WO2020254533A1 - Novel biocontrol agent and use thereof for controlling fungal diseases of plants - Google Patents
Novel biocontrol agent and use thereof for controlling fungal diseases of plants Download PDFInfo
- Publication number
- WO2020254533A1 WO2020254533A1 PCT/EP2020/067034 EP2020067034W WO2020254533A1 WO 2020254533 A1 WO2020254533 A1 WO 2020254533A1 EP 2020067034 W EP2020067034 W EP 2020067034W WO 2020254533 A1 WO2020254533 A1 WO 2020254533A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- strain
- spores
- plant
- trichoderma atroviride
- tal
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
- A01N63/38—Trichoderma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/885—Trichoderma
Definitions
- TITLE NEW BIOCONTROL AGENT AND ITS USE FOR THE CONTROL OF FUNGAL DISEASES OF PLANTS
- the present invention relates to a novel biocontrol agent and its use for the control of fungal diseases of plants.
- ⁇ leaf diseases eg powdery mildew, septoria, helminthosporiosis, yellow rust and brown rust
- ⁇ and ear diseases eg, fusarium head blight, ear powdery mildew and septoria.
- “Wheat septoria” refers to two diseases:
- Phaeosphaeria nodorum anamorph / asexual form: Stagonospora nodorum which attacks the leaves but also the ears and grains of wheat;
- Fusarium head blight is associated with a complex of fungal species belonging to the genera Fusarium and Microdochium.
- the genus Fusarium was first described in 1809 by Link and owes its name to the Latin "fusus" (spindle) in relation to the spindle-shaped shape of its spores. It belongs to the division of Ascomycetes, to the order of Hypocreales and to the family of Nectriaceae.
- F. graminearum is one of the most problematic species in France due to its production of mycotoxins including trichothecene deoxynivalenol (DON).
- Brown rust of wheat is a disease which usually appears quite late in the spring. It can cause significant damage if poorly controlled.
- the fungus overwinters mainly on the regrowth of cereals and early sowing crops in the form of uredospores. These uredospores germinate in the presence of free water and at temperatures between 15 and 25 ° C. The sporulation period is 5 to 25 days depending on the temperature and the variety. Under favorable conditions, more than 3000 uredospores can be produced per pustule, which explains the character explosive disease.
- the spores are dispersed mainly by the wind (Ali, S., Gladieux, P., Leconte, M., Gautier, A., Justesen, AF, Hovmoller, MS, Enjalbert, J., de Vallavieille-Pope, C. ( 2014). Origin, Migration Routes and Worldwide Population Genetic Structure of the Wheat Yellow Rust Pathogen Puccinia striiformis f.sp. tritici. PLoS Pathogens, 10 (1), el003903; De Vallavieille-Pope, C., Ali, S., & Leconte, M. (2012) Special Report Virulence Dynamics and Regional Structuring of Puccinia striiformis f sp. Tritici in France Between 1984 and 2009.).
- Yellow rust of wheat is a disease which can be very harmful in susceptible varieties if attacked early.
- the cool and humid conditions are favorable to its development.
- Yellow rust spends the winter as mycelium or active spores on regrowth of cereals or crops sown in early fall. This fungus is resistant to freezing temperatures and usually survives the winter on infected plants. In the spring, yellow rust begins to develop and produces active spores, especially since the weather is cool and humid.
- Optimal conditions for spore germination are met when temperatures are between 10 and 13 ° C with 100% relative humidity.
- the spores are dispersed mainly by the wind (Rossi, V., Racca, P., Giosue ', S., Pancaldi, D., & Alberti, F (1997).
- control agents biological or BCA can control target pathogens through one or more modes of action:
- ISR Induced Systemic Resistance
- Trichoderma comprises various species of fungi that may be biocontrol agents
- their mode of action has been the subject of much work. They report in particular a capacity of this filamentous fungus to intervene according to various mechanisms: mycoparasitism, antagonism (competition), antibiosis (production of antibiotics), root stimulation, growth stimulation by solubilization of fertilizing minerals, stimulation of natural defenses plants, etc. They colonize the roots of herbaceous and woody plants without any damage.
- this fungus can penetrate the roots and promote development, nutrition and disease resistance.
- the effects are uneven from one species to another or even from one strain to another because a good biological control agent must be a good colonizer and a good antagonist, but above all, it must also be compatible with the rhizosphere. and with plants.
- a first aim of the invention therefore consists in providing an effective strain, such as a biological control agent (or biocontrol agent) .
- a second aim of the invention is to provide phytosanitary compositions for the prevention and / or treatment of fungal diseases of plants.
- a third aim of the invention is also to provide phytosanitary coating compositions where, in association with a plant seed, the strain of the invention is used as an agent for accelerating the germination of said seed.
- Another object of the invention is to provide methods for manufacturing said compositions and for implementing the prevention and / or treatment of fungal diseases of plants, and the acceleration of germination.
- a first aspect of the invention relates to an isolated strain of Trichoderma atroviride in which the ech42 gene has a sequence identity of at least 98% with the sequence SEQ ID NO: 1 of the ech42 gene of the TAL-17 strain deposited on July 03. 2018 at the CNCM under number CNCM 1-5333.
- sequence identity of at least 98% with the sequence SEQ ID NO: 1 is meant a sequence identity of at least 98.5%, at least 99% or even at least 99, 5% with the sequence SEQ ID NO: 1 represented by the following nucleic acid sequence:
- sequence identity is measured by conventional tools for comparing sequences known to those skilled in the art such as the algorithms of the BLAST platform or the MatGat program (Campanella, Bitincka and Smalley, 2003) .
- one of the objects of the invention is the isolated strain of Trichoderma atroviride deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333 and / or one of its mutants.
- isolated strain is meant the culture of a single microorganism which has been isolated from various microorganisms present on and / or in the tissues of a leaf fragment. of wheat grown in fields.
- one of its mutants is meant mutant strains obtained by mutations or genetic manipulations of a reference strain, which in the context of the invention is the isolated strain of Trichoderma atroviride TAL-17 filed on July 3, 2018 at the CNCM under the number CNCM 1-5333. These mutants, however, retain the same physiological properties as the reference strain or even may exhibit improved physiological properties (eg. Improvement in biocontrol capacities).
- one of the subjects of the invention also relates to an isolated strain of Trichoderma atroviride, the ech42 gene of which has a sequence identity of at least 98% with the sequence SEQ ID NO: 1 of the ech42 gene of the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333 and / or one of its mutants,
- said isolated strain of Trichoderma atroviride is the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333 and / or one of its mutants, and preferably, said isolated strain of Trichoderma atroviride is the strain TAL-17 filed on July 03, 2018 at the CNCM under number CNCM 1-5333.
- strains ie TAL-17 and its mutants
- qPCR real-time Polymerase Chain Reaction
- the inventors have developed specific tools thereof namely, a TaqMan ® probe GS285741-P1 and a pair of nucleotide primers associated GS285741-F1 and GS285741-R1 (see Table 1), which can amplify a sequence specific to the strains of the invention ⁇ cf. Table 2).
- FAM 6-carboxyfluorescein
- MGB minor groove binder
- Table 2 Target sequence of oligonucleotides and of the TaqMan ® probe in strain TAL-17 and / or its mutants
- one of the subjects of the invention relates to an isolated strain of Trichoderma atroviride, the ech42 gene of which has a sequence identity of at least 98% with the sequence SEQ ID NO: 1 of the ech42 gene of the TAL- strain. 17 filed on 03 July 2018 at the CNCM under number CNCM 1-5333,
- said isolated strain of Trichoderma atroviride is the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333.
- one of the objects of the invention is the isolated strain of Trichoderma atroviride deposited on July 3, 2018 at the CNCM under number CNCM 1-5333.
- another of the objects of the invention relates to the isolated strain of Trichoderma atroviride of the invention in the form of spores, produced by fermentation in solid or liquid medium, said spores possibly in purified form or in the matrix of production, said production matrix being solid or liquid.
- spores in the form of spores
- FMS solid medium
- liquid fermentation is meant any process allowing the development of the microorganism using a production matrix with the presence of free water.
- production matrix any natural and / or synthetic substrate, which allows the development of the microorganism and induces the production of biomass, and / or enzymes, and / or primary and / or secondary metabolites.
- families of enzymes or enzymes produced by the fungus are proteases, chitinases and beta-1,3-glucanase.
- sporestiti in purified form is meant the concentrated spores following the elimination of the major part of the remainder of the matrix after production which has not been used for the formation of the spores, with the help of 'a sieving process for example.
- sporestiti in the production matrix is meant the spores that remain in the production matrix at the end of the manufacturing process, without a purification step.
- Another object of the invention relates to the isolated strain of Trichoderma atroviride of the invention as a biological control agent.
- biological control agent is meant that a strain of Trichoderma atroviride according to the invention can interfere with the growth and / or the survival of pathogens, thus making it possible to control them, via one or more of the methods. action described above (eg via the development of its biomass and / or its production of enzymes and / or secondary metabolites).
- one of the means of demonstrating that a strain of Trichoderma atroviride according to the invention is a biological control agent is to carry out a Dual culture test on culture medium in a Petri dish such as those presented among the examples. below.
- Double culture test is meant a test on a Petri dish in the laboratory on culture medium, where the strain of the microorganism, biological control agent and the strain of the pathogen are cultured on the same dish in order to observe. the effect of one strain on another over time and vice versa.
- Another object of the invention relates to the isolated strain of Trichoderma atroviride of the invention, as an antifungal agent of plants.
- plant antifungal agent is meant that a strain of Trichoderma atroviride according to the invention is capable of combating phytopathogenic fungi.
- one of the means of demonstrating that a strain of Trichoderma atroviride according to the invention is an antifungal agent for plants is to carry out a dual culture test such as those presented among the examples below.
- one of the objects of the invention relates to the isolated strain of Trichoderma atroviride of the invention as a biological control agent
- a second aspect of the invention relates to the use of the isolated strain of Trichoderma atroviride of the invention, in particular in the field of malting.
- the invention relates to the use of said isolated strain of Trichoderma atroviride in the prevention and / or treatment of fungal diseases of plants, in particular of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley.
- the invention relates to the use of said isolated strain of Trichoderma atroviride in the prevention and / or treatment of fungal diseases of wheat and / or corn and / or barley.
- the invention also relates to the use of said isolated strain of Trichoderma atroviride for promoting the germination of a seed of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley.
- the invention relates to the use of said isolated strain of Trichoderma atroviride to promote the germination of a seed of wheat and / or corn and / or barley.
- the germination aid advantageously and at the same time allows the prevention and / or treatment of fungal diseases at the time of sowing. The development of a disease after sowing is thus avoided and the yield is optimized via the biostimulant aspect of the strain of the invention.
- this aspect also makes it possible to avoid a significant slowdown in the development of the crop if a period of drought occurs some time after sowing (which can happen in spring) and therefore to avoid loss of yields at harvest.
- a third aspect of the invention relates to a phytosanitary composition
- a phytosanitary composition comprising: the isolated strain of Trichoderma atroviride of the invention as an active principle; or
- BCA biological control agent
- metabolites emitted during the production of the strain or “its metabolites emitted during its production” is meant any molecule produced by the strain of the invention during its development.
- metabolites can be enzymes produced by the fungus such as proteases, chitinases and beta-1,3-glucanase.
- biological control agent is meant a microorganism capable of interfering with the growth and / or survival of pathogens, thus making it possible to control them.
- the strain of the invention TAL-17 (deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333) is an example, but within the meaning of the invention it is a question here of combining the strain of invention to at least one other biological control agent, which is different from the strain of the invention.
- at least one other biological control agent is meant that the plant protection composition of the invention can contain 2 biological control agents (that of the invention and another), just as it can contain 3, 4 or more. 5 (that of the invention and 2, 3 or 4 others).
- one of the objects of the invention relates to the phytosanitary composition described above, said phytosanitary composition being initially (on purchase) in the form of a solid or concentrated liquid composition.
- a solid or concentrated liquid composition can be, for example, obtained by means of a particular formulation of the spores of the isolated strain of Trichoderma atroviride of the invention produced by fermentation in solid or liquid medium, said spores possibly being in purified form or in the production matrix, said production matrix being solid or liquid.
- concentration composition is meant a composition in which the concentration of the active principle (ie the strain of the invention, which can be in the form of spores) is greater than an effective amount of 10 7 spores / g, i.e. 10 7 CFU / g.
- concentration of the active principle ie the strain of the invention, which can be in the form of spores
- concentration of the active principle ie the strain of the invention, which can be in the form of spores
- concentration of the active principle ie the strain of the invention, which can be in the form of spores
- concentration of the active principle ie the strain of the invention, which can be in the form of spores
- greater than an effective amount of 10 7 spores / g is also meant greater than an effective amount of 10 8 spores / g, greater than an effective amount 10 9 spores / g, greater than an effective amount 10 10 spores / g. g, greater than an effective amount of 10 11 spores / g or greater than an effective amount of 10 12 spores / g.
- the user of the aforesaid composition must then incorporate or suspend it in a solid (eg. Soil, etc.) or aqueous (eg water) medium to obtain a dilute composition comprising an effective amount of 10 4 to 10 12 spores / g of the Trichoderma atroviride strain of the invention, which may be in the form of spores.
- a solid eg. Soil, etc.
- aqueous (eg water) medium e.g.
- the resulting diluted solid or liquid composition can then be applied to plants for which prevention and / or treatment of a fungal plant disease is desired.
- the spreading of the aforesaid composition comprises in particular the conventional spreading techniques known to those skilled in the art, which are used to spread solid materials (eg sewage sludge, manure over an area to be treated). , etc.) or liquid (eg pesticides, etc.) of agronomic interest.
- solid materials eg sewage sludge, manure over an area to be treated. , etc.
- liquid eg pesticides, etc.
- one of the subjects of the invention relates to the phytosanitary composition described above, comprising an effective amount of 10 4 to 10 12 spores / g, more particularly 10 7 to 10 9 spores / g,
- said phytosanitary composition optionally being obtained after a preparation step (e.g. dilution by suspending or mixing) making it ready for spreading.
- a preparation step e.g. dilution by suspending or mixing
- the expression "from 10 4 to 10 12 spores / g" can also mean from 10 4 to 10 5 spores / g, from 10 4 to 10 6 spores / g, from 10 4 to 10 7 spores / g, from 10 4 to 10 8 spores / g, from 10 4 to 10 9 spores / g, from 10 4 to 10 10 spores / g, from 10 4 to 10 11 spores / g, from 10 5 to 10 6 spores / g, from 10 5 to 10 7 spores / g, from 10 5 to 10 8 spores / g, from 10 5 to 10 9 spores / g, from 10 5 to 10 10 spores / g, from 10 5 to 10 11 spores / g, from 10 5 to 10 12 spores / g, from 10 6 to 10 7 spores / g, from 10 6 to 10 8 spor
- the latter also relates to a phytosanitary coating composition comprising the isolated strain of Trichoderma atroviride of the invention and optionally at least one fixing agent, said phytosanitary coating composition making it possible to produce a coated seed.
- the invention therefore also relates to a phytosanitary coating composition comprising the isolated strain of Trichoderma atroviride of the invention, said phytosanitary coating composition making it possible to produce a coated seed; a phytosanitary coating composition comprising the isolated strain of Trichoderma atroviride of the invention and at least one fixing agent, said phytosanitary coating composition making it possible to produce a coated seed.
- One of the objects of the invention therefore relates to a coated seed comprising a plant seed, said plant seed being coated with said phytosanitary coating composition and said plant belonging in particular to the Poaceae family, in particular wheat and / or corn and / or barley.
- coated seed is meant a seed selected for sowing, said seed having undergone a particular treatment which has enabled it to be coated in a phytosanitary coating composition.
- the invention relates to the coated seed as described above, said plant being wheat and / or corn and / or barley.
- the invention also relates to the coated seed as described above, said coated seed comprising an effective amount of 10 5 to 10 8 (or 10 6 to 10 7 ) spores / coated seed, preferably 10 6 ( or 10 7 ) coated spores / seed.
- a fourth aspect of the invention relates to the use of the composition of the invention. More particularly, the invention relates to the use of the composition of the invention in the prevention and / or treatment of fungal diseases of plants, in particular of plants belonging to the Poaceae family, in particular wheat and / or corn. and / or barley.
- the invention relates to the use of the composition of the invention in the prevention and / or treatment of fungal diseases of wheat and / or corn and / or barley.
- the invention also relates to the use of the composition of the invention for promoting the germination of a seed of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley.
- the invention relates to the use of the composition of the invention for promoting the germination of a seed of wheat and / or corn and / or barley.
- one of the subjects of the invention relates to the use of the isolated strain of Trichoderma atroviride of the invention or of the phytosanitary composition described above in the prevention and / or treatment of fungal diseases of plants, in particular of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley; and or
- a fifth aspect of the invention relates to a method of protecting and / or treating a plant against a disease caused by a pathogenic fungus for plants comprising the application of the composition of the invention to at least part of said plant or soil near said plant.
- the invention relates to said method of the invention, wherein said part of said plant is a leaf, a fruit, a seed.
- one of the objects of the invention relates to a method of protecting and / or treating a plant against a disease caused by a pathogenic fungus for plants comprising the application of the composition of the invention to at least part of said plant or of the soil near said plant,
- said part of said plant is a leaf, a fruit, a seed, and
- said plant belongs to the Poaceae family, in particular wheat and / or corn and / or barley.
- the invention relates to the method described above, in which said composition is applied
- 10 to 500 L / ha also means 10 to 400 L / ha, 10 to 300 L / ha, 10 to 200 L / ha, 10 to 100 L / ha , 100 to 500 L / ha, 200 to 500 L / ha, 300 to 500 L / ha, 400 to 500 L / ha, 50 to 500 L / ha, 50 to 250 L / ha or 250 to 500 L / ha.
- the expression "from 10 10 to 10 14 spores / ha” also means from 10 10 to 10 11 spores / ha, from 10 10 to 10 13 spores / ha, from 10 11 to 10 12 spores / ha, from 10 11 to 10 13 spores / ha, 10 11 to 10 14 spores / ha, 10 12 to 10 13 spores / ha, 10 12 to 10 14 spores / ha or 10 13 to 10 14 spores / ha.
- the invention relates more particularly to the process described above, in which said plant belongs to the Poaceae family, in particular wheat and / or corn and / or barley.
- the invention relates to the process described above, in which said plant is wheat and / or corn and / or barley.
- Septoria tritici is meant the pathogen of septoria.
- Gabberella zeae F. graminearum
- Fusarium wilt the pathogen of Fusarium wilt.
- Prosinia striiformis is understood to mean the pathogen of yellow rust of wheat.
- the invention relates more particularly to the method described above, in which
- the protection of said plant comprises a step of coating the seed with said phytosanitary composition
- the protection of said plant comprises spraying said composition at the time of sowing or at the germination of said plant;
- the protection of said plant comprises either a preventive application at soil level before sowing said phytosanitary composition with the addition of organic amendment, or a preventive application at soil level before sowing said phytosanitary composition on the previous crop; and or
- the treatment of said plant comprises spraying said composition during different phenological stages of the plant to prevent a risk of infection of said pathogenic fungus of the whole or part of the plant.
- Figure 1 represents the visual observations of the Dual culture test against Fusarium graminearum, to the left of the Petri dishes, at 6 (A and B) and 10 (C and D) days of cultures for the TAL-17 strain (A and C) and the BCA C strain (B and D), to the right of the Petri dishes.
- FIG. 2 represents the microscopic observation (x100 magnification) with an inverted microscope of the mycelia of F. graminearum (black arrow) and of the TAL-17 strain (white arrow) on a Petri dish containing PDA medium (potato, dextrose, agar), after 8 days of growth.
- Figure 3 represents the occupied surface (in%) and the associated photographs of the front face of a Petri dish inoculated with a rake with three strains of microorganisms (F. graminearum, TAL-17 and BCA C alone or in mixtures after 7 growing days Average ⁇ sd Different letters indicate a significant difference between the modalities (1-way ANOVA, p ⁇ 0.05).
- FIG. 4 represents the change in the surface area occupied by the BCA TAL-17 and Fusarium graminearum microorganisms alone or as a mixture after depositing 30 ⁇ L in the center of a culture dish with PDA medium after 72 h (A) and after 96 h (B) of culture at 25 ° C under a light hood.
- Figure 5 shows the change in the percentage inhibition of Fusarium graminearum on a dish depending on the formulation used.
- Figure 6 shows the percentage of CIV tubes showing septoria spots as a function of treatment after 18 days and 26 days of disease inoculation.
- FIG. 7 represents the percentage of healthy grains observed at harvest during the tests in the phytotronic room.
- FIG. 8 represents the mass of grains per ear at harvest during the tests in a phytotronic room.
- FIG. 9 represents the percentage of visual symptoms of contamination on ears by Fusarium wilt during the tests in the phytotronic room.
- FIG. 10 represents the mass of grains per ear at harvest during the tests in a phytotronic room.
- FIG. 11 represents the percentage of fusarious grains at harvest during the phytotronic room tests carried out.
- FIG. 12 represents the germination of maize plants after 6 days of growth with a sowing treatment of a suspension of TAL-17 spores at 1.10 5 CFU spores / seed or 1.10 8 CFU spores / seed.
- An aerial treatment is carried out later during the 5-leaf stage and is not taken into account when measuring germination.
- Mean ⁇ sd Different letters indicate a significant difference between the different modalities (1-way ANOVA, p ⁇ 0.05).
- FIG. 13 represents the measurement of the height in height of corn plants after 25 days of growth with a sowing treatment of a suspension of TAL-17 spores at 1.10 5 UFC spores / seed or 1.10 8 UFC spores / seed.
- An aerial treatment is carried out later during the 5-leaf stage and is not taken into account when measuring germination.
- Mean ⁇ sd Different letters indicate a significant difference between the different modalities (1-way ANOVA, p ⁇ 0.05).
- FIG. 14 represents the percentage of germination of seeds of spring wheat (Calixo) in the presence or absence of suspended spores of Trichoderma atroviride TAL-17 at sowing. Culture in a phytotron chamber with photoperiod. Mean ⁇ s.d. Significant difference between the water modality and the TAL-17 modality (1-factor ANOVA, p ⁇ 0.05).
- Figure 15 includes photographs (A) and a graphic (B).
- Figure 16 includes photographs (A) and a graphic (B).
- Line 1 corresponds to BCA alone at the dose of 1.10 4 CFU / mL
- line 2 corresponds to the BCA / Fusa ratio 2/1 mixture (BCA at 1.10 4 CFU / mL and Fusa at 5.10 3 CFU / mL)
- line 3 corresponds to the BCA / Fusa ratio 1/1 mixture (BCA at 1.10 4 UFC / mL and Fusa at 1.10 4 UFC / mL)
- line 4 corresponds to the BCA / Fusa ratio 1/2 mixture (BCA at 1.10 4 CFU / mL and Fusa at 2.10 4 CFU / mL).
- the bottom panel corresponds to the culture of Fusarium graminearum alone, from left to right, at a dose of 2.10 4 , 1.10 4 and
- Figure 17 includes photographs (A) and a graphic (B).
- Line 1 corresponds to BCA alone at a dose of 1.10 4 CFU / mL
- line 2 corresponds to the BCA / Fusa ratio 2/1 mixture (BCA at 1.10 4 UFC / mL and Fusa at 5.10 3 UFC / mL)
- line 3 corresponding to the BCA / Fusa ratio 1/1 mixture (BCA at 1.10 4 UFC / mL and Fusa at 1.10 4 UFC / mL)
- line 4 corresponds to the BCA / Fusa ratio 1/2 mixture (BCA at 1.10 4 UFC / mL and Fusa at 2.10 4 UFC / mL).
