sequence that binds to a first RNA binding protein or a second RNA binding protein of a fusion protein of the disclosure.
  • scaffolding sequences of the disclosure comprise a secondary structure or a tertiary structure.
  • Exemplary secondary structures include, but are not limited to, a helix, a stem loop, a bulge, a tetraloop and a pseudoknot.
  • Exemplary tertiary structures include, but are not limited to, an A-form of a helix, a B-form of a helix, and a Z-form of a helix.
  • Exemplary tertiary structures include, but are not limited to, a twisted or helicized stem loop. Exemplary tertiary structures include, but are not limited to, a twisted or helicized pseudoknot.
  • scaffolding sequences of the disclosure comprise at least one secondary structure or at least one tertiary structure. In some embodiments, scaffolding sequences of the disclosure comprise one or more secondary structure(s) or one or more tertiary structure(s).
  • a guide RNA or a portion thereof selectively binds to a tetraloop motif in an RNA molecule of the disclosure.
  • a target sequence of an RNA molecule comprises a tetraloop motif.
  • the tetraloop motif is a“GRNA” motif comprising or consisting of one or more of the sequences of GAAA, GUGA, GCAA or GAGA.
  • a guide RNA or a portion thereof that binds to a target sequence of an RNA molecule hybridizes to the target sequence of the RNA molecule.
  • a guide RNA or a portion thereof that binds to a first RNA binding protein or to a second RNA binding protein covalently binds to the first RNA binding protein or to the second RNA binding protein.
  • a guide RNA or a portion thereof that binds to a first RNA binding protein or to a second RNA binding protein non-covalently binds to the first RNA binding protein or to the second RNA binding protein.
  • a guide RNA or a portion thereof comprises or consists of between 10 and 100 nucleotides, inclusive of the endpoints.
  • a spacer sequence of the disclosure comprises or consists of between 10 and 30 nucleotides, inclusive of the endpoints.
  • a spacer sequence of the disclosure comprises or consists of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.
  • the spacer sequence of the disclosure comprises or consists of 20 nucleotides.
  • the spacer sequence of the disclosure comprises or consists of 21 nucleotides.
  • the spacer sequence of the disclosure comprises or consists of 26 nucleotides.
  • an unprocessed guide RNA is 36nt of DR followed by 30-32 nt of spacer.
  • the guide RNA is processed (truncated/modified) by Cas 13d itself or other RNases into the shorter "mature" form.
  • an unprocessed guide sequence is about, or at least about 30, 35, 40, 45, 50, 55, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, or more nucleotides (nt) in length.
  • a processed guide sequence is about 44 to 60 nt (such as 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 nt).
  • an unprocessed spacer is about 28-32 nt long (such as 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nt) while the mature (processed) spacer can be about 10 to 30 nt, 10 to 25 nt, 14 to 25 nt, 20 to 22 nt, or 14-30 nt (such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
  • an unprocessed DR is about 36 nt (such as 30,
  • a DR sequence is truncated by 1-10 nucleotides (such as 1, 2, 3, 4, 5, 6, 7, 8, 9, ot 10 nucleotides at e.g., the 5’ end in order to be expressed as mature pre-processed guide RNAs.
  • a scaffold sequence such as e.g., a Cas9 scaffold sequence, of the disclosure comprises or consists of between 10 and 100 nucleotides, inclusive of the endpoints.
  • a scaffold sequence of the disclosure comprises or consists of 30, 35, 40, 45, 50, 55, 60, 65, 70, 76, 80, 87, 90, 95, 100 or any number of nucleotides in between.
  • the scaffold sequence of the disclosure comprises or consists of between 85 and 95 nucleotides, inclusive of the endpoints.
  • the scaffold sequence of the disclosure comprises or consists of 85 nucleotides.
  • the scaffold sequence of the disclosure comprises or consists of 90 nucleotides. In some embodiments, the scaffold sequence of the disclosure comprises or consists of 93 nucleotides. In some embodiments of the compositions of the disclosure, the sequence comprising the gRNA further comprises a scaffold sequence that specifically binds to the first RNA binding protein. In some embodiments, the scaffold sequence comprises a stem- loop structure. In some embodiments, the scaffold sequence comprises or consists of 90 nucleotides. In some embodiments, the scaffold sequence comprises or consists of 93 nucleotides. In some embodiments, the scaffold sequence comprises or consists of the sequence
  • the scaffold sequence comprises or consists of the sequence
  • the scaffold sequence comprises or consists of the sequence
  • a guide RNA or a portion thereof does not comprise a nuclear localization sequence (NLS).
  • NLS nuclear localization sequence
  • a guide RNA or a portion thereof does not comprise a sequence complementary to a protospacer adjacent motif (PAM).
  • PAM protospacer adjacent motif
  • Therapeutic or pharmaceutical compositions of the disclosure do not comprise a PAMmer oligonucleotide.
  • optionally, non-therapeutic or non- pharmaceutical compositions may comprise a PAMmer oligonucleotide.
  • PAMmer refers to an oligonucleotide comprising a PAM sequence that is capable of interacting with a guide nucleotide sequence-programmable RNA binding protein.
  • PAMmers are described in O’Connell et al. Nature 516, pages 263-266 (2014), incorporated herein by reference.
  • a PAM sequence refers to a protospacer adjacent motif comprising about 2 to about 10 nucleotides.
  • PAM sequences are specific to the guide nucleotide sequence-programmable RNA binding protein with which they interact and are known in the art. For example, Streptococcus pyogenes PAM has the sequence 5’-NGG-3’, where“N” is any nucleobase followed by two guanine (“G”) nucleobases.
  • a guide RNA or a portion thereof comprises a sequence complementary to a protospacer flanking sequence (PFS).
  • the first RNA binding protein may comprise a sequence isolated or derived from a Casl3 protein. In some embodiments, including those wherein a guide RNA or a portion thereof comprises a sequence complementary to a PFS, the first RNA binding protein may comprise a sequence encoding a Casl3 protein or an RNA- binding portion thereof. In some embodiments, the guide RNA or a portion thereof does not comprise a sequence complementary to a PFS.
  • guide RNA sequence of the disclosure comprises a promoter sequence to drive expression of the guide RNA.
  • a vector comprising a guide RNA sequence of the disclosure comprises a promoter sequence to drive expression of the guide RNA.
  • the promoter to drive expression of the guide RNA is a constitutive promoter.
  • the promoter sequence is an inducible promoter.
  • the promoter is a sequence is a tissue-specific and/or cell-type specific promoter.
  • the promoter is a hybrid or a recombinant promoter.
  • the promoter is a promoter capable of expressing the guide RNA in a mammalian cell. In some embodiments, the promoter is a promoter capable of expressing the guide RNA in a human cell. In some embodiments, the promoter is a promoter capable of expressing the guide RNA and restricting the guide RNA to the nucleus of the cell. In some embodiments, the promoter is a human RNA polymerase promoter or a sequence isolated or derived from a sequence encoding a human RNA polymerase promoter. In some embodiments, the promoter is a U6 promoter or a sequence isolated or derived from a sequence encoding a U6 promoter.
  • the promoter is a human tRNA promoter or a sequence isolated or derived from a sequence encoding a human tRNA promoter. In some embodiments, the promoter is a human valine tRNA promoter or a sequence isolated or derived from a sequence encoding a human valine tRNA promoter.
  • a promoter to drive expression of the guide RNA further comprises a regulatory element.
  • a vector comprising a promoter sequence to drive expression of the guide RNA further comprises a regulatory element.
  • a regulatory element enhances expression of the guide RNA.
  • Exemplary regulatory elements include, but are not limited to, an enhancer element, an intron, an exon, or a combination thereof.
  • a vector of the disclosure comprises one or more of a sequence encoding a guide RNA, a promoter sequence to drive expression of the guide RNA and a sequence encoding a regulatory element. In some embodiments of the compositions of the disclosure, the vector further comprises a sequence encoding a fusion protein of the disclosure.
  • gRNAs correspond to target RNA molecules and an RNA-guided RNA binding protein.
  • the gRNAs correspond to an RNA-guided RNA binding fusion protein, wherein the fusion protein comprises first and second RNA binding proteins.
  • the sequence encoding the first RNA binding protein is positioned 5’ of the sequence encoding the second RNA binding protein.
  • the sequence encoding the first RNA binding protein is positioned 3’ of the sequence encoding the second RNA binding protein.
  • the sequence encoding the first RNA binding protein comprises a sequence isolated or derived from a protein capable of binding an RNA molecule. In some embodiments, the sequence encoding the first RNA binding protein comprises a sequence isolated or derived from a protein capable of selectively binding an RNA molecule and not binding a DNA molecule, a mammalian DNA molecule or any DNA molecule. In some embodiments, the sequence encoding the first RNA binding protein comprises a sequence isolated or derived from a protein capable of binding an RNA molecule and inducing a break in the RNA molecule.
  • the sequence encoding the first RNA binding protein comprises a sequence isolated or derived from a protein capable of binding an RNA molecule, inducing a break in the RNA molecule, and not binding a DNA molecule, a mammalian DNA molecule or any DNA molecule. In some embodiments, the sequence encoding the first RNA binding protein comprises a sequence isolated or derived from a protein capable of binding an RNA molecule, inducing a break in the RNA molecule, and neither binding nor inducing a break in a DNA molecule, a mammalian DNA molecule or any DNA molecule. [080] In some embodiments of the compositions of the disclosure, the sequence encoding the first RNA binding protein comprises a sequence isolated or derived from a protein with no DNA nuclease activity.
  • the sequence encoding the first RNA binding protein comprises a sequence isolated or derived from a protein having DNA nuclease activity, wherein the DNA nuclease activity does not induce a break in a DNA molecule, a mammalian DNA molecule or any DNA molecule when a composition of the disclosure is contacted to an RNA molecule or introduced into a cell or into a subject of the disclosure.
  • the sequence encoding the first RNA binding protein comprises a sequence isolated or derived from a protein having DNA nuclease activity, wherein the DNA nuclease activity is inactivated and wherein the DNA nuclease activity does not induce a break in a DNA molecule, a mammalian DNA molecule or any DNA molecule when a composition of the disclosure is contacted to an RNA molecule or introduced into a cell or into a subject of the disclosure.
  • the sequence encoding the first RNA binding protein comprises a mutation that inactivates or decreases the DNA nuclease activity to a level at which the DNA nuclease activity does not induce a break in a DNA molecule, a mammalian DNA molecule or any DNA molecule when a composition of the disclosure is contacted to an RNA molecule or introduced into a cell or into a subject of the disclosure.
  • the sequence encoding the first RNA binding protein comprises a mutation that inactivates or decreases the DNA nuclease activity and the mutation comprises one or more of a substitution, inversion, transposition, insertion, deletion, or any combination thereof to a nucleic acid sequence or amino acid sequence encoding the first RNA binding protein or a nuclease domain thereof.
  • the sequence encoding the RNA-guided RNA binding protein disclosed herein comprises a sequence isolated or derived from a CRISPR Cas protein.
  • the CRISPR Cas protein comprises a Type II CRISPR Cas protein.
  • the Type II CRISPR Cas protein comprises a Cas9 protein.
  • Exemplary Cas9 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, a bacteria or an archaea.
  • Exemplary Cas9 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, Streptococcus pyogenes , Haloferax mediteranii , Mycobacterium tuberculosis , Francisella tularensis subsp. novicida , Pasteurella multocida , Neisseria meningitidis , Campylobacter jejune , Streptococcus thermophilus , Campylobacter lari CF89- 12, Mycoplasma gallisepticum str. F, Nitratifractor salsuginis str. DSM 16511,
  • Parvibaculum lavamentivorans Parvibaculum lavamentivorans, Roseburia intestinalis, Neisseria cinerea, a
  • Gluconacetobacter diazotrophicus an Azospirillum B510, a Sphaerochaeta globus str. Buddy, Flavobacterium columnare, Fluviicola taffensis, Bacteroides coprophilus,
  • Mycoplasma mobile Lactobacillus farciminis, Streptococcus pasteurianus, Lactobacillus johnsonii, Staphylococcus pseudintermedius, Filifactor alocis, Treponema denticola, Legionella pneumophila str. Paris, Sutterella wadsworthensis, Corynebacter diphtherias, Streptococcus aureus, and Francisella novicida.
  • Exemplary wild type S. pyogenes Cas9 proteins of the disclosure may comprise or consist of the amino acid sequence of
  • Nuclease inactivated S. pyogenes Cas9 proteins may comprise a substitution of an Alanine (A) for an Aspartic Acid (D) at position 10 and an alanine (A) for a Histidine (H) at position 840.
  • Exemplary nuclease inactivated S. pyogenes Cas9 proteins of the disclosure may comprise or consist of the amino acid sequence (D10A and H840A bolded and underlined) of (EQ ID NO: 417.
  • Nuclease inactivated S. pyogenes Cas9 proteins may comprise deletion of a RuvC nuclease domain or a portion thereof, an HNH domain, a DNAse active site, a bba-metal fold or a portion thereof comprising a DNAse active site or any combination thereof.
  • exemplary Cas9 proteins or portions thereof may comprise or consist of the following amino acid sequences.
  • the Cas9 protein can be S. pyogenes Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 418.
  • the Cas9 protein can be S. aureus Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 419.
  • the Cas9 protein can be S. thermophiles CRISPR1 Cas9 and may comprise or consist of the amino acid sequence ofSEQ ID NO: 420.
  • the Cas9 protein can be N. meningitidis Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 421.
  • the Cas9 protein can be Parvibaculum. lavamentivorans Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 422. [093] In some embodiments the Cas9 protein can be Corynebacter diphtheria Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 423.
  • the Cas9 protein can be Streptococcus pasteurianus Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 424.
  • the Cas9 protein can be Neisseria cinerea Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 425.
  • the Cas9 protein can be Campylobacter lari Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 426.
  • the Cas9 protein can be T. denticola Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 427.
  • the Cas9 protein can be S. mutans Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 428.
  • the Cas9 protein can be S. thermophilus CRISPR 3 Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 429.
  • the Cas9 protein can be C. jejuni Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 430.
  • the Cas9 protein can be P. multocida Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 431.
  • the Cas9 protein can be F. novicida Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 432.
  • the Cas9 protein can be Lactobacillus buchneri Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 433.
  • the Cas9 protein can be Listeria innocua Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 434.
  • the Cas9 protein can be L. pneumophilia Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 435.
  • the Cas9 protein can be N lactamica Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 436.
  • the Cas9 protein can be N meningitides Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 437.
  • the Cas9 protein can be B. longum Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 438.
  • the Cas9 protein can be A. muciniphila Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 439.
  • the Cas9 protein can be O. laneus Cas9 and may comprise or consist of the amino acid sequence of SEQ ID NO: 440.
  • the sequence encoding the first RNA binding protein comprises a sequence isolated or derived from a CRISPR Cas protein or portion thereof.
  • the CRISPR Cas protein comprises a Type V CRISPR Cas protein.
  • the Type V CRISPR Cas protein comprises a Cpfl protein.
  • Exemplary Cpfl proteins of the disclosure may be isolated or derived from any species, including, but not limited to, a bacteria or an archaea.
  • Exemplary Cpfl proteins of the disclosure may be isolated or derived from any species, including, but not limited to, Francisella tularensis subsp. novicida, Acidaminococcus sp. BV3L6 and Lachnospiraceae bacterium sp. ND2006.
  • Exemplary Cpfl proteins of the disclosure may be nuclease inactivated.
  • Exemplary wild type Francisella tularensis subsp. Novicida Cpfl (FnCpfl) proteins of the disclosure may comprise or consist of the amino acid sequence of SEQ ID NO: 441.
  • Exemplary wild typ Q Lachnospiraceae bacterium sp. ND2006 Cpfl (LbCpfl) proteins of the disclosure may comprise or consist of the amino acid sequence of SEQ ID NO: 442.
  • Exemplary wild type Acidaminococcus sp. BV3L6 Cpfl (AsCpfl) proteins of the disclosure may comprise or consist of the amino acid sequence of SEQ ID NO: 443.
  • the sequence encoding the RNA binding protein comprises a sequence isolated or derived from a CRISPR Cas protein.
  • the CRISPR Cas protein comprises a Type VI CRISPR Cas protein or portion thereof.
  • the Type VI CRISPR Cas protein comprises a Casl3 protein or portion thereof.
  • Exemplary Casl3 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, a bacteria or an archaea.
  • Exemplary Casl3 proteins of the disclosure may be isolated or derived from any species, including, but not limited to, Leptotrichia wadei, Listeria seeligeri serovar l/2b (strain ATCC 35967 / DSM 20751 / CIP 100100 / SLCC 3954), Lachnospiraceae bacterium, Clostridium aminophilum DSM 10710, Carnobacterium gallinarum DSM 4847, Paludibacter propionicigenes WB4, Listeria weihenstephanensis FSL R9-0317, Listeria
  • Exemplary Casl3 proteins of the disclosure may be DNA nuclease inactivated.
  • Exemplary Casl3 proteins of the disclosure include, but are not limited to, Casl3a, Casl3b, Casl3c, Casl3d and orthologs thereof.
  • Exemplary Casl3b proteins of the disclosure include, but are not limited to, subtypes 1 and 2 referred to herein as Csx27 and Csx28, respectively.
  • Exemplary Casl3a proteins include, but are not limited to:
  • Exemplary wild type Casl3a proteins of the disclosure may comprise or consist of the amino acid sequence of SEQ ID NO: 459.
  • Exemplary Casl3b proteins include, but are not limited to:
  • Exemplary wild type Bergeyella zoohelcum ATCC 43767 Casl3b (BzCasl3b) proteins of the disclosure may comprise or consist of the amino acid sequence of SEQ ID NO: 460.
  • the sequence encoding the RNA binding protein comprises a sequence isolated or derived from a Casl3d protein.
  • Casl3d is an effector of the type VI-D CRISPR-Cas systems.
  • the Casl3d protein is an RNA-guided RNA endonuclease enzyme that can cut or bind RNA.
  • the Casl3d protein can include one or more higher eukaryotes and prokaryotes nucleotide-binding (HEPN) domains.
  • the Casl3d protein can include either a wild-type or mutated HEPN domain.
  • the Casl3d protein includes a mutated HEPN domain that cannot cut RNA but can process guide RNA.
  • the Casl3d protein does not require a protospacer flanking sequence. Also see WO Publication No. WO2019/040664 & US2019/0062724, which is incorporated herein by reference in its entirety, for further examples and sequences of Casl3d protein, without limitation.
  • Casl3d sequences of the disclosure include without limitation SEQ ID NOS: 1-296 of WO 2019/040664, so numbered herein and included herewith.
  • SEQ ID NO: 1 is an exemplary Casl3d sequence from Eubacterium siraeum containing a HEP site.
  • SEQ ID NO: 2 is an exemplary Casl3d sequence from Eubacterium siraeum containing a mutated HEPN site.
  • SEQ ID NO: 3 is an exemplary Casl3d sequence from uncultured
  • Ruminococcus sp. containing a HEPN site Ruminococcus sp. containing a HEPN site.
  • SEQ ID NO: 4 is an exemplary Casl3d sequence from uncultured Ruminococcus sp. containing a mutated HEPN site.
  • SEQ ID NO: 5 is an exemplary Casl3d sequence from
  • SEQ ID NO: 6 is an exemplary Casl3d sequence from
  • SEQ ID NO: 7 is an exemplary Casl3d sequence from
