WO2021004456A1 - Improved genome editing system and use thereof - Google Patents

Abstract

Provided is a genome edited fusion polypeptide, with same comprising a CRISPR nuclease domain and a transcription activation domain. Also provided are a polynucleotide and an expression construct encoding the fusion polypeptide, a genome editing system comprising the fusion polypeptide, polynucleotide and/or expression construct, and a method for editing the genome of a cell by means of the genome editing system.

Description

Improved genome editing system and its applications Invention field

The invention relates to the field of genome editing. Specifically, the present invention relates to an improved genome editing system and its application. More specifically, the present invention provides a genome editing fusion polypeptide comprising a CRISPR nuclease domain and a transcription activation domain. The present invention also provides polynucleotides or expression constructs encoding the polypeptides, and genomic systems comprising the polypeptides, polynucleotides and/or constructs. The present invention also provides a method for editing cell genome using the genome editing system.

Background technique

The CRISPR/Cas9 system has been widely and successfully used in genome engineering of many eukaryotic species. However, in animal and plant cells, the editing efficiency of different genomic sites varies greatly. The low CRISPR/Cas9 editing efficiency at certain sites limits the availability of targets in vivo, thus limiting further applications.

Unlike prokaryotic DNA, eukaryotic genomic DNA wraps around histones and further compresses to form higher-order chromatin structures that may prevent Cas9 from binding to its target. Genome-wide mapping of the binding sites of catalytically inactivated Cas9 (dCas9) in mammalian cells shows that the binding sites are enriched in open chromatin regions. In addition, in human cells, CRISPR/Cas9 induces more insertions and deletions (indels) in open chromatin regions. In vitro and in vivo experiments have proved that Cas9 binding and cleavage are inhibited by the basic unit nucleosomes of chromatin. Similarly, in HEK293T, HeLa and human fibroblasts, Cas9-mediated genome editing is more effective in euchromatin regions than in heterochromatin regions. Interestingly, the chromatin structure has a more significant inhibitory effect on the off-target activity of CRISPR/Cas9. In contrast, chromatin accessibility was not found to affect CRISPR/Cas9 activity in zebrafish. Whether chromatin accessibility affects Cas9 editing in plant cells is unclear.

There are some studies trying to change local accessibility to improve Cas9 activity in vivo. The proxy-CRISPR strategy uses additional catalytically inactive SpCas9 (dCas9) to bind to nearby locations. This makes the target site accessible to FnCas9, CjCas9, NcCas9 and FnCpf1, thereby improving editing efficiency. However, this method relies on the accessible genome of SpCas9 and requires the co-expression of two different CRISPR-Cas systems, which inevitably increases the size of the vector and the difficulty of in vivo application.

Recently, a method called CRISPR-chrom, in which Cas9 orthologs are fused with chromatin regulatory peptides (CMP), significantly improves Cas9 editing efficiency, especially at refractory sites. CMP is a truncated form of endogenous protein, and it is not clear whether their overexpression has a dominant negative effect.

The art needs to provide further methods to improve the accessibility of eukaryotic organisms, especially plant genomic DNA to increase editing efficiency.

Summary of the invention

In one aspect, the present invention provides a genome editing fusion polypeptide, which comprises a CRISPR nuclease domain and a transcription activation domain.

In another aspect, the present invention also provides an isolated polynucleotide encoding the genome editing fusion polypeptide of the present invention.

In another aspect, the present invention also provides an expression vector, which comprises the polynucleotide of the present invention.

In another aspect, the present invention also provides a host cell, which contains the polynucleotide or expression vector of the present invention.

On the other hand, the present invention also provides a genome editing system, which comprises at least one of the following i) to v):

i) The genome editing fusion polypeptide and guide RNA of the present invention;

ii) The expression construct of the present invention, and the guide RNA;

iii) The genome editing fusion polypeptide of the present invention, and an expression construct containing a nucleotide sequence encoding a guide RNA;

iv) The expression construct of the present invention, and an expression construct comprising a nucleotide sequence encoding a guide RNA;

v) An expression construct comprising the polynucleotide of the present invention and a nucleotide sequence encoding a guide RNA.

In some embodiments, the genome editing system of the present invention further comprises or encodes a dsgRNA whose target site is 30-300 bp away from the sgRNA target site, preferably 40-270 bp, most preferably 115-120 bp.

On the other hand, the present invention also provides a host cell comprising the polynucleotide or expression vector of the present invention or the genome editing system of the present invention.

On the other hand, the present invention also provides a method for genetically modifying cells, including introducing the genome editing system of the present invention into cells, preferably plant cells.

Description of the drawings

Figure 1 shows the effect of chromatin accessibility on the efficiency of rice Cas9 genome editing. Figure 1a summarizes the number of CRISPR/Cas9-mediated mutations and chromatin accessibility at 70 target sites. The mutagenesis efficiency was measured on regenerated TO rice plants by PCR/RE. The accessibility of each target site was obtained from the high-resolution map of rice DNase I hypersensitive (DH) sites generated by Zhang et al., 2012. Figure 1b shows the indel frequency of 40 target sites in 20 rice genes detected in protoplasts. Two sites are targeted by independent sgRNAs in each gene. The indel frequency is measured by sequencing the targeted amplicon. The data are from three independent biological replicates (n=3) and are shown as the mean±s.e.m. Figure 1c summarizes the insertion frequency and chromatin status of the 40 target sites in Figure 1b. The P value was calculated by the two-tailed Mann-Whitney test. **P<0.01, ***P<0.001.

Figure 2 shows that Cas9 editing in rice is more effective in open chromatin regions than in closed chromatin regions. a Compare the indel frequencies of sgRNA target sites in open and closed chromatin regions in pairs. By sequencing the targeted amplicons, the frequency of indels in rice protoplasts was measured. The data are from three independent biological replicates (n=3) and are shown as the mean±s.e.m. b summarizes the Cas9 editing efficiency in a. The P value was calculated by two-tailed Mann-Whitney test, *P<0.05. c shows that Cas9 cuts all 10 target sites the same in chromatin-free state. The PCR product containing the corresponding target site was incubated with Cas9 ribonucleoprotein (RNP) complex, and observed and measured on an agarose gel. The data are from three independent biological replicates (n=3) and are shown as mean ± s.e.m. d shows the indel patterns generated at 10 target sites. All experiments were repeated three times with similar results.