- the bottom panel corresponds to the culture of Fusarium graminearum alone, from left to right, at a dose of 2.10 4 , 1.10 4
- the leaf sample from the wheat crop was ground and then brought into contact in an infinitely mixed with a PDA (Potato Dextrose Agar) agar at 50 ° C which contains spores of Fusarium graminearum.
- the dish was cultured at 25 ° C. under a light hood. Thus only the strains being able to reproduce in the presence of Fusarium graminearum developed on the dish.
- TAL-17 was present.
- a specific sample from an area of interest in the box and several successive subcultures made it possible to isolate the TAL-17 strain, which was then deposited on July 3, 2018 at the CNCM under number CNCM 1-5333.
- strains TAL-17 and BCA C both exhibited an ability to occupy space, whereas strain TAL-17 unlike strain BCA C is capable of growing on the mycelium of Fusarium graminearum ( Figure 1).
- the TAL-17 strain therefore presents a much greater mycoparasitism potential than the other reference strain BCA C.
- this mixture also contains 0.5% of the Appyphyt formulation, which is an emulsion of vegetable oil esters (Vegetable oil esters : 60- 80%; Biobased emulsifier; 1-5%; Qsp Water).
- the mixture was inoculated after 2 h of contact.
- the Petri dishes were incubated at 25 ° C. under artificial light (24 hours a day) (fluorescent tube F36WT8 / 2084 Britegro). Measurements of the growth of F.
- endophyte comes from two Greek words “endon” and "phuton” which means respectively "inside” and "plant”.
- the definition of endophyte has changed very often over time.
- the definition concerned any organism that could live inside a plant.
- endophytic organisms are organisms having a way of life with the plant known as “endophism”. That is, endophytic species are able to colonize the internal structures of plants asymptomatically (Hardoim, PR, van Overbeek, LS, Berg, G., Pirttilà, AM, Compant, S., Campisano, A ., ... Sessitsch, A. (2015).
- Endophytes can be microorganisms like fungi. They can colonize the plant at different levels depending on the microorganism.
- the organs concerned can be, depending on the case: the stem, the roots, the leaf segments, the fruits, the buds, the seeds but also in the dead and hollow hyaline cells of the plants (Stçpniewska, Z., & Kuzniar, A. (2013). Endophytic microorganisms— promising applications in bioremediation of greenhouse gases. Applied Microbiology and Biotechnology, 97 (22), 9589-96.).
- Cotton blue (LACP-00D-100 Labkem ® ) with lactophenol was used in this study as a dye for the detection of fungi. Samples of 1 x 0.5 cm wheat leaf and 2.5 x 1.5 cm corn were taken for each modality studied. The procedure is as follows for the treatment of sections:
- the substrate used is a mixture of universal soil and expanded vermiculite (0.5-10 mm) (2: 1 v / v).
- the substrate was moistened 24 hours before sowing with reverse osmosis water.
- the seeds were moistened the day before sowing for 24 h at 4 ° C.
- the pots were placed under a light hood at 25 ° C (16/8 hour photoperiod) and were watered three times a week.
- Fungus mycelium was observed in the leaves and roots of the seedling treated plant in contrast to the untreated control plant.
- the substrate used is a mixture of universal soil and expanded vermiculite (0.5-10 mm) (2: 1 v / v).
- the substrate was moistened 24 hours before sowing with reverse osmosis water.
- the pots were watered three times a week with an increasing volume of RO water as the plant developed.
- Fungus mycelium was observed in the leaves and roots of the seedling treated plant in contrast to the untreated control plant.
- Strain TAL-17 resulted in a 63% reduction in the development of Fusarium graminearum in a Petri dish at 72 h and 78% at 96 h. This reduction rose to 77% at 72 h and to 85% at 96 h when combined with the Appyphyt formulation ( Figure 5). It should be noted that at 96 h the Appyphyt formula alone did not show any inhibition on the growth of Fusarium graminearum.
- the in vitro culture was developed to perform a screening of the selected BCAs potentials against the septoria blight of the wheat Septoria tritici.
- the standard in vitro culture medium has been modified by removing the sucrose to avoid possible contamination.
- the disease and BCA were applied simultaneously by spraying under conditions as close to the field as possible.
- FIG. 6 The percentages of plants exhibiting septoria spots according to the methods are presented in FIG. 6. Two Trichoderma atroviride were tested, including TAL-17. The latter has proved to be the most interesting against this disease. Note the quantity of BCA is in number of viable spores (equivalent to 5.10 11 viable spores / hectare).
- the phytotronic room has the possibility of increasing to 90% RH humidity during infection at the time of flowering of the ears.
- the tray allows you to test 30 planters of 15 plants. The tests were carried out with “Calixo” spring wheat.
- a first test showed an interest for the TAL-17 strain ( Figures 7 and 8). This interest was confirmed thanks to a new test ( Figures 9, 10 and 11). The latter demonstrated an interest in the use of TAL-17 (equivalent to 10 11 UFC spores / ha) with the Appyphyt formulation (equivalent to lL / ha) on wheat for the visual symptoms of the disease and on the mass of grains per ear which are then both statistically different from the contaminated modality to Fusarium graminearum alone. However, the mass of grains per ear when the wheat was treated with TAL-17 and the Appyphyt formula does not reach the mass of uncontaminated control wheat (ie 0.831 g / ears for Figure 8 and 0.77 g / ears for figure 10).
- the TAL-17 strain showed an interest for an application at the flowering stage of wheat, but in view of its endophytic character, a much earlier application is of interest in the fight against fusarium head blight.
- the substrate used is a mixture of universal soil and expanded vermiculite (0.5-10 mm) (2: 1 v / v).
- the substrate was moistened 24 hours before sowing with reverse osmosis water.
- the pots were watered three times a week with an increasing volume of RO water as the plant developed.
- witness (A) did not receive any treatment; the sowing treatment (B and C) was carried out with a TAL-17 solution of 1.10 5 or 1.10 8 spores / seed (sp / seed); the spraying treatment at the 5-leaf stage (D and E), ie 21 days of growth, was carried out with a TAL-17 solution of 1.10 11 or 5.10 11 spores / ha.
- the germination rate tends towards 97% for the modalities having received the sowing treatment at 1.10 5 spores / seed and for those who have not yet received the aerial treatment.
- the control mode without treatment, increases up to a germination percentage of 93%.
- the results of the size-in-height measurements of the 25-day-old plants represented are presented in FIG. 13, and demonstrated a statistical difference between the sowing treatment of TAL-17 compared with the aerial spray treatment and the control.
- the sowing treatments at 1.10 5 and 1.10 8 spores / seed (viable spores) allow plants to grow in the order of 105 cm, while the aerial treatments, carried out 4 days earlier and the control, only allow growth ranging from 97 cm for the control, to 100.5 cm for the aerial treatment at 1.10 11 spores / ha and 101 cm for the treatment at 5.10 11 spores / ha. These values are found in the same statistical group.
- the substrate used is a mixture of universal soil and expanded vermiculite (0.5-10 mm) (2: 1 v / v). The substrate was moistened 24 hours before sowing with reverse osmosis water.
- the pots were placed in the phytotronic room (16 / 8h photoperiod) and were watered twice a week.
- the germination percentage was observed at 4 and 11 days depending on the modalities.
- the experimental protocol was the same as that described previously.
- the Dual culture test was performed with 30 m ⁇ of BCA or F. graminearum deposited at the ends of the Petri dish. After 6 and 10 days of culture at 25 ° C on PDA under a light hood with 16 h photoperiod, the dishes were observed ( Figure 15 A) and the length of the pathogen coverage by BCA was measured ( Figure 15B).
- the TAL-17 strain exhibited the particularity of growing on the mycelium of the pathogen over time, unlike the BCA D.
- VII probe specificity Assay TaqMan ® GS285741-P1 and the torque associated GS285741 primer-F1-R1 and GS285741 vis-à-vis the strain of the invention (tal- 17 and / or a mutant thereof )
- An internal control standard is also produced with genomic DNA extracted from the strain of the invention, which has been serially diluted. All qPCR assays were performed using a CFX 96 touch thermal cycler from Biorad ® . The amplification program used is that recommended by the supplier with a temperature hybridization at 60 ° C. For the TaqMan ® method, the Luna ® Universal Probe qPCR Master Mix (NEB ® ) reaction mixture was used. The amplification program is 95 ° C 2 min followed by 40X 95 ° C 15 ”and 60 ° C 30”.
- SCI strain isolated Trichoderma atroviride present in the Vintec ® product.
- a Dual culture test was carried out on which 100 ⁇ L of a F. graminearum / T. atroviride (Fusa / BCA) was spread on PDA medium in a Petri dish.
- BCA / Fusa mixture (ratio 1/2): BCA at 1.10 4 CFU / mL and Fusa at 2.10 4 CFU / mL (lmL mixture of BCA at 2.10 4 CFU / mL + 1mL of fusa at 4.10 4 CFU / mL).
- BCA / Fusa mixture (ratio 2/1): BCA at 1.10 4 CFU / mL and Fusa at 5.10 3 CFU / mL (lmL mixture of BCA at 2.10 4 CFU / mL + 1mL of fusa at 1.10 4 CFU / mL).
- the strain of the invention TAL-17 at the same dose combats Fusarium graminearum more. This is clearly visible for the ratio of 2 CFU of Fusa / 1 CFU of BCA. In fact, under these conditions, the SCI strain stalls unlike the TAL-17 strain.
- the sown plot was divided into 4 micro-plots of the order of 20 m 2 per modality (see Table 4) and the actual test was able to start.
- two treatments were carried out at the 'ears 6 to 8' (T1) and 'early flowering' (T2) stage with conventional treatments (Onnel ® , Faxer ® , Librax ® ) in the usual dose (0.6 L / ha) or in half-dose (0.3 L / ha) in combination or not with a mixture of BCA (strain TAL-17 [BCA 1] or another strain of T. atroviride [BCA 2]) at a dose of 1.10 11 CFU / ha and Appyphyt at a dose of 1 kg / ha (see Table 4).
- the statistical analysis was carried out using StatBox ® analysis and statistical processing software. It is paired with Excel ® software and enriched its functions. It made it possible to carry out the ANOVAs which will be presented in the results section. The comparisons of means are carried out according to the Newman-Keuls test at the 5% threshold. Homogeneous statistical groups are determined, the modalities associated with the same letter are not statistically different.
- BCA 1 ie. Strain TAL-17
- BCA 2 another strain of Trichoderma atroviride
- This difference in efficacy is statistically different when comparing modality No. 9 to modality No. 7 of the test and looking at the notes on brown rust.
- BCA was applied alone to the first treatment and was also applied to the second treatment with a half-dose of conventional Librax ® fungicide.
- the TAL-17 strain showed in this test a statistical interest on the physical symptoms of brown rust.
- the TAL 17 strain when it is applied (cf. modality No. 9), it allowed to obtain a brown rust score of the same statistical group as the best modality (cf. modality No. 4) for the brown rust notation.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Mycology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Plant Pathology (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The present invention relates to a novel biocontrol agent and to the use thereof for controlling fungal diseases of plants.
Description
DESCRIPTION DESCRIPTION
TITRE : NOUVEL AGENT DE BIOCONTROLE ET SON UTILISATION POUR LA LUTTE CONTRE DES MALADIES FONGIQUES DE PLANTES TITLE: NEW BIOCONTROL AGENT AND ITS USE FOR THE CONTROL OF FUNGAL DISEASES OF PLANTS
DOMAINE DE L’INVENTION FIELD OF THE INVENTION
La présente invention concerne un nouvel agent de biocontrôle et son utilisation pour la lutte contre des maladies fongiques de plantes. The present invention relates to a novel biocontrol agent and its use for the control of fungal diseases of plants.
ART ANTERIEUR PRIOR ART
Différentes maladies menacent le blé au cours de sa croissance. Elles peuvent être classées en trois catégories : Various diseases threaten wheat during its growth. They can be classified into three categories:
■ les maladies de la base des tiges (ex : piétin- verse, fusariose), ■ diseases of the base of stems (eg foot rot, fusarium wilt),
■ les maladies des feuilles (ex : oïdium, septoriose, helminthosporiose, rouille jaune et rouille brune) ; ■ leaf diseases (eg powdery mildew, septoria, helminthosporiosis, yellow rust and brown rust);
■ et les maladies des épis (ex : fusariose de l’épi, oïdium de l’épis et septoriose). ■ and ear diseases (eg, fusarium head blight, ear powdery mildew and septoria).
Suivant les variétés de plantes et les conditions climatiques, des pertes quantitatives importantes des récoltes sont possibles, comme avec la septoriose qui réduit l’activité photosynthétique de la plante. De plus, d’autres maladies peuvent altérer la qualité de la récolte, telle la fusariose de l’épi qui produit des my cotoxines. Depending on the variety of plants and the climatic conditions, significant quantitative crop losses are possible, as with septoria which reduces the photosynthetic activity of the plant. In addition, other diseases can affect the quality of the crop, such as Fusarium head blight which produces my cotoxins.
Plus précisément : More precisely :
[1] La septoriose. dont l’agent pathogène est Septoria tritici (= Mycosphaerella graminicola ), est, sur le blé tendre, la maladie la plus fréquente et la plus dommageable quantitativement avec par exemple 17 q/ha de baisse de rendement moyen à l’échelle du territoire sur les dix dernières années. La « septoriose du blé » désigne deux maladies : [1] Septoria. whose pathogen is Septoria tritici (= Mycosphaerella graminicola), is, on common wheat, the most frequent disease and the most damaging quantitatively with for example 17 q / ha of decrease in average yield on the scale of the territory on the last ten years. "Wheat septoria" refers to two diseases:
■ la septoriose des épis causée par le champignon Phaeosphaeria nodorum (anamorphe / forme asexuée : Stagonospora nodorum) qui attaque les feuilles mais aussi les épis et les grains de blé ; et ■ septoria on the ears caused by the fungus Phaeosphaeria nodorum (anamorph / asexual form: Stagonospora nodorum) which attacks the leaves but also the ears and grains of wheat; and
■ la septoriose des feuilles causée par le champignon Mycosphaerella graminicola (anamorphe / forme asexuée : Septoria tritici , récemment renommée Zymoseptoria tritici) qui attaque les feuilles et les gaines de blé.
La septoriose à P. nodorum a été l’espèce prédominante en France jusque dans les années 80, de nos jours la forme majoritaire est la septoriose à M. graminicola , sans doute pour des raisons écologiques (Bearchell, S. J., Fraaije, B. A., Shaw, M. W., & Fitt, B. D. L. (2005). Wheat archive links long-term fungal pathogen population dynamics to air pollution. Proceedings of the National Academy of Sciences of the United States of America, 102(15), 5438-42.). ■ leaf septoria caused by the fungus Mycosphaerella graminicola (anamorphic / asexual form: Septoria tritici, recently renamed Zymoseptoria tritici) which attacks the leaves and sheaths of wheat. Septoria caused by P. nodorum was the predominant species in France until the 1980s, nowadays the majority form is septoria caused by M. graminicola, probably for ecological reasons (Bearchell, SJ, Fraaije, BA, Shaw , MW, & Fitt, BDL (2005). Wheat archive links long-term fungal pathogen population dynamics to air pollution. Proceedings of the National Academy of Sciences of the United States of America, 102 (15), 5438-42.).
[2] La fusariose. dont l’agent pathogène est Gibberella zeae (= Fusarium graminearum ), est un terme générique qui désigne un groupe de maladies cryptogamiques. Dans le cas du blé, cette maladie peut dévaster une culture quelques semaines avant la récolte. Outre le blé, elle est également retrouvée sur d’autres espèces comme le maïs et l’orge. Contrairement à la septoriose, la fusariose peut infecter toutes les parties de la plante, depuis les racines jusqu’aux épis, et ceci à tous les stades de développement. Le terme « fusariose » des céréales regroupe trois types de symptômes (Parry, D. W., Jenkinson, P., & McLeod, L. (1995). Fusarium ear blight (scab) in small grain cereals, a review. Plant Pathology , 44(2), 207- 238.) : [2] Fusarium wilt. whose pathogen is Gibberella zeae (= Fusarium graminearum), is a generic term for a group of fungal diseases. In the case of wheat, this disease can devastate a crop a few weeks before harvest. Besides wheat, it is also found on other species such as corn and barley. Unlike septoria, fusarium can infect all parts of the plant, from the roots to the ears, at all stages of development. The term “fusarium” in cereals covers three types of symptoms (Parry, DW, Jenkinson, P., & McLeod, L. (1995). Fusarium ear blight (scab) in small grain cereals, a review. Plant Pathology, 44 ( 2), 207-238.):
■ la fusariose des semences ; ■ Fusarium wilt of seeds;
■ la fusariose du collet ; et ■ Fusarium head blight; and
■ la fusariose de l’épi. ■ Fusarium head blight.
Cette dernière, la fusariose de l’épi est associée à un complexe d’espèces de champignons appartenant aux genres Fusarium et Microdochium. Le genre Fusarium a été décrit pour la première fois en 1809 par Link et doit son nom du latin « fusus » (fuseau) en rapport à l’allure fusiforme de ses spores. Il appartient à la division des ascomycètes, à l’ordre des Hypocreales et à la famille des Nectriaceae. Parmi la vingtaine d’espèces du genre Fusarium pouvant causer la fusariose de l’épi, F. graminearum, est l’une des espèces la plus problématique en France de par sa production de mycotoxines dont le trichothécène déoxynivalenol (DON). The latter, Fusarium head blight, is associated with a complex of fungal species belonging to the genera Fusarium and Microdochium. The genus Fusarium was first described in 1809 by Link and owes its name to the Latin "fusus" (spindle) in relation to the spindle-shaped shape of its spores. It belongs to the division of Ascomycetes, to the order of Hypocreales and to the family of Nectriaceae. Among the twenty species of the Fusarium genus that can cause Fusarium head blight, F. graminearum, is one of the most problematic species in France due to its production of mycotoxins including trichothecene deoxynivalenol (DON).
[3] La rouille brune du blé dont l’agent pathogène est Puccinia recondita , est une maladie qui apparaît généralement assez tardivement au printemps. Elle peut provoquer d'importants dégâts si elle est mal contrôlée. Le champignon hiverne essentiellement sur les repousses de céréales et les cultures à semis précoces sous forme d’urédospores. Ces urédospores germent en présence d’eau libre et pour des températures comprises entre 15 et 25°C. La période de sporulation est de 5 à 25 jours selon les températures et les variétés. En conditions favorables, plus de 3000 urédospores peuvent être produites par pustule, ce qui explique le caractère
explosif de la maladie. Les spores sont disséminées principalement par le vent (Ali, S., Gladieux, P., Leconte, M., Gautier, A., Justesen, A. F., Hovmoller, M. S., Enjalbert, J., de Vallavieille-Pope, C. (2014). Origin, Migration Routes and Worldwide Population Genetic Structure of the Wheat Yellow Rust Pathogen Puccinia striiformis f.sp. tritici. PLoS Pathogens , 10(1), el003903 ; De Vallavieille-Pope, C., Ali, S., & Leconte, M. (2012). Spécial Report Virulence Dynamics and Régional Structuring of Puccinia striiformis f sp. tritici in France Between 1984 and 2009.). [3] Brown rust of wheat, the pathogen of which is Puccinia recondita, is a disease which usually appears quite late in the spring. It can cause significant damage if poorly controlled. The fungus overwinters mainly on the regrowth of cereals and early sowing crops in the form of uredospores. These uredospores germinate in the presence of free water and at temperatures between 15 and 25 ° C. The sporulation period is 5 to 25 days depending on the temperature and the variety. Under favorable conditions, more than 3000 uredospores can be produced per pustule, which explains the character explosive disease. The spores are dispersed mainly by the wind (Ali, S., Gladieux, P., Leconte, M., Gautier, A., Justesen, AF, Hovmoller, MS, Enjalbert, J., de Vallavieille-Pope, C. ( 2014). Origin, Migration Routes and Worldwide Population Genetic Structure of the Wheat Yellow Rust Pathogen Puccinia striiformis f.sp. tritici. PLoS Pathogens, 10 (1), el003903; De Vallavieille-Pope, C., Ali, S., & Leconte, M. (2012) Special Report Virulence Dynamics and Regional Structuring of Puccinia striiformis f sp. Tritici in France Between 1984 and 2009.).
[4] La rouille jaune du blé dont l’agent pathogène est Puccinia striiformis , est une maladie qui peut être très nuisible sur des variétés sensibles en cas d’attaques précoces. Les conditions fraîches et humides sont favorables à son développement. La rouille jaune passe l’hiver sous forme de mycélium ou de spores actives sur les repousses de céréales ou les cultures semées tôt à l’automne. Ce champignon résiste à des températures négatives et survit généralement à l’hiver sur des plants infectés. Au printemps, la rouille jaune commence à se développer et produit des spores actives, et ce d’autant plus que le temps est frais et humide. Les conditions optimales pour la germination des spores sont réunies lorsque les températures sont comprises entre 10 et 13°C avec un taux d’humidité relative à 100 %. Les spores sont disséminées principalement par le vent (Rossi, V., Racca, P., Giosue’, S., Pancaldi, D., & Alberti, F (1997). A simulation model for the development of brown rust épidémies in winter wheat. European Journal of Plant Pathology, 103(5), 453-465.). [4] Yellow rust of wheat, the pathogen of which is Puccinia striiformis, is a disease which can be very harmful in susceptible varieties if attacked early. The cool and humid conditions are favorable to its development. Yellow rust spends the winter as mycelium or active spores on regrowth of cereals or crops sown in early fall. This fungus is resistant to freezing temperatures and usually survives the winter on infected plants. In the spring, yellow rust begins to develop and produces active spores, especially since the weather is cool and humid. Optimal conditions for spore germination are met when temperatures are between 10 and 13 ° C with 100% relative humidity. The spores are dispersed mainly by the wind (Rossi, V., Racca, P., Giosue ', S., Pancaldi, D., & Alberti, F (1997). A simulation model for the development of brown rust epidemics in winter wheat, European Journal of Plant Pathology, 103 (5), 453-465.).
Parmi les différentes méthodes de lutte disponibles pour lutter contre ces maladies, notamment la septoriose et la fusariose et leurs conséquences, il existe la lutte chimique (fongicides), la résistance variétale, les stimulateurs de défenses des plantes (SDN ou « éliciteurs »), la lutte agronomique (travail du sol, précédents culturaux, gestion des résidus de culture ou des repousses, date et densité de semis, fertilisation azotée...). Toutefois, celles- ci présentent soit des inconvénients environnementaux liés à la pollution de sols et des nappes phréatiques, soit impliquent un coût humain et temporel important. Among the various control methods available to fight against these diseases, in particular septoria and fusarium and their consequences, there is chemical control (fungicides), varietal resistance, plant defense stimulators (SDN or "elicitors"), agronomic control (tillage, previous crops, management of crop residues or regrowth, date and density of sowing, nitrogen fertilization, etc.). However, these present either environmental drawbacks linked to soil and groundwater pollution, or involve a significant human and time cost.
