WO2020258078A1

WO2020258078A1 - Rna-directed editing-based method for inhibiting choroidal neovascularization, and reagent

Info

Publication number: WO2020258078A1
Application number: PCT/CN2019/093030
Authority: WO
Inventors: 杨辉; 周昌阳
Original assignee: 中国科学院脑科学与智能技术卓越创新中心
Priority date: 2019-06-26
Filing date: 2019-06-26
Publication date: 2020-12-30

Abstract

Provided are an RNA-directed editing-based method for inhibiting choroidal neovascularization, and a reagent. By constructing an adeno-associated virus for the delivery of CasRx and gRNA targeting vascular endothelial growth factor A (Vegfa), CasRx and gRNA are used to targetedly inhibit Vegfa mRNA and inhibit the formation and development of pathogenic choroidal neovascularization (CNV).

Description

Method and reagent for inhibiting choroidal neovascularization based on RNA-directed editing

Technical field

The present invention belongs to the technical field of genetic modification. More specifically, the present invention relates to methods and reagents for inhibiting choroidal neovascularization based on RNA-directed editing technology.

Background technique

Age-related macular degeneration (AMD), characterized by the development of choroidal neovascularization (CNV), is the main cause of vision deterioration in adults over 50 years of age. In its clinical manifestations, visual acuity can be normal or severely decreased. The main complaint is often dyslexia and the need to increase light intensity to help reading; the fundus manifests as drusen, focal hyperpigmentation, patchy depigmentation foci, geographic atrophy, etc. .

The angiogenic growth factor vascular endothelial growth factor A (vascular endothelial growth factor A, VEGFA) plays a key role in it. Anti-VEGFA therapy using humanized antibodies has been used clinically to treat AMD, and the therapeutic effect is maintained by regular injection of antibodies. However, the defect of this type of antibody has also been found clinically, that is, the antibody is prone to degradation in the body, resulting in a short effective time and requires relatively frequent administration, for example, it takes 1 to several months depending on the condition. Frequent administration on the one hand increases the cost of medical treatment, on the other hand it also reduces the compliance of patients, which is called the bottleneck restricting the widespread use of such drugs.

In order to change this situation, people are also trying to use VEGFA as a regulatory target to regulate at the gene level or protein level to develop more ideal drugs. However, given that choroidal neovascularization occurs in the organ of the eye, it is extremely prone to side effects or uncertain risks, and drug research is more difficult.

In summary, further development and research are needed in this field to obtain more effective drugs targeting VEGFA or its encoding genes.

Summary of the invention

The purpose of the present invention is to provide an RNA targeting tool based on the CRISPR system that can efficiently and specifically target the VEGFA gene, achieve the inhibition of choroidal neovascularization, and achieve the purpose of preventing and treating macular degeneration.

In the first aspect of the present invention, a method for targeted inhibition of vascular endothelial growth factor A in cells is provided, which includes: using adeno-associated virus to deliver CasRx and gRNA directed against vascular endothelial growth factor A into cells, thereby targeted Inhibit intracellular vascular endothelial growth factor A.

In a preferred example, in the CasRx expression cassette, both ends of the CasRx encoding gene also include a nuclear localization signal sequence.

In another preferred example, the CasRx expression cassette uses EFS, CMV, CAG, CBH or EF1a as a promoter to drive the expression of CasRx; preferably, EFS is used as a promoter.

In another preferred embodiment, the CasRx expression cassette includes the following operatively linked sequence elements: promoter sequence, nuclear localization signal 1 sequence, CasRx encoding nucleic acid sequence, nuclear localization signal 2 sequence; preferably, in the promoter The 5'end of the sequence also includes a 5'end inverted repeat sequence; preferably, the 3'end of the nuclear localization signal 2 sequence also includes a PolyA sequence.

In another preferred example, the gRNA expression cassette for vascular endothelial growth factor A uses U6 as a promoter to drive the expression of gRNA.

In another preferred embodiment, the gRNA expression cassette for vascular endothelial growth factor A includes the following operatively linked sequence elements: U6 promoter, gRNA for vascular endothelial growth factor A; preferably, in the The 3'end of the gRNA also includes a 3'end inverted repeat sequence.

In another preferred embodiment, the CasRx has a polypeptide sequence encoded by the nucleotide sequence 1699-4596 in SEQ ID NO:1 or its degenerate sequence (also includes variants or fragments of the same function) .

In another preferred embodiment, the gRNA for vascular endothelial growth factor A is targeted to the region of the sequence shown in SEQ ID NO: 9 (AGACCCTGGTGGACATCTTCCAGGAGTACC) or SEQ ID NO: 10 (CACATAGGAGAGATGAGCTTCCTACAGCAC) in the following vascular endothelial growth factor A segment.

In another preferred example, the coding sequence of CasRx and gRNA for vascular endothelial growth factor A are assembled in an adeno-associated virus vector.

