EP4075983A1

EP4075983A1 - Bio-control method for combating the propagation of phytopathogenic fungi and oomycetes

Info

Publication number: EP4075983A1
Application number: EP20851322.6A
Authority: EP
Inventors: Bruno LE CAM; Valérie CAFFIER
Original assignee: Institut National Superieur Des Sciences Agronomiques Agroalimentaires Horticoles Et Du Paysage; Universite dAngers; Institut National de Recherche pour lAgriculture lAlimentation et lEnvironnement
Current assignee: Institut National Superieur Des Sciences Agronomiques Agroalimentaires Horticoles Et Du Paysage; Universite dAngers; Institut National de Recherche pour lAgriculture lAlimentation et lEnvironnement
Priority date: 2019-12-20
Filing date: 2020-12-21
Publication date: 2022-10-26
Also published as: FR3104905B1; US20230217931A1; FR3104905A1; WO2021123698A1

Abstract

The present invention relates to a bio-control method for combating the propagation of phytopathogenic fungi or oomycetes on plants, comprising the application, to the soil and/or to the vegetative apparatus of plants that are infected or are capable of being infected by pathogenic endemic fungal or oomycete strains referred to as type A, of a composition comprising a mixture of at least two strains, referred to as type B, of the same species, said type B strains being non-pathogenic for said plant, sexually compatible with said pathogenic type A strains and characterized in that they exhibit: a) sexual reproduction, b) a sexual phase initiated in non-parasitic mode, c) reproduction according to a heterothallic mode, and d) the existence of special forms or divergent populations within the species, capable of producing, by crossing with the type A strains, descendants that are non-pathogenic or even sterile on said plant of interest, and characterized in that the mixture of non-pathogenic type B strains comprises strains of opposite mating-type signs.

Description

Bio-control method to fight against the spread of phytopathogenic fungi and oomycetes

FIELD OF THE INVENTION

The present invention relates to a bio-control method for controlling the propagation of phytopathogenic fungi or oomycetes on plants.

STATE OF THE ART

Phytopathogenic fungi are the main cause of disease in plants and are responsible for about 70% of diseases in crop plants. The economic losses due to fungal diseases in world agriculture and the annual cost of fungicide treatments are therefore very large.

The use of fungicides or other alternatives by farmers to combat the proliferation of phytopathogenic fungi and / or oomycetes on crops is known from the state of the art.

In the case of apple scab, due to the fungus Venturia inaequalis, which represents the main disease on apple trees in the world, an average of 25 fungicide treatments are applied per year in France to fight against this disease, in orchards conducted in organic farming. as well as conventional, which represents a cost of around 30 million euros for the purchase of fungicides for French arborists. The most effective alternative to pesticides is currently the use of resistant varieties coupled with cultivation methods (prophylaxis, varietal mixing) (Didelot et al., 2016). However, the availability of varieties with lasting resistance (cumulating several resistance genes) is currently lacking on the market. Multiple bio-control strategies (antagonistic fungi, plant defense stimulators, biocides of natural origin, etc.) have been tested for several years to fight against scab, without proven success in practice in orchards.

There therefore remains the need to develop new methods of combating the spread of phytopathogenic fungi or oomycetes responsible for diseases on agricultural and tree crops, which are lastingly effective, specific to the phytopathogenic fungus or oomycete to be eradicated, non-toxic for the applicator (farmer), for the environment and the consumer (absence of residues) and reducing the number of passages of tractors in orchards.

The Applicant has precisely developed a new biocontrol method meeting these needs.

This method makes it possible to break the biological cycle of a phytopathogenic fungus or oomycete, by crossing pathogenic strains to non-pathogenic strains to produce non-pathogenic or even sterile descendants. The bio-control strategy according to the invention thus targets the sexual phase of phytopathogenic fungi or oomycetes, by forcing them to make them produce non-pathogenic descendants.

The Applicant has in fact demonstrated, in the case of the phytopathogenic fungus Venturia inaequalis, the existence of two special forms, one form which specifically infects apple trees (f. Sp pomi = POMI), and another which specifically infects pyracantha. (f. sp pyracanthae = PYR), described in particular in Le Cam et al. 2002 “Evidence of two special formae in Venturia inaequalis, responsible for apple and Pyracantha scab”, Phytopathology 92: 314-320. And she observed that crossing these strains corresponding to two special forms produced non-pathogenic descendants on the apple tree. Knowing that within the same species of fungus or phytopathogenic oomycete, several special forms or divergent populations may exist, the Applicant proposes to promote this type of crosses, between strains of two special forms - or of divergent populations, by massively introducing strains of special form or of divergent population not pathogenic for the plant, which will develop on the vegetative apparatus contaminated by resident or endemic strains of special pathogenic form, producing non-pathogenic or even sterile descendants, and consequently a collapse of the pathogen population. This bio-control method is applicable to any cultivated space, whether in fields or in gardens. According to a particular embodiment, the descendants are non-pathogenic or even sterile. This bio-control method allows farmers to greatly limit the use of fungicides, or even to completely eliminate them after several years of application. This bio-control method is advantageous in particular in that:

- this is a new method of bio-control in phytopathogenic fungi and oomycetes;

- it is species specific, because it specifically targets the phytopathogenic fungus or oomycete to be eradicated;

-it is non-toxic to humans and the environment;

- it is based on the use of endemic fungi or oomycetes; and

- it is sustainable because it does not - a priori - create selection pressure on the populations. The Applicant has also recently shown that the application of PYR strains according to the invention to the vegetative apparatus in the vegetative growth phase (eg: spring, summer) of plants infected or likely to be infected by POMI strains, made it possible to protect plants against POMI infection. We will speak of “phytoprotection”, in addition to “biocontrol”, as described below in the description. The invention illustrated by the phytopathogenic fungus V. inaequalis responsible for apple scab is not limited to this phytopathogenic fungus and can be applied to other phytopathogenic fungi or oomycetes which have sexual reproduction.

DISCLOSURE OF THE INVENTION

A first object of the invention is therefore a bio-control method for combating the propagation of phytopathogenic fungi or oomycetes on plants, comprising the application, on the soil and / or on the vegetative apparatus of infected plants. or likely to be infected with strains of endemic pathogenic fungi or oomycetes called type A, of a composition comprising a mixture of at least two strains, called type B, of the same species or of a population divergent within said species, said type B strains being non-pathogenic for said plant, sexually compatible with said pathogenic type A strains and characterized in that they exhibit: a) sexual reproduction, b) a sexual phase initiated in non-parasitic mode, c) reproduction in a heterothallic mode, and d) the existence of special forms or divergent populations within the species, capable of producing, in crossing with type A strains, non-pathogenic or even sterile ash on said plant of interest, and characterized in that the mixture of non-pathogenic type B strains comprises strains of opposite sexual signs.

According to one particular method, the type B strains are applied to the vegetative apparatus in the vegetative growth phase (eg spring, summer) of plants infected or liable to be infected by strains of endemic fungi or oomycetes, called pathogens. type A, then on the vegetative apparatus in the senescence phase (eg: autumn) of said plants, in particular on senescent leaves or on dead leaves that have fallen to the ground, of said plants infected or likely to be infected by strains of endemic pathogenic fungi or oomycetes known as type A.

The invention also relates to a bio-control method, characterized in that the two strains of Venturia inaequalis type B of the specific special form of pyracantha (f. Sp pyracantha or PYR) and of opposite sexual signs, are selected according to an in vitro method comprising: a step of extracting DNA from the Venturia inaequalis strains; a step of amplification by PCR or even qPCR of specific nucleic sequences of the genome of the PYR strains, in particular of nucleic sequences comprising an identical nucleic sequence or having at least 90% identity with one of the sequences SEQ ID NO: 4 to SEQ ID NO: 8, preferably the sequence SEQ ID NO: 5, by means of specific nucleic primers, in particular a direct primer of identical nucleic sequence or having at least 90% identity with the sequence SEQ ID NO : 11 or SEQ ID NO: 19 (direct primer sp Pyr-F) and a reverse primer of identical nucleic sequence or having at least 90% identity with the sequence SEQ ID NO: 12 or SEQ ID NO: 20 ( reverse primer sp Pyr-R); a step of amplification by PCR or even qPCR of specific sequences of the sexual locus, comprising the use of a pair of mat-alpha primers consisting of the sequences comprising an identical nucleic sequence or having at least 90% identity with the sequence SEQ ID NO: 13 (forward primer mat-alpha-F) and a nucleic acid sequence identical or having at least 90% identity with the sequence SEQ ID NO: 14 (reverse primer mat-alpha-R) and d 'a pair of mat-HMG primers consisting of the sequences comprising an identical nucleic sequence or having at least 90% identity with the sequence SEQ ID NO: 15 (direct primer mat-HMG-F) and an identical nucleic sequence or exhibiting at least 90% identity with the sequence SEQ ID NO: 16 (reverse primer mat-HMG-R), and optionally a step of detecting said amplified sequences by means of probes, preferably labeled with fluorophores.

The invention also relates to a bio-control composition comprising a mixture of at least two type B strains of opposite sexual signs of a phytopathogenic fungus or oomycete non-pathogenic for the plant to be treated and sexually compatible in crossing with type A strains of the same species or related but pathogenic and endemic to the plant to be treated. In particular, said phytopathogenic fungus is chosen from the group consisting of: Venturia inaequalis responsible for apple scab, Zymoseptoria tritici responsible for wheat septoria, Blumeria graminis responsible for wheat powdery mildew, Mycosphaerella fijiensis responsible for banana Sigatoka , and Leptosphaeria maculans responsible for neck necrosis of rapeseed; and said oomycete is chosen from the group consisting of: Plasmopara viticola responsible for downy mildew of grapevine, and Phytophthora infestons responsible for late blight of potato and tomato, in particular for use in the biocontrol method according to the invention . According to a particular and preferred embodiment, said composition comprises at least a mixture of the V.pyra 1669 strain deposited at the CNCM under the number CNCM I-5456 and of the V. pyra 2507 strain deposited at the CNCM under the number CNCM. I-5457, or a mixture of the V. pyra 1381 strain deposited at the CNCM under the number CNCM I-5627 and of the V. pyra 1387 strain deposited at the CNCM under the number CNCM I-5629, or a mixture of the V. pyra 1381 strain and of the V. pyra 2299 strain deposited at the CNCM under the number CNCM I -5630, or a mixture of the V. pyra 1386 strain deposited at the CNCM under the number CNCM I-5628 and of the V. pyra 1387 strain deposited at the CNCM under the number CNCM I-5629, or a mixture of the V. pyra 1386 strain and of the V. pyra 2299 strain deposited at the CNCM under the CNCM number I - 5630.