Dans un souci de respect de l’environnement, il a alors été développé des moyens de lutte biologique naturelle à l’aide de microorganismes. Cette dernière, également appelée lutte microbiologique directe, consiste à introduire des antagonistes microbiens spécifiques dans le sol ou sur le matériel végétal. Ces antagonistes, également appelés agents de lutte biologique ou BCA ( Biological Control Agent ), peuvent interférer avec la croissance et/ou la survie des agents pathogènes permettant ainsi de les contrôler. Pour ce faire, les agents de lutte
biologique ou BCA peuvent contrôler les pathogènes cibles grâce à un ou plusieurs modes d’action : In order to respect the environment, it was then developed means of natural biological control using microorganisms. The latter, also called direct microbiological control, consists of introducing specific microbial antagonists into the soil or into the plant material. These antagonists, also called biological control agents or BCA (Biological Control Agent), can interfere with the growth and / or survival of pathogens, thus making it possible to control them. To do this, control agents biological or BCA can control target pathogens through one or more modes of action:
1/ la compétition laquelle peut avoir lieu entre le BCA et l’agent pathogène pour l’oxygène, pour l’espace, ou encore pour les nutriments ; 1 / the competition which can take place between the BCA and the pathogen for oxygen, for space, or for nutrients;
2/ l’antibiose. laquelle correspond aux interactions impliquant au moins un composé diffusible de faible masse moléculaire ou un antibiotique produit par un microorganisme qui inhibe la croissance d’un autre microorganisme; 2 / antibiosis. which corresponds to interactions involving at least one diffusible low molecular compound or an antibiotic produced by a microorganism which inhibits the growth of another microorganism;
3/ le parasitisme et la production d’enzymes hydrolytiques et/ou de métabolites antibiotiques au détriment d’un autre organisme hôte ; et/ou 3 / parasitism and the production of hydrolytic enzymes and / or antibiotic metabolites to the detriment of another host organism; and or
4/ l’induction de résistance chez la plante hôte (« élicitation ») à l’image des bactéries de la rhizosphère, connues sous le nom de PGPR Plant Growth Promoting Rhizobacteria ), lesquelles sont capables d'induire chez la plante une résistance systémique induite (ISR, Induced Systemic Résistance) qui permet d'accroître la résistance aux pathogènes grâce à un phénomène de potentialisation (ou priming ), qui correspond à un état de veille permettant une réponse immunitaire plus rapide et plus intense de la plante. 4 / induction of resistance in the host plant ("elicitation") like bacteria of the rhizosphere, known under the name of PGPR Plant Growth Promoting Rhizobacteria), which are capable of inducing systemic resistance in the plant Induced Systemic Resistance (ISR) which increases resistance to pathogens thanks to a phenomenon of potentiation (or priming), which corresponds to a waking state allowing a faster and more intense immune response of the plant.
Le genre Trichoderma comprenant diverses espèces de champignons susceptibles d’être des agents de biocontrôle, leur mode d’action a fait l’objet de nombreux travaux. Ils font notamment état d’une capacité de ce champignon filamenteux à intervenir selon divers mécanismes : mycoparasitisme, antagonisme (compétition), antibiose (production d’antibiotiques), stimulation racinaire, stimulation de la croissance par solubilisation de minéraux fertilisants, stimulation des défenses naturelles des plantes, etc. Ils colonisent les racines des plantes herbacées et ligneuses sans aucun dommage. En outre, ce champignon peut pénétrer dans les racines et favoriser le développement, la nutrition et la résistance aux maladies. Toutefois, les effets sont inégaux d’une espèce à l’autre voire d’une souche à l’autre car un bon agent de lutte biologique doit être un bon colonisateur et un bon antagoniste mais surtout, il doit également être compatible avec la rhizosphère et avec les plantes. Since the genus Trichoderma comprises various species of fungi that may be biocontrol agents, their mode of action has been the subject of much work. They report in particular a capacity of this filamentous fungus to intervene according to various mechanisms: mycoparasitism, antagonism (competition), antibiosis (production of antibiotics), root stimulation, growth stimulation by solubilization of fertilizing minerals, stimulation of natural defenses plants, etc. They colonize the roots of herbaceous and woody plants without any damage. In addition, this fungus can penetrate the roots and promote development, nutrition and disease resistance. However, the effects are uneven from one species to another or even from one strain to another because a good biological control agent must be a good colonizer and a good antagonist, but above all, it must also be compatible with the rhizosphere. and with plants.
BREF APERÇU BRIEF OVERVIEW
Dans ce contexte de lutte contre des maladies fongiques, telles que la septoriose et la fusariose, un premier but de l’invention consiste donc à la mise à disposition d’une souche efficace, comme un agent de lutte biologique (ou agent de biocontrôle).
Un second but de l’invention est de fournir des compositions phytosanitaires pour la prévention et/ou le traitement de maladies fongiques de végétaux. In this context of combating fungal diseases, such as septoria and fusarium, a first aim of the invention therefore consists in providing an effective strain, such as a biological control agent (or biocontrol agent) . A second aim of the invention is to provide phytosanitary compositions for the prevention and / or treatment of fungal diseases of plants.
Un troisième but de l’invention est également de fournir des compositions phytosanitaires d’enrobage où, en association avec une semence de plante, la souche de l’invention est utilisée comme un agent d’accélération de la germination de ladite semence. A third aim of the invention is also to provide phytosanitary coating compositions where, in association with a plant seed, the strain of the invention is used as an agent for accelerating the germination of said seed.
Un autre but de l’invention est la mise à disposition des procédés permettant de fabriquer lesdites compositions et de mettre en œuvre la prévention et/ou le traitement de maladies fongiques de végétaux, et l’accélération de la germination. Another object of the invention is to provide methods for manufacturing said compositions and for implementing the prevention and / or treatment of fungal diseases of plants, and the acceleration of germination.
DESCRIPTION DETAILLEE DETAILED DESCRIPTION
Un premier aspect de l’invention concerne une souche isolée de Trichoderma atroviride dont le gène ech42 possède une identité de séquence d’au moins 98% avec la séquence SEQ ID NO : 1 du gène ech42 de la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333. A first aspect of the invention relates to an isolated strain of Trichoderma atroviride in which the ech42 gene has a sequence identity of at least 98% with the sequence SEQ ID NO: 1 of the ech42 gene of the TAL-17 strain deposited on July 03. 2018 at the CNCM under number CNCM 1-5333.
De manière surprenante, il est apparu que la souche de Trichoderma atroviride TAL-17 développée par les inventeurs, dont le gène ech42 a été séquencé, possède d’excellentes propriétés stimulatrices de croissance, des propriétés antagonistes utiles en agriculture ainsi qu’une grande stabilité en matière de viabilité. De fait, elle constitue un agent de biocontrôle idéal pour lutter efficacement contre des maladies fongiques de plantes. Surprisingly, it appeared that the strain of Trichoderma atroviride TAL-17 developed by the inventors, of which the ech42 gene was sequenced, has excellent growth stimulating properties, antagonistic properties useful in agriculture as well as great stability. in terms of sustainability. In fact, it is an ideal biocontrol agent to effectively fight against fungal diseases of plants.
Par « une identité de séquence d’au moins 98% avec la séquence SEQ ID NO : 1 », on entend une identité de séquence d’au moins 98,5%, d’au moins 99% voire d’au moins 99,5% avec la séquence SEQ ID NO : 1 représentée par la séquence d’acide nucléique suivante : By "a sequence identity of at least 98% with the sequence SEQ ID NO: 1" is meant a sequence identity of at least 98.5%, at least 99% or even at least 99, 5% with the sequence SEQ ID NO: 1 represented by the following nucleic acid sequence:
AC AG T AT AAG CAT AT C G GAGAAAT G C CAC CAC C AG C AAC G T T G C T AGAC T T G G C GAG G T G C G GCATAGT TCAGTGATAT TGCGCCGGGGCATCCCCTGGATATGCT TATCT TCTGAATCTGGGG AACT TGGGAAT TCTACGAGTCGACAGCCGCCGAGCCCTGGGCACGGGACAGGGGCCACAAGC T C T T G CAC GAT G G CAC T AT T C T AGAG C AGAAG T GAG CAT AAC G T T G C GAT T GAC CAT G T T G G C AAAG CAT G G G T T AC AT AC C TAC T C G T G C T AAGAAC C C C GAAAG G GAAG C T T CAT AAG T T GA C T T CAGAT T T CGC T GAACAATAGGAGGC T CCACAAT CAC T TATAAATAT GC T GCATAT CC T T CCAGCACT TCG GAT G AAAAT TCCATCCAGCAGCAG C AAC T T G G AG AG CTCT T T TCAGCAGCA ACT TCT TCCT T TCAAAGCATCTCT TGACAACCT T TGCTGAATCTCAAACACT TCACCATGT T GGGCT TCCTCGGAAAATCCGTGGCCCTGCT TGCTGCGCTGCAGGCCACTCTCAT T TCTGCAT AC AG T AT AAG CAT AT CG GAGAAAT GC CAC CAC C AG C AAC GTTGCT AGAC TTGGC GAG GTGCG GCATAGT TCAGTGATAT TGCGCCGGGGCATCCCCTGGATATGCT TATCT TCTGAATCTGGGG AACT TGGGAAT TCTACGAGTCGACAGCCGCCGAGCCCTGGGCACGGGACAGGGGCCACAAGC TCTTG ACC GAT GG CAC T AT TCT AGAG C AGAAG T GAG CAT AAC GTTGC GAT T GAC CAT GTTGGC AAAG CAT GGGTT AC AT AC C TAC TCGTGCT AAGAAC CCC GAAAG G GAAG CTT CAT AAG TT GA CTT CAGAT TT CGC T GAACAATAGGAGGC T CCACAAT CAC T TATAAATAT GC T GCATAT CC TT CCAGCACT TCG GAT G AAAAT TCCATCCAGTAGCAGCAG TCAG TTCA AAGCAGCAGC TTCA A TCT TCCT T TCAAAGCATCTCT TGACAACCT T TGCTGAATCTCAAACACT TCACCATGT T GGGCT TCCTCGGAAAATCCGTGGCCCTGCT TGCTGCGCTGCAGGCCACTCTCAT T TCTGCAT
CTCCTGTAACTGCAAACGACGTCTCTGT TGAGAAGAGAGCCAGTGGATACGCAAACGCCGTC
TAC T T CAC C AAC T G G T AAG T GAAG C T G C T T C AGAG T CAT GAAAAT C AG GAC T AAC CAT T G G T GATTAAAGGGGTATTTACGGCCGCAACTTCCAGCCTCAGAACCTGGTCGCGTCGGACATCAC TCATGTCATCTACTCGTTCATGAACTTCCAAGCAGACGGCACTGTGTAAGTTTTGAAGACAA GAGTCAAGATATTCTAATTTCCATATCCAGTGACTAATCTTTTCACTTATAGCGTCTCTGGA GAT G C C TAC G C C GAT T AT C AGAAG CAC T AT GAC GAC GAT T G T AT G C T AG C C C TAC T C C C T T T GTTCTCTCCTGTTTTTGAGCTCTTCAGGTATACTAACGTCTACAACAGCTTGGAACGACGTC GGTAACAATGCGTACGGCTGTGTGAAGCAGCTGTTCAAGCTGAAGAAGGCCAACCGCAACTT GAAGGTTATGCTTTCCATCGGTGGCTGGACCTGGTCCACCAACTTTCCTTCTGCAGCAAGCA CCGATGCCAACCGCAAGAACTTTGCCAAGACTGCCATCACCTTCATGAAGGACTGGGGTTTC GATGGTATTGACGTCGATTGGGAGTACCCCGCCGATGATACCCAGGCCACCAACATGGTTCT TCTGCTCAAGGAGATCCGATCTCAGCTAGATGCCTATGCTGCGCAATACGCTCCGGGCTACC ACTTCCTTCTTTCCATTGCTGCCCCCGCTGGCCCAGAGCACTACTCTTTCCTGCACATGTCC GACCTTGGCCAAGTTCTCGACTATGTCAACCTCATGGCCTACGACTATGCTGGTTCTTGGAG CAGCTACTCCGGACACGATGCCAACTTGTTTGCCAACCCGTCCAACCCCAACTCTTCACCAT AC AAC AC C GAT C AAG C T AT C AAG GAC TATAT C AAG G GAG GTGTTCCCG C AAG C AAGAT C G T T CTTGGCATGCCCATCTACGGACGAGCTTTTGAGAGCACCGGTGGCATTGGCCAGACCTACAG TGGAATTGGATCTGGAAGCTGGGAGAACGGTATTTGGGACTACAAGGTTCTTCCCAAGGCCG G C G C CAC AG T C C AG T AT GAC T C T G T C G CAC AG G CAT AC T AC AG C T AT GAC C C C AG C AG C AAG GAGCTCATCTCTTTCGATACCCCTGACATGATCAACACCAAGGTCTCTTACCTCAAGAACCT CGGCCTGGGAGGCAGCATGTTCTGGGAAGCTTCTGCTGACAAGACTGGCTCTGACTCCTTGA T C G G AAC AAG C CAC AG AG C T T T G G GAAG C C T AG AC T C CAC T C AG AAC T T G C T GAG C T AC C C C AACTCCCAGTATGATAACATCCGAAGCGGTCTCAACTAGAGATCTTTCTTCTTCTTATCTTT TTCTTTTACTTCCCCTATGGTTGTACCAACATTTCACACACGTTATGCGAAACGATTATGCA G G GAG CGTTATTTTTTAG T AAAT AG TTGCCCTTT GAGAT AT AT G AAC C T G T AC AT AAAGAAC TAC T AG C AG T AT AT AAG GAGAC AT G C AG G . CTCCTGTAACTGCAAACGACGTCTCTGT TGAGAAGAGAGCCAGTGGATACGCAAACGCCGTC TAC TT CAC C AAC TGGT AAG T GAAG CTGCTTC AGAG T CAT GAAAAT C AG GAC T AAC CAT TGGT GATTAAAGGGGTATTTACGGCCGCAACTTCCAGCCTCAGAACCTGGTCGCGTCGGACATCAC TCATGTCATCTACTCGTTCATGAACTTCCAAGCAGACGGCACTGTGTAAGTTTTGAAGACAA GAGTCAAGATATTCTAATTTCCATATCCAGTGACTAATCTTTTCACTTATAGCGTCTCTGGA GAT CCG TAC CCG GAT T AT C AGAAG CAC T AT GAC GAC GAT TGT AT GCT AG CCC TAC TCCCTTT GTTCTCTCCTGTTTTTGAGCTCTTCAGGTATACTAACGTCTACAACAGCTTGGAACGACGTC GGTAACAATGCGTACGGCTGTGTGAAGCAGCTGTTCAAGCTGAAGAAGGCCAACCGCAACTT GAAGGTTATGCTTTCCATCGGTGGCTGGACCTGGTCCACCAACTTTCCTTCTGCAGCAAGCA CCGATGCCAACCGCAAGAACTTTGCCAAGACTGCCATCACCTTCATGAAGGACTGGGGTTTC GATGGTATTGACGTCGATTGGGAGTACCCCGCCGATGATACCCAGGCCACCAACATGGTTCT TCTGCTCAAGGAGATCCGATCTCAGCTAGATGCCTATGCTGCGCAATACGCTCCGGGCTACC ACTTCCTTCTTTCCATTGCTGCCCCCGCTGGCCCAGAGCACTACTCTTTCCTGCACATGTCC GACCTTGGCCAAGTTCTCGACTATGTCAACCTCATGGCCTACGACTATGCTGGTTCTTGGAG CAGCTACTCCGGACACGATGCCAACTTGTTTGCCAACCCGTCCAACCCCAACTCTTCACCAT AC AC C AAC GAT AAG C AT C CT AAG GAC AAG Tatat C G GAG AAG GTGTTCCCG C C AAG AT CGTT CTTGGCATGCCCATCTACGGACGAGCTTTTGAGAGCACCGGTGGCATTGGCCAGACCTACAG TGGAATTGGATCTGGAAGCTGGGAGAACGGTATTTGGGACTACAAGGTTCTTCCCAAGGCCG GCGC CAC AG TCC AG T AT GAC TCTGTCG CAC AG G CAT AC T AC AG CT AT GAC CCC AG C AG C AAG GAGCTCATCTCTTTCGATACCCCTGACATGATCAACACCAAGGTCTCTTACCTCAAGAACCT CGGCCTGGGAGGCAGCATGTTCTGGGAAGCTTCTGCTGACAAGACTGGCTCTGACTCCTTGA TCGG AAC AAG C CAC AG AG CTTTGG GAAG CTC AG AC TC CAC TC AG AAC TTGCT GAG CT AC CCC AACTCCCAGTATGATAACATCCGAAGCGGTCTCAACTAGAGATCTTTCTTCTTCTTATCTTT TTCTTTTACTTCCCCTATGGTTGTACCAACATTTCACACACGTTATGCGAAACGATTATGCA GG GAG CGTTATTTTTTAG AT AAAT AG TTG TAC GAC AGCTTTTTTAG AT AAAT AG TTG TAC GCC AGCTTT GATT AT ATG AT AG TTG TAC GAC GCTTT AT AT ATG ATG AT AG TTG TAC GCTTT GATT AT ATG AT AG TTG TAC GCT GAC ATTT AT AT
Au sens de l’Invention, l’identité de séquence est mesurée par les outils classiques de comparaison de séquences connues de l’Homme du métier tels que les algorithmes de la plateforme BLAST ou le programme MatGat (Campanella, Bitincka and Smalley, 2003). Within the meaning of the invention, the sequence identity is measured by conventional tools for comparing sequences known to those skilled in the art such as the algorithms of the BLAST platform or the MatGat program (Campanella, Bitincka and Smalley, 2003) .
Plus particulièrement, un des objets de l’invention est la souche isolée de Trichoderma atroviride déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333 et/ou un de ses mutants. More particularly, one of the objects of the invention is the isolated strain of Trichoderma atroviride deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333 and / or one of its mutants.
Par « souche isolée », on entend la culture d’un microorganisme unique qui a été isolée à partir de différents microorganismes présents sur et/ou dans les tissus d’un fragment de feuille
de blé cultivé en champs. Par « un de ses mutants », on entend des souches mutantes obtenues par mutations ou manipulations génétiques d’une souche de référence, laquelle dans le contexte de l’invention est la souche isolée de Trichoderma atroviride TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333. Ces mutants conservent toutefois les mêmes propriétés physiologiques que la souche de référence voire peuvent présenter des propriétés physiologiques améliorées ( e.g . amélioration des capacités de biocontrôle). By “isolated strain” is meant the culture of a single microorganism which has been isolated from various microorganisms present on and / or in the tissues of a leaf fragment. of wheat grown in fields. By “one of its mutants” is meant mutant strains obtained by mutations or genetic manipulations of a reference strain, which in the context of the invention is the isolated strain of Trichoderma atroviride TAL-17 filed on July 3, 2018 at the CNCM under the number CNCM 1-5333. These mutants, however, retain the same physiological properties as the reference strain or even may exhibit improved physiological properties (eg. Improvement in biocontrol capacities).
Au vu de ce qui précède, on comprend donc qu’un des objets de l’Invention concerne également une souche isolée de Trichoderma atroviride dont le gène ech42 possède une identité de séquence d’au moins 98% avec la séquence SEQ ID NO : 1 du gène ech42 de la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333 et/ou un de ses mutants, In view of the foregoing, it is therefore understood that one of the subjects of the invention also relates to an isolated strain of Trichoderma atroviride, the ech42 gene of which has a sequence identity of at least 98% with the sequence SEQ ID NO: 1 of the ech42 gene of the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333 and / or one of its mutants,
en particulier ladite souche isolée de Trichoderma atroviride est la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333 et/ou un de ses mutants, et de préférence, ladite souche isolée de Trichoderma atroviride est la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333. in particular said isolated strain of Trichoderma atroviride is the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333 and / or one of its mutants, and preferably, said isolated strain of Trichoderma atroviride is the strain TAL-17 filed on July 03, 2018 at the CNCM under number CNCM 1-5333.
L’ensemble de ces souches (i.e. TAL-17 et ses mutants), peuvent par ailleurs être facilement identifiées via la méthode dite de Polymerase Chain Reaction en temps réel (qPCR). Les inventeurs ont en effet développé des outils spécifiques de celles-ci à savoir, une sonde TaqMan® GS285741-P1 et un couple d’amorces nucléotidiques associé GS285741-F1 et GS285741-R1 ( cf Tableau 1), lesquelles permettent d’amplifier une séquence spécifique aux souches de l’invention {cf. Tableau 2). All of these strains (ie TAL-17 and its mutants) can moreover be easily identified via the so-called real-time Polymerase Chain Reaction (qPCR) method. The inventors have developed specific tools thereof namely, a TaqMan ® probe GS285741-P1 and a pair of nucleotide primers associated GS285741-F1 and GS285741-R1 (see Table 1), which can amplify a sequence specific to the strains of the invention {cf. Table 2).
GS285741-R1 AAC-GAG-ACT-TGA-CAG-TAG-CG 3 60,0 GS285741-R1 AAC-GAG-ACT-TGA-CAG-TAG-CG 3 60.0
GS285741-P1 FAM-ACG-GCG-TAT-ATT-GTT-GAC-AAA- 4 GS285741-P1 FAM-ACG-GCG-TAT-ATT-GTT-GAC-AAA- 4
CAA-GAT-GC-MGB CAA-GAT-GC-MGB
Tableau 1 : Amorces nucléotidiques (Fl et RI) et Sonde TaqMan® (PI) Table 1: Nucleotide primers (Fl and RI) and TaqMan ® probe (PI)
FAM : 6-carboxyfluorescéine, MGB : minor groove binder.
SEQ IDFAM: 6-carboxyfluorescein, MGB: minor groove binder. SEQ ID
Nom Séquence Name Sequence
NO : NO:
Dell 1_285741 GCAATAAC T GC T CGTAT TAC T CCAGAAAAAGGGGCAAGT C TA 5 Ins (251-264) TCAACAGCCGCCGCTGCCAAGAATACGGGCTGGTCCTAGT TC Dell 1_285741 GCAATAAC T GC T CGTAT TAC T CCAGAAAAAGGGGCAAGT C TA 5 Ins (251-264) TCAACAGCCGCCGCTGCCAAGAATACGGGCTGGTCCTAGT TC
AAAT TGT TCATCGTCGCT TGGTGCTGCGTAGTCT TGAGCTAA AT GT T TAGCCAAT T C T CAAACGC T T GGCAGATAAAT T T TAT T AT T TAC C C T AGAAT AT G G T CAT T G G C GAAT G C C AGAC GAAT C AATC T GGAT GAT GCC T T CAACAGAT GGCCAT GCATCT TGT T T GTCAACAATATACGCCGT TGATGGGGCGCTACTGTCAAGTCT CGT T T TGATACTCTAGT T TCTCTCTCGTGATATATCAGCCGC CAC C T T AT G T AAAAC AG C C T G C AT CAAT T C T C CAAAT T GAC A T T GT T GTATAAAGAGGAAGGCGC T CATAGAT GC TATACAT CA T GAT T AACAAAGG T T AT T T AC T ACAAT T C T T C T T G T T AT GC T CGCAAT TCTCTACT TCTGATGGAATGTCCACGTGCGTAGCT T GTGTAGTACT STW TGT TCATCGTCGCT TGGTGCTGCGTAGTCT TGAGCTAA AT GT T TAGCCAAT TCT CAAACGC TT GGCAGATAAAT TT TAT T AT T TAC CTC Agaat AT GGT CAT TGGC GAAT GCC AGAC GAAT C ACLS T GGAT GAT GCC TT CAACAGAT GGCCAT GCATCT TGT TT GTCAACAATATACGCCGT TGATGGGGCGCTACTGTCAAGTCT CGT TT TGATACTCTAGT T TCTCTCTCGTGATATATCAGCCGC CAC CTT AT GT AAAAC AG CCTGC AT CAAT TCTC CAAAT T GAC ATT GT T GTATAAAGAGGAAGGCGC T CATAGAT GC TATACAT CA T GAT T AACAAAGG TT AT TT AC T ACAAT TCTTCTTGTT AT GC T CGCAAT TCTCTACT TCTGATGGAATGTGTAGTGCTGTG
Tableau 2 : Séquence cible des oligonucléotides et de la sonde TaqMan® chez la souche TAL-17 et/ou ses mutants Table 2: Target sequence of oligonucleotides and of the TaqMan ® probe in strain TAL-17 and / or its mutants
De façon très particulière, un des objets de l’invention concerne une souche isolée de Trichoderma atroviride dont le gène ech42 possède une identité de séquence d’au moins 98% avec la séquence SEQ ID NO : 1 du gène ech42 de la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333, Very particularly, one of the subjects of the invention relates to an isolated strain of Trichoderma atroviride, the ech42 gene of which has a sequence identity of at least 98% with the sequence SEQ ID NO: 1 of the ech42 gene of the TAL- strain. 17 filed on 03 July 2018 at the CNCM under number CNCM 1-5333,
en particulier ladite souche isolée de Trichoderma atroviride est la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333. in particular said isolated strain of Trichoderma atroviride is the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333.
