WO2020247850A1

WO2020247850A1 - Compositions and methods for inhibiting angiopoietin-2

Info

Publication number: WO2020247850A1
Application number: PCT/US2020/036462
Authority: WO
Inventors: Carl ERICKSON; Christopher P. Rusconi; Matthew Levy; Matthew WARNER; Kevin G. Mclure; Derek PARKS
Original assignee: Drive Therapeutics Llc
Priority date: 2019-06-05
Filing date: 2020-06-05
Publication date: 2020-12-10

Abstract

The application discloses methods and compositions for inhibiting functions associated with Angiopoietin-2 (Ang2). The methods and compositions involve the use of aptamers for binding to Ang2 and preventing or reducing association of Ang2 with Tie2. The methods and compositions further involve the use of aptamers for binding to Ang2 and preventing oligomerization of Ang2. The methods and compositions may include one or more aptamers that bind to the receptor binding domain or fibrinogen-like binding domain of Ang2. The methods and compositions may include one or more aptamers that bind to the coiled-coil motif of Ang2. The methods and compositions may include one or more aptamers that bind to a region of Ang2 that binds to cell-surface co- receptors. The application further provides anti-Ang2 aptamers for the treatment of ocular diseases or disorders.

Description

COMPOSmONS AND METHODS FOR INHIBITING ANGIOPOIETIN-2

BACKGROUND OF THE INVENTION

[0001] Visual impairment is a national and global health concern that has a negative impact on physical and mental health. The number of people with visual impairment and blindness is increasing due to an overall aging population. Visual impairment and blindness can be caused by any one of a large number of eye diseases and disorders affecting people of all ages.

SUMMARY OF THE INVENTION

[0002] In one example, age-related macular degeneration (AMD) is an eye disorder that is currently the leading cause of vision loss in people fifty years of age or older in industrialized countries. It is estimated that by 2020, the number of people with AMD could exceed 196 million and by 2040, that number is expected to rise to 288 million. AMD is a degenerative eye disease. Risk factors for the disease include aging, lifestyle factors such as smoking, and genetics. The clearest indicator of progression to AMD is the appearance of drusen, yellow- white deposits under the retina, and it is an important component of both forms of AMD:

exudative ("wet") and non-exudative ("dry"). Wet AMD likely causes vision loss due to abnormal blood vessel growth in the choriocapillaris through Bruch's membrane. The most advanced form of dry AMD, known as geographic atrophy, is generally more gradual and occurs when light-sensitive cells in the macula atrophy, thereby blurring and eliminating vision in the affected eye.

[0003] Diabetic eye disease is a group of eye conditions that affect people with diabetes.

Diabetic retinopathy is thought to be the most prevalent diabetic eye disease and one of the leading causes of blindness in American adults. Diabetic macular edema is a consequence of diabetic retinopathy that may cause swelling in the area of the retina called the macula.

Currently, people suffering from diabetic eye disease may be prescribed an anti-vascular endothelial growth factor (VEGF) therapy, however, such therapies may have limited efficacy for some people. Therefore, there is an unmet need for therapeutics that are efficacious in patients suffering from diabetic eye disease, especially in contexts in which anti-VEGF therapy may not work or may have limited efficacy. [0004] Angiopoietin-2 may play a role in the pathology of diabetic eye diseases. Angiopoietins may be critical for the development and the maintenance of the three vascular systems and the Angiopdetin-2-Tie2 signaling pathway may control vascular permeability, inflammation and angiogenic responses. Ang2 expression may be restricted to sites of vascular remodeling, especially during pathological angiogenesis, and may be a suitable target for anti-angiogenic therapeutics. However, because the Ang2 homolog, Angiopoietin-1 (Ang1), may be important for the maintenance of the adult vasculature and because there is significant sequence and structural homology within the Tie2 receptor binding domains of Ang1 and Ang2, inhibitor specificity towards Ang2 over Ang1 may be important.

[0005] There is an un-met need in the art for inhibitors demonstrating high specificity and potency towards Ang2. Additionally, there is an un-met need in the art for therapeutics that are effective in the eye and for therapeutics that are effective for the treatment of diabetic eye disease. These needs may be met by the aptamers provided in the present disclosure.

SUMMARY

[0006] In one aspect, an aptamer is provided comprising a nucleic acid sequence that selectively binds to Angiopoietin-2 (Ang2), wherein the aptamer inhibits a function associated with Ang2 with an IC₅₀ of less than about 500 pM. In another aspect, an aptamer is provided comprising a nucleic acid sequence that selectively binds to Ang2 with a K_d of less than about 500 pM. In another aspect, an aptamer is provided comprising a nucleic acid sequence that selectively blocks the fibrinogen-like binding domain of Ang2, or the receptor binding domain of Ang2, and inhibits a function associated with Ang2.

[0007] In some cases, any aptamer of the preceding inhibits a function associated with Ang2 with an IC₅₀ of less than about 250 pM. In some cases, any aptamer of the preceding inhibits a function associated with Ang2 with an IC₅₀ of less than about 100 pM. In some cases, any aptamer of the preceding aptamer inhibits a function associated with Ang2 with an IC₅₀ of less than about 50 pM. In some cases, any aptamer of the preceding inhibits a function associated with Ang2 with an IC₅₀ of less than about 10 pM. In some cases, the IC₅₀ is measured by an Ang2-Tie2 competition ELISA assay or a Tie2 phosphorylation assay.

[0008] In some cases, any aptamer of the preceding binds to Ang2 with a K_d of less than about 100 pM. In some cases, any aptamer of the preceding binds to Ang2 with a K_d of less than about 50 pM. In some cases, any aptamer of the preceding binds to Ang2 with a K_d of less than about 10 pM. In some cases, any aptamer of the preceding binds to Ang2 with a K_d of less than about 1 pM. In some cases, any aptamer of the preceding binds to Ang2 with a K_d of less than about 0.5 pM.

[0009] In some cases, any aptamer of the preceding is an RNA aptamer or a modified RNA aptamer. In some cases, at least 50% of the nucleic acid sequence comprises one or more modified nucleotides. In some cases, the one or more modified nucleotides comprises a 2'F- modified nucleotide, a 2'OMe-modified nucleotide, or a combination thereof. In some cases, the one or more modified nucleotides are selected from the group consisting of: 2T-G, 2'OMe-G, 2'OMe-U, 2'OMe-A, 2'OMe-C, a 3' terminal inverted deoxythymidine, and any combination thereof. In some cases, any aptamer of the preceding comprises a nuclease-stabilized nucleic acid backbone. In some cases, any aptamer of the preceding prevents or reduces association of Ang2 with Tie2. In some cases, the nucleic acid sequence has from about 30 to about 90 nucleotides or modified nucleotides, or a combination of nucleotides and modified nucleotides. In some cases, any aptamer of the preceding is conjugated to a polyethylene glycol (PEG) molecule. In some cases, the PEG molecule has a molecular weight of about 40 kDa or less. In some cases, the nucleic acid sequence does not comprise any one of SEQ ID NOs:62-92. In some cases, the nucleic acid sequence comprises any one of SEQ ID NOs:2-61.

[0010] In another aspect, an aptamer is provided having a nucleic acid sequence comprising any one of SEQ ID NOs:2-41 or a nucleic acid sequence having at least 50% sequence identity to any one of SEQ ID NOs:2-41. In yet another aspect, an aptamer is provided selected from the group consisting of the aptamer sequences disclosed in Tables 1-3.

[0011] In another aspect, a method is provided for modulating Ang2 in a biological system, the method comprising: administering to the biological system any aptamer of the preceding, thereby modulating Ang2 in the biological system. In some cases, the biological system comprises a biological tissue or biological cells. In some cases, the biological system is a subject. In some cases, the subject is a human. In some cases, the modulating comprises inhibiting a function associated with Ang2. In some cases, the modulating comprises preventing or reducing an association of Ang2 with Tie2. In some cases, any method of the preceding further comprises administering to the biological system a therapeutically effective amount of an anti-VEGF composition. In some cases, the anti-VEGF composition comprises bevacizumab. ranibizumab, pegaptanib, brolucizumab, abicipar pegol, conbercept, or aflibercept. In some cases, the aptamer and the anti-VEGF composition are administered to the biological system at the same time. In some cases, the aptamer and the anti-VEGF composition are administered to the biological system sequentially or separately.

INCORPORATION BY REFERENCE

[0012] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference in their entireties to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

BRIEF DESCRIPTION OF THE DRAWINGS

[0013] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

[0014] FIG. 1A depicts a non-limiting example of an aptamer library suitable for screening for aptamers that target Angiopoietin-2 according to embodiments of the disclosure.

[0015] FIG. IB depicts a non-limiting example of a reverse oligonucleotide hybridized to a portion of the aptamer library sequence of FIG. 1A according to embodiments of the disclosure.

[0016] FIG. 1C depicts non-limiting examples of structures of modified nucleotides that may be used to generate an aptamer library suitable for the selection of Angiopoietin-2 aptamers according to embodiments of the disclosure.

[0017] FIG. 2A depicts non-limiting examples of flow cytometry data demonstrating the ability of various aptamer selection rounds to bind to unlabeled beads according to embodiments of the disclosure.

[0018] FIG. 2B depicts non-limiting examples of flow cytometry data demonstrating the ability of various aptamer selection rounds to bind to Angiopoietin-1 labeled beads according to embodiments of the disclosure.