Another subject of the invention is a phytoprotection method for combating the infection of plants by phytopathogenic fungi or oomycetes, comprising the application, to the vegetative apparatus in the vegetative growth phase of plants infected or liable to be. infected with so-called type A pathogenic endemic fungi or oomycetes strains, of a composition comprising one or more type B strains, or type A offspring by B, said type A and type B strains being such than defined previously.

Another subject of the invention is a method for selecting strains of phytopathogenic fungi or type B oomycetes which are not pathogenic for the plant to be treated, in particular strains of Venturia inaequalis, capable of being used in a method. of bio-control according to the invention to fight against the propagation of pathogenic strains on a plant of interest or a bio-control composition according to the invention, comprising the following steps:

(1) evaluation of their intrinsic ability to saprophytically colonize apple leaves, in particular using the PCR technique or even quantitative PCR using primers specific for PYR strains,

(2) evaluation of their ability to produce pseudothecia in the presence of type A strains, for example by performing crosses in a Petri dish on a support of autoclaved dead leaves, in particular according to the protocol described by Le Cam et al, 2002. " Evidence of two special formae in Venturia inaequalis, responsible for apple and Pyracantha scab ”, Phytopathology 92: 314-320.

According to another aspect, the invention also relates to an in vitro method for identifying and selecting Venturia inaequalis type B strains of special form specific for pyracantha (f. Sp pyracantha or PYR), which can be used in a bio-control method according to the invention or of a bio-control composition according to the invention for combating the propagation of pathogenic strains of V inaequalis, in particular of type A strains of special form f. sp pomi or POMI, comprising: a step of extracting the DNA of the Venturia inaequalis strains; a step of amplification by PCR or even by qPCR of specific nucleic sequences of the genome of the PYR strains, in particular of nucleic sequences comprising an identical nucleic sequence or exhibiting at least 90%, or even at least 95% identity with one of the sequences SEQ ID NO: 4 to SEQ ID NO: 8, preferably the sequence SEQ ID NO: 5, by means of specific nucleic acid primers, in particular of a direct primer of identical nucleic sequence or having at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 11 and of a reverse primer of identical nucleic acid sequence or exhibiting at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 12; and optionally a step of detecting said amplified sequences by means of probes, preferably labeled with fluorophores.

The invention also relates to a kit for the detection of Venturia inaequalis type A strains of special form specific to apple (f. Sp pomi or POMI) for use of a targeted bio-control method according to the invention or application of. a bio-control composition according to the invention, comprising a forward primer and a reverse primer comprising respectively 12 to 30 nucleotides, preferably 15 to 25 nucleotides, and capable of amplifying by PCR a specific nucleic sequence of the POMI genome, in in particular, a nucleic acid sequence identical or exhibiting at least 90%, or even at least 95% identity with one of the sequences SEQ ID NO: 1 to SEQ ID NO: 3, preferably a direct primer of identical nucleic sequence or exhibiting at less 90%, or even at least 95% identity with the sequence SEQ ID NO: 9 or SEQ ID NO: 17 and a reverse primer of identical nucleic acid sequence or having at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 10 or SEQ ID NO : 18.

According to a particular embodiment, the present invention relates to a kit for the in vitro detection of PYR strains of opposite sexual signs and of POMI strains, comprising nucleic acid sequences primers for amplification of specific nucleic acid sequences of PYR and respectively of POMI comprising: a) A pair of primer nucleic sequences comprising an identical sequence or exhibiting at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 9 or SEQ ID NO: 17 (direct primer), and a sequence identical or exhibiting at less 90%, or even at least 95% identity with the sequence SEQ ID NO: 10 or SEQ ID NO: 18 (reverse primer), to amplify by PCR or even by qPCR a specific nucleic acid sequence of POMI, and optionally in addition to specific probes, preferably labeled with fluorophores to detect said amplified sequences, b) optionally, in addition, a pair of primer nucleic acid sequences comprising an identical sequence or exhibiting at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 11 or SEQ ID NO: 19 (direct primer) a sequence identical or having at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 12 or SEQ ID NO: 20 (reverse primer), to amplify by PCR or even qPCR a specific nucleic acid sequence of PYR, and optionally in addition specific probes, preferably labeled with fluorophores to detect said amplified sequences, and c) optionally in addition two pairs of primers respectively mat-a consisting of sequences comprising an identical nucleic sequence or having at least 90% of identity with the sequence SEQ ID NO: 13 (forward primer) and a nucleic acid sequence identical or exhibiting at least 90%, or even at least 95% identity with the sequence the sequence SEQ ID NO: 14 (reverse primer) and mat- HMG made up by sequences comprising an identical nucleic sequence or exhibiting at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 15 (direct primer) and a nucleic acid sequence identical or exhibiting at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 16 (reverse primer), to amplify specific sequences of the sexual locus and select the PYR strains of opposite sexual signs.

DEFINITIONS

By 'bio-control' is meant a set of crop protection methods based on the use of living organisms (eg macro- or micro-organisms) or natural substances (eg pheromones, natural substances of mineral origin , plant or animal). In the context of the present invention, use is made of non-pathogenic strains of fungi or oomycetes which aim to interrupt the cycle of the fungus by forcing it to produce non-pathogenic or even sterile descendants. We can speak, for example, of a bio-control method by sexual diversion during the senescence phase of the vegetative system of plants.

By "phyto-protection" is meant according to the invention a method of biological control of crop protection against infection by pathogenic fungi or oomycetes using mechanisms such as stimulation of the plant's defenses, antagonism, exclusion by occupation of the ecological niche, etc. In particular, the application of non-pathogenic type B strains according to the invention at the time of contamination during the vegetative growth phase of the plant makes it possible to strengthen the protection of the plant. plant against infection by pathogenic strains of type A. The term “vegetative apparatus” is understood to mean in particular the leaves, stems and / or fruits. According to a particular mode of the invention, the composition of the invention is applied to the sheets. According to a preferred embodiment, the composition of the invention is applied to the leaves in the vegetative growth phase in spring and in summer for a phytoprotective effect and to senescent leaves in the fall for a bio-control effect.

By "phytopathogenic fungi" is meant species of parasitic fungi which cause fungal diseases in plants. These fungi belong to the different groups of the eumycocetes or “true fungi” kingdom: ascomycetes, basidiomycetes, chytridiomycetes, zygomycetes and deuteromycetes (imperfect fungi). Phytopathogenic fungi are capable of infecting any tissue at any stage of plant growth, following a complex biological cycle which may include stages of sexual or asexual reproduction. The invention relates in particular to phytopathogenic fungi which reproduce sexually or have the capacity to reproduce sexually.

We can cite in particular Venturia inaequalis responsible for apple scab, Fusicladium effusum responsible for pecan scab, Venturia pirina responsible for pear scab, Zymoseptoria tritici responsible for septoria in wheat, Blumeria graminis responsible for oidium in wheat , Mycosphaerella fijiensis responsible for Sigatoka disease of banana, and Leptosphaeria maculans responsible for neck necrosis of rapeseed.

By "phytopathogenic oomycetes" is meant parasitic filamentous eukaryotic organisms which cause fungal diseases in plants.

Mention may in particular be made of Plasmopara viticola responsible for downy mildew in grapevine, and Phytophthora infestons responsible for downy mildew in potatoes and tomatoes. By "special forms" or "divergent populations" is meant according to the invention the existence, within the same species of fungus or oomycete, of divergent forms or populations which are specifically pathogenic of a host plant. In the case of Venturia inaequalis, there is a form that specifically infects apple trees (f. Sp pomi = POMI), and another that specifically infects pyracantha (f. Sp pyracanthae = PYR). We will speak of a strain of special form POMI pathogenic for the apple tree (strain 'of type A' or pathogenic strain according to the invention) and of a strain of special form PYR which is not pathogenic for the apple tree (strain 'of type B' or non-pathogenic strain. according to the invention).

By 'sexual reproduction' is meant that fungi or oomycetes reproduce sexually or have an ability to reproduce sexually when environmental conditions are met. By “sexual phase initiated in saprotrophic (or saprophytic) or non-parasitic mode” is meant that the fungi or oomycetes are capable of developing on plant tissues in an advanced state of senescence or even death, this phase is therefore not parasitic.

By "reproduction according to a heterothallic mode" is meant according to the invention a sexual reproduction which can only take place between strains of fungi or oomycetes carrying a sexual sign opposite the locus of the "mating type". These strains of the opposite sex sign are said to be 'compatible'.

By 'mixture of strains of fungi or of non-pathogenic oomycetes' ('type B strains' or non-pathogenic strains according to the invention) is meant a mixture of type B strains, compatible in crossing ('sexually compatible') with strains of fungi or oomycetes of the same species but pathogens resident on said plants ('type A strains'). The mixing of the different strains makes it possible to increase the chances of obtaining fertile crosses (production of zygotes, in particular of pseudothecia in the case of V. inaequalis) with the strains of pathogenic fungi or oomycetes resident on said plants and therefore the obtaining descending strains that are not pathogenic or even non-fertile. The mixture can include two or more different strains. According to a particular and preferred embodiment, the mixture comprises strains of non-pathogenic fungi or oomycetes of the same species or of divergent, sexually compatible populations, of opposite sexual signs.

By "divergent populations" within a species, we mean in particular populations which have evolved sufficiently separately to have developed intrinsic biological characteristics, in particular having a different host range. Thus two divergent populations can specialize on different hosts.

According to the invention, we will also speak of an inoculum of strains of non-pathogenic fungi or oomycetes, used in agriculture for inoculation of the vegetative apparatus of the plants to be treated or of culture substrates (soils and / or culture media plants to be treated).

By 'cross compatible' or 'sexually compatible' is meant the ability of two strains to cross and produce a zygote (a pseudothecium in the case of V. inaequalis).

By “opposite sexual signs” is meant in particular that the mixture comprises “mat HMG” and “mat Alpha Box” strains respectively. The mat locus is the sex identity locus in fungi that controls the gender identity of cells and their development. Mat loci encode Mat-HMG transcription factors (for 'High mobility group box ') or Mat-a (for' alpha box '), which coordinate the expression of genes specific to the sexual trait. In heterothallic fungi, the mat locus encodes one of two non-allelic (idiomorphic) sequences which occupy the same genetic position on homologous chromosomes of two sexually compatible strains, mat-HMG and mat-a (mat-alpha). Fertilization occurs exclusively between mat-HMG and mat-a strains.

By "resident pathogenic fungal or oomycete strains" is meant endemic strains naturally present on infected plants ("type A strains" or pathogenic strains according to the invention).