Figure 3 shows that fusing the synthetic transcription activation domain with Cas9 improves its editing efficiency. a is a schematic diagram of the structure of the fusion of transcription activation domain and Cas9 (Cas9-TV). b shows the indel frequencies induced by Cas9 and Cas9-TV in 20 targets in rice protoplasts. Untreated protoplast samples were used as controls. The data are from three independent biological replicates (n=3) and are shown as the mean±s.e.m. c shows the indel frequencies induced by Cas9 and Cas9-TV at 20 target sites. d shows the insertion frequency of the target site in the open chromatin region induced by Cas9 and Cas9-TV. e shows the frequency of indels induced by Cas9 and Cas9-TV at target sites in the enclosed chromatin region. The P value was calculated by the two-tailed Mann-Whitney test. *P<0.05, ***P<0.001.

Figure 4 shows that proximal targeting of dsgRNA enhances Cas9-TV editing. a shows the indel frequencies of Cas9/sgRNA, Cas9-TV/sgRNA and Cas9-TV/sgRNA-dsgRNA at 20 target sites in rice protoplasts. Untreated protoplast samples were used as controls. The indel frequency is measured by sequencing the targeted amplicon. The data are from three independent biological replicates (n=3) and are shown as the mean±s.e.m. b shows the fold change of indel frequency induced by Cas9-TV/sgRNA and Cas9-TV/sgRNA-dsgRNA at 10 target sites relative to Cas9/sgRNA. c shows the fold change of indel frequency in the open chromatin area. d shows the summary of the indel frequency fold change of the target site in the enclosed chromatin region. The P value was calculated by the two-tailed Mann-Whitney test. ***P<0.001, ****P<0.0001.

Figure 5 shows the effect of the position of the proximal dsgRNA on Cas9-TV editing. The distance is calculated based on the nucleotides between the sgRNA and dsgRNA target sites. The indel frequency was measured by sequencing targeted amplicons in rice protoplasts. Untreated protoplast samples were used as controls. The data are from three independent biological replicates (n=3) and are shown as the mean±s.e.m.

Figure 6 Increases Cas9 editing efficiency through proximal dsgRNA targeting. A shows the indel frequencies induced by Cas9/sgRNA and Cas9/sgRNA-dsgRNA at 20 target sites in rice protoplasts. Untreated protoplast samples were used as controls. The indel frequency is measured by sequencing the targeted amplicon. The data are from three independent biological replicates (n=3) and are shown as the mean±s.e.m. b shows the indel frequency of 20 target sites. C shows the frequency of indels induced by target sites in open chromatin. D shows the indel frequency of the target site in the blocked chromatin. The P value was calculated by the two-tailed Mann-Whitney test. ***p<0.001, ****p<0.0001.

Figure 7 shows the effect of the position of the proximal dsgRNA on the editing activity of Cas9. The dsgRNA target site and the Cas9-TV target site are separated from each other by the distance expressed in bp, which is expressed by numbers, respectively. Untreated protoplast samples were used as controls. The indel frequency is measured by sequencing the targeted amplicon. The data are from three independent biological replicates (n=3) and are shown as the mean±s.e.m.

Figure 8 shows that Cas9-TV and proximal dsgRNA alter local chromatin accessibility. The rice protoplasts were transfected with Cas9/sgRNA and Cas9-TV/sgRNA-dsgRNA, and the local chromatin accessibility around the target site was analyzed by DNase I determination of a small sample. The fraction of intact genomic DNA is quantified by real-time PCR. For each site, the relative amount of intact genomic DNA in the Cas9/sgRNA-treated sample is set as one unit. Error bars indicate SD for three replicates.

Figure 9 compares the off-target activity of Cas9/sgRNA, Cas9-TV/sgRNA and Cas9-TV/sgRNA-dsgRNA. The indel frequency was measured by sequencing targeted amplicons in rice protoplasts. Untreated protoplast samples were used as controls. The data are from three independent biological replicates (n=3) and are shown as the mean±s.e.m.

Figure 10 shows the indel patterns induced by Cas9 and Cas9-TV at the target site. The figure shows representative results from one of three independent experiments. All three experiments gave similar results.

Figure 11 shows the indel patterns produced by Cas9/sgRNA, Cas9/sgRNA-dsgRNA and Cas9-TV/sgRNA-dsgRNA at designated target sites. This figure shows representative results from one of three independent experiments that produced similar results.

Figure 12 shows that dsgRNA does not induce indels at the target site. The dsgRNA was co-transformed with Cas9 or Cas9-TV into rice protoplasts. The indel frequency is measured by sequencing the targeted amplicon. Untreated protoplast samples were used as controls. The data are from three independent biological replicates (n=3) and are shown as the mean±s.e.m.

Figure 13 shows the sgRNA and dsgRNA target sites for the partial genomic DNA sequence of LOC_Os11g08760.

Detailed description of the invention

1. Definition

In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology related terms and laboratory procedures used herein are all terms and routine procedures widely used in the corresponding fields. For example, the standard recombinant DNA and molecular cloning techniques used in the present invention are well known to those skilled in the art, and are described more fully in the following documents: Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (abbreviated as "Sambrook"). At the same time, in order to better understand the present invention, definitions and explanations of related terms are provided below.

As used herein, the term "CRISPR nuclease" generally refers to the nuclease that exists in the naturally occurring CRISPR system, as well as its modified form, its variant, its catalytically active fragment, and the like. The term covers any effector protein based on the CRISPR system that can achieve gene targeting (such as gene editing, gene targeted regulation, etc.) in cells.

Examples of "CRISPR nuclease" include Cas9 nuclease or variants thereof. The Cas9 nuclease may be a Cas9 nuclease from different species, such as spCas9 from S. pyogenes or SaCas9 derived from S. aureus. "Cas9 nuclease" and "Cas9" are used interchangeably herein, and refer to RNA comprising Cas9 protein or fragments thereof (for example, a protein containing the active DNA cleavage domain of Cas9 and/or the gRNA binding domain of Cas9) Guided nuclease. Cas9 is a component of CRISPR/Cas (clustered regularly spaced short palindrome repeats and related systems) genome editing system, which can target and cut DNA target sequences under the guidance of guide RNA to form DNA double-strand breaks (DSB) ).

Examples of "CRISPR nuclease" may also include Cpf1 nuclease or a variant thereof such as a highly specific variant. The Cpf1 nuclease may be Cpf1 nuclease from different species, such as Cpf1 nuclease from Francisella novicida U112, Acidaminococcus sp. BV3L6 and Lachnospiraceae bacterium ND2006.

As used herein, a "transcription activation domain (TAD)" is generally a domain in a transcription factor that contains binding sites for other proteins such as transcriptional co-regulatory proteins. TAD is generally classified according to the composition of amino acids. These amino acids can be amino acids that are essential for activity or the most abundant amino acids in TAD. Transcription activation domains are generally divided into acid activation domains, glutamine-rich domains, proline-rich domains and isoleucine-rich domains.