[0019] FIG. 2C depicts non-limiting examples of flow cytometry data demonstrating the ability of various aptamer selection rounds to bind to Angiopoietin-2 labeled beads according to embodiments of the disclosure. [0020] FIG. 3 depicts non-limiting examples of flow cytometry data demonstrating the ability of various aptamer selection rounds to bind to Angiopoietin-2 receptor binding domain (RBD)- labeled beads according to embodiments of the disclosure.

[0021] FIG. 4 depicts a non-limiting example of a graph of the relative median fluorescence intensity versus aptamer concentration in a flow cytometry assay of various aptamer selection rounds according to embodiments of the disclosure.

[0022] FIG. 5 depicts non-limiting examples of data obtained from a flow cytometry assay demonstrating the ability of aptamers of the disclosure to bind to Angiopoietin-2 receptor binding domain (RBD) according to embodiments of the disclosure.

[0023] FIG. 6A depicts a non-limiting example of a graph of the relative median fluorescence intensity versus aptamer concentration in a flow cytometry assay of various aptamers of the disclosure according to embodiments of the disclosure.

[0024] FIG. 6B depicts a non-limiting example of a graph of the relative median fluorescence intensity versus aptamer concentration in a flow cytometry assay of various aptamers of the disclosure according to embodiments of the disclosure.

[0025] FIG. 7 depicts a non-limiting example of a graph of the relative fluorescence intensity versus aptamer concentration in a time-resolved fluorescence energy resonance (TR-FRET) assay of an aptamer of the disclosure according to embodiments of the disclosure.

[0026] FIG. 8 depicts non-limiting examples of data demonstrating the ability of various aptamers of the disclosure to block binding of Angiopoietin-2 to Tie2 according to embodiments of the disclosure.

[0027] FIG. 9 depicts non-limiting examples of data demonstrating the ability of various aptamers of the disclosure to inhibit Angiopoietin-2 dependent Tie2 phosphorylation according to embodiments of the disclosure.

[0028] FIG. 10A and FIG. 10B depict the generic structure of the H-type pseudoknot adopted by the Aptamer 18 family of molecules.

[0029] FIG. 11A depicts a secondary structure of an exemplary anti-Ang2 aptamer from the Aptamer 18 family of molecules described in the disclosure (SEQ ID NO:37).

[0030] FIG. 11B depicts a non-limiting example of a consensus structure of anti-Ang2 aptamers from the Aptamer 18 family of molecules described in the disclosure (SEQ ID NO: 97). [0031] FIG. llC depicts a non-limiting example of a consensus structure of anti-Ang2 aptamers from the Aptamer 18 family of molecules described in the disclosure (SEQ ID NO: 484).

[0032] FIG. 11D depicts a non-limiting example of a consensus structure of anti-Ang2 aptamera from the Aptamer 18 family of molecules described in the disclosure (SEQ ID NO: 485).

[0033] FIG. 12 depicts a representation of nucleotide conservation within the top 250 stacks of sequences from round 5 of a secondary selection conducted on the Aptamer 18 family, according to embodiments of the disclosure.

[0034] FIG. 13 depicts competitive TR-FRET data demonstrating the relative affinity of anti- Ang2 aptamer variants from the Aptamer 18 family of molecules according to embodiments of the disclosure. Data is represented as the log of fold change in IC₅₀ as compared to parent aptamer.

[0035] FIG. 14 depicts competitive TR-FRET data demonstrating the relative affinity of anti- Ang2 aptamer variants from the Aptamer 18 family of molecules according to embodiments of the disclosure. Data is represented as the log of fold change in IC₅₀ as compared to parent aptamer.

[0036] FIG. 15 depicts competitive TR-FRET data demonstrating the relative affinity of anti- Ang2 aptamer variants from the Aptamer 18 family of molecules according to embodiments of the disclosure. Data is represented as the log of fold change in IC₅₀ as compared to parent aptamer.

[0037] FIG. 16 depicts competitive TR-FRET data demonstrating the relative affinity of anti- Ang2 aptamer variants from the Aptamer 18 family of molecules according to embodiments of the disclosure. Data is represented as the log of fold change in IC₅₀ as compared to parent aptamer.

[0038] FIG. 17 depicts competitive TR-FRET data demonstrating the relative affinity of anti- Ang2 aptamer variants from the Aptamer 18 family of molecules according to embodiments of the disclosure. Data is represented as the log of fold change in IC₅₀ as compared to parent aptamer.

[0039] FIG. 18 depicts non-limiting examples of TR-FRET data demonstrating the affinity of Aptamers 18, 53, 185, 204 and an anti-Ang2 cross-Mab for Ang2. Compounds were tested in a dose-dependent fashion to determine a Kd against Ang2 according to embodiments of the disclosure. [0040] FIG. 19 depicts non-limiting examples data demonstrating the IC50 of Aptamers 18, 53, 185, 204 and an anti-Ang2 cross-Mab for the ability to inhibit the Ang2:TIE2 interaction using a receptor competition AlphaScreen® assay according to embodiments of the disclosure.

[0041] FIG. 20 depicts non-limiting examples of data demonstrating the ability of Aptamers 185, 204 and an anti-Ang2 cross-Mab to inhibit Ang2 dependent Tie2 phosphorylation according to embodiments of the disclosure.

[0042] FIG. 21 depicts non-limiting examples of data demonstrating the specificity of Aptamer 204 and an anti-Ang2 cross-Mab for Ang2 and Ang1 as determined the ability to inhibit the Ang2:TIE2 or Ang1 :TIE2 interaction using an a receptor competition AlphaScreen® assay according to embodiments of the disclosure.

[0043] FIG. 22 depicts non-limiting examples of data demonstrating the potency of Aptamer P02 compared to Aptamer 185 in a receptor competition AlphaScreen® assay according to embodiments of the disclosure.

[0044] FIG. 23A depicts a secondary structure of an exemplary anti-Ang2 aptamer from the Aptamer 13 family of molecules described in the disclosure (SEQ ID NO:32).

[0045] FIG. 23B depicts a non-limiting example of a consensus structure of anti-Ang2 aptamers from the Aptamer 13 family of molecules described in the disclosure (SEQ ID NO: 107).

[0046] FIG. 23C depicts a non-limiting example of a consensus structure of anti-Ang2 aptamers from the Aptamer 13 family of molecules described in the disclosure (SEQ ID NO: 108).

[0047] FIG. 24 depicts a representation of nucleotide conservation within the top 250 stacks of sequences from round 5 of a secondary selection conducted on the Aptamer 13 family, according to embodiments of the disclosure.

[0048] FIG. 25 depicts competitive TR-FRET data demonstrating the relative affinity of anti- Ang2 aptamer variants from the Aptamer 13 family of molecules according to embodiments of the disclosure. Data is represented as the log of fold change in IC₅₀ as compared to parent aptamer.

[0049] FIG. 26 depicts competitive TR-FRET data demonstrating the relative affinity of anti- Ang2 aptamer variants from the Aptamer 13 family of molecules according to embodiments of the disclosure. Data is represented as the log of fold change in IC₅₀ as compared to parent aptamer.

[0050] FIG. 27 depicts non-limiting examples of TR-FRET data demonstrating the affinity of Aptamers 13, 116, 184, 188 and an anti-Ang2 cross-Mab for Ang2. Compounds were tested in a dose-dependent fashion to determine a Kd against Ang2 according to embodiments of the disclosure.

[0051] FIG. 28 depicts non-limiting examples data demonstrating the IC50 of Aptamers 13, 116, 184, 188 and an anti-Ang2 cross-Mab the ability to inhibit the Ang2:TIE2 interaction using a a receptor competition AlphaScreen® assay according to embodiments of the disclosure.

[0052] FIG. 29 depicts non-limiting examples of data demonstrating the ability of Aptamers 13, 116 and an anti-Ang2 cross-Mab to inhibit Ang2 dependent Tie2 phosphorylation according to embodiments of the disclosure.

[0053] FIG. 30 depicts non-limiting examples of data demonstrating the specificity of Aptamer 188 and an anti-Ang2 cross-Mab for Ang2 and Ang1 as determined the ability to inhibit the Ang2:TIE2 or Ang1 :TIE2 interaction using a receptor competition AlphaScreen® assay according to embodiments of the disclosure.

[0054] FIG. 31 depicts non-limiting examples of data demonstrating the potency of Aptamer P01 compared to Aptamer 184 in a receptor competition AlphaScreen® assay according to embodiments of the disclosure.

DETAILED DESCRIPTION OF THE INVENTION

[0055] The disclosure herein provides aptamer compositions that selectively bind to and inhibit a function associated with Angiopoietin-2 (Ang2) and methods of using such aptamer

compositions. In some cases, the anti-Ang2 aptamers may bind to the fibrinogen-like binding domain of Ang2, or a portion thereof; without wishing to be bound by theory, the action of these anti-Ang2 aptamers may prevent or reduce association of Ang2 with the Tie2 receptor. In some cases, the anti-Ang2 aptamers may bind to the receptor binding domain (RBD) of Ang2, or a portion thereof; without wishing to be bound by theory, the action of these anti-Ang2 aptamers may prevent or reduce association of Ang2 with the Tie2 receptor. Additionally or alternatively, in some cases, the anti-Ang2 aptamers may bind to the coiled-coil motif of Ang2, or a portion thereof; without wishing to be bound by theory, the action of these anti-Ang2 aptamers may prevent or reduce dimerization or oligomerization of Ang2. Additionally or alternatively, in some cases, the anti-Ang2 aptamers may bind to a region of Ang2 that is important for binding to cell-surface co-receptors (e.g.., Tie1, integrin a_vb₃, integrin a_nb_5, integrin a₅b₁). Additionally or alternatively, in some cases, the anti-Ang2 aptamers may bind to a region of Ang2 such that a molecule conjugated to the anti-Ang2 aptamer (e.g., a polyethylene glycol polymer) is positioned in a manner such that the conjugate itself may prevent or reduce association of Ang2 with Tie2, may prevent or reduce Ang2 dimerization or oligomerization, or may prevent or reduce Ang2 binding to cell-surface co-receptors of Tie2.