Plus particulièrement encore, un des objets de l’invention est la souche isolée de Trichoderma atroviride déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333. More particularly still, one of the objects of the invention is the isolated strain of Trichoderma atroviride deposited on July 3, 2018 at the CNCM under number CNCM 1-5333.
Selon ce même aspect, un autre des objets de l’invention concerne la souche isolée de Trichoderma atroviride de l’invention sous forme de spores, produites par fermentation en milieu solide ou liquide, lesdites spores pouvant être sous forme purifiée ou dans la matrice de production, ladite matrice de production étant solide ou liquide. According to this same aspect, another of the objects of the invention relates to the isolated strain of Trichoderma atroviride of the invention in the form of spores, produced by fermentation in solid or liquid medium, said spores possibly in purified form or in the matrix of production, said production matrix being solid or liquid.
Par « sous forme de spores », on entend sous forme de conidiospores ou chlamydospore, (plus particulièrement conidiospores) assurant la fonction de multiplication asexuée chez le champignon.
Par « fermentation en milieu solide (FMS) », on entend tout procédé permettant le développement du micro-organisme à la surface et/ou à l’intérieur d’une matrice de production poreuse solide et humidifiée, en absence d’eau libre. By “in the form of spores” is meant in the form of conidiospores or chlamydospores (more particularly conidiospores) ensuring the function of asexual multiplication in the fungus. The term “fermentation in a solid medium (FMS)” is understood to mean any process allowing the development of the microorganism on the surface and / or inside a solid and humidified porous production matrix, in the absence of free water.
Par « fermentation liquide », on entend tout procédé permettant le développement du micro organisme à l’aide d’une matrice de production avec présence d’eau libre. By "liquid fermentation" is meant any process allowing the development of the microorganism using a production matrix with the presence of free water.
Par « matrice de production », on entend tout substrat naturel et/ou synthétique, qui permet le développement du micro-organisme et induit la production de biomasse, et/ou d’enzymes, et/ou de métabolites primaires et/ou secondaires. Des exemples de familles d’enzyme ou d’enzyme produites par le champignon sont des protéases, des chitinases et la bêta- 1,3- glucanase. By "production matrix" is meant any natural and / or synthetic substrate, which allows the development of the microorganism and induces the production of biomass, and / or enzymes, and / or primary and / or secondary metabolites. Examples of families of enzymes or enzymes produced by the fungus are proteases, chitinases and beta-1,3-glucanase.
Par « spores [...] sous forme purifiées », on entend les spores concentrées suite à l’élimination de la majeure partie du reste de la matrice après production n’ayant pas servi à la formation des spores, avec l’aide d’un procédé de tamisage par exemple. By "spores [...] in purified form" is meant the concentrated spores following the elimination of the major part of the remainder of the matrix after production which has not been used for the formation of the spores, with the help of 'a sieving process for example.
Par « spores [...] dans la matrice de production », on entend les spores restées dans la matrice de production à l’issue du process de fabrication, sans étape de purification. By "spores [...] in the production matrix" is meant the spores that remain in the production matrix at the end of the manufacturing process, without a purification step.
Un autre des objets de l’invention concerne la souche isolée de Trichoderma atroviride de l’invention en tant qu’agent de lutte biologique. Another object of the invention relates to the isolated strain of Trichoderma atroviride of the invention as a biological control agent.
Par « agent de lutte biologique », on entend qu’une souche de Trichoderma atroviride selon l’invention peut interférer avec la croissance et/ou la survie des agents pathogènes permettant ainsi de les contrôler et ce, via l’un ou plusieurs des modes d’action décrits précédemment (e.g. via le développement de sa biomasse et/ou sa production d’enzymes et/ou de métabolites secondaires). Par exemple, un des moyens de mettre en évidence qu’une souche de Trichoderma atroviride selon l’invention est un agent de lutte biologique est la réalisation d’un test Dual culture sur milieu de culture en boîte de Pétri comme ceux présentés parmi les exemples ci-après. Plus précisément par « test Dual culture », on entend un test sur boîte de Pétri en laboratoire sur milieu de culture, où la souche du microorganisme agent de lutte biologique et la souche du pathogène sont mises en culture sur la même boîte afin d’observer l’effet d’une souche sur une autre au cours du temps et vice versa. By “biological control agent” is meant that a strain of Trichoderma atroviride according to the invention can interfere with the growth and / or the survival of pathogens, thus making it possible to control them, via one or more of the methods. action described above (eg via the development of its biomass and / or its production of enzymes and / or secondary metabolites). For example, one of the means of demonstrating that a strain of Trichoderma atroviride according to the invention is a biological control agent is to carry out a Dual culture test on culture medium in a Petri dish such as those presented among the examples. below. More precisely by “Dual culture test” is meant a test on a Petri dish in the laboratory on culture medium, where the strain of the microorganism, biological control agent and the strain of the pathogen are cultured on the same dish in order to observe. the effect of one strain on another over time and vice versa.
Un autre des objets de l’invention concerne la souche isolée de Trichoderma atroviride de l’invention, en tant qu’agent antifongique de végétaux. Another object of the invention relates to the isolated strain of Trichoderma atroviride of the invention, as an antifungal agent of plants.
Par « agent antifongique de végétaux », on entend qu’une souche de Trichoderma atroviride selon l’invention est capable de lutter contre les champignons phytopathogènes. Par exemple,
un des moyens de mettre en évidence qu’une souche de Trichoderma atroviride selon l’invention est un agent antifongique de végétaux est la réalisation d’un test Dual culture comme ceux présentés parmi les exemples ci-après. By “plant antifungal agent” is meant that a strain of Trichoderma atroviride according to the invention is capable of combating phytopathogenic fungi. For example, one of the means of demonstrating that a strain of Trichoderma atroviride according to the invention is an antifungal agent for plants is to carry out a dual culture test such as those presented among the examples below.
De façon très particulière, un des objets de l’invention concerne la souche isolée de Trichoderma atroviride de l’invention en tant qu’ agent de lutte biologique, Very particularly, one of the objects of the invention relates to the isolated strain of Trichoderma atroviride of the invention as a biological control agent,
en particulier en tant qu’ agent antifongique de végétaux dirigé contre un champignon pathogène pour végétaux, ledit champignon pathogène étant notamment choisi parmi Septoria tritici ou Gibberella zeae (= Fusarium graminearum) ou Puccinia recondita ou Puccinia striiformis. in particular as an antifungal agent for plants directed against a fungus pathogenic for plants, said pathogenic fungus being chosen in particular from Septoria tritici or Gibberella zeae (= Fusarium graminearum) or Puccinia recondita or Puccinia striiformis.
Un second aspect de l’invention concerne l’utilisation de la souche isolée de Trichoderma atroviride de l’invention, en particulier dans le domaine de la malterie. A second aspect of the invention relates to the use of the isolated strain of Trichoderma atroviride of the invention, in particular in the field of malting.
Plus particulièrement, l’invention concerne l’utilisation de ladite souche isolée de Trichoderma atroviride dans la prévention et/ou le traitement de maladies fongiques de végétaux, notamment de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge. De manière avantageuse, l’invention concerne l’utilisation de ladite souche isolée de Trichoderma atroviride dans la prévention et/ou le traitement de maladies fongiques du blé et/ou du maïs et/ou de l’orge. More particularly, the invention relates to the use of said isolated strain of Trichoderma atroviride in the prevention and / or treatment of fungal diseases of plants, in particular of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley. Advantageously, the invention relates to the use of said isolated strain of Trichoderma atroviride in the prevention and / or treatment of fungal diseases of wheat and / or corn and / or barley.
L’invention concerne également l’utilisation de ladite souche isolée de Trichoderma atroviride pour favoriser la germination d’une semence de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge. De manière avantageuse, l’invention concerne l’utilisation de ladite souche isolée de Trichoderma atroviride pour favoriser la germination d’une semence de blé et/ou de maïs et/ou d’orge. Concernant cet aspect particulier, il convient de noter que l’aide à la germination permet avantageusement et en même temps la prévention et/ou le traitement de maladies fongiques au moment du semis. Le développement d’une maladie après le semis est ainsi évité et le rendement est optimisé via l’aspect biostimulant de la souche de l’invention. Avantageusement, cet aspect permet également d’éviter un ralentissement important du développement de la culture si quelques temps après le semis une période de sécheresse se présente (ce qui peut arriver au printemps) et donc d’éviter des pertes de rendements à la récolte. The invention also relates to the use of said isolated strain of Trichoderma atroviride for promoting the germination of a seed of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley. Advantageously, the invention relates to the use of said isolated strain of Trichoderma atroviride to promote the germination of a seed of wheat and / or corn and / or barley. Regarding this particular aspect, it should be noted that the germination aid advantageously and at the same time allows the prevention and / or treatment of fungal diseases at the time of sowing. The development of a disease after sowing is thus avoided and the yield is optimized via the biostimulant aspect of the strain of the invention. Advantageously, this aspect also makes it possible to avoid a significant slowdown in the development of the crop if a period of drought occurs some time after sowing (which can happen in spring) and therefore to avoid loss of yields at harvest.
Un troisième aspect de l’invention concerne une composition phytosanitaire comprenant :
la souche isolée de Trichoderma atroviride de l’invention en tant que principe actif ; ou A third aspect of the invention relates to a phytosanitary composition comprising: the isolated strain of Trichoderma atroviride of the invention as an active principle; or
les métabolites émis lors de la production la souche isolée de Trichoderma atroviride de l’invention en tant que principe actif ; ou the metabolites emitted during the production of the isolated strain of Trichoderma atroviride of the invention as an active principle; or
la souche isolée de Trichoderma atroviride de l’invention et ses métabolites émis lors de sa production en tant que principe actif ; ou the isolated strain of Trichoderma atroviride of the invention and its metabolites emitted during its production as an active principle; or
la souche isolée de Trichoderma atroviride de l’invention en association avec au moins un autre agent de lutte biologique (BCA) en tant que principe actif ; ou la souche isolée de Trichoderma atroviride de l’invention et ses métabolites émis lors de la production de la souche en association avec au moins un autre agent de lutte biologique en tant que principe actif. the isolated strain of Trichoderma atroviride of the invention in combination with at least one other biological control agent (BCA) as active principle; or the isolated strain of Trichoderma atroviride of the invention and its metabolites emitted during the production of the strain in combination with at least one other biological control agent as an active principle.
Par « métabolites émis lors de la production de la souche » ou « ses métabolites émis lors de sa production », on entend toute molécule produite par la souche de l’invention au cours de son développement. Par exemple et de manière non limitative, de tels métabolites peuvent être des enzymes produites par le champignon telles que des protéases, des chitinases et la bêta- 1,3-glucanase. By "metabolites emitted during the production of the strain" or "its metabolites emitted during its production" is meant any molecule produced by the strain of the invention during its development. For example and without limitation, such metabolites can be enzymes produced by the fungus such as proteases, chitinases and beta-1,3-glucanase.
Par « agent de lutte biologique », on entend un microorganisme pouvant interférer avec la croissance et/ou la survie des agents pathogènes permettant ainsi de les contrôler. La souche de l’invention TAL-17 (déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333) en est un exemple, mais au sens de l’invention il s’agit ici de combiner la souche de l’invention à au moins un autre agent de lutte biologique, lequel est différent de la souche de l’invention. Par « au moins un autre agent de lutte biologique », on entend que la composition phytosanitaire de l’invention peut contenir 2 agents de lutte biologique (celui de l’invention et un autre), tout comme elle peut en contenir 3, 4 ou 5 (celui de l’invention et 2, 3 ou 4 autres). By “biological control agent” is meant a microorganism capable of interfering with the growth and / or survival of pathogens, thus making it possible to control them. The strain of the invention TAL-17 (deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333) is an example, but within the meaning of the invention it is a question here of combining the strain of invention to at least one other biological control agent, which is different from the strain of the invention. By “at least one other biological control agent” is meant that the plant protection composition of the invention can contain 2 biological control agents (that of the invention and another), just as it can contain 3, 4 or more. 5 (that of the invention and 2, 3 or 4 others).
Plus particulièrement, un des objets de l’invention concerne la composition phytosanitaire précédemment décrite, ladite composition phytosanitaire se présentant à la base (à l’achat) sous la forme d’une composition solide ou liquide concentrée. Une telle composition solide ou liquide concentrée peut être, par exemple, obtenue grâce à une formulation particulière des spores de la souche isolée de Trichoderma atroviride de l’invention produites par fermentation en milieu solide ou liquide, lesdites spores pouvant être sous forme purifiée ou dans la matrice de production, ladite matrice de production étant solide ou liquide. More particularly, one of the objects of the invention relates to the phytosanitary composition described above, said phytosanitary composition being initially (on purchase) in the form of a solid or concentrated liquid composition. Such a solid or concentrated liquid composition can be, for example, obtained by means of a particular formulation of the spores of the isolated strain of Trichoderma atroviride of the invention produced by fermentation in solid or liquid medium, said spores possibly being in purified form or in the production matrix, said production matrix being solid or liquid.
Par « composition [...] concentrée », on entend une composition dans laquelle la concentration du principe actif (i.e. la souche de l’invention, laquelle peut être sous forme de
spores) est supérieure à une quantité efficace de 107 spores/g soit 107 UFC/g. Aussi, un aspect particulier de l’invention concerne la composition phytosanitaire comprenant la souche isolée de Trichoderma atroviride de l’invention en tant que principe actif, ladite composition phytosanitaire se présentant sous la forme d’une composition solide ou liquide concentrée dans laquelle la concentration du principe actif est supérieure à une quantité efficace de 107 spores/g. By "concentrated composition" is meant a composition in which the concentration of the active principle (ie the strain of the invention, which can be in the form of spores) is greater than an effective amount of 10 7 spores / g, i.e. 10 7 CFU / g. Also, a particular aspect of the invention relates to the phytosanitary composition comprising the isolated strain of Trichoderma atroviride of the invention as active principle, said phytosanitary composition being in the form of a solid or concentrated liquid composition in which the concentration of the active principle is greater than an effective amount of 10 7 spores / g.
Par « supérieure à une quantité efficace de 107 spores/g », on entend également supérieure à une quantité efficace de 108 spores/g, supérieure à une quantité efficace 109 spores/g, supérieure à une quantité efficace 1010 spores/g, supérieure à une quantité efficace 1011 spores/g ou supérieure à une quantité efficace 1012 spores/g. By "greater than an effective amount of 10 7 spores / g" is also meant greater than an effective amount of 10 8 spores / g, greater than an effective amount 10 9 spores / g, greater than an effective amount 10 10 spores / g. g, greater than an effective amount of 10 11 spores / g or greater than an effective amount of 10 12 spores / g.
L’utilisateur de la susdite composition doit alors incorporer ou mettre en suspension celle-ci dans un milieu solide ( e.g . terreau, etc.) ou aqueux (e.g. eau) pour obtenir une composition diluée comprenant une quantité efficace de 104 à 1012 spores/g de la souche Trichoderma atroviride de l’invention, laquelle peut être sous forme de spores. La composition solide ou liquide diluée obtenue peut alors être épandue sur les plantes dont la prévention et/ou le traitement d’une maladie fongique de plante est souhaité. The user of the aforesaid composition must then incorporate or suspend it in a solid (eg. Soil, etc.) or aqueous (eg water) medium to obtain a dilute composition comprising an effective amount of 10 4 to 10 12 spores / g of the Trichoderma atroviride strain of the invention, which may be in the form of spores. The resulting diluted solid or liquid composition can then be applied to plants for which prevention and / or treatment of a fungal plant disease is desired.
Au sens de l’Invention, l’épandage de la susdite composition comprend notamment les techniques d’épandage classiques connues de l’Homme du métier, lesquelles servent à répandre sur une zone à traiter des matières solide (e.g. boues d’épuration, fumier, etc.) ou liquide (e.g. pesticides, etc.) présentant un intérêt agronomique. Within the meaning of the invention, the spreading of the aforesaid composition comprises in particular the conventional spreading techniques known to those skilled in the art, which are used to spread solid materials (eg sewage sludge, manure over an area to be treated). , etc.) or liquid (eg pesticides, etc.) of agronomic interest.
Plus particulièrement, un des objets de l’invention concerne la composition phytosanitaire précédemment décrite, comprenant une quantité efficace de 104 à 1012 spores/g, plus particulièrement de 107 à 109 spores/g, More particularly, one of the subjects of the invention relates to the phytosanitary composition described above, comprising an effective amount of 10 4 to 10 12 spores / g, more particularly 10 7 to 10 9 spores / g,
ladite composition phytosanitaire étant éventuellement obtenue après une étape de préparation (e.g. dilution par mise en suspension ou mélange) la rendant prête à l’épandage. said phytosanitary composition optionally being obtained after a preparation step (e.g. dilution by suspending or mixing) making it ready for spreading.
Par « quantité efficace de spores/g », on entend le nombre de spores capables de former une colonie sur milieu de culture (UFC= unité formant colonie) par g (gramme) de produit. By “effective quantity of spores / g” is meant the number of spores capable of forming a colony on culture medium (CFU = colony-forming unit) per g (gram) of product.
De plus, l’expression « de 104 à 1012 spores/g » peut également signifier de 104 à 105 spores/g, de 104 à 106 spores/g, de 104 à 107 spores/g, de 104 à 108 spores/g, de 104 à 109 spores/g, de 104 à 1010 spores/g, de 104 à 1011 spores/g, de 105 à 106 spores/g, de 105 à 107 spores/g, de 105 à 108 spores/g, de 105 à 109 spores/g, de 105 à 1010 spores/g, de 105 à 1011 spores/g, de 105 à 1012 spores/g, de 106 à 107 spores/g, de 106 à 108 spores/g, de 106 à 109 spores/g, de 106 à 1010 spores/g, de 106 à 1011 spores/g, de 106 à 1012 spores/g, de 107 à 108 spores/g, de 107 à 109
spores/g, de 107 à 1010 spores/g, de 107 à 1011 spores/g, de 107 à 1012 spores/g, de 108 à 109 spores/g, de 108 à 1010 spores/g, de 108 à 1011 spores/g, de 108 à 1012 spores/g, de 109 à 1010 spores/g, de 109 à 1011 spores/g, de 109 à 1012 spores/g, de 1010 à 1011 spores/g, de 1010 à 1012 spores/g ou de 1011 à 1012 spores/g. In addition, the expression "from 10 4 to 10 12 spores / g" can also mean from 10 4 to 10 5 spores / g, from 10 4 to 10 6 spores / g, from 10 4 to 10 7 spores / g, from 10 4 to 10 8 spores / g, from 10 4 to 10 9 spores / g, from 10 4 to 10 10 spores / g, from 10 4 to 10 11 spores / g, from 10 5 to 10 6 spores / g, from 10 5 to 10 7 spores / g, from 10 5 to 10 8 spores / g, from 10 5 to 10 9 spores / g, from 10 5 to 10 10 spores / g, from 10 5 to 10 11 spores / g, from 10 5 to 10 12 spores / g, from 10 6 to 10 7 spores / g, from 10 6 to 10 8 spores / g, from 10 6 to 10 9 spores / g, from 10 6 to 10 10 spores / g, from 10 6 to 10 11 spores / g, from 10 6 to 10 12 spores / g, from 10 7 to 10 8 spores / g, from 10 7 to 10 9 spores / g, from 10 7 to 10 10 spores / g, from 10 7 to 10 11 spores / g, from 10 7 to 10 12 spores / g, from 10 8 to 10 9 spores / g, from 10 8 to 10 10 spores / g, from 10 8 to 10 11 spores / g, from 10 8 to 10 12 spores / g, from 10 9 to 10 10 spores / g, from 10 9 to 10 11 spores / g, from 10 9 to 10 12 spores / g, from 10 10 to 10 11 spores / g, from 10 10 to 10 12 spores / g or from 10 11 to 10 12 spores / g.
Au sens de l’invention, celle-ci concerne également une composition phytosanitaire d’enrobage comprenant la souche isolée de Trichoderma atroviride de l’invention et éventuellement au moins un agent de fixation, ladite composition phytosanitaire d’enrobage permettant de produire une semence enrobée. L’invention concerne donc aussi bien une composition phytosanitaire d’enrobage comprenant la souche isolée de Trichoderma atroviride de l’invention, ladite composition phytosanitaire d’enrobage permettant de produire une semence enrobée ; qu’une composition phytosanitaire d’enrobage comprenant la souche isolée de Trichoderma atroviride de l’invention et au moins un agent de fixation, ladite composition phytosanitaire d’enrobage permettant de produire une semence enrobée. Within the meaning of the invention, the latter also relates to a phytosanitary coating composition comprising the isolated strain of Trichoderma atroviride of the invention and optionally at least one fixing agent, said phytosanitary coating composition making it possible to produce a coated seed. . The invention therefore also relates to a phytosanitary coating composition comprising the isolated strain of Trichoderma atroviride of the invention, said phytosanitary coating composition making it possible to produce a coated seed; a phytosanitary coating composition comprising the isolated strain of Trichoderma atroviride of the invention and at least one fixing agent, said phytosanitary coating composition making it possible to produce a coated seed.
Un des objets de l’invention concerne par conséquent une semence enrobée comprenant une graine de végétal, ladite graine de végétal étant enrobée par ladite composition phytosanitaire d’enrobage et ledit végétal appartenant notamment à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge. Par « semence enrobée », on entend une graine sélectionnée pour être semée, ladite graine ayant subi un traitement particulier lequel a permis son enrobage dans une composition phytosanitaire d’enrobage. De manière avantageuse, l’invention concerne la semence enrobée telle que décrit ci-dessus, ledit végétal étant du blé et/ou du maïs et/ou de l’orge. De manière avantageuse, l’invention concerne également la semence enrobée telle que décrit ci-dessus, ladite semence enrobée comprenant une quantité efficace de 105 à 108 (ou de 106 à 107) spores/semence enrobée, préférentiellement 106 (ou 107) spores/semence enrobée. One of the objects of the invention therefore relates to a coated seed comprising a plant seed, said plant seed being coated with said phytosanitary coating composition and said plant belonging in particular to the Poaceae family, in particular wheat and / or corn and / or barley. By “coated seed” is meant a seed selected for sowing, said seed having undergone a particular treatment which has enabled it to be coated in a phytosanitary coating composition. Advantageously, the invention relates to the coated seed as described above, said plant being wheat and / or corn and / or barley. Advantageously, the invention also relates to the coated seed as described above, said coated seed comprising an effective amount of 10 5 to 10 8 (or 10 6 to 10 7 ) spores / coated seed, preferably 10 6 ( or 10 7 ) coated spores / seed.