  • SEQ ID NO: 8 is an exemplary Casl3d sequence from
  • SEQ ID NO: 9 is an exemplary Casl3d sequence from
  • SEQ ID NO: 10 is an exemplary Casl3d sequence from
  • SEQ ID NO: 11 is an exemplary Casl3d sequence from
  • SEQ ID NO: 12 is an exemplary Casl3d sequence from human gut metagenome.
  • SEQ ID NO: 13 is an exemplary Casl3d sequence from
  • SEQ ID NO: 14 is an exemplary Casl3d sequence from
  • SEQ ID NO: 15 is an exemplary Casl3d sequence from
  • SEQ ID NO: 16 is an exemplary Casl3d sequence from
  • SEQ ID NO: 17 is an exemplary Casl3d sequence from
  • SEQ ID NO: 18 is an exemplary Casl3d sequence from
  • SEQ ID NO: 19 is an exemplary Casl3d sequence from
  • SEQ ID NO: 20 is an exemplary Casl3d sequence from
  • SEQ ID NO: 21 is an exemplary Casl3d sequence from Gut_metagenome_contigl2963000286.
  • SEQ ID NO: 22 is an exemplary Casl3d sequence from Gut_metagenome_contig2952000470.
  • SEQ ID NO: 23 is an exemplary Casl3d sequence from Gut_metagenome_contig451000394.
  • SEQ ID NO: 24 is an exemplary Casl3d sequence from Eubacterium_siraeum_DSM_15702.
  • SEQ ID NO: 25 is an exemplary Casl3d sequence from gut_metagenome_P 19E0k2120140920, _c369000003.
  • SEQ ID NO: 26 is an exemplary Casl3d sequence from Gut_metagenome_contig7593000362.
  • SEQ ID NO: 27 is an exemplary Casl3d sequence from Gut_metagenome_contigl2619000055.
  • SEQ ID NO: 28 is an exemplary Casl3d sequence from Gut_metagenome_contigl405000151.
  • SEQ ID NO: 29 is an exemplary Casl3d sequence from Chicken gut metagenome c298474.
  • SEQ ID NO: 30 is an exemplary Casl3d sequence from Gut_metagenome_contigl516000227.
  • SEQ ID NO: 31 is an exemplary Casl3d sequence from Gut_metagenome_contigl838000319.
  • SEQ ID NO: 32 is an exemplary Casl3d sequence from Gut_metagenome_contigl3123000268.
  • SEQ ID NO: 33 is an exemplary Casl3d sequence from Gut_metagenome_contig5294000434.
  • SEQ ID NO: 34 is an exemplary Casl3d sequence from Gut_metagenome_contig6415000192.
  • SEQ ID NO: 35 is an exemplary Casl3d sequence from Gut_metagenome_contig6144000300.
  • SEQ ID NO: 36 is an exemplary Casl3d sequence from Gut_metagenome_contig9118000041.
  • SEQ ID NO: 37 is an exemplary Casl3d sequence from
  • SEQ ID NO: 38 is an exemplary Casl3d sequence from
  • SEQ ID NO: 39 is an exemplary Casl3d sequence from
  • SEQ ID NO: 40 is an exemplary Casl3d sequence from
  • SEQ ID NO: 41 is an exemplary Casl3d sequence from
  • SEQ ID NO: 42 is an exemplary Casl3d sequence from
  • SEQ ID NO: 43 is an exemplary Casl3d sequence from
  • SEQ ID NO: 44 is an exemplary Casl3d sequence from
  • SEQ ID NO: 45 is an exemplary Casl3d sequence from
  • SEQ ID NO: 46 is an exemplary Casl3d sequence from
  • SEQ ID NO: 47 is an exemplary Casl3d sequence from human gut metagenome.
  • SEQ ID NO: 48 is an exemplary Casl3d sequence from
  • SEQ ID NO: 49 is an exemplary Casl3d sequence from
  • SEQ ID NO: 50 is an exemplary Casl3d sequence from
  • SEQ ID NO: 51 is an exemplary Casl3d sequence from
  • SEQ ID NO: 52 is an exemplary Casl3d sequence from Gut_metagenome_contigll400000031.
  • SEQ ID NO: 53 is an exemplary Casl3d sequence from Gut_metagenome_contig7940000191.
  • SEQ ID NO: 54 is an exemplary Casl3d sequence from Gut_metagenome_contig6049000251.
  • SEQ ID NO: 55 is an exemplary Casl3d sequence from Gut_metagenome_contigll37000500.
  • SEQ ID NO: 56 is an exemplary Casl3d sequence from Gut_metagenome_contig9368000105.
  • SEQ ID NO: 57 is an exemplary Casl3d sequence from Gut_metagenome_contig546000275.
  • SEQ ID NO: 58 is an exemplary Casl3d sequence from Gut_metagenome_contig7216000573.
  • SEQ ID NO: 59 is an exemplary Casl3d sequence from Gut_metagenome_contig4806000409.
  • SEQ ID NO: 60 is an exemplary Casl3d sequence from Gut_metagenome_contigl0762000480.
  • SEQ ID NO: 61 is an exemplary Casl3d sequence from Gut_metagenome_contig4114000374.
  • SEQ ID NO: 62 is an exemplary Casl3d sequence from Ruminococcus_flavefaciens_FDl .
  • SEQ ID NO: 63 is an exemplary Casl3d sequence from Gut_metagenome_contig7093000170.
  • SEQ ID NO: 64 is an exemplary Casl3d sequence from Gut_metagenome_contigll 113000384.
  • SEQ ID NO: 65 is an exemplary Casl3d sequence from Gut_metagenome_contig6403000259.
  • SEQ ID NO: 66 is an exemplary Casl3d sequence from Gut_metagenome_contig6193000124.
  • SEQ ID NO: 67 is an exemplary Casl3d sequence from Gut_metagenome_contig721000619.
  • SEQ ID NO: 68 is an exemplary Casl3d sequence from
  • SEQ ID NO: 69 is an exemplary Casl3d sequence from
  • SEQ ID NO: 70 is an exemplary Casl3d sequence from Ruminococcus_albus.
  • SEQ ID NO: 71 is an exemplary Casl3d sequence from
  • SEQ ID NO: 72 is an exemplary Casl3d sequence from
  • SEQ ID NO: 73 is an exemplary Casl3d sequence from
  • SEQ ID NO: 74 is an exemplary Casl3d sequence from
  • SEQ ID NO: 75 is an exemplary Casl3d sequence from
  • SEQ ID NO: 76 is an exemplary Casl3d sequence from
  • SEQ ID NO: 77 is an exemplary Casl3d sequence from
  • SEQ ID NO: 78 is an exemplary Casl3d sequence from
  • SEQ ID NO: 79 is an exemplary Casl3d sequence from
  • SEQ ID NO: 80 is an exemplary Casl3d sequence from
  • SEQ ID NO: 81 is an exemplary Casl3d sequence from
  • SEQ ID NO: 82 is an exemplary Casl3d sequence from
  • SEQ ID NO: 83 is an exemplary Casl 3d sequence from gut_metagenome_Pl E0k2120140920_cI000078.
  • SEQ ID NO: 84 is an exemplary Casl 3d sequence from
  • SEQ ID NO: 85 is an exemplary Casl 3d sequence from
  • SEQ ID NO: 86 is an exemplary Casl 3d sequence from
  • SEQ ID NO: 87 is an exemplary Casl 3d sequence from
  • SEQ ID NO: 88 is an exemplary Casl 3d sequence from
  • SEQ ID NO: 89 is an exemplary Casl 3d sequence from
  • SEQ ID NO: 90 is an exemplary Casl 3d sequence from
  • SEQ ID NO: 91 is an exemplary Casl3d sequence from
  • SEQ ID NO: 92 is an exemplary Casl 3d sequence from
  • SEQ ID NO: 93 is an exemplary Casl 3d sequence from
  • SEQ ID NO: 94 is an exemplary Casl 3d sequence from M36_Uncultured_
  • Eub acterium sp T S28_c40956 Eub acterium sp T S28_c40956.
  • SEQ ID NO: 95 is an exemplary Casl 3d sequence from
  • SEQ ID NO: 96 is an exemplary Casl 3d sequence from human gut metagenome.
  • SEQ ID NO: 97 is an exemplary Casl 3d sequence from MIO gut metagenome P25C90k2120 1 40920 c2800004 1.
  • SEQ ID NO: 98 is an exemplary Casl3d sequence from 30 Ml I_gut_metagenome_P25C7k2120140920_c4078000105.
  • SEQ ID NO: 99 is an exemplary Casl3d sequence from
  • SEQ ID NO: 100 is an exemplary Casl3d sequence from M13_gut_metagenome _P23C7k2120140920 _c3000067.
  • SEQ ID NO: 101 is an exemplary Cas 13d sequence from
  • SEQ ID NO: 102 is an exemplary Casl3d sequence from
  • SEQ ID NO: 103 is an exemplary Casl3d sequence from M7_gut_metagenome _P38C7k2120 1 40920_c484 1 000003.
  • SEQ ID NO: 104 is an exemplary Casl3d sequence from
  • SEQ ID NO: 105 is an exemplary Casl3d sequence.
  • SEQ ID NO: 106 is an exemplary Casl3d consensus sequence.
  • SEQ ID NO: 107 is an exemplary Casl3d sequence from M18_gut_metagenome _P22EOk2120140920_c3395000078.
  • SEQ ID NO: 108 is an exemplary Cas 13d sequence from
  • SEQ ID NO: 109 is an exemplary Casl3d sequence from
  • SEQ ID NO: 110 is an exemplary Casl3d sequence from gut_metagenome_Pl lE90k2120 1 40920_c43000123.
  • SEQ ID NO: 111 is an exemplary Cas 13d sequence from
  • SEQ ID NO: 112 is an exemplary Casl3d sequence from
  • SEQ ID NO: 113 is an exemplary Casl3d sequence from
  • SEQ ID NO: 114 is an exemplary human codon optimized Eubacterium siraeum Cast 3d nucleic acid sequence.
  • SEQ ID NO: 115 is an exemplary human codon optimized Eubacterium siraeum Casl3d nucleic acid sequence with a mutant HEPN domain.
  • SEQ ID NO: 116 is an exemplary human codon-optimized Eubacterium siraeum Casl3d nucleic acid sequence with N-terminal NLS.
  • SEQ ID NO: 117 is an exemplary human codon-optimized Eubacterium siraeum Casl3d nucleic acid sequence with N- and C-terminal NLS tags.
  • SEQ ID NO: 118 is an exemplary human codon-optimized uncultured
  • SEQ ID NO: 119 is an exemplary human codon-optimized uncultured
  • SEQ ID NO: 120 is an exemplary human codon-optimized uncultured
  • SEQ ID NO: 121 is an exemplary human codon-optimized uncultured
  • SEQ ID NO: 122 is an exemplary human codon-optimized uncultured
  • Ruminococcus flavefaciens FD1 Casl3d nucleic acid sequence Ruminococcus flavefaciens FD1 Casl3d nucleic acid sequence.
  • SEQ ID NO: 123 is an exemplary human codon-optimized uncultured
  • SEQ ID NO: 124 is an exemplary Casl3d nucleic acid sequence from
  • SEQ ID NO: 125 is an exemplary Casl3d nucleic acid sequence from
  • SEQ ID NO: 126 is an exemplary Casl3d nucleic acid sequence from
  • SEQ ID NO: 127 is an exemplary Casl3d nucleic acid sequence from
  • SEQ ID NO: 128 is an exemplary Casl3d nucleic acid sequence from
  • SEQ ID NO: 129 is an exemplary consensus DR nucleic acid sequence for E. siraeum Casl3d.
  • SEQ ID NO: 130 is an exemplary consensus DR nucleic acid sequence for Rum. Sp. Casl3d.
  • SEQ ID NO: 131 is an exemplary consensus DR nucleic acid sequence for Rum. Flavefaciens strain XPD3002 Casl3d ( CasRx).
  • SEQ ID NOS: 132-137 are exemplary consensus DR nucleic acid sequences.
  • SEQ ID NO: 138 is an exemplary 50% consensus sequence for seven full-length Casl3d orthologues.
  • SEQ ID NO: 139 is an exemplary Casl3d nucleic acid sequence from Gut metagenome P1EO.
  • SEQ ID NO: 140 is an exemplary Casl3d nucleic acid sequence from Anaerobic digester.
  • SEQ ID NO: 141 is an exemplary Casl3d nucleic acid sequence from
  • SEQ ID NO: 142 is an exemplary human codon-optimized uncultured Gut metagenome P1EO Casl3d nucleic acid sequence.
  • SEQ ID NO: 143 is an exemplary human codon-optimized Anaerobic Digester Casl3d nucleic acid sequence.
  • SEQ ID NO: 144 is an exemplary human codon-optimized Ruminococcus flavefaciens XPD Casl3d nucleic acid sequence.
  • SEQ ID NO: 145 is an exemplary human codon-optimized Ruminococcus albus Casl3d nucleic acid sequence.
  • SEQ ID NO: 146 is an exemplary processing of the Ruminococcus sp. CAG:57 CRISPR array.
  • SEQ ID NO: 147 is an exemplary Casl3d protein sequence from contig emb I OB YHO 1003037.1, human gut metagenome sequence (also found in WGS contigs emb IOBXZ01000094. 1
  • SEQ ID NO: 148 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 147).
  • SEQ ID NO: 149 is an exemplary Casl3d protein sequence from contig tpg
  • SEQ ID NOS: 150-152 are exemplary consensus DR nucleic acid sequences (goes with SEQ ID NO: 149).
  • SEQ ID NO: 153 is an exemplary Casl3d protein sequence from contig tpg
  • SEQ ID NO: 154 is an exemplary consensus DRnucleic acid sequence (goes with SEQ ID NO: 153).
  • SEQ ID NO: 155 is an exemplary Casl3d protein sequence from contig
  • OGZC01000639.1 human gut metagenome assembly
  • SEQ ID NOS: 156-177 are exemplary consensus DR nucleic acid sequences (goes with SEQ ID NO: 155).
  • SEQ ID NO: 158 is an exemplary Casl3d protein sequence from contig emb I OHBMO 1000764.1 (human gut metagenome assembly).
  • SEQ ID NO: 159 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 158).
  • SEQ ID NO: 160 is an exemplary Casl3d protein sequence from contig emb
  • SEQ ID NO: 161 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 160).
  • SEQ ID NO: 162 is an exemplary Casl3d protein sequence from contig emblOGDFOl 008514.1
  • SEQ ID NO: 163 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 162).
  • SEQ ID NO: 164 is an exemplary Casl3d protein sequence from contig emb
  • SEQ ID NO: 165 is an exemplary consensus DRnucleic acid sequence (goes with SEQ ID NO: 164).
  • SEQ ID NO: 166 is an exemplary Casl3d protein sequence from contig NFIR01000008. 1 (Eubacterium sp. An3, from chicken gut metagenome).
  • SEQ ID NO: 167 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 166).
  • SEQ ID NO: 168 is an exemplary Casl3d protein sequence from contig NFLY01000009.1 (Eubacterium sp. Anl 1 from chicken gut metagenome).
  • SEQ ID NO: 169 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 168).
  • SEQ ID NOS: 171-174 are an exemplary Casl3d motif sequences.
  • SEQ ID NO: 175 is an exemplary Casl3d protein sequence from contig OJMMO 1002900 human gut metagenome sequence.
  • SEQ ID NO: 176 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 175).
  • SEQ ID NO: 177 is an exemplary Casl3d protein sequence from contig ODAI01 1611274.1 gut metagenome sequence.
  • SEQ ID NO: 178 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 177).
  • SEQ ID NO: 179 is an exemplary Casl3d protein sequence from contig OIZXO 1000427.1.
  • SEQ ID NO: 180 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 179).
  • SEQ ID NO: 181 is an exemplary Casl3d protein sequence from contig emb I OCYYO 12889144.1
  • SEQ ID NO: 182 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 181).
  • SEQ ID NO: 183 is an exemplary Casl3d protein sequence from contig OCTW011587266.1
  • SEQ ID NO: 184 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 183).
  • SEQ ID NO: 185 is an exemplary Casl3d protein sequence from contig emb IOGNFO 1009141.1.
  • SEQ ID NO: 186 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 185).
  • SEQ ID NO: 187 is an exemplary Casl3d protein sequence from contig emb IOIEN01002196.1.
  • SEQ ID NO: 188 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 187).
  • SEQ ID NO: 189 is an exemplary Casl3d protein sequence from contig e- k87_l 1092736.
  • SEQ ID NOS: 190-193 are exemplary consensus DR nucleic acid sequences (goes with SEQ ID NO: 189).
  • SEQ ID NO: 194 is an exemplary Casl3d sequence from
  • SEQ ID NOS: 195-197 are exemplary Casl3d motif sequences.
  • SEQ ID NO: 198 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 199 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 198).
  • SEQ ID NO: 200 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 202 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 201 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 200).
  • SEQ ID NO: 202 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 203 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 203
  • SEQ ID NO: 204 is an exemplary Casl3d protein sequence from Ga0129317_l 008067.
  • SEQ ID NO: 205 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 204).
  • SEQ ID NO: 206 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 207 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 206).
  • SEQ ID NO: 208 is an exemplary Casl3d protein sequence from 160582958 _gene49834.
  • SEQ ID NO: 209 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 208).
  • SEQ ID NO: 210 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 211 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 210).
  • SEQ ID NO: 212 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 213 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 212).
  • SEQ ID NO: 214 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 215 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 214).
  • SEQ ID NO: 216 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 217 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 216).
  • SEQ ID NO: 218 is an exemplary Casl3d protein sequence from BMZ-1 1B_GL0037771.
  • SEQ ID NO: 219 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 218).
  • SEQ ID NO: 220 is an exemplary Casl3d protein sequence from BMZ-1 1B_GL0037915.
  • SEQ ID NO: 221 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 220).
  • SEQ ID NO: 222 is an exemplary Casl3d protein sequence from BMZ- 1 1B_GL00696 1 7.
  • SEQ ID NO: 223 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 222).
  • SEQ ID NO: 224 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 225 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 224).
  • SEQ ID NO: 226 is an exemplary Casl3d protein sequence from EYZ- 362B_GL0088915.
  • SEQ ID NO: 227-228 are exemplary consensus DR nucleic acid sequences (goes with SEQ ID NO: 226).
  • SEQ ID NO: 229 is an exemplary Casl3d protein sequence from Ga0099364 10024192.
  • SEQ ID NO: 230 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 229).
  • SEQ ID NO: 231 is an exemplary Casl3d protein sequence from
  • GaOl 87910 10006931 GaOl 87910 10006931.
  • SEQ ID NO: 232 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 231).
  • SEQ ID NO: 233 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 234 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 233).
  • SEQ ID NO: 235 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 236 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 23).
  • SEQ ID NO: 237 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 238 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 237).
  • SEQ ID NO: 239 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 240 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 239).
  • SEQ ID NO: 241 is an exemplary Casl3d protein sequence from 02.UC29- 0_GL0096317.
  • SEQ ID NO: 242 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 241).
  • SEQ ID NO: 243 is an exemplary Casl3d protein sequence from PIG- 014_GL0226364.
  • SEQ ID NO: 244 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 243).
  • SEQ ID NO: 245 is an exemplary Casl3d protein sequence from PIG- 018_GL0023397.
  • SEQ ID NO: 246 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 245).
  • SEQ ID NO: 247 is an exemplary Casl3d protein sequence from PIG- 025_GL0099734.
  • SEQ ID NO: 248 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 247).
  • SEQ ID NO: 249 is an exemplary Casl3d protein sequence from PIG- 028_GL0185479.
  • SEQ ID NO: 250 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 249).
  • SEQ ID NO: 251 is an exemplary Casl3d protein sequence from - Ga0224422_l 0645759.
  • SEQ ID NO: 252 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 251).
  • SEQ ID NO: 253 is an exemplary Casl3d protein sequence from ODAI chimera.
  • SEQ ID NO: 254 is an exemplary consensus DR nucleic acid sequence (goes with SEQ ID NO: 253).
  • SEQ ID NO: 255 is an HEPN motif.
  • SEQ ID NOs: 256 and 257 are exemplary Casl3d nuclear localization signal amino acid and nucleic acid sequences, respectively.
  • SEQ ID NOs: 258 and 260 are exemplary SY40 large T antigen nuclear localization signal amino acid and nucleic acid sequences, respectively.
  • SEQ ID NO: 259 is a dCas9 target sequence.
  • SEQ ID NO: 261 is an artificial Eubacterium siraeum nCasl array targeting ccdB.
  • SEQ ID NO: 262 is a full 36 nt direct repeat.
  • SEQ ID Nos: 263-266 are spacer sequences.
  • SEQ ID NO: 267 is an artificial uncultured Ruminoccus sp. nCasl array targeting ccdB.
  • SEQ ID NO: 268 is a full 36 nt direct repeat.
  • SEQ ID Nos: 269-272 are spacer sequences.
  • SEQ ID NO: 273 is a ccdB target RNA sequence.
  • SEQ ID Nos: 274-277 are spacer sequences.
  • SEQ ID NO: 278 is a mutated Casl3d sequence, NLS-Ga_0531(trunc)-NLS- HA. This mutant has a deletion of the non-conservedN-terminus.
  • SEQ ID NO: 279 is a mutated Casl3d sequence, NES-Ga_0531(trunc)-NES-HA. This mutant has a deletion of the non-conservedN-terminus.
  • SEQ ID NO: 280 is a full-length Casl3d sequence, NLS-RfxCasl3d-NLS-HA.
  • SEQ ID NO: 281 is a mutated Casl3d sequence, NLS-RfxCasl3d(del5)-NLS- HA. This mutant has a deletion of amino acids 558-587.
  • SEQ ID NO: 282 is a mutated Casl3d sequence, NLS-RfxCasl3d(del5.12)-NLS- HA. This mutant has a deletion of amino acids 558-587 and 953-966.
  • SEQ ID NO: 283 is a mutated Casl3d sequence, NLS-RfxCasl3d(del5.13)-NLS- HA. This mutant has a deletion of amino acids 376-392 and 558-587.
  • SEQ ID NO: 284 is a mutated Casl3d sequence, NLS-
  • RfxCasl3d(del5.12+5.13)-NLS-HA This mutant has a deletion of amino acids 376-392, 558-587, and 953-966.
  • SEQ ID NO: 285 is a mutated Casl3d sequence, NLS-RfxCasl3d(dell3)-NLS- HA. This mutant has a deletion of amino acids 376-392.
  • SEQ ID NO: 286 is an effector sequence used to edit expression of ADAR2.
  • Amino acids 1 to 969 are dRfxCasl3, aa 970 to 991 are an NLS sequence, and amino acids 992 to 1378 are ADAR2DD.
  • SEQ ID NO: 287 is an exemplary HIV NES protein sequence.
  • SEQ ID NOS: 288-291 are exemplary Casl3d motif sequences.
  • SEQ ID NO: 292 is Casl3d ortholog sequence MH_4866.
  • SEQ ID NO: 293 is an exemplary Casl3d protein sequence from 037_- _emblOIZA01000315.11
  • SEQ ID NO: 294 is an exemplary Casl3d protein sequence from PIG- 022 GL002635 1.
  • SEQ ID NO: 295 is an exemplary Casl3d protein sequence from PIG- 046_GL0077813.
  • SEQ ID NO: 296 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 297 is an exemplary nuclease-inactive or dead Casl3d
  • SEQ ID NO: 298 is an exemplary Casl3d protein sequence.
  • SEQ ID NO: 299 is an exemplary Casl3d protein sequence from
  • SEQ ID NO: 300 is an exemplary Casl3d direct repeat nucleotide sequence from Casl3d (contig tpg
  • SEQ ID NO: 301 is an exemplary Casl3d protein contig emb
  • SEQ ID NO: 467 is an exemplary CasM protein from Eubacterium siraeum.
  • SEQ ID NO: 468 is an exemplary CasM protein from Ruminococcus sp., isolate 2789STDY5834971.
  • SEQ ID NO: 469 is an exemplary CasM protein from Ruminococcus bicirculans.
  • SEQ ID NO: 470 is an exemplary CasM protein from Ruminococcus sp., isolate 2789STDY5608892.