[0056] The disclosure herein further provides aptamer compositions having unique H-type pseudoknot or stem-loop secondary structures that selectively bind to and inhibit a function associated with Ang2 and methods of using such aptamer compositions. In one aspect, a first structural family of aptamers is provided (hereinafter referred to as the“Aptamer 18 structural family” or“Aptamer 18 family”). The Aptamer 18 structural family of aptamers may comprise the parent aptamer, Aptamer 18, as disclosed herein, as well as additional aptamers that share common structural features with Aptamer 18. The Aptamer 18 structural family of aptamers generally comprise aptamers that selectively bind to and inhibit functions associated with Ang2. In some cases, the Aptamer 18 structural family may comprise H-type pseudoknot secondary structures having, in a 5’ to 3’ direction, a first side of a first base paired stem (e.g., S1); a first side of a second base paired stem (e.g., S2); a first loop (e.g., L1); a first side of a third base paired stem (e.g., S3); a second, complementary side of the first base paired stem (e.g., S1’); a second loop (e.g., L2); a second, complementary side of the third base paired stem (e.g., S3’); a third loop (e.g., L3); a second, complementary side of the second base paired stem (e.g., S2’); and a 3’ unpaired terminal sequence (e.g., 3’T). In some cases, the Aptamer 18 structural family may comprise H-type pseudoknots having, in a 5’ to 3’ direction, a first side of a first base paired stem (e.g., S1); a fourth loop (e.g., L4); a first side of a second base paired stem (e.g., S2); a first loop (e.g., L1); a first side of a third base paired stem (e.g., S3); a second, complementary side of the first base paired stem (e.g., S1’); a second loop (e.g., L2); a second, complementary side of the third base paired stem (e.g., S3’); a third loop (e.g., L3); a second, complementary side of the second base paired stem (e.g., S2’); and a 3’ unpaired terminal sequence (e.g., 3’T). In some cases, the Aptamer 18 structural family may comprise H-type pseudoknots having, in a 5’ to 3’ direction, a first side of a first base paired stem (e.g.., S1); a fourth loop (e.g.., L4); a first side of a second base paired stem (e.g.., S2); a first loop (e.g., L1); a first side of a third base paired stem (e.g.., S3); a fifth loop (e.g., L5); a second, complementary side of the first base paired stem (e.g, SV); a second loop (e.g., L2); a second, complementary side of the third base paired stem (e.g., S3’); a third loop (e.g., L3); a second, complementary side of the second base paired stem (e.g., S2’); and a 3’ unpaired terminal sequence (e.g., 3’T). In some cases, the Aptamer 18 structural family may comprise H-type pseudoknots having, in a 5’ to 3’ direction, a first side of a first base paired stem (e.g., S1); a first side of a second base paired stem (e.g.., S2); a first loop (e.g.., L1); a first side of a third base paired stem (e.g., S3); a fifth loop (e.g., L5); a second, complementary side of the first base paired stem (e.g., SV); a second loop (e.g., L2); a second, complementary side of the third base paired stem (e.g.., S3’); a third loop (e.g., L3); a second, complementary side of the second base paired stem (e.g., S2’); and a 3’ unpaired terminal sequence (e.g., 3’T). Put another way, aptamers of the Aptamer 18 structural family may have the following H-type pseudoknot structure: 5’-S1-S2- L1-S3-S1’-L2-S3’-L3-S2’-3’T-3’; 5’-S1- L4-S2-L1-S3-S1’-L2-S3’-L3-S2’-3’T-3’; 5’-S1-L4-S2-L1-S3-L5-S1’-L2-S3’-L3-S2’-3’T-3’; or 5’ -S 1 -S2-L 1 -S3-L5-S 1’ -L2-S3’ -L3-S2’-3’ T-3’ . The Aptamer 18 structural family of aptamers described herein may also include one or more further elements (e.g., additional stem(s) or loop(s)). In some cases, additional elements (stem(s), loop(s), one or more nucleotides, etc.) may be located before (e.g., 5’ side) the first side of the first base paired stem, after (e.g.., 3’ side) of the 3’T or the second complementary side of the second base paired stem, or both. In some cases, additional elements may be located interspersed between other elements of the aptamer.

Additional elements may include additional stem structures, loop structures, non-nucleotidyl linkers, or any number of overhanging, unpaired nucleotides.

[0057] In some aspects, each element may be adjacent to each other. For example, the Aptamer 18 structural family may comprise aptamers having, in a 5’ to 3’ direction, a first side of a first base paired stem. The 3’ terminal end of the first side of the first base paired stem may be connected to the 5’ terminal end of the first side of the second base paired stem. Alternatively, if a fourth loop is present, the fourth loop may be connected at its 5’ terminal end to the 3’ terminal end of first side of the first base paired stem, and the fourth loop may be connected at its 3’ terminal end to the 5’ terminal end of the first side of the second base paired stem. The first side of the second base paired stem may be connected at its 5’ terminal end to the 3’ end of the first side of the first base paired stem, and the first side of the second base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the first loop. Alternatively, if a fourth loop is present, the first side of the second base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the fourth loop, and the first side of the second base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the first loop. The first loop may be connected at its 5’ terminal end to 3’ terminal end of the first side of the second stem, and the first loop may be connected at its 3’ terminal end to the 5’ terminal end of the first side of the third base paired stem. The first side of the third base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the first loop, and the first side of the third base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the second,

complementary side of the first base paired stem. Alternatively, if a fifth loop is present, the fifth loop may be connected at its 5’ terminal end to the 3’ terminal end of first side of the third base paired stem, and the fifth loop may be connected at its 3’ terminal end to the 5’ terminal end of the second, complementary side of the first base paired stem. The second, complementary side of the first base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the first side of the third base paired stem, and the second, complementary side of the first base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the second loop. Alternatively, if a fifth loop is present, the second, complementary side of the first base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the fifth loop, and the second, complementary side of the first base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the second loop. The second loop may be connected at its 5’ terminal end to the 3’ terminal end of the second, complimentary side of the first base paired stem, and the second loop may be connected at its 3’ terminal end to the 5’terminal end of the second, complementary side of the third base paired stem. The second, complementary side of the third base paired stem may be connected at its 5’ terminal end to the 3’terminal end of the second loop, and the second, complementary side of the third base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the third loop. The third loop may be connected at its 5’ terminal end to the 3’ terminal end of the second, complementary side of the third base paired stem, and the third loop may be connected at its 3’ terminal end to the 5’ terminal end of the second, complementary side of the second base paired stem. The second, complementary side of the second base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the third loop, and the second, complementary side of the second base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the 3’ unpaired terminal sequence. In some cases, the Aptamer 18 structural family may include aptamers comprising two terminal stems. In some cases, the first terminal stem may be the first base paired stem. In some cases, the second terminal stem may be the second base paired stem. In some cases, the Aptamer 18 structural family may include aptamer comprising no terminal loops. Non-limiting examples of Aptamer 18 structural family aptamer that may be used to inhibit Ang2 are described throughout.

[0058] As described above, in some cases, the Aptamer 18 structural family may comprise anti- Ang2 aptamers that have the following H-type pseudoknot structure: 5’-S1-S2-L1-S3-S1’-L2- S3^,-L3-S2^,-3’T-3^,; 5^,-S1-L4-S2-L1-S3-SV-L2-S3^,-L3-S2^,-3^,T-3^,; 5^,-S1-L4-S2-L1-S3-L5-Sr- L2-S3’-L3-S2’-3’T-3’; or 5’-S1-S2-L1-S3-L5-S1’-L2-S3’-L3-S2^,-3^,T-3’. In some cases, S1/S1, S2/S2’, S3/S3’, L1, L2, L3 and/or 3’T may comprise any combination of nucleotide sequence provided in Tables 13-19 and Tables 21-25. Additionally, such aptamers may include on or more of the following: L4 may be 5’-G-3’ or 5’-ACG-3’, and L5 may be 5’-A-’.