DESCRIPTION OF FIGURES

Figure 1: Sensitivity of plants of the variety of pyracantha 'Kazan', known for its susceptibility to scab, inoculated by each of the 38 descendants of the 1669 (PYR) x EUB04 (POMI) cross in a test conducted in a climate-controlled cell over a period of time 27 days. The disease scoring was performed at 15, 20, 23 and 27 days after inoculation of the offspring. Each time corresponds to the rating average of the three leaves of the most sensitive plants. The parental strains used as a control are placed at each end of the figure.

Other characteristics, aims and advantages of the invention will emerge from the following description, which is purely illustrative and not limiting.

DETAILED DESCRIPTION OF THE INVENTION Biocontrol method

A first object of the invention is therefore a bio-control method for combating the propagation of phytopathogenic fungi or oomycetes on plants, comprising the application, on the soil and / or on the vegetative apparatus of infected plants. or likely to be infected by strains of endemic pathogenic fungi or oomycetes called type A, of a composition comprising a mixture of at least two strains, called type B, of the same species or of divergent populations at within the species, said type B strains being non-pathogenic for said plant and sexually compatible with said pathogenic strains, and characterized in that the mixture of non-pathogenic type B strains comprises strains of opposite sexual signs.

The biocontrol method according to the invention comprises in particular the application of a composition according to the invention on the soil and / or the vegetative apparatus of the plant during the senescence phase (eg: autumn), in particular on the leaves. senescent or dead fallen to the ground. The crossing between pathogenic type A strains and non-pathogenic type B strains produces non-pathogenic or even sterile descendants on plants.

Type B strains are further characterized in that they exhibit: a) sexual reproduction, b) a sexual phase initiated in a non-parasitic mode, c) reproduction according to a heterothallic mode, and d) the existence of forms special or divergent populations within the species, capable of producing, in crossing with type A strains, non-pathogenic or even sterile descendants on said plant of interest.

According to a first embodiment, the biocontrol composition is applied to the vegetative apparatus in the senescence phase of said plants to be treated, in particular dead leaves that have fallen to the ground.

According to another embodiment, the bio-control composition is applied to the orchard soil.

According to yet another embodiment, the biocontrol composition is applied to the vegetative apparatus and the soil of said plants to be treated.

The vegetative apparatus can be the leaves, stems and / or fruits. According to a particular embodiment, the biocontrol composition is applied to the leaves in the senescence phase, in particular the dead leaves that have fallen to the ground.

In the case of Venturia inaequalis in particular, the bio-control composition is applied to the leaves in the senescence phase or even dead of the apple trees to be treated. According to a particular embodiment, said phytopathogenic fungus whose propagation is sought to be eradicated by means of the biocontrol method according to the invention is chosen from the group consisting of: Venturia inaequalis responsible for apple scab, Zymoseptoria tritici (= Mycosphaerella graminicola) responsible septoria blight of wheat, Blumeria graminis responsible for oidium in wheat, Mycosphaerella fijiensis responsible for Sigatoka disease of banana, and Leptosphaeria maculons responsible for neck necrosis of rapeseed.

According to another particular embodiment, said oomycete whose propagation is sought to be eradicated by means of the bio-control method according to the invention is chosen from the group consisting of: Plasmopara viticola responsible for downy mildew of grapevine, and Phytophthora infestons responsible for downy mildew potato and tomato.

According to a particular and preferred embodiment, said phytopathogenic fungus the propagation of which is sought to be eradicated by means of the bio-control method according to the invention is Venturia inaequalis responsible for apple scab. If we take the example of the apple tree, V. inaequalis systematically completes its biological cycle with a sexual phase in winter. Sexual reproduction begins in the fall when the fungus develops in saprotrophic (or non-parasitic) mode on senescent leaves on which the meeting between two strains of opposite sexual signs leads to the production of a zygote called pseudothecia. In spring, ascospores (spores resulting from sexual reproduction) expelled from the pseudothecia are responsible for the primary contaminations of apple trees.

The bio-control method according to the invention, applied to Venturia inaequalis, thus uses a composition applied to the vegetative apparatus of the apple tree, in particular the senescent leaves and to the dead apple leaves that have fallen to the ground, comprising a mixture of Venturia inaequalis type B strains of special form specific for pyracantha (f. sp pyracantha or PYR) non-pathogenic for apple trees and sexually compatible with Venturia inaequalis type A strains pathogenic of special form specific for apple tree (f. sp pomi or POMI) ).

The massive application of PYR strains in the fall in orchards on senescent and dead leaves would thus lead to crosses between special forms within the species which will generate non-pathogenic or even sterile descendants on the apple tree. Thus, by applying PYR strains in the fall, the following spring would cause a collapse in the size of the pathogen population (POMI).

Combination of the effects of phytoprotection (during the vegetative growth phase of the plant) and bio-control (during the senescence phase of the plant)

In addition and as indicated above, Venturia inaequalis starts its parasitic cycle in spring by the projection of ascospores responsible for the first scab spots on leaves and fruits of the apple tree, and continues with secondary contaminations initiated by conidia until autumn contaminating leaves and fruits. In practice, the periods of application of fungicides by arborists to protect apple trees are based on models whose main function is to predict the projections of ascospores which spread over several months. Secondary contaminations are also protected by the application of fungicides. The Applicant has shown, in the following illustrative examples, under controlled conditions that the prior inoculation of PYR strains after a POMI inoculation on apple trees reduced the disease on the Golden Delicious and Gala varieties. On the basis of this result, the present invention proposes to develop a new control method based on successive introductions of PYR strains or of POMIxPYR descendants in the spring when the POMI ascospores are sprayed instead of fungicides, or even also. in summer if necessary until the fruit harvest. According to a particular embodiment of the invention, it is thus possible to combine this 'phytoprotective' effect which protects the plant from subsequent infection, by applying PYR strains to the vegetative apparatus during its vegetative growth phase (in spring or even also in summer), with the 'bio-control' effect which aims to interrupt the fungus cycle by forcing it to produce non-pathogenic PYRxPOMI hybrid descendants, by massive application of PYR strains on the soil and / or the vegetative system in phase of senescence (autumn) which will cross with the infectious POMI strains of the orchard. This combination of the two treatments would lead on the one hand to the production of non-pathogenic hybrid ascospores (fall treatment) and on the other hand to a strengthening of the protection of the apple tree by successive applications of PYR strains at the time of the predicted contaminations in spring. by models.

The application of PYR strains in the fall may lead in the spring to the production of ascospores from crosses PYRxPOMI and PYRxPYR, which is also expected to protect the apple tree following their projection on young apple tree shoots. There would therefore be a double induced protection of the apple tree, both by the PYR strains applied by spraying in spring and in summer and by the projection of the PYRxPOMI and PYRxPYR ascospores generated following the application of PYR in the fall. The ascospores projected naturally in the spring would be synchronous with those of POMI projected during the rains and would therefore have the advantage of protecting at the time of infection risks.

The invention is illustrated without limitation with the PYR strains on apple trees but can be extrapolated to other non-pathogenic type B strains as defined according to the invention.

According to a particular embodiment of the invention, the bio-control composition according to the invention is applied by spreading, in particular by spraying on the vegetative apparatus of said plants and / or on the orchard ground.

The dose to be applied will depend on the plants to be treated and the phytopathogenic fungus or oomycete to be eradicated. Those skilled in the art will thus adjust the dose to be used depending on these conditions. In particular, the effective dose or concentration of strains of fungus or oomycete type B not pathogenic for the plant to be treated will generally range from 500 spores / ml to 600,000 spores / ml, in particular 5,000 to 400,000 spores / ml of composition applied to the plants to be treated.

According to a particular and preferred embodiment, the method of bio-control of the propagation of pathogenic strains of V. inaequalis responsible for apple scab, is implemented in the fall, after the apple harvest and before the leaves fall. . Thus, the PYR strains selected according to the invention as described below are inoculated in the fall on apple tree leaves sampled in an orchard. After winter incubation, the percentage of hybrid perithecia as well as the amount of disease generated by the ascospores produced are evaluated, by inoculating them on apple trees under controlled conditions. It is thus possible to optimize the methods of application of said PYR strains by varying the conditions, for example:

- On different dates depending on the key moments of leaf senescence in the fall to optimize the date of application of PYR;

- With different PYR inocula (different PYR mixtures, each mixture comprising at least one PYR mat-HMG strain and one PYR mat-a strain to optimize the nature of the inoculum to be applied;

- With PYRxPOMI descendants obtained in the laboratory which have been shown to be non-pathogenic on apple and pyracantha see Fig1, each mixture comprising at least one strain mat-HMG and one strain PYR mat-a.

- With different modes of application to optimize the application conditions (different concentrations of PYR, different formulations - presence of different types of adjuvants or not, spores encapsulated in microbeads or not).

A person skilled in the art thus selects the condition which makes it possible to obtain the greatest number of hybrid pseudothecia and the absence of disease.

The bio-control method according to the invention, illustrated in the examples described below for V. inaequalis is capable of being transposed to other fungi or other phytopathogenic oomycetes to protect other crops, provided that said phytopathogenic fungi or oomycetes satisfy the following 4 criteria: a stage of sexual reproduction, a sexual phase initiated in non-parasitic mode, reproduction in a heterothallic mode, the existence of special forms within the species - or of divergent populations sexually compatible - of a phytopathogenic fungus or oomycete, of which the crosses between type B strains which are not pathogenic for the plant to be treated and type A strains that are pathogenic and endemic to the plant to be treated, produce offspring which are not pathogenic on said plant or even sterile. Biocontrol composition and phytoprotection composition

In the description, we speak indifferently of “biocontrol composition” or “biocontrol preparation” according to the invention. The present invention thus also relates to a biocontrol composition comprising at least a mixture of type B strains of opposite sexual signs of a phytopathogenic fungus or oomycete non-pathogenic for the plant to be treated and sexually compatible in crossing with the type A strains of the same or related species but pathogenic and endemic to the plant to be treated.

Thus, said type B strains have special forms within the species or sexually compatible divergent populations, not pathogenic for the plant but compatible in crossing with type A strains of the same species but pathogenic for the plant, allowing the production of descendants which are not pathogenic for said plant, or even sterile.

According to a particular embodiment, said bio-control composition comprises at least a mixture of strains of Venturia inaequalis type B of the special (specific) form of pyracantha (f. Sp pyracantha or PYR) non-pathogenic for apple trees and sexually compatible with strains of Venturia inaequalis type A pathogenic of the specific special form of apple tree (f. sp pomi or POMI).