In another preferred example, the adeno-associated virus vector includes the nucleotide sequence shown in SEQ ID NO:4.

In another preferred embodiment, the CasRx expression cassette includes the nucleotide sequence shown in SEQ ID NO:1.

In another preferred embodiment, the gRNA expression cassette includes the nucleotide sequence shown in SEQ ID NO: 2 and/or the nucleotide sequence shown in SEQ ID NO: 2.

In another preferred embodiment, the method for targeted inhibition of vascular endothelial growth factor A expression in cells is a non-therapeutic method.

In another aspect of the present invention, a recombinant vector expressing CasRx and gRNA directed against vascular endothelial growth factor A is provided. The recombinant vector is an adeno-associated virus vector, including an expression cassette of CasRx and an expression cassette of gRNA of vascular endothelial growth factor A .

In a preferred example, in the CasRx expression cassette, both ends of the CasRx encoding gene also include a nuclear localization signal sequence; and/or use EFS, CMV, CAG, CBH or EF1a as a promoter to drive the expression of CasRx More preferably, the expression cassette includes the following operatively linked sequence elements: promoter sequence, nuclear localization signal 1 sequence, CasRx encoding nucleic acid sequence, nuclear localization signal 2 sequence; preferably, 5'of the promoter sequence The end also includes a 5'end inverted repeat sequence; preferably, the 3'end of the nuclear localization signal 2 sequence also includes a PolyA sequence.

In another preferred example, in the gRNA expression cassette for vascular endothelial growth factor A, U6 is used as a promoter to drive the expression of gRNA; more preferably, the expression cassette includes the following operably linked sequence Element: U6 promoter, gRNA directed against vascular endothelial growth factor A; preferably, at the 3'end of the gRNA, it also includes a 3'end inverted repeat sequence.

In another preferred embodiment, the gRNA for vascular endothelial growth factor A is targeted to a segment of the sequence shown in SEQ ID NO: 9 or SEQ ID NO: 10 in vascular endothelial growth factor A.

In another preferred example, the coding sequence of CasRx and the gRNA for vascular endothelial growth factor A are assembled in an adeno-associated virus vector; more preferably, the adeno-associated virus vector includes the nucleoside shown in SEQ ID NO: 4 Acid order.

In another aspect of the present invention, the use of any of the aforementioned recombinant vectors is provided for packaging recombinant viruses, and the recombinant viruses are recombinant adeno-associated viruses.

In another aspect of the present invention, a recombinant virus is provided. The virus is an adeno-associated virus, which is packaged by the recombinant vector.

In a preferred example, the recombinant virus is used to prepare a reagent for targeted inhibition of intracellular vascular endothelial growth factor A.

In another preferred embodiment, the recombinant virus is used to prepare a medicine or composition for inhibiting choroidal neovascularization.

In another preferred embodiment, the recombinant virus is used to prepare a medicine or composition for alleviating or treating macular degeneration (such as age-related macular degeneration).

In another aspect of the present invention, a kit or a medicine kit is provided, comprising: the recombinant virus or the recombinant vector.

Other aspects of the present invention are obvious to those skilled in the art due to the disclosure herein.

Description of the drawings

Figure 1. Using CasRx to knock down Vegfa.

(a) Schematic diagram of the target site. The CasRx targeting site is conserved in human and mouse Vegfa genes.

(b,c) Transient transfection of AAV vector can effectively knock down Vegfa in human 293T (n=6 repeats, p<0.001, t=6.396) cells and mouse N2a cells (n=3 repeats, p = 0.012, t = 4.389).

(d) Detect the VEGFA protein level in cells by ELISA test (n=6 replicates, p<0.001, t=9.675).

All values are expressed as mean±s.e.m; *p<0.05, **p<0.01, ***p<0.001, unpaired t test.

Figure 2. AAV-mediated CasRx delivery reduces the area of CNV in a mouse model of AMD.

(a) Schematic diagram of integrated AAV vector and experimental procedure. 21 days before laser burn, AAV-CasRx-Vegfa was injected intravitreally into one eye, and PBS was injected into the other eye as a control. Three weeks after AAV infection, the transcription level of Vegfa mRNA was analyzed without laser burn. The VEGFA protein level was quantified by ELISA 3 days after laser burn. Measure CasRx and Vegfa mRNA levels jm and CNV area 7 days after laser burn.

(b) Vegfa mRNA level without laser burn 21 days after AAV injection (n=6 mice, p=0.002, t=4.059).

(c, d) CasRx and Vegfa mRNA levels 7 days after laser burn (CasRx mRNA: n=3 mice; Vegfa mRNA: n=3 mice, p=0.002, t=7.583).

(e) VEGFA protein level 3 days after CNV induction (n=5 mice, p=0.019, t=2.928).

(f) Representative CNV images injected with PBS or AAV-CasRx-Vegfa 7 days after laser burn. The area of CNV is indicated by a yellow line. Scale bar: 200μm.