  • SEQ ID NO: 471 is an exemplary CasM protein from Ruminococcus sp. CAG:57.
  • SEQ ID NO: 472 is an exemplary CasM protein from Ruminococcus
  • SEQ ID NO: 473 is an exemplary CasM protein from Ruminococcus albus strain KH2T6.
  • SEQ ID NO: 474 is an exemplary CasM protein from Ruminococcus flavefaciens strain XPD3002.
  • SEQ ID NO: 475 is an exemplary CasM protein from Ruminococcus sp., isolate 2789STDY5834894.
  • SEQ ID NO: 476 is an exemplary RtcB homolog.
  • SEQ ID NO: 477 is an exemplary WYL from Eubacterium siraeum + C-terminal NLS.
  • SEQ ID NO: 478 is an exemplary WYL from Ruminococcus sp. isolate 2789STDY5834971 + C-term NLS.
  • SEQ ID NO: 479 is an exemplary WYL from Ruminococcus bicirculans + C-term NLS.
  • SEQ ID NO: 480 is an exemplary WYL from Ruminococcus sp. isolate
  • SEQ ID NO: 481 is an exemplary WYL from Ruminococcus sp. CAG:57 + C-term NLS.
  • SEQ ID NO: 482 is an exemplary WYL from Ruminococcus flavefaciens FD-1 + C- term NLS.
  • SEQ ID NO: 483 is an exemplary WYL from Ruminococcus albus strain KH2T6 + C-term NLS.
  • SEQ ID NO: 484 is an exemplary WYL from Ruminococcus flavefaciens strain XPD3002 + C-term NLS.
  • SEQ ID NO: 485 is an exemplary RtcB from Eubacterium siraeum + C-term NLS.
  • Exemplary wild type Casl3d proteins of the disclosure may comprise or consist of the amino acid sequence SEQ ID NO: 92 or SEQ ID NO: 298 (Casl3d protein also known as CasRx) .
  • An exemplary direct repeat sequence of Ruminococcus flavefaciens XPD3002 Casl3d comprises the nucleic acid sequence:
  • AACCCCTACCAACTGGTCGGGGTTTGAAAC (SEQ ID NO: 461).
  • compositions comprising therapeutic replacement genes disclosed herein include any effective gain-or-loss-of-function gene replacement therapies.
  • exemplary therapeutic replacement genes include, without limitation, genes
  • therapeutic replacement genes are codon optimized.
  • the codons relevant to the target site are not codon optimized.
  • the RNA-targeting proteins of the disclosure ensure cleavage of the mutant allele but not cleavage of the transgene or therapeutic replacement gene.
  • Exemplary therapeutic replacement genes and corresponding sequences include, without limitation, the following:
  • Exemplary therapeutic replacement genes may comprise or consist of the amino acid sequence of Rhodopsi n:
  • Exemplary therapeutic replacement genes may comprise or consist of the amino acid sequence of Super Oxide Dismutase 1 :
  • PMP22 Peripheral Myelin Protein 22
  • Exemplary therapeutic replacement genes may comprise or consist of the amino acid sequence of Peripheral Myelin Protein 22:
  • Exemplary therapeutic replacement genes may comprise or consist of the amino acid sequence ofPoly(A) Binding Protein Nuclear 1 :
  • Exemplary therapeutic replacement genes may comprise or consist of the amino acid sequence of Potassium Voltage-Gated Channel Subfamily Q Member 4:
  • Exemplary therapeutic replacement genes may comprise or consist of the amino acid sequence of Clarin 1 : Q )
  • Apolipoprotein 2 (APOE2)
  • Exemplary therapeutic replacement genes may comprise or consist of the amino acid sequence of Apolipoprotein 2:
  • Apolipoprotein 4 (APOE4)
  • Exemplary therapeutic replacement genes may comprise or consist of the amino acid sequence of Apolipoprotein 4:
  • Exemplary therapeutic replacement genes may comprise or consist of the amino acid sequence of Bestrophin-1 :
  • Exemplary therapeutic replacement genes may comprise or consist of the amino acid sequence of Cardiac Myosin-Binding Protein-C:
  • TNNT2 Cardiac Troponin T2
  • Exemplary therapeutic ⁇ replacement genes may comprise or consist of the amino acid sequence of Cardiac Troponin T2:
  • TNNI3 Cardiac Troponin TI3
  • Exemplary therapeutic replacement genes may comprise or consist of the amino acid sequence of Cardiac Troponin TI3 :
  • Exemplary therapeutic replacement genes may comprise or consist of the amino acid sequence of pre-mRNA processing factor 31 (PRPF31) (autosomal dominant Retinitis Pigmentosa):
  • PRPF31 autosomal dominant Retinitis Pigmentosa
  • GNN Progranulin
  • Exemplary therapeutic replacement genes may comprise or consist of the ammo acid sequence of Progranulin (GRN) (frontotemporal dementia (FTD)):
  • a target sequence of an RNA molecule comprises a pathogenic sequence.
  • the target RNA comprises a sequence motif corresponding to the spacer sequence of the guide RNA of the RNA-guided RNA-binding protein.
  • one or more spacer sequences are used to target one or more target sequences.
  • multiple spacers are used to target multiple target RNAs.
  • Such target RNAs can be different taget sites within the same RNA molecule or can be different target sites within different RNA molecules.
  • Spacer sequences can also target non-coding RNA.
  • multiple promoters e.g., pol III promoters
  • target RNA(s) or target sequence motif(s) when the target RNA(s) or target sequence motif(s) is/are targeted and knocked down by the RNA-targeting compositions disclosed herein, then pathogenic or disease-causing gain-or-loss-of-function mutations are destroyed.
  • the sequence motif of the target RNA is a signature of a disease or disorder.
  • a sequence motif of the disclosure may be isolated or derived from a sequence of foreign or exogenous sequence found in a genomic sequence, and therefore translated into an mRNA molecule of the disclosure or a sequence of foreign or exogenous sequence found in an RNA sequence of the disclosure.
  • a target sequence motif of the disclosure may comprise, consist of, be situated by, or be associated with a mutation in an endogenous sequence that causes a disease or disorder.
  • the mutation may comprise or consist of a sequence substitution, inversion, deletion, insertion, transposition, or any combination thereof.
  • a target sequence motif of the disclosure may comprise or consist of a repeated sequence.
  • the repeated sequence may be associated with a
  • MSI microsatellite instability
  • a target sequence motif of the disclosure may comprise or consist of a biomarker.
  • the biomarker may indicate a risk of developing a disease or disorder.
  • the biomarker may indicate a healthy gene (low or no determinable risk of developing a disease or disorder.
  • the biomarker may indicate an edited gene.
  • Exemplary biomarkers include, but are not limited to, single nucleotide polymorphisms (SNPs), sequence variations or mutations, epigenetic marks, splice acceptor sites, exogenous sequences, heterologous sequences, and any combination thereof.
  • SNPs single nucleotide polymorphisms
  • a target sequence motif of the disclosure may comprise or consist of a secondary, tertiary or quaternary structure.
  • the secondary, tertiary or quaternary structure may be endogenous or naturally occurring.
  • the secondary, tertiary or quaternary structure may be induced or non-naturally occurring.
  • the secondary, tertiary or quaternary structure may be encoded by an endogenous, exogenous, or heterologous sequence.
  • a target sequence of an RNA molecule comprises or consists of between 2 and 100 nucleotides or nucleic acid bases, inclusive of the endpoints. In some embodiments, the target sequence of an RNA molecule comprises or consists of between 2 and 50 nucleotides or nucleic acid bases, inclusive of the endpoints. In some embodiments, the target sequence of an RNA molecule comprises or consists of between 2 and 20 nucleotides or nucleic acid bases, inclusive of the endpoints. In some embodiments, the target sequence of an RNA molecule comprises or consists of between 20-30 nucleotides or nucleic acid bases, inclusive of the endpoints. In some embodiments, the target sequence of an RNA molecule comprises or consists of about 26 nucleotides or nucleic acid bases, inclusive of the endpoints.
  • a target sequence of an RNA molecule is continuous.
  • the target sequence of an RNA molecule is discontinuous.
  • the target sequence of an RNA molecule may comprise or consist of one or more nucleotides or nucleic acid bases that are not contiguous because one or more intermittent nucleotides are positioned in between the nucleotides of the target sequence.
  • a target sequence of an RNA molecule is naturally occurring.
  • the target sequence of an RNA molecule is non-naturally occurring.
  • Exemplary non-naturally occurring target sequences may comprise or consist of sequence variations or mutations, chimeric sequences, exogenous sequences, heterologous sequences, chimeric sequences, recombinant sequences, sequences comprising a modified or synthetic nucleotide or any combination thereof.
  • a target sequence of an RNA molecule binds to a guide RNA of the disclosure. In some embodiments of the compositions and methods of the disclosure, one or more target sequences of an RNA molecule binds to one or more guide RNA spacer sequences of the disclosure. [0442] In some embodiments of the compositions and methods of the disclosure, a target sequence of an RNA molecule binds to a first RNA binding protein of the disclosure.
  • a target sequence of an RNA molecule binds to a second RNA binding protein of the disclosure.
  • compositions of the disclosure may comprise a gRNA comprising a spacer sequence that specifically binds to a target sequence of an RNA molecule encoding Rhodospin protein comprising or consisting of about 20-30 nucleotides of the sequence of:
  • Exemplary gRNA spacer sequences of the disclosure that specifically bind to a target sequence of an RNA molecule encoding a Rhodopsin protein of the disclosure may comprise or consist of a nucleic acid having a sequence selected from any one of any one of SEQ ID NO: 619 to SEQ ID NO: 3361.
  • exemplary gRNA spacer sequences and corresponding Rho target sequences comprises or consists of the sequences as deailed in table 1.
  • Table 1 Spacer sequences and target sequences used for Rhodopsin targeting
  • compositions of the disclosure may comprise a gRNA comprising a spacer sequence that specifically binds to a target sequence of an RNA molecule encoding SOD1 protein comprising or consisting of about 20-30 nucleotides of the sequence of:
  • Exemplary gRNA spacer sequences of the disclosure that specifically bind to a target sequence of an RNA molecule encoding a SOD1 protein of the disclosure may comprise or consist of a nucleic acid having a sequence selected from any one of any one of SEQ ID NO: 3362 to SEQ ID NO: 4317.
  • compositions of the disclosure may comprise a gRNA comprising a spacer sequence that specifically binds to a target sequence of an RNA molecule encoding PMP22 protein comprising or consisting of about 20-30 nucleotides of the sequence of:
  • Exemplary gRNA spacer sequences of the disclosure that specifically bind to a target sequence of an RNA molecule encoding a PMP22 protein of the disclosure may comprise or consist of a nucleic acid having a sequence selected from any one of any one of SEQ ID NO: 4318 to SEQ ID NO: 6120.
  • compositions of the disclosure may comprise a gRNA comprising a spacer sequence that specifically binds to a target sequence of an RNA molecule encoding PABPN1 protein comprising or consisting of about 20-30 nucleotides of the sequence of:
  • Exemplary gRNA spacer sequences of the disclosure that specifically bind to a target sequence of an RNA molecule encoding a PABPN1 protein of the disclosure may comprise or consist of a nucleic acid having a sequence selected from any one of any one of SEQ ID NO: 6121 to SEQ ID NO: 9213.
  • Compositions of the disclosure may comprise a gRNA comprising a spacer sequence that specifically binds to a target sequence of an RNA molecule encoding KCNQ4 protein comprising or consisting of about 20-30 nucleotides of the sequence of:
  • Exemplary gRNA spacer sequences of the disclosure that specifically bind to a target sequence of an RNA molecule encoding a KCNQ4 protein of the disclosure may comprise or consist of a nucleic acid having a sequence selected from any one of any one of SEQ ID NO: 9214 to SEQ ID NO: 13512.
  • compositions of the disclosure may comprise a gRNA comprising a spacer sequence that specifically binds to a target sequence of an RNA molecule encoding CLRN1 protein comprising or consisting of about 20-30 nucleotides of the sequence of:
  • Exemplary gRNA spacer sequences of the disclosure that specifically bind to a target sequence of an RNA molecule encoding a CLRN1 protein of the disclosure may comprise or consist of a nucleic acid having a sequence selected from any one of any one of SEQ ID NO: 13513 to SEQ ID NO: 15574.
  • compositions of the disclosure may comprise a gRNA comprising a spacer sequence that specifically binds to a target sequence of an RNA molecule encoding APOE2 protein comprising or consisting of about 20-30 nucleotides of the sequence of:
  • Exemplary gRNA spacer sequences of the disclosure that specifically bind to a target sequence of an RNA molecule encoding a APOE2 protein of the disclosure may comprise or consist of a nucleic acid having a sequence selected from any one of any one of SEQ ID NO: 15575 to SEQ ID NO: 16797.
  • compositions of the disclosure may comprise a gRNA comprising a spacer sequence that specifically binds to a target sequence of an RNA molecule encoding TNNI3 protein comprising or consisting of about 20-30 nucleotides of the sequence of:
  • Exemplary gRNA spacer sequences of the disclosure that specifically bind to a target sequence of an RNA molecule encoding a TNNI3 protein of the disclosure may comprise or consist of a nucleic acid having a sequence selected from any one of any one of
  • compositions of the disclosure may comprise a gRNA comprising a spacer sequence that specifically binds to a target sequence of an RNA molecule encoding BEST1 protein comprising or consisting of about 20-30 nucleotides of the sequence of:
  • Exemplary gRNA spacer sequences of the disclosure that specifically bind to a target sequence of an RNA molecule encoding a BEST1 protein of the disclosure may comprise or consist of a nucleic acid having a sequence selected from any one of any one of
  • compositions of the disclosure may comprise a gRNA comprising a spacer sequence that specifically binds to a target sequence of an RNA molecule encoding
  • MYBPC3 protein comprising or consisting of about 20-30 nucleotides of the sequence of:
  • Exemplary gRNA spacer sequences of the disclosure that specifically bind to a target sequence of an RNA molecule encoding a MYBPC3 protein of the disclosure may comprise or consist of a nucleic acid having a sequence selected from any one of any one of SEQ ID NO: 19801 to SEQ ID NO: 23992.
  • compositions of the disclosure may comprise a gRNA comprising a spacer sequence that specifically binds to a target sequence of an RNA molecule encoding TNNT2 protein comprising or consisting of about 20-30 nucleotides of the sequence of:
  • Exemplary gRNA spacer sequences of the disclosure that specifically bind to a target sequence of an RNA molecule encoding a TNNT2 protein of the disclosure may comprise or consist of a nucleic acid having a sequence selected from any one of any one of SEQ ID NO: 23993 to SEQ ID NO: 25329.
  • compositions of the disclosure may comprise a gRNA comprising a spacer sequence that specifically binds to a target sequence of an RNA molecule encoding pre- mRNA processing factor 31 (PRPF31) protein comprising or consisting of about 20-30 nucleotides of the sequence of:
  • PRPF31 pre- mRNA processing factor 31
  • Exemplary gRNA spacer sequences of the disclosure that specifically bind to a target sequence of an RNA molecule encoding a PRPF31 protein of the disclosure may comprise or consist of a nucleic acid having a sequence selected from any one of any one of SEQ ID NO: 25330 to SEQ ID NO: 27137.
  • compositions of the disclosure may comprise a gRNA comprising a spacer sequence that specifically binds to a target sequence of an RNA molecule encoding Progranulin (GRN) protein comprising or consisting of about 20-30 nucleotides of the sequence of:
  • GNN Progranulin
  • Exemplary gRNA spacer sequences of the disclosure that specifically bind to a target sequence of an RNA molecule encoding a Progranulin (GRN) protein of the disclosure may comprise or consist of a nucleic acid having a sequence selected from any one of any one of SEQ ID NO: 27138 to SEQ ID NO: 29242.
  • an RNA molecule of the disclosure comprises a target RNA sequence.
  • a pathogenic RNA comprises the target RNA sequence or the target sequence is associated with the pathogenic RNA.
  • the RNA molecule of the disclosure comprises at least one target sequence.
  • the RNA molecule of the disclosure comprises one or more target sequence(s).
  • the RNA molecule of the disclosure comprises two or more target sequences.
  • the target RNA is non-coding RNA.
  • an RNA molecule of the disclosure is a naturally occurring RNA molecule.
  • the RNA molecule of the disclosure is a non-naturally occurring molecule.
  • Exemplary non- naturally occurring RNA molecules may comprise or consist of sequence variations or mutations, chimeric sequences, exogenous sequences, heterologous sequences, chimeric sequences, recombinant sequences, sequences comprising a modified or synthetic nucleotide or any combination thereof.
  • an RNA molecule of the disclosure comprises or consists of a sequence isolated or derived from a virus.
  • an RNA molecule of the disclosure comprises or consists of a sequence isolated or derived from a prokaryotic organism. In some embodiments, an RNA molecule of the disclosure comprises or consists of a sequence isolated or derived from a species or strain of archaea or a species or strain of bacteria.
  • the RNA molecule of the disclosure comprises or consists of a sequence isolated or derived from a eukaryotic organism.
  • an RNA molecule of the disclosure comprises or consists of a sequence isolated or derived from a species of protozoa, parasite, protist, algae, fungi, yeast, amoeba, worm, microorganism, invertebrate, vertebrate, insect, rodent, mouse, rat, mammal, or a primate.
  • an RNA molecule of the disclosure comprises or consists of a sequence isolated or derived from a human.
  • the RNA molecule of the disclosure comprises or consists of a sequence derived from a coding sequence from a genome of an organism or a virus.
  • the RNA molecule of the disclosure comprises or consists of a primary RNA transcript, a precursor messenger RNA (pre-mRNA) or messenger RNA (mRNA).
  • pre-mRNA precursor messenger RNA
  • mRNA messenger RNA
  • the RNA molecule of the disclosure comprises or consists of a gene product that has not been processed (e.g. a transcript).
  • the RNA molecule of the disclosure comprises or consists of a gene product that has been subject to post-transcriptional processing (e.g.
  • the RNA molecule of the disclosure comprises or consists of a gene product that has been subject to alternative splicing (e.g. a splice variant). In some embodiments, the RNA molecule of the disclosure comprises or consists of a gene product that has been subject to removal of non-coding and/or intronic sequences (e.g. a messenger RNA (mRNA)).
  • mRNA messenger RNA
  • the RNA molecule of the disclosure comprises or consists of a sequence derived from a non-coding sequence (e.g. a non-coding RNA (ncRNA)).
  • a non-coding RNA e.g. a non-coding RNA (ncRNA)
  • the RNA molecule of the disclosure comprises or consists of a ribosomal RNA.
  • the RNA molecule of the disclosure comprises or consists of a small ncRNA molecule.
  • Exemplary small RNA molecules of the disclosure include, but are not limited to, microRNAs
  • miRNAs small interfering (siRNAs), piwi-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs), small nuclear RNAs (snRNAs), extracellular or exosomal RNAs
  • RNA molecules of the disclosure comprises or consists of a long ncRNA molecule.
  • exemplary long RNA molecules of the disclosure include, but are not limited to, X-inactive specific transcript (Xist) and HOX transcript antisense RNA (HOTAIR).
  • the RNA molecule of the disclosure contacted by a composition of the disclosure in an intracellular space. In some embodiments, the RNA molecule of the disclosure contacted by a
  • composition of the disclosure in a cytosolic space.
  • the RNA molecule of the disclosure contacted by a composition of the disclosure in a nucleus.
  • the RNA molecule of the disclosure contacted by a composition of the disclosure in a vesicle, membrane-bound compartment of a cell, or an organelle.
  • the RNA molecule of the disclosure contacted by a composition of the disclosure in an extracellular space. In some embodiments, the RNA molecule of the disclosure contacted by a
  • composition of the disclosure in an exosome In some embodiments, the RNA molecule of the disclosure contacted by a composition of the disclosure in a liposome, a polymersome, a micelle or a nanoparticle. In some embodiments, the RNA molecule of the disclosure contacted by a composition of the disclosure in an extracellular matrix. In some