As used herein, "gRNA" and "guide RNA" are used interchangeably, and refer to RNA that can form a complex with the CRISPR nuclease and can target the complex to the target sequence due to its certain complementarity with the target sequence molecular. For example, in a Cas9-based gene editing system, gRNA is usually composed of crRNA and tracrRNA molecules that are partially complementary to form a complex, where the crRNA contains sufficient complementarity with the target sequence to hybridize with the target sequence and guide the CRISPR complex (Cas9+ crRNA+tracrRNA) A sequence that specifically binds to the target sequence sequence. However, it is known in the art that single guide RNA (sgRNA) can be designed, which includes both the characteristics of crRNA and tracrRNA. In a genome editing system based on Cpf1, gRNA is usually composed of mature crRNA molecules only, and the sequence contained in crRNA is sufficiently identical to the target sequence to hybridize with the complementary sequence of the target sequence and direct the complex (Cpf1+crRNA) to the The target sequence specifically binds. Designing a suitable gRNA sequence based on the CRISPR nuclease used and the target sequence to be edited is within the ability of those skilled in the art.

"Dead sgRNA" or "dsgRNA" refers to sgRNA that can guide Cas9 to a target site without inducing a double-strand break (DSB), which only has a spacer sequence (target sequence) of 14 or 15 bp.

As used herein, "chromatin" refers to a linear composite structure composed of DNA, histones, non-histone proteins, and a small amount of RNA in the interphase cell nucleus, and is a form of interphase cell genetic material. During mitosis or meiosis, the chromatin of eukaryotic cells condenses into rod-shaped chromosomes. In chromatin, DNA regions that are easy to bind to other proteins (such as nucleases, transposases, modifying enzymes, etc.) are called "open chromatin regions"; DNA regions that are difficult to bind to other proteins are called "closed ( closed) Chromatin area".

As used herein, "genome" not only covers chromosomal DNA present in the nucleus, but also includes organelle DNA present in subcellular components of the cell (such as mitochondria, plastids).

As used herein, "cell" includes cells of any organism suitable for genome editing. Examples of organisms include, but are not limited to, mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, and cats; poultry such as chickens, ducks, and geese; plants include monocots and dicots, For example, rice, corn, wheat, sorghum, barley, soybean, peanut, Arabidopsis and so on.

"Genetically modified organism" or "genetically modified cell" means an organism or cell that contains exogenous polynucleotides or modified genes or expression control sequences in its genome. For example, exogenous polynucleotides can be stably integrated into the genome of organisms or cells, and inherited for successive generations. The exogenous polynucleotide can be integrated into the genome alone or as part of a recombinant DNA construct. The modified gene or expression control sequence contains single or multiple deoxynucleotide substitutions, deletions and additions in the organism or cell genome.

"Foreign" in terms of sequence means a sequence from a foreign species or, if from the same species, a sequence whose composition and/or locus has been significantly altered from its natural form through deliberate human intervention.

"Polynucleotide", "nucleic acid sequence", "nucleotide sequence" or "nucleic acid fragment" are used interchangeably and are single-stranded or double-stranded RNA or DNA polymers, optionally containing synthetic, non-natural Or changed nucleotide bases. Nucleotides are referred to by their single letter names as follows: "A" is adenosine or deoxyadenosine (respectively for RNA or DNA), "C" is cytidine or deoxycytidine, and "G" is guanosine or Deoxyguanosine, "U" means uridine, "T" means deoxythymidine, "R" means purine (A or G), "Y" means pyrimidine (C or T), "K" means G or T, " H" means A or C or T, "I" means inosine, and "N" means any nucleotide.

"Polypeptide", "peptide", and "protein" are used interchangeably in the present invention and refer to a polymer of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues are corresponding artificial chemical analogs of naturally occurring amino acids, as well as to naturally occurring amino acid polymers. The terms "polypeptide", "peptide", "amino acid sequence" and "protein" may also include modified forms, including but not limited to glycosylation, lipid linkage, sulfation, gamma carboxylation of glutamic acid residues, hydroxyl And ADP-ribosylation.

As used in the present invention, "expression construct" refers to a vector, such as a recombinant vector, suitable for expression of a nucleotide sequence of interest in an organism. "Expression" refers to the production of a functional product. For example, the expression of a nucleotide sequence may refer to the transcription of the nucleotide sequence (such as transcription to generate mRNA or functional RNA) and/or the translation of RNA into a precursor or mature protein.

The "expression construct" of the present invention can be a linear nucleic acid fragment, a circular plasmid, a viral vector, or, in some embodiments, can be an RNA (such as mRNA) that can be translated.

The "expression construct" of the present invention may contain regulatory sequences and nucleotide sequences of interest from different sources, or regulatory sequences and nucleotide sequences of interest from the same source but arranged in a way different from those normally occurring in nature.

"Regulatory sequence" and "regulatory element" can be used interchangeably and refer to the upstream (5' non-coding sequence), middle or downstream (3' non-coding sequence) of the coding sequence, and affect the transcription, RNA processing or processing of the related coding sequence. Stability or translated nucleotide sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.

"Promoter" refers to a nucleic acid fragment capable of controlling the transcription of another nucleic acid fragment. In some embodiments of the invention, the promoter is a promoter capable of controlling gene transcription in a cell, regardless of whether it is derived from the cell. The promoter can be a constitutive promoter or a tissue-specific promoter or a developmentally regulated promoter or an inducible promoter.

A "constitutive promoter" refers to a promoter that will generally cause gene expression in most cell types in most cases. "Tissue-specific promoter" and "tissue-preferred promoter" are used interchangeably, and refer to mainly but not necessarily exclusively expressed in a tissue or organ, and can also be expressed in a specific cell or cell type The promoter. "Developmentally regulated promoter" refers to a promoter whose activity is determined by developmental events. "Inducible promoters" selectively express operably linked DNA sequences in response to endogenous or exogenous stimuli (environment, hormones, chemical signals, etc.).

As used herein, the term "operably linked" refers to the connection of regulatory elements (for example, but not limited to, promoter sequences, transcription termination sequences, etc.) to nucleic acid sequences (for example, coding sequences or open reading frames) such that the nucleotides The transcription of the sequence is controlled and regulated by the transcription control element. Techniques for operably linking regulatory element regions to nucleic acid molecules are known in the art.

