WO2020248629A1

WO2020248629A1 - Biomarker and use thereof

Info

Publication number: WO2020248629A1
Application number: PCT/CN2020/077423
Authority: WO
Inventors: 刘兴国; 杨亮; 林晓冰; 唐海特
Original assignee: 中国科学院广州生物医药与健康研究院
Priority date: 2019-06-13
Filing date: 2020-03-02
Publication date: 2020-12-17
Also published as: CN111621555A; JP2022538763A

Abstract

The present invention provides use of the mtDNA point mutation rate as a biomarker for ovum quality, and use of an agent for reducing the mtDNA point mutation rate in the preparation of a medicament for improving ovum quality or treating or preventing infertility in women.

Description

Biomarkers and their applications

Technical field

The invention relates to the field of bioengineering. Specifically, the present invention relates to biomarkers and their applications. More specifically, the present invention relates to the use of mtDNA point mutation rate as a biomarker of egg quality, the use of kits, reagents in the preparation of kits, pharmaceutical compositions, reagents The use in the preparation of drugs, the method of screening drugs, and the system for judging the quality of eggs, judging the effectiveness of drugs in treating female infertility or judging the prognosis of female infertility patients.

Background technique

Age is one of the key factors affecting female fertility. The female fertility rate usually peaks at the age of 24 and declines after the age of 30. Pregnancy rarely occurs after the age of 50. In recent years, the phenomenon of infertility and low fertility has increased. The most likely explanation is due to the rapid changes in the environment.

Therefore, finding a new biomarker that specifically reflects egg quality is of great significance for the prevention and treatment of infertility.

Summary of the invention

This application is based on the inventor's discovery and understanding of the following facts and problems:

The inventor analyzed the clinical reproductive data and found that the egg quality index-egg blastocyst formation rate of old women was significantly lower than that of young women, indicating that the egg quality of old women was significantly lower than that of young women. At the same time, the inventors used high-throughput second-generation detection of mtDNA mutations in young and old eggs discarded in the process of assisted reproduction ICSI, and found that older eggs accumulated significantly more mitochondrial DNA point mutations than younger eggs. The inventor further analyzed the frequency of these point mutations and found that the mutation frequency of these point mutations is mainly concentrated in the region (0.002, 0.005). These experimental results show that the rate of mtDNA point mutations is especially low-frequency point mutations in mitochondrial DNA. Rate can be used as a marker of egg aging.

Therefore, in the first aspect of the present invention, the present invention proposes the use of mtDNA point mutation rate as a biomarker of egg quality. The inventor found through experiments that low-quality eggs have accumulated significantly more mitochondrial DNA point mutations than high-quality eggs. Therefore, the mitochondrial DNA point mutation rate can be used as a biomarker of egg quality. It should be noted that "egg quality" refers to the pros and cons of the egg. The blastocyst formation rate of the egg reflects the quality of the egg. The higher the blastocyst formation rate of the egg, the better the quality of the egg, and vice versa. The quality of the eggs is worse. In addition, the “point mutation rate” refers to the number of point mutations in the mitochondrial genome obtained after the mitochondrial genome of the egg to be tested has been sequenced. The inventor found that the higher the point mutation rate, the greater the number of point mutations, indicating The worse the quality of the egg; the lower the point mutation rate, that is, the fewer the number of point mutations, the better the quality of the egg. In some embodiments, the inventors found through experiments that low-quality eggs accumulate significantly more low-frequency (mutation frequency not higher than 0.005 and higher than 0.002) mitochondrial DNA point mutations than high-quality eggs. Therefore, the mutation frequency is not higher than 0.005, and the low-frequency mitochondrial DNA point mutation rate higher than 0.002 is more accurate when used as a biomarker of egg quality.

