CN111621555A

CN111621555A - Biomarkers and uses thereof

Info

Publication number: CN111621555A
Application number: CN201910509578.2A
Authority: CN
Inventors: 刘兴国; 杨亮; 林晓冰; 唐海特
Original assignee: Guangzhou Institute of Biomedicine and Health of CAS
Current assignee: Guangzhou Institute of Biomedicine and Health of CAS
Priority date: 2019-06-13
Filing date: 2019-06-13
Publication date: 2020-09-04
Also published as: WO2020248629A1; JP2022538763A

Abstract

The invention relates to a biomarker and application thereof, and particularly provides application of mtDNA point mutation rate as an ovum quality biomarker. The inventors found through experiments that eggs with low quality accumulated significantly more mitochondrial DNA point mutations than eggs with high quality. Therefore, the mitochondrial DNA point mutation rate can be used as a biomarker for egg quality.

Description

Biomarkers and uses thereof

Technical Field

The present invention relates to the field of bioengineering. The invention relates to an application of an mtDNA point mutation rate as an ovum quality biomarker, a kit, an application of a reagent in preparation of the kit, a pharmaceutical composition, an application of the reagent in preparation of a medicament, a method for screening the medicament and a system for judging the quality of an ovum and judging the effectiveness of the medicament in treating female infertility or judging the prognosis effect of a female infertility patient.

Background

Age is one of the key factors affecting female fertility. Female fertility rates usually peak at 24 years of age, decline after 30 years of age, and pregnancy rarely occurs after 50 years of age. In recent years, the phenomena of infertility and poor fertility have increased, the most likely explanation being due to rapid changes in the environment.

Therefore, a new biomarker specifically reflecting the ovum quality is found at the present stage, and the biomarker has great significance for preventing and treating infertility.

Disclosure of Invention

The present application is based on the discovery and recognition by the inventors of the following facts and problems:

the inventor finds that the ovum quality index-the rate of formation of the oocyst embryo of the old women is obviously lower than that of the young women by analyzing the clinical reproduction data, and indicates that the ovum quality of the old women is obviously lower than that of the young women. Meanwhile, the inventor finds that old ova accumulate significantly more mitochondrial DNA point mutations than young ova by detecting the mutation of mtDNA of the discarded young and old ova in the assisted reproductive ICSI process in a second generation manner at high throughput. The inventors further analyzed the frequency of these point mutations, and found that the mutation frequency of these point mutations was mainly concentrated in the region of (0.002, 0.005.) the results of these experiments indicate that the mtDNA point mutation rate, especially the mutation rate of low-frequency point mutations of mitochondrial DNA, can be used as a marker of ovum senescence.

To this end, in a first aspect of the invention, the invention proposes the use of mtDNA point mutation rate as an ovum quality biomarker. The inventors found through experiments that eggs with low quality accumulated significantly more mitochondrial DNA point mutations than eggs with high quality. Therefore, the mitochondrial DNA point mutation rate can be used as a biomarker for egg quality. The term "egg quality" means the quality of an egg, and indicates the quality of an egg as a result of the rate of blastocyst formation of an egg, and indicates that the higher the rate of blastocyst formation of an egg, the better the quality of an egg, and conversely, the worse the quality of an egg. In addition, the term "point mutation rate" refers to the number of point mutations in the mitochondrial genome obtained by detecting after gene sequencing of the mitochondria of the ovum to be tested, and the inventors found that the higher the point mutation rate, i.e., the greater the number of point mutations, the worse the quality of the ovum; a lower point mutation rate, i.e.a lower number of point mutations, indicates a better quality of the ovum. In some embodiments, the inventors experimentally found that low quality ova accumulated significantly more low frequency (mutation frequency no higher than 0.005 and higher than 0.002) mitochondrial DNA point mutations than high quality ova. Therefore, the mutation frequency is not higher than 0.005, and the low-frequency mitochondrial DNA point mutation rate of higher than 0.002 is used as the biomarker of the ovum quality, so that the accuracy is higher.