"Introducing a nucleic acid molecule (such as a plasmid, linear nucleic acid fragment, RNA, etc.) or protein into an organism refers to transforming the cell of the organism with the nucleic acid or protein so that the nucleic acid or protein can function in the cell. The "transformation" used in the present invention includes stable transformation and transient transformation. "Stable transformation" refers to the introduction of exogenous nucleotide sequences into the genome, resulting in stable inheritance of the exogenous gene. Once stably transformed, the exogenous nucleic acid sequence is stably integrated into the genome of the organism and any successive generations thereof. "Transient transformation" refers to the introduction of nucleic acid molecules or proteins into cells to perform functions without stable inheritance of foreign genes. In transient transformation, the foreign nucleic acid sequence is not integrated into the genome.

2. Genome editing fusion peptide

The present invention provides a genome editing fusion polypeptide, which comprises a CRISPR nuclease domain and a transcription activation domain.

The CRISPR nuclease of the present invention can be any CRISPR nuclease that can realize genome editing. In some embodiments, the CRISPR nuclease is Cas9 or an active fragment thereof, such as Cas9 from Streptococcus pyogenes (SpCas9), Cas9 from Staphylococcus aureus (SaCas9), Cas9 from Francisella novicida (FnCas9), Cas9 (CjCas9) from Campylobacter jejuni and Cas9 (NcCas9) from Neisseria cinerea. In some embodiments, the CRISPR nuclease is Cpf1 or an active fragment thereof, such as Cpf1 (FnCpf1) from Francisella novicida U112, Cpf1 from Acidaminococcus sp. BV3L6, and Lachnospiraceae bacterium Cpf1 (LbCpf1) of ND2006.

The transcription activation domain (TAD) used in the present invention is not particularly limited as long as it can realize the function of opening chromatin. In some embodiments, the transcription activation domain (TAD) comprises an acidic activation domain, a glutamine-rich domain, a proline-rich domain, an isoleucine-rich domain, and any combination thereof. The acid activation domain is rich in aspartic acid and glutamate, including but not limited to Gal4, Oaf1, Leu3, Rtg3, Pho4, Gln3, Gcn4 TAD from yeast and p53, NFAT, NF- from mammals. TAD of κB and VP16. The glutamine-rich domain contains multiple repeating sequences similar to "QQQXXXQQQ", including but not limited to TAD from POU2F1 (Oct1), POU2F2 (Oct2) and Sp1. The proline-rich domain contains repeating sequences similar to "PPPXXXPPP", including but not limited to TAD from c-jun, AP2 and Oct-2. The isoleucine-rich domain contains the repeating sequence "IIXXII", for example, TAD from NTF-1.

In some embodiments, the transcription activation domain comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more copies of the same or different TAD. In some embodiments, the transcription activation domain comprises one or more VP16-TAD. In some embodiments, the transcription activation domain comprises one or more transcription activator-like effector TADs (TALE-TAD). In some embodiments, the transcription activation domain comprises one or more VP16-TAD and one or more transcription activator-like effector TAD (TALE-TAD). Preferably, the transcription activation domain contains 8 copies of VP16-TAD and 6 copies of TALE-TAD. Preferably, the transcription activation domain comprises the amino acid sequence of SEQ ID NO:1. Preferably, the transcription activation domain consists of the amino acids of SEQ ID NO:1.

In the polypeptide of the present invention, the transcription activation domain and the CRISPR nuclease domain may be directly or indirectly fused. In some embodiments, the transcription activation domain is directly fused to the CRISPR nuclease domain. In some embodiments, the transcription activation domain and the CRISPR nuclease domain may be fused indirectly, for example, connected via a linker. The joint can be 1-50 long (e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 20-25, 25-50) or more amino acids, non-functional amino acid sequences without secondary or higher structure. For example, the linker may be a flexible linker, such as GGGGS, GS, GAP, (GGGGS)x3, GGS and (GGS)x7, etc.

In the polypeptide of the present invention, the transcription activation domain is located at the N-terminus or C-terminus of the CRISPR nuclease domain. In some embodiments, the transcription activation domain is fused to the N-terminus of the CRISPR nuclease domain. In some embodiments, the transcription activation domain is fused to the C-terminus of the CRISPR nuclease domain.

In some embodiments, the polypeptide further comprises a nuclear localization sequence (NLS). Generally speaking, one or more NLS in the polypeptide should have sufficient strength to drive the accumulation of the polypeptide in an amount that can achieve its genome editing function in the nucleus of the plant cell. Generally speaking, the strength of nuclear localization activity is determined by the number and location of NLS in the polypeptide, one or more specific NLS used, or a combination of these factors.

In some embodiments of the present invention, the NLS of the polypeptide of the present invention may be located at the N-terminal and/or C-terminal. In some embodiments of the present invention, the NLS of the polypeptide of the present invention may be located between the transcription activation domain and the CRISPR nuclease domain. In some embodiments, the polypeptide comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS. In some embodiments, the polypeptide comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS at or near the N-terminus. In some embodiments, the polypeptide comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS at or near the C-terminus. In some embodiments, the polypeptide includes a combination of these, such as one or more NLS at the N-terminus and one or more NLS at the C-terminus. When there is more than one NLS, each one can be selected as not dependent on the other NLS. In some preferred embodiments of the present invention, the polypeptide comprises at least 2 NLS, for example, the at least 2 NLS are located at the C-terminus. In some preferred embodiments, the NLS is located at the C-terminus of the polypeptide. In some preferred embodiments, the polypeptide contains at least 3 NLS. In a more preferred embodiment, the polypeptide comprises at least 3 NLS at the C-terminus. In some preferred embodiments, the polypeptide does not comprise NLS at the N-terminus and/or between the transcription activation domain and the CRISPR nuclease domain.

Generally speaking, NLS consists of one or more short sequences of positively charged lysine or arginine exposed on the surface of the protein, but other types of NLS are also known. Non-limiting examples of NLS include: KKRKV (nucleotide sequence 5'-AAGAAGAGAAAGGTC-3'), PKKKRKV (nucleotide sequence 5'-CCCAAGAAGAAGAGGAAGGTG-3' or CCAAAGAAGAAGAGGAAGGTT), or SGGSPKKKRKV (nucleotide sequence 5'- TCGGGGGGGAGCCCAAAGAAGAAGCGGAAGGTG-3').

In a preferred embodiment, the polypeptide comprises two nuclear localization sequences. Preferably, one nuclear localization sequence is located at the N-terminus of the CRISPR nuclease or active fragment thereof, and one nuclear localization sequence is located at the CRISPR nuclease domain or Between the C-terminus of the active fragment and the N-terminus of the transcription activation domain.

In a preferred embodiment, the polypeptide of the present invention comprises the amino acid sequence of SEQ ID NO: 2. More preferably, the polypeptide consists of the amino acids of SEQ ID NO: 2.