  • RNA molecule of the disclosure contacted by a composition of the disclosure in a droplet. In some embodiments, the RNA molecule of the disclosure contacted by a composition of the disclosure in a microfluidic droplet.
  • a RNA molecule of the disclosure comprises or consists of a single-stranded sequence. In some embodiments, the RNA molecule of the disclosure comprises or consists of a double-stranded sequence. In some embodiments, the double-stranded sequence comprises two RNA molecules. In some embodiments, the double-stranded sequence comprises one RNA molecule and one DNA molecule. In some embodiments, including those wherein the double-stranded sequence comprises one RNA molecule and one DNA molecule, compositions of the disclosure selectively bind and, optionally, selectively cut the RNA molecule.
  • RNA binding protein which comprises or consists of a nuclease or endonuclease domain.
  • the second RNA-binding protein is an effector protein.
  • the second RNA binding protein binds RNA in a manner in which it associates with RNA.
  • the second RNA binding protein associates with RNA in a manner in which it cleaves RNA.
  • the second RNA-binding protein is fused to a first RNA-binding protein which is a PUF,
  • the second RNA binding protein comprises or consists of an RNAse.
  • the second RNA binding protein comprises or consists of an RNAsel.
  • the RNAsel protein comprises or consists of SEQ ID NO:
  • the second RNA binding protein comprises or consists of an RNAse4.
  • the RNAse4 protein comprises or consists of SEQ ID NO:
  • the second RNA binding protein comprises or consists of an RNAse6.
  • the RNAse6 protein comprises or consists of SEQ ID NO:
  • the second RNA binding protein comprises or consists of an RNAse7.
  • the RNAse7 protein comprises or consists of SEQ ID NO:
  • the second RNA binding protein comprises or consists of an RNAse8.
  • the RNAse8 protein comprises or consists of SEQ ID NO:
  • the second RNA binding protein comprises or consists of an RNAse2.
  • the RNAse2 protein comprises or consists of SEQ ID NO:
  • the second RNA binding protein comprises or consists of an RNAse6PL.
  • the RNAse6PL protein comprises or consists of SEQ ID NO: 331.
  • the second RNA binding protein comprises or consists of an RNAseL.
  • the RNAseL protein comprises or consists of SEQ ID NO: 332.
  • the second RNA binding protein comprises or consists of an RNAseT2.
  • the RNAseT2 protein comprises or consists of SEQ ID NO: 333.
  • the second RNA binding protein comprises or consists of an RNAsel 1.
  • the RNAsel 1 protein comprises or consists of SEQ ID NO: 334.
  • the second RNA binding protein comprises or consists of an RNAseT2-like.
  • the RNAseT24ike protein comprises or consists of SEQ ID NO: 335.
  • the second RNA binding protein comprises or consists of a mutated RNAse.
  • the second RNA binding protein comprises or consists of a mutated Rnasel (Rnasel(K41R)) polypeptide.
  • Rnasel(K41R) polypeptide comprises or consists of SEQ ID NO: 336.
  • the second RNA binding protein comprises or consists of a mutated Rnasel (Rnasel(K41R, D121E)) polypeptide.
  • the Rnasel (Rnasel(K41R, D121E)) polypeptide comprises or consists of SEQ ID NO: 337.
  • the second RNA binding protein comprises or consists of a mutated Rnasel (Rnasel(K41R, D121E, H119N)) polypeptide.
  • the Rnasel (Rnasel(K41R, D121E, HI 19N)) polypeptide comprises or consists of SEQ ID NO: 338.
  • the second RNA binding protein comprises or consists of a mutated Rnasel.
  • the second RNA binding protein comprises or consists of a mutated Rnasel (Rnasel(Hl 19N)) polypeptide.
  • the Rnasel (Rnasel(Hl 19N)) polypeptide comprises or consists of SEQ ID NO: 339.
  • the second RNA binding protein comprises or consists of a mutated Rnasel (Rnasel(R39D, N67D, N88A, G89D, R91D, H119N)) polypeptide.
  • the Rnasel (Rnasel(R39D, N67D, N88A, G89D, R91D,
  • HI 19N)) polypeptide comprises or consists of SEQ ID NO: 340.
  • the second RNA binding protein comprises or consists of a mutated Rnasel (Rnasel(R39D, N67D, N88A, G89D, R91D, H119N)) polypeptide.
  • Rnasel Rnasel(R39D, N67D, N88A, G89D, R91D, H119N, K41R, D121E)
  • polypeptide comprises or consists of SEQ ID NO: 341.
  • the second RNA binding protein comprises or consists of a mutated Rnasel (Rnasel(R39D, N67D, N88A, G89D, R91D, H119N)) polypeptide.
  • Rnasel (Rnasel(R39D, N67D, N88A, G89D, R91D)) polypeptide comprises or consists of SEQ ID NO: 342.
  • the second RNA binding protein comprises or consists of a mutated Rnasel (Rnasel (R39D, N67D, N88A, G89D, R91D, H119N, K41R, D121E)) polypeptide that comprises or consists of SEQ ID NO: 343.
  • Rnasel R39D, N67D, N88A, G89D, R91D, H119N, K41R, D121E
  • the second RNA binding protein comprises or consists of a NOB1 polypeptide.
  • the NOB1 polypeptide comprises or consists of SEQ ID NO: 344.
  • the second RNA binding protein comprises or consists of an endonuclease. In some embodiments, the second RNA binding protein comprises or consists of an endonuclease V (ENDOV). In some embodiments, the ENDOV protein comprises or consists of SEQ ID NO: 345.
  • ENDOV endonuclease V
  • the second RNA binding protein comprises or consists of an endonuclease G (ENDOG).
  • ENDOG protein comprises or consists of SEQ ID NO: 346.
  • the second RNA binding protein comprises or consists of an endonuclease D1 (ENDODl). In some embodiments, the ENDODl protein comprises or consists of SEQ ID NO: 347. [0507] In some embodiments, the second RNA binding protein comprises or consists of a Human flap endonuclease- 1 (hFENl). In some embodiments, the hFENl polypeptide comprises or consists of SEQ ID NO: 348.
  • the second RNA binding protein comprises or consists of a DNA repair endonuclease XPF (ERCC4) polypeptide.
  • ERCC4 polypeptide comprises or consists of SEQ ID NO: 349.
  • the second RNA binding protein comprises or consists of an Endonuclease Ill-like protein 1 (NTHL) polypeptide.
  • NTHL polypeptide comprises or consists of SEQ ID NO: 340.
  • the second RNA binding protein comprises or consists of a human Schlafen 14 (hSLFN14) polypeptide.
  • hSLFN14 polypeptide comprises or consists of SEQ ID NO: 351.
  • the second RNA binding protein comprises or consists of a human beta-lactamase-like protein 2 (hLACTB2) polypeptide.
  • hLACTB2 polypeptide comprises or consists of SEQ ID NO: 352.
  • the second RNA binding protein comprises or consists of an apurinic/apyrimidinic (AP)
  • the second RNA binding protein comprises or consists of an apurinic/apyrimidinic (AP)
  • APEX2 endodeoxyribonuclease polypeptide.
  • the APEX2 polypeptide comprises or consists of SEQ ID NO: 353.
  • the APEX2 polypeptide comprises or consists of SEQ ID NO: 354.
  • the second RNA binding protein comprises or consists of an apurinic or apyrimidinic site lyase (APEX1) polypeptide.
  • APEX1 polypeptide comprises or consists of SEQ ID NO: 355.
  • the second RNA binding protein comprises or consists of an angiogenin (ANG) polypeptide.
  • the ANG polypeptide comprises or consists of SEQ ID NO: 356.
  • the second RNA binding protein comprises or consists of a heat responsive protein 12 (HRSP12) polypeptide.
  • HRSP12 polypeptide comprises or consists of SEQ ID NO: 357.
  • the second RNA binding protein comprises or consists of a Zinc Finger CCCH-Type Containing 12A
  • ZC3H12A polypeptide.
  • the ZC3H12A polypeptide comprises or consists of SEQ ID NO: 358.
  • the ZC3H12A polypeptide comprises or consists of SEQ ID NO: 359.
  • the second RNA binding protein comprises or consists of a Reactive Intermediate Imine Deaminase A (RIDA) polypeptide.
  • RIDA Reactive Intermediate Imine Deaminase A
  • the RIDA polypeptide comprises or consists of SEQ ID NO: 360.
  • the second RNA binding protein comprises or consists of a Phospholipase D Family Member 6 (PDL6) polypeptide.
  • PDL6 polypeptide comprises or consists of SEQ ID NO: 361.
  • the second RNA binding protein comprises or consists of a mitochondrial ribonuclease P catalytic subunit (KIAA0391) polypeptide.
  • the KIAA0391 polypeptide comprises or consists of SEQ ID NO: 362.
  • the second RNA binding protein comprises or consists of an argonaute 2 (AG02) polypeptide.
  • the AG02 polypeptide comprises or consists of SEQ ID NO: 363.
  • the second RNA binding protein comprises or consists of a mitochondrial nuclease EXOG (EXOG) polypeptide.
  • EXOG mitochondrial nuclease EXOG
  • the EXOG polypeptide comprises or consists of SEQ ID NO: 364.
  • the second RNA binding protein comprises or consists of a Zinc Finger CCCH-Type Containing 12D
  • the ZC3H12D polypeptide comprises or consists of SEQ ID NO: 365.
  • the second RNA binding protein comprises or consists of an endoplasmic reticulum to nucleus signaling 2 (ERN2) polypeptide.
  • the ERN2 polypeptide comprises or consists of SEQ ID NO: 366.
  • the second RNA binding protein comprises or consists of a pelota mRNA surveillance and ribosome rescue factor (PELO) polypeptide.
  • the PELO polypeptide comprises or consists of SEQ ID NO: 367.
  • the second RNA binding protein comprises or consists of a YBEY metallopeptidase (YBEY) polypeptide.
  • YBEY YBEY metallopeptidase
  • the YBEY polypeptide comprises or consists of SEQ ID NO: 368.
  • the second RNA binding protein comprises or consists of a cleavage and polyadenylation specific factor 4 like (CPSF4L) polypeptide.
  • CPSF4L polypeptide comprises or consists of SEQ ID NO: 369.
  • the second RNA binding protein comprises or consists of an hCG_2002731 polypeptide.
  • the hCG_2002731 polypeptide comprises or consists of SEQ ID NO: 370.
  • the hCG_2002731 polypeptide comprises or consists of SEQ ID NO: 371.
  • the second RNA binding protein comprises or consists of an Excision Repair Cross-Complementation Group 1 (ERCC1) polypeptide.
  • ERCC1 polypeptide comprises or consists of SEQ ID NO: 372.
  • the second RNA binding protein comprises or consists of a ras-related C3 botulinum toxin substrate 1 isoform (RACl) polypeptide.
  • RACl ras-related C3 botulinum toxin substrate 1 isoform
  • the RAC1 polypeptide comprises or consists of SEQ ID NO: 373.
  • the second RNA binding protein comprises or consists of a Ribonuclease A A1 (RAA1) polypeptide.
  • RAAl polypeptide comprises or consists of SEQ ID NO: 374.
  • the second RNA binding protein comprises or consists of a Ras Related Protein (RAB1) polypeptide.
  • RAB1 polypeptide comprises or consists of SEQ ID NO: 375.
  • the second RNA binding protein comprises or consists of a DNA Replication Helicase/Nuclease 2 (DNA2) polypeptide.
  • the DNA2 polypeptide comprises or consists of SEQ ID NO: 376.
  • the second RNA binding protein comprises or consists of a FLJ35220 polypeptide.
  • the FLJ35220 polypeptide comprises or consists of SEQ ID NO: 377.
  • the second RNA binding protein comprises or consists of a FLJ13173 polypeptide.
  • the FLJ13173 polypeptide comprises or consists of SEQ ID NO: 378.
  • the second RNA binding protein comprises or consists of Teneurin Transmembrane Protein (TENM) polypeptide. In some embodiments, the second RNA binding protein comprises or consists of Teneurin Transmembrane Protein 1 (TENM1) polypeptide. In some embodiments, the TENM1 polypeptide comprises or consists of SEQ ID NO: 379.
  • TEM Teneurin Transmembrane Protein
  • the second RNA binding protein comprises or consists of Teneurin Transmembrane Protein 2 (TENM2) polypeptide.
  • the TENM2 polypeptide comprises or consists of SEQ ID NO: 380.
  • the second RNA binding protein comprises or consists of a Ribonuclease Kappa (RNAseK) polypeptide.
  • RNAseK Ribonuclease Kappa
  • the RNAseK polypeptide comprises or consists of SEQ ID NO: 381.
  • the second RNA binding protein comprises or consists of a transcription activator-like effector nuclease (TALEN) polypeptide or a nuclease domain thereof.
  • TALEN transcription activator-like effector nuclease
  • the TALEN polypeptide comprises or consists of SEQ ID NO: 382.
  • the TALEN polypeptide comprises or consists of SEQ ID NO: 383.
  • the second RNA binding protein comprises or consists a zinc finger nuclease polypeptide or a nuclease domain thereof. In some embodiments, the second RNA binding protein comprises or consists of a ZNF638 polypeptide or a nuclease domain thereof. In some embodiments, the ZNF638 polypeptide polypeptide comprises or consists of SEQ ID NO: 384.
  • the second RNA binding protein comprises or consists of a PIN domain derived from the human SMG6 protein, also commonly known as telomerase-binding protein EST1 A isoform 3, NCBI Reference Sequence: NP 001243756.1.
  • the PIN from hSMG6 is used herein in the form of a Cas fusion protein and as an internal control, for example, and without limitation, see FIG. 9, which shows PIN-dSauCas9, PIN-dSauCas9dHNH, PIN-dSPCas9, and dcjeCas9-PIN.
  • the composition further comprises (a) a sequence comprising a gRNA that specifically binds within an RNA molecule and (b) a sequence encoding a nuclease.
  • a nuclease comprises a sequence isolated or derived from a CRISPR/Cas protein.
  • the CRISPR/Cas protein is isolated or derived from any one of a type I, a type IA, a type IB, a type IC, a type ID, a type IE, a type IF, a type IU, a type III, a type IIIA, a type MB, a type IIIC, a type HID, a type IV, a type IVA, a type IVB, a type II, a type IIA, a type IIB, a type IIC, a type V, or a type VI CRISPR/Cas protein .
  • a nuclease comprises a sequence isolated or derived from a TALEN or a nuclease domain thereof.
  • a nuclease comprises a sequence isolated or derived from a zinc finger nuclease or a nuclease domain thereof.
  • the composition comprises a sequence encoding a target RNA-binding fusion protein comprising
  • RNA-nuclease activity (b) a sequence encoding a second RNA-binding polypeptide, wherein the first RNA-biding polypeptide binds a target RNA, and wherein the second RNA-binding polypeptide comprises RNA-nuclease activity.
  • a target RNA-binding fusion protein is an RNA-guided target RNA-binding fusion protein.
  • RNA-guided target RNA-binding fusion proteins comprise at least one RNA-binding polypeptide which corresponds to a gRNA which guides the RNA- binding polypeptide to target RNA.
  • RNA-guided target RNA-binding fusion proteins include without limitation, RNA-binding polypeptides which are CRISPR/Cas-based RNA-binding polypeptides or portions thereof.
  • a target RNA-binding fusion protein is not an RNA-guided target RNA-binding fusion protein and as such comprises at least one RNA-binding polypeptide which is capable of binding a target RNA without a corresponding gRNA sequence.
  • Such non-guided RNA-binding polypeptides include, without limitation, at least one RNA-binding protein or RNA-binding portion thereof which is a PUF (Pumilio and FBF homology family). This type RNA-binding polypeptide can be used in place of a gRNA- guided RNA binding protein such as CRISPR/Cas.
  • the unique RNA recognition mode of PUF proteins (named for Drosophila Pumilio and C.
  • the PUF domain of human Pumiliol also known in the art, binds tightly to cognate RNA sequences and its specificity can be modified. It contains eight PUF repeats that recognize eight consecutive RNA bases with each repeat recognizing a single base. Since two amino acid side chains in each repeat recognize the Watson-Crick edge of the corresponding base and determine the specificity of that repeat, a PUF domain can be designed to specifically bind most 8-nt RNA. Wang et al, Nat Methods. 2009; 6(11): 825-830. See also WO2012/068627 which is incorporated by reference herein in its entirety.
  • PumHD is a modified version of the WT Pumilio protein that exhibits programmable binding to arbitrary 8-base sequences of RNA.
  • Each of the eight units of PumHD can bind to all four RNA bases, and the RNA bases flanking the target sequence do not affect binding. See also the following for art- recognized RNA-binding rules of PUF design: Filipovska A, Razif MF, Nygard KK, & Rackham O.
  • human PUMl (1186 amino acids) contains an RNA-binding domain (RBD) in the C-terminus of the protein (also known as Pumilio homology domain PUM-HD amino acid 828-amino acid 1175) and that PUFs are based on the RBD of human PUML
  • RBD RNA-binding domain
  • amino acids 12, 13, and 16 are important for RNA binding with 12 and 16 controlling RNA base recognition.
  • Amino acid 13 stacks with RNA bases and can be modified to tune specificity and affinity.
  • the PUF design may maintain amino acid 13 as human PUMUs native residue. Recognition occurs in reverse orientation as N- and C-terminal PUF recognizes 3’ to 5’
  • RNA Accordingly, PUF engineering of 8 modules (8PUF), as known in the art, mimics a human protein.
  • An exemplary 8-mer RNA recognition (8PUF) would designed as follows: R1 , -R1-R2-R3-R4-R5-R6-R7-R8-R8 ⁇
  • an 8PUF is used as the RBD.
  • a variation of the 8PUF design is used to create a 12-mer RNA recognition (12PUF) RBD or a 16-mer RNA recognition (16PUF) RBD. Repeats 1-8 of wild type human PUMl are provided herewith at SEQ ID NOS: 609-616, respectively.
  • the nucleic acid sequence encoding the PUF domain from human PUMl is SEQ ID NO: 617 and the amino acid sequence of the PUF domain from human PUMl amino acids 828-176 is SEQ ID NO: 618. See also US Patent 9,580,714 which is incorporated herein in its entirety.
  • the fusion protein comprises at least one RNA-binding protein or RNA-binding portion thereof which is a PUMBY (Pumilio-based assembly) protein.
  • RNA-binding protein PumHD which has been widely used in native and modified form for targeting RNA, has been engineered into a protein architecture designed to yield a set of four canonical protein modules, each of which targets one RNA base. These modules (i.e., Pumby, for Pumilio- based assembly) are concatenated in chains of varying composition and length, to bind desired target RNAs.
  • PUMBY is a more simple and modular form of PumHD, in which a single protein unit of PumHD is concatenated into arrays of arbitrary size and binding sequence specificity.
  • the specificity of such Pumby-RNA interactions is high, with undetectable binding of a Pumby chain to RNA sequences that bear three or more
  • the first RNA binding protein comprises a Pumilio and FBF (PUF) protein. In some embodiments, the first RNA binding protein comprises a Pumilio-based assembly (PUMBY) protein. In some embodiments,
  • the PUF or PUMBY RNA-binding proteins are fused with a nuclease domain such as E17.
  • Exemplary PUF RNA-binding protein used in the compositions and methods disclosed herein are as follows:
  • a PUF26 protein (original sequence) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 393.
  • a PUF26 protein of the disclosure is encoded by an optimized nucleic acid sequence comprising or consisting of of SEQ ID NO: 394
  • a PUF54 protein (original sequence) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 395.
  • a PUF54 protein of the disclosure is encoded by an optimized nucleic acid sequence comprising or consisting of of SEQ ID NO: 396.
  • a PUF60 protein (original sequence) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 397.
  • a PUF60 protein of the disclosure is encoded by an optimized nucleic acid sequence comprising or consisting of of SEQ ID NO: 398.
  • a PUF 110 protein (original sequence) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 399.
  • a PUF 110 protein of the disclosure is encoded by an optimized nucleic acid sequence comprising or consisting of SEQ ID NO: 400.
  • RNA-binding proteins used in the compositions and methods disclosed herein are as follows: [0560]
  • a PUF08 (targeting 8 nucleotides) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 491.
  • a PUF08 (targeting 8 nucleotides) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 492.
  • a PUF16 (targeting 8 nucleotides) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 493.
  • a PUF16 (targeting 8 nucleotides) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 494.
  • a PUF22 (targeting 8 nucleotides) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 495.
  • a PUF22 (targeting 8 nucleotides) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 496.
  • a PUF34 (targeting 8 nucleotides) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 497.
  • a PUF34 (targeting 8 nucleotides) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 498.
  • a PUF56 (targeting 8 nucleotides) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 499.
  • a PUF56 (targeting 8 nucleotides) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 500.
  • a PUF64 (targeting 8 nucleotides) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 501.
  • a PUF64 (targeting 8 nucleotides) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 502.
  • a PUF66 (targeting 8 nucleotides) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 503.
  • a PUF66 (targeting 8 nucleotides) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 504.
  • a PUF90 (targeting 8 nucleotides) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 505.
  • a PUF90 (targeting 8 nucleotides) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 506.
  • a PUF102 (targeting 8 nucleotides) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 507.