Examples of such PYR strains which can be used in the biocontrol method or the biocontrol composition according to the invention are described below.

Preferably, said composition comprises a mixture of the V.pyra 1669 strain deposited at the CNCM under the number CNCM I-5456 and of the V. pyra 2507 strain deposited at the CNCM under the number CNCM I-5457.

These two strains of filamentous fungi were deposited, under the terms of the Budapest Treaty, on November 21, 2019 at the National Collection of Cultures of Microorganisms (CNCM) of the Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15) , on behalf of the National Institute of Agronomic Research - INRA, 147 rue de l'Université, 75338 Paris Cedex 07.

According to another particular and preferred embodiment, the composition of the invention comprises a mixture of the V. pyra 1381 strain deposited at the CNCM under the number CNCM I-5627 and of the V. pyra 1387 strain deposited at the CNCM under the number n ° CNCM I-5629, or a mixture of the strain V. pyra 1381 and of the strain V. pyra 2299 deposited at the CNCM under the n ° CNCM I-5630, or a mixture of the strain V. pyra 1386 deposited at the CNCM under the number CNCM I-5628 and the strain V. pyra 1387 deposited at the CNCM under the number CNCM I-5629, or a mixture of the strain V. pyra 1386 and the strain V. pyra 2299 deposited at the CNCM under number CNCM I -5630.

According to a particular and preferred embodiment, the bio-control composition according to the invention comprises a mixture of strains of opposite sexual signs of a phytopathogenic fungus or of type B oomycete non-pathogenic for the plant to be treated, in in particular a mixture of PYR strains of opposite sexual signs, in a concentration ranging from 500 spores / ml to 600,000 spores / ml, in particular 5,000 to 400,000 spores / ml.

The biocontrol composition can further comprise adjuvants conventionally used in the formulation of biocontrol products. These adjuvants can in particular be chosen from the group consisting of wetting agents, adhesive agents, water retainers, emulsifiers, and mixtures thereof. These adjuvants make it possible to facilitate the homogenization of the composition, the adhesion of the strains to the vegetative system, the resistance of the strains to leaching, or even to their germination. According to one particular embodiment, the composition will contain at least 2 PYR strains of opposite sexual signs and non-pathogenic for apple trees, with a final concentration of between 500 spores / ml to 600,000 spores per milliliter (ml), in particular 5,000 to 400 000 spores / ml of biocontrol composition, and optionally one or more adjuvants chosen from wetting agents, adhesive agents, water retainers, emulsifiers, and mixtures thereof.

Mention may be made, as an example of wetting agents, of a mixture of methyl ester and dioctyl sulfoccinate or of alkylglucoside ester citrate, esterified vegetable or mineral oils. As adhesive agent, mention may be made of carboxy methylcellulose. As water-retaining agent, there may be mentioned, for example, guar gum. By way of example of an emulsifying agent, mention may be made of sorbitol derivatives.

Those skilled in the art will adapt the choice of adjuvants and their contents in the biocontrol composition, depending in particular on the plants to be treated and the methods of application. According to a particular embodiment, the biocontrol composition is applied by spreading, in particular by spraying on said plants, and in particular by spraying on the vegetative apparatus of said plants and / or on the orchard ground.

According to a preferred embodiment, the bio-control composition will be applied using an atomizer, a device conventionally used in arboriculture which allows excellent dispersion of the preparations over the entire plant cover.

The 'phytoprotection' composition according to the invention will comprise one or more type B strains according to the invention, or type A by B descendants, in particular one or more Venturia inaequalis type B strains of the special pyracantha form (f . sp pyracantha or PYR), preferably chosen from the group consisting of the strain V.pyra 1669 deposited at the CNCM under the number CNCM I-5456, the strain V. pyra 2507 deposited at the CNCM under the number CNCM I -5457, the V. pyra 1381 strain deposited at the CNCM under the number CNCM I-5627, the V. pyra 1387 strain deposited at the CNCM under the number CNCM I-5629, the V. pyra 2299 strain deposited at the CNCM under the number CNCM I -5630, the strain V. pyra 1386 deposited at the CNCM under the number CNCM 1-5628, and their mixtures as defined above for the biocontrol composition, or PYRxPOMI descendants.

According to a particular and preferred embodiment, the phytoprotection composition according to the invention comprises one or more PYR strains, or PYRxPOMI descendants, in a concentration ranging from 500 spores / ml to 600,000 spores / ml, in particular 5,000 to 400,000 spores. / ml.

The phytoprotection composition may further comprise adjuvants as described above for the biocontrol composition.

According to a particular embodiment, the phytoprotection composition is applied by spreading, in particular by spraying on said plants, and in particular by spraying on the vegetative apparatus in the vegetative growth phase of said plants. Selection of strains of fungus or oomycetes which can be used as non-pathogenic type B strains in the bio-control method or composition according to the invention

This method of selection according to the invention, strains of fungus or phytopathogenic oomycete type B, which are non-pathogenic for the plant to be treated but sexually compatible in crossing with type A strains of the same species but pathogenic and endemic for the plant to be treated, comprises a step of pre-selection of the strains characterized by: a) a step of sexual reproduction b) a sexual phase initiated in non-parasitic mode, c) reproduction according to a heterothallic mode, and d) existence special forms within the species or divergent sexually compatible populations, crossings of which with pathogenic strains of the same species ('type A' strains) produce non-pathogenic or even sterile descendants on said plant of interest.

We will speak of strains of fungus or oomycete within the same species of fungus or oomycete (e.g. Venturia inaequalis), but of a special form specific to a plant (e.g. apple tree or pyracantha respectively), the strains type B and type A strains of the same species of fungus or oomycete having special forms for pyracantha and apple, respectively.

Method for selecting strains of interest and analysis of the progeny (Method 1) According to a first method, non-pathogenic strains of interest for the apple tree are selected by crossing with strains pathogenic for the apple tree, observation of fertile crosses (production pseudothecia), analysis of non-pathogenic progeny and selection of non-pathogenic PYRxPOMI descendants on apple and pyracantha. This selection can be made by crossing between PYR strains and POMI strains and observation of fertile crosses (production of pseudothecia).

The PYR strains which can be used in the bio-control method or composition according to the invention are selected from PYR strains isolated from Pyracantha leaves infected with V. inaequalis and called 'PYR' strains or from collections of strains. accessible to the scientific community.

Mention may be made, for example, of the PYR strains listed in Table 1 below: According to a particular embodiment of the invention, the following will be mentioned: the Vina_1669_pyr strain otherwise called V. pyra 1669 deposited in the name of INRA on November 21, 2019 at the CNCM at the Institut Pasteur, 25 rue du

Doctor Roux, 75724 Paris Cedex 15 under number CNCM I-5456, the Vina_2507_pyr strain otherwise known as V.pyra 2507 deposited in the name of INRA on November 21, 2019 at the CNCM at the Institut Pasteur, 25 rue du

Doctor Roux, 75724 Paris Cedex 15 under number CNCM I-5457, the Vina_1381_pyr strain otherwise known as V.pyra 1381 deposited in the name of INRAE on December 11, 2020 at the CNCM at the Institut Pasteur, 25 rue du

Doctor Roux, 75724 Paris Cedex 15 under number CNCM I-5627, the Vina_1386_pyr strain otherwise known as V.pyra 1386 deposited in the name of INRAE on December 11, 2020 at the CNCM at the Institut Pasteur, 25 rue du

Doctor Roux, 75724 Paris Cedex 15 under number CNCM I-5628, the Vina_1387_pyr strain otherwise known as V.pyra 1387 deposited in the name of INRAE on December 11, 2020 at the CNCM at the Institut Pasteur, 25 rue du

Doctor Roux, 75724 Paris Cedex 15 under number CNCM I-5629, the Vina_2299_pyr strain otherwise known as V.pyra 2299 deposited in the name of INRAE on December 11, 2020 at the CNCM at the Institut Pasteur, 25 rue du

Docteur Roux, 75724 Paris Cedex 15 under the number CNCM I -5630, and their mixtures.

The following table shows the sexual type of each of these 6 strains:

In the biocontrol method or the phytoprotection composition according to the invention, a mixture of two strains from among those mentioned in Table 2, of opposite sexual signs, can be used. All combinations are possible, and one will advantageously choose the strains 1381 and 1386 (mat HMG) combined with the strains 1387 and 2299 (mat alpha), that is to say the mixtures 1381/1387, 1381/2299, 1386/1387 and

1386/2299. Among the PYR strains available, the PYR strains used according to the bio-control method or the composition of the invention are selected according to two criteria: saprotrophic (non-parasitic) growth on the leaf litter of apple trees, and the aptitude for reproduction. sexed with POMI strains.

Thus, according to a particular method, PYR strains of Venturia inaequalis are selected which are not pathogenic for the apple tree (so-called 'type B' strains), but sexually compatible with POMI strains of Venturia inaequalis pathogenic for the apple tree (strains of type A ' ), capable of being used in a biocontrol method according to the invention or a biocontrol composition according to the invention.

Said PYR strains are selected according to the following steps: a) Ability of said PYR strains to multiplication in vitro and to produce spores, for example on agar medium with or without deposit of a cellophane sheet, b) Intrinsic aptitude of said PYR strains to colonize apple leaves in the saprophytic form, by inoculating scab-free leaves not treated with fungicides with PYR strains (strain by strain) and by evaluating the colonization of each strain, for example by PCR, or even by qPCR (quantitative PCR), c) Aptitude of said PYR strains for sexual reproduction with POMI strains, in particular by crossing and counting the number of pseudothecia produced, d) Aptitude of said PYR strains for sexual reproduction in a situation of competition between strains POMI and the strains to be tested, in particular by making mixtures of mat-HMG and mat-a strains and evaluating the number of pseudothecia and the percentage of hybrid pseudothecia, for example by PCR or even by qPCR; e) Ability of said PYR strains to produce non-pathogenic descendants resulting from crosses between POMI strains and the strains to be tested, in particular by isolation of the ascospores produced and phenotyping of the descendants on grafted apple tree plants or apple tree seedlings under controlled conditions.

In addition to the typing of the sex sign, the ability of the PYR strains for in vitro multiplication (step a)) is achieved in particular as follows:

Mycelial development kinetics in vitro (on agar medium or in liquid medium)

Evaluation of sporulation in vitro (on sheets of cellophane placed on a Petri dish).