In a second aspect of the invention, the invention provides a kit for judging the quality of eggs, judging the effectiveness of a medicament for treating female infertility or judging the prognosis effect of female infertility patients. According to an embodiment of the invention, the kit comprises: a reagent for detecting mtDNA point mutation rate. As previously mentioned, the mitochondrial DNA point mutation rate can be used as a biomarker for egg quality. Therefore, the kit comprising the reagent for detecting the mtDNA point mutation rate provided by the embodiment of the invention can be used for judging the quality of the ovum, judging the effectiveness of drug treatment on female infertility or judging the prognosis effect of female infertility patients. It should be noted that "female infertility" is to be understood in a broad sense and refers not only to women who are unable to become pregnant or to live, but also to women who are pregnant or have difficulty in getting born.

According to an embodiment of the present invention, the kit may further comprise at least one of the following additional technical features:

according to the embodiment of the invention, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and is higher than 0.002. As described above, the accuracy is higher when the mutation frequency is not higher than 0.005 and the low-frequency mitochondrial DNA point mutation rate is higher than 0.002 as the biomarker of the ovum quality. Therefore, the kit comprising the reagent for detecting the mtDNA point mutation rate with the mutation frequency not higher than 0.005 and higher than 0.002, provided by the embodiment of the invention, is used for judging the quality of the ovum, and has higher accuracy when the effectiveness of the drug for treating female infertility or the prognosis effect of female infertility patients are judged.

According to an embodiment of the present invention, the reagent comprises at least one selected from a primer, a probe specifically detecting mtDNA point mutation rate. In some embodiments, the primer has SEQ ID NO: 1 to 8. The inventor finds that the reagent has higher detection accuracy and better sensitivity on the mtDNA point mutation rate.

In a third aspect of the invention, the invention provides the use of a reagent in the preparation of a kit, wherein the reagent is used for detecting mtDNA point mutation rate, and the kit is used for judging the quality of ova, judging the effectiveness of a medicament for treating female infertility or judging the prognosis effect of female infertility patients. As previously mentioned, the mitochondrial DNA point mutation rate can be used as a biomarker for egg quality. Therefore, the kit prepared by the reagent for detecting the mtDNA point mutation rate can be used for judging the quality of ova, judging the effectiveness of the medicine for treating female infertility or judging the prognosis effect of female infertility patients.

According to an embodiment of the present invention, the above-mentioned use may further include at least one of the following additional technical features:

according to the embodiment of the invention, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and is higher than 0.002. As described above, the accuracy is higher when the mutation frequency is not higher than 0.005 and the low-frequency mitochondrial DNA point mutation rate is higher than 0.002 as the biomarker of the ovum quality. Therefore, the kit prepared by the reagent for detecting the mtDNA point mutation rate with the mutation frequency not higher than 0.005 and higher than 0.002 can more accurately judge the quality of the ovum and judge the effectiveness of the medicament for treating female infertility or the prognosis effect of female infertility patients.

In a fourth aspect of the invention, a kit is provided. According to an embodiment of the invention, the kit comprises an agent for reducing the mtDNA point mutation rate, and the kit is used for improving the quality of an ovum. As mentioned above, the mitochondrial DNA point mutation rate can be used as a biomarker for the quality of the ovum, and a higher point mutation rate, i.e. a higher number of point mutations, indicates a poorer quality of the ovum; a lower point mutation rate, i.e.a lower number of point mutations, indicates a better quality of the ovum. Therefore, by reducing the mtDNA point mutation rate, the quality of the ovum can be improved. Thus, the kit including the agent for reducing the mtDNA point mutation rate according to the embodiment of the present invention can be used to improve the quality of an ovum for scientific research and experiments.