In the second aspect of the present invention, the present invention provides a kit for judging the quality of eggs, judging the effectiveness of drugs in treating female infertility or judging the prognosis of female infertility patients. According to an embodiment of the present invention, the kit includes: reagents for detecting mtDNA point mutation rate. As mentioned earlier, the mitochondrial DNA point mutation rate can be used as a biomarker of egg quality. Therefore, the kit including the reagent for detecting the mtDNA point mutation rate according to the embodiment of the present invention can be used to determine the quality of the egg, determine the effectiveness of the drug in the treatment of female infertility, or determine the prognostic effect of female infertility patients . It should be noted that "female infertility" needs to be understood in a broad sense, not only refers to women who cannot become pregnant or infertile, but also refers to women who are unable to become pregnant or have difficulties in giving birth.

According to an embodiment of the present invention, the aforementioned kit may further include at least one of the following additional technical features:

According to an embodiment of the present invention, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and higher than 0.002. As mentioned earlier, the mutation frequency is not higher than 0.005, and the low-frequency mitochondrial DNA point mutation rate higher than 0.002 is more accurate when used as a biomarker of egg quality. Therefore, according to an embodiment of the present invention, a kit including a reagent for detecting a mutation frequency not higher than 0.005 and an mtDNA point mutation rate higher than 0.002 is used to determine the quality of eggs and determine the effectiveness of drugs in treating female infertility Or when judging the prognosis effect of female infertility patients, the accuracy is higher.

According to an embodiment of the present invention, the reagent includes at least one selected from the group consisting of primers and probes that specifically detect the rate of mtDNA point mutations. In some embodiments, the primer has a nucleotide sequence shown in SEQ ID NO: 1-8. The inventor found that the reagent has higher detection accuracy and better sensitivity for mtDNA point mutation rate.

In the third aspect of the present invention, the present invention proposes the use of reagents in the preparation of kits. The reagents are used to detect the rate of mtDNA point mutations, and the kits are used to determine the quality of the eggs and determine the drug treatment of female infertility. Effectiveness of infertility or the prognostic effect of judging female infertility patients. As mentioned earlier, the mitochondrial DNA point mutation rate can be used as a biomarker of egg quality. Therefore, the kit prepared by the reagent for detecting the mtDNA point mutation rate can be used to judge the quality of the egg, judge the effectiveness of the drug treatment of female infertility, or judge the prognostic effect of female infertility patients.

According to the embodiment of the present invention, the above-mentioned use may further include at least one of the following additional technical features:

According to an embodiment of the present invention, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and higher than 0.002. As mentioned earlier, the mutation frequency is not higher than 0.005, and the low-frequency mitochondrial DNA point mutation rate higher than 0.002 is more accurate when used as a biomarker of egg quality. Therefore, the reagent kit prepared for detecting the mutation frequency not higher than 0.005 and the mtDNA point mutation rate higher than 0.002 can more accurately judge the quality of the egg, judge the effectiveness of the drug treatment of female infertility or judge the female The prognostic effect of infertility patients.

In the fourth aspect of the present invention, the present invention provides a kit. According to an embodiment of the present invention, the kit includes a reagent for reducing the rate of mtDNA point mutations, and the kit is used to improve egg quality. As mentioned above, the rate of mitochondrial DNA point mutations can be used as a biomarker of egg quality. The higher the rate of point mutations, the more the number of point mutations, the worse the quality of the eggs; the lower the rate of point mutations, the more point mutations are. The smaller the quantity, the better the quality of the eggs. Therefore, by reducing the rate of mtDNA point mutations, the quality of eggs can be improved. Therefore, the kit including the reagent for reducing the rate of mtDNA point mutation according to the embodiment of the present invention can be used to improve the quality of eggs for scientific research and experiments.