The intrinsic ability of the strains to colonize apple leaves in the saprophytic form (step b)) is achieved in particular as follows:

Harvesting scab-free orchard leaves not treated with fungicides, Inoculation of leaves with PYR strains (strain by strain),

Incubation in controlled conditions and in a wire cage outside (autumn weather conditions), and

Evaluation of the colonization of each strain by PCR or even qPCR. The evaluation of PYR strains for their aptitude for sexual reproduction with POMI strains (step c)) can be carried out as follows:

Crosses between each PYR strain and POMI strains (mixtures of mat-HMG strains or mixtures of mat-a strains according to the sexual sign of the PYR strain) - Comparison of the number of pseudothecia produced by the different PYR strains by counting the pseudothecia

The POMI strains are derived from POMI strains isolated from apple leaves infected with V. inaequalis and called 'ROMG strains or from collections of strains accessible to the scientific community. Mention may be made, for example, of the POMI strains listed in Table 3 below. The genome of all of these strains has been published (Le Cam et al., 2019):

Secondly, the aptitude for sexual reproduction in a situation of competition between POMI and PYR strains (step d)) is evaluated, for example according to the following protocol:

- Production of a PYR GFP strain to follow the installation of the fungus in the apple leaf in comparison with a POMI GFP strain, by fluorescence microscopy, or advantageously by PCR or even by qPCR (quantitative PCR) specific to each special form to assess the relative biomass of each strain.

- Carrying out different crosses each involving 4 mixed strains (1 strain PYR mat-HMG, 1 strain PYR mat- a, 1 strain POMI mat-HMG, 1 strain POMI mat-a)

- Evaluation of the number of pseudothecia and the percentage of hybrid pseudothecia by PCR or even qPCR.

Finally, the non-pathogenic character of the descendants of crosses between PYR and POMI (step e)) can be analyzed on a large number of strains in order to document the probability of generating potentially pathogenic descendants on apple trees, in particular by:

Isolation of ascospores produced during crosses between PYR strains and POMI strains (50 ascospores per isolated per cross),

Phenotyping of the descendants on grafted apple tree plants in a climatic chamber at 18 ° C under controlled conditions carried out up to 27 days after inoculation according to the protocol described by Le Van et al., 2012 Evolutionary applications)

The PYR strains were thus selected, the capacity of which has been shown to cross with POMI strains and to allow the production of non-pathogenic progeny on the apple tree.

According to a particular embodiment, the PYR 1669 strain (Vina_1669_pyr), the V.pyra 2507 strain, the V.pyra1381 strain, the V.pyra strain, and the V.pyra strain will be used in the bio-control or phytoprotection method or composition of the invention. 1386, the strain V. pyra 1387, the strain V.pyra 2299, and their mixtures 2 to 2 according to their sexual signs (mixtures of strains of opposite sexual signs).

The characteristics of the strains V.pyra 1669, V.pyra 2507, V.pyra1381, V.pyra 1386, V. pyra 1387 and V.pyra 2299 are presented in Tables 1 and 2.

The strains 1381 and 1386 (mat HMG) combined with the strains 1387 and 2299 (mat alpha) will advantageously be chosen. According to another particular embodiment, a V.pyra 1669 strain deposited at the CNCM under the number CNCM I-5456, a V. pyra 2507 strain deposited at the CNCM under the number CNCM I-5457, and preferably a mixture of these two strains, of opposite sexual signs.

According to another particular embodiment, a V. pyra 1381 strain deposited at the CNCM under the number CNCM I-5627, a V. pyra 1387 strain deposited at the CNCM under the number CNCM I-

5629, and preferably a mixture of these two strains, of opposite sexual signs.

According to another particular embodiment, a V. pyra 1381 strain deposited at the CNCM under the number CNCM I-5627, a V. pyra 2299 strain deposited at the CNCM under the number CNCM I-

5630, and preferably a mixture of these two strains, of opposite sexual signs.

According to another particular embodiment, a V. pyra 1386 strain deposited at the CNCM under the number CNCM I-5628, a V. pyra 1387 strain deposited at the CNCM under the number CNCM I-

5629, and preferably a mixture of these two strains, of opposite sexual signs.

According to another particular embodiment, a V. pyra 1386 strain deposited at the CNCM under the number CNCM I-5628, a V. pyra 2299 strain deposited at the CNCM under the number CNCM I-

5630, and preferably a mixture of these two strains, of opposite sexual signs.

According to a particular embodiment of the invention, the PYR strains are cultured at 18 ° C on cellophane membranes placed on Petri dishes containing a PDA-YE Agar medium (PotatoDextrose Agar, BD Difco) supplemented with 0.3% extract of yeast (Sigma-Aldrich) with a 12h / 12h day / night alternation. They are stored both under liquid nitrogen and at -20 ° C on dehydrated cellophane membranes in the Venturia collection of the Horticulture and Seeds Research Institute (IRHS - INRA, Beaucouzé, France).

And we select the PYRxPOMI descendants obtained in the laboratory which have been shown to be non-pathogenic on apple and pyracantha see Fig1, each mixture comprising at least one strain mat-HMG and one strain PYR mat-a.

Method for selecting strains of interest that are not pathogenic for apple trees by PCR analysis (Method 2 alternative to method 1)

Advantageously and alternatively to the first method described above, the selection of PYR strains capable of crossing with POMI strains can be done by specific amplification of the allele at the mat locus, by PCR.

Thus another subject of the invention is a method of selecting strains of phytopathogenic fungi or type B oomycetes which are not pathogenic for the plant to be treated, in particular strains of Venturia inaequalis, capable of being used in a plant to be treated. bio-control method according to the invention to fight against propagation of pathogenic strains on a plant of interest or a bio-control composition according to the invention, comprising the following steps:

(1) evaluation of their intrinsic ability to saprophytically colonize apple leaves, in particular using the quantitative PCR technique using primers specific for PYR strains,

According to a first step, the PYR strains are selected from the strains of V. inaequalis.

The PYR and POMI strains are specific for their hosts. The isolation host (Apple or Pyracantha) therefore makes it possible to specify whether it is a PYR or POMI strain. The Applicant has identified specific nucleotide sequences for each special form making it possible to distinguish the PYR strains and the POMI strains. In particular, he identified nucleic acid sequences specific to POMI, not present in PYR, illustrated in the following table by the sequences SEQ ID NO: 1 to SEQ ID NO: 3, and respectively nucleic acid sequences specific to PYR, not present in POMI, illustrated in the following table by the sequences SEQ ID NO: 4 to SEQ ID NO: 8.

The nucleic acid sequences are referenced in Tables 4 and 5 below:

Nucleic sequences specific to POMI or PYR respectively

Those skilled in the art will thus be able to define specific PCR or qPCR primers making it possible to amplify a specific fragment of POMI emitting in particular FAM fluorescence according to the Taqman technique, or respectively a specific fragment of PYR emitting in particular CYR fluorescence according to the Taqman technique.

According to a particular and preferred embodiment, use will be made of POMI primers defined from an identical sequence or having at least 90% or even at least 95% identity with the sequence SEQ ID NO: 1 of the g9008 gene. The primers generally comprise 12 to 30 nucleotides, in particular 15 to 25 nucleotides. According to a particular and preferred embodiment, PYR primers defined from a sequence having 100% identity with the sequence SEQ ID NO: 5 of the Vina_1669.g9936_fragment gene will be used.

Such primers are shown in Tables 5 and 6: Primers for PCR

The identity percentages to which reference is made in the context of the disclosure of the present invention are determined after optimal alignment of the sequences to be compared, which may therefore include one or more additions, deletions, truncations and / or substitutions.

This percentage identity can be calculated by any method of sequence analysis well known to those skilled in the art.

The percentage of identity can be determined after global alignment of the sequences to be compared taken in their entirety, over their entire length. Besides manually, it is possible to determine the overall alignment of sequences using the algorithm of Needleman and Wunsch (1970).

For the nucleotide sequences, the comparison of the sequences can be carried out using any software well known to those skilled in the art, such as, for example, the Needle software. The parameters used can in particular be the following: “Gap Open” equal to 10.0, “Gap Extend” equal to 0.5 and the EDNAFULL matrix (EMBOSS version of NCBI NUC4.4).

Preferably, the percentage identity defined in the context of the present invention is determined by means of an overall alignment of the sequences to be compared over their entire length.

PCR or qPCR primers can thus be defined from said sequences, making it possible to specifically amplify each of the special forms, for use in an identification or detection tool. According to the Taqman technique, the presence of a probe specific to each special form will release a different fluorescence allowing the quantification of the DNA of each special form in the sample.

According to a particular mode, the following PCR primers will be used:

POMI specific PCR primers (Vina_EUB04.g9008_spPomi, expected amplicon size = 163 bp) spPomi-F Forward primer GTTATGTCTGGCCGCGTTAT (SEQ ID NO: 9) spPomi-R Reverse primer AGAAAAGCTGGCACCTCGTA (SEQ ID NO: 10) PYR specific PCR primers (Vina_1669.g9936_spPyr, expected amplicon size = 157 bp) spPyr-F Forward primer CAAGCGAGCTGAAATCGAG (SEQ ID NO: 11) spPyr-R Reverse primer GTACAACCCGATCCCTTTTG (SEQ ID NO: 12) According to another particular embodiment, the following qPCR primers will be used:

POMI specific qPCR primers (Vina_EUB04.g9008_spPomi, expected amplicon size = 135pb) spPomi-F Forward primer AAAGGTCCCCTCACGAATAC (SEQ ID NO: 17) spPomi-R Reverse primer G AT CT GTTT CCCTT CC ACCT (SEQ ID NO: 18)

Sequence of the labeled probe specific for POMI [FAM] TGCCATCTGGATCGGAACAA [BHQ3] (SEQ ID NO: 21)

PYR specific qPCR primers (Vina_1669.g9936_spPyr, expected amplicon size = 85bp) spPyr-F Forward primer GAGTTATTGCTGAGGCCAAG (SEQ ID NO: 19) spPyr-R Reverse primer GCCTTGACTGTGCTCGTAAC (SEQ ID N0: 20)

Sequence of the labeled probe specific for PYR: [CY5] GCTCCAACCGTTGGTGGAGA [BBQ3] (SEQ ID NO: 22).

According to a particular embodiment, the method of detecting PYR strains or POMI strains within V inaequalis strains comprises the following steps: a) extraction of the DNA of the V. inaequalis strains b) denaturation of said extracted DNA c) use of sense (forward) and antisense (reverse) primers for amplifying specific nucleic acid sequences of POMI such as a sequence comprising an identical nucleic acid sequence or exhibiting at least 90%, or even at least 95% identity with one of the sequences SEQ ID NO: 1 to SEQ ID NO: 3 or a fragment thereof, or for amplification of nucleic acid sequences specific for PYR such as a sequence comprising an identical nucleic sequence or having at least 90% identity with the 'one of the sequences SEQ ID NO: 4 to SEQ ID NO: 8 or a fragment thereof, and d) optionally use of specific probes, advantageously labeled with fluorophores to detect said amplified nucleic sequences or fragments thereof, Perm and to categorize the POMI strains and the PYR strains. The term “nucleic sequence fragment” is understood to mean a fragment comprising from 8 to 30 nucleotides, in particular from 15 to 25 nucleotides.