  • a PUF102 (targeting 8 nucleotides) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 508.
  • a PUF112 (targeting 8 nucleotides) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 509.
  • a PUF112 (targeting 8 nucleotides) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 510.
  • a PUF122 (targeting 8 nucleotides) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 511.
  • a PUF122 (targeting 8 nucleotides) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 512.
  • a PUF128 (targeting 8 nucleotides) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 513.
  • a PUF128 (targeting 8 nucleotides) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 514.
  • a PUF130 (targeting 8 nucleotides) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 515.
  • a PUF130 (targeting 8 nucleotides) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 516.
  • a PUF154 (targeting 8 nucleotides) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 517.
  • a PUF154 (targeting 8 nucleotides) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 518.
  • a PUF166 (targeting 8 nucleotides) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 519.
  • a PUF166 (targeting 8 nucleotides) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 520.
  • Exemplary PUF RNA-binding proteins (targeting 16 Rho nucleotides) are as follows:
  • a PUF26 (Design 1-POOlIS) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 521.
  • a PUF26 (Design 1-POOlIS) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 522.
  • a PUF26 (Design 2-POO 1KZ) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 523.
  • a PUF26 (Design 2-POO 1KZ) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 524.
  • a PUF26 (Design 3-P001LE) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 525.
  • a PUF26 (Design 3-P001LE) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 526.
  • a PUF54 (Design 1-POOlIT) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 527.
  • a PUF54 (Design 1-POOlIT) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 528.
  • a PUF54 (Design 2-POO 1LA) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 529.
  • a PUF54 (Design 2-POO 1LA) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 530.
  • a PUF54 (Design 3-P001LF) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 531.
  • a PUF54 (Design 3-P001LF) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 532.
  • a PUF60 (Design 1-POO HU) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 533.
  • a PUF60 (Design 1-POO HU) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 534.
  • a PUF60 (Design 2-P001LB) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 535.
  • a PUF60 (Design 2-P001LB) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 536.
  • a PUF60 (Design 3-P001LG) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 537.
  • a PUF60 (Design 3-P001LG) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 538.
  • a PUF110 (Design 1-POOHV) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 539.
  • a PUF110 (Design 1-POOHV) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 540.
  • a PUF110 (Design 2-POO 1LC) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 541.
  • a PUF110 (Design 2-POO 1LC) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 542.
  • a PUF110 (Design 3-P001LH) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 543.
  • a PUF110 (Design 3-P001LH) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of SEQ ID NO: 545.
  • Exemplary PUMBY RNA-binding proteins (targeting 8 Rho nucleotides) are as follows:
  • a PUM14 protein of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 401.
  • a PUM14 protein of the disclosure is encoded by a nucleic acid sequence comprising or consisting of of SEQ ID NO: 402.
  • Exemplary PUMBY RNA-binding proteins (targeting 16 Rho nucleotides) are as follows:
  • a PUM14 protein (Design 1-POOl JG) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 545.
  • a PUM14 protein (Design 1-POOl JG) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of of SEQ ID NO: 546
  • a PUM14 protein (Design 2-P001JB) of the disclosure comprises or consists of the amino acid sequence of SEQ ID NO: 547.
  • a PUM14 protein (Design 2-P001JB) of the disclosure is encoded by a nucleic acid sequence comprising or consisting of of SEQ ID NO: 548.
  • RNA-binding proteins or RNA-binding portions thereof is a PPR protein.
  • PPR proteins proteins with pentatricopeptide repeat (PPR) motifs derived from plants
  • PPR proteins are nuclear- encoded and exclusively controlled at the RNA level organelles (chloroplasts and mitochondria), cutting, translation, splicing, RNA editing, genes specifically acting on RNA stability.
  • PPR proteins are typically a motif of 35 amino acids and have a structure in which a PPR motif is about 10 contiguous amino acids.
  • the combination of PPR motifs can be used for sequence-selective binding to RNA.
  • PPR proteins are often comprised of PPR motifs of about 10 repeat domains.
  • PPR domains or RNA-binding domains may be configured to be catalytically inactive. WO 2013/058404 incorporated herein by reference in its entirety.
  • the fusion protein disclosed herein comprises a linker between the at least two RNA-binding polypeptides.
  • the linker is a peptide linker.
  • the peptide linker comprises one or more repeats of the tri-peptide GGS. In other embodiments, the linker is a non-peptide linker.
  • the non-peptide linker comprises polyethylene glycol (PEG), polypropylene glycol (PPG), co-poly(ethylene/propylene) glycol, polyoxyethylene (POE), polyurethane, polyphosphazene, polysaccharides, dextran, polyvinyl alcohol, polyvinylpyrrolidones, polyvinyl ethyl ether, polyacryl amide, polyacrylate, polycyanoacrylates, lipid polymers, chitins, hyaluronic acid, heparin, or an alkyl linker.
  • PEG polyethylene glycol
  • PPG polypropylene glycol
  • POE polyoxyethylene
  • polyurethane polyphosphazene
  • polysaccharides dextran
  • polyvinyl alcohol polyvinylpyrrolidones
  • polyvinyl ethyl ether polyacryl amide
  • polyacrylate polycyanoacrylates
  • lipid polymers chitins, hyaluronic
  • the at least one RNA-binding protein does not require multimerization for RNA-binding activity.
  • the at least one RNA- binding protein is not a monomer of a multimer complex.
  • a multimer protein complex does not comprise the RNA binding protein.
  • the at least one of RNA-binding protein selectively binds to a target sequence within the RNA molecule.
  • the at least one RNA-binding protein does not comprise an affinity for a second sequence within the RNA molecule.
  • the at least one RNA-binding protein does not comprise a high affinity for or selectively bind a second sequence within the RNA molecule.
  • the at least one RNA-binding protein comprises between 2 and 1300 amino acids, inclusive of the endpoints.
  • the at least one RNA-binding protein of the fusion proteins disclosed herein further comprises a sequence encoding a nuclear localization signal (NLS).
  • a nuclear localization signal (NLS) is positioned at the N-terminus of the RNA binding protein.
  • the at least one RNA-binding protein comprises an NLS at a C-terminus of the protein.
  • the at least one RNA-binding protein further comprises a first sequence encoding a first NLS and a second sequence encoding a second NLS.
  • the first NLS or the second NLS is positioned at the N-terminus of the RNA-binding protein.
  • the at least one RNA-binding protein comprises the first NLS or the second NLS at a C-terminus of the protein. In some embodiments, the at least one RNA-binding protein further comprises an NES (nuclear export signal) or other peptide tag or secretory signal.
  • NES nuclear export signal
  • a fusion protein disclosed herein comprises the at least one RNA-binding protein as a first RNA-binding protein together with a second RNA-binding protein comprising or consisting of a nuclease domain.
  • the second RNA-binding polypeptide is operably configured to the first RNA-binding polypeptide at the C-terminus of the first RNA-binding polypeptide. In some embodiments, the second RNA-binding polypeptide is operably configured to the first RNA-binding polypeptide at the N-terminus of the first RNA-binding polypeptide.
  • one such exemplary fusion protein is E99 which is configured so that
  • RNAsel (R39D, N67D, N88A, G89D, R19D, HI 19N, K41R) is located at the N-terminus of SpyCas9 whereas another exemplary fusion protein, El 00, is configured so that
  • RNAsel (R39D, N67D, N88A, G89D, R19D, HI 19N, K41R) is located at the C-terminus of SpyCas9.
  • an exemplary fusion protein is a PUF or PUMBY-based first RNA-binding protein fused to a second RNA-bindng protein which is an zinc-finger endonuclease known as ZC3H12A of SEQ ID NO: 358 (also termed E17).
  • a vector comprises a guide RNA of the disclosure.
  • the vector comprises at least one guide RNA of the disclosure.
  • the vector comprises one or more guide RNA(s) of the disclosure.
  • the vector comprises two or more guide RNAs of the disclosure.
  • the vector comprises three guide RNAs.
  • the vector comprises four guide RNAs.
  • the vector further comprises a guided or non-guided RNA-binding protein of the disclosure.
  • the vector further comprises a RNA-binding fusion protein of the disclosure.
  • the fusion protein comprises a first RNA binding protein and a second RNA binding protein.
  • the RNA-guided RNA-binding systems comprising a RNA-binding protein and a gRNA are in a single vector.
  • the single vector comprises the RNA-guided RNA-binding systems which are Casl3d RNA-guided RNA-binding systems.
  • the single vector comprises the Casl3dRNA-guided RNA-binding systems which are CasRx RNA-guided RNA-binding systems.
  • the single vector comprises a non-guided RNA-binding system comprising a PUF or PUMBY-based protein fused with a nuclease domain such as ZC3H12A.
  • a first vector comprises a guide RNA of the disclosure and a second vector comprises an RNA- binding protein or RNA-binding fusion protein of the disclosure.
  • the first vector comprises at least one guide RNA of the disclosure.
  • the first vector comprises one or more guide RNA(s) of the disclosure.
  • the first vector comprises two or more guide RNA(s) of the disclosure.
  • the fusion protein comprises a first RNA binding protein and a second RNA binding protein.
  • the first vector and the second vector are identical vectors or vector serotypes. In some embodiments, the first vector and the second vector are not identical vectors or vector serotypes.
  • the vector is or comprises a component of a“2-component Cas9-based RNA targeting system” comprising (a) nucleic acid sequence encoding an RNA-binding protein or RNA-binding fusion protein and a therapeutic replacement protein of the disclosure; and (b) a single guide RNA (sgRNA) sequence comprising: on its 5’ end, an RNA sequence (or spacer sequence) that hybridizes to or binds to a target RNA sequence (e.g., a pathogenic RNA comprising a target RNA sequence); and on its 3’ end, an RNA sequence (or scaffold sequence) capable of binding to or associating with the CRISPR/Cas9 protein of the fusion protein; and wherein the 2-component RNA targeting system recognizes and alters the target RNA (e.g., comprised within pathogenic target RNA) in a cell in the absence of a PAMmer.
  • vectors refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.
  • viral vector e.g., retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses.
  • Viral vectors also include polynucleotides carried by a virus for transfection into a host cell.
  • the vector is a lentivirus (such as an integration-deficient lentiviral vector) or adeno-associated viral (AAV) vector.
  • Vectors are capable of autonomous replication in a host cell into which they are introduced such as e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors and other vectors such as, e.g., non-episomal mammalian vectors, are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
  • vectors such as e.g., expression vectors
  • Common expression vectors are often in the form of plasmids.
  • recombinant expression vectors comprise a nucleic acid provided herein such as e.g., a guide RNA which can be expressed from an RNA sequence or a RNA sequence, and a nucleic acid encoding a Cas 13d protein, in a form suitable for expression of the nucleic acid in a host cell.
  • Recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed.
  • "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence such as e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell. Certain embodiments of a vector depend on factors such as the choice of the host cell to be transformed, and the level of expression desired.
  • a vector can be introduced into host cells to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein such as, e.g., CRISPR transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc..
  • a vector of the disclosure is a viral vector.
  • the viral vector comprises a sequence isolated or derived from a retrovirus.
  • the viral vector comprises a sequence isolated or derived from a lentivirus.
  • the viral vector comprises a sequence isolated or derived from an adenovirus.
  • the viral vector comprises a sequence isolated or derived from an adeno-associated virus (AAV).
  • AAV adeno-associated virus
  • the viral vector is replication incompetent.
  • the viral vector is isolated or recombinant.
  • the viral vector is self complementary.
  • the viral vector comprises a sequence isolated or derived from an adeno-associated virus (AAV).
  • AAV adeno-associated virus
  • the viral vector comprises an inverted terminal repeat sequence or a capsid sequence that is isolated or derived from an AAV of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 (AAVrhlO), AAV11 or AAV12.
  • the AAV vector comprises a modified capsid.
  • the AAV vector is an AAV2-Tyr mutant vector.
  • the AAV vector comprises a capsid with a non-tyrosine amino acid at a position that corresponds to a surface-exposed tyrosine residue in position Tyr252, Tyr272, Tyr275, Tyr281, Tyr508, Tyr612, Tyr704, Tyr720, Tyr730 or Tyr673 of wild-type AAV2. See also WO 2008/124724 incorporated herein in its entirety.
  • the AAV vector comprises an engineered capsid.
  • AAV vectors comprising engineered capsids include without limitation, AAV2.7m8, AAV9.7m8, AAV2 2tYF, and AAV8 Y733F).
  • the viral vector is replication incompetent.
  • the viral vector is isolated or recombinant (rAAV).
  • the viral vector is self-complementary (scAAV).
  • a vector of the disclosure is a non-viral vector.
  • the vector comprises or consists of a nanoparticle, a micelle, a liposome or lipoplex, a polymersome, a polyplex or a dendrimer.
  • the vector is an expression vector or recombinant expression system.
  • the term“recombinant expression system” refers to a genetic construct for the expression of certain genetic material formed by recombination.
  • an expression vector, viral vector or non-viral vector provided herein includes without limitation, an expression control element.
  • An“expression control element” as used herein refers to any sequence that regulates the expression of a coding sequence, such as a gene.
  • Exemplary expression control elements include but are not limited to promoters, enhancers, microRNAs, post-transcriptional regulatory elements, polyadenylation signal sequences, and introns. Expression control elements may be constitutive, inducible, repressible, or tissue- specific, for example.
  • A“promoter” is a control sequence that is a region of a polynucleotide sequence at which initiation and rate of transcription are controlled.
  • Non-limiting exemplary promoters include a pol III promoter such as, e.g., U6 and HI promoters and/or a pol II promoter e.g., SV40, CMV (optionally including the CMV enhancer), RSV (Rous Sarcoma Virus LTR promoter (optionally including RSV enhancer), CB A (hybrid CMV enhancer/ chicken B-actin), CAG (hybrid CMV enhancer fused to chicken B-actin), truncated CAG, Cbh (hybrid CBA), EF-la (human longation factor alpha- 1) or EFS (short intron-less EF-1 alphs), PGK (phosphoglycerol kinase), C
  • a pol III promoter such as, e.g., U6 and HI promoters and/or a pol II promoter e.g., SV40, CMV (optionally including the CMV enhancer), RSV (
  • An“enhancer” is a region of DNA that can be bound by activating proteins to increase the likelihood or frequency of transcription.
  • Non-limiting exemplary enhancers and posttranscriptional regulatory elements include the CMV enhancer, MCK enhancer, R-U5’ segment in LTR of HTLV-1, SV40 enhancer, the intron sequence between exons 2 and 3 of rabbit B-globin, and WPRE.
  • an expression vector, viral vector or non-viral vector includes without limitation, vector elements such as an IRES or 2A peptide sites for configuration of “multicistronic” or“polycistronic” or“bicistronic” or tricistronic” constructs, i.e., having double or triple or multiple coding areas or exons, and as such will have the capability to express from mRNA two or more proteins from a single construct.
  • Multicistronic vectors simultaneously express two or more separate proteins from the same mRNA.
  • the two strategies most widely used for constructing multicistronic configurations are through the use of an IRES or a 2A self-cleaving site.
  • an“IRES” refers to an internal ribosome entry site or portion thereof of viral, prokaryotic, or eukaryotic origin which are used within polycistronic vector constructs.
  • an IRES is an RNA element that allows for translation initiation in a cap-independent manner.
  • self-cleaving peptides or“sequences encoding self-cleaving peptides” or“2 A self-cleaving site” refer to linking sequences which are used within vector constructs to incorporate sites to promote ribosomal skipping and thus to generate two polypeptides from a single promoter, such self- cleaving peptides include without limitation, T2A, and P2A peptides or sequences encoding the self-cleaving peptides.
  • the vector configuration is shown in e.g., Figures 1, 2 or 6.
  • the vector configuration comprises a promoter or regulatory sequence driving the expression of the nucleic acid encoding the RNA-binding protein in operable linkage with a promoter or regulatory sequence driving the expression of the replacement gene.
  • a vector configuration comprises an promoter such as a rhodopsin kinase promoter driving expression of the nucleic acid encoding the PUF or PUMBY fusion protein in operable linkage with a promoter such as an opsin promoter driving expression of a nucleic acid sequence encoding the replacement or“hardened” rhodopsin protein.
  • a vector configuration comprises an promoter such as an opsin promoter driving expression of the nucleic acid encoding the PUF or PUMBY fusion protein in operable linkage with a promoter such as an rhodopsin kinase promoter driving expression of a nucleic acid sequence encoding the replacement or “hardened” rhodopsin protein.
  • the nucleic acid encoding the RNA- binding protein operably linked to the nucleic acid encoding the replacement protein via an IRES or a 2A peptide.
  • the vector is a viral vector.
  • the vector is an adenoviral vector, an adeno-associated viral (AAV) vector, or a lentiviral vector.
  • the vector is a retroviral vector, an adenoviral/retroviral chimera vector, a herpes simplex viral I or II vector, a parvoviral vector, a reticuloendotheliosis viral vector, a polioviral vector, a papillomaviral vector, a vaccinia viral vector, or any hybrid or chimeric vector incorporating favorable aspects of two or more viral vectors.
  • the vector further comprises one or more expression control elements operably linked to the polynucleotide. In some embodiments, the vector further comprises one or more selectable markers. In some embodiments, the AAV vector has low toxicity. In some embodiments, the AAV vector does not incorporate into the host genome, thereby having a low probability of causing insertional mutagenesis. In some embodiments, the AAV vector can encode a range of total polynucleotides from 4.5 kb to 4.75 kb.
  • exemplary AAV vectors that may be used in any of the herein described compositions, systems, methods, and kits can include an AAV1 vector, a modified AAV1 vector, an AAV2 vector, a modified AAV2 vector, an AAV2-Tyr mutant vector, an AAV3 vector, a modified AAV3 vector, an AAV4 vector, a modified AAV4 vector, an AAV5 vector, a modified AAV5 vector, an AAV6 vector, a modified AAV6 vector, an AAV7 vector, a modified AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV.rhlO vector, a modified AAV.rhlO vector, an AAV.rh32/33 vector, a modified AAV.rh32/33 vector, an AAV.rh43 vector, a modified AAV.rh43 vector, an AAV.rh64Rl vector, and a modified AAV.rh64Rl vector, an AAV-Tyr mutant vector, and
  • the lentiviral vector is an integrase-competent lentiviral vector (ICLV).
  • the lentiviral vector can refer to the transgene plasmid vector as well as the transgene plasmid vector in conjunction with related plasmids (e.g., a packaging plasmid, a rev expressing plasmid, an envelope plasmid) as well as a lentiviral-based particle capable of introducing exogenous nucleic acid into a cell through a viral or viral-like entry mechanism.