Un quatrième aspect de l’invention concerne, l’utilisation de la composition de l’invention. Plus particulièrement, l’invention concerne l’utilisation de la composition de l’invention dans la prévention et/ou le traitement de maladies fongiques de végétaux, notamment de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge. De manière avantageuse, l’invention concerne l’utilisation de la composition de l’invention dans la prévention et/ou le traitement de maladies fongiques du blé et/ou du maïs et/ou de l’orge.
L’invention concerne également l’utilisation de la composition de l’invention pour favoriser la germination d’une semence de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge. De manière avantageuse, l’invention concerne l’utilisation de la composition de l’invention pour favoriser la germination d’une semence de blé et/ou de maïs et/ou d’orge. A fourth aspect of the invention relates to the use of the composition of the invention. More particularly, the invention relates to the use of the composition of the invention in the prevention and / or treatment of fungal diseases of plants, in particular of plants belonging to the Poaceae family, in particular wheat and / or corn. and / or barley. Advantageously, the invention relates to the use of the composition of the invention in the prevention and / or treatment of fungal diseases of wheat and / or corn and / or barley. The invention also relates to the use of the composition of the invention for promoting the germination of a seed of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley. Advantageously, the invention relates to the use of the composition of the invention for promoting the germination of a seed of wheat and / or corn and / or barley.
De façon très particulière, un des objets de l’invention concerne l’utilisation de la souche isolée de Trichoderma atroviride de l’invention ou de la composition phytosanitaire décrite ci-dessus dans la prévention et/ou le traitement de maladies fongiques de végétaux, notamment de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge ; et/ou Very particularly, one of the subjects of the invention relates to the use of the isolated strain of Trichoderma atroviride of the invention or of the phytosanitary composition described above in the prevention and / or treatment of fungal diseases of plants, in particular of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley; and or
pour favoriser la germination d’une semence de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge. to promote the germination of a seed of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley.
Un cinquième aspect de l’invention concerne un procédé de protection et/ou de traitement d‘un végétal contre une maladie provoquée par un champignon pathogène pour végétaux comprenant l’application de la composition de l’invention sur au moins une partie dudit végétal ou du sol à proximité dudit végétal. A fifth aspect of the invention relates to a method of protecting and / or treating a plant against a disease caused by a pathogenic fungus for plants comprising the application of the composition of the invention to at least part of said plant or soil near said plant.
Plus particulièrement, l’invention concerne ledit procédé de l’invention, où ladite partie dudit végétal est une feuille, un fruit, une graine. More particularly, the invention relates to said method of the invention, wherein said part of said plant is a leaf, a fruit, a seed.
De façon très particulière, un des objets de l’invention concerne un procédé de protection et/ou de traitement d‘un végétal contre une maladie provoquée par un champignon pathogène pour végétaux comprenant l’application de la composition de l’invention sur au moins une partie dudit végétal ou du sol à proximité dudit végétal, Very particularly, one of the objects of the invention relates to a method of protecting and / or treating a plant against a disease caused by a pathogenic fungus for plants comprising the application of the composition of the invention to at least part of said plant or of the soil near said plant,
en particulier ladite partie dudit végétal est une feuille, un fruit, une graine, et in particular said part of said plant is a leaf, a fruit, a seed, and
en particulier ledit végétal appartient à la famille des Poaceae , notamment le blé et/ou le maïs et/ou l’orge. in particular said plant belongs to the Poaceae family, in particular wheat and / or corn and / or barley.
Toujours selon ce cinquième aspect, l’invention concerne le procédé ci-dessus décrit, dans lequel ladite composition est épandue Still according to this fifth aspect, the invention relates to the method described above, in which said composition is applied
à raison de 10 à 500 L/ha, en particulier de 50 à 250 L/ha, notamment pour la pulvérisation aérienne ; ou
à raison d’une quantité efficace de 1010 à 1014 spores/ha, en particulier de 1010 à 1012 spores/ha, notamment pour les épandages aériens de type pulvérisation foliaire. at a rate of 10 to 500 L / ha, in particular from 50 to 250 L / ha, in particular for aerial spraying; or at an effective amount of 10 10 to 10 14 spores / ha, in particular 10 10 to 10 12 spores / ha, in particular for aerial spraying of the foliar spray type.
L’expression « de 10 à 500 L/ha (litre/hectare) » signifie également de 10 à 400 L/ha, de 10 à 300 L/ha, de 10 à 200 L/ha, de 10 à 100 L/ha, de 100 à 500 L/ha, de 200 à 500 L/ha, de 300 à 500 L/ha, de 400 à 500 L/ha, de 50 à 500 L/ha, de 50 à 250 L/ha ou de 250 à 500 L/ha. L’expression « de 1010 à 1014 spores/ha » signifie également de 1010 à 1011 spores/ha, de 1010 à 1013 spores/ha, de 1011 à 1012 spores/ha, de 1011 à 1013 spores/ha, de 1011 à 1014 spores/ha, de 1012 à 1013 spores/ha, de 1012 à 1014 spores/ha ou de 1013 à 1014 spores/ha. The expression "10 to 500 L / ha (liter / hectare)" also means 10 to 400 L / ha, 10 to 300 L / ha, 10 to 200 L / ha, 10 to 100 L / ha , 100 to 500 L / ha, 200 to 500 L / ha, 300 to 500 L / ha, 400 to 500 L / ha, 50 to 500 L / ha, 50 to 250 L / ha or 250 to 500 L / ha. The expression "from 10 10 to 10 14 spores / ha" also means from 10 10 to 10 11 spores / ha, from 10 10 to 10 13 spores / ha, from 10 11 to 10 12 spores / ha, from 10 11 to 10 13 spores / ha, 10 11 to 10 14 spores / ha, 10 12 to 10 13 spores / ha, 10 12 to 10 14 spores / ha or 10 13 to 10 14 spores / ha.
L’invention concerne plus particulièrement le procédé ci-dessus décrit, dans lequel ledit végétal appartient à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge. De manière avantageuse, l’invention concerne le procédé ci-dessus décrit, dans lequel ledit végétal est le blé et/ou le maïs et/ou l’orge. The invention relates more particularly to the process described above, in which said plant belongs to the Poaceae family, in particular wheat and / or corn and / or barley. Advantageously, the invention relates to the process described above, in which said plant is wheat and / or corn and / or barley.
L’invention concerne préférentiellement le procédé ci-dessus décrit, dans lequel ledit champignon pathogène est Septoria tritici ou Gibberella zeae (= Fusarium graminearum) ou Puccinia recondita ou Puccinia striiformis. The invention preferably relates to the method described above, in which said pathogenic fungus is Septoria tritici or Gibberella zeae (= Fusarium graminearum) or Puccinia recondita or Puccinia striiformis.
Par « Septoria tritici », on entend l’agent pathogène de la septoriose. By "Septoria tritici" is meant the pathogen of septoria.
Par « Gibberella zeae (= F. graminearum ) », on entend l’agent pathogène de la fusariose. By "Gibberella zeae (= F. graminearum)" is meant the pathogen of Fusarium wilt.
Par « Puccinia recondita », on entend l’agent pathogène de la rouille brune du blé. By "Puccinia recondita" is meant the pathogen of brown rust of wheat.
Par « Puccinia striiformis », on entend l’agent pathogène de la rouille jaune du blé. "Puccinia striiformis" is understood to mean the pathogen of yellow rust of wheat.
L’invention concerne plus particulièrement le procédé ci-dessus décrit, dans lequel The invention relates more particularly to the method described above, in which
la protection dudit végétal comprend une étape d’enrobage de la semence avec ladite composition phytosanitaire ; et/ou the protection of said plant comprises a step of coating the seed with said phytosanitary composition; and or
la protection dudit végétal comprend la pulvérisation de ladite composition au moment du semis ou à la germination dudit végétal ; et/ou the protection of said plant comprises spraying said composition at the time of sowing or at the germination of said plant; and or
la protection dudit végétal comprend soit une application préventive au niveau du sol avant le semis de ladite composition phytosanitaire avec l’apport d’amendement organique, soit une application préventive au niveau du sol avant le semis de ladite composition phytosanitaire sur la culture précédente ; et/ou the protection of said plant comprises either a preventive application at soil level before sowing said phytosanitary composition with the addition of organic amendment, or a preventive application at soil level before sowing said phytosanitary composition on the previous crop; and or
le traitement dudit végétal comprend la pulvérisation de ladite composition aux cours de différents stades phénologiques de la plante en prévention d’un risque d’infection dudit champignon pathogène de l’ensemble ou une partie de la plante.
Par « différents stades phénologiques », on entend de la graine jusqu’à la floraison (BBCH000 à BBCH619 selon l’échelle BBCH des stades phénologiques des légumes dans la famille des Solanacées (Feller et al., 1995 - Phànologische entwicklungsstadien von gemüsepflanzen: II. Fruchtgemüse und hülsenfrüchte ; Nachrichtenbl. Deut. Pflanzenschutzd)). the treatment of said plant comprises spraying said composition during different phenological stages of the plant to prevent a risk of infection of said pathogenic fungus of the whole or part of the plant. By “different phenological stages” is meant from seed to flowering (BBCH000 to BBCH619 according to the BBCH scale of phenological stages of vegetables in the Solanaceae family (Feller et al., 1995 - Phànologische entwicklungsstadien von gemüsepflanzen: II . Fruchtgemüse und hülsenfrüchte; Nachrichtenbl. Deut. Pflanzenschutzd)).
S’agissant du procédé ci-dessus, il convient de noter que sa mise en œuvre pour le traitement de la fusariose au stade floraison de la plante implique préférentiellement que la souche de l’invention soit active rapidement et en ce sens, que ladite composition soit plutôt sous forme liquide et ne contient pas de « formulants » non compatibles avec la souche qui pourraient gêner le développement et le mode d’action de ladite souche de l’invention. Par « formulants », on entend des adjuvants mouillants ou agents protecteur de conservation. Regarding the above process, it should be noted that its implementation for the treatment of fusarium wilt at the flowering stage of the plant preferably implies that the strain of the invention is active rapidly and in this sense that said composition or rather in liquid form and does not contain “formulants” incompatible with the strain which could hinder the development and the mode of action of said strain of the invention. By “formulants” is meant wetting adjuvants or preservative protectants.
A tout égard, il convient de noter que les différents aspects de l’invention, tout comme les différents modes de réalisation de celle-ci sont interdépendants. Ces derniers peuvent donc être combinés entre eux à foison pour obtenir des aspects et/ou des modes de réalisation préférés de l’invention non explicitement décrits. Ceci est également valable pour l’ensemble des définitions fourni dans la présente description, lequel s’applique à tous les aspects de l’invention et ses modes de réalisation. In all respects, it should be noted that the different aspects of the invention, as well as the different embodiments thereof, are interdependent. The latter can therefore be combined in abundance to obtain aspects and / or preferred embodiments of the invention not explicitly described. This also applies to all of the definitions provided in this description, which applies to all aspects of the invention and its embodiments.
La présente invention est par ailleurs illustrée, sans toutefois s'y limiter, par les figures et exemples suivants. The present invention is further illustrated, without however being limited to, by the following figures and examples.
LISTE DES FIGURES LIST OF FIGURES
La figure 1 représente les observations visuelles du test Dual culture contre Fusarium graminearum , à gauche des boîtes de Pétri, à 6 (A et B) et 10 (C et D) jours de cultures pour la souche TAL-17 (A et C) et la souche BCA C (B et D), à droite des boîtes de Pétri. Figure 1 represents the visual observations of the Dual culture test against Fusarium graminearum, to the left of the Petri dishes, at 6 (A and B) and 10 (C and D) days of cultures for the TAL-17 strain (A and C) and the BCA C strain (B and D), to the right of the Petri dishes.
La figure 2 représente l’observation microscopique (grossissement xlOO) avec un microscope inversé des mycéliums de F. graminearum (flèche noire) et de la souche TAL-17 (flèche blanche) sur boite de Pétri contenant du milieu PDA (pomme de terre, dextrose, agar), après 8 jours de croissance. FIG. 2 represents the microscopic observation (x100 magnification) with an inverted microscope of the mycelia of F. graminearum (black arrow) and of the TAL-17 strain (white arrow) on a Petri dish containing PDA medium (potato, dextrose, agar), after 8 days of growth.
La figure 3 représente la surface occupée (en %) et les photographies associées de la face avant d’une boite de Pétri inoculée au râteau avec trois souches de microorganismes (F. graminearum , TAL-17 et BCA C seuls ou en mélanges après 7 jours de croissance. Moyenne
± s.d. Des lettres différentes indiquent une différence significative entre les modalités (ANOVA 1 facteur, p<0,05). Figure 3 represents the occupied surface (in%) and the associated photographs of the front face of a Petri dish inoculated with a rake with three strains of microorganisms (F. graminearum, TAL-17 and BCA C alone or in mixtures after 7 growing days Average ± sd Different letters indicate a significant difference between the modalities (1-way ANOVA, p <0.05).
La figure 4 représente l’évolution de la surface occupée par les microorganismes BCA TAL- 17 et Fusarium graminearum seuls ou en mélange après dépôt de 30 pL au centre d’une boîte de culture avec milieu PDA au bout de 72 h (A) et au bout de 96 h (B) de culture à 25°C sous hotte lumineuse. FIG. 4 represents the change in the surface area occupied by the BCA TAL-17 and Fusarium graminearum microorganisms alone or as a mixture after depositing 30 μL in the center of a culture dish with PDA medium after 72 h (A) and after 96 h (B) of culture at 25 ° C under a light hood.
La figure 5 représente l’évolution du pourcentage d’inhibition de Fusarium graminearum sur boîte en fonction de la formulation utilisée. Figure 5 shows the change in the percentage inhibition of Fusarium graminearum on a dish depending on the formulation used.
La figure 6 représente le pourcentage de tubes CIV présentant des tâches de septoriose en fonction du traitement après 18 jours et 26 jours d’inoculation de la maladie. Figure 6 shows the percentage of CIV tubes showing septoria spots as a function of treatment after 18 days and 26 days of disease inoculation.
La figure 7 représente le pourcentage de grains sains observés à la récolte au cours des essais en salle phytotronique. FIG. 7 represents the percentage of healthy grains observed at harvest during the tests in the phytotronic room.
La figure 8 représente la masse de grains par épis à la récolte au cours des essais en salle phytotronique. FIG. 8 represents the mass of grains per ear at harvest during the tests in a phytotronic room.
La figure 9 représente le pourcentage de symptômes visuels de contamination sur épis par la fusariose au cours des essais en salle phytotronique. FIG. 9 represents the percentage of visual symptoms of contamination on ears by Fusarium wilt during the tests in the phytotronic room.
La figure 10 représente la masse de grains par épis à la récolte au cours des essais en salle phytotronique. FIG. 10 represents the mass of grains per ear at harvest during the tests in a phytotronic room.
La figure 11 représente le pourcentage de grains fusariés à la récolte au cours des essais en salle phytotronique réalisés. FIG. 11 represents the percentage of fusarious grains at harvest during the phytotronic room tests carried out.
La figure 12 représente la germination de plants de maïs après 6 jours de croissance avec un traitement au semis d’une suspension de spores de TAL-17 à 1.105 spores UFC/graine ou 1.108 spores UFC/graine. Un traitement aérien est réalisé plus tard lors du stade 5 feuilles et ne rentre pas en compte au moment de la mesure de la germination. Moyenne ± s.d. Des lettres différentes indiquent une différence significative entre les différentes modalités (ANOVA 1 facteur, p<0,05). FIG. 12 represents the germination of maize plants after 6 days of growth with a sowing treatment of a suspension of TAL-17 spores at 1.10 5 CFU spores / seed or 1.10 8 CFU spores / seed. An aerial treatment is carried out later during the 5-leaf stage and is not taken into account when measuring germination. Mean ± sd Different letters indicate a significant difference between the different modalities (1-way ANOVA, p <0.05).
La figure 13 représente la mesure de la taille en hauteur de plants de maïs après 25 jours de croissance avec un traitement au semis d’une suspension de spores de TAL-17 à 1.105 spores UFC/graine ou 1.108 spores UFC/graine. Un traitement aérien est réalisé plus tard lors du
stade 5 feuilles et ne rentre pas en compte au moment de la mesure de la germination. Moyenne ± s.d. Des lettres différentes indiquent une différence significative entre les différentes modalités (ANOVA 1 facteur, p<0,05). FIG. 13 represents the measurement of the height in height of corn plants after 25 days of growth with a sowing treatment of a suspension of TAL-17 spores at 1.10 5 UFC spores / seed or 1.10 8 UFC spores / seed. An aerial treatment is carried out later during the 5-leaf stage and is not taken into account when measuring germination. Mean ± sd Different letters indicate a significant difference between the different modalities (1-way ANOVA, p <0.05).
La figure 14 représente le pourcentage de germination de graines de blé de printemps (Calixo) en présence ou non de spores en suspension de Trichoderma atroviride TAL-17 au semis. Culture en chambre phytotronique avec photopériode. Moyenne ± s.d. Différence significative entre la modalité eau et la modalité TAL-17 (ANOVA 1 facteur, p<0,05). FIG. 14 represents the percentage of germination of seeds of spring wheat (Calixo) in the presence or absence of suspended spores of Trichoderma atroviride TAL-17 at sowing. Culture in a phytotron chamber with photoperiod. Mean ± s.d. Significant difference between the water modality and the TAL-17 modality (1-factor ANOVA, p <0.05).
La figure 15 comprend des photographies (A) et un graphique (B). Figure 15 includes photographs (A) and a graphic (B).
(A) Observations visuelles du test Dual culture contre Fusarium graminearum , à droite des boîtes de Pétri, à 6 et 10 jours de co-cultures avec la souche TAL-17 (panel du haut) ou la souche BCA D (panel du centre), à gauche des boîtes de Pétri. Le panel du bas correspond à la culture de Fusarium graminearum seule. Les flèches blanches indiquent la zone de recouvrement de la souche TAL-17 sur Fusarium graminearum. (A) Visual observations of the Dual culture test against Fusarium graminearum, to the right of the Petri dishes, at 6 and 10 days of co-cultures with the TAL-17 strain (top panel) or the BCA D strain (center panel) , to the left of the Petri dishes. The bottom panel corresponds to the culture of Fusarium graminearum alone. The white arrows indicate the area of overlap of the TAL-17 strain on Fusarium graminearum.
(B) Représentation graphique de la longueur du recouvrement du pathogène F. graminearum (F. gram) par le BCA en Dual culture sur gélose PDA (25°C sans photopériode). (B) Graphical representation of the length of recovery of the pathogen F. graminearum (F. gram) by the BCA in Dual culture on PDA agar (25 ° C without photoperiod).
La figure 16 comprend des photographies (A) et un graphique (B). Figure 16 includes photographs (A) and a graphic (B).
(A) Observations visuelles du test Dual culture contre Fusarium graminearum à 6 jours de co-cultures avec la souche TAL-17 (panel de gauche) ou la souche SCI (panel de droite). La ligne 1 (celle du haut) correspond au BCA seul à la dose de 1.104 UFC/mL, la ligne 2 correspond au mélange BCA/Fusa ratio 2/1 (BCA à 1.104 UFC/mL et Fusa à 5.103 UFC/mL), la ligne 3 correspondant au mélange BCA/Fusa ratio 1/1 (BCA à 1.104 UFC/mL et Fusa à 1.104 UFC/mL) et la ligne 4 correspond au mélange BCA/Fusa ratio 1/2 (BCA à 1.104 UFC/mL et Fusa à 2.104 UFC/mL). Le panel du bas correspond à la culture de Fusarium graminearum seule, de gauche à droite, à la dose de 2.104, 1.104 et 5.103 UFC/mL. (A) Visual observations of the Dual culture test against Fusarium graminearum after 6 days of co-cultures with the TAL-17 strain (left panel) or the SCI strain (right panel). Line 1 (the top one) corresponds to BCA alone at the dose of 1.10 4 CFU / mL, line 2 corresponds to the BCA / Fusa ratio 2/1 mixture (BCA at 1.10 4 CFU / mL and Fusa at 5.10 3 CFU / mL), line 3 corresponding to the BCA / Fusa ratio 1/1 mixture (BCA at 1.10 4 UFC / mL and Fusa at 1.10 4 UFC / mL) and line 4 corresponds to the BCA / Fusa ratio 1/2 mixture (BCA at 1.10 4 CFU / mL and Fusa at 2.10 4 CFU / mL). The bottom panel corresponds to the culture of Fusarium graminearum alone, from left to right, at a dose of 2.10 4 , 1.10 4 and 5.10 3 CFU / mL.
(B) Représentation graphique du pourcentage d’occupation du BCA (TAL-17 ou SCI) et du pathogène F. graminearum (F. gram) à l’issue du test en Dual culture sur gélose PDA (25°C sans photopériode). (B) Graphic representation of the percentage occupancy of BCA (TAL-17 or SCI) and of the pathogen F. graminearum (F. gram) at the end of the dual culture test on PDA agar (25 ° C without photoperiod).
La figure 17 comprend des photographies (A) et un graphique (B). Figure 17 includes photographs (A) and a graphic (B).
(A) Observations visuelles du test Dual culture contre Fusarium graminearum à 10 jours de co-cultures avec la souche TAL-17 (panel de gauche) ou la souche SCI (panel de droite). La ligne 1 (celle du haut) correspond au BCA seul à la dose de 1.104 UFC/mL, la ligne 2
correspond au mélange BCA/Fusa ratio 2/1 (BCA à 1.104 UFC/mL et Fusa à 5.103 UFC/mL), la ligne 3 correspondant au mélange BCA/Fusa ratio 1/1 (BCA à 1.104 UFC/mL et Fusa à 1.104 UFC/mL) et la ligne 4 correspond au mélange BCA/Fusa ratio 1/2 (BCA à 1.104 UFC/mL et Fusa à 2.104 UFC/mL). Le panel du bas correspond à la culture de Fusarium graminearum seule, de gauche à droite, à la dose de 2.104, 1.104 et 5.103 UFC/mL. (A) Visual observations of the Dual culture test against Fusarium graminearum after 10 days of co-cultures with the TAL-17 strain (left panel) or the SCI strain (right panel). Line 1 (the top one) corresponds to BCA alone at a dose of 1.10 4 CFU / mL, line 2 corresponds to the BCA / Fusa ratio 2/1 mixture (BCA at 1.10 4 UFC / mL and Fusa at 5.10 3 UFC / mL), line 3 corresponding to the BCA / Fusa ratio 1/1 mixture (BCA at 1.10 4 UFC / mL and Fusa at 1.10 4 UFC / mL) and line 4 corresponds to the BCA / Fusa ratio 1/2 mixture (BCA at 1.10 4 UFC / mL and Fusa at 2.10 4 UFC / mL). The bottom panel corresponds to the culture of Fusarium graminearum alone, from left to right, at a dose of 2.10 4 , 1.10 4 and 5.10 3 CFU / mL.