[0059] In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid sequence of 5’- U VSGGRCDNNCCUGCSB ANNHAC AGGHNVNGY CGNU-3’ (SEQ ID NO: 97), where V is A, C or G, S is G or C, R is A or G, D is A, G or U, N is any nucleotide, B is C , G or U, H is A, C or U and Y is C or U. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid sequence of 5’-

UVSGGRCRANCCUGCSBANNHACAGGHNVNGYCGNU-3’(SEQ ID NO: 98), where V is A, C or G, S is G or C, R is A or G, D is A, G or U, N is any nucleotide, B is C , G or U, H is A, C or U, and Y is C or U. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid sequence of 5’-

UVSGGRCDNNCCUGCSBANNHACAGGYAVNGYCGNU-3’ (SEQ ID NO: 99), where V is A, C or G, S is G or C, R is A or G, D is A, G or U, N is any nucleotide, B is C , G or U, H is A, C or U, and Y is C or U. In some cases, an anti-Ang2 aptamer of the disclosure amy comprise a consensus nucleic acid sequence of 5’-

NSGGGRCRNWVNNDCCSNNNNNHNNBYRVAGYCN-3’ (SEQ ID NO: 100), where N is any nucleotide, S is G or C, R is A or G, W is A or U, V is A, G or C, D is A, G or U, H is A, C or U, B is C , G or U, and Y is C or U. In some cases, an anti-Ang2 aptamer of the disclosure amy comprise a consensus nucleic acid sequence of 5’- NSGGGRCRNWVNNDCC SNNNNNHNNB YRVAGYCG-3’ (SEQ ID NO: 101), where N is any nucleotide, S is G or C, R is A or G, W is A or U, V is A, G or C, D is A, G or U, H is A, C or U, B is C , G or U, and Y is C or U. In some cases, an anti-Ang2 aptamer of the disclosure amy comprise a consensus nucleic acid sequence of 5’-

MCGGGGCAAUCCUGCCGKUUUACAGGUAAAGCCG-3’ (SEQ ID NO: 102), where M is A or C, and K is G or U.

[0060] In another aspect, a second structural family of aptamers is provided (hereinafter referred to as the“Aptamer 13 structural family” or“Aptamer 13 family”). The Aptamer 13 structural family of aptamers may comprise the parent aptamer, Aptamer 13, as disclosed herein, as well as additional aptamers that share common structural features with Aptamer 13. The Aptamer 13 structural family of aptamers generally comprise aptamers that selectively bind to and inhibit functions associated with Ang2. In some cases, the Aptamer 13 structural family may comprise stem-loop secondary structures having, in a 5’ to 3’ direction, a first side of a first base paired stem (e.g., S1); a first loop (e.g.., L1); a first side of a second base paired stem (e.g., S2); a second loop (e.g., L2); a second, complementary side of the second base paired stem (e.g., S2’); a third loop (e.g., L3); and a second, complementary side of the first base paired stem (e.g., S1’). Put another way, aptamers of the Aptamer 13 structural family may have the following stem-loop structure: 5’-S1-L1-S2-L2-S2’-L3-S1’- ’. The Aptamer 13 structural family of aptamers described herein may also include one or more further elements (e.g., additional stem(s) or loop(s)). In some cases, additional elements (stem(s), loop(s), one or more nucleotides, etc.) may be located before (e.g., 5’ side) the first side of the first base paired stem, after (e.g., 3’ side) the second complementary side of the second base paired stem, or both. In some cases, additional elements may be located interspersed between other elements of the aptamer. Additional elements may include additional stem structures, loop structures, non-nucleotidyl linkers, or any number of overhanging, unpaired nucleotides.

[0061] In some aspects, each element may be adjacent to each other. For example, the Aptamer 13 structural family may comprise aptamers having, in a 5’ to 3’ direction, a first side of a first base paired stem. The 3’ terminal end of the first side of the first base paired stem may be connected to the 5’ terminal end of the first side of the first loop. The first loop may be connected at its 5’ terminal end to the 3’ terminal end of the first side of the first base paired stem, and the first loop may be connected at its 3’ terminal end to the 5’ terminal end of the first side of the second base paired stem. The first side of the second base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the first loop, and the first side of the second base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the second loop. The second loop may be connected at its 5’ terminal end to the 3’ terminal end of the first side of the second base paired stem, and the second loop may be connected at its 3’ terminal end to the 5’ terminal end of the second, complementary side of the second base paired stem. The second, complementary side of the second base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the second loop, and the second, complementary side of the second base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the third loop. The third loop may be connected at its 5’ terminal end to the 3’ terminal end of the second, complimentary side of the second base paired stem, and the third loop may be connected at its 3’ end to the second, complementary side of the first base paired stem. The second, complementary side of the first base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the third loop. In some cases, the Aptamer 13 structural family may include aptamers comprising a terminal stem. In some cases, the terminal stem may be the first base paired stem. In some cases, the Aptamer 13 structural family may include aptamers comprising a terminal loop. In some cases, the terminal loop may be the second loop. Non-limiting examples of Aptamer 13 structural family aptamer that may be used to inhibit Ang2 are described throughout.

[0062] As described above, in some cases, the Aptamer 13 structural family may comprise anti- Ang2 aptamers that have the following stem-loop structure: 5’-S1-L1-S2-L2-S2’-L3-S1’-’. In some cases, S1/SV, S2/S2’, L1, L2, and/or L3 may comprise any combination of nucleotide sequence provided in Tables 34-38 and 41-44.

[0063] In some aspects, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid sequence. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid structure of 5’- GGUACACCGUGG-3’ (SEQ ID NO: 103). In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid structure of 5’-GAGUCGCAC-’. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid structure of 5’-SKKAUGAW-3’, where S is G or C, K is G or U, and W is A or U. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid structure of 5’- GWNNHMM -3’, where W is A or U, N is any nucleotide, H is A, C or U, and M is A or C. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid structure of 5’-

USGGMADAGGCAAAHCANMACCGWNNHMMCCSAHNU -3 (SEQ ID NO: 104), where S is G or C, M is A or C, D is A, G, or U, H is A, C or U, W is A or U, and N is any nucleotide. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid structure of 5’-NNBDHNDWGGHDVDNNNNNHCCRNNNNNNHVNNNNU-3’(SEQ ID NO: 105), where B is C, G, or U, D is A, G or U, W is A or U, R is G or A, V is A, C or G, and N is any nucleotide.

[0064] The disclosure herein further provides methods and compositions for the treatment of ocular diseases or disorders. In some cases, the methods and compositions include the use of an anti-Ang2 aptamer for, e.g.., the treatment of ocular diseases or disorders. Additionally or alternatively, the methods and compositions may include the use of an anti-Ang2 aptamer of the disclosure, in combination with an anti-vascular endothelial growth factor (VEGF) inhibitor, for the treatment of an ocular disease or disorder. In some cases, the ocular disease or disorder comprises an age-related macular degeneration (AMD). In some cases, macular degeneration comprises wet age-related macular degeneration (wet AMD). In some cases, macular degeneration comprises dry age-related macular degeneration (dry AMD). In some cases, the ocular disease or disorder comprises proliferative diabetic retinopathy. In some cases, the ocular disease or disorder comprises non-proliferative diabetic retinopathy. In some cases, the ocular disease or disorder comprises a macular edema. In some cases, the ocular disease or disorder comprises diabetic macular edema (DME). In some cases, the ocular disease or disorder comprises central retinal vein occlusion (CRVO). In some cases, the ocular disease or disorder comprises retinopathy of prematurity (ROP). In some cases, the ocular disease or disorder comprises rhegmatogenous retinal detachment. In some cases, the ocular disease or disorder comprises choroidal neovascularization. In some cases, the ocular disease or disorder comprises proliferative vitreoretinopathy . In some aspects of the disclosure, the methods and compositions may involve partial or complete inhibition of a function associated with Ang2. In some cases, the methods and compositions may involve partial or complete inhibition of a function associated with Ang2 for the treatment of ocular diseases. Additionally or alternatively, the methods and compositions may involve partial or complete inhibition of a function associated with Ang2, in combination with partial or complete inhibition of a function associated with VEGF, for the treatment of an ocular disease or disorder. In some cases, the methods and compositions may involve the inhibition of a function associated with Ang2 for the treatment of wet age-related macular degeneration. In some cases, the methods and compositions may involve the inhibition of a function associated with Ang2 for the treatment of dry age-related macular degeneration. In some cases, the methods and compositions may involve the inhibition of a function associated with Ang2 for the treatment of proliferative diabetic retinopathy. In some cases, the methods and compositions may involve the inhibition of a function associated with Ang2 for the treatment of non-proliferative diabetic retinopathy. In some cases, the methods and compositions may involve the inhibition of a function associated with Ang2 for the treatment of diabetic macular edema. In some cases, the methods and compositions may involve the inhibition of a function associated with Ang2 for the treatment of central retinal vein occlusion. In some cases, the methods and compositions may involve the inhibition of a function associated with Ang2 for the treatment of retinopathy of prematurity. In some cases, the methods and compositions may involve the inhibition of a function associated with Ang2 for the treatment of rhegmatogenous retinal detachment. In some cases, the methods and compositions may involve the inhibition of a function associated with Ang2 for the treatment of choroidal neovascularization. In some cases, the methods and compositions may involve the inhibition of a function associated with Ang2 for the treatment of proliferative vitreoretinopathy.

Additionally or alternatively, the methods and compositions may involve the inhibition of a function associated with Ang2, in combination with inhibition of a function associated with VEGF, for the treatment of any one of wet age-related macular degeneration, dry age-related macular degeneration, proliferative diabetic retinopathy, non-proliferative diabetic retinopathy, diabetic macular edema, central retinal vein occlusion, retinopathy of prematurity, and rhegmatogenous retinal detachment.

[0065] In various aspects, the compositions may include oligonucleotides (e.g., aptamers) that selectively bind to and inhibit a function associated with Ang2. In some aspects, the

oligonucleotide compositions may bind directly to Ang2 and inhibit a function thereof. In some cases, the oligonucleotide compositions of the disclosure bind to the coiled-coil motif of Ang2.