  • Lentiviral vectors are well-known in the art (see, e.g., Trono D. (2002)
  • exemplary lentiviral vectors that may be used in any of the herein described compositions, systems, methods, and kits can include a human immunodeficiency virus (HIV) 1 vector, a modified human immunodeficiency virus (HIV) 1 vector, a human immunodeficiency virus (HIV) 2 vector, a modified human immunodeficiency virus (HIV) 2 vector, a sooty mangabey simian immunodeficiency virus (SIVSM) vector, a modified sooty mangabey simian
  • SIVSM African green monkey simian immunodeficiency virus
  • SIVAGM African green monkey simian immunodeficiency virus
  • SIVAGM modified African green monkey simian immunodeficiency virus
  • EIAV equine infectious anemia virus
  • EIAV feline immunodeficiency virus
  • FV feline immunodeficiency virus
  • FIV feline immunodeficiency virus
  • FIV feline immunodeficiency virus
  • FIV feline immunodeficiency virus
  • FIV feline immunodeficiency virus
  • FIV feline immunodeficiency virus
  • FIV feline immunodeficiency virus
  • FIV feline immunodeficiency virus
  • FIV feline immunodeficiency virus
  • FIV feline immunodeficiency virus
  • FIV feline immunodeficiency virus
  • FIV feline immunodeficiency virus
  • FIV feline immunodeficiency virus
  • FIV
  • nucleic acid sequences encoding the knockdown and replacement therapeutics disclosed herein for use in gene transfer and expression techniques described herein. It should be understood, although not always explicitly stated that the sequences provided herein can be used to provide the expression product as well as substantially identical sequences that produce a protein that has the same biological properties. These“biologically equivalent” or“biologically active” or“equivalent” polypeptides are encoded by equivalent polynucleotides as described herein.
  • They may possess at least 60%, or alternatively, at least 65%, or alternatively, at least 70%, or alternatively, at least 75%, or alternatively, at least 80%, or alternatively at least 85%, or alternatively at least 90%, or alternatively at least 95% or alternatively at least 98%, identical primary amino acid sequence to the reference polypeptide when compared using sequence identity methods run under default conditions.
  • Specific polypeptide sequences are provided as examples of particular embodiments. Modifications to the sequences to amino acids with alternate amino acids that have similar charge.
  • an equivalent polynucleotide is one that hybridizes under stringent conditions to the reference polynucleotide or its complement or in reference to a polypeptide, a polypeptide encoded by a polynucleotide that hybridizes to the reference encoding polynucleotide under stringent conditions or its complementary strand.
  • an equivalent polypeptide or protein is one that is expressed from an equivalent polynucleotide.
  • nucleic acid sequences e.g., polynucleotide sequences
  • the nucleic acid sequences may be codon-optimized which is a technique well known in the art.
  • exemplary Cas sequences such as e.g., a nucleic acid sequenc encoding SEQ ID NO: 92 (Casl3d known as CasRx) or the nucleic acid sequence encoding SEQ ID NO: 298 (Casl3d known as CasRx), are codon optimized for expression in human cells. Codon optimization refers to the fact that different cells differ in their usage of particular codons.
  • This codon bias corresponds to a bias in the relative abundance of particular tRNAs in the cell type.
  • By altering the codons in the sequence to match with the relative abundance of corresponding tRNAs it is possible to increase expression. It is also possible to decrease expression by deliberately choosing codons for which the corresponding tRNAs are known to be rare in a particular cell type. Codon usage tables are known in the art for mammalian cells, as well as for a variety of other organisms. Based on the genetic code, nucleic acid sequences coding for, e.g., a Cas protein, can be generated.
  • such a sequence is optimized for expression in a host or target cell, such as a host cell used to express the Cas protein or a cell in which the disclosed methods are practiced (such as in a mammalian cell, e.g., a human cell).
  • Codon preferences and codon usage tables for a particular species can be used to engineer isolated nucleic acid molecules encoding a Cas protein (such as one encoding a protein having at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to its corresponding wild-type protein) that takes advantage of the codon usage preferences of that particular species.
  • the Cas proteins disclosed herein can be designed to have codons that are preferentially used by a particular organism of interest.
  • an Cas nucleic acid sequence is optimized for expression in human cells, such as one having at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity to its corresponding wild-type or originating nucleic acid sequence.
  • an isolated nucleic acid molecule encoding at least one Cas protein (which can be part of a vector) includes at least one Cas protein coding sequence that is codon optimized for expression in a eukaryotic cell, or at least one Cas protein coding sequence codon optimized for expression in a human cell.
  • such a codon optimized Cas coding sequence has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to its corresponding wild-type or originating sequence.
  • a eukaryotic cell codon optimized nucleic acid sequence encodes a Cas protein having at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to its corresponding wild-type or originating protein.
  • clones containing functionally equivalent nucleic acids may be routinely generated, such as nucleic acids which differ in sequence but which encode the same Cas protein sequence.
  • Silent mutations in the coding sequence result from the degeneracy (i.e., redundancy) of the genetic code, whereby more than one codon can encode the same amino acid residue.
  • leucine can be encoded by CTT, CTC, CTA, CTG, TTA, or TTG; serine can be encoded by TCT, TCC, TCA, TCG, AGT, or AGC; asparagine can be encoded by AAT or AAC; aspartic acid can be encoded by GAT or GAC; cysteine can be encoded by TGT or TGC; alanine can be encoded by GCT, GCC, GCA, or GCG; glutamine can be encoded by CAA or CAG; tyrosine can be encoded by TAT or TAC; and isoleucine can be encoded by ATT, ATC, or ATA. Tables showing the standard genetic code can be found in various sources (see, for example, Stryer, 1988, Biochemistry, 3.sup.rd Edition, W.H. 5 Freeman and Co., NY).
  • Hybridization refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues.
  • the hydrogen bonding may occur by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner.
  • the complex may comprise two strands forming a duplex structure, three or more strands forming a multi -stranded complex, a single self-hybridizing strand, or any combination of these.
  • a hybridization reaction may constitute a step in a more extensive process, such as the initiation of a PC reaction, or the enzymatic cleavage of a polynucleotide by a ribozyme.
  • Examples of stringent hybridization conditions include: incubation temperatures of about 25°C to about 37°C; hybridization buffer concentrations of about 6x SSC to about lOx SSC; formamide concentrations of about 0% to about 25%; and wash solutions from about 4x SSC to about 8x SSC.
  • Examples of moderate hybridization conditions include: incubation temperatures of about 40°C to about 50°C; buffer concentrations of about 9x SSC to about 2x SSC; formamide concentrations of about 30% to about 50%; and wash solutions of about 5x SSC to about 2x SSC.
  • Examples of high stringency conditions include: incubation temperatures of about 55°C to about 68°C; buffer concentrations of about lx SSC to about O.
  • lx SSC formamide concentrations of about 55% to about 75%
  • wash solutions of about lx SSC, O.lx SSC, or deionized water.
  • hybridization incubation times are from 5 minutes to 24 hours, with 1, 2, or more washing steps, and wash incubation times are about 1, 2, or 15 minutes.
  • SSC is 0.15 M NaCl and 15 mM citrate buffer. It is understood that equivalents of SSC using other buffer systems can be employed.
  • Homology or“identity” or“similarity” refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An “unrelated” or“non-homologous” sequence shares less than 40% identity, or alternatively less than 25% identity, with one of the sequences of the present invention.
  • a cell of the disclosure is a prokaryotic cell.
  • a cell of the disclosure is a eukaryotic cell.
  • the cell is a mammalian cell.
  • the cell is a bovine, murine, feline, equine, porcine, canine, simian, or human cell.
  • the cell is a non-human mammalian cell such as a non human primate cell.
  • a cell of the disclosure is a somatic cell. In some embodiments,
  • a cell of the disclosure is a germline cell. In some embodiments, a germline cell of the disclosure is not a human cell.
  • a cell of the disclosure is a stem cell.
  • a cell of the disclosure is an embryonic stem cell.
  • an embryonic stem cell of the disclosure is not a human cell.
  • a cell of the disclosure is a multipotent stem cell or a pluripotent stem cell.
  • a cell of the disclosure is an adult stem cell.
  • a cell of the disclosure is an induced pluripotent stem cell (iPSC).
  • a cell of the disclosure is a hematopoietic stem cell (HSC).
  • a somatic cell is an ocular cell.
  • An ocular cell includes, without limitation, corneal epithelial cells, keratyocytes, retinal pigment epithelial (RPE) cells, lens epithelial cells, iris pigment epithelial cells, conjunctival fibroblasts, non-pigmented ciliary epithelial cells, trabecular meshwork cells, ocular choroid fibroblasts, conjunctival epithelial cells,
  • an ocular cell is a retinal cell or a corneal cell.
  • a retinal cell is a photoreceptor cell or a retinal pigment epithelial cell.
  • a retinal cell is a ganglion cell, an amacrine cell, a bipolar cell, a horizontal cell, a Miiller glial cell, a rod cell, or a cone cell.
  • a somatic cell of the disclosure is an immune cell.
  • an immune cell of the disclosure is a lymphocyte.
  • an immune cell of the disclosure is a T lymphocyte (also referred to herein as a T-cell).
  • Exemplary T-cells of the disclosure include, but are not limited to, naive T cells, effector T cells, helper T cells, memory T cells, regulatory T cells (Tregs) and Gamma delta T cells.
  • an immune cell of the disclosure is a B lymphocyte.
  • an immune cell of the disclosure is a natural killer cell.
  • an immune cell of the disclosure is an antigen- presenting cell.
  • a somatic cell of the disclosure is a muscle cell.
  • a muscle cell of the disclosure is a myoblast or a myocyte.
  • a muscle cell of the disclosure is a cardiac muscle cell, skeletal muscle cell or smooth muscle cell.
  • a muscle cell of the disclosure is a striated cell.
  • a somatic cell of the disclosure is an epithelial cell.
  • an epithelial cell of the disclosure forms a squamous cell epithelium, a cuboidal cell epithelium, a columnar cell epithelium, a stratified cell epithelium, a pseudostratified columnar cell epithelium or a transitional cell epithelium.
  • an epithelial cell of the disclosure forms a gland including, but not limited to, a pineal gland, a thymus gland, a pituitary gland, a thyroid gland, an adrenal gland, an apocrine gland, a holocrine gland, a merocrine gland, a serous gland, a mucous gland and a sebaceous gland.
  • an epithelial cell of the disclosure contacts an outer surface of an organ including, but not limited to, a lung, a spleen, a stomach, a pancreas, a bladder, an intestine, a kidney, a gallbladder, a liver, a larynx or a pharynx.
  • an epithelial cell of the disclosure contacts an outer surface of a blood vessel or a vein.
  • a somatic cell of the disclosure is a neuronal cell.
  • a neuron cell of the disclosure is a neuron of the central nervous system.
  • a neuron cell of the disclosure is a neuron of the brain or the spinal cord.
  • a neuron cell of the disclosure is a neuron of the retina.
  • a neuron cell of the disclosure is a neuron of a cranial nerve or an optic nerve.
  • a neuron cell of the disclosure is a neuron of the peripheral nervous system.
  • a neuron cell of the disclosure is a neuroglial or a glial cell.
  • a glial of the disclosure is a glial cell of the central nervous system including, but not limited to, oligodendrocytes, astrocytes, ependymal cells, and microglia.
  • a glial of the disclosure is a glial cell of the peripheral nervous system including, but not limited to, Schwann cells and satellite cells.
  • a somatic cell of the disclosure is a primary cell.
  • a somatic cell of the disclosure is a cultured cell.
  • a somatic cell of the disclosure is in vivo, in vitro, ex vivo or in situ.
  • a somatic cell of the disclosure is autologous or allogeneic.
  • the disclosure provides a method of modifying level of expression of an RNA molecule of the disclosure or a protein encoded by the RNA molecule comprising contacting the composition of the disclosure and the RNA molecule under conditions suitable for binding of one or more of the guide RNA or the RNA-binding protein or RNA-binding fusion protein (or a portion thereof) to the RNA molecule.
  • the disclosure provides a method of modifying an activity of a protein encoded by an RNA molecule comprising contacting the composition of the disclosure and the RNA molecule under conditions suitable for binding of one or more of the guide RNA or the RNA- binding protein or the fusion protein (or a portion thereof) to the RNA molecule.
  • the disclosure provides a method of modifying level of expression of an RNA molecule of the disclosure or a protein encoded by the RNA molecule comprising contacting the composition of the disclosure and a cell comprising the RNA molecule under conditions suitable for binding of one or more of the guide RNA or the RNA-binding protein or fusion protein (or a portion thereof) to the RNA molecule.
  • the cell is in vivo, in vitro, ex vivo or in situ.
  • the composition of the disclosure comprises a vector comprising a guide RNA of the disclosure and an RNA-binding protein or fusion protein of the disclosure and the therapeutic replacement protein of the disclosure.
  • the vector is an AAV.
  • the disclosure provides a method of modifying an activity of a protein encoded by an RNA molecule comprising contacting the composition of the disclosure and a cell comprising the RNA molecule under conditions suitable for binding of one or more of the guide RNA or the RNA-binding protein or fusion protein (or a portion thereof) to the RNA molecule.
  • the cell is in vivo, in vitro, ex vivo or in situ.
  • the composition of the disclosure comprises a vector comprising a guide RNA or a single guide RNA sequence of the disclosure and a nucleic acid sequence encoding the RNA-binding protein or fusion protein of the disclosure and the therapeutic replacement protein of the disclosure.
  • the vector is an AAV.
  • the disclosure provides a method of modifying the level of expression of an RNA molecule of the disclosure or a protein encoded by the RNA molecule comprising contacting the composition of the disclosure and the RNA molecule under conditions suitable for RNA nuclease activity wherein the RNA-binding protein or fusion protein induces a break in the RNA molecule.
  • the disclosure provides a method of modifying an activity of a protein encoded by an RNA molecule comprising contacting the composition of the disclosure and the RNA molecule under conditions suitable for RNA nuclease activity wherein the RNA-binding protein or fusion protein induces a break in the RNA molecule.
  • the disclosure provides a method of modifying a level of expression of an RNA molecule of the disclosure or a protein encoded by the RNA molecule comprising contacting the composition of the disclosure and a cell comprising the RNA molecule under conditions suitable for RNA nuclease activity wherein the RNA-binding protein or fusion protein induces a break in the RNA molecule.
  • the composition of the disclosure additionally provides a replacement therapeutic protein which corresponds to a pathogenic RNA comprising a target RNA.
  • the cell is in vivo, in vitro, ex vivo or in situ.
  • the composition comprises a vector comprising composition comprising a guide RNA of the disclosure, an RNA-binding fusion protein of the disclosure, and a therapeutic replacement protein of the disclosure.
  • the vector is an AAV.
  • the disclosure provides a method of modifying an activity of a protein encoded by an RNA molecule comprising contacting the composition and a cell comprising the RNA molecule under conditions suitable for RNA nuclease activity wherein the RNA-binding protein or fusion protein induces a break in the RNA molecule.
  • the cell is in vivo, in vitro, ex vivo or in situ.
  • the composition comprises a vector comprising composition comprising a guide RNA or a single guide RNA of the disclosure and a nucleic acid sequence encoding an RNA-binding protein or fusion protein of the disclosure and a therapeutic replacement protein.
  • the vector is an AAV.
  • the disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of a composition of the disclosure.
  • the disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of a composition of the disclosure, wherein the composition comprises a vector comprising composition comprising a guide RNA of the disclosure and a nucleic acid sequence encoding an RNA-binding protein or fusion protein of the disclosure and a therapeutic replacement protein of the disclosure, wherein the composition modifies, reduces or ablates a level of expression of a pathogenic target RNA of an RNA molecule of the disclosure or a protein encoded by the RNA molecule (compared to the level of expression of a corresponding wild-type protein), and wherein the therapeutic protein replaces gain-or-loss-of-function mutations encoded by the pathogenic RNA.
  • the disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of a composition of the disclosure, wherein the composition comprises a vector comprising composition comprising a guide RNA of the disclosure and a nucleic acid sequence encoding an RNA-binding protein or fusion protein of the disclosure and a therapeutic replacement protein of the disclosure, wherein the composition modifies, reduces or ablates a level of expression of a pathogenic target RNA of an RNA molecule of the disclosure or a protein encoded by the RNA molecule (compared to the level of expression of a corresponding wild-type protein), and wherein the therapeutic protein replaces gain-or-loss-of-function mutations encoded by the pathogenic RNA.
  • a disease or disorder includes, without limitation, a disease or disorder related to rhodopsin expression or lack thereof.
  • the disease or disorder is a retinal degenerative disorder or retinopathy.
  • the retinal degenerative disorder is retinitis pigmentosa.
  • Retinitis pigmentosa is an autosomal dominant disorder caused by gain-or-loss-of- function mutations in the rhodopsin gene. Loss of rod photoreceptor cells which express rhodopsin leads to loss of cone photoreceptor cells which causes a degenerative loss of vision. Mutations in the human rhodopsin gene affect the protein’s folding, trafficking and activity which most often triggers retinal degeneration in afflicted patients. A single base- substitution at codon position 23 in the human opsin gene (P23H) is also a common cause of retinitis pigmentosa.
  • Retinitis pigmentosa is one of the most common forms of inherited retinal degeneration with a prevalence of 1 in 4000. The disease is the result of varying inheritance patterns (autosomal dominant, autosomal recessive, and X-linked) depending on the mutated gene.
  • a disease or disorder of the disclosure includes, but is not limited to, a genetic disease or disorder.
  • the genetic disease or disorder is a single-gene disease or disorder.
  • the single-gene disease or disorder is an autosomal dominant disease or disorder, an autosomal recessive disease or disorder, an X-chromosome linked (X-linked) disease or disorder, an X-linked dominant disease or disorder, an X-linked recessive disease or disorder, a Y-linked disease or disorder or a mitochondrial disease or disorder.
  • the genetic disease or disorder is a multiple-gene disease or disorder.
  • the genetic disease or disorder is a multiple-gene disease or disorder.
  • the single-gene disease or disorder is an autosomal dominant disease or disorder including, but not limited to, Huntington's disease, neurofibromatosis type 1, neurofibromatosis type 2, Marfan syndrome, hereditary nonpolyposis colorectal cancer, hereditary multiple exostoses, Von Willebrand disease, and acute intermittent porphyria.
  • the single-gene disease or disorder is an autosomal recessive disease or disorder including, but not limited to, Albinism, Medium-chain acyl-CoA dehydrogenase deficiency, cystic fibrosis, sickle-cell disease, Tay-Sachs disease, Niemann-Pick disease, spinal muscular atrophy, and Roberts syndrome.