In a fifth aspect of the invention, the invention proposes a pharmaceutical composition for improving the quality of eggs or for treating or preventing infertility in women. According to an embodiment of the invention, the pharmaceutical composition comprises an agent that reduces the mtDNA point mutation rate. As mentioned above, the mitochondrial DNA point mutation rate can be used as a biomarker for the quality of the ovum, and a higher point mutation rate, i.e. a higher number of point mutations, indicates a poorer quality of the ovum; a lower point mutation rate, i.e.a lower number of point mutations, indicates a better quality of the ovum. Therefore, by reducing the mtDNA point mutation rate, the quality of the ovum can be improved, or female infertility can be treated or prevented. Thus, the pharmaceutical composition comprising the agent for reducing mtDNA point mutation rate according to the embodiment of the present invention can be used to improve ovum quality or treat or prevent female infertility.

According to an embodiment of the present invention, the above pharmaceutical composition may further comprise at least one of the following additional technical features:

according to the embodiment of the invention, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and is higher than 0.002. As described above, the accuracy is higher when the mutation frequency is not higher than 0.005 and the low-frequency mitochondrial DNA point mutation rate is higher than 0.002 as the biomarker of the ovum quality. Therefore, the pharmaceutical composition comprising an agent capable of reducing mtDNA point mutation rate of not more than 0.005 and more than 0.002 can more effectively improve the quality of ova or treat or prevent female infertility.

In a sixth aspect of the invention, the invention proposes the use of an agent for reducing the mtDNA point mutation rate in the preparation of a kit for improving the quality of an ovum. As mentioned above, the mitochondrial DNA point mutation rate can be used as a biomarker for the quality of the ovum, and a higher point mutation rate, i.e. a higher number of point mutations, indicates a poorer quality of the ovum; a lower point mutation rate, i.e.a lower number of point mutations, indicates a better quality of the ovum. Therefore, by reducing the mtDNA point mutation rate, the quality of the ovum can be improved. Therefore, the kit prepared by the reagent for reducing the mtDNA point mutation rate can be used for improving the quality of the ovum so as to be used for scientific research and experiments.

In a seventh aspect of the invention, the invention proposes the use of an agent for reducing the mtDNA point mutation rate in the manufacture of a medicament for improving ovum quality or treating or preventing infertility in women. As mentioned above, the mitochondrial DNA point mutation rate can be used as a biomarker for the quality of the ovum, and a higher point mutation rate, i.e. a higher number of point mutations, indicates a poorer quality of the ovum; a lower point mutation rate, i.e.a lower number of point mutations, indicates a better quality of the ovum. Therefore, by reducing the mtDNA point mutation rate, the quality of the ovum can be improved, or female infertility can be treated or prevented. Therefore, the medicine prepared from the reagent for reducing the mtDNA point mutation rate can be used for improving the quality of ova or treating or preventing female infertility.

according to the embodiment of the invention, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and is higher than 0.002. As described above, the accuracy is higher when the mutation frequency is not higher than 0.005 and the low-frequency mitochondrial DNA point mutation rate is higher than 0.002 as the biomarker of the ovum quality. Therefore, the medicine prepared by the reagent which can reduce the mtDNA point mutation rate of which the mutation frequency is not higher than 0.005 and is higher than 0.002 can more effectively improve the quality of ova or treat or prevent female infertility.

In an eighth aspect of the invention, the invention provides a method of screening for a drug for improving ovum quality or treating or preventing female infertility. According to an embodiment of the invention, the method comprises: contacting an egg with a candidate drug, the egg being derived from a female patient with low egg quality or infertility; comparing the mtDNA point mutation rate in the ovum before and after the contact; a decrease in the rate of mtDNA point mutations in the egg after exposure as compared to before exposure is indicative of the drug candidate being a drug of interest. As previously mentioned, the mitochondrial DNA point mutation rate can be used as a biomarker for egg quality. Therefore, the method provided by the embodiment of the invention can effectively screen and obtain the medicine capable of improving the quality of the ovum or treating or preventing female infertility. It should be noted that the quality of the ovum is measured according to the conventional cognitive or general standard of the skilled person, for example, the rate of blastogenesis of the ovum is significantly lower than the normal standard, and the ovum is of low quality.