In some cases, binding of an oligonucleotide composition of the disclosure to the coiled-coil motif of Ang2 may prevent dimerization of Ang2 (e.g., homodimerization or

heterodimerization). In some cases, binding of an oligonucleotide composition of the disclosure to the coiled-coil motif may prevent the formation of Ang2 complexes (e.g.., tetramers, hexamers, or higher order oligomers). In other aspects, oligonucleotide compositions of the disclosure may bind to the fibrinogen-like binding domain or the receptor binding domain of Ang2. In some cases, binding of oligonucleotide compositions of the disclosure to the fibrinogen-like binding domain or the receptor binding domain of Ang2 may prevent binding of Ang2 to the Tie2 receptor. In other aspects, oligonucleotide compositions of the disclosure may bind to a region of Ang2 involved in Ang2 binding to specific cell surface co-receptors. In some cases, such oligonucleotide compositions may prevent association of Ang2 with specific cell surface co- receptors (e.g., Tie1, integrin a_vb₃, integrin a_nb₅, integrin a_nb₁), thereby inhibiting a function associated with Ang2. In some cases, the oligonucleotides are aptamers including, but not limited to, RNA aptamers, DNA aptamers, modified RNA aptamers, or modified DNA aptamers.

[0066] In general,“sequence identity” refers to an exact nucleotide-to-nucleotide or amino acid- to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Typically, techniques for determining sequence identity include determining the nucleotide sequence of a polynucleotide and/or determining the amino acid sequence encoded thereby, and comparing these sequences to a second nucleotide or amino acid sequence. Two or more sequences (polynucleotide or amino acid) can be compared by determining their“percent identity.” The percent identity of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences divided by the length of the longer sequence and multiplied by 100. Percent identity may also be determined, for example, by comparing sequence information using the advanced BLAST computer program, including version 2.2.9, available from the National Institutes of Health. The BLAST program is based on the alignment method of Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 87:2264-2268 (1990) and as discussed in Altschul, et al, J. Mol. Biol., 215:403-410 (1990); Karlin And Altschul,

Proc. Natl. Acad Sci. USA, 90:5873-5877 (1993); and Altschul et al., Nucleic Acids Res.

25:3389-3402 (1997). The program may be used to determine percent identity over the entire length of the oligonucleotides or proteins being compared. Default parameters are provided to optimize searches with short query sequences in, for example, with the blastp program. The program also allows use of an SEG filter to mask-off segments of the query sequences as determined by the SEG program of Wootton and Federhen, Computers and Chemistry 17:149- 163 (1993). Ranges of desired degrees of sequence identity are approximately 50% to 100% and integer values therebetween. In general, this disclosure encompasses sequences with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity with any sequence provided herein. In general, this disclosure encompasses sequences with about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 98% sequence identity with any sequence provided herein.

[0067] In general,“modification identity” refers to two polynucleotides with identical patterns of modifications on a nucleotide-to-nucleotide level. Techniques for determining modification identity may include determining the modifications of a polynucleotide and comparing these modifications to modifications of a second polynucleotide. The percent modification identity of two sequences is the number of exact modification matches between two aligned sequences divided by the length of the longer sequence of the longer sequence and multiplied by 100. Ranges of desired degrees of modification identity are generally approximately 80% to 100%. In general, this disclosure encompasses sequences with at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% modification identity with any sequence provided herein. In general, this disclosure encompasses sequences with about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 98%

modification identity with any sequence provided herein.

[0068] The term“about,” as used herein, generally refers to a range that is 15% greater than or less (±) than a stated numerical value within the context of the particular usage. For example, “about 10” would include a range from 8.5 to 11.5.

[0069] As used herein, the term“or” is used nonexclusively to encompass“or” and“and.” For example,“A or B” includes“A but not B,”“B but not A,” and“A and B” unless otherwise indicated.

[0070] In some instances, a therapeutic agent for use in the methods described herein is isolated or purified.“Isolated” (used interchangeably with“substantially pure” or“purified”) as used herein means that an agent is synthesized chemically; or has been separated from other agents.

A therapeutic agent may be, for example, at least 95% purified. In some instances, a

composition that comprises therapeutic agent has been treated to remove one or more endotoxins such that the composition can be administered to a subject. Angiopoietin-2 as a Target for Inhibition

[0071] This disclosure generally provides compositions that target angiopoietins, particularly Angiopoietin-2 (Ang2), and methods of using such compositions to modulate angiopoietin signaling pathways. Ang2 may be important for the development and maintenance of the three mammalian vascular systems; as such, the compositions and methods provided herein may impact the development and maintenance of the vasculature. In preferred embodiments, the methods and compositions provided herein target angiogenesis, and generally may have anti- angiogenic properties.

[0072] Ang2 is one of four members of the angiopoietin family of secreted glycoproteins.

Additional members of this family include angiopoietin- 1 (Ang1), angiopoietin-3 (Ang3) and angiopoietin-4 (Ang4). Ang1 is likely an agonist of the receptor tyrosine kinase (RTK) with Ig and epidermal growth factor homology domains receptor, Tie2. Ang2 is a vertebrate receptor tyrosine kinase antagonist that may also act as a Tie 2 agonist under certain context-specific conditions. Ang2 likely inhibits Ang1-mediated Tie2 phosphorylation by competing for the same receptor-binding site on Tie2.

[0073] Sequence homology between Human Ang1 and Ang2 is roughly 64%. Structurally, the angiopoietins are very similar, sharing a notable N-terminal signal peptide (Metl-Thrl5 for Ang1 and Met1-Ala18 for Ang2) and super-clustering coiled-coil motif (Phe78 - Leu261 for Ang1 and Asp75-Gln248 for Ang2), and a C-terminal fibrinogen-like binding domain, including the receptor binding domain of Ang2 (Arg277-Phe498 for Ang1; Lys275-Phe496 for Ang2).

The anti-Ang2 compositions provided herein may be designed to bind specifically to Ang2, and may generally demonstrate little to no binding of Ang1, Ang3, or Ang4.

[0074] This disclosure provides compositions that include aptamers that bind to and antagonize a function associated with Ang2. Generally, the aptamers described herein may be designed to bind to a specific region of Ang2, and the mechanism of inhibition of Ang2 function may vary according to where the aptamer binds.

[0075] In some aspects, the disclosure provides compositions that bind to the receptor binding domain or fibrinogen-like binding domain of Ang2. The C-terminal domain (including the fibrinogen-like binding domain) of Ang2 may be responsible for binding the

immunoglobulin(Ig)-like domain of Tie2. Accordingly, aptamers that target the receptor binding domain or fibrinogen-like binding domain of Ang2 may prevent or reduce binding of Ang2 to Tie2.

[0076] In some aspects, the disclosure provides compositions that bind to the coiled-coil motif of Ang2. Without wishing to be bound by theory, the coiled-coil motif may be important for mediating the homo- and heterodimerization of the angiopoietins. In some cases, homo- and heterodimerization of the angiopoietins may be important for influencing the activity of Tie2 and the downstream signaling processes that it controls. In some cases, Ang2 may be found as tetramers, hexamers and higher-order oligomers in solution. Thus, in some cases, the anti-Ang2 compositions may bind to the coiled-coil motif of Ang2. In some cases, such compositions may prevent homo- and/or heterodimerization of Ang2. In some cases, such compositions may prevent or reduce formation of tetramers hexamers, or higher-order oligomers of Ang2.

[0077] In some aspects, the disclosure provides compositions that bind to regions of Ang2 that are involved in binding to specific cell-surface co-receptors. Endothelial cells may contain unique Tie2 binding co-receptors such as the Tie2 homolog, Tie1, or integrins, which may provide a means to discriminate the angiopoietins from each other. Although Tie2 may be the primary receptor of the angiopoietins, integrins such as the a_vb₃, a_nb₅ and a₅b₁ integrins may also be capable of binding to Ang2, albeit with low affinity, and may play a role in regulating the activities of these proteins in both a Tie2-dependent and Tie2-independent manner. Thus, although the dominant cellular responses to Ang2 may result from direct interactions with Tie2, they may also involve the interactions of co-receptors. Alternatively, cellular responses to Ang2 may occur through direct interactions with the integrins themselves. Hence, in some cases, the anti-Ang2 compositions provided herein may bind to regions of Ang2 that prevent binding of Ang2 with Tie1, a_vb₃ integrin, a_nb₅ integrin, and/or a₅b₁ integrin.

[0078] In one instance, an amino add sequence of human Ang2 comprises the following sequence:

Aptamers

[0079] In some cases, the methods and compositions described herein comprise one or more aptamers for the treatment of an ocular disease. In some cases, the methods and compositions described herein comprise one or more aptamers for inhibiting an activity associated with Ang2. Inhibition can be about 2% or more or 2-fold or more compared to a negative control.