In the fifth aspect of the present invention, the present invention provides a pharmaceutical composition for improving the quality of eggs or treating or preventing female infertility. According to an embodiment of the present invention, the pharmaceutical composition includes an agent that reduces the rate of mtDNA point mutations. As mentioned above, the rate of mitochondrial DNA point mutations can be used as a biomarker of egg quality. The higher the rate of point mutations, the more the number of point mutations, the worse the quality of the eggs; the lower the rate of point mutations, the more point mutations are. The smaller the quantity, the better the quality of the eggs. Therefore, by reducing the rate of mtDNA point mutations, you can improve the quality of eggs, or treat or prevent female infertility. Therefore, the pharmaceutical composition including the agent for reducing the rate of mtDNA point mutation according to the embodiment of the present invention can be used to improve the quality of eggs, or to treat or prevent female infertility.

According to an embodiment of the present invention, the aforementioned pharmaceutical composition may further include at least one of the following additional technical features:

According to an embodiment of the present invention, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and higher than 0.002. As mentioned earlier, the mutation frequency is not higher than 0.005, and the low-frequency mitochondrial DNA point mutation rate higher than 0.002 is more accurate when used as a biomarker of egg quality. Therefore, a pharmaceutical composition comprising an agent capable of reducing the mutation frequency not higher than 0.005 and the mtDNA point mutation rate higher than 0.002 can more effectively improve the quality of eggs, or treat or prevent female infertility.

In the sixth aspect of the present invention, the present invention proposes the use of reagents in the preparation of kits, the reagents are used to reduce the rate of mtDNA point mutations, and the kits are used to improve the quality of eggs. As mentioned above, the rate of mitochondrial DNA point mutations can be used as a biomarker of egg quality. The higher the rate of point mutations, the more the number of point mutations, the worse the quality of the eggs; the lower the rate of point mutations, the more point mutations are. The smaller the quantity, the better the quality of the eggs. Therefore, by reducing the rate of mtDNA point mutations, the quality of eggs can be improved. Therefore, the kit for the preparation of reagents for reducing the rate of mtDNA point mutations can be used to improve the quality of eggs for scientific research and experiments.

In the seventh aspect of the present invention, the present invention proposes the use of reagents in the preparation of drugs, the reagents are used to reduce the rate of mtDNA point mutations, and the drugs are used to improve egg quality or treat or prevent female infertility. As mentioned above, the rate of mitochondrial DNA point mutations can be used as a biomarker of egg quality. The higher the rate of point mutations, the more the number of point mutations, the worse the quality of the eggs; the lower the rate of point mutations, the more point mutations are. The smaller the quantity, the better the quality of the eggs. Therefore, by reducing the rate of mtDNA point mutations, you can improve the quality of eggs, or treat or prevent female infertility. As a result, drugs prepared from reagents for reducing the rate of mtDNA point mutations can be used to improve the quality of eggs, or to treat or prevent female infertility.

According to an embodiment of the present invention, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and higher than 0.002. As mentioned earlier, the mutation frequency is not higher than 0.005, and the low-frequency mitochondrial DNA point mutation rate higher than 0.002 is more accurate when used as a biomarker of egg quality. Therefore, drugs prepared by reagents that can reduce the mutation frequency not higher than 0.005 and the mtDNA point mutation rate higher than 0.002 can more effectively improve the quality of eggs, or treat or prevent female infertility.

In the eighth aspect of the present invention, the present invention provides a method for screening drugs for improving egg quality or treating or preventing female infertility. According to an embodiment of the present invention, the method includes: contacting an egg with a candidate drug, the egg derived from a female patient with low egg quality or infertility; comparing the level of mtDNA point mutation rate in the egg before and after the contact After the contact, the mtDNA point mutation rate in the egg is lower than before the contact, which is an indication that the candidate drug is a target drug. As mentioned earlier, the mitochondrial DNA point mutation rate can be used as a biomarker of egg quality. Therefore, the method according to the embodiment of the present invention can effectively screen and obtain drugs that can improve the quality of eggs or treat or prevent female infertility. It should be noted that the egg quality is measured according to the conventional knowledge or general standards of those skilled in the art. For example, an egg whose blastocyst formation rate is significantly lower than a normal standard is a low-quality egg.