(g) CNV area. The data points represent laser burns, and a total of 4 laser burns were induced in each eye. (180mW, n=6 mice, p=0.004, t=3.079; 240mW, n=4 mice, p=0.002, t=3.39).

Detailed ways

After in-depth research, the inventors constructed an adeno-associated virus for the delivery of CasRx and gRNA targeting vascular endothelial growth factor A (Vegfa), and realized the use of CasRx and gRNA targeted inhibition to efficiently and accurately knock down Vegfa mRNA and inhibit the cause The formation and development of diseased choroidal neovascularization (CNV). The virus obtained by the invention can continuously and effectively realize the down-regulation of Vegfa mRNA, has a long action time and good stability.

As used herein, the "element" refers to a series of functional nucleic acid sequences useful for protein expression. In the present invention, the "element" is systematically constructed to form an expression construct. The sequence of the "element" may be those provided in the present invention, and also include their variants, as long as these variants basically retain the function of the "element" by inserting or deleting some bases ( Such as 1-50bp; preferably 1-30bp, more preferably 1-20bp, more preferably 1-10bp), or by random or site-directed mutagenesis.

As used herein, the term "operably linked" or "operably linked" refers to the functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example, the promoter region is placed at a specific position relative to the nucleic acid sequence of the target gene, so that the transcription of the nucleic acid sequence is guided by the promoter region, so that the promoter region is "operably linked" to the nucleic acid sequence.

As used herein, the "expression cassette" refers to a gene expression system that contains all the necessary elements required to express a target gene, and usually includes the following elements: promoter, target gene sequence, terminator; in addition, it can also optionally Including signal peptide coding sequence and so on. These elements are operatively connected.

As used herein, the "construct (or construct)" refers to a single-stranded or double-stranded DNA molecule that has been made through human intervention to contain DNA fragments assembled and arranged according to sequences that do not exist in nature . The "construct" includes an expression vector; or, the "construct" is included in an expression vector as a part of the expression vector.

As used herein, the "gRNA target" refers to a target region suitable for gene editing operations in the Vegfa mRNA of interest in the present invention.

The inventor is committed to the study of inhibiting choroidal neovascularization. In the previous research process, it was considered that in the AMD animal model, the permanent Vegfa gene destruction was induced through editing such as spCas9; however, because this editing is aimed at the DNA level The risks associated with permanent DNA modification cannot be avoided, including unwanted off-target and targeting effects; and the inventors also found that Cas9 is difficult to package into AAV viruses, and the editing efficiency is not ideal. After extensive and in-depth research, the inventors improved the previous plan, using AAV to deliver CasRx and Vegfa gRNA, which can efficiently and accurately knock down Vegfa mRNA and inhibit the formation and development of pathogenic choroidal neovascularization (CNV). One of the differences between the technical solution of the present invention and other gene editing technical solutions is that the present invention targets Vegfa mRNA to suppress, rather than target DNA or protein, which avoids the risk of permanent DNA modification.

Adeno-associated virus (AAV) is a virus that cannot replicate itself and has low immunogenicity. However, the loading capacity of AAV viral vectors is limited, which limits its use. In this field, there are relatively few examples of successful transfection with AAV virus.

AAV vector is a vector that can be artificially transgenic, which is produced after genetic engineering using certain characteristics of naturally occurring adeno-associated virus. In the preferred mode of the present invention, the AAV vector is optimized.

In the present invention, for the Vegfa gene, a gRNA target suitable for targeted operations is provided, which can achieve high-efficiency and precise targeted inhibition of Vegfa without off-target effects and other adverse side effects.

As a preferred mode of the present invention, an expression cassette for expressing CasRx is provided, which includes the following operatively linked sequence elements: a promoter, a nuclear localization signal 1 sequence, a CasRx encoding nucleic acid sequence, a nuclear localization signal 2 sequence; The 5'end of the subsequence also includes a 5'end inverted repeat sequence; preferably, the 3'end of the nuclear localization signal 2 sequence also includes a PolyA sequence. The promoter can be CMV, CAG, CBH, EF1a, EFS, etc. In a more preferred manner, the promoter is an EFS promoter. The inventors found that applying it to the present invention not only has a short sequence but also has ideal gene expression activity, and can also selectively drive CasRx expression.

As a preferred mode of the present invention, an expression cassette for expressing gRNA targeting Vegfa is provided, including the following operatively linked sequence elements: a promoter, a gRNA targeting vascular endothelial growth factor A; preferably, in the 3 of the gRNA 'End, also includes 3'end inverted repeat sequence. In a preferred mode, the promoter is U6 promoter.

As a preferred mode of the present invention, the simplified SV40PolyA is connected after the expression frame, which can ensure that the target packaging system is reduced to a minimum, effectively reduce the difficulty of virus packaging, and improve the packaging efficiency of AAV.

As a preferred mode of the present invention, the use of guide-1 and guide-2 in series can effectively improve editing efficiency.