(B) Représentation graphique du pourcentage d’occupation du BCA (TAL-17 ou SCI) et du pathogène F. graminearum (F. gram) à l’issue du test en Dual culture sur gélose PDA (25°C sans photopériode). (B) Graphic representation of the percentage occupancy of BCA (TAL-17 or SCI) and of the pathogen F. graminearum (F. gram) at the end of the dual culture test on PDA agar (25 ° C without photoperiod).
EXEMPLES EXAMPLES
(I) Isolement de la souche de Trichoderma atroviride TAL-17 (I) Isolation of Trichoderma atroviride strain TAL-17
Souche isolée d’une feuille de blé cultivé en champs. Isolated stump of a wheat leaf grown in fields.
Le prélèvement de feuille de la culture du blé a été broyé puis mis au contact en infiniment mélangé d’une gélose de PDA ( Potato Dextrose Agar ) à 50°C qui contient des spores de Fusarium graminearum. La boîte a été mise en culture à 25°C sous hotte lumineuse. Ainsi seules les souches étant capables de se reproduire en présence de Fusarium graminearum se sont développées sur la boîte. Parmi ces souches TAL-17 était présente. Un prélèvement spécifique d’une zone présentant un intérêt dans la boîte et plusieurs repiquages successifs ont permis d’isoler la souche TAL-17, laquelle a ensuite été déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333. The leaf sample from the wheat crop was ground and then brought into contact in an infinitely mixed with a PDA (Potato Dextrose Agar) agar at 50 ° C which contains spores of Fusarium graminearum. The dish was cultured at 25 ° C. under a light hood. Thus only the strains being able to reproduce in the presence of Fusarium graminearum developed on the dish. Among these strains TAL-17 was present. A specific sample from an area of interest in the box and several successive subcultures made it possible to isolate the TAL-17 strain, which was then deposited on July 3, 2018 at the CNCM under number CNCM 1-5333.
(II) Etude in vitro de l’efficacité et du mode d’action du TAL-17 contre F. sraminearum (II) In vitro study of the efficacy and mode of action of TAL-17 against F. sraminearum
Compétitivité, mycoparasitisme et antibiose 1/ Tests Dual-culture côte à côte sur boîte de Pétri Competitiveness, mycoparasitism and antibiosis 1 / Side-by-side dual-culture tests on a Petri dish
Plusieurs tests de Dual-culture avec les BCA vs F. graminearum ont été réalisés en proximité sur milieu PDA ( Potato Dextrose Agar). On inocule 30 pL contenant 1.104 spores/mL (sp/mL) de F. graminearum , à 2 cm de l’extrémité d’une boîte de Pétri de 8,5 cm de diamètre contenant du milieu PDA, et 30 pL contenant 1.106 spores/mL d’un autre microorganisme (TAL-17 ou un autre Trichoderma BCA C) à l’autre extrémité de la boîte de Pétri. Les boîtes
de Pétri ont été incubées à 23-27°C sous lumière artificielle (24h/24) (tube fluorescent F36WT8/2084 BriteGro®). Des observations macroscopiques ont été réalisées à 6 jours et 10 jours après l’inoculation (Figure 1). Des témoins de F. graminearum seuls et des BCA seuls ont été réalisés. Les souches testées ont été la souche TAL-17 et une autre souche de référence également référencée comme un Trichoderma atroviride utilisé dans le Biocontrôle (= BCA C > Référence : ATCC® 20476). Several dual-culture tests with BCA vs. F. graminearum were carried out in proximity on PDA medium (Potato Dextrose Agar). 30 μL containing 1.10 4 spores / mL (sp / mL) of F. graminearum are inoculated, 2 cm from the end of an 8.5 cm diameter Petri dish containing PDA medium, and 30 μL containing 1.10 6 spores / mL of another microorganism (TAL-17 or another Trichoderma BCA C) at the other end of the Petri dish. The boxes Petri dishes were incubated at 23-27 ° C under artificial light (24 hours a day) (fluorescent tube F36WT8 / 2084 BriteGro ® ). Macroscopic observations were made 6 days and 10 days after inoculation (Figure 1). Controls of F. graminearum alone and of BCA alone were carried out. The strains tested were the TAL-17 strain and another reference strain also referred to as a Trichoderma atroviride used in Biocontrol (= BCA C> Reference: ATCC ® 20476).
Les souches TAL-17 et BCA C ont toutes 2 présenté une capacité à occuper l’espace, par contre la souche TAL-17 contrairement à la souche BCA C est capable de se développer sur le mycélium de Fusarium graminearum (Figure 1). La souche TAL-17 présente donc un potentiel mycoparasitisme beaucoup plus important que l’autre souche de référence BCA C. Des observations au microscope du mycélium de la souche TAL-17 en présence de mycélium de Fusarium graminearum ont révélé par ailleurs un enroulement du mycélium de la souche TAL-17 autour de Fusarium graminearum (Figure 2), lequel phénomène n’a pas été observé avec l’autre souche de Trichoderma atroviride (= BCA C) testée. Strains TAL-17 and BCA C both exhibited an ability to occupy space, whereas strain TAL-17 unlike strain BCA C is capable of growing on the mycelium of Fusarium graminearum (Figure 1). The TAL-17 strain therefore presents a much greater mycoparasitism potential than the other reference strain BCA C. Microscopic observations of the mycelium of the TAL-17 strain in the presence of mycelium from Fusarium graminearum also revealed a coiling of the mycelium. of the TAL-17 strain around Fusarium graminearum (Figure 2), which phenomenon was not observed with the other strain of Trichoderma atroviride (= BCA C) tested.
Par rapport à la bibliographie existante sur le sujet, le mycoparasitisme du genre Trichoderma , lequel correspond au genre de la souche TAL-17, a été étudié à de nombreuses reprises et sur de nombreuses cibles. Hibar et al. (Hibar, K., Daami-Remadi, M., Khiareddine, H., & Mahjoub, M. El. (2005). Effet inhibiteur in vitro et in vivo du Trichoderma harzianum sur Fusarium oxysporum f. sp. Radicis-lycopersici .) ont présenté un effet inhibiteur in vivo et vitro de Trichoderma harzianum sur Fusarium oxysporum , notamment par des observations microscopiques de la zone de contact entre les deux souches qui met en évidence une lyse importante, accompagnée d’un enroulement de la souche de T harzianum sur F. oxysporum. Steyaert et al. (Steyaert J., Ridgway H., Elad Y., Stewart A. (2003). Genetic basis of mycoparasitism: A mechanism of biological control by species of Trichoderma. New Zealand Journal of Crop and Horticultural Science ; 31(4), 281-291) ont mis en évidence le mycoparasitisme d’une souche de Trichoderma atroviride autour d’un hyphe d’une souche de Botrytis cinerea. Les résultats microscopiques précédemment décrits confirment de ce fait le potentiel mycoparasitisme accru de la souche TAL-17, notamment par rapport à la souche BCA C. Compared to the existing bibliography on the subject, mycoparasitism of the genus Trichoderma, which corresponds to the genus of the TAL-17 strain, has been studied on numerous occasions and on numerous targets. Hibar et al. (Hibar, K., Daami-Remadi, M., Khiareddine, H., & Mahjoub, M. El. (2005) In vitro and in vivo inhibitory effect of Trichoderma harzianum on Fusarium oxysporum f. Sp. Radicis-lycopersici. ) showed an inhibitory effect in vivo and in vitro of Trichoderma harzianum on Fusarium oxysporum, in particular by microscopic observations of the contact zone between the two strains which shows a significant lysis, accompanied by a coiling of the strain of T harzianum on F. oxysporum. Steyaert et al. (Steyaert J., Ridgway H., Elad Y., Stewart A. (2003). Genetic basis of mycoparasitism: A mechanism of biological control by species of Trichoderma. New Zealand Journal of Crop and Horticultural Science; 31 (4), 281 -291) demonstrated the mycoparasitism of a strain of Trichoderma atroviride around a hypha of a strain of Botrytis cinerea. The previously described microscopic results therefore confirm the increased mycoparasitism potential of the TAL-17 strain, in particular compared to the BCA C.
De plus ces essais sur boîtes ont montré une zone d’inhibition créée par la souche TAL-17 signe d’un potentiel effet d’antibiose et un autre test utilisant du filtrat de culture de la souche
TAL-17 a montré quant à lui un effet inhibiteur sur la croissance du pathogène Fusarium graminearum (données non montrées). In addition, these tests on dishes showed an inhibition zone created by the TAL-17 strain, a sign of a potential antibiosis effect and another test using culture filtrate of the strain. TAL-17 showed an inhibitory effect on the growth of the pathogen Fusarium graminearum (data not shown).
2/ Essais en mélange dépôt sur l’ensemble de la surface 2 / Tests in mixture deposit on the entire surface
Un autre test de Dual-culture avec les BCA us F. graminearum a été réalisé sur milieu PDA, mais cette fois-ci en mélange, avec étalement de 100 mΐ sur l’ensemble de la boîte de Pétri (diamètre 8,5 cm). Au centre d’une boîte de Pétri de 8,5 cm contenant du milieu PDA, sont étalés en surface 100 pL d’un mélange contenant 1.104 spores/mL de A. graminearum et 1.104 spores/mL du BCA (ou 0,5.104 spores/mL de chaque BCA pour la modalité mélange BCA), de plus pour certaines modalités ce mélange contient également 0,5% de la formulation Appyphyt, laquelle est une émulsion d’esters d’huile végétale (Esters d’huile végétale : 60- 80% ; Emulsionnant biosourcé ; 1-5% ; Qsp Eau). Le mélange a été inoculé après 2 h de contact. Les boîtes de Pétri ont été incubées à 25°C sous lumière artificielle (24h/24) (tube fluorescent F36WT8/2084 Britegro). Des mesures de la croissance de F. graminearum (en cm) ont été prises après 48, 72, 96 et 168 h ( i.e . de 2 à 7 jours) de culture après l’inoculation. Des témoins de F. graminearum seul et des BCA seuls ont été réalisés. Les souches testées ont été TAL-17 et BCA C. Another Dual-culture test with the BCA us F. graminearum was carried out on PDA medium, but this time in a mixture, with 100 mΐ spread over the entire Petri dish (diameter 8.5 cm) . In the center of an 8.5 cm Petri dish containing PDA medium, are spread on the surface 100 μL of a mixture containing 1.10 4 spores / mL of A. graminearum and 1.10 4 spores / mL of BCA (or 0, 5.10 4 spores / mL of each BCA for the BCA mixture modality), moreover for certain modalities this mixture also contains 0.5% of the Appyphyt formulation, which is an emulsion of vegetable oil esters (Vegetable oil esters : 60- 80%; Biobased emulsifier; 1-5%; Qsp Water). The mixture was inoculated after 2 h of contact. The Petri dishes were incubated at 25 ° C. under artificial light (24 hours a day) (fluorescent tube F36WT8 / 2084 Britegro). Measurements of the growth of F. graminearum (in cm) were taken after 48, 72, 96 and 168 h (ie 2 to 7 days) of culture after inoculation. Controls of F. graminearum alone and of BCA alone were carried out. The strains tested were TAL-17 and BCA C.
Lors de ce test le TAL-17 a été le plus performant, son mycoparasitisme permettant de recouvrir 100% de la boîte face avant à 7 jours (Figure 3). During this test, the TAL-17 was the most efficient, its mycoparasitism making it possible to cover 100% of the box front face at 7 days (Figure 3).
(III) Essais sur plante afin d’observer si le mode d’action du TAL-17 a un caractère endophyte (III) Tests on plants to observe whether the mode of action of TAL-17 has an endophytic character
Le terme endophyte provient de deux mots grecs « endon » et « phuton » qui signifie respectivement « à l’intérieur » et « végétal ». La définition d’endophyte a très souvent changé au cours du temps. Tout d’abord, la définition concernait tout organisme pouvant vivre à l’intérieur d’une plante. Aujourd’hui, les organismes endophytes sont des organismes ayant un mode de vie avec la plante dit « endophisme ». C’est-à-dire que les espèces endophytes sont capables de coloniser les structures internes des végétaux de façon asymptomatique (Hardoim, P. R., van Overbeek, L. S., Berg, G., Pirttilà, A. M., Compant, S., Campisano, A., ... Sessitsch, A. (2015). The Hidden World within Plants: Ecological and
Evolutionary Considérations for Defining Functioning of Microbial Endophytes. Microbiology and Molecular Biology Review s, 79(3), 293-320.). Les endophytes peuvent être des microorganismes comme les champignons. Ils peuvent coloniser la plante à différents niveaux selon le micro-organisme. Les organes concernés peuvent être suivant les cas : la tige, les racines, les segments de feuilles, les fruits, les bourgeons, les graines mais aussi dans les cellules hyalines mortes et creuses des plantes (Stçpniewska, Z., & Kuzniar, A. (2013). Endophytic microorganisms— promising applications in bioremediation of greenhouse gases. Applied Microbiology and Biotechnology, 97(22), 9589-96.). The term endophyte comes from two Greek words "endon" and "phuton" which means respectively "inside" and "plant". The definition of endophyte has changed very often over time. First, the definition concerned any organism that could live inside a plant. Today, endophytic organisms are organisms having a way of life with the plant known as “endophism”. That is, endophytic species are able to colonize the internal structures of plants asymptomatically (Hardoim, PR, van Overbeek, LS, Berg, G., Pirttilà, AM, Compant, S., Campisano, A ., ... Sessitsch, A. (2015). The Hidden World within Plants: Ecological and Evolutionary Considerations for Defining Functioning of Microbial Endophytes. Microbiology and Molecular Biology Review s, 79 (3), 293-320.). Endophytes can be microorganisms like fungi. They can colonize the plant at different levels depending on the microorganism. The organs concerned can be, depending on the case: the stem, the roots, the leaf segments, the fruits, the buds, the seeds but also in the dead and hollow hyaline cells of the plants (Stçpniewska, Z., & Kuzniar, A. (2013). Endophytic microorganisms— promising applications in bioremediation of greenhouse gases. Applied Microbiology and Biotechnology, 97 (22), 9589-96.).
Méthode préparation des échantillons pour observation Method for preparing samples for observation
Le bleu de coton (LACP-00D-100 Labkem®) au lactophénol a été utilisé dans cette étude comme colorant pour la mise en évidence des champignons. Des échantillons de feuille de blé de 1 x 0,5 cm et de maïs de 2,5 x 1,5 cm ont été prélevés pour chaque modalité étudiée. La démarche est la suivante pour le traitement des coupes : Cotton blue (LACP-00D-100 Labkem ® ) with lactophenol was used in this study as a dye for the detection of fungi. Samples of 1 x 0.5 cm wheat leaf and 2.5 x 1.5 cm corn were taken for each modality studied. The procedure is as follows for the treatment of sections:
1. Mordançage à l’eau de javel (3 min) 1. Mordanting with bleach (3 min)
2. Lavage dans l’eau ultra pure 2. Washing in ultra pure water
3. Coloration dans le bleu coton lactophénol (3 min) 3. Coloring in lactophenol cotton blue (3 min)
4. Rinçage dans le lactoglycérol 4. Rinsing in lactoglycerol
5. Les échantillons sont ensuite placés sous lame et lamelle pour une observation microscopique (x 400). 5. The samples are then placed under slide and coverslip for microscopic observation (x 400).
1/ Essais sur le blé 1 / Tests on wheat
6 graines de blé ont été semées par pot de 0,5 L et percé au fond pour le drainage. Le substrat utilisé est un mélange de terreau universel et de vermiculite expansée (0,5-10 mm) (2: 1 v/v). Le substrat a été humidifié 24 h avant le semis avec de l’eau osmosée. Les graines ont été humidifiées la veille du semis pendant 24 h à 4°C. Une fois le semis réalisé, les pots ont été placés sous hotte lumineuse à 25°C (photopériode 16/8 heures) et ont été arrosés trois fois par semaine. 6 wheat seeds were sown per 0.5 L pot and drilled at the bottom for drainage. The substrate used is a mixture of universal soil and expanded vermiculite (0.5-10 mm) (2: 1 v / v). The substrate was moistened 24 hours before sowing with reverse osmosis water. The seeds were moistened the day before sowing for 24 h at 4 ° C. Once the sowing was done, the pots were placed under a light hood at 25 ° C (16/8 hour photoperiod) and were watered three times a week.
Différentes traitements ont été réalisés. Pour le traitement au semis, 1 mL de la solution de TAL-17 à la concentration souhaitée a été ajouté sur la graine semée (500 pL avant le dépôt
de la graine et 500 pL après). Pour le témoin et les autres conditions testées, les graines n’ont pas reçu de traitement de BCA mais 1 mL d’eau de forage stérile. Le traitement en pulvérisation a été effectué lors du stade 2 feuilles ou lors du stade floraison. Les pots ne recevant pas de traitements au BCA ont été traités avec de l’eau de forage par le même dispositif. Les premières feuilles situées au plus bas de la plante ont été utilisées pour cet essai. Different treatments have been carried out. For the sowing treatment, 1 mL of the TAL-17 solution at the desired concentration was added to the sown seed (500 pL before deposition of the seed and 500 pL after). For the control and the other conditions tested, the seeds did not receive the BCA treatment but 1 mL of sterile well water. The spray treatment was carried out during the 2 leaf stage or during the flowering stage. The pots not receiving BCA treatments were treated with borehole water by the same device. The first leaves at the bottom of the plant were used for this test.
Du mycélium de champignon a été observé dans les feuilles et racines de la plante traitée au semis contrairement à la plante témoin non traité au semis. Fungus mycelium was observed in the leaves and roots of the seedling treated plant in contrast to the untreated control plant.
2/ Essais sur le maïs 2 / Tests on corn
3 graines sont semées par pot de 5 L percés au fond pour le drainage. Le substrat utilisé est un mélange de terreau universel et de vermiculite expansée (0,5-10 mm) (2: 1 v/v). Le substrat a été humidifié 24 h avant le semis avec de l’eau osmosée. Les pots ont été arrosés trois fois par semaine avec un volume d’eau osmosée croissant en fonction du développement de la plante. 3 seeds are sown per 5 L pot drilled at the bottom for drainage. The substrate used is a mixture of universal soil and expanded vermiculite (0.5-10 mm) (2: 1 v / v). The substrate was moistened 24 hours before sowing with reverse osmosis water. The pots were watered three times a week with an increasing volume of RO water as the plant developed.
Pour le traitement au semis, 1 mL de la solution de TAL-17 à la concentration souhaitée (105 ou 108/mL) a été ajouté sur la graine semée (500 pL avant le dépôt de la graine et 500 pL après). Pour le témoin et les autres conditions testées, les graines n’ont pas reçu de traitement de BCA mais 1 mL d’eau de forage stérile. Le traitement en pulvérisation a été effectué lors du stade 5 feuilles. For the sowing treatment, 1 mL of the TAL-17 solution at the desired concentration (10 5 or 10 8 / mL) was added to the sown seed (500 pL before seed deposition and 500 pL after). For the control and the other conditions tested, the seeds did not receive the BCA treatment but 1 mL of sterile well water. The spray treatment was carried out during the 5 leaf stage.
Du mycélium de champignon a été observé dans les feuilles et racines de la plante traitée au semis contrairement à la plante témoin non traité au semis. Fungus mycelium was observed in the leaves and roots of the seedling treated plant in contrast to the untreated control plant.
Finalement, ces tests ( cf exemples II et III) ont montré que la souche TAL-17 est capable d’agir contre Fusarium graminearum de différentes façons. Elle cumule compétition, antibiose, my coparasitisme et est capable de pénétrer dans la plante.
(IV) Stratégie d’inoculation du BCA Finally, these tests (see Examples II and III) showed that the TAL-17 strain is capable of acting against Fusarium graminearum in different ways. It combines competition, antibiosis, my coparasitism and is able to penetrate the plant. (IV) BCA inoculation strategy
Développement de formulations 1/ Essais en mélange avec dépôt au centre Development of formulations 1 / Mixed tests with central deposition
Un autre test de Dual-culture avec les BCA us F. graminearum a été réalisé sur milieu PDA, mais cette fois-ci en mélange, avec dépôt d’une goutte au centre de la boîte (30 mΐ). Dans ce test seule TAL-17 a été testée. Des mesures de la croissance de F. graminearum (en cm) ont été prises après 48, 72 et 96 h de culture (Figure 4). Another Dual-culture test with the BCA us F. graminearum was carried out on PDA medium, but this time mixed, with a drop deposited in the center of the dish (30 m 30). In this test only TAL-17 was tested. Growth measurements of F. graminearum (in cm) were taken after 48, 72 and 96 h of culture (Figure 4).
Au centre d’une boîte de Pétri de 8,5 cm contenant du milieu PDA, ont été inoculés 30 pL d’un mélange contenant 1.104 spores/mL de F. graminearum et 1.104 spores du BCA, de plus pour certaines modalités ce mélange contient également 0,5% de la formulation Appyphyt, laquelle est une émulsion d’esters d’huile végétale (Esters d’huile végétale : 60-80% ; Emulsionnant biosourcé ; 1-5% ; Qsp Eau). Le mélange a été inoculé après 2 h de contact. Les boîtes de Pétri ont été incubées à 23-27°C sous lumière artificielle (24h/24) (tube fluorescent F36WT8/2084 BriteGro®). Des mesures de la croissance de F. graminearum ont été réalisées de 2 à 7 jours après l’inoculation. Des témoins de F. graminearum seul et du BCA seul ont été réalisés. In the center of an 8.5 cm Petri dish containing PDA medium, were inoculated 30 μL of a mixture containing 1.10 4 spores / mL of F. graminearum and 1.10 4 spores of BCA, more for certain modalities this mixture also contains 0.5% of the Appyphyt formulation, which is an emulsion of vegetable oil esters (Vegetable oil esters: 60-80%; Bio-based emulsifier; 1-5%; Qsp Water). The mixture was inoculated after 2 h of contact. The Petri dishes were incubated at 23-27 ° C under artificial light (24 hours a day) (fluorescent tube F36WT8 / 2084 BriteGro ® ). Growth measurements of F. graminearum were taken 2 to 7 days after inoculation. Controls for F. graminearum alone and BCA alone were made.
La souche TAL-17 a permis une réduction de l’ordre de 63% du développement de Fusarium graminearum sur boîte de Pétri à 72 h et 78% à 96 h. Cette réduction est montée à 77% à 72 h et à 85% à 96 h lorsqu’elle est couplée à la formulation Appyphyt (Figure 5). Il convient de noter qu’à 96 h la formule Appyphyt seule n’a pas montré d’inhibition sur la croissance de Fusarium graminearum. Strain TAL-17 resulted in a 63% reduction in the development of Fusarium graminearum in a Petri dish at 72 h and 78% at 96 h. This reduction rose to 77% at 72 h and to 85% at 96 h when combined with the Appyphyt formulation (Figure 5). It should be noted that at 96 h the Appyphyt formula alone did not show any inhibition on the growth of Fusarium graminearum.
2/ Enrobage de graines 2 / Coating of seeds
Les résultats précédents, lesquels ont démontré l’aspect endophyte, indiquent un intérêt potentiel à enrober les graines des cultures visés avec la souche TAL-17. Cet intérêt a été confirmé par les essais de bio stimulation sur la germination (voir ci-après).