According to an embodiment of the present invention, the method may further include at least one of the following additional technical features:

according to the embodiment of the invention, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and is higher than 0.002. As described above, the accuracy is higher when the mutation frequency is not higher than 0.005 and the low-frequency mitochondrial DNA point mutation rate is higher than 0.002 as the biomarker of the ovum quality. Therefore, the method provided by the embodiment of the invention can be used for more effectively and accurately screening and obtaining the medicine capable of improving the quality of the ovum or treating or preventing female infertility.

In the ninth aspect of the invention, the invention provides a system for judging the quality of ova, judging the effectiveness of a medicament for treating female infertility or judging the prognosis effect of female infertility patients. According to an embodiment of the invention, with reference to fig. 4, the system comprises: an obtaining device 100 for obtaining mtDNA point mutation rate in a sample to be tested (such as an ovum to be tested); the judging device 200 is connected with the obtaining device 100 and is used for judging the quality of the ovum based on the mtDNA point mutation rate in the sample to be detected, judging the effectiveness of drug treatment on female infertility or judging the prognosis effect of female infertility patients.

According to an embodiment of the present invention, the system may further include at least one of the following additional features:

according to the embodiment of the invention, the mutation frequency of the mtDNA point mutation is not higher than 0.005 and is higher than 0.002.

According to the embodiment of the invention, the mtDNA point mutation rate in the sample to be detected is higher than that in the normal sample, and is an indication that the quality of the ovum of the sample to be detected is low; or the mtDNA point mutation rate in the sample to be detected is reduced after the drug treatment compared with before the drug treatment, and the indication that the effectiveness of the drug treatment on female infertility is good is provided; or compared with the case before the drug treatment after the drug treatment, the mtDNA point mutation rate in the sample to be detected is equivalent to the mtDNA point mutation rate in the normal sample, and the indication is the indication that the female infertility patient has good prognosis effect.

Drawings

FIG. 1 shows blastocyst rate profiles of ova of older and younger women according to one embodiment of the present invention;

FIG. 2 shows a map of the number of mitochondrial genomic point mutations of the ova of older and younger women according to one embodiment of the invention;

FIG. 3 shows a map of mitochondrial genomic point mutation frequencies of eggs from old and young women according to one embodiment of the invention;

fig. 4 shows a schematic structural diagram of a system for determining high or low quality of eggs, effectiveness of drug treatment on female infertility, or prognosis effect of female infertility patients according to an embodiment of the present invention.

Reference numerals:

100: obtaining device

200: judging device

Detailed Description

Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention.

Example 1

The experimental method comprises the following steps: the inventors analyzed clinical data of intracytoplasmic single sperm injection (ICSI) female patients of the cooperative unit, and classified the female patients into a young group (not more than 30 years) and an old group (not less than 38 years) according to age, and systematically analyzed blastocyst formation rates of eggs of female patients of 157 young and 103 old groups subjected to ICSI in 5 to 3 months of 2017. The results of the experiment are shown in FIG. 1.

FIG. 1 shows blastogenesis rates of eggs from 157 young and 103 old female patients receiving ICSI according to the present invention. The results indicate that the rate of blastocyst formation is higher in the young group than in the old group, reflecting that the quality of eggs is poorer in patients with older women than in patients with young women.