In a preferred embodiment of the present invention, the expression cassette for expressing CasRx and the expression cassette for expressing gRNA for Vegfa are placed in the same AAV expression vector for virus packaging. The inventor's optimized design overcomes the problem of low AAV packaging capacity, and successfully integrates the two groups of expression cassettes into one expression vector, which helps simplify the subsequent operation process, and the drug delivery scheme is simple and easy to operate.

According to the information of each element provided in the present invention, variants of the aforementioned elements that have been appropriately changed and still retain their original functions are also included in the present invention. For example, a sequence variant that hybridizes with the sequence defined in the present invention under stringent conditions and has the same function. As used herein, the term "stringent conditions" refers to: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) adding during hybridization There are denaturants, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42°C, etc.; or (3) only the homology between the two sequences is at least 70%, More preferably 75% or more, 80% or more, 85% or more or 90% or more, and more preferably 95% or more before hybridization occurs. For example, the sequence may also be the complement of these defined sequences.

The full-length nucleotide sequence of the gene pointed to by each element of the present invention or its fragments can usually be obtained by PCR amplification method, recombination method or artificial synthesis method. For the PCR amplification method, primers can be designed according to the relevant nucleotide sequence disclosed in the present invention, especially the open reading frame sequence, and a commercially available cDNA library or a cDNA prepared by a conventional method known to those skilled in the art can be used. The library is used as a template to amplify the relevant sequences.

The upstream and downstream positions of the aforementioned elements in the vector may also include restriction enzyme cleavage sites, which facilitates the organic connection of the elements.

Methods well known to those skilled in the art can be used to construct the expression vector required by the present invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology. In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells.

The vector containing the above-mentioned appropriate polynucleotide sequence and appropriate promoter or control sequence can be used for virus packaging.

In a specific embodiment of the present invention, the packaged AAV virus expressing CasRx and gRNA is injected into the vitreous of an animal model eye, successfully reducing the area of CNV in the animal eye, and the effect is particularly significant.

The present invention also provides a composition (such as a pharmaceutical composition), which contains an effective amount (such as 0.000001-50wt%; preferably 0.00001-20wt%; more preferably, 0.0001-10wt%) The adeno-associated virus obtained by packaging of the present invention and a pharmaceutically acceptable carrier.

As used herein, the term "effective amount" or "effective dose" refers to those that can produce function or activity on humans and/or animals and can be accepted by humans and/or animals as used herein. As used herein, "pharmaceutically acceptable" ingredients are substances that are suitable for humans and/or mammals without excessive adverse reactions (such as toxicity, irritation, and allergic reactions), that is, substances with a reasonable benefit/risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier for the administration of a therapeutic agent, including various excipients and diluents.

Generally, the adenovirus can be formulated in a non-toxic, inert and pharmaceutically acceptable aqueous carrier medium, where the pH is usually about 5-8, and preferably, the pH is about 6-8.

The pharmaceutical composition of the present invention can be prepared in the form of injection, for example, prepared by conventional methods with physiological saline or an aqueous solution containing glucose and other adjuvants. The dosage of the active ingredient (adenovirus) is a therapeutically effective amount, which is within the skill range of a skilled physician.

In application, the adeno-associated virus can be administered systemically or locally. In the present invention, topical administration is preferred, especially intravitreal injection.

The present invention also provides a kit/kit containing the expression cassette for expressing CasRx and the expression cassette for expressing gRNA targeting Vegfa, or a virus packaged by the vector.

Other reagents commonly used for virus packaging, transfection, injection, etc. may also be included in the kit/kit for the convenience of those skilled in the art. In addition, the kit may also include instructions for instructing those skilled in the art to operate.

The technical scheme of the present invention demonstrates the feasibility of the RNA-targeted CRISPR system for in vivo gene therapy, and provides effective clinically for choroidal neovascularization and macular degeneration (such as age-related macular degeneration) caused by high expression of VEGFA. , Precise new treatment tools.

Choroidal neovascularization is currently treated with monoclonal antibodies or inhibitors, which has a short duration. In the present invention, AAV is used for the first time to carry an efficient and accurate RNA editing tool to target VEGFA, and the therapeutic effect can be achieved for several years.

The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods that do not specify specific conditions in the following examples are usually based on conventional conditions such as those described in J. Sambrook et al., Molecular Cloning Experiment Guide, Third Edition, Science Press, 2002, or according to the manufacturer The suggested conditions.

Materials and Method

Ethics compliance

The use and care of animals conform to the guidelines of the Biomedical Research Ethics Committee of the Institute of Neuroscience, Chinese Academy of Sciences.

gRNA sequence:

gRNA-1: 5’-gtgctgtaggaagctctctctcctatgtg-3’;

gRNA-2: 5'-ggtactcctggaagatgtccaccagggtct-3'.