According to an embodiment of the present invention, the above method may further include at least one of the following additional technical features:

According to an embodiment of the present invention, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and higher than 0.002. As mentioned earlier, the mutation frequency is not higher than 0.005, and the low-frequency mitochondrial DNA point mutation rate higher than 0.002 is more accurate when used as a biomarker of egg quality. Therefore, the method according to the embodiment of the present invention can more effectively and accurately screen and obtain drugs that can improve the quality of eggs or treat or prevent female infertility.

In the ninth aspect of the present invention, the present invention proposes a system for judging the quality of eggs, judging the effectiveness of drugs in treating female infertility or judging the prognosis of female infertility patients. According to an embodiment of the present invention, referring to FIG. 4, the system includes: an obtaining device 100 for obtaining the mtDNA point mutation rate in a sample to be tested (such as an egg to be tested); a judging device 200, the judging device 200 is connected to the obtaining device 100, and the judging device is used for judging the egg quality based on the mtDNA point mutation rate in the sample to be tested, judging the effectiveness of the drug treatment of female infertility or judging female infertility patients Prognostic effect.

According to the embodiment of the present invention, the aforementioned system may further include at least one of the following additional technical features:

According to an embodiment of the present invention, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and higher than 0.002.

According to an embodiment of the present invention, the mtDNA point mutation rate in the sample to be tested is higher than the mtDNA point mutation rate in the normal sample, which is an indicator that the egg quality of the sample to be tested is low; or after drug treatment, compared to before drug treatment, The decrease in the mtDNA point mutation rate in the sample to be tested is an indication that the drug is effective in treating female infertility; or after drug treatment, compared to before drug treatment, the rate of mtDNA point mutation in the sample to be tested is The mtDNA point mutation rate in normal samples is equivalent, which is an indicator of the good prognosis of the female infertility patients.

Description of the drawings

Fig. 1 shows a graph of the blastocyst formation rate of eggs of an elderly female and a young female according to an embodiment of the present invention;

Figure 2 shows a map of the number of point mutations in the mitochondrial genome of the eggs of an elderly woman and a young woman according to an embodiment of the present invention;

Figure 3 shows a map of the frequency of point mutations in the mitochondrial genome of the eggs of an elderly woman and a young woman according to an embodiment of the present invention;

Fig. 4 shows a schematic structural diagram of a system for judging the quality of eggs, judging the effectiveness of drug treatment of female infertility or judging the prognosis of female infertility patients according to an embodiment of the present invention.

Reference signs:

100: Get device

200: Judging device

Detailed description of the invention

The embodiments of the present invention are described in detail below, and examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary, and are intended to explain the present invention, but should not be construed as limiting the present invention.

Example 1

Experimental method: The inventor analyzed the clinical data of female patients with intracytoplasmic sperm injection (ICSI) of the cooperative unit, and divided the female patients into young group (not more than 30 years old) and old group (not less than 38 years old) according to their age ), the blastocyst formation rate of 157 young group and 103 old group female patients who underwent ICSI from May 2017 to March 2018 was systematically analyzed. The experimental results are shown in Figure 1.

Figure 1 shows the blastocyst formation rate of the eggs of 157 young group and 103 old group female patients who received ICSI in the present invention. The results showed that the formation rate of blastocysts in the young group was higher than that in the old group, reflecting that the egg quality of elderly female patients was worse than that of young female patients.