  • the single-gene disease or disorder is X-linked disease or disorder including, but not limited to, muscular dystrophy, Duchenne muscular dystrophy, Hemophilia, Adrenoleukodystrophy (ALD), Rett syndrome, and Hemophilia A.
  • the single-gene disease or disorder is a mitochondrial disorder including, but not limited to, Leber's hereditary optic neuropathy.
  • a disease or disorder of the disclosure includes, but is not limited to, an immune disease or disorder.
  • the immune disease or disorder is an immunodeficiency disease or disorder including, but not limited to, B-cell deficiency, T-cell deficiency, neutropenia, asplenia, complement deficiency, acquired immunodeficiency syndrome (AIDS) and immunodeficiency due to medical intervention (immunosuppression as an intended or adverse effect of a medical therapy).
  • the immune disease or disorder is an autoimmune disease or disorder including, but not limited to, Achalasia, Addison’s disease, Adult Still's disease, Agammaglobulinemia, Alopecia areata, Amyloidosis, Anti- GBM/Anti-TBM nephritis, Antiphospholipid syndrome, Autoimmune angioedema, Autoimmune dysautonomia, Autoimmune encephalomyelitis, Autoimmune hepatitis, Autoimmune inner ear disease (AIED), Autoimmune myocarditis, Autoimmune oophoritis, Autoimmune orchitis, Autoimmune pancreatitis, Autoimmune retinopathy, Autoimmune urticaria, Axonal & neuronal neuropathy (AMAN), Balo disease, Behcet’s disease, Benign mucosal pemphigoid, Bullous pemphigoid, Castleman disease (CD), Celiac disease, Cha
  • Granulomatosis Cicatricial pemphigoid, Cogan’s syndrome, Cold agglutinin disease, Congenital heart block, Coxsackie myocarditis, CREST syndrome, Crohn’s disease, Dermatitis herpetiformis, Dermatomyositis, Devic’s disease (neuromyelitis optica), Discoid lupus, Dressier’ s syndrome, Endometriosis, Eosinophilic esophagitis (EoE), Eosinophilic fasciitis, Erythema nodosum, Essential mixed cryoglobulinemia, Evans syndrome,
  • Fibromyalgia Fibrosing alveolitis
  • Giant cell arteritis temporary arteritis
  • Giant cell myocarditis Glomerulonephritis
  • Goodpasture’s syndrome Granulomatosis with
  • hemoglobinuria PNH
  • Parry Romberg syndrome Pars planitis (peripheral uveitis)
  • Parsonnage-Tumer syndrome Pemphigus
  • Peripheral neuropathy Perivenous
  • PA Pernicious anemia
  • POEMS syndrome Polyarteritis nodosa
  • Polyglandular syndromes type I, II, III Polymyalgia rheumatica
  • Polymyositis
  • Postmyocardial infarction syndrome Postpericardiotomy syndrome, Primary biliary cirrhosis, Primary sclerosing cholangitis, Progesterone dermatitis, Psoriasis, Psoriatic arthritis, Pure red cell aplasia (PRC A), Pyoderma gangrenosum, Raynaud’s phenomenon, Reactive Arthritis, Reflex sympathetic dystrophy, Relapsing polychondritis, Restless legs syndrome (RLS), Retroperitoneal fibrosis, Rheumatic fever, Rheumatoid arthritis,
  • Sarcoidosis Schmidt syndrome, Scleritis, Scleroderma, Sjogren’s syndrome, Sperm & testicular autoimmunity, Stiff person syndrome (SPS), Subacute bacterial endocarditis (SBE), Susac’s syndrome, Sympathetic ophthalmia (SO), Takayasu’s arteritis, Temporal
  • TTP Thrombocytopenic purpura
  • TITS Tolosa-Hunt syndrome
  • TITS Transverse myelitis
  • Type 1 diabetes Ulcerative colitis
  • UCTD Undifferentiated connective tissue disease
  • UCTD Undifferentiated connective tissue disease
  • Vasculitis Vitiligo
  • Vogt-Koyanagi-Harada Disease AAT (alpha 1 anti -trypsin deficiency)
  • Wegener’s granulomatosis Wilson disease
  • Hereditary Hemochromatosis Types 1-5 Type I tyrosinemia, Argininosuccinate Lyase Deficiency
  • Glycogen storage disease type I- VIII Citrin deficiency
  • Cholesteryl ester storage disease progressive familial intrahepatic cholestasis type 3, polycystic kidney disease, Alstrom syndrome, and Congenital hepatic fibrosis.
  • a disease or disorder of the disclosure includes, but is not limited to, an inflammatory disease or disorder.
  • a disease or disorder of the disclosure includes, but is not limited to, a metabolic disease or disorder.
  • the metabolic disease or disorder is related to inborn errors of the metabolism.
  • the metabolic disease or disorder related to inborn errors of the metabolism include, without limitation, disorders of amino acid metabolism, disorders of carbohydrate metabolism, disorder or defects of urea cycle, disorders of organic acid metabolism (e.g., organic acidurias), disorders of fatty acid oxidation and mitochondrial metabolism, disorders of porphyrin metabolism, disorders of purine or pyrimidine
  • a disease or disorder of the disclosure includes, but is not limited to, mitochondrial diseases.
  • the mitochondrial disease includes, but is not limited to, Leber’s hereditary optic neuropathy (LHON), Leigh’s disease or syndrome, Neuropathy, Ataxia, and Retinitis Pigmentosa (NARP), Keams-Sayre syndrome (KSS), Pearson syndrome, Chronic
  • a disease or disorder of the disclosure includes, but is not limited to, a degenerative or a progressive disease or disorder.
  • the degenerative or a progressive disease or disorder includes, but is not limited to, amyotrophic lateral sclerosis (ALS), Huntington’s disease, Alzheimer’s disease, and aging.
  • a disease or disorder of the disclosure includes, but is not limited to, an infectious disease or disorder.
  • a disease or disorder of the disclosure includes, but is not limited to, a pediatric or a developmental disease or disorder.
  • a disease or disorder of the disclosure includes, but is not limited to, a cardiovascular disease or disorder.
  • a disease or disorder of the disclosure includes, but is not limited to, a proliferative disease or disorder.
  • the proliferative disease or disorder is a cancer.
  • the cancer includes, but is not limited to, Acute Lymphoblastic Leukemia (ALL), Acute Myeloid Leukemia (AML), Adrenocortical Carcinoma, AIDS-Related Cancers, Kaposi Sarcoma (Soft Tissue Sarcoma), AIDS-Related Lymphoma (Lymphoma), Primary CNS Lymphoma (Lymphoma), Anal Cancer, Appendix Cancer, Gastrointestinal Carcinoid Tumors, Astrocytomas, Atypical Teratoid/Rhabdoid Tumor, Central Nervous System (Brain Cancer), Basal Cell Carcinoma, Bile Duct Cancer, Bladder Cancer, Bone Cancer, Ewing Sarcoma, Osteosarcoma, Malignant
  • CML Myelogenous Leukemia
  • Chronic Myeloproliferative Neoplasms Colorectal Cancer
  • Craniopharyngioma Cutaneous T-Cell Lymphoma
  • Ductal Carcinoma In situ Embryonal Tumors
  • Endometrial Cancer Uterine Cancer
  • Ependymoma Esophageal Cancer
  • Extracranial Germ Cell Tumor Extragonadal Germ Cell Tumor, Eye Cancer, Childhood Intraocular Melanoma, Intraocular Melanoma, Retinoblastoma, Fallopian Tube Cancer, Fibrous Histiocytoma of Bone, Malignant, and Osteosarcoma, Gallbladder Cancer, Gastric (Stomach) Cancer, Gastrointestinal Carcinoid Tumor, Gastrointestinal Stromal Tumors (GIST) (Soft Tissue Sarcoma), Childhood Gastrointestinal Stromal Tumors, Germ Cell Tumors, Childhood Extracranial Germ Cell Tumors, Extragonadal Germ Cell Tumors, Ovarian Germ Cell Tumors, Testicular Cancer, Gestational Trophoblastic Disease, Hairy Cell Leukemia, Head and Neck Cancer, Heart Tumors, Hepatocellular (Liver) Cancer,
  • Nasopharyngeal Cancer Head and Neck Cancer
  • Neuroblastoma Non-Hodgkin Lymphoma
  • Non-Small Cell Lung Cancer Oral Cancer
  • Lip and Oral Cavity Cancer and Oropharyngeal Cancer Osteosarcoma and Malignant Fibrous Histiocytoma of Bone, Ovarian Cancer, Pancreatic Cancer, Pancreatic Neuroendocrine Tumors (Islet Cell Tumors), Papillomatosis, Paraganglioma, Parathyroid Cancer, Penile Cancer, Pharyngeal Cancer (Head and Neck Cancer), Pheochromocytoma , Plasma Cell Neoplasm/Multiple Myeloma, Pleuropulmonary Blastoma, Pregnancy and Breast Cancer, Primary Central Nervous System (CNS)
  • CNS Central Nervous System
  • Lymphoma Primary Peritoneal Cancer, Prostate Cancer, Rectal Cancer, Recurrent Cancer, Renal Cell (Kidney) Cancer, Retinoblastoma, Rhabdomyosarcoma, Childhood (Soft Tissue Sarcoma), Salivary Gland Cancer (Head and Neck Cancer), Sarcoma, Childhood
  • Osteosarcoma (Bone Cancer), Uterine Sarcoma, Sezary Syndrome, Lymphoma, Skin Cancer, Small Cell Lung Cancer, Small Intestine Cancer, Soft Tissue Sarcoma, Squamous Cell Carcinoma of the Skin, Squamous Neck Cancer, Stomach (Gastric) Cancer, T-Cell
  • Lymphoma Testicular Cancer, Throat Cancer (Head and Neck Cancer), Nasopharyngeal Cancer, Oropharyngeal Cancer, Hypopharyngeal Cancer, Thymoma and Thymic Carcinoma , Thyroid Cancer, Transitional Cell Cancer of the Renal Pelvis and Ureter, Renal Cell Cancer, Urethral Cancer, Uterine Sarcoma, Vaginal Cancer, Vascular Tumors (Soft Tissue Sarcoma), Vulvar Cancer, Wilms Tumor and Other Childhood Kidney Tumors.
  • a subject of the disclosure has been diagnosed with the disease or disorder.
  • the subject of the disclosure presents at least one sign or symptom of the disease or disorder.
  • the subject has a biomarker predictive of a risk of developing the disease or disorder.
  • the biomarker is a genetic mutation.
  • a subject of the disclosure is female. In some embodiments of the methods of the disclosure, a subject of the disclosure is male. In some embodiments, a subject of the disclosure has two XX or XY chromosomes. In some embodiments, a subject of the disclosure has two XX or XY chromosomes and a third chromosome, either an X or a Y.
  • a subject of the disclosure is a neonate, an infant, a child, an adult, a senior adult, or an elderly adult. In some embodiments of the methods of the disclosure, a subject of the disclosure is a neonate, an infant, a child, an adult, a senior adult, or an elderly adult. In some
  • a subject of the disclosure is at least 1, 2, 3, 4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27,28, 29, 30 or 31 days old. In some embodiments of the methods of the disclosure, a subject of the disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months old. In some embodiments of the methods of the disclosure, a subject of the disclosure is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or any number of years or partial years in between of age.
  • a subject of the disclosure is a mammal. In some embodiments, a subject of the disclosure is a non-human mammal.
  • a subject of the disclosure is a human.
  • a therapeutically effective amount comprises a single dose of a composition of the disclosure. In some embodiments, a therapeutically effective amount comprises a therapeutically effective amount comprises at least one dose of a composition of the disclosure. In some embodiments, a therapeutically effective amount comprises a therapeutically effective amount comprises one or more dose(s) of a composition of the disclosure. [0688] In some embodiments of the methods of the disclosure, a therapeutically effective amount eliminates a sign or symptom of the disease or disorder. In some embodiments, a therapeutically effective amount reduces a severity of a sign or symptom of the disease or disorder.
  • a therapeutically effective amount eliminates the disease or disorder.
  • a therapeutically effective amount prevents an onset of a disease or disorder. In some embodiments, a therapeutically effective amount delays the onset of a disease or disorder. In some embodiments, a therapeutically effective amount reduces the severity of a sign or symptom of the disease or disorder. In some embodiments, a therapeutically effective amount improves a prognosis for the subject.
  • a composition of the disclosure is administered to the subject systemically. In some embodiments, the composition of the disclosure is administered to the subject by an intravenous route. In some
  • composition of the disclosure is administered to the subject by an injection or an infusion.
  • composition of the disclosure is administered to the subject locally.
  • composition of the disclosure is administered to the subject by an intraosseous, intraocular,
  • composition of the disclosure is administered directly to the cerebral spinal fluid of the central nervous system.
  • the composition of the disclosure is administered directly to a tissue or fluid of the eye and does not have bioavailability outside of ocular structures. In some embodiments, the composition of the disclosure is administered to the subject by an injection or an infusion.
  • compositions disclosed herein are formulated as pharmaceutical compositions.
  • pharmaceutical compositions for use as disclosed herein may comprise a protein(s) or a polynucleotide encoding the protein(s), optionally comprised in an AAV, which is optionally also immune orthogonal, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients.
  • compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.
  • buffers such as neutral buffered saline, phosphate buffered saline and the like
  • carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol
  • proteins such as glucose, mannose, sucrose or dextrans, mannitol
  • proteins such as glucose, mannose, sucrose or dextrans, mannitol
  • proteins such as glucose, mannose, sucrose or dextrans, mannitol
  • proteins such as glucose, mannose, sucrose or dextrans, mannitol
  • proteins such as glucose, mannose
  • compositions of the disclosure may be formulated for routes of administration, such as e.g., oral, enteral, topical, transdermal, intranasal, and/or inhalation; and for routes of
  • intraocular administration via injection or infusion such as, e.g., intravenous, intramuscular, subpial, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular, and/or parenteral administration.
  • intraocular administration via injection or infusion such as, e.g., intravenous, intramuscular, subpial, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular, and/or parenteral administration.
  • intraocular administration via injection or infusion
  • intraocular such as, e.g., intravenous, intramuscular, subpial, intrathecal, intrastriatal, subcutaneous, intradermal, intraperitoneal, intratumoral, intravenous, intraocular, and/or parenteral administration.
  • intraocular administration via injection or infusion
  • intraocular administration via injection or infusion
  • intraocular such as, e
  • administration includes, without limitation, subretinal, intravitreal, deep intravitreal, or topical (via eye drops) administration.
  • subretinal injection targets photoreceptors and RPE (retinal pigment epithelium) cells.
  • the compositions of the present disclosure are formulated for intravenous administration.
  • Embodiment 1 A composition comprising a nucleic acid sequence encoding an RNA-guided target RNA knockdown and replacement therapeutic comprising (a) an RNA- binding polypeptide or portion thereof; and (b) a therapeutic protein, wherein the RNA- binding polypeptide binds and cleaves a target RNA when guided by a gRNA sequence, wherein a pathogenic RNA comprises the target RNA, and wherein the therapeutic protein is a replacement of gain-or-loss-of-function mutations encoded by the pathogenic RNA.
  • a composition comprising a nucleic acid sequence encoding a target RNA knockdown and replacement therapeutic comprising (a) an RNA-binding polypeptide or portion thereof; and (b) a therapeutic protein, wherein the RNA-binding polypeptide binds and cleaves a target RNA, wherein a pathogenic RNA comprises the target RNA, and wherein the therapeutic protein is a replacement of gain-or-loss-of-function mutations encoded by the pathogenic RNA.
  • a composition comprising a nucleic acid sequence encoding a target RNA knockdown and replacement therapeutic comprising (a) an RNA-binding polypeptide or portion thereof; and (b) a therapeutic protein, wherein the RNA-binding polypeptide binds and cleaves a target RNA, wherein a pathogenic RNA comprises the target RNA, and wherein the pathogenic RNA encodes one or more gain-of-function rhodopsin mutations, and wherein the therapeutic protein is wild-type rhodopsin or“hardened” rhodopsin which replaces the gain-or-loss-of-function rhodopsin mutations.
  • Embodiment 2 Embodiment 2.
  • composition of embodiment 1, wherein the therapeutic protein is selected from the group consisting of rhodopsin (Retinitis Pigmentosa), PRPF3 (Retinitis Pigmentosa), PRPF31 (autosomal dominant Retinitis Pigmentosa), GRN (FTD), SOD1 (ALS), PMP22 (Charcot Marie Tooth Disease), PABPN1 (Oculopharangeal Muscular Dystrophy), KCNQ4 (Hearing Loss), CLRN1 (Usher Syndrome), APOE2 (Alzheimer’s Disease), APOE4 (Alzheimer’s Disease), BEST1 (Eye Disease), MYBPC3 (Familial Cardiomyopathy), TNNT2 (Familial Cardiomyopathy), and TNNI3 (Familial
  • Embodiment 3 The composition of embodiment 1 or 2, wherein the pathogenic target sequence comprises or encodes at least one gain-or-loss-of-function mutation.
  • Embodiment 4 The composition of embodiment 1, wherein the sequence comprising the gRNA comprises a promoter capable of expressing the gRNA in a eukaryotic cell.
  • Embodiment 5 The composition of embodiment 4, wherein the eukaryotic cell is an animal cell.
  • Embodiment 6 The composition of embodiment 4, wherein the animal cell is a mammalian cell.
  • Embodiment 7 The composition of embodiment 5, wherein the animal cell is a human cell.
  • Embodiment 8 The composition of any one of embodiments 1-7, wherein the promoter is a constitutively active promoter.
  • Embodiment 9 The composition of any one of embodiments 1-7, wherein the promoter is isolated or derived from a promoter capable of driving expression of an RNA polymerase.
  • Embodiment 9 The composition of embodiment 9, wherein the promoter is isolated or derived from a U6 promoter.
  • Embodiment 10 The composition of any one of embodiments 1-9, wherein the promoter is isolated or derived from a promoter capable of driving expression of a transfer RNA (tRNA).
  • tRNA transfer RNA
  • Embodiment 11 The composition of embodiment 10, wherein the promoter is isolated or derived from an alanine tRNA promoter, an arginine tRNA promoter, an asparagine tRNA promoter, an aspartic acid tRNA promoter, a cysteine tRNA promoter, a glutamine tRNA promoter, a glutamic acid tRNA promoter, a glycine tRNA promoter, a histidine tRNA promoter, an isoleucine tRNA promoter, a leucine tRNA promoter, a lysine tRNA promoter, a methionine tRNA promoter, a phenylalanine tRNA promoter, a proline tRNA promoter, a serine tRNA promoter, a threonine tRNA promoter, a tryptophan tRNA promoter, a tyrosine tRNA promoter, or a valine tRNA promoter.
  • Embodiment 12 The composition of embodiment 11, wherein the promoter is isolated or derived from a valine tRNA promoter.
  • Embodiment 13 The composition of any one of embodiments 1-12, wherein the sequence comprising the gRNA comprises a spacer sequence that specifically binds to the target RNA sequence.
  • Embodiment 14 The composition of embodiment 13, wherein the spacer sequence has at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 87%, 90%, 95%, 97%, 99% or any percentage in between of complementarity to the target RNA sequence.
  • Embodiment 15 The composition of embodiment 14, wherein the spacer sequence has 100% complementarity to the target RNA sequence.
  • Embodiment 16 The composition of any one of embodiments 13-15, wherein the spacer sequence comprises or consists of 20 nucleotides.
  • Embodiment 17 The composition of any one of embodiments 13-15, wherein the spacer sequence comprises or consists of 26 nucleotides.
  • Embodiment 18 The composition of any one of embodiments 1-17, wherein the sequence comprising the gRNA comprises a direct repeat (DR) or scaffold sequence that specifically binds to the first RNA binding protein.
  • Embodiment 20 The composition of embodiment 18, wherein the scaffold sequence comprises a stem-loop structure.
  • Embodiment 21 The composition of embodiment 19 or 20, wherein the scaffold sequence comprises or consists of 90 nucleotides.
  • Embodiment 22 The composition of embodiment 19 or 20, wherein the scaffold sequence comprises or consists of 93 nucleotides.
  • Embodiment 23 The composition of embodiment 22, wherein the scaffold sequence comprises the sequence
  • Embodiment 24 The composition of embodiment 19, wherein the scaffold sequence comprises a step-loop structure.
  • Embodiment 25 The composition of embodiment 19, wherein the scaffold sequence comprises or consists of 85 nucleotides.
  • Embodiment 26 The composition of embodiment 25, wherein the scaffold sequence comprises the sequence
  • Embodiment 27 The composition of embodiment 19, wherein the sequence comprising the gRNA comprises a DR sequence that specifically binds to the first RNA binding protein.
  • Embodiment 28 The composition of embodiment 27, wherein the DR sequence comprises a stem-loop structure.
  • Embodiment 29 The composition of embodiment 27, wherein the DR sequence comprises or consists of about 20-36 nucleotides.
  • Embodiment 30 The composition of embodiment 27, wherein the scaffold sequence comprises or consists of 30-32 nucleotides.
  • Embodiment 31 The composition of embodiment 27, wherein the DR sequence comprises the nucleotide sequence comprising