Plasmid construction

(1) Construction of CasRx plasmid

Using pcDNA3.1 as the backbone plasmid, adding multiple cloning sites and CAG promoters in it, to obtain the pCAG-EGFP plasmid, and then clone into it in sequence SV40NLS1, CasRx, SV40NLS2, P2A, GFP, WPRE, BGH PolyA elements, thereby The pCAG-SV40NLS1-CasRx-SV40NLS2-P2A-GFP-WPRE-PolyA plasmid was obtained. The sequence was optimized by codons, and gene synthesis was performed by Shanghai Huajin Biological Co., Ltd.

The coding sequence of each element is:

SEQ ID NO: 1 to 1648 are the pCAG promoter sequence;

SV40NLS1: Sequence ID NO: 1669-1689;

CasRx: the sequence of positions 1699-4596 in SEQ ID NO:1;

SV40NLS2: The sequence of positions 4612 to 4632 in SEQ ID NO:1;

P2A: SEQ ID NO: 4639-4695 sequence;

GFP: SEQ ID NO: 4702～5421 sequence;

WPRE: SEQ ID NO: 5433～6021 sequence;

PolyA: SEQ ID NO:1, the sequence of positions 6042 to 6249.

The nucleotide sequence of pCAG-SV40NLS1-CasRx-SV40NLS2-P2A-GFP-WPRE-PolyA is shown in SEQ ID NO:1.

(2) Construction of gRNA-1 plasmid

U6-gRNA plasmid is obtained through gene synthesis, which in turn includes U6, DR1, guide 1, DR2, CMV promoter (pCMV), mCherry, WPRE, and PolyA elements to obtain U6-DR1-guide 1-DR2-pCMV- mCherry-WPRE-PolyA plasmid. The coding sequence of each element is:

U6: The sequence of positions 1 to 241 in SEQ ID NO: 2;

DR1: SEQ ID NO: 2 257 to 282 sequence;

guide 1: SEQ ID NO: 2 sequence of positions 287 to 316;

DR2: the sequence of the 323th to 359th positions in SEQ ID NO: 2;

pCMV: the sequence of positions 365 to 872 in SEQ ID NO: 2;

mCherry: sequence of 906th to 1616th in SEQ ID NO: 2;

WPRE: the 1617 to 2204th sequence of SEQ ID NO: 2;

PolyA: SEQ ID NO: 2 the 2246 to 2471 sequence.

The nucleotide sequence of U6-DR1-guide1-DR2-pCMV-mCherry-WPRE-PolyA is shown in SEQ ID NO: 2. Among them, DR1 and DR2 are used to guide CasRx to target RNA.

(3) Construction of gRNA-2 plasmid

U6-gRNA plasmid is obtained through gene synthesis, which in turn includes U6, DR1, guide 2, DR2, CMV promoter (pCMV), mCherry, WPRE, and PolyA elements to obtain U6-DR1-guide 2-DR2-pCMV- mCherry-WPRE-PolyA plasmid. The coding sequence of each element is:

U6: Sequence ID NO: 1 to 241 in the sequence;

DR1: SEQ ID NO: 3, 257 to 282;

guide 2: Sequence ID NO: 287 to 316;

DR2: SEQ ID NO: the 323-359th sequence;

pCMV: SEQ ID NO: the 365 to 872 sequence;

mCherry: the 906th to 1616th sequence in SEQ ID NO: 3;

WPRE: the sequence of the 1617 to 2204 in SEQ ID NO: 3;

PolyA: SEQ ID NO: 2246-2471 sequence.

The nucleotide sequence of the U6-DR1-guide2-DR2-pCMV-mCherry-WPRE-PolyA plasmid is shown in SEQ ID NO: 3. Among them, DR1 and DR2 are used to guide CasRx to target RNA.

(4) Construction of U6-gRNA-pCMV-mCherry-PolyA plasmid

Obtain the tandem DR1-guide2-DR2 element from the aforementioned U6-DR1-guide2-DR2-pCMV-mCherry-WPRE-PolyA plasmid and insert it into the pCMV element of the U6-DR1-guide1-DR2-pCMV-mCherry-WPRE-PolyA plasmid Previously, the U6-gRNA-pCMV-mCherry-PolyA plasmid was obtained.

(5) Construction of AAV-CasRx-Vegfa plasmid

Using the AAV plasmid (#60231) purchased from Addgene, ITR, EFS, SV40NLS1, CasRx, HA, SV40NLS2, SV40PolyA, U6, DR1, guide1, DR2, guide2, DR3, ITR elements were sequentially cloned in it to obtain ITR -EFS-SV40NLS1-CasRx-HA-SV40NLS2-SV40PolyA-U6-DR1-guide1-DR2-guide2-DR3-ITR plasmid. The coding sequence of each element is:

ITR: SEQ ID NO: the sequence from 1 to 130 in 4;

EFS: SEQ ID NO: No. 143 to 398 sequence;

SV40NLS1: SEQ ID NO: the 414th to 434th sequence;

CasRx: the sequence of positions 444 to 3341 in SEQ ID NO: 4;