Example 2

Experimental method: The inventor collected the immature waste eggs after ICSI from the cooperative unit, and obtained 9 eggs of young female patients and 10 eggs of elderly female patients, and placed 1-4 cases of immature waste eggs from each patient. Put it into a centrifuge tube containing 20 μL of cell lysis buffer. The ratio of the lysis buffer is 17.75 μL H ₂ O, 2 μL 10×KOD buffer, and 0.25 μL proteinase K. Cracking procedure: 55°C for 45 minutes, 94°C for 5 minutes, 4°C hold. Then take 5μL of egg lysate for PCR amplification of mitochondrial genome. 4 pairs of primers are used to amplify mitochondrial genome 3561-9794 region, 9795-14567 region, 14562-139 region and 115-3560 region, these 4 regions Covers the full length of the mitochondrial genome. The primers used are shown in Table 1. PCR conditions: denaturation at 95°C for 5 minutes, then 40 cycles: denaturation at 94°C for 30 seconds, annealing at 57°C for 45 seconds, and extension at 68°C. The extension time of each fragment is calculated as 1000bp per minute 3561-9794 fragment 6 minutes and 30 seconds, 9795-14567 fragment 5 minutes, 14562-139 fragment 2 minutes, 115-3560 fragment 3 minutes 30 seconds); then stretched at 68°C for 10 minutes and stored at 4°C. The four PCR fragments were subjected to 1% agarose gel electrophoresis, and the gel was cut and recovered. After the four fragments were mixed, high-throughput second-generation sequencing was performed to analyze the mutation rate of the mitochondrial genome. The experimental results are shown in Figure 2.

Table 1: Primers used to amplify mtDNA from a small number of eggs

引物名称Primer name	引物序列Primer sequence
3561-FP3561-FP	ATGAACCCCCCTCCCCATACCC(SEQ ID NO：1)ATGAACCCCCCTCCCCATACCC (SEQ ID NO: 1)
h1-9794-R1h1-9794-R1	TGTTGAGCCGTAGATGCCGTCGGAAAT(SEQ ID NO：2)TGTTGAGCCGTAGATGCCGTCGGAAAT (SEQ ID NO: 2)
h1-9795-F2h1-9795-F2	TTTTTTGTAGCCACAGGCTTCCACGGACT(SEQ ID NO：3)TTTTTTGTAGCCACAGGCTTCCACGGACT (SEQ ID NO: 3)
h1-14567-R2h1-14567-R2	TGTGGTCGGGTGTGTTATTATTCT(SEQ ID NO：4)TGTGGTCGGGTGTGTTATTATTCT (SEQ ID NO: 4)
h1-14562-F3h1-14562-F3	CCACACCGCTAACAATCAAT(SEQ ID NO：5)CCACACCGCTAACAATCAAT (SEQ ID NO: 5)
h1-139-R3h1-139-R3	GAATCAAAGACAGATACTGCGACAT(SEQ ID NO：6)GAATCAAAGACAGATACTGCGACAT (SEQ ID NO: 6)
h1-115-F4h1-115-F4	ATGTCGCAGTATCTGTCTTTGATTC(SEQ ID NO：7)ATGTCGCAGTATCTGTCTTTGATTC (SEQ ID NO: 7)
3560-RP3560-RP	AGTAGAAGAGCGATGGTGAG(SEQ ID NO：8)AGTAGAAGAGCGATGGTGAG (SEQ ID NO: 8)

Figure 2 shows the number of mitochondrial genome point mutations in the eggs of 9 young female patients and 10 old female patients in the present invention. The results showed that the number of point mutations in the mitochondrial genome of eggs in elderly female patients was significantly higher than that in young female patients.

Example 3

Experimental method: The inventor further analyzed the results in Figure 2 to analyze the mutation frequency of point mutations in the mitochondrial genome. The experimental results are shown in Figure 3.

Figure 3 shows the mutation frequencies of the mitochondrial genome point mutations in the eggs of 9 young female patients and 10 elderly female patients in the present invention. The results showed that the frequency of point mutations in the mitochondrial genome of elderly female patients was mainly between (0.002, 0.005), and the number of point mutations in this region of the eggs of elderly female patients was significantly higher than that of young female patients.