The invention also provides isolated polynucleotides encoding the polypeptides of the invention. In some embodiments, the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 3 or a degenerate variant thereof. Preferably, the polynucleotide consists of the nucleotide sequence of SEQ ID NO: 3 or a degenerate variant thereof.

In order to obtain effective expression, in some embodiments, the polynucleotide is codon-optimized for the edited organism, such as a plant.

Codon optimization refers to replacing at least one codon (e.g., about or more than about 1, 2, 3, 4, 5, 10) of the natural sequence with a codon that is used more frequently or most frequently in the gene of the host cell. , 15, 20, 25, 50 or more codons while maintaining the natural amino acid sequence to modify the nucleic acid sequence to enhance expression in the host cell of interest. Different species display certain codons for specific amino acids Codon preference (the difference in codon usage between organisms) is often related to the translation efficiency of messenger RNA (mRNA), and the translation efficiency is considered to depend on the nature and nature of the codon being translated The availability of specific transfer RNA (tRNA) molecules. The advantages of selected tRNAs in cells generally reflect the most frequently used codons for peptide synthesis. Therefore, genes can be tailored to be the best in a given organism based on codon optimization. Good gene expression. Codon utilization tables can be easily obtained, such as the "Codon Usage Database" available at www.kazusa.orjp/codon/ , and these tables can be adjusted in different ways Applicable. See, Nakamura Y. et al., "Codon usage tabulated from the international DNA sequence databases: status for the year 2000. Nucl. Acids Res., 28:292 (2000).

3. Improved genome editing system

The present invention provides an improved genome editing system, which comprises at least one of the following i) to v):

i) The genome editing fusion polypeptide and guide RNA of the present invention;

ii) An expression construct encoding the genome editing fusion polypeptide of the present invention, and a guide RNA;

iii) The genome editing fusion polypeptide of the present invention, and an expression construct containing a nucleotide sequence encoding a guide RNA;

iv) An expression construct encoding the genome editing fusion polypeptide of the present invention, and an expression construct containing a nucleotide sequence encoding a guide RNA;

v) An expression construct comprising the polynucleotide of the present invention and a nucleotide sequence encoding a guide RNA.

In some embodiments, wherein the guide RNA is a sgRNA, preferably the sgRNA targets a closed chromatin region. The method of constructing a suitable sgRNA based on a given target sequence is known in the art. For example, see the literature: Wang, Y. et al. Simultaneous editing of three homoeoalleles in hexaploid bread wheat conflicts heritable resistance to powdery mildew. Nat. Biotechnol. 32,947-951 (2014); Shan, Q.et gen. Target modified. of crop plants using a CRISPR-Cas system.Nat.Biotechnol.31,686-688(2013); Liang,Z.et al.Targeted mutagenesis in Zea mays using TALENs and the CRISPR/Cas system.J Genet Genomics.41,63-- 68 (2014).

The design of a target sequence that can be recognized and targeted by the CRISPR nuclease and the guide RNA complex belongs to the skill of those of ordinary skill in the art. In general, the target sequence is a sequence complementary to the guide sequence of about 20 nucleotides contained in the guide RNA, and the 3'end is immediately adjacent to the protospacer adjacent motif (PAM).

In an exemplary embodiment, the scaffold sequence of the guide RNA of the present invention is shown in SEQ ID NO: 4.

In some embodiments, the CRISPR system of the present invention further comprises or encodes a dsgRNA whose target site is 30-300 bp away from the sgRNA target site, preferably 40-270 bp, most preferably 115-120 bp. In some embodiments, the dsgRNA only contains a 14 or 15 nucleotide leader sequence. That is, the dsgRNA only targets a target sequence of 14 or 15 nucleotides. Such dsgRNA can target the CRISPR nuclease to its target sequence, but cannot cause cleavage.

In some embodiments, the CRISPR system of the present invention includes at least one of ii) to v) above. In some embodiments, the nucleotide sequence encoding the polypeptide of the present invention and/or the nucleotide sequence encoding the guide RNA is operably linked to an expression control sequence, preferably a plant expression control sequence, such as a promoter.

Examples of promoters that can be used in the present invention include but are not limited to: cauliflower mosaic virus 35S promoter (Odell et al. (1985) Nature 313:810-812), maize Ubi-1 promoter, wheat U6 promoter, rice U3 promoter, corn U3 promoter, rice actin promoter, TrpPro5 promoter (US Patent Application No. 10/377,318; filed March 16, 2005), pEMU promoter (Last et al. (1991) Theor .Appl.Genet.81:581-588), MAS promoter (Velten et al. (1984) EMBO J. 3:2723-2730), maize H3 histone promoter (Lepetit et al. (1992) Mol.Gen Genet.231:276-285 and Atanassova et al. (1992) Plant J.2(3):291-300) and Brassica napus ALS3 (PCT application WO 97/41228) promoters. The promoters that can be used in the present invention also include commonly used tissue-specific promoters reviewed in Moore et al. (2006) Plant J.45(4):651-683.

In an exemplary embodiment, the construct of the present invention includes a rice U3 promoter, which includes the nucleotide sequence shown in SEQ ID NO: 5.

Fourth, the method of genetic modification of cells

In another aspect, the present invention provides a method for genetically modifying cells, including introducing the genome editing system of the present invention into the cells.

The design of a target sequence that can be recognized and targeted by the CRISPR nuclease and the guide RNA complex belongs to the skill of those of ordinary skill in the art. Generally speaking, the target sequence is a sequence complementary to the guide sequence of about 20 nucleotides contained in the guide RNA, and the 3'end is immediately adjacent to the protospacer adjacent motif (PAM).

In the present invention, the target sequence to be modified can be located anywhere in the genome, for example, in a functional gene such as a protein-coding gene, or, for example, can be located in a gene expression control region such as a promoter region or an enhancer region, so as to achieve Modification of gene function or modification of gene expression. Preferably, the target sequence is located in an enclosed chromatin region.

The substitution, deletion and/or addition in the cell target sequence can be detected by T7EI, PCR/RE or sequencing methods.

In the method of the present invention, the genome editing system can be introduced into cells by various methods well known to those skilled in the art.

Methods that can be used to introduce the genome editing system of the present invention into cells include, but are not limited to: calcium phosphate transfection, protoplast fusion, electroporation, liposome transfection, microinjection, viral infection (such as baculovirus, vaccinia virus, adenovirus) Viruses and other viruses), gene bombardment, PEG-mediated transformation of protoplasts, and Agrobacterium-mediated transformation.

Cells that can be genome edited by the method of the present invention can be derived from, for example, mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, cats; poultry such as chickens, ducks, and geese; plants, including monas Leafy plants and dicotyledonous plants, such as rice, corn, wheat, sorghum, barley, soybean, peanut, Arabidopsis, etc. Preferably, the cell is a plant cell, such as a rice cell.