The invention also relates to an in vitro method of selecting Venturia inaequalis type B strains of special form specific for pyracantha (f. Sp pyracantha or PYR), which can be used in a bio-control method according to the invention or of a bio-control composition according to the invention for combating the propagation of pathogenic strains of V. inaequalis, in particular of type A strains of special form f. sp pomi or POMI, comprising: a step of extracting DNA from the Venturia inaequalis strains; a step of amplification by PCR or even qPCR of specific nucleic acid sequences of the genome of PYR strains, in particular of nucleic acid sequences comprising an identical nucleic acid sequence or exhibiting at least 90%, or even at least 95% identity with one of the sequences SEQ ID NO: 4 to SEQ ID NO: 8, preferably the sequence SEQ ID NO: 5, by means of specific nucleic acid primers, in particular of a direct primer of identical nucleic sequence or having at least 90%, or even at least less 95% identity with the sequence SEQ ID NO: 11 or SEQ ID NO: 19 and of a reverse primer of identical nucleic sequence or having at least 90%, or even at least 95% identity with the sequence SEQ ID NO : 12 or SEQ ID NO: 20; and optionally a step of detecting said amplified sequences by means of probes, preferably labeled with fluorophores.

The extraction of nucleic acids from a biological sample can be done by standard methods known to those skilled in the art, such as described in Maniatis T. et al. (Edition 1999).

By “nucleic acid denaturation” is meant the step in which the complementary strands of nucleic acid are dissociated. Double-stranded nucleic acid molecules are formed by non-covalent association through hydrogen bonds between complementary nucleotides, denaturation of nucleic acid occurs by breaking said hydrogen bonds. Those skilled in the art will readily determine the conditions for inducing denaturation and renaturation. In a method according to the invention, the induction of the denaturation of double-stranded nucleic acid molecules can be obtained by any method subjecting nucleic acids to any physical or chemical agent capable of destabilizing the hydrogen bonds, such as a high temperature. The denaturation of the nucleic acid is reversible, when the denaturation has been induced by raising the temperature, a temperature cooling step allows the renaturation, in which the complementary strands reassemble with the formation of hydrogen bonds.

According to a particular embodiment, a forward primer is used comprising an identical sequence or exhibiting at least 90%, or even at least 95% identity with the nucleic acid sequence SEQ ID NO: 9 or SEQ ID NO: 17 and a reverse primer comprising a sequence identical or exhibiting at least 90%, or even at least 95%, identity with the nucleic acid sequence SEQ ID NO: 10 or SEQ ID NO: 18 for amplifying fragments of nucleic acid sequences specific for POMI.

According to a particular embodiment, a forward primer is used comprising an identical sequence or exhibiting at least 90%, or even at least 95% identity with the nucleic acid sequence SEQ ID NO: 11 or SEQ ID NO: 19 and a reverse primer comprising a sequence identical or exhibiting at least 90%, or even at least 95%, identity with the nucleic acid sequence SEQ ID NO: 12 or SEQ ID NO: 20 for amplifying fragments of nucleic acid sequences specific for PYR.

According to a particular embodiment, the conditions for amplifying a locus specific to the POMI form and to the PYR form are as follows: 2 minutes of denaturation of the DNA of V. inaequalis at 95 ° C. followed by 35 cycles comprising 30 seconds at 95 ° C, 30 seconds at 60 ° C 30 seconds at 72 ° C followed by a final extension phase at 72 ° C for 5 minutes.

It is thus possible to develop a detection (or identification) tool making it possible to detect PYR strains relative to POMI strains, using the specific sequences of the special PYR form among those described above, and among the PYR strains, select, as described below, PYR strains of opposite sexual signs which can be used in a method or a bio-control composition according to the invention.

Thus, according to a second step of the method, the PYR strains of opposite sexual signs are selected.

The sexual sign of each PYR strain can be identified through specific amplification of the allele at the "mating type" locus, otherwise known as the mat locus, by PCR.

One can in particular use the pairs of primers below, making it possible to distinguish the two sexual signs (Mat Alpha and Mat HMG, otherwise called mat-a (-) and mat- HMG (+)), the entire sequences of which are referenced in Genbank under accession numbers MG818328.1 and MG818329.1 respectively. Specific primers Mat Alpha mat-alpha-F Forward primer 5 'CAC CT CTTT CC AG CAG AAG G 3' (SEQ ID NO: 13) mat-alpha-R Reverse primer 5 'CGATTCGCAGGAACTTGTCA3' (SEQ ID NO: 14)

Specific primers Mat HMG

Mat- HMG- F Direct primer 5'CCCCTCTGACTCTGAACAGC 3 '(SEQ ID NO: 15)

Mat- HMG -R Reverse primer 5 ’TGTCGAAATCGTCAATCTGC3’ (SEQ ID NO: 16)

According to a particular embodiment, the conditions for amplifying the locus of the sexual type are as follows: 2 minutes of denaturation of the DNA of V. inaequalis at 95 ° C followed by 35 cycles comprising 45 seconds at 95 ° C, of 45 seconds at 60 ° C 45 seconds at 72 ° C followed by a final extension phase at 72 ° C for 5 minutes.

The bio-control method according to the invention can thus comprise, upstream, and to ensure its targeted efficiency on the endemic pathogenic POMI strains of apple trees, the following steps: a) Detection of the presence of POMI strains on the apple tree. 'vegetative apparatus of the apple tree, in particular by PCR, comprising the use of nucleic acid sequences comprising an identical sequence or exhibiting at least 90%, or even at least 95% identity with one of the nucleic sequences SEQ ID NO: 1 to SEQ ID NO: 3 or fragments thereof, in particular the use of primer nucleic acid sequences comprising an identical sequence or exhibiting at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 9 or SEQ ID NO: 17 (forward primer), an identical sequence or having at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 10 or SEQ ID NO: 18 (reverse primer), and their mixture ; b) Selection of PYR strains, in particular by PCR or even qPCR, comprising the use of nucleic acid sequences comprising an identical sequence or exhibiting at least 90%, or even at least 95% identity with one of the nucleic acid sequences SEQ ID NO : 4 to SEQ ID NO: 8 or fragments thereof, in particular the use of primer nucleic acid sequences comprising an identical sequence or exhibiting at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 11 or SEQ ID NO: 19 (forward primer), an identical sequence or having at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 12 or SEQ ID NO: 20 (reverse primer), and their mixture; c) Selection, from among the PYR strains selected in step b), of PYR strains of opposite sexual signs, in particular by PCR or even qPCR, comprising the use of pairs of primers respectively a pair of mat- primers. alpha-F and mat-alpha-R consisting of the sequences comprising an identical nucleic acid sequence or exhibiting at least 90%, even at least 95% identity with the sequence SEQ ID NO: 13 (direct primer, mat-aF) and a nucleic acid sequence identical or having at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 14 (reverse primer, mat-aR) and a couple mat-HMG-F and mat-HMG- R consisting of the sequences comprising an identical nucleic sequence or exhibiting at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 15 (direct primer, mat-HMG-F) and an identical nucleic sequence or exhibiting at least 90%, even at least 95% identity with the sequence SEQ ID NO: 16 (reverse primer, mat-HMG-R), and d) Crossing of the PYR strains selected in step c) and of POMI strains identified in step a), to verify that non-pathogenic or even sterile progeny have been obtained.

The PYR strains resulting from selection steps b), c) and d) can then be used, preferably as a mixture consisting of at least two PYR strains of opposite sexual signs, in a bio-control method or a bio composition. -control according to the invention.

The present invention also relates to a kit for the in vitro detection (or identification) of PYR strains of opposite sexual signs and of POMI strains, comprising nucleic acid sequences primers for amplification by PCR or qPCR of specific nucleic sequences of PYR and respectively of POMI comprising : a) A pair of primer nucleic acid sequences comprising an identical sequence or exhibiting at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 9 or SEQ ID NO: 17 (direct primer sp Pomi-F) , and a sequence identical or having at least 90%, even at least 95% identity with the sequence SEQ ID NO: 10 or SEQ ID NO: 17 (reverse primer sp Pomi- R), to amplify by PCR or qPCR a nucleic acid sequence specific for POMI, and optionally specific probes, preferably labeled with fluorophores, for detecting said amplified sequences, b) Optionally, in addition, a pair of primer nucleic sequences comprising an identical sequence o u exhibiting at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 11 or SEQ ID NO: 19 (direct primer sp Pyr-F) an identical sequence or exhibiting at least 90%, or even at least 95% identity with the sequence SEQ ID NO: 12 or SEQ ID NO: 20 (reverse primer sp Pyr-R), to amplify a sequence by PCR or qPCR nucleic acid specific for PYR, and optionally specific probes, preferably labeled with fluorophores in order to detect said amplified sequences, and c) Optionally, in addition, two pairs of primers respectively mat-alpa constituted by the sequences comprising an identical nucleic sequence or exhibiting at less 90%, or even at least 95% identity with the sequence SEQ ID NO: 13 (direct primer mat-alpha-F) and a nucleic acid sequence identical or exhibiting at least 90%, or even at least 95% identity with the sequence the sequence SEQ ID NO: 14 (reverse primer mat-alpha-R) and mat-HMG consisting of the sequences comprising a nucleic acid sequence which is identical or exhibiting at least 90%, or even at least 95%, identity with the sequence SEQ ID NO: 15 (forward primer mat-HMG-F) and a nucleic acid sequence identical or exhibiting at least 90%, even at least 95% identity with the sequence SEQ ID NO: 16 (reverse primer mat-HMG- F), to amplify specific sequences es of the sex locus and select the PYR strains of opposite sex signs.

The different pairs of primers can be present in the same in vitro detection kit or in separate kits.

The present invention will be illustrated by the following non-limiting examples.