HA: SEQ ID NO: 3351～3377 sequence;

SV40NLS2: Sequence ID NO: 3378-3398 in SEQ ID NO: 4;

SV40 PolyA: SEQ ID NO: 3414~3548 sequence;

U6: the sequence of positions 3555-3795 in SEQ ID NO: 4;

DR1: the sequence of positions 3805 to 3834 in SEQ ID NO: 4;

guide1: the sequence of positions 3835 to 3864 in SEQ ID NO: 4;

DR2: the sequence of positions 3865 to 3900 in SEQ ID NO: 4;

guide 2: Sequence ID NO: 4, 3901 to 3930;

DR3: Sequence of positions 3931 to 3973 in SEQ ID NO: 4;

ITR: SEQ ID NO: 3998-4138 sequence.

The nucleotide sequence of ITR-EFS-SV40NLS1-CasRx-HA-SV40NLS2-SV40PolyA-U6-DR1-guide1-DR2-guide2-DR3-ITR plasmid is shown in SEQ ID NO: 4.

Transient transfection and qPCR

Perform plasmid transient transfection. The 293T and N2a cells were cultured in Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS) and penicillin/streptomycin, and maintained at 37°C with 5% CO2. Inoculate the cells in a 6-well plate, and use Lipofectamine 3000 reagent (Thermo Fisher Scientific) with a 4μg/well vector expressing CasRx and gRNA (CasRx: gRNA-1: gRNA-2=2:1:1, see supplementary sequence) Transfection.

The control group was only transfected with 2μg/well vector containing CasRx. Three days after transfection, GFP+mCherry+ cells (GFP+ cells in the control group) were isolated using flow cytometry. First, use Trizol (Ambion) to purify total RNA, and then transcribe it into complementary DNA (HiScript QRT SuperMix for qPCR, Vazyme, Biotech). The qPCR reaction is tracked through SYBR green probes (AceQ qPCR SYBR Green Master Mix, Vazyme, Biotech).

VEGFA qPCR primer:

Forward: 5'-GGTGGACATCTTCCAGGAGT-3' (SEQ ID NO: 5);

Reverse: 5'-TGATCTGCATGGTAGATGTTG-3' (SEQ ID NO: 6).

CasRx qPCR primer:

Forward: 5’-CCCTGGTGTCCGGCTCTAA-3’ (SEQ ID NO: 7);

Reverse: 5'-GGACTCGCCGAAGTACCTCT-3' (SEQ ID NO: 8).

AAV production and intravitreal injection

AAV-CasRx-Vegfa (AAV-PHP.eb capsid) was packaged by transfecting HEK293T cells with polyethyleneimine (PEI) (50μg/ml) (Chan,KYet al.Engineered AAVs for efficient noninvasive gene delivery to the central and peripheral nervous systems.Nature neuroscience 20,1172-1179, doi:10.1038/nn.4593(2017)]. The virus was harvested 3-7 days after three transfections, purified and concentrated. Mice (C57BL/6) aged 6-8 weeks were anesthetized for intravitreal injection. AAV-CasRx-Vegfa (7.5×10 ⁹ viral genomes in 1 μl) or PBS was injected intravitreally under an Olympus microscope (Olympus, Tokyo, Japan) using a Hamilton syringe with a 34G needle. Exclude mice with retinal hemorrhage.

Laser-induced CNV model and CNV staining

Two to three weeks after AAV injection, the mice were used for laser burns to induce CNV models [Gong, Y.et al. Optimization of an Image-Guided Laser-Induced Choroidal Neovascularization Model in Mice.Plos One 10, doi:ARTN e0132643 10.1371/journal.pone.0132643 (2015)]. In short, the mice were anesthetized and the pupils were dilated with dilating eye drops to dilate the pupil size. Use NOVUS Spectra (LUMENIS) for laser photocoagulation. The laser parameters used in the present invention are: 532nm wavelength, 70ms exposure time, 180mW or 240mW power and 50μm spot size. Induced 4 laser burns around the optic disc (30 laser burns for ELISA). Mice with vitreous hemorrhage were excluded from the study. After 3 days of laser induction, the mice were perfused with saline, and the RPE complex was dissociated for ELISA analysis (qPCR was performed 7 days after laser burn). CNV analysis was performed 7 days after laser burn. The mice were perfused with PFA, and then the eyes were fixed with PFA for 2 hours. The retina was removed from the eye, and the RPE/choroid/sclera complex was stained overnight with isolectin-B4 (IB4, 10 μg/ml, I21413, Life Technologies) only. Lay the RPE complex flat and observe it with a confocal microscope (VS120 Olympus). Only eyes with successful AAV-CasRx-Vegfa infection were included for quantification. After obtaining the CNV image, DNA was extracted from the RPE complex, and the copy number of CasRx was evaluated by qPCR. The area of CNV was quantified by a blind observer using ImageJ software.