In some embodiments, the methods of the invention are performed in vitro. For example, the cell is an isolated cell. In other embodiments, the method of the present invention can also be performed in vivo. For example, the cell is a cell in a living body, and the system of the present invention can be introduced into the cell in vivo by, for example, a virus-mediated method. In some embodiments, the cell is a germ cell. In some embodiments, the cell is a somatic cell.

In another aspect, the present invention also provides a genetically modified organism, which comprises a genetically modified cell produced by the method of the present invention.

The organisms include, but are not limited to, mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cows, and cats; poultry such as chickens, ducks, and geese; plants, including monocots and dicots, For example, rice, corn, wheat, sorghum, barley, soybean, peanut, Arabidopsis and so on. Preferably, the organism is a plant, preferably rice.

Example

Embodiment 1. Method

Plasmid construction

The coding sequences of VP64 (4 copies of VP16-TAD) and 2TAL (2 copies of TALE-TAD) are codon optimized for rice (Oryza sativa) and synthesized (as shown in SEQ ID NO: 6 and SEQ ID NO: 7) (GenScript, Nanjing, China). The VP64 coding sequence was fused with the 3'end of Cas9 by overlapping PCR, and the Avr II site was introduced between Cas9 and VP64. The Cas9-VP64 fusion gene was cloned into pJIT163 to generate p163-Cas9-VP64. Then 1 copy of VP64 and 3 copies of 2TAL fragments were sequentially inserted into the AvrII site of p163-Cas9-VP64 to generate p163-Cas9-TV, where the sequence of Cas9-TV is as described in the nucleotide sequence of SEQ ID NO: 3 . As mentioned above, introduce different sgRNAs into pOsU3-sgRNA (see Shan et al. (2014). Genome editing in rice and wheat using the CRISPR/Cas system. Nat Protoc 9, 2395-2410). Construct the sgRNA-dsgRNA co-expression plasmid as previously reported (see Xing et al., (2014). A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol 14,327).

DNase-seq data analysis

Obtain the previously reported DNase-seq data of rice seedlings (GSE26610) from NCBI’s Gene Expression Omnibus (GEO) (see Zhang et al., (2012). High-resolution mapping of open chromatin in the rice gene. Genome Res 22,151- 162). Load the DNase-seq data into the Gbrowse (Gbrowse of the rice annotation project database) of the Rice Annotation Project Database (RAP-DB), and observe the chromatin status of the target site.

Protoplast transfection

Two-week-old seedlings of the rice cultivar "Nipponbare" were used to isolate the protoplasts. According to the standard protocol (see Shan et al. (2014). Genome editing in rice and wheat using the CRISPR/Cas system. Nat Protoc 9, 2395-2410) for protoplast isolation and transfection. Plasmids (10 μg per construct) were transfected into protoplasts by PEG-mediated transfection.

Extraction of Plant Genomic DNA

The transfected protoplasts were incubated at 28°C. After 48 hours, the protoplasts were collected, and the genomic DNA was extracted by the CTAB method (see Murray&Thompson, (1980). Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8,4321-4325).

PCR amplification and next-generation sequencing of targeted regions

Genomic DNA extracted from protoplasts is used as a PCR template. In the first round of PCR, specific primers are used to amplify the genomic region flanking the CRISPR target site. In the second round, primers are used to amplify the 150-250bp PCR product to introduce the forward and reverse barcodes into the first round of PCR products. The same amount of final PCR products were combined and sequenced by paired-end read sequencing using the Illumina NextSeq 500 platform (GENEWIZ, Suzhou, China). Detection of indels at the target site of sgRNA. Sequencing of each amplicon was repeated three times, using genomic DNA from three independent protoplast samples.

In vitro cutting of Cas9RNP

As previously reported, in vitro cutting is performed by Cas9RNP (see Liang et al., (2017). Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes. NatCommun 8,14261). The target DNA sequence is amplified by PCR using specific primers, then purified and eluted with RNase-free water. The Cas9 protein (1μg) and sgRNA (1μg) were premixed and incubated with the target DNA (200ng) at 37°C for 1h. The product was then separated on a 2% agarose gel, and the band intensity was measured using Image J software to calculate the Cas9 cleavage activity.

Detect chromatin accessibility

The micro-sample DNase I digestion assay was performed as previously reported (see Lu et al. (2016). Establishing Chromatin Regulatory Landscape during Mouse Preimplantation Development. Cell 165, 1375-1388). The transfected protoplasts were cultured at 28°C for 24 hours. Resuspend 4×10 ⁵ transfected aquatic protoplast samples in 45μL lysis buffer (10mM Tris-HCl[pH 7.5], 10mM NaCl, 3mM MgCl ₂ , 0.1% Triton X-100), and incubate on ice 5min, then add DNase I (1000U/ml, Sigma, AMPD1-1KT) to a final concentration of 2U/mL. The sample was incubated at 37°C for another 5 minutes, and then 50 μL of stop buffer (10 mM Tris-HCl [pH 7.5], 10 mM NaCl, 0.15% SDS, 10 mM EDTA) containing 1 U of proteinase K was added to terminate the reaction. Incubate at 55°C for 1 hour. Genomic DNA was extracted from each sample by the phenol-chloroform method (see Sambrook & Russell, (2006). Purification of nucleic acids by extraction with Phenol: Chloroform. CSH Protoc 2006: pdb.prot4455), and by real-time qPCR (SYBR Premix Ex TaqTM II , Takara) for analysis.

Detection of off-target mutations

Use the online tool CRISPR-P (see Liu et al., (2017).CRISPR-P 2.0: An Improved CRISPR-Cas9 Tool for Genome Editing in Plants.Mol Plant 10, 530-532) to predict the potential of sgRNA24, 28, 34, and 38 Off-target site. Locus-specific primers for these sites are designed to generate PCR products of about 150 to 250 bp. In the first round of PCR, specific primers are used to amplify the genomic regions flanking the target and off-target sites. The resulting PCR product is used as a template for the second round of PCR, and a barcode is added to each end of the PCR product. The PCR products were then combined in equal amounts for next-generation sequencing. Check the target and potential off-target indels. Sequencing of each amplicon was repeated three times, using genomic DNA from three independent protoplast samples.

Example 2. Cas9 genome editing is more effective in open chromatin regions of rice

Using the CRISPR-Cas9 system, 41 rice genes were edited with 70 sgRNAs (Table 2). Cas9 and various sgRNAs were transformed into rice callus by Agrobacterium transformation. The edits in the regenerated T0 plants were analyzed by PCR/RE and confirmed by Sanger sequencing. The frequency of indels induced by CRISPR-Cas9 at various target sites varies greatly (Table 1).