EXAMPLES

Example 1: Crosses and obtaining of non-pathogenic progeny A first cross was carried out between the strain PYR 1669 and the strain POMI EUB04 then other crosses were carried out as described below. This first fertile cross made it possible to generate ascospores which were cultured and stored at -20 ° C. Crosses between the PYR strains and the POMI strains are carried out by depositing mycelium or a concentration of spores (150,000 spores / ml) of each of the strains, mixed beforehand on an inert support, of the sterilized apple leaf portion type placed in a Petri dish containing an agar medium. After depositing the fungal material, the inert supports (round or square leaves) are incubated for 21 days at 17 ° C in the dark and then placed at 8 ° C for 140 days. The pseudothecia obtained are then crushed, thus releasing the ascospores which are then dispersed in water on a Petri dish containing a mixture of Malt agar. After 48 hours of incubation at 18 ° C, the germinated ascospores are isolated individually under an optical microscope and then cultured at 18 ° C in a Petri dish on an agar medium.

In this first study, the pathogenicity of 38 descendants of one progeny, obtained by crossing the strain PYR 1669 and the strain POMI EUB04 was evaluated. on the apple cultivar 'Gala' on the one hand and on the pyracantha cultivar 'Kazan', known for its sensitivity to scab on the other hand, according to the protocol described by Le Cam et al. 2002. The plants were inoculated with a suspension of spores from each progeny at a concentration of 150,000 spores / ml then placed at 17 ° C in a climatic chamber. The plants (apple tree and pyracantha) were then scored for the presence of disease on different occasions (15, 20 23, and 27 days after inoculation). 27 days after inoculation, none of the 38 descendants of the cross was found to be pathogenic on the apple variety 'Gala', 35 were found to be pathogenic on the variety of pyracantha 'Kazan' with varying levels of aggressiveness (Figure 1) and finally 3 offspring were found to be non-pathogenic both on apple 'Gala' and on Pyracantha 'Kazan'.

Additional crosses were made between the PYR 1669 strain and a mixture of 5 POMI strains (301 + 2498 + 2499 + 2788 + EU-NL-19), the PYR 1386 strain and the POMI 2556 strain, the PYR 1387 strain with the strain POMI 2557 and with a mixture of 5 POMI strains (104, 2416, 2429, 2444, 2557), the strain PYR 2299 with the strain POMI 2557 and with a mixture of 5 Pomi strains (104, 2416, 2429, 2444, 2557 ), the PYR 2507 strain with a mixture of 5 POMI strains (104, 2416, 2429, 2444, 2557) and the PYR 1381 strain with the POMI 2556 strain.

These fertile crosses made it possible to generate ascospores which were cultured and stored at -20 ° C.

The crosses between the PYR strains and the POMI strains are carried out as described above by depositing mycelium from each of the strains mixed beforehand or 40 μl of suspension of a mixture of spore suspension of 2 or more strains at a concentration of 200,000 spores. / ml, on an inert support, of the portion type of sterilized apple tree leaves placed in a Petri dish containing an agar medium. After depositing the fungal material, the inert supports (round or square leaves) are incubated for 14 days at 17 ° C. in the dark and then placed at 8 ° C. for 10 days. The pseudothecia obtained are then crushed, thus releasing the ascospores which are then dispersed in water on a Petri dish containing a mixture of Malt agar. After 48 hours of incubation at 18 ° C., the germinated ascospores are isolated individually under an optical microscope and then cultured at 18 ° C. in a Petri dish on an agar medium. In the end, on all the crosses made, the pathogenicity of 84 descendants from progenies, obtained by crossing with the parental strains PYR 1669, PYR 2299, PYR 2507 and PYR 1387 was evaluated on apple tree plants on the one hand. and on the other hand on pyracantha. All 84 descendants were tested on the pyracantha variety 'Kazan' known for its sensitivity to scab according to the protocol described by Le Cam et al. 2002. The pathogenicity of 21 descendants of the cross PYR 1669 with the strain POMI EUB04 was tested on seedlings from the variety 'Gala', the 31 other descendants of this crossing and the descendants of the other crosses were tested on the cultivars of apple tree 'Gala' and 'Golden Delicious', known for their sensitivity to scab according to the protocol described by Le Cam et al. 2002. The plants were inoculated with a suspension of spores from each progeny at a concentration of 150,000 spores / ml then placed at 17 ° C in a climatic chamber. Each offspring was tested on 3 plants. The plants (apple tree and pyracantha) were then noted for the presence of disease on different occasions (15, 20 days after inoculation). 20 days after inoculation, none of the 84 descendants of the 4 crosses was found to be pathogenic on the apple varieties 'Gala' and 'Golden delicious'. 24 descendants of the cross PYR 1669 x POMI EUB04 were found to be pathogenic on the variety of pyracantha 'Kazan' and finally 59 descendants were found to be non-pathogenic on both apple and Pyracantha. These different crosses and the results obtained are summarized in the following table: Summary table of PYRxPOMI crosses carried out for which descendants were obtained and for some, tested on apple and pyracantha Example 2: Infertility of the descendants tested in backcross (descendants x POMI strains) Backcross crosses between hybrids (PYRxPOMI descendants) and POMI strains (alone or as a mixture, see table below) are carried out. We observe the presence of pseudothecia and the presence or absence of ascospores inside.

Analysis of the content of the pseudothecium consists of crushing the pseudothecium between slides and coverslips and observing the presence of ascospores under a microscope.

The results are presented in the following table, where the figure indicates the number of pseudothecia observed and analyzed during backcross crosses (PYRxPOMI X POMI):

** POMI strain mixture 2 consists of strains 481, 2286, 2288, 2432, 2556 None of the pseudothecia analyzed contains ascospores, that is to say no descendants. These results suggest infertility / sterility in the offspring of PYRxPOMI. The biocontrol method according to the invention would therefore lead to the production of non-pathogenic and sterile descendants, which would not survive the winter, even though they would have succeeded, for possible weakly pathogenic descendants, in infecting the apple tree and therefore in survive in the orchard during the summer.

Example 3: Selection of PYR strains by PCR

For the selection of PYR strains which can be used in a method according to the invention, the following primers can be used:

POMI specific primers (Vina_EUB04.g9008_spPomi, expected amplicon size = 163 bp) spPomi-F, Direct primer GTTATGTCTGGCCGCGTTAT (SEQ ID NO: 9) spPomi-R, Reverse primer AGAAAAGCTGGCACCTCGTA (SEQ ID NO: 10)

PYR specific primers (Vina_1669.g9936_spPyr, expected amplicon size = 157 bp) spPyr-R Forward primer CAAGCGAGCTGAAATCGAG (SEQ ID NO: 11) spPyr-F Reverse primer GTACAACCCGATCCCTTTTG (SEQ ID NO: 12) The selection of PYR strains or POMI strains within V inaequalis strains comprises the following steps: a) extraction of the DNA of the V. inaequalis strains b) denaturation of said extracted DNA c) use of sense (direct) and antisense primers (indirect) as described above of amplification by PCR or qPCR of nucleic acid sequences specific for POMI such as the sequences SEQ ID NO: 1 to SEQ ID NO: 3 or of fragments thereof, or of amplification by PCR or qPCR of specific nucleic acid sequences for PYR such as the sequences SEQ ID NO: 4 to SEQ ID NO: 8 or fragments thereof, and d) and optionally use of specific probes, advantageously labeled with fluorophores to detect said amplified nucleic sequences or fragments thereof, making it possible to categorize the POMI strains and the PYR strains.

The conditions for amplification of a locus specific to the POMI form and to the PYR form are as follows: 2 minutes of denaturation of the DNA of V. inaequalis at 95 ° C followed by 35 cycles comprising 30 seconds at 95 ° C, 30 seconds at 60 ° C for 30 seconds at 72 ° C followed by a final extension phase at 72 ° C for 5 minutes.

The PYR strains thus selected can be used in crossbreeding and obtaining pathogenic progeny according to Example 1 described above.

Example 4: Selection of PYR strains by Taqman multiplex qPCR

In this example, two special forms Venturia inaequalis fsp were detected and quantified. pomi and Venturia ineaqualis fsp. Pyracantha. The following steps were taken:

1) Design of primers and specific probes on 2 specific loci of each special shape

2) DNA extraction using the Nucleospin Food kit (Macherey Nagel)

3) Taqman multiplex qPCR Amplification protocol:

1: 95.0 ° C for 3:00 minutes 2: 95.0 ° C for 0:15 minute 3: 60.0 ° C for 1: 00 minute Reading of plate 4: repeat the cycles 39 times Primers and probes with fluorochromes used (FAM and CY)

Composition of the reaction mix: It is observed that the POMI specific primers (FAM) amplify only the POMI strains and the specific PYR (CY5) primers only amplify the PYR strains.

Example 5: Demonstration of the phytoprotective effect of an application of PYR strain against apple scab.

This study was carried out on the Golden Delicious variety on the one hand and on the Gala variety on the other hand

2 tests were carried out respectively with:

PYR (1387 + POMI 2257) vs Water + POMI (2257), on 12 plants of the Golden Delicious variety PYR (1381 + POMI 2256) vs Water + POMI (2256), on 8 plants of the Gala variety. The inoculum of strain PYR 1387 (respectively 1381) is prepared at a concentration of 250,000 spores / ml and that of strain POMI 2557 (respectively 2256) at a concentration of 80,000 spores / ml. The experiments carried out in climatic chambers took place on the Golden Delicious and gala varieties respectively. 24 hours before inoculation with strain POMI 2557, a total of 20 trees were sprayed with a spore solution of strain PYR 1387 (12 trees) and PYR 1381 (8 trees) respectively, and 20 other trees were sprayed of water (control). 24 hours before the application of the PYR strain and water, the plants were placed in an atmosphere between 80 and 90% relative humidity at a temperature of 17 ° C. The optimum temperature and relative humidity conditions inoculation and incubation are those described in Le Van et al., 2012. The disease severity ratings consisting in measuring the scab area per leaf were performed 10 days after inoculation. of the strain POMI 2557 (respectively POMI 2556).

The compiled results are presented in the following tables which show a significant difference in scab observed on apple leaves having undergone a pretreatment with the strain PYR 1387 and respectively PYR 1381, 24 hours before an inoculation with the strain POMI 2557 and respectively POMI 2556. , compared to apple leaves having received a pre-treatment with water (control).

In particular, for each of the two tests, the following results were obtained (average of the spotted area on 12 plants):

Test 1

*: statistically different

Student's test: p-value = 9,045.10-5 (threshold a = 0.05) Test 2

Result: average scab area on 8 plants

*: statistically different

Anova test: p-value = 0.0064 (threshold a = 0.05)

These results show that a pre-treatment with a PYR strain makes it possible to protect the apple tree against a subsequent infection by a pathogenic POMI strain, therefore suggesting a phytoprotective effect of the PYR strains, which can be exploited in a sequential treatment of 'application of PYR strains in spring (or even also in summer) and of POMI strains in autumn, to couple a' phyto-protective 'effect to the' bio-control 'effect described in Example 1.