[0080] The term aptamer as used herein may refer to oligonucleotide molecules and analogues thereof that bind to a target (e.g., a protein) with high affinity and specificity through non- Watson-Crick base pairing interactions. Generally, the aptamers described herein are non- naturally occurring oligonucleotides (i.e., synthetically produced) that are isolated and used for the treatment of a disorder or a disease. Aptamers can bind to essentially any target molecule including, without limitation, proteins, oligonucleotides, carbohydrates, lipids, small molecules, and even bacterial cells. The aptamers described herein are generally oligonucleotides that bind to Ang2. Whereas many naturally occurring oligonucleotides, such as mRNA, encode information in their linear base sequences, aptamers generally do not encode information in their linear base sequences. Further, aptamers can be distinguished from many naturally occurring oligonucleotides in that binding of aptamers to target molecules is dependent upon secondary and tertiary structures of the aptamer.

[0081] Aptamers may be suitable as therapeutic agents and may be preferable to other therapeutic agents because: 1) aptamers may be fast and economical to produce because aptamers can be developed entirely by in vitro processes; 2) aptamers may have low toxicity and may lack an immunogenic response; 3) aptamers may have high specificity and affinity for their targets; 4) aptamers may have good solubility; 5) aptamers may have tunable pharmacokinetic properties; 6) aptamers may be amenable to site-specific conjugation of PEG and other carriers; and 7) aptamers may be stable at ambient temperatures.

[0082] Aptamers can include RNA, DNA, modified RNA, modified DNA, any nucleic acid analogue, and/or combinations thereof. Aptamers can be single-stranded oligonucleotides. In some cases, aptamers may comprise more than one nucleic acid strand (e.g.., two or more nucleic acid strands). Aptamers may be monomeric (composed of a single unit) or multimeric (composed of multiple units). Multimeiic aptamers can be homomeric (composed of multiple identical units) or heteromeric (composed of multiple non-identical units). Aptamers herein may be described by their primary structures, meaning the linear nucleotide sequence of the aptamer. Aptamer sequences herein are generally described from the 5' end to the 3' end, unless otherwise stated.

[0083] Aptamers as described herein may include any number of modifications that can affect the function or affinity of the aptamer. For example, aptamers may be unmodified or they may contain modified nucleotides to improve stability, nuclease resistance or delivery characteristics. Examples of such modifications may include chemical substitutions at the sugar and/or phosphate and/or base positions, for example, at the 2' position of ribose, the 5' position of pyrimidines, and the 8' position of purines, various 2'-modified pyrimidines and purines and modifications with 2'-amino (2-NH₂), 2'-fluoro (2'-F), and/or 2'-O-methy1 (2'-OMe) substituents. In some cases, aptamers described herein comprise a 2'-OMe and/or a 2”F modification to increase in vivo stability. In some cases, the aptamers described herein contain modified nucleotides to improve the affinity and specificity of the aptamers for a specific epitope.

Examples of modified nucleotides include those modified with guanidine, indole, amine, phenol, hydroxymethyl, or boronic acid. In other cases, pyrimidine nucleotide triphosphate analogs or CE-phosphoramidites may be modified at the 5' position to generate, for example, 5- benzylaminocarbonyl-2'-deoxyuridine (BndU); 5-[N-(phenyl-3-propyl)caiboxamide]-2'- deoxyuridine (PPdU); 5-(N-thiophenylmethylcarboxyamide)-2^,-deoxyuridine (ThdU); 5-(N-4- fluorobenzylcarboxyamide)-2'-deoxyuridine (FBndU); 5-(N-(l-naphthylmethyl)carboxamide)- 2'-deoxyuridine (NapdU); 5 -(N-2-naphthylmethylcarboxyamide)-2'-deoxyuridine (2NapdU); 5- (N-l-naphthylethylcarboxyamide)-2'-deoxyuridine (NEdU); 5-(N-2- naphthylethylcarboxyamide)-2'-deoxyuridine (2NEdU); 5-(N-tryptaminocarboxyamide)-2'- deoxyuridine (TrpdU); 5-isobutylaminocarbonyl-2'-deoxyuridine (IbdU); 5-(N- tyrosylcarboxyamide)-2'-deoxyuridine (TyrdU); 5-(N-isobutylaminocarbonyl-2'-deoxyuridine (iBudU); 5-(N-benzylcarboxyamide)-2'-0-methyluridine, 5-(N-benzylcarboxyamide)-2'- fluorouridine, 5-(N-phenethylcarboxyamide)-2'-deoxyuridine (PEdU), 5-(N-3,4- methylenedioxybenzylcarboxyamide)-2'-deoxyuridine (MBndU), 5-(N- imidizolylethylcarboxyamide)-2^,-deoxyuridine (ImdU), 5-(N-isobutylcarboxyamide)-2'-0- methyluridine, 5-(N-isobutylcarboxyamide)-2'-fluorouridine, 5-(N-R-threoninylcarboxyamide)- 2'-deoxyuridine (ThrdU), 5-(N-tryptaminocarboxyamide)-2'-0-methyluridine, 5-(N- tryptaimnocarboxyamide)-2'-fluorouridine, 5-(N-[ 1 -(3- trimethylamonium)propyl]carboxyamide)-2'-deoxyuridine chloride, 5-(N- naphthylmethylcarboxyamide)-2'-0-methyluridine, 5-(N-naphthylmethylcarboxyamide)-2'- fluorouridine, 5-(N-[l -(2,3-dihydroxypropyl)]carboxyamide)-2'-deoxyuridine), 5-(N-2- naphthylmethylcarboxyamide)-2'-0-methyluridine, 5-(N-2-naphthylmethylcarboxyamide)-2'- fluorouridine, 5-(N- 1 -naphthylethylcarboxyamide)-2'-0-methyluridine, 5-(N-l- naphthylethylcarboxyamide)-2'-fluorouridine, 5-(N-2-naphthylethylcarboxyamide)-2'-0- methyluridine, 5-(N-2-naphthylethylcarboxyamide)-2'-fluorouridine, 5-(N-3- benzofuranylethylcarboxyamide)-2'-deoxyuridine (BFdU), 5-(N-3- benzofiuranylethylcarboxyamide)-2'-0-methyluridine, 5-(N-3-benzofuranylethylcarboxyamide)- 2'-fluorouridine, 5-(N-3-benzothiophenylethylcarboxyamide)-2'-deoxyuridine (BTdU), 5-(N-3- benzothiophenylethylcarboxyamide)-2^,-0-methyluridine, 5-(N-3- benzothiophenyletbylcarboxyamide)-2^,-fluorouridine; 5-[N-(l-morpholino-2- ethyl)carboxamide]-2'-deoxyuridine (MOEdu); R-tetrahydrofuranylmethyl-2'-deoxyuridine (RTMdU); 3-methoxybenzyl-2'-deoxyuridine (3MBndU); 4-methoxybenzyl-2'-deoxyuridine (4MBndU); 3,4-dimethoxybenzyl-2’-deoxyuridine (3,4DMBndU); S-tetrahydrofuranylmethyl-2'- deoxyuridine (STMdU); 3,4-methylenedioxyphenyl-2-ethyl-2’-deoxyuridine (MPEdU); 4- pyridinylmethyl-2'-deoxyuridine (PyrdU); or l-benzimiidazol-2-ethyl-2^,-deoxyuridine (BidU); 5- (amino-1-propenyl)-2'-deoxyuridine; 5-(indole-3-acetamido-1-propenyl)-2'-deoxyuridine; or 5- (4-pivaloylbenzamido-l-propenyl)-2'-deoxyuridine.

[0084] Modifications of the aptamers contemplated in this disclosure include, without limitation, those which provide other chemical groups that incorporate additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interaction, and functionality to the nucleic acid aptamer bases or to the nucleic acid aptamer as a whole. Modifications to generate

oligonucleotide populations that are resistant to nucleases can also include one or more substitute intemucleotide linkages, altered sugars, altered bases, or combinations thereof. Such

modifications include, but are not limited to, 2'-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil; backbone modifications, phosphorothioate, phosphorodithioate, or alkyl phosphate modifications, methylations, and unusual base-pairing combinations such as the isobases isocytidine and isoguanosine.

Modifications can also include 3' and 5' modifications such as capping, e.g., addition of a 3'-3'- dT cap to increase exonuclease resistance.

[0085] Aptamers of the disclosure may generally comprise nucleotides having ribose in the b-D- ribofuranose configuration. In some cases, 100% of the nucleotides present in the aptamer have ribose in the b-D-ribofuranose configuration. In some cases, at least 50% of the nucleotides present in the aptamer have ribose in the b-D-ribofuranose configuration. In some cases, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the nucleotides present in the aptamer have ribose in the b-D- ribofuranose configuration. In some cases, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the nucleotides present in the aptamer have ribose in the b-D-ribofuranose configuration.

[0086] The length of the aptamer can be variable. In some cases, the length of the aptamer is less than 100 nucleotides. In some cases, the length of the aptamer is greater than 10

nucleotides. In some cases, the length of the aptamer is between 10 and 90 nucleotides. The aptamer can be, without limitation, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, or about 90 nucleotides in length.

[0087] In some instances, a polyethylene glycol (PEG) polymer chain is covalently bound to the aptamer, referred to herein as PEGylation. Without wishing to be bound by theory, PEGylation may increase the half-life and stability of the aptamer in physiological conditions. In some cases, a PEG polymer is covalently bound to the 5' end of the aptamer. In some cases, a PEG polymer is covalently bound to the 3' end of the aptamer. In some cases, a PEG polymer is covalently bound to both the 5' end and the 3' end of the aptamer. In some cases, a PEG polymer is covalently bound to a specific site on a nucleobase within the aptamer, including the 5-position of a pyrimidine or 8-position of a purine. In some cases, the PEG polymer is covalently bound to an abasic site within the aptamer.