(V) Effet des BCA sur la protection des plantes The previous results, which demonstrated the endophytic appearance, indicate a potential interest in coating the seeds of the target crops with the TAL-17 strain. This interest was confirmed by the bio-stimulation tests on germination (see below). (V) Effect of BCAs on plant protection
Etude en salle phytotronique 1/ Septoriose Phytotronic room study 1 / Septoria
La culture in vitro a été développée pour réaliser un screening des potentiels BCAs sélectionnés contre la septoriose du blé Septoria tritici. Le milieu de culture in vitro standard a été modifié en enlevant le saccharose afin d’éviter d’éventuelles contaminations. The in vitro culture was developed to perform a screening of the selected BCAs potentials against the septoria blight of the wheat Septoria tritici. The standard in vitro culture medium has been modified by removing the sucrose to avoid possible contamination.
Deux tests ont été réalisés. Two tests were carried out.
La maladie et le BCA ont été appliqués simultanément par pulvérisation dans des conditions se rapprochant le plus possible du champ. The disease and BCA were applied simultaneously by spraying under conditions as close to the field as possible.
Les pourcentages de plants présentant des tâches de septoriose suivant les modalités sont présentés Figure 6. Deux Trichoderma atroviride ont été testés dont TAL-17. Cette dernière s’est révélée être la plus intéressante contre cette maladie. A noter la quantité de BCA est en nombre de spores viables (équivalent 5.1011 spores viables/hectare). The percentages of plants exhibiting septoria spots according to the methods are presented in FIG. 6. Two Trichoderma atroviride were tested, including TAL-17. The latter has proved to be the most interesting against this disease. Note the quantity of BCA is in number of viable spores (equivalent to 5.10 11 viable spores / hectare).
2/ Fusariose 2 / Fusarium wilt
La salle phytotronique a la possibilité de monter à 90% d’humidité HR pendant l’infection au moment de la floraison des épis. Le plateau permet de tester 30 jardinières de 15 plants. Les tests ont été réalisés avec le blé de printemps « Calixo ». The phytotronic room has the possibility of increasing to 90% RH humidity during infection at the time of flowering of the ears. The tray allows you to test 30 planters of 15 plants. The tests were carried out with “Calixo” spring wheat.
Les traitements avec BCA ont été pour ces tests exclusivement réalisés au moment de la floraison et les BCA utilisés sont : The treatments with BCA were for these tests exclusively carried out at the time of flowering and the BCA used are:
■ TAL-17 (cf. Exemple I) ; ■ TAL-17 (cf. Example I);
■ BCA A > Trichoderma asperellum (Réf : ATCC® 52438) et ■ BCA A> Trichoderma asperellum (Ref: ATCC ® 52438) and
■ BCA B > Trichoderma atroviride (Réf. Interne : BCA B- 15). ■ BCA B> Trichoderma atroviride (Internal ref.: BCA B-15).
Un premier test a montré un intérêt pour la souche TAL-17 (Figures 7 et 8). Cet intérêt a été confirmé grâce à un nouveau test (Figures 9, 10 et 11). Ce dernier a mis en évidence un intérêt à l’utilisation du TAL-17 (équivalent 1011 spores UFC/ha) avec la formulation Appyphyt (équivalent lL/ha) sur le blé pour les symptômes visuels de la maladie et sur la masse de grains par épis qui sont alors tous deux statistiquement différents de la modalité contaminée
au Fusarium graminearum seul. Cependant la masse de grains par épis quand le blé a été traité avec le TAL-17 et la formule Appyphyt n’atteint pas la masse du blé témoin non contaminé (i.e. 0,831 g/épis pour la figure 8 et 0,77 g/épis pour la figure 10). A first test showed an interest for the TAL-17 strain (Figures 7 and 8). This interest was confirmed thanks to a new test (Figures 9, 10 and 11). The latter demonstrated an interest in the use of TAL-17 (equivalent to 10 11 UFC spores / ha) with the Appyphyt formulation (equivalent to lL / ha) on wheat for the visual symptoms of the disease and on the mass of grains per ear which are then both statistically different from the contaminated modality to Fusarium graminearum alone. However, the mass of grains per ear when the wheat was treated with TAL-17 and the Appyphyt formula does not reach the mass of uncontaminated control wheat (ie 0.831 g / ears for Figure 8 and 0.77 g / ears for figure 10).
En conclusion la souche TAL-17 a montré un intérêt pour une application au stade floraison du blé mais au vu de son caractère endophyte, une application beaucoup plus précoce présente un intérêt dans la lutte contre la fusariose de l’épi. In conclusion, the TAL-17 strain showed an interest for an application at the flowering stage of wheat, but in view of its endophytic character, a much earlier application is of interest in the fight against fusarium head blight.
De plus une stratégie de traitement avec demi-dose de fongicide est possible. In addition, a treatment strategy with half a dose of fungicide is possible.
Etude en salle phytotronique / serre / biostimulation 1/ Essais en serre sur maïs Phytotronic / greenhouse / biostimulation room study 1 / Greenhouse trials on corn
Trois graines ont été semées par pot de 5 L percés au fond pour le drainage. Le substrat utilisé est un mélange de terreau universel et de vermiculite expansée (0,5-10 mm) (2: 1 v/v). Le substrat a été humidifié 24 h avant le semis avec de l’eau osmosée. Les pots ont été arrosés trois fois par semaine avec un volume d’eau osmosée croissant en fonction du développement de la plante. Three seeds were sown per 5 L pot drilled at the bottom for drainage. The substrate used is a mixture of universal soil and expanded vermiculite (0.5-10 mm) (2: 1 v / v). The substrate was moistened 24 hours before sowing with reverse osmosis water. The pots were watered three times a week with an increasing volume of RO water as the plant developed.
Les traitements réalisés ont été identiques à ceux de l’Exemple (III), 1/. The treatments carried out were identical to those of Example (III), 1 /.
Pour rappel, le témoin (A) n’a pas reçu de traitement ; le traitement au semis (B et C) a été réalisé avec une solution de TAL-17 de 1.105 ou 1.108 spores/graine (sp/graine) ; le traitement en pulvérisation au stade 5 feuilles (D et E), soit 21 jours de croissance, a été réalisé avec une solution de TAL-17 de 1.1011 ou 5.1011 spores/ha. As a reminder, Witness (A) did not receive any treatment; the sowing treatment (B and C) was carried out with a TAL-17 solution of 1.10 5 or 1.10 8 spores / seed (sp / seed); the spraying treatment at the 5-leaf stage (D and E), ie 21 days of growth, was carried out with a TAL-17 solution of 1.10 11 or 5.10 11 spores / ha.
Les résultats obtenus pour le pourcentage de germination sur des plants âgés de 6 jours sont représentés sur la figure 12. Les valeurs pour les plants de maïs n’ayant pas (témoin) ou pas encore (pulvérisation aérienne) reçus de traitements au TAL-17 sont statistiquement identiques et de l’ordre de 80%. De même avec le traitement au BCA au semis à 1.105 spores/graine, aucune différence significative n’est visible par rapport au témoin non traité. Par contre, avec le traitement au semis de 1.108 spores/graine, soit une concentration lOOOx supérieures à la précédente, le pourcentage de germination atteint les 100% dès 6 jours après le semis. Après 9 jours de croissance (données non présentées), le taux de germination tend vers 97% pour les modalités ayant reçu le traitement au semis à 1.105 spores/graine et pour
celles n’ayant pas encore reçu le traitement aérien. La modalité témoin, sans traitement, augmente jusqu’à un pourcentage de germination de 93%. The results obtained for the germination percentage on 6-day-old plants are shown in Figure 12. The values for corn plants not having (control) or not yet (aerial spraying) received TAL-17 treatments. are statistically identical and in the order of 80%. Similarly with the BCA treatment at sowing at 1.10 5 spores / seed, no significant difference is visible compared to the untreated control. On the other hand, with the sowing treatment of 1.10 8 spores / seed, that is to say a concentration lOOOx higher than the previous one, the germination percentage reaches 100% as early as 6 days after sowing. After 9 days of growth (data not shown), the germination rate tends towards 97% for the modalities having received the sowing treatment at 1.10 5 spores / seed and for those who have not yet received the aerial treatment. The control mode, without treatment, increases up to a germination percentage of 93%.
Les résultats des mesures de la taille en hauteur des plants âgés de 25 jours représentés sont présentés en figure 13, et ont mis en évidence une différence statistique du traitement au semis du TAL-17 face au traitement en pulvérisation aérienne et au témoin. Les traitements au semis à 1.105 et 1.108 spores/graine (spores viables) permettent une croissance des plants de l’ordre de 105 cm, tandis que les traitements aériens, réalisé 4 jours plus tôt et le témoin, ne permettent qu’une croissance allant de 97 cm pour le témoin, à 100,5 cm pour le traitement aérien à 1.1011 spores/ha et 101 cm pour le traitement à 5.1011 spores/ha. Ces valeurs sont retrouvées dans un même groupe statistique. The results of the size-in-height measurements of the 25-day-old plants represented are presented in FIG. 13, and demonstrated a statistical difference between the sowing treatment of TAL-17 compared with the aerial spray treatment and the control. The sowing treatments at 1.10 5 and 1.10 8 spores / seed (viable spores) allow plants to grow in the order of 105 cm, while the aerial treatments, carried out 4 days earlier and the control, only allow growth ranging from 97 cm for the control, to 100.5 cm for the aerial treatment at 1.10 11 spores / ha and 101 cm for the treatment at 5.10 11 spores / ha. These values are found in the same statistical group.
2/ Essais en salle phytotronique sur blé 2 / Tests in a phytotronic room on wheat
Culture : Culture :
6 graines de blé ont été semées par pot de 0,5 L et percé au fond pour le drainage. Le substrat utilisé est un mélange de terreau universel et de vermiculite expansée (0,5-10 mm) (2: 1 v/v). Le substrat a été humidifié 24 h avant le semis avec de l’eau osmosée. 6 wheat seeds were sown per 0.5 L pot and drilled at the bottom for drainage. The substrate used is a mixture of universal soil and expanded vermiculite (0.5-10 mm) (2: 1 v / v). The substrate was moistened 24 hours before sowing with reverse osmosis water.
Pour la disposition des pots dans la salle phytotronique, ils ont été regroupés par groupe de 3 dans une soucoupe de jardinières. 12 « jardinières » ont été ensemencées avec 0,5 mL d’une suspension de spores de TAL-17 à 106 spores UFC/graines dans 0,5 mL et 18 jardinières ont été ensemencées avec 0,5 ml d’eau de forage stérile afin de s’affranchir d’un apport d’eau différents suivant les traitements. For the arrangement of the pots in the phytotronic room, they were grouped together in groups of 3 in a saucer of planters. 12 "planters" were inoculated with 0.5 mL of a suspension of TAL-17 spores containing 10 6 CFU spores / seeds in 0.5 mL and 18 planters were inoculated with 0.5 mL of borehole water sterile in order to avoid a different water supply depending on the treatment.
Les pots ont été placés dans la salle phytotronique (photopériode 16/8h) et ont été arrosés deux fois par semaine. The pots were placed in the phytotronic room (16 / 8h photoperiod) and were watered twice a week.
Le pourcentage de germination a été observé à 4 et 11 jours suivant les modalités. The germination percentage was observed at 4 and 11 days depending on the modalities.
Ce pourcentage moyen est calculé par jardinière (soit sur 18 graines) puis l’ensemble des données des jardinières pour chaque modalité a été traité statistiquement par ANOVA (p<0.05).
Il en ressort que les modalités inoculées avec la souche TAL-17 ont présenté un taux de germination supérieur à la modalité témoin eau de 5% à 11 jours (Figure 14). Cette différence est significative statistiquement. This average percentage is calculated per gardener (ie on 18 seeds) then all the data from the planters for each modality was statistically processed by ANOVA (p <0.05). It emerges that the modalities inoculated with the TAL-17 strain exhibited a germination rate greater than the water control modality of 5% at 11 days (Figure 14). This difference is statistically significant.
(VI) Comparaison de la souche TAL-17 à d’autres BCA (VI) Comparison of the TAL-17 strain to other BCAs
Tests Dual-culture côte à côte sur boîte de Pétri (suite de la partie (II) 1/) Side-by-side dual-culture tests on a Petri dish (continued from part (II) 1 /)
Le protocole expérimental a été le même que celui décrit précédemment. La souche TAL-17 a été comparée à la souche BCA D (= Trichoderma atroviride, Réf. : 1-12137). Le test Dual culture a été réalisé avec 30 mΐ de BCA ou de F. graminearum déposés aux extrémités de la boite de Pétri. Après 6 et 10 jours de culture à 25°C sur PDA sous hotte lumineuse avec photopériode de 16 h, les boîtes ont été observées (Figure 15 A) et la longueur du recouvrement du pathogène par le BCA a été mesuré (Figure 15B). The experimental protocol was the same as that described previously. The TAL-17 strain was compared to the BCA D strain (= Trichoderma atroviride, Ref .: 1-12137). The Dual culture test was performed with 30 mΐ of BCA or F. graminearum deposited at the ends of the Petri dish. After 6 and 10 days of culture at 25 ° C on PDA under a light hood with 16 h photoperiod, the dishes were observed (Figure 15 A) and the length of the pathogen coverage by BCA was measured (Figure 15B).
Dans cet exemple également, la souche TAL-17 a présenté la particularité de se développer sur le mycélium du pathogène au cours du temps, contrairement au BCA D. Also in this example, the TAL-17 strain exhibited the particularity of growing on the mycelium of the pathogen over time, unlike the BCA D.
(VII) Essai de spécificité de la sonde TaqMan® GS285741-P1 et du couple de primer associé GS285741-F1 et GS285741-R1 vis-à-vis de la souche de l’Invention (TAL- 17 et/ou un de ses mutants) (VII) probe specificity Assay TaqMan ® GS285741-P1 and the torque associated GS285741 primer-F1-R1 and GS285741 vis-à-vis the strain of the invention (tal- 17 and / or a mutant thereof )
Protocole Protocol
Afin de tester la spécificité des outils moléculaires (sonde TaqMan® GS285741-P1 et le couple de primer associé GS285741-F1 et GS285741-R1), il a été mis en œuvre une analyse classique par Polymerase Chain Reaction en temps réel (qPCR) sur 3 souches distinctes, à savoir : In order to test the specificity of the molecular tools (TaqMan ® probe GS285741-P1 and the pair of associated primer GS285741-F1 and GS285741-R1), a classic analysis by Polymerase Chain Reaction in real time (qPCR) was carried out on 3 distinct strains, namely:
la souche de Trichoderma viride de l’espèce T. asperellum (TV) ; the strain of Trichoderma viride of the species T. asperellum (TV);
la souche Trichoderma atroviride TAS ; et the strain Trichoderma atroviride TAS; and
la souche Trichoderma atroviride de l’invention (TAL-17). the Trichoderma atroviride strain of the invention (TAL-17).
Un étalon interne contrôle est également réalisé avec de F ADN génomique extrait de la souche de l’invention, lequel a été dilué en série. L’ensemble des essais de qPCR ont été réalisés en utilisant un thermocycleur CFX 96 touch de Biorad®. Le programme d’amplification utilisé est celui recommandé par le fournisseur avec une température
d’hybridation de 60°C. Pour la méthode TaqMan®, le mélange réactionnel Luna® universel Probe qPCR Master Mix (NEB®) a été utilisé. Le programme d’amplification est de 95°C 2 min suivi de 40X 95°C 15” et 60°C 30”. An internal control standard is also produced with genomic DNA extracted from the strain of the invention, which has been serially diluted. All qPCR assays were performed using a CFX 96 touch thermal cycler from Biorad ® . The amplification program used is that recommended by the supplier with a temperature hybridization at 60 ° C. For the TaqMan ® method, the Luna ® Universal Probe qPCR Master Mix (NEB ® ) reaction mixture was used. The amplification program is 95 ° C 2 min followed by 40X 95 ° C 15 ”and 60 ° C 30”.
Résultats Results
Les résultats de cette analyse sont présentés dans le Tableau 3 ci-après. The results of this analysis are presented in Table 3 below.
Cq Mean Cq Mean
Echantillon (nombre de cycle d'amplification nécessaire pour obtenir un signal fluorescent caractéristique) dilution 1 23,66 Sample (number of amplification cycles necessary to obtain a characteristic fluorescent signal) dilution 1 23.66
dilution 2 26,84 dilution 2 26.84
Etalon interne Internal standard
dilution 3 29,99 dilution 3 29.99
(5 ng) (5 ng)
(dilution en série dilution 4 33,36 (serial dilution dilution 4 33.36
d’ADN génomique dilution 5 37,4 of genomic DNA dilution 5 37.4
de la souche TAL- dilution 6 38,28 of the TAL strain - dilution 6 38.28
17) 17)
dilution 7 N.D. (pas assez d’ADN) dilution 7 ND (not enough DNA)
dilution 8 N.D. (pas assez d’ADN) dilution 8 N.D. (not enough DNA)
puits 1 N.D. well 1 N.D.
Souche TV TV strain
puits 2 N.D. well 2 N.D.
(5 ng) (5 ng)
puits 3 N.D. well 3 N.D.
puits 1 N.D. well 1 N.D.
Souche TAS TAS strain
puits 2 N.D. well 2 N.D.
(5 ng) (5 ng)
puits 3 N.D. well 3 N.D.
puits 1 21,46 well 1 21.46
Souche TAL-17 Strain TAL-17
puits 2 21,46 well 2 21.46
(5 ng) (5 ng)
puits 3 21,46 well 3 21.46
Tableau 3 : Détection spécifique par qPCR de la souche de l’Invention Table 3: Specific detection by qPCR of the strain of the invention
Conclusion Conclusion
La sonde TaqMan® GS285741-P1 et le couple de primer associé GS285741-F1 et GS285741- R1 n’ont permis de détecter que la souche TAL-17. Ces outils permettent donc bien la détection et l’identification dans un échantillon de la présence de la souche de l’Invention TAL-17 et/ou un de ses mutants.
(VIII) Comparaison de l’efficacité de la souche TAL-17 versus celle de la souche SCI The TaqMan ® probe GS285741-P1 and the pair of primer associated GS285741 GS285741--F1 and R1 have detected that the LAT-17 strain. These tools therefore allow the detection and identification in a sample of the presence of the strain of the invention TAL-17 and / or one of its mutants. (VIII) Comparison of the efficiency of the TAL-17 strain versus that of the SCI strain
Tests Dual-culture en mélange sur boîte de Pétri Dual-culture tests in a mixture on a Petri dish
L’effet biocontrôle de la souche TAL-17 sur le développement de F graminearum a été comparé à celui de la souche SCI (= Trichoderma atroviride isolée présente dans le produit Vintec®). Pour cela, un test Dual culture a été réalisé sur lequel 100 pL d’un mélange F. graminearum/T. atroviride (Fusa/BCA) a été étalé sur milieu PDA en boite de Pétri. The biocontrol effect of the TAL-17 strain on the development of F graminearum was compared with that of the SCI strain (= isolated Trichoderma atroviride present in the Vintec ® product). For this, a Dual culture test was carried out on which 100 μL of a F. graminearum / T. atroviride (Fusa / BCA) was spread on PDA medium in a Petri dish.
Les mélanges utilisés ont été les suivants : The mixtures used were as follows:
■ Mélange BCA/Fusa (ratio 1/2) : BCA à 1.104 UFC/mL et Fusa à 2.104 UFC/mL (mélange lmL de BCA à 2.104 UFC/mL + lmL de fusa à 4.104 UFC/mL). ■ BCA / Fusa mixture (ratio 1/2): BCA at 1.10 4 CFU / mL and Fusa at 2.10 4 CFU / mL (lmL mixture of BCA at 2.10 4 CFU / mL + 1mL of fusa at 4.10 4 CFU / mL).
■ Mélange BCA/Fusa (ratio 1/1) : BCA à 1.104 UFC/mL et Fusa à 1.104 UFC/mL (mélange lmL de BCA à 2.104 UFC/mL + lmL de fusa à 2.104 UFC/mL). ■ BCA / Fusa mixture (1/1 ratio): BCA at 1.10 4 CFU / mL and Fusa at 1.10 4 CFU / mL (lmL mixture of BCA at 2.10 4 CFU / mL + 1mL of fusa at 2.10 4 CFU / mL).
■ Mélange BCA/Fusa (ratio 2/1) : BCA à 1.104 UFC/mL et Fusa à 5.103 UFC/mL (mélange lmL de BCA à 2.104 UFC/mL + lmL de fusa à 1.104 UFC/mL). ■ BCA / Fusa mixture (ratio 2/1): BCA at 1.10 4 CFU / mL and Fusa at 5.10 3 CFU / mL (lmL mixture of BCA at 2.10 4 CFU / mL + 1mL of fusa at 1.10 4 CFU / mL).
Après 6 et 10 jours de culture à 25°C sur PDA sous hotte lumineuse avec photopériode de 16 h, les boîtes ont été observées (Figures 16A et 17 A) et une évaluation visuelle du pourcentage d’occupation de l'espace par les différentes souches a été réalisées (Figure 16B et 17B). Ce dernier correspond à l'intensité de sporulation du BCA (TAL-17 ou SCI) sachant que le témoin = 100%. Celui de F graminearum est estimé en soustrayant la surface totale de la boite moins la surface estimée d’occupation en BCA. After 6 and 10 days of culture at 25 ° C on PDA under a light hood with a 16 h photoperiod, the dishes were observed (Figures 16A and 17 A) and a visual evaluation of the percentage of space occupied by the different strains were made (Figure 16B and 17B). The latter corresponds to the intensity of sporulation of the BCA (TAL-17 or SCI) knowing that the control = 100%. That of F graminearum is estimated by subtracting the total area of the box minus the estimated area of occupancy in BCA.
In fine , comparé à la souche Trichoderma atroviride SCI, la souche de l’invention TAL-17 à la même dose combat d’avantage Fusarium graminearum. Ceci est d’ailleurs nettement visible pour le ratio 2 UFC de Fusa / 1 UFC de BCA. En effet, dans ces conditions, la souche SCI décroche contrairement à la souche TAL-17. In fine, compared to the strain Trichoderma atroviride SCI, the strain of the invention TAL-17 at the same dose combats Fusarium graminearum more. This is clearly visible for the ratio of 2 CFU of Fusa / 1 CFU of BCA. In fact, under these conditions, the SCI strain stalls unlike the TAL-17 strain.
(IX) Essai en champs et comparaison de l’efficacité de la souche TAL-17 versus celle d’une souche de T. atroviride sur la rouille brune du blé (IX) Field trial and comparison of the efficacy of strain TAL-17 versus that of a strain of T. atroviride on brown rust of wheat
Protocole Protocol
Après le semis de la variété de blé Pakito, la parcelle semée a été divisée en 4 microparcelles de l’ordre de 20 m2 par modalité ( cfi Tableau 4) et l’essai à proprement parler a pu débuter. Pour cela, deux traitements ont été réalisé au stade‘épis 6 à 8’ (Tl) et‘début floraison’ (T2) avec des traitement conventionnel (Onnel®, Faxer®, Librax®) en dose usuelle (0,6 L/ha) ou en
demi-dose (0,3 L/ha) en combinaison ou non avec un mélange de BCA (souche TAL-17 [BCA 1] ou une autre souche de T. atroviride [BCA 2]) à la dose de 1.1011 UFC/ha et d’ Appyphyt à la dose de 1 kg/ha ( cf Tableau 4). After the sowing of the Pakito wheat variety, the sown plot was divided into 4 micro-plots of the order of 20 m 2 per modality (see Table 4) and the actual test was able to start. For this, two treatments were carried out at the 'ears 6 to 8' (T1) and 'early flowering' (T2) stage with conventional treatments (Onnel ® , Faxer ® , Librax ® ) in the usual dose (0.6 L / ha) or in half-dose (0.3 L / ha) in combination or not with a mixture of BCA (strain TAL-17 [BCA 1] or another strain of T. atroviride [BCA 2]) at a dose of 1.10 11 CFU / ha and Appyphyt at a dose of 1 kg / ha (see Table 4).