Example 6: Biocontrol composition and phytoprotection composition By way of example, a biocontrol composition according to the invention contains 2 strains PYR 1669 and PYR 2507 of opposite sexual signs mat-HMG and mat-a +, of final concentration of between 500 spores / ml and 600,000 spores per ml of composition.

According to another example, a bio-control composition according to the invention contains 2 strains PYR 1381 and PYR 1387 of opposite sexual signs mat-HMG and mat-a +, with a final concentration of between 500 spores / ml and 600,000 spores per ml of composition.

According to another example, a bio-control composition according to the invention contains 2 strains PYR 1381 and PYR 2299 of opposite sexual signs mat-HMG and mat-a +, with a final concentration of between 500 spores / ml and 600,000 spores per ml of composition.

According to another example, a bio-control composition according to the invention contains 2 strains PYR 1386 and PYR 1387 of opposite sexual signs mat-HMG and mat-a +, with a final concentration of between 500 spores / ml and 600,000 spores per ml of composition.

According to another example, a bio-control composition according to the invention contains 2 strains PYR 1386 and PYR 2299 of opposite sexual signs mat-HMG and mat-a +, with a final concentration of between 500 spores / ml and 600,000 spores per ml of composition. By way of example, a phytoprotection composition according to the invention contains one or more PYR strains as described above or PYRxPOMI descendants. In the case of 2 to 2 mixtures of PYR strains of opposite sexual signs, the same mixtures as those described for the biocontrol compositions can be used. These compositions also advantageously comprise adjuvants of the wetting, emulsifying, water-retaining and adhesive type which facilitate the homogenization of the solution, the adhesion of the PYR particles to the plant cover or even their germination. REFERENCES Didelot F, Caffier V, Orain G, Lemarquand A, and Parisi L. 2016 Sustainable management of scab control through the integration of apple resistant cultivars in a low-fungicide input System. Agriculture ecosystems & environment 217, 41 -48

Gladieux P, Caffier V, Devaux M, Le Cam B. 2010. Host-specific differentiation among populations of Venturia inaequalis causing scab on apple, pyracantha and loquat. Fungal Genetics and Biology. doi: 10.1016 / d. fgb.2009.12.007.

Le Cam et al. 2002 “Evidence of special twoformae in Venturia inaequalis, responsible for apple and Pyracantha scab”, Phytopathology 92: 314-320

Le Cam B, Sargent D, Gouzy J, Amselem J, Bellanger MN, Bouchez O, Brown S, Caffier V, De Gracia M, Debuchy R, Duvaux L, Payen T, Sannier M, Shiller J, Collemare J, Lemaire C. , 2019. Population Genome Sequencing of the Scab Fungal, Species Venturia inaequalis,

Venturia pirina, Venturia aucupariae and Venturia asperata G3, 9: 2405-2414 Lê Van A., Gladieux P., Lemaire C., Cornille A., Giraud T., Durel CE, Caffier V., Le Cam B. (2012) . Evolution of pathogenicity traits in the apple scab fungal pathogen in response to the domestication of its host. Evolutionary Applications 5, 694-704 doi: 10.1111 / j. 1752- 4571.2012.00246.

Claims

1. Bio-control method for controlling the propagation of phytopathogenic fungi or oomycetes on plants, comprising the application, on the soil and / or the vegetative apparatus of plants infected or likely to be infected by strains of so-called type A pathogenic endemic fungi or oomycetes, of a composition comprising a mixture of at least two so-called type B strains of the same species or of a divergent population within said species, said strains type B being non-pathogenic for said plant, sexually compatible with said pathogenic strains of type A and characterized in that they exhibit: a) sexual reproduction, b) a sexual phase initiated in non-parasitic mode, c) reproduction according to a heterothallic mode, and d) the existence of special forms or divergent populations within the species, capable of producing, in crossing with type A strains, non-pathogenic or even sterile descendants on the scale ite plant of interest, and characterized in that the mixture of non-pathogenic type B strains comprises strains of opposite sex signs.

2. Method according to claim 1, characterized in that the type B strains are applied to the vegetative apparatus in the vegetative growth phase of plants infected or liable to be infected by strains of endemic fungi or oomycetes called pathogenic. type A, then on the senescent vegetative apparatus of said plants, in particular on senescent leaves or on dead leaves that have fallen to the ground, of said plants infected or likely to be infected by strains of endemic pathogenic fungi or oomycetes say type A.

3. Bio-control method according to claim 1 or claim 2, characterized in that: a) said phytopathogenic fungus is selected from the group consisting of: Venturia inaequalis responsible for apple scab, Zymoseptoria tritici responsible for septoria wheat, Blumeria graminis responsible for oidium in wheat, Mycosphaerella fijiensis responsible for Sigatoka disease of banana, and Leptosphaeria maculans responsible for neck necrosis of rapeseed; or b) said oomycete is selected from the group consisting of: Plasmopara viticola responsible for downy mildew of grapevine, and Phytophthora infestons responsible for late blight of potato and tomato.

4. Biocontrol method according to claim 3, characterized in that said phytopathogenic fungus is Venturia inaequalis responsible for apple scab.

5. Biocontrol method according to claim 4, characterized in that the composition applied to the vegetative apparatus of the apple tree, in particular the senescent leaves, comprises a mixture of at least two strains of Venturia inaequalis type B of the special specific form of pyracantha (f. sp pyracantha or PYR) and opposite sexual signs.

6. Bio-control method according to claim 5, characterized in that the two strains of Venturia inaequalis type B of the specific special form of pyracantha (f. Sp pyracantha or PYR) and of opposite sexual signs, are selected according to a in vitro method comprising:

- a step of extracting DNA from the Venturia inaequalis strains;

- a step of amplification by PCR or even qPCR of specific nucleic sequences of the genome of the PYR strains, in particular of nucleic sequences comprising an identical nucleic sequence or having at least 90% identity with one of the sequences SEQ ID NO: 4 with SEQ ID NO: 8, preferably the sequence SEQ ID NO: 5, by means of specific nucleic primers, in particular of a direct primer of identical nucleic sequence or having at least 90% identity with the sequence SEQ ID NO: 11 or the sequence SEQ ID NO: 19 (direct primer sp Pyr-F) and a reverse primer of identical nucleic sequence or having at least 90% identity with the sequence SEQ ID NO: 12 or the sequence ID NO: 20 (sp Pyr-R reverse primer);

- a step of amplification by PCR or even qPCR of specific sequences of the sexual locus, comprising the use of a pair of mat-alpha primers consisting of the sequences comprising an identical nucleic sequence or having at least 90% identity with the sequence SEQ ID NO: 13 (forward primer mat-alpha-F) and a nucleic acid sequence identical or having at least 90% identity with the sequence the sequence SEQ ID NO: 14 (reverse primer mat-alpha-R) and a pair of mat-HMG primers consisting of the sequences comprising an identical nucleic sequence or having at least 90% identity with the sequence SEQ ID NO: 15 (direct primer mat-FIMG-F) and an identical nucleic sequence or having at least 90% identity with the sequence SEQ ID NO: 16 (reverse primer mat-HMG-R),

- And optionally a step of detecting said amplified sequences by means of probes, preferably labeled with fluorophores.

7. Biocontrol method according to any one of claims 1 to 6, characterized in that the composition is applied by spreading, in particular by spraying on the vegetative apparatus of said plants and / or on the orchard ground.

8. Biocontrol composition comprising a mixture of at least two type B strains of opposite sexual signs of a phytopathogenic fungus or oomycete non-pathogenic for the plant to be treated and sexually compatible in crossing with the type A strains. of the same species, characterized in that said phytopathogenic fungus is chosen from the group consisting of: Venturia inaequalis responsible for apple scab, Zymoseptoria tritici responsible for wheat septoria, Blumeria graminis responsible for wheat powdery mildew, Mycosphaerella fijiensis responsible for Sigatoka disease of banana, and Leptosphaeria maculans responsible for colza crown necrosis; and said oomycete is selected from the group consisting of: Plasmopara viticola responsible for downy mildew of grapevine, and Phytophthora infestons responsible for late blight of potato and tomato, for use in a biocontrol method according to any one of the following claims 1 to 7.

9. Bio-control composition, characterized in that it comprises a mixture of at least two Venturia inaequalis type B strains of the special pyracantha form (f. Sp pyracantha or PYR), in particular a mixture of the V strain .pyra 1669 deposited at the CNCM under the number CNCM I-5456 and of the V. pyra 2507 strain deposited at the CNCM under the number CNCM I-5457, or a mixture of the V. pyra 1381 strain deposited at the CNCM under the n ° CNCM I-5627 and of the strain V. pyra 1387 deposited at the CNCM under the n ° CNCM I-5629, or a mixture of the strain V. pyra 1381 and of the strain V. pyra 2299 deposited at the CNCM under the n ° CNCM I -5630, or a mixture of the strain V. pyra 1386 deposited at the CNCM under the n ° CNCM I-5628 and of the strain V. pyra 1387 deposited at the CNCM under the n ° CNCM I -5629, or a mixture of the strain V. pyra 1386 and the strain V. pyra 2299 deposited at the CNCM under the number CNCM I-5630.

10. Biocontrol composition according to claim 9, characterized in that the mixture of strains is present in a concentration ranging from 500 spores / ml to 600,000 spores / ml, in particular 5,000 to 400,000 spores / ml of composition.

11. Phytoprotection method for combating the infection of plants by phytopathogenic fungi or oomycetes, comprising the application to the vegetative apparatus in the vegetative growth phase of plants infected or likely to be infected by strains of fungi or endemic pathogenic oomycetes known as type A, one or more type B strains, or type A descendants by B, said type A and type B strains being as defined in claim 1 and claim 9.

12. Method according to claim 11, characterized in that it comprises: the application of one or more Venturia inaequalis type B strains of the special pyracantha form (f. Sp pyracantha or PYR), in particular chosen from the group consisting of the V.pyra 1669 strain deposited at the CNCM under the number CNCM I-5456, the V. pyra strain 2507 deposited at the CNCM under the number CNCM I-5457, the V. pyra 1381 strain deposited at the CNCM under the n ° CNCM I-5627, the strain V. pyra 1387 deposited at the CNCM under the n ° CNCM I-5629, the strain V. pyra 2299 deposited at the CNCM under the n ° CNCM 1-5630, the strain V pyra 1386 deposited at the CNCM under the number CNCM I-5628, and mixtures thereof as defined in claim 9, or PYRxPOMI descendants.