ELISA

Collect RPE complexes for ELISA. In order to perform VEGFA ELISA, 30 laser burns were induced in each eye 3 weeks after AAV injection. The eyes were removed 3 days after induction, and the RPE complex was dissociated from the retina and lysed with RPA. According to the standard protocol, Quantikine ELISA kit (MMV00, R&D SYSTEMS) was used to determine the level of VEGFA protein.

Statistical Analysis

All values are expressed as mean ±s.e.m. The statistical significance (p<0.05) was determined by the unpaired two-tailed Student's t test.

Example 1. Targeted down-regulation of VEGFA sites and effects

After selection and experiments, CasRx targeting sites suitable for the targeted operation of the present invention have been identified. In addition, the targeting site is a CasRx targeting site that is conserved in human and mouse Vegfa genes. The inventors separately designed two guide RNAs (gRNAs) targeting these two sites (Figure 1a) to achieve effective Vegfa mRNA knockdown.

Human 293T cells and mouse N2a cells were used to study the effectiveness of the targeted operation of the present invention. Firstly, the mRNA level was investigated, and the pCAG-SV40NLS1-CasRx-SV40NLS2-P2A-GFP-WPRE-PolyA plasmid and U6-gRNA-pCMV-mCherry-PolyA plasmid constructed above were co-transfected into human 293T cells or Mouse N2a cells.

As a result, the inventors found that, compared with cells transfected with the control vector, transient transfection of vectors expressing CasRx and gRNA resulted in cultured human 293T cells (36+/-4%, sem) and mouse N2a cells (31 +/-9%, Vegfa mRNA level in sem) was significantly reduced (Figure 1b, c).

The protein level was investigated, and the results showed that the VEGFA protein level in mouse N2a cells was also significantly reduced (Figure 1d).

Example 2: Adeno-associated virus (AAV)-mediated CasRx delivery reduces the area of CNV

In order to study the knockdown efficiency of CasRx in the retina of normal mice, the present inventors injected AAV encoding CasRx and a double gRNA array targeting Vegfa (called AAV-CasRx-Vegfa) into the vitreous of mouse eyes, and observed them The effect on the area of CNV. The schematic diagram of the construction of the AAV-CasRx-Vegfa recombinant plasmid is shown in the left figure in Figure 2a, and the operation flow of injection and detection is shown in the right figure in Figure 2a.

Three weeks after injection, the choroid-retinal pigment epithelium (RPE) tissue complex was isolated for qPCR analysis (Figure 2a). The inventors found that the Vegfa transcript in the treated eye was effectively inhibited compared to the contralateral eye injected with PBS (Figure 2b).

The inventor next induced CNV in both eyes by laser irradiation to create AMD mice. In order to study the potential use of the mRNA knockdown method to treat AMD, the inventors injected AAV-CasRx-Vegfa into one eye of a mouse, and PBS injection in the other eye was used as a control (Figure 2a). After 3 weeks, CNV was induced in both eyes. After laser burn, the inventors confirmed that AAV-CasRx-Vegfa was successfully infected (Figure 2c). In addition, the inventors found that the levels of Vegfa mRNA and VEGFA protein in eyes injected with AAV were significantly lower than those in eyes injected with contralateral PBS (mRNA, 22.7+/-1.8% sem, p=0.002; protein, 68.2+/ -8.7%, sem, p=0.019; unpaired t-test) (Figure 2d-e). Therefore, intravitreal injection of Vegfa mRNA targeting AAV is effective for VEGFA expression in the injected eye.

The therapeutic effect of the CasRx method was evaluated by quantifying the CNV area 7 days after laser treatment. The inventors' results showed that compared with the control eyes injected with PBS, Vegfa targeting AAV significantly reduced the CNV area of two different laser irradiation levels. When the laser parameter is 180mW power, the CasRx group is 66+/-7.8% of the CNV area of the PBS group, sem, n=6 mice, p=0.004; when the laser parameter is 240mW power, the CasRx group only It was 36.5+/-6.9% of the CNV area in the PBS group, sem, n=4 mice, p=0.002 (unpaired t-test).

At the same time, the inventors conducted phased observations on the transfected animal model, and no side effects caused by off-target effects and other visible side effects were observed.

In summary, the inventors’ results show that AAV-mediated CasRx delivery can efficiently and accurately knock down Vegfa mRNA and inhibit the development of pathogenic CNV in AMD mouse models, supporting the view that RNA-targeted CRISPR systems can be used for therapeutic purposes. CasRx is suitable for containing multiple gRNAs in a single AAV vector for in vivo delivery.

CasRx provided by AAV has the potential to continuously correct protein expression for up to 2 years in a single injection. This makes the risk associated with mRNA editing significantly lower than the risk of DNA editing because there are a large number of transcripts, many of which may maintain normal functions.

Therefore, the CasRx knockdown method can complement existing therapeutic strategies such as monoclonal antibodies, antisense oligonucleotides and DNA nuclease editing.