Table 1. Mutagenesis efficiency induced by CRISPR/Cas9 at different genomic sites in rice T0 plants

Then analyzed whether indel frequency is related to chromatin accessibility. Open chromatin is DNase I sensitive (DH), and the comprehensive DNase I sensitivity data of rice genome can be used. Using these data, it was found that the frequency of Cas9-induced indels at the tested target sites was significantly higher at the DH site (Figure 1a), indicating that CRISPR-Cas9 activity in rice is affected by chromatin openness. To confirm that the chromatin structure affects Cas9 editing in rice, another 20 genes in open and closed chromatin regions were tested based on the rice open chromatin map. Two sgRNAs were designed for each gene, one targeting the promoter and the other targeting the exons (Table 2).

Table 2. Information of the selected 40 target sites

Cas9 and each of these sgRNAs were transformed into rice protoplasts, and the indel frequency of all 40 target sites was measured by targeted deep sequencing (Figure 1b). The results confirmed that the editing efficiency in the open chromatin region was higher than that in the closed chromatin region (Figure 1c).

In order to exclude the possible influence of spacer sequence composition on editing efficiency, five independent spacers (sgRNA A～E) were identified with the sequence of open and closed chromatin regions (Table 3).

Table 3. The selected sgRNAs each target two genomic sites with opposite chromatin states.

Pairwise comparison of indel frequencies at these sites showed that the Cas9 activity in the open chromatin region was 13.4 times higher than that in the closed chromatin region, while the frequency of indel induced by different sgRNAs varied greatly (Figure 2a, 2b). Interestingly, when targeting PCR products or chromatin-free DNA in vitro, Cas9 was able to edit all these target sites almost identically (Figure 2c). In addition, the patterns of indels produced at the paired target sites are similar (Figure 2d). Taken together, these results indicate that CRISPR-Cas9 genome editing in rice cells is more effective in open chromatin regions than in closed chromatin regions.

Example 3. Fusion with a synthetic transcription activation domain increases the editing activity of Cas9 in rice

The synthetic transcription activation domain (hereinafter referred to as TV) contains 6 copies of TALE (transcription activator-like effector)-TAD (transcription activation domain) and 8 copies of VP16, fused to the C-terminus of Cas9. Generate Cas9-TV (Figure 3a). 20 sgRNAs targeting different chromatin regions (Table 3) were used to study the genome editing efficiency of Cas9-TV in rice protoplasts.

The results showed that the indel frequencies of the target sites induced by Cas9 and Cas9-TV were 1.95%-29.56% and 3.81%-44.85%, respectively (Figure 3b). The genome editing efficiency of Cas9-TV was high in all tested sites. In Cas9 (Figure 3c). On average, the frequency of indels induced by Cas9-TV in open and closed chromatin regions was 1.87 times and 1.44 times higher than that of Cas9, respectively (Figure 3d, 3e).

It was also found that Cas9-TV and Cas9 produced similar indel patterns (Figure 10). These data indicate that Cas9-TV in vivo editing activity increases at target sites in open and closed chromatin regions.

Example 4. Use dsgRNA for proximal targeting to improve genome editing

Using 20 sgRNA targeting sites in the rice genome (Table 2) and designing dsgRNAs targeting each nearby proximal site (Table 4).

Table 4. Selected sgRNA and its corresponding proximal dsgRNA targeting position

sgRNA a	dsgRNA targeting sequence b	Distance c
sgRNA2	GACATCATCTGGCAGGG	50bp
sgRNA 4	TGCAGGCTTCACGACGG	32bp
sgRNA 6	TGACCTGATGCCCAAGG	55bp
sgRNA 8	GCGCTGGTGCTTGCTGG	57bp
sgRNA 10	CTTCGCGCGCTCCATGG	35bp
sgRNA 12	GGCGTGGGCAAGAGCGG	39bp
sgRNA 14	TACAAGCTCAAGCTCGG	50bp
sgRNA 16	GGACCTTGGACTCGAGG	55bp
sgRNA 18	ACCTGATTGGGTGAAGG	60bp
sgRNA 20	TATGGTAGCGAGCGTGG	68bp
sgRNA 22	AACAGCTAGGCTCTTGG	39bp
sgRNA 24	ACTGCAGGCGCTGCAGG	59bp
sgRNA 26	ACTCATCGGTGTGTAGG	92bp
sgRNA 28	GTTGATGGACGAGGTGG	61bp
sgRNA 30	AGCAGCACGTGCCTCGG	62bp
sgRNA 32	GGCCAACTGAACGACGG	56bp
sgRNA 34	GGCCACGTCGCTCGCGG	55bp
sgRNA 36	CCGATGCAGCCCACCGG	66bp
sgRNA 38	GCGCATTAGACCAAGGG	83bp
sgRNA 40	GGCGCGACCAACCACGG	40bp

a, sgRNA is the same as Table 2; b, 14nt guide sequence + PAM; c, the distance between the dsgRNA targeting site and the sgRNA targeting site is expressed in bp.

The distance between the sgRNA targeting site and the dsgRNA binding site ranges from 32 to 92 bp. Compared with sgRNA alone, when dsgRNA and sgRNA were combined with Cas9-TV or Cas9 to transform into rice protoplasts, the proximal dsgRNA increased the editing efficiency of all target sites (Figure 4a). On average, the indel frequency obtained by combining Cas9-TV with proximal dsgRNA was 1.5 times higher than Cas9-TV and 2.5 times higher than Cas9 (Figure 4b).

In addition, no indels were detected at the dsgRNA targeting site (Figure 12).

Proximal dsgRNA promotes Cas9-TV editing in open and closed chromatin regions (Figure 4c, d), and does not affect the pattern of Cas9-TV-induced indels (Figure 11).

In order to optimize proximal dsgRNA targeting, dsgRNA 1, 2, 6 and dsgRNA 3, 4, 5 (Table 5) (Figure 13) were designed to target sites on either side of the PAM sequence of sgRNA34.

Table 5, dsgRNA targeting sequence and its distance to the sgRNA34 targeting site

a, 14nt guide sequence + PAM; b, the distance between the dsgRNA target site and the sgRNA target site is expressed in bp.

The distance between dsgRNA and sgRNA binding sites ranges from 47 to 266 bp (Figure 5). Each dsgRNA or dsgRNA pair was co-transformed with Cas9-TV and the corresponding sgRNA into rice protoplasts, and the indel frequency was measured by targeted deep sequencing.