Example 2

The experimental method comprises the following steps: the inventors collected immature waste eggs from cooperative units after ICSI, and obtained 9 young female patients and 10 old female patients, and placed 1-4 immature waste eggs from each patient into a centrifuge tube containing 20. mu.L of cell lysis buffer with a lysate ratio of 17.75. mu. L H₂O, 2 muL 10 × KOD buffer, 0.25 muL proteinase K lysis program, 55 ℃ for 45 minutes, 94 ℃ for 5 minutes, and 4 ℃ for 4. mu.L each of the ovum lysates was then taken to perform PCR amplification of the mitochondrial genome, 4 pairs of primers were used to amplify 3561-9794 region, 9795-14567 region, 14562-139 region, and 115-3560 region, respectively, which covered the entire length of the mitochondrial genome, the primers used are shown in Table 1, the PCR conditions were 95 ℃ denaturation for 5 minutes, then 40 cycles of 94 ℃ denaturation for 30 seconds, 57 ℃ annealing for 45 seconds, and 68 ℃ extension, the extension time of each fragment was calculated according to 1000bp per minute (3561-9794 fragment for 6 minutes for 30 seconds, 9795-14567 fragment for 5 minutes, 14562-139 fragment for 2 minutes, 115-3560 fragment for 3 minutes for 30 seconds), then after 68 ℃ extension for 10 minutes, 4 ℃ for storing four fragments at 1%, the gel electrophoresis results were obtained, and the high throughput of the PCR results were obtained by high throughput analysis of the mitochondrial genome.

Table 1: primers for amplification of mtDNA of small number of ova

Primer name	Primer sequences
		3561-FP	ATGAACCCCCCTCCCCATACCC(SEQ ID NO：1)
h1-9794-R1	TGTTGAGCCGTAGATGCCGTCGGAAAT(SEQ ID NO：2)
		h1-9795-F2	TTTTTTGTAGCCACAGGCTTCCACGGACT(SEQ ID NO：3)
h1-14567-R2	TGTGGTCGGGTGTGTTATTATTCT(SEQ ID NO：4)
		h1-14562-F3	CCACACCGCTAACAATCAAT(SEQ ID NO：5)
h1-139-R3	GAATCAAAGACAGATACTGCGACAT(SEQ ID NO：6)
		h1-115-F4	ATGTCGCAGTATCTGTCTTTGATTC(SEQ ID NO：7)
3560-RP	AGTAGAAGAGCGATGGTGAG(SEQ ID NO：8)

FIG. 2 shows the numbers of mitochondrial genomic point mutations in the ova of 9 young female patients and in the ova of 10 old female patients according to the present invention. The results show that the number of the mitochondrial genomic point mutations of the ovum of the old female patients is obviously higher than that of the mitochondrial genomic point mutations of the young female patients.

Example 3

The experimental method comprises the following steps: the inventors further analyzed the results of FIG. 2 to analyze the mutation frequency of mitochondrial genomic point mutations. The results of the experiment are shown in FIG. 3.

FIG. 3 shows the mutation frequencies of the point mutations of the mitochondrial genome of the ovum of 9 young female patients and the ovum of 10 old female patients in the present invention. The results show that the frequency of point mutations in the mitochondrial genome of the ovum of older women patients lies mainly between (0.002, 0.005) and that the number of point mutations in this region of the ovum of older women patients is significantly higher than that of younger women patients.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

SEQUENCE LISTING

<110> Guangzhou biomedical and health research institute of Chinese academy of sciences

<120> biomarkers and uses thereof

<130>PIDC3191815

<160>8

<170>PatentIn version 3.3

<210>1

<211>22

<212>DNA

<213>Artificial

<220>

<223>3561-FP

<400>1

atgaaccccc ctccccatac cc 22

<210>2

<211>27

<212>DNA

<213>Artificial

<220>

<223>h1-9794-R1

<400>2

tgttgagccg tagatgccgt cggaaat 27

<210>3

<211>29

<212>DNA

<213>Artificial

<220>

<223>h1-9795-F2

<400>3

ttttttgtag ccacaggctt ccacggact 29

<210>4

<211>24

<212>DNA

<213>Artificial

<220>

<223>h1-14567-R2

<400>4

tgtggtcggg tgtgttatta ttct 24

<210>5

<211>20

<212>DNA

<213>Artificial

<220>

<223>h1-14562-F3

<400>5

ccacaccgct aacaatcaat 20

<210>6

<211>25

<212>DNA

<213>Artificial

<220>

<223>h1-139-R3

<400>6

gaatcaaaga cagatactgc gacat 25

<210>7

<211>25

<212>DNA

<213>Artificial

<220>

<223>h1-115-F4

<400>7

atgtcgcagt atctgtcttt gattc 25

<210>8

<211>20

<212>DNA

<213>Artificial

<220>

<223>3560-RP

<400>8

agtagaagag cgatggtgag 20

Claims

Use of mtDNA point mutation rate as an ovum quality biomarker;