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Virology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Cardiology (AREA)
  • Epidemiology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Psychiatry (AREA)
PCT/US2020/041634 2019-07-10 2020-07-10 Rna-targeting knockdown and replacement compositions and methods for use Ceased WO2021007529A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CA3145309A CA3145309A1 (en) 2019-07-10 2020-07-10 Rna-targeting knockdown and replacement compositions and methods for use
JP2022500898A JP2022540446A (ja) 2019-07-10 2020-07-10 Rna標的ノックダウン及び置換の組成物及び使用方法
EP20753516.2A EP3997227A1 (en) 2019-07-10 2020-07-10 Rna-targeting knockdown and replacement compositions and methods for use
AU2020310201A AU2020310201A1 (en) 2019-07-10 2020-07-10 RNA-targeting knockdown and replacement compositions and methods for use
CN202080061471.7A CN114450031A (zh) 2019-07-10 2020-07-10 靶向rna的敲低和替代组合物及使用方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201962872604P 2019-07-10 2019-07-10
US62/872,604 2019-07-10
US202062968819P 2020-01-31 2020-01-31
US62/968,819 2020-01-31

Publications (1)

Publication Number Publication Date
WO2021007529A1 true WO2021007529A1 (en) 2021-01-14

Family

ID=71995058

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/041634 Ceased WO2021007529A1 (en) 2019-07-10 2020-07-10 Rna-targeting knockdown and replacement compositions and methods for use

Country Status (7)

Country Link
US (1) US20210009987A1 (cg-RX-API-DMAC7.html)
EP (1) EP3997227A1 (cg-RX-API-DMAC7.html)
JP (1) JP2022540446A (cg-RX-API-DMAC7.html)
CN (1) CN114450031A (cg-RX-API-DMAC7.html)
AU (1) AU2020310201A1 (cg-RX-API-DMAC7.html)
CA (1) CA3145309A1 (cg-RX-API-DMAC7.html)
WO (1) WO2021007529A1 (cg-RX-API-DMAC7.html)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021214066A1 (en) * 2020-04-20 2021-10-28 Universität Regensburg Compositions for use in treating autosomal dominant best1-related retinopathies
WO2022221278A1 (en) * 2021-04-12 2022-10-20 Locanabio, Inc. Compositions and methods comprising hybrid promoters
WO2022241059A3 (en) * 2021-05-11 2022-12-29 Mammoth Biosciences, Inc. Effector proteins and methods of use
WO2025043278A1 (en) * 2023-08-25 2025-03-06 PYC Therapeutics Limited Gene-mediated conditions
WO2026010243A1 (ko) * 2024-07-03 2026-01-08 주식회사 아바타테라퓨틱스 Crispr/cas 시스템을 사용하는 best1 유전자 편집 방법
EP4493702A4 (en) * 2022-03-18 2026-04-01 Univ Florida METHODS AND COMPOSITIONS FOR TREATING TNNT2-RELATED CARDIOMYOPATHY WITH A VIRAL VECTOR

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011160052A2 (en) 2010-06-18 2011-12-22 The University Of North Carolina At Chapel Hill Methods and compositions for sequence specific rna endonucleases
EP4216964A4 (en) * 2020-09-24 2025-02-12 Ionis Pharmaceuticals, Inc. Compounds and methods for reducing apoe expression
EP4291654A2 (en) 2021-02-12 2023-12-20 Alnylam Pharmaceuticals, Inc. Superoxide dismutase 1 (sod1) irna compositions and methods of use thereof for treating or preventing superoxide dismutase 1- (sod1-) associated neurodegenerative diseases
WO2023015153A2 (en) * 2021-08-02 2023-02-09 President And Fellows Of Harvard College ANTISENSE OLIGONUCLEOTIDE TARGETING APOE ε4 AND USES THEREOF
EP4419688A2 (en) * 2021-10-21 2024-08-28 Prime Medicine, Inc. Genome editing compositions and methods for treatment of usher syndrome type 3
US12173368B2 (en) * 2022-03-11 2024-12-24 New England Biolabs, Inc. Compositions and analysis of dephosphorylated oligoribonucleotides
WO2023215761A1 (en) * 2022-05-03 2023-11-09 Tacit Therapeutics, Inc. Localization of trans-splicing nucleic acid molecules to and within the cellular nucleus
WO2024196955A2 (en) * 2023-03-20 2024-09-26 Duke University Apoe-targeted microglia-specific gene therapy for neurological diseases
WO2025043118A1 (en) * 2023-08-23 2025-02-27 Ohio State Innovation Foundation Making tiny rnas inside the cell
WO2025159427A1 (ko) * 2024-01-26 2025-07-31 서울대학교산학협력단 신규한 apoe 안티센스 올리고뉴클레오타이드 및 이의 용도
WO2025217591A1 (en) * 2024-04-12 2025-10-16 Strand Therapeutics Inc. Human-derived synthetic regulators and uses thereof

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008124724A1 (en) 2007-04-09 2008-10-16 University Of Florida Research Foundation, Inc. Raav vector compositions having tyrosine-modified capsid proteins and methods for use
WO2012006827A1 (zh) 2010-07-14 2012-01-19 中兴通讯股份有限公司 一种移动终端及其解锁方法
WO2012068627A1 (en) 2010-11-24 2012-05-31 The University Of Western Australia Peptides for the specific binding of rna targets
WO2013058404A1 (ja) 2011-10-21 2013-04-25 国立大学法人九州大学 Pprモチーフを利用したrna結合性蛋白質の設計方法及びその利用
US20160238593A1 (en) 2015-01-13 2016-08-18 Massachusetts Institute Of Technology Pumilio Domain-based Modular Protein Architecture for RNA Binding
WO2016176690A2 (en) * 2015-04-30 2016-11-03 The Trustees Of Columbia University In The City Of New York Gene therapy for autosomal dominant diseases
WO2018183403A1 (en) 2017-03-28 2018-10-04 Caribou Biosciences, Inc. Crispr-associated (cas) protein
WO2019006471A2 (en) 2017-06-30 2019-01-03 Arbor Biotechnologies, Inc. NOVEL CRISPR RNA TARGETING ENZYMES, SYSTEMS AND USES THEREOF
US20190062724A1 (en) 2017-08-22 2019-02-28 Salk Institute For Biological Studies Rna targeting methods and compositions

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2058401A1 (en) * 2007-10-05 2009-05-13 Genethon Widespread gene delivery to motor neurons using peripheral injection of AAV vectors
US9951349B2 (en) * 2011-09-27 2018-04-24 Yale University Compositions and methods for transient expression of recombinant RNA
US9850269B2 (en) * 2014-04-25 2017-12-26 Translate Bio, Inc. Methods for purification of messenger RNA
EP3858992A1 (en) * 2015-03-13 2021-08-04 The Jackson Laboratory A three-component crispr/cas complex system and uses thereof
CN108690861A (zh) * 2017-04-10 2018-10-23 肖晓莺 用于早期乳腺癌症诊断的微小核糖核酸

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008124724A1 (en) 2007-04-09 2008-10-16 University Of Florida Research Foundation, Inc. Raav vector compositions having tyrosine-modified capsid proteins and methods for use
WO2012006827A1 (zh) 2010-07-14 2012-01-19 中兴通讯股份有限公司 一种移动终端及其解锁方法
WO2012068627A1 (en) 2010-11-24 2012-05-31 The University Of Western Australia Peptides for the specific binding of rna targets
US9580714B2 (en) 2010-11-24 2017-02-28 The University Of Western Australia Peptides for the specific binding of RNA targets
WO2013058404A1 (ja) 2011-10-21 2013-04-25 国立大学法人九州大学 Pprモチーフを利用したrna結合性蛋白質の設計方法及びその利用
US20160238593A1 (en) 2015-01-13 2016-08-18 Massachusetts Institute Of Technology Pumilio Domain-based Modular Protein Architecture for RNA Binding
WO2016176690A2 (en) * 2015-04-30 2016-11-03 The Trustees Of Columbia University In The City Of New York Gene therapy for autosomal dominant diseases
WO2018183403A1 (en) 2017-03-28 2018-10-04 Caribou Biosciences, Inc. Crispr-associated (cas) protein
WO2019006471A2 (en) 2017-06-30 2019-01-03 Arbor Biotechnologies, Inc. NOVEL CRISPR RNA TARGETING ENZYMES, SYSTEMS AND USES THEREOF
US20190062724A1 (en) 2017-08-22 2019-02-28 Salk Institute For Biological Studies Rna targeting methods and compositions
WO2019040664A1 (en) 2017-08-22 2019-02-28 Salk Institute For Biological Studies RNA TARGETING METHODS AND COMPOSITIONS

Non-Patent Citations (20)

* Cited by examiner, † Cited by third party
Title
"Therapeutic Targets of the TNF Superfamily", vol. 723, 11 November 2011, SPRINGER NEW YORK, New York, NY, ISBN: 978-0-38-789520-8, ISSN: 0065-2598, article HAOYU MAO ET AL.: "Gene delivery of wild-type Rhodopsin rescues retinal function in an autosomal dominant retinitis pigmentosa mouse model", pages: 199 - 205, XP055183733, DOI: 10.1007/978-1-4614-0631-0_27 *
ABIL ZDENARD CAZHAO H.: "Modular assembly of designer PUF proteins for specific post-transcriptional regulation of endogenous RNA", JOURNAL OF BIOLOGICAL ENGINEERING, vol. 8, no. 1, 2014, pages 7, XP021179053, DOI: 10.1186/1754-1611-8-7
CHEONG, C. G.HALL, T. M., PNAS, vol. 103, 2006, pages 13635 - 13639
DONG, S. ET AL.: "Specific and modular binding code for cytosine recognition in Pumilio/FBF (PUF) RNA-binding domains", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 286, 2011, pages 26732 - 26742, XP055064475, DOI: 10.1074/jbc.M111.244889
DURAND ET AL., VIRUSES, vol. 3, no. 2, 2011, pages 132 - 159
FILIPOVSKA ARACKHAM O: "Modular recognition of nucleic acids by PUF, TALE and PPR proteins", MOLECULAR BIOSYSTEMS, vol. 8, no. 3, 2012, pages 699 - 708, XP055071307, DOI: 10.1039/c2mb05392f
FILIPOVSKA ARAZIF MFNYGARD KKRACKHAM O: "A universal code for RNA recognition by PUF proteins", NATURE CHEMICAL BIOLOGY, vol. 7, no. 7, 2011, pages 425 - 427
KATARZYNA ET AL., PNAS, vol. 113, no. 19, 2016, pages E2579 - E2588
KOH YYWANG YQIU COPPERMAN LGROSS LTANAKA HALL TMWICKENS M: "Stacking Interactions in PUF-RNA Complexes", RNA, vol. 17, no. 4, 2011, pages 718 - 727
KONERMANN ET AL., CELL, vol. 173, no. 3, 2018, pages 665 - 676
O'CONNELL ET AL., NATURE, vol. 516, 2014, pages 263 - 266
SHINODA KTSUJI SFUTAKI SIMANISHI M: "Nested PUF Proteins: Extending Target RNA Elements for Gene Regulation", CHEMBIOCHEM, vol. 19, no. 2, 2018, pages 171 - 176
STRYER: "Biochemistry", 1988, W.H. 5 FREEMAN AND CO.
TRONO D.: "Lentiviral vectors", 2002, SPRING-VERLAG
TSAI YI-TING ET AL.: "Clustered Regularly Interspaced Short Palindromic Repeats-based genome surgery for the treatment of autosomal dominant retinitis pigmentosa", OPHTHALMOLOGY, ELSEVIER, AMSTERDAM, NL, vol. 125, no. 9, 11 May 2018 (2018-05-11), pages 1421 - 1430, XP085448365, ISSN: 0161-6420, DOI: 10.1016/J.OPHTHA.2018.04.001 *
TSAI YI-TING ET AL.: "supplemental online material", 11 May 2018 (2018-05-11), XP055741387, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6109419/> [retrieved on 20201019] *
WANG ET AL., NAT METHODS., vol. 6, no. 11, 2009, pages 825 - 830
WANG, X. ET AL., CELL, vol. 110, 2002, pages 501 - 512
YAN ET AL., MOL CELL, vol. 70, no. 2, 2018, pages 327 - 339
ZHAO YMAO MZHANG WWANG JLI HYANG YWANG ZWU J: "Expanding RNA binding specificity and affinity of engineered PUF domains", NUCLEIC ACIDS RESEARCH, vol. 46, no. 9, 2018, pages 4771 - 4782

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021214066A1 (en) * 2020-04-20 2021-10-28 Universität Regensburg Compositions for use in treating autosomal dominant best1-related retinopathies
US12590323B2 (en) 2020-04-20 2026-03-31 Universität Regensburg Compositions for use in treating autosomal dominant BEST1-related retinopathies
WO2022221278A1 (en) * 2021-04-12 2022-10-20 Locanabio, Inc. Compositions and methods comprising hybrid promoters
WO2022241059A3 (en) * 2021-05-11 2022-12-29 Mammoth Biosciences, Inc. Effector proteins and methods of use
EP4493702A4 (en) * 2022-03-18 2026-04-01 Univ Florida METHODS AND COMPOSITIONS FOR TREATING TNNT2-RELATED CARDIOMYOPATHY WITH A VIRAL VECTOR
WO2025043278A1 (en) * 2023-08-25 2025-03-06 PYC Therapeutics Limited Gene-mediated conditions
WO2026010243A1 (ko) * 2024-07-03 2026-01-08 주식회사 아바타테라퓨틱스 Crispr/cas 시스템을 사용하는 best1 유전자 편집 방법

Also Published As

Publication number Publication date
EP3997227A1 (en) 2022-05-18
US20210009987A1 (en) 2021-01-14
JP2022540446A (ja) 2022-09-15
AU2020310201A1 (en) 2022-01-27
CA3145309A1 (en) 2021-01-14
CN114450031A (zh) 2022-05-06

Similar Documents

Publication Publication Date Title
WO2021007529A1 (en) Rna-targeting knockdown and replacement compositions and methods for use
US10822617B2 (en) RNA-targeting fusion protein compositions and methods for use
US20220127621A1 (en) Fusion proteins and fusion ribonucleic acids for tracking and manipulating cellular rna
US20240344060A1 (en) Compositions and methods for the modulation of adaptive immunity
WO2023154807A2 (en) Compositions and methods for modulating pre-mrna splicing
US20220220473A1 (en) Protein translational control
US20220175960A1 (en) Fasl immunomodulatory gene therapy compositions and methods for use
US20240011026A1 (en) Rna editing via recruitment of spliceosome components
US20240209366A1 (en) High efficiency trans-splicing for replacement of targeted rna sequences in human cells
EP4255470A1 (en) Rna-targeting compositions and methods for treating cag repeat diseases
EP4519436A1 (en) Localization of trans-splicing nucleic acid molecules to and within the cellular nucleus
WO2022221278A1 (en) Compositions and methods comprising hybrid promoters
CN117320741A (zh) 用于治疗cag重复疾病的靶向rna的组合物和方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20753516

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3145309

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2022500898

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020310201

Country of ref document: AU

Date of ref document: 20200710

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2020753516

Country of ref document: EP

Effective date: 20220210

WWW Wipo information: withdrawn in national office

Ref document number: 2020753516

Country of ref document: EP