[0088] In some cases, an aptamer described herein may be conjugated to a PEG having the general formula, H-(O-CH₂-CH₂)_n-0H. In some cases, an aptamer described herein may be conjugated to a methoxy-PEG (mPEG) of the general formula, CH₃O-(CH₂-CH₂-O)_n-H. In some cases, the aptamer is conjugated to a linear chain PEG or mPEG. The linear chain PEG or mPEG may have an average molecular weight of up to about 30 kD. Multiple linear chain PEGs or mPEGs can be linked to a common reactive group to form multi-arm or branched PEGs or mPEGs. For example, more than one PEG or mPEG can be linked together through an amino acid linker (e.g.., lysine) or another linker, such as glycerine. In some cases, the aptamer is conjugated to a branched PEG or branched mPEG Branched PEGs or mPEGs may be referred to by their total mass (e.g.., two linked 20kD mPEGs have a total molecular weight of 40kD). Branched PEGs or mPEGs may have more than two arms. Multi-arm branched PEGs or mPEGs may be referred to by their total mass (e.g., four linked 10 kD mPEGs have a total molecular weight of 40 kD). In some cases, an aptamer of the present disclosure is conjugated to a PEG polymer having a total molecular weight from about 5 kD to about 200 kD, for example, about 5 kD, about 10 kD, about 20 kD, about 30 kD, about 40 kD, about 50 kD, about 60 kD, about 70 kD, about 80 kD, about 90 kD, about 100 kD, about 110 kD, about 120 kD, about 130 kD, about 140 kD, about 150 kD, about 160 kD, about 170 kD, about 180 kD, about 190 kD, or about 200 kD. In one non-limiting example, the aptamer is conjugated to a PEG having a total molecular weight of from about 30 kD to about 60 kD. In one non-limiting example, the aptamer is conjugated to a PEG having a total molecular weight of about 40 kD.

[0089] In some cases, the reagent that may be used to generate PEGylated aptamers is a branched PEG N-Hydroxysuccinimide (mPEG-NHS) having the general formula:

with a 20 kD, 40 kD or 60 kD total molecular weight (e.g., where each mPEG is about 10 kD, 20 kD or about 30 kD). As described above, the branched PEGs can be linked through any appropriate reagent, such as an amino acid (e.g., lysine or glycine residues).

[0090] In one non-limiting example, the reagent used to generate PEGylated aptamers is [N²- (monomethoxy 20K polyethylene glycol carbamoy1)-N⁶monomethoxy 20K polyethylene glycol carbamoy1)]-1ysine N-hydroxysuccinimide having the formula:

[0091] In yet another non-limiting example, the reagent used to generate PEGylated aptamers has the formula:

where X is N-hydroxysuccinimide and the PEG arms are of approximately equivalent molecular weight. Such PEG architecture may provide a compound with reduced viscosity compared to a similar aptamer conjugated to a two-armed or single-arm linear PEG.

[0092] In some examples, the reagent used to generate PEGylated aptamers has the formula:

where X is N-hydroxysuccinimide and the PEG arms are of different molecular weights, for example, a 40 kD PEG of this architecture may be composed of 2 arms of 5 kD and 4 arms of 7.5 kD. Such PEG architecture may provide a compound with reduced viscosity compared to a similar aptamer conjugated to a two-armed PEG or a single-arm linear PEG.

[0093] In some cases, the reagent that may be used to generate PEGylated aptamers is a non- branched mPEG-Succinimidyl Propionate (mPEG-SPA), having the general formula:

where mPEG is about 20 kD or about 30 kD. In one example, the reactive ester may be -O-CH₂- CH₂-CO₂-NHS.

[0094] In some instances, the reagent that may be used to generate PEGylated aptamers may include a branched PEG linked through glycerol, such as the SUNBRIGHT® series from NOF Corporation, Japan. Non-limiting examples of these reagents include:

[0095] In another example, the reagents may include a non-branched mPEG Succinimidyl alpha-methylbutanoate (mPEG-SMB) having the general formula:

where mPEG is between 10 kD and 30 kD. In one example, the reactive ester may be -O-CH₂-CH₂.CH(CH₃) CO₂-NHS. [0096] In other instances, the PEG reagents may include nitrophenyl carbonate-linked PEGs, having the general formula:

[0097] Compounds including nitrophenyl carbonate can be conjugated to primary amine containing linkers.

[0098] In some cases, the reagents used to generate PEGylated aptamers may include PEG with thiol-reactive groups that can be used with a thiol-modified linker. One non-limiting example may include reagents having the following general structure:

where mPEG is about 10 kD, about 20 kD or about 30 kD. Another non-limiting example may include reagents having the following general structure:

where each mPEG is about 10 kD, about 20 kD, or about 30 kD and the total molecular weight is about 20 kD, about 40 kD, or about 60 kD, respectively. Branched PEGs with thiol reactive groups that can be used with a thiol-modified linker, as described above, may include reagents in which the branched PEG has a total molecular weight of about 40 kD or about 60 kD (e.g.., where each mPEG is about 20 kD or about 30 kD). [0099] In some cases, the reagents used to generate PEGylated aptamers may include reagents having the following structure:

In some cases, the reaction to conjugate the PEG to the aptamer is carried out between about pH 6 and about pH 10, or between about pH 7 and pH 9 or about pH 8.

[00100] In some cases, the reagents used to generate PEGylated aptamers may include reagents having the following structure:

[00101] In some cases, the reagents used to generate PEGylated aptamers may include reagents having the following structure:

[00102] In some cases, the aptamer is associated with a single PEG molecule. In other cases, the aptamer is associated with two or more PEG molecules.

[00103] In some cases, the aptamers described herein may be bound or conjugated to one or more molecules having desired biological properties. Any number of molecules can be bound or conjugated to aptamers, non-limiting examples including antibodies, peptides, proteins, carbohydrates, enzymes, polymers, drugs, small molecules, gold nanoparticles, radiolabels, fluorescent labels, dyes, haptens (e.g.., biotin), other aptamers, or nucleic acids (e.g., siRNA). In some cases, aptamers may be conjugated to molecules that increase the stability, the solubility or the bioavailability of the aptamer. Non-limiting examples include polyethylene glycol (PEG) polymers, carbohydrates and fatty acids. In some cases, molecules that improve the transport or delivery of the aptamer may be used, such as cell penetrating peptides. Non-limiting examples of cell penetrating peptides can include peptides derived from Tat, penetratin, polyarginine peptide Argg sequence, Transportan, VP22 protein from Herpes Simplex Virus (HSV), antimicrobial peptides such as Buforin I and SynB, polyproline sweet arrow peptide molecules, Pep-1 and MPG. In some embodiments, the aptamer is conjugated to a lipophilic compound such as cholesterol, dialkyl glycerol, diacyl glycerol, or a non-immunogenic, high molecular weight compound or polymer such as polyethylene glycol (PEG) or other water-soluble pharmaceutically acceptable polymers including, but not limited to, polyaminoamines

(PAMAM) and polysaccharides such as dextran, or polyoxazolines (POZ).

[00104] The molecule to be conjugated can be covalently bonded or can be associated through non-covalent interactions with the aptamer of interest. In one example, the molecule to be conjugated is covalently attached to the aptamer. The covalent attachment may occur at a variety of positions on the aptamer, for example, to the exocyclic amino group on the base, the 5- position of a pyrimidine nucleotide, the 8-position of a purine nucleotide, the hydroxyl group of the phosphate, or a hydroxyl group or other group at the 5' or 3' terminus. In one example, the covalent attachment is to the 5' or 3' hydroxyl group of the aptamer.

[00105] In some cases, the aptamer can be attached to another molecule directly or with the use of a spacer or linker. For example, a lipophilic compound or a non-immunogenic, high molecular weight compound can be attached to the aptamer using a linker or a spacer. Various linkers and attachment chemistries are known in the art. In a non-limiting example, 6- (trifluoroacetamido)hexanol (2-cyanoethyl-N,N-diisopropyl)phosphoramidite can be used to add a hexylamino linker to the 5' end of the synthesized aptamer. This linker, as with the other amino linkers provided herein, once the group protecting the amine has been removed, can be reacted with PEG-NHS esters to produce covalently linked PEG-aptamers. Other non-limiting examples of linker phosphoramidites may include: TFA-amino C4 CED phosphoramidite having the structure:

5'-amino modifier C3 TFA having the structure:

MMT amino modifier C6 CED phosphoramidite having the structure:

5'-amino modifier 5 having the structure:

5'-amino modifier C12 having the structure:

5' thiol-modifier C6 having the structure:

5' thiol-modifier C6 having the structure:

and 5’ thiol-modifier C6 having the structure:

[00106] The 5'-thiol modified linker may be used, for example, with PEG-maleimides, PEG- vinylsulfone, PEG-iodoacetamide and PEG-orthopyridyl-disulfide. In one example, the aptamer may be bonded to the 5'-thiol through a maleimide or vinyl sulfone functionality. [00107] In some cases, the aptamer formulated according to the present disclosure may also be modified by encapsulation within or displayed on the surface of a liposome. In other cases, the aptamer formulated according to the present disclosure may also be modified by encapsulation within or displayed on the surface of a micelle. Liposomes and micelles may be comprised of any lipids, and in some cases the lipids may be phospholipids, including phosphatidylcholine. Liposomes and micelles may also contain or be comprised in part or in total of other polymers and amphipathic molecules including PEG conjugates of poly lactic acid (PLA), poly DL-lactic- co-glycolic add (PLGA) or poly-caprolactone (PCL). In some cases, the aptamer formulated according to the present disclosure may be attached to or coated on a hydrogel, or may be embedded within a hydrogel matrix. The hydrogel may then be implanted into, e.g.., the eye, for controlled delivery of aptamers. Hydrogels may be composed of a variety of different materials, including, without limitation, poly(hydroxyethyl methacrylate) (PHEMA), poly(vinyl alcohol) (PVA), poly(ethylene glycol) (PEG), poly(acrylic acid) (PAA), poly(methacrylic acid) (PMA), poly(vinylpyrrolidone), starch, carboxymethyl cellulose, hydroxypropyl methyl cellulose, acrylic acid, methacrylic acid, chitosan, ab-glycerophosphate, k-carrageenan, and 2-acrylamido-2- methylpropanesulfonic acid.