optionally, the mutation frequency of the mtDNA point mutation is not higher than 0.005, higher than 0.002.
2. A kit for determining egg quality, effectiveness of a medicament for treating female infertility or prognosis effect of female infertility patients, comprising: a reagent for detecting mtDNA point mutation rate.
3. The kit according to claim 2, wherein the mutation frequency of the mtDNA point mutation is not higher than 0.005, higher than 0.002;

optionally, the reagent comprises at least one selected from a primer and a probe for specifically detecting the mtDNA point mutation rate;

optionally, the primer has SEQ ID NO: 1 to 8.
4. The application of the reagent in preparing a kit, wherein the reagent is used for detecting mtDNA point mutation rate, and the kit is used for judging the quality of ova, judging the effectiveness of medicines for treating female infertility or judging the prognosis effect of female infertility patients.
5. The use according to claim 4, wherein the mutation frequency of the mtDNA point mutation is not higher than 0.005, higher than 0.002;

optionally, the reagent comprises at least one selected from a primer and a probe for specifically detecting the mtDNA point mutation rate;

optionally, the primer has SEQ ID NO: 1 to 8.
6. A kit comprising an agent that reduces the mtDNA point mutation rate, said kit being for use in improving ovum quality.
7. A pharmaceutical composition for increasing the quality of an ovum or for treating or preventing infertility in a female, comprising an agent that reduces the mtDNA point mutation rate;

optionally, the mutation frequency of the mtDNA point mutation is not higher than 0.005, higher than 0.002.
8. Use of a reagent for reducing the mtDNA point mutation rate in the manufacture of a kit for improving the quality of an ovum.
9. Use of an agent for reducing mtDNA point mutation rate in the manufacture of a medicament for improving ovum quality or treating or preventing female infertility;

optionally, the mutation frequency of the mtDNA point mutation is not higher than 0.005, higher than 0.002.
10. A method of screening for a drug for increasing ovum quality or treating or preventing female infertility, comprising:

contacting an egg with a candidate drug, the egg being derived from a female patient with low egg quality or infertility,

comparing the mtDNA point mutation rate in the ovum before and after the contact,

a decrease in mtDNA point mutation rate in the egg after exposure as compared to before exposure is indicative of the candidate drug being a drug of interest;

optionally, the mutation frequency of the mtDNA point mutation is not higher than 0.005, higher than 0.002.
11. A system for judging the quality of ova, the effectiveness of a medicament for treating female infertility or the prognosis effect of female infertility patients is characterized by comprising the following steps:

an obtaining device, which is used for obtaining the mtDNA point mutation rate in the sample to be detected,

the judging device is connected with the obtaining device and is used for judging the quality of the ovum based on the mtDNA point mutation rate in the sample to be detected, judging the effectiveness of the drug treatment on female infertility or judging the prognosis effect of female infertility patients;

optionally, the mutation frequency of the mtDNA point mutation is not higher than 0.005, higher than 0.002.
12. The system of claim 11, wherein a mtDNA point mutation rate in the sample under examination that is higher than the mtDNA point mutation rate in a normal sample is an indication that the quality of the ovum of the sample under examination is low; or

Compared with the method before drug treatment, the mtDNA point mutation rate in the sample to be detected is reduced after drug treatment, and the method is an indication of good effectiveness of drug treatment on female infertility; or

Compared with the method before drug treatment, the mtDNA point mutation rate in the sample to be detected is equivalent to the mtDNA point mutation rate in the normal sample after drug treatment, and the method is an indication of good prognosis effect of the female infertility patient.