Tableau 4. Conditions testées lors de cet essai en champ Table 4. Conditions tested in this field trial
Un mois après le dernier traitement, l’évaluation du développement de la rouille brune (i.e. Puccinia recondita ) a été mesuré. One month after the last treatment, the assessment of the development of brown rust (i.e. Puccinia recondita) was measured.
Analyse statistique Statistical analysis
L’analyse statistique a été réalisée grâce au logiciel d’analyse et de traitement statistique StatBox®. Il se couple au logiciel Excel® et en enrichi les fonctionnalités. Il a permis de réaliser les ANOVA qui seront présentées dans la partie résultats. Les comparaisons de moyennes sont effectuées selon le test de Newman-Keuls au seuil 5%. Des groupes statistiques homogènes sont déterminés, les modalités associées à la même lettre ne sont pas statistiquement différentes. The statistical analysis was carried out using StatBox ® analysis and statistical processing software. It is paired with Excel ® software and enriched its functions. It made it possible to carry out the ANOVAs which will be presented in the results section. The comparisons of means are carried out according to the Newman-Keuls test at the 5% threshold. Homogeneous statistical groups are determined, the modalities associated with the same letter are not statistically different.
Résultats Results
Moyenne générale 97,2 44,33 44,33 6, 18 General average 97.2 44.33 44.33 6.18
Ecart-type résiduel 1,69 0,72 0,72 0,87 Residual standard deviation 1.69 0.72 0.72 0.87
Coefficient de Coefficient of
variation 1,7 1,6 1,6 14 variation 1.7 1.6 1.6 14
Tableau 5. Effet des traitements appliqués sur le rendement et l’évolution de la rouille brune Table 5. Effect of treatments applied on the yield and development of brown rust
S’agissant de la note évaluant la rouille brune, plus la note est élevée moins il y a de maladie (échelle 1 à 10 : 10 = zéro symptômes de maladie). Les lettres symbolisent les statistiques calculées. For the score for brown rust, the higher the score the less disease there is (scale 1 to 10: 10 = zero disease symptoms). The letters symbolize the calculated statistics.
Conclusion Conclusion
Le BCA 1 ( i.e . souche TAL-17) s’est montré efficace pour lutter contre la rouille brune (i.e. Puccinia recondita ) contrairement à la souche BCA 2 (autre souche de Trichoderma atroviride). Cette différence d'efficacité est statistiquement différente quand on compare la modalité No. 9 à la modalité No. 7 de l’essai et que l’on regarde les notes sur la rouille brune. En effet, pour ces deux modalités le BCA a été appliqué seul au premier traitement et a également été appliqué au second traitement avec une demi-dose fongicide conventionnel Librax®. Ainsi la souche TAL-17 a montré dans cet essai un intérêt statistique sur les symptômes physique de la rouille brune. BCA 1 (ie. Strain TAL-17) has been shown to be effective in controlling brown rust (ie Puccinia recondita) unlike strain BCA 2 (another strain of Trichoderma atroviride). This difference in efficacy is statistically different when comparing modality No. 9 to modality No. 7 of the test and looking at the notes on brown rust. In fact, for these two modalities, BCA was applied alone to the first treatment and was also applied to the second treatment with a half-dose of conventional Librax ® fungicide. Thus, the TAL-17 strain showed in this test a statistical interest on the physical symptoms of brown rust.
De plus, la souche TAL 17 lorsqu’elle est appliqué ( cf. modalité No. 9), elle a permis d’obtenir une note de rouille brune du même groupe statistique que la meilleure modalité ( cf. modalité No. 4) pour la notation de rouille brune. In addition, the TAL 17 strain when it is applied (cf. modality No. 9), it allowed to obtain a brown rust score of the same statistical group as the best modality (cf. modality No. 4) for the brown rust notation.
Finalement, l’ensemble de ces essais a montré une efficacité statistique contre la rouille brune en microparcelle de la souche de l’invention TAL-17 par rapport à une autre souche de T. atroviride avec un traitement en Tl et un traitement en T2 complété avec une demi-dose de Librax®.
PCT Finally, all of these tests showed statistical efficacy against brown rust in microplots of the strain of the invention TAL-17 compared to another strain of T. atroviride with a T1 treatment and a T2 treatment completed. with half a dose of Librax ® . PCT
(original sous forme électronique) (original in electronic form)
(Cette feuille ne fait pas partie de la demande internationale ni ne compte comme une feuille de celle-ci) (This sheet does not form part of or count as a sheet of the international application)
RÉSERVÉ AU BUREAU INTERNATIONAL FOR INTERNATIONAL OFFICE
Claims
1. Souche isolée de Trichoderma atroviride dont le gène ech42 possède une identité de séquence d’au moins 98% avec la séquence SEQ ID NO : 1 du gène ech42 de la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333 et/ou un de ses mutants, 1. Isolated strain of Trichoderma atroviride, the ech42 gene of which has a sequence identity of at least 98% with the sequence SEQ ID NO: 1 of the ech42 gene of the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333 and / or one of its mutants,
en particulier ladite souche isolée de Trichoderma atroviride est la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333 et/ou un de ses mutants, et in particular said isolated strain of Trichoderma atroviride is the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333 and / or one of its mutants, and
de préférence, ladite souche isolée de Trichoderma atroviride est la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333. preferably, said isolated strain of Trichoderma atroviride is the TAL-17 strain deposited on July 3, 2018 at the CNCM under the number CNCM 1-5333.
2. Souche isolée de Trichoderma atroviride selon la revendication 1, sous forme de spores, produites par fermentation en milieu solide ou liquide, lesdites spores pouvant être sous forme purifiée ou dans la matrice de production, ladite matrice de production étant solide ou liquide. 2. Isolated strain of Trichoderma atroviride according to claim 1, in the form of spores, produced by fermentation in a solid or liquid medium, said spores possibly being in purified form or in the production matrix, said production matrix being solid or liquid.
3. Souche isolée de Trichoderma atroviride selon la revendication 1 ou 2, en tant qu’ agent de lutte biologique, 3. Isolated strain of Trichoderma atroviride according to claim 1 or 2, as a biological control agent,
en particulier en tant qu’ agent antifongique de végétaux dirigé contre un champignon pathogène pour végétaux, ledit champignon pathogène étant notamment choisi parmi Septoria tritici ou Gibberella zeae (= Fusarium graminearum) ou Puccinia recondita ou Puccinia striiformis. in particular as an antifungal agent for plants directed against a fungus pathogenic for plants, said pathogenic fungus being chosen in particular from Septoria tritici or Gibberella zeae (= Fusarium graminearum) or Puccinia recondita or Puccinia striiformis.
4. Composition phytosanitaire comprenant : 4. Phytosanitary composition comprising:
la souche isolée de Trichoderma atroviride selon l’une quelconque des revendications 1 à 3 en tant que principe actif ; ou the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 as an active principle; or
les métabolites émis lors de la production la souche isolée de Trichoderma atroviride selon l’une quelconque des revendications 1 à 3 en tant que principe actif ; ou la souche isolée de Trichoderma atroviride selon l’une quelconque des revendications 1 à 3 et ses métabolites émis lors de sa production en tant que principe actif ; ou
la souche isolée de Trichoderma atroviride selon l’une quelconque des revendications 1 à 3 en association avec au moins un autre agent de lutte biologique en tant que principe actif ; ou the metabolites emitted during the production of the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 as active principle; or the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 and its metabolites emitted during its production as an active principle; or the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 in combination with at least one other biological control agent as active principle; or
la souche isolée de Trichoderma atroviride selon l’une quelconque des revendications 1 à 3 et ses métabolites émis lors de la production de la souche en association avec au moins un autre agent de lutte biologique en tant que principe actif. the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 and its metabolites emitted during the production of the strain in association with at least one other biological control agent as active principle.
5. Composition phytosanitaire selon la revendication 4, comprenant une quantité efficace de 104 à 1012 spores/g, plus particulièrement de 107 à 109 spores/g, 5. Phytosanitary composition according to claim 4, comprising an effective amount of 10 4 to 10 12 spores / g, more particularly 10 7 to 10 9 spores / g,
ladite composition phytosanitaire étant éventuellement obtenue après une étape de préparation la rendant prête à l’épandage. said phytosanitary composition optionally being obtained after a preparation step making it ready for spreading.
6. Utilisation de la souche isolée de Trichoderma atroviride selon l’une quelconque des revendications 1 à 3 ou de la composition phytosanitaire selon la revendication 4 ou 5 dans la prévention et/ou le traitement de maladies fongiques de végétaux, notamment de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge ; et/ou 6. Use of the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 or of the phytosanitary composition according to claim 4 or 5 in the prevention and / or treatment of fungal diseases of plants, in particular of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley; and or
pour favoriser la germination d’une semence de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge. to promote the germination of a seed of plants belonging to the Poaceae family, in particular wheat and / or corn and / or barley.
7. Composition phytosanitaire d’enrobage comprenant la souche isolée de Trichoderma atroviride selon l’une quelconque des revendications 1 à 3 et éventuellement au moins un agent de fixation. 7. A phytosanitary coating composition comprising the isolated strain of Trichoderma atroviride according to any one of claims 1 to 3 and optionally at least one fixing agent.
8. Semence enrobée comprenant une graine de végétal, ladite graine de végétal étant enrobée par la composition phytosanitaire d’enrobage telle que définie selon la revendication 7 et ledit végétal appartenant notamment à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge.
8. Coated seed comprising a plant seed, said plant seed being coated with the phytosanitary coating composition as defined in claim 7 and said plant belonging in particular to the Poaceae family, in particular wheat and / or corn. and / or barley.
9. Procédé de protection et/ou de traitement d‘un végétal contre une maladie provoquée par un champignon pathogène pour végétaux comprenant l’application de la composition selon la revendication 4 ou 5 sur au moins une partie dudit végétal ou du sol à proximité dudit végétal, 9. A method of protecting and / or treating a plant against a disease caused by a pathogenic fungus for plants comprising the application of the composition according to claim 4 or 5 on at least part of said plant or of the soil in the vicinity of said. vegetal,
en particulier ladite partie dudit végétal est une feuille, un fruit, une graine, et in particular said part of said plant is a leaf, a fruit, a seed, and
en particulier ledit végétal appartient à la famille des Poaceae , notamment le blé et/ou le maïs et/ou l’orge. in particular said plant belongs to the Poaceae family, in particular wheat and / or corn and / or barley.
10. Procédé selon la revendication 9, dans lequel ladite composition est épandue 10. The method of claim 9, wherein said composition is applied
à raison de 10 à 500 L/ha, en particulier de 50 à 250 L/ha, notamment pour la pulvérisation aérienne ; ou at a rate of 10 to 500 L / ha, in particular from 50 to 250 L / ha, in particular for aerial spraying; or
à raison d’une quantité efficace de 1010 à 1014 spores/ha, en particulier de 1010 à 1012 spores/ha, notamment pour les épandages aériens de type pulvérisation foliaire. at an effective amount of 10 10 to 10 14 spores / ha, in particular 10 10 to 10 12 spores / ha, in particular for aerial spraying of the foliar spray type.
11. Procédé selon la revendication 9 ou 10, dans lequel ledit champignon pathogène est Septoria tritici ou Gibberella zeae (= Fusarium graminearum) ou Puccinia recondita ou Puccinia striiformis. 11. The method of claim 9 or 10, wherein said pathogenic fungus is Septoria tritici or Gibberella zeae (= Fusarium graminearum) or Puccinia recondita or Puccinia striiformis.
12. Procédé selon l'une quelconque des revendications 9 à 11, dans lequel 12. A method according to any one of claims 9 to 11, wherein
la protection dudit végétal comprend une étape d’enrobage de la semence avec ladite composition phytosanitaire ; et/ou the protection of said plant comprises a step of coating the seed with said phytosanitary composition; and or
la protection dudit végétal comprend la pulvérisation de ladite composition au moment du semis ou à la germination dudit végétal ; et/ou the protection of said plant comprises spraying said composition at the time of sowing or at the germination of said plant; and or
la protection dudit végétal comprend soit une application préventive au niveau du sol avant le semis de ladite composition phytosanitaire avec l’apport d’amendement organique, soit une application préventive au niveau du sol avant le semis de ladite composition phytosanitaire sur la culture précédente ; et/ou the protection of said plant comprises either a preventive application at soil level before sowing said phytosanitary composition with the addition of organic amendment, or a preventive application at soil level before sowing said phytosanitary composition on the previous crop; and or
le traitement dudit végétal comprend la pulvérisation de ladite composition aux cours de différents stades phénologiques de la plante en prévention à un risque d’infection dudit champignon pathogène de l’ensemble ou une partie de la plante.
the treatment of said plant comprises spraying said composition during different phenological stages of the plant to prevent a risk of infection of said pathogenic fungus of the whole or part of the plant.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP20732637.2A EP3987068A1 (en) | 2019-06-18 | 2020-06-18 | Novel biocontrol agent and use thereof for controlling fungal diseases of plants |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FRFR1906554 | 2019-06-18 | ||
FR1906554A FR3097557A1 (en) | 2019-06-18 | 2019-06-18 | NEW BIOCONTROL AGENT AND ITS USE FOR THE CONTROL OF FUNGAL DISEASES OF PLANTS |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2020254533A1 true WO2020254533A1 (en) | 2020-12-24 |
Family
ID=68806854
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2020/067034 WO2020254533A1 (en) | 2019-06-18 | 2020-06-18 | Novel biocontrol agent and use thereof for controlling fungal diseases of plants |
Country Status (3)
Country | Link |
---|---|
EP (1) | EP3987068A1 (en) |
FR (1) | FR3097557A1 (en) |
WO (1) | WO2020254533A1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2021255267A1 (en) * | 2020-06-18 | 2021-12-23 | Agro Industrie Recherches Et Developpements A.R.D. | Novel biocontrol agent and use thereof for controlling fungal diseases of plants |
WO2022129478A1 (en) * | 2020-12-18 | 2022-06-23 | Agro Industrie Recherches Et Developpements (A.R.D.) | Novel biocontrol agent and use thereof for controlling fungal diseases of plants |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
FR3119300B1 (en) * | 2021-01-30 | 2023-11-03 | Elephant Vert France | process for combating diseases associated with ascomycete fungi and associated phytosanitary composition |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2009116106A1 (en) * | 2008-03-21 | 2009-09-24 | Trentino Sviluppo S.P.A. | Trichoderma atroviride sc1 for biocontrol of fungal diseases in plants |
CN103484384A (en) * | 2013-10-08 | 2014-01-01 | 天津市植物保护研究所 | Trichoderma atroviride preparation for preventing and controlling vegetable fungal diseases and preparation method of trichoderma atroviride preparation thereof |
-
2019
- 2019-06-18 FR FR1906554A patent/FR3097557A1/en active Pending
-
2020
- 2020-06-18 EP EP20732637.2A patent/EP3987068A1/en active Pending
- 2020-06-18 WO PCT/EP2020/067034 patent/WO2020254533A1/en unknown
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2009116106A1 (en) * | 2008-03-21 | 2009-09-24 | Trentino Sviluppo S.P.A. | Trichoderma atroviride sc1 for biocontrol of fungal diseases in plants |
CN103484384A (en) * | 2013-10-08 | 2014-01-01 | 天津市植物保护研究所 | Trichoderma atroviride preparation for preventing and controlling vegetable fungal diseases and preparation method of trichoderma atroviride preparation thereof |
Non-Patent Citations (13)
Title |
---|
ALI, S.GLADIEUX, P.LECONTE, M.GAUTIER, A.JUSTESEN, A. F.HOVMOLLER, M. S.ENJALBERT, J.DE VALLAVIEILLE-POPE, C.: "Origin, Migration Routes and Worldwide Population Genetic Structure of the Wheat Yellow Rust Pathogen Puccinia striiformis fsp. tritici", PLOS PATHOGENS, vol. 10, no. 1, 2014, pages e1003903 |
BEARCHELL, S. J.FRAAIJE, B. A.SHAW, M. W.FITT, B. D. L.: "Wheat archive links long-term fungal pathogen population dynamics to air pollution", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 102, no. 15, 2005, pages 5438 - 42 |
DE VALLAVIEILLE-POPE, C.ALI, S.LECONTE, M., SPÉCIAL REPORT VIRULENCE DYNAMICS AND RÉGIONAL STRUCTURING OF PUCCINIA STRIIFORMIS F SP. TRITICI IN FRANCE BETWEEN 1984 AND 2009, 2012 |
FELLER ET AL.: "Phànologische entwicklungsstadien von gemüsepflanzen: II. Fruchtgemüse und hülsenfrüchte", NACHRICHTENBL. DEUT. PFLANZENSCHUTZD, 1995 |
HARDOIM, P. R.VAN OVERBEEK, L. S.BERG, G.PIRTTILÀ, A. M.COMPANT, S.CAMPISANO, A.SESSITSCH, A.: "The Hidden World within Plants: Ecological and Evolutionary Considérations for Defining Functioning of Microbial Endophytes", MICROBIOLOGY ANDMOLECULAR BIOLOGY REVIEWS, vol. 79, no. 3, 2015, pages 293 - 320 |
HIBAR, K.DAAMI-REMADI, M.KHIAREDDINE, H.MAHJOUB, M. EL, EFFET INHIBITEUR IN VITRO ET IN VIVO DU TRICHODERMA HARZIANUM SUR FUSARIUM OXYSPORUM F. SP. RADICIS-LYCOPERSICI., 2005 |
LONGA CLAUDIA MARIA OLIVEIRA ET AL: "Ecophysiological requirements and survival of a Trichoderma atroviride isolate with biocontrol potential", JOURNAL OF BASIC MICROBIOLOGY, WILEY - V C H VERLAG GMBH & CO. KGAA, BERLIN, DE, vol. 48, no. 4, 1 August 2008 (2008-08-01), pages 269 - 277, XP002506410, ISSN: 0233-111X, DOI: 10.1002/JOBM.200700396 * |
PARRY, D. W.JENKINSON, P.MCLEOD, L.: "Fusarium ear blight (scab) in small grain cereals, a review", PLANT PATHOLOGY, vol. 44, no. 2, 1995, pages 207 - 238 |
ROSSI, V.RACCA, P.GIOSUE', S.PANCALDI, D.ALBERTI, I.: "A simulation model for the development of brown rust épidémies in winter wheat", EUROPEAN JOURNAL OF PLANT PATHOLOGY, vol. 103, no. 5, 1997, pages 453 - 465 |
SAVAZZINI F ET AL: "Real-time PCR for detection and quantification of the biocontrol agent Trichoderma atroviride strain SC1 in soil", JOURNAL OF MICROBIOLOGICAL METHODS, ELSEVIER, AMSTERDAM, NL, vol. 73, no. 2, 1 May 2008 (2008-05-01), pages 185 - 194, XP022620396, ISSN: 0167-7012, [retrieved on 20080328], DOI: 10.1016/J.MIMET.2008.02.004 * |
STÇPNIEWSKA, Z.KUZNIAR, A.: "Endophytic microorganisms--promising applications in bioremediation of greenhouse gases", APPLIEDMICROBIOLOGY AND BIOTEEHNOLOGY, vol. 97, no. 22, 2013, pages 9589 - 96, XP035328575, DOI: 10.1007/s00253-013-5235-9 |
STEYAERT J.RIDGWAY H.ELAD Y.STEWART A.: "Genetic basis of mycoparasitism: A mechanism of biological control by species of Trichoderma", NEW ZEALAND JOURNAL OF CROP AND HORTICULTURAL SCIENCE, vol. 31, no. 4, 2003, pages 281 - 291 |
VERÃ3NICA FABIANA CONSOLO ET AL: "Characterization of novelspp. isolates as a search for effective biocontrollers of fungal diseases of economically important crops in Argentina", WORLD JOURNAL OF MICROBIOLOGY AND BIOTECHNOLOGY, KLUWER ACADEMIC PUBLISHERS, DO, vol. 28, no. 4, 17 November 2011 (2011-11-17), pages 1389 - 1398, XP035037877, ISSN: 1573-0972, DOI: 10.1007/S11274-011-0938-5 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2021255267A1 (en) * | 2020-06-18 | 2021-12-23 | Agro Industrie Recherches Et Developpements A.R.D. | Novel biocontrol agent and use thereof for controlling fungal diseases of plants |
FR3111521A1 (en) * | 2020-06-18 | 2021-12-24 | Agro Industrie Recherches Et Developpements A.R.D. | NEW BIOCONTROL AGENT AND ITS USE FOR THE CONTROL OF FUNGAL DISEASES OF PLANTS |
WO2022129478A1 (en) * | 2020-12-18 | 2022-06-23 | Agro Industrie Recherches Et Developpements (A.R.D.) | Novel biocontrol agent and use thereof for controlling fungal diseases of plants |
FR3117733A1 (en) * | 2020-12-18 | 2022-06-24 | Agro Indusrie Recherche Et Developpements (A.R.D.) | NEW BIOCONTROL AGENT AND ITS USE FOR THE FIGHT AGAINST FUNGAL DISEASES OF PLANTS |
Also Published As
Publication number | Publication date |
---|---|
EP3987068A1 (en) | 2022-04-27 |
FR3097557A1 (en) | 2020-12-25 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US11771090B2 (en) | Fungal endophytes for improved crop yields and protection from pests | |
Brownbridge et al. | Persistence of Beauveria bassiana (Ascomycota: Hypocreales) as an endophyte following inoculation of radiata pine seed and seedlings | |
Talgø et al. | Sydowia polyspora associated with current season needle necrosis (CSNN) on true fir (Abies spp.) | |
CN111432631A (en) | Endophytic plant composition and method for improving plant traits | |
AU2017366699A1 (en) | Modulated nutritional quality traits in seeds | |
EP3987068A1 (en) | Novel biocontrol agent and use thereof for controlling fungal diseases of plants | |
Reddy et al. | Treatment of millet crop plant (Sorghum bicolor) with the entomopathogenic fungus (Beauveria bassiana) to combat infestation by the stem borer, Chilo partellus Swinhoe (Lepidoptera: Pyralidae) | |
EP1990404B1 (en) | Trichoderma atroviride strain, method of isolating such a strain, method of obtaining a product based on such a strain and use of such a strain | |
WO2019103588A1 (en) | Production, formulation and recycling of a biofungicidal and biostimulant product based on trichoderma asperellum | |
JP2019165676A (en) | Plant disease control agent and method of controlling plant disease | |
US10765084B2 (en) | Method for improving the mean dry shoot weight, mean dry grain weight, and suppressing seed-borne infection in a cereal crop | |
WO2022129478A1 (en) | Novel biocontrol agent and use thereof for controlling fungal diseases of plants | |
WO2020016444A1 (en) | Method for biocontrol of fusarium head blight in cereals | |
FR3111521A1 (en) | NEW BIOCONTROL AGENT AND ITS USE FOR THE CONTROL OF FUNGAL DISEASES OF PLANTS | |
EP4075983A1 (en) | Bio-control method for combating the propagation of phytopathogenic fungi and oomycetes | |
Akhmedova et al. | Importance of fungus in feeding termites with sunflower plants | |
CA3233938A1 (en) | Agricultural input and associated methods for protecting and for stimulating the growth of a plant |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 20732637 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 2020732637 Country of ref document: EP Effective date: 20220118 |