[00108] In some cases, the aptamers described herein may be designed to inhibit a function associated with Ang2. In some cases, the aptamers described herein may be designed to bind to a region of Ang2 that includes the receptor binding domain or the fibrinogen-like binding domain. In some cases, binding of aptamers to the receptor binding domain or the fibrinogen- like binding domain of Ang2 may prevent binding or association of Ang2 with the Tie2 receptor. In some cases, the aptamers described herein may be designed to bind to a region of Ang2 that includes the coiled-coil motif. In some cases, binding of aptamers to the coiled-coil motif of Ang2 may prevent dimerization of Ang2 (e.g.., homodimerization or heterodimerization). In some cases, binding of aptamers to the coiled-coil motif of Ang2 may prevent formation of Ang2 oligomers (e.g., tetramers, hexamers, or higher-order oligomers). In some cases, the aptamers described herein may be designed to bind to a region of Ang2 such that binding of Ang2 to specific cell surface co-receptors is prevented or reduced. In some cases, the aptamers described herein may bind to a region of Ang2 that is recognized by an antibody or antibody fragment thereof that inhibits a function associated with Ang2. [00109] In some cases, an aptamer of the disclosure comprises one or more of the following sequences described in Table 1 or Table 2.

[00110] Table 1. Anti-Ang2 Aptamer Sequences

-34-

-35-

-36-

-37-

[00111] Table 2. Aptamer 18 Family

-39-

-40-

-41-

-42-

-43-

-44-

-45-

-46-

-47-

-48-

-49-

-50-

-51-

-52-

-53-

-54-

-55-

-56-

-57-

-58-

-59-

-60-

-61-

-62-

-63-

-64-

-65-

-66-

-67-

-68-

[00112] Table 3. Aptamer 13 Family

Q

-69-

-70-

-71-

-72-

-73-

-74-

SEQ ID NO: P7.R7 1279 RNA GGGAGAGUCGGUAGCAG GGGAGAGUCGGUAGCAGUCU

-75-

-76-

-77-

-78-

-79-

-80-

-81-

-82-

-83-

-84-

-85-

In some aspects, an aptamer of the disclosure may have a primary nucleic add sequence according to any one of the aptamer sequences described in Tables 1-3, or may have a primary nudeic acid sequence that shares at least 40% sequence identity to any one of the aptamer sequences described in Tables 1-3. In some aspects, an aptamer of the disclosure may have a primary nucleic acid sequence consisting of any one of the aptamer sequences described in Tables 1-3, or may have a primary nucleic add sequence that shares at least 40% sequence identity to a primary nucleic acid sequence consisting of any one of the aptamer sequences described in Tables 1-3. In some cases, the nucldc acid sequence may comprise one or more modified nucleotides. In some cases, at least 50% of said nuddc add sequence may comprise the one or more modified nucleotides. In some cases, the one or more modified nucleotides may comprise a 2'F-modified nucleotide, a 2'OMe-modified nucleotide, or a combination thereof. In some cases, the one or more modified nucleotides may be selected from the group consisting of: 2'F-G, 2'OMe-G, 2'OMe-U, 2'OMe-A, 2'OMe-C, an inverted deoxythymidine at the 3' terminus, and any combination thereof. In some cases, the aptamer may comprise a nucleic add sequence comprising modified nucleotides (and/or other modifications) of any one of the aptamers described in Tables 1-3. In some cases, the aptamer is any aptamer described in Tables 1-3. In some cases, the aptamer is any aptamer of the Aptamer 18 structural family as described in Table 2. In some cases, the aptamer is any aptamer of the Aptamer 13 structural family as described in Table 3. In some cases, the aptamer may be conjugated to a polyethylene glycol (PEG) molecule. In some cases, the PEG molecule may have a molecular weight of 80 kDa or less (e.g., 40 kDa). [00113] In some cases, an aptamer of the disclosure may share at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with any aptamer described herein. For example, an anti-IL8 aptamer of the disclosure may share at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with any aptamer described in Tables 1-3.

[00114] In some cases, an anti-Ang2 aptamer of the disclosure may be truncated to remove constant regions, or portions thereof. In some cases, an anti-Ang2 aptamer of the disclosure may comprise an aptamer sequence according to any one of in Tables 1-3, with the constant regions, or portions thereof, removed. In some cases, the constant regions may include the sequences: 5’- GGGAGAGUCGGUAGC AGUC-3’ (SEQ ID NO: 475), and 5’- CUAUGUGGAAAUGGCGCUGU-3’ (SEQ ID NO: 476), flanking the random region of the aptamer at the 5’ end and the 3’ end, respectively (e.g, SEQ ID NOs: 2-21, 109-225, and 339- 445). In other cases, the constant regions may include the sequences 5’- GGGAGGGCAAGAGACAGA-3’(SEQ ID NO: 477), and 5’-

CUAUGUGGAAAUGGCGCUGU-3’ (SEQ ID NO: 478), flanking the random region of the aptamer at the 5’ end and the 3’ end, respectively. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a random region of any one of the sequences shown in Tables 1-3. In some cases, an anti-Ang2 aptamer of the disclosure may share at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with a random region of any one of the sequences shown in Tables 1-3.

[00115] In some cases, an anti-Ang2 aptamer of the disclosure may have at least 40% sequence identity with any one of the aptamer sequences described in Tables 1-3. In some cases, an anti- Ang2 aptamer of the disclosure may have at least 45% sequence identity with any one of the aptamer sequences described in Tables 1-3. In some cases, an anti-Ang2 aptamer of the disclosure may have at least 50% sequence identity with any one of the aptamer sequences described in Tables 1-3. In some cases, an anti-Ang2 aptamer of the disclosure may have at least 55% sequence identity with any one of the aptamer sequences described in Tables 1-3. In some cases, an anti-Ang2 aptamer of the disclosure may have at least 60% sequence identity with any one of the aptamer sequences described in Tables 1-3. In some cases, an anti-Ang2 aptamer of the disclosure may have at least 65% sequence identity with any one of the aptamer sequences described in Tables 1-3. In some cases, an anti-Ang2 aptamer of the disclosure may have at least 70% sequence identity with any one of the aptamer sequences described in Tables 1-3. In some cases, an anti-Ang2 aptamer of the disclosure may have at least 75% sequence identity with any one of the aptamer sequences described in Tables 1-3. In some cases, an anti- Ang2 aptamer of the disclosure may have at least 80% sequence identity with any one of the aptamer sequences described in Tables 1-3. In some cases, an anti-Ang2 aptamer of the disclosure may have at least 85% sequence identity with any one of the aptamer sequences described in Tables 1-3. In some cases, an anti-Ang2 aptamer of the disclosure may have at least 90% sequence identity with any one of the aptamer sequences described in Tables 1-3. In some cases, an anti-Ang2 aptamer of the disclosure may have at least 95% sequence identity with any one of the aptamer sequences described in Tables 1-3.

[00116] In some cases, an aptamer of the disclosure may have a primary nucleotide sequence that shares at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, or at least 40 contiguous nucleotides with a nucleotide sequence described in Tables 1-3.

[00117] In such cases where specific nucleotide modifications have been recited, it should be understood that any number and type of nucleotide modifications may be substituted. For example, 2’OMe-G may be substituted for 2’F-G. Non-limiting examples of nucleotide modifications have been provided herein. In some instances, all of the nucleotides of an aptamer may be modified. In some instances, at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotides of an aptamer of the disclosure may be modified. In some aspects, an aptamer of the disclosure has the modified nucleotide sequence of any aptamer sequence described in Tables 1-

3.

[00118] In some cases, an aptamer of the disclosure may have a modified nucleotide sequence. In some cases, an aptamer of the disclosure may have a modified nucleotide sequence as described in Tables 1-3. In some cases, an aptamer of the disclosure may have a primary nucleotide sequence according to any aptamer described in Tables 1-3, and a modified nucleotide sequence that is different than that described in Tables 1-3. In such cases, an aptamer of the disclosure may have a modified nucleotide sequence that shares at least 10% modification identity with any modified nucleotide sequence described in Tables 1-3. For example, an aptamer of the disclosure may have a modified nucleotide sequence that shares at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% modification identity with any modified nucleotide sequence described in Tables 1-3.

[00119] In some cases, an aptamer of the disclosure may have a primary nucleotide sequence of any aptamer sequence described in