In the description of this specification, descriptions with reference to the terms "one embodiment", "some embodiments", "examples", "specific examples", or "some examples" etc. mean specific features described in conjunction with the embodiment or example , Structure, materials or features are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the described specific features, structures, materials or characteristics can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine the different embodiments or examples and the characteristics of the different embodiments or examples described in this specification without contradicting each other.

Although the embodiments of the present invention have been shown and described above, it can be understood that the above-mentioned embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can comment on the foregoing within the scope of the present invention. The embodiment undergoes changes, modifications, substitutions and modifications.

Claims

Use of mtDNA point mutation rate as a biomarker of egg quality;

Optionally, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and higher than 0.002.
A kit for judging the quality of eggs, judging the effectiveness of drug treatment of female infertility or judging the prognostic effect of female infertility patients, characterized in that it comprises: a reagent, the reagent is used for Detection of mtDNA point mutation rate.
The kit according to claim 2, wherein the mutation frequency of the mtDNA point mutation is not higher than 0.005 and higher than 0.002;

Optionally, the reagent includes at least one selected from the group consisting of primers and probes that specifically detect mtDNA point mutation rate;

Optionally, the primer has a nucleotide sequence shown in SEQ ID NO: 1-8.
Use of the reagent in the preparation of a kit, the reagent is used to detect the mtDNA point mutation rate, the kit is used to determine the quality of the egg, determine the effectiveness of the drug treatment of female infertility or determine the prognosis of female infertility patients effect.
The use according to claim 4, wherein the mutation frequency of the mtDNA point mutation is not higher than 0.005 and higher than 0.002;

Optionally, the reagent includes at least one selected from the group consisting of primers and probes that specifically detect mtDNA point mutation rate;

Optionally, the primer has a nucleotide sequence shown in SEQ ID NO: 1-8.
A kit is characterized in that it comprises a reagent for reducing the rate of mtDNA point mutations, and the kit is used for improving the quality of eggs.
A pharmaceutical composition, which is used to improve the quality of eggs or treat or prevent female infertility, and is characterized in that it includes an agent that reduces the rate of mtDNA point mutations;

Optionally, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and higher than 0.002.
Use of the reagent in the preparation of a kit, the reagent being used to reduce the mtDNA point mutation rate, and the kit being used to improve the quality of eggs.
Use of the reagent in the preparation of medicines, the reagents being used to reduce the rate of mtDNA point mutations, and the medicines are used to improve the quality of eggs or treat or prevent female infertility;

Optionally, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and higher than 0.002.
A method for screening drugs for improving the quality of eggs or treating or preventing female infertility, and is characterized in that it comprises:

Contacting an egg with a candidate drug, which is derived from a female patient with low egg quality or infertility,

Compare the mtDNA point mutation rate in the egg before and after the contact,

After the contact, the mtDNA point mutation rate in the egg is lower than before the contact, which is an indication that the candidate drug is the target drug;

Optionally, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and higher than 0.002.
A system for judging the quality of eggs, judging the effectiveness of drug treatment of female infertility or judging the prognosis effect of female infertility patients, which is characterized in that it includes:

An obtaining device for obtaining the mtDNA point mutation rate in the sample to be tested,

A judging device, the judging device is connected to the obtaining device, and the judging device is used for judging the quality of the egg based on the mtDNA point mutation rate in the sample to be tested, judging the effectiveness of the drug treatment of female infertility or judging female The prognostic effect of infertility patients;

Optionally, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and higher than 0.002.
The system according to claim 11, wherein the mtDNA point mutation rate in the sample to be tested is higher than the mtDNA point mutation rate in the normal sample, which is an indicator that the egg quality of the sample to be tested is low; or

After the drug treatment, compared with before the drug treatment, the mtDNA point mutation rate in the sample to be tested is reduced, which is an indication that the drug is effective in treating female infertility; or

After drug treatment, compared to before drug treatment, the mtDNA point mutation rate in the sample to be tested is equivalent to the mtDNA point mutation rate in the normal sample, which is an indicator that the female infertility patient has a good prognosis.