All documents mentioned in the present invention are cited as references in this application, as if each document was individually cited as a reference. In addition, it should be understood that after reading the above teaching content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims

A method for targeted inhibition of intracellular vascular endothelial growth factor A, which is characterized in that it comprises: using adeno-associated virus to deliver CasRx and gRNA directed against vascular endothelial growth factor A into cells, thereby targeted inhibition of intracellular vascular endothelium Growth factor A.
The method of claim 1, wherein in the CasRx expression cassette, both ends of the CasRx encoding gene further include a nuclear localization signal sequence; or

In the CasRx expression cassette, EFS, CMV, CAG, CBH or EF1a is used as a promoter to drive the expression of CasRx; preferably, EFS is used as a promoter.
The method according to claim 2, characterized in that it comprises the following operatively linked sequence elements: promoter sequence, nuclear localization signal 1 sequence, CasRx encoding nucleic acid sequence, nuclear localization signal 2 sequence; preferably, in the promoter The 5'end of the sequence also includes a 5'end inverted repeat sequence; preferably, the 3'end of the nuclear localization signal 2 sequence also includes a PolyA sequence.
The method of claim 1, wherein the expression cassette of gRNA for vascular endothelial growth factor A uses U6 as a promoter to drive the expression of gRNA.
The method of claim 4, wherein the expression cassette for gRNA targeting vascular endothelial growth factor A includes the following operatively linked sequence elements: U6 promoter, gRNA targeting vascular endothelial growth factor A; Preferably, the 3'end of the gRNA further includes a 3'end inverted repeat sequence.
The method according to any one of claims 1 to 5, wherein the CasRx has a polypeptide sequence encoded by the nucleotide sequence 1699-4596 in SEQ ID NO:1 or its degenerate sequence.
The method according to any one of claims 1 to 5, wherein the gRNA for vascular endothelial growth factor A is targeted to the following vascular endothelial growth factor A in SEQ ID NO: 9 or SEQ ID NO: 10 Shows the segment of the sequence.
The method according to any one of claims 1 to 5, wherein the coding sequence of CasRx and gRNA for vascular endothelial growth factor A are assembled in an adeno-associated virus vector; preferably, the adeno-associated virus vector comprises The nucleotide sequence shown in SEQ ID NO: 4.
The recombinant vector expressing CasRx and gRNA directed against vascular endothelial growth factor A is characterized in that the recombinant vector is an adeno-associated virus vector and includes an expression cassette of CasRx and an expression cassette of gRNA of vascular endothelial growth factor A.
The recombinant vector of claim 9, wherein in the CasRx expression cassette, both ends of the CasRx encoding gene further include a nuclear localization signal sequence; and/or are expressed as EFS, CMV, CAG, CBH or EF1a As a promoter, it drives the expression of CasRx; more preferably, the expression cassette includes the following operatively linked sequence elements: promoter sequence, nuclear localization signal 1 sequence, CasRx encoding nucleic acid sequence, nuclear localization signal 2 sequence; preferably , At the 5'end of the promoter sequence, it also includes a 5'end inverted repeat sequence; preferably, at the 3'end of the nuclear localization signal 2 sequence, it also includes a PolyA sequence.
9. The recombinant vector of claim 9, wherein the expression cassette for gRNA targeting vascular endothelial growth factor A uses U6 as a promoter to drive the expression of gRNA; more preferably, in the expression cassette, It includes the following operatively linked sequence elements: U6 promoter, gRNA directed against vascular endothelial growth factor A; preferably, at the 3'end of the gRNA, it also includes a 3'end inverted repeat sequence.
The recombinant vector according to any one of claims 9-11, wherein the CasRx has a polypeptide sequence encoded by the nucleotide sequence 1699-4596 in SEQ ID NO:1 or its degenerate sequence; or

The gRNA for vascular endothelial growth factor A is targeted to the segment of the sequence shown in SEQ ID NO: 9 or SEQ ID NO: 10 in vascular endothelial growth factor A; or

The coding sequence of CasRx and the gRNA for vascular endothelial growth factor A are assembled in an adeno-associated virus vector; more preferably, the adeno-associated virus vector includes the nucleotide sequence shown in SEQ ID NO: 4.
The use of the recombinant vector of any one of claims 9 to 12 for packaging a recombinant virus, the recombinant virus being a recombinant adeno-associated virus.
A recombinant virus, characterized in that the virus is an adeno-associated virus, which is packaged by the recombinant vector of any one of claims 9-12.
The use of the recombinant virus of claim 14 for:

Preparing a reagent for targeted inhibition of intracellular vascular endothelial growth factor A; and/or

Preparation of drugs or compositions for inhibiting choroidal neovascularization; and/or

A medicine or composition for relieving or treating macular degeneration is prepared.
A kit or medicine kit, characterized in that the kit or medicine kit comprises: the recombinant virus according to claim 14; or the recombinant vector according to any one of 9-12.