The results showed that all dsgRNA enhanced editing, but targeting dsgRNA4 located at the 117bp site of the cutting site had the greatest effect (Figure 5). The results also showed that the position (downstream and upstream) of dsgRNA relative to PAM did not significantly affect editing efficiency (Figure 5).

In addition, the use of dsgRNA pairs instead of a single dsgRNA does not further increase Cas9-TV-mediated editing (Figure 5). Cas9-mediated editing achieved similar results (Figure 7).

Example 5. Cas9-TV and proximal dsgRNA increase chromatin accessibility

DNase I digestion analysis was used to determine the chromatin accessibility at sites 26, 28 and 34 to determine whether the binding of Cas9-TV and dsgRNA would change the chromatin structure of the target area. The results showed that Cas9-TV plus dsgRNA significantly increased the chromatin accessibility at each site (Figure 8). These results indicate that Cas9-TV/dsgRNA can increase the chromatin accessibility of target sites in vivo.

Example 6. Neither TV nor proximal dsgRNA increased the off-target activity of Cas9

By using sgRNA 24, 28, 34 and 38 to sequence the targeted amplicons at target and non-target sites to detect the frequency of indels, and to detect the off-target effects of Cas9-TV and Cas9-TV/dsgRNA.

For sgRNA 24 and 28, three possible off-target (OT) sites with 2 to 4 mismatches were identified, 4 off-target sites were identified for sgRNA 38, and 5 off-target sites were identified for sgRNA 34 (Table 6).

Table 6. Potential off-target sites identified in the rice genome for four sgRNAs

Target site	Sequence a	Target gene locus
Position 24	ACGGCCGCCTCCGTACGCCGCGG	LOC_Os04g18650
OT24-1	ACGGCCGC T TCCG C ACGCCGCGG	LOC_Os03g05590
OT24-2	C CG CT CGCC C CCGTACGCCGCGG	LOC_Os06g11400
OT24-3	G CGGCCGC GG CCGTACGC T GGGG	LOC_Os01g73410
Locus 28	GTCTTTGGACGTAGCCATGGTGG	LOC_Os04g12220
OT28-1	GTCTTTG C AC A TAGCCATGGCGG	LOC_Os05g04110
OT28-2	GTCTTT T GA T G C AGC A ATGGAGG	LOC_Os01g56140
OT28-3	GT T TTTGGAC T TAGCCA A GGAGG	LOC_Os04g57390
Locus 34	AGACATCGTCACCAAGGCGCAGG	LOC_Os11g08760
OT34-1	C GAC GC CG A CACCAAGGCGCTGG	LOC_Os04g56110
OT34-2	G GAC G TCCTC G CCAAGGCGCAGG	LOC_Os09g38050
OT34-3	G GACATCGTC GT C G AGGCGCTGG	LOC_Os04g32010
OT34-4	C GAC G TCGT G ACCAAGG T GCCGG	LOC_Os11g04940
OT34-5	AG T CATCCTCA A CAAGGC C CAGG	LOC_Os02g14059
Locus 38	TGGGTAATGGTGATATCCCATGG	LOC_Os09g24280
OT38-1	T A GGT G ATG A TGATAT A CCAAGG	LOC_Os12g29220
OT38-2	T A GGTA G T T GTGATATC A CAGGG	LOC_Os12g39430
OT38-3	TGGGT G ATG A TGATATCC AT CGG	LOC_Os03g37411
OT38-4	T AT GT G ATGGTGATATCC T ACGG	LOC_Os12g40790

^a Mismatched bases are underlined and PAM continues to be displayed in bold.

In all target positions, Cas9-TV has higher on-target activity than Cas9 (Figure 9).

On the other hand, at the OT24-2 site of sgRNA24 and the OT34-1 site of sgRNA34, Cas9, Cas9-TV and Cas9-TV/dsgRNA induced indels with similar frequencies. At the positions OT24-1 and OT24-3 of sgRNA24, the positions OT28-2 and OT28-2 of sgRNA28, the positions OT34-2, OT34-3, OT34-4 and OT34-5 of sgRNA34, and all off-targets of sgRNA38 At the site, none of the nucleases induced a significant number of indels. Surprisingly, at OT28-3, the frequency of indels induced by Cas9-TV and Cas9-TV/dsgRNA is lower than that induced by Cas9 (Figure 9).

These results indicate that the combination of TV and proximal dsgRNA does not change the off-target activity of Cas9.

Claims (10)

1. A genome editing fusion polypeptide comprising a CRISPR nuclease domain and a transcription activation domain (TAD), preferably, the transcription activation domain is fused to the C-terminus of the CRISPR nuclease domain.
2. The genome editing fusion polypeptide of claim 1, wherein the CRISPR nuclease is Cas9 or Cpf1.
3. The genome editing fusion polypeptide of claim 1 or 2, wherein the transcription activation domain comprises one or more VP16-TAD.
4. The genome editing fusion polypeptide of any one of claims 1 to 3, wherein the transcription activation domain comprises one or more TALE-TAD.
5. The genome editing fusion polypeptide of any one of claims 1 to 4, wherein the transcription activation domain comprises the amino acid sequence of SEQ ID NO:1.
6. The genome editing fusion polypeptide of any one of claims 1-5, further comprising one or more nuclear localization sequences, preferably two, preferably, one of the nuclear localization sequences is located at the N-terminus of the CRISPR nuclease domain, and one nuclear The positioning sequence is located between the C-terminus of the CRISPR nuclease domain and the N-terminus of the transcription activation domain.
7. An improved genome editing system comprising at least one of the following i) to v):

   i) The genome editing fusion polypeptide and guide RNA of any one of claims 1-6;

   ii) An expression construct comprising a polynucleotide encoding the genome editing fusion polypeptide of any one of claims 1 to 6, and a guide RNA;

   iii) The genome editing fusion polypeptide of any one of claims 1-6, and an expression construct comprising a nucleotide sequence encoding a guide RNA;

   iv) an expression construct comprising a polynucleotide encoding the genome editing fusion polypeptide of any one of claims 1 to 6, and an expression construct comprising a nucleotide sequence encoding a guide RNA;

   v) An expression construct comprising a polynucleotide encoding the genome editing fusion polypeptide of any one of claims 1 to 6 and a nucleotide sequence encoding a guide RNA.
8. The genome editing system of claim 7, wherein the guide RNA is sgRNA, preferably the sgRNA targets a closed chromatin region.
9. The genome editing system of claim 8, further comprising or encoding dsgRNA, the target site of which is 30-300 bp away from the site targeted by the sgRNA, preferably 40-270 bp, most preferably 115-120 bp.
10. A method for genetically modifying cells, comprising introducing the genome editing system of any one of claims 7-9 into cells, preferably plant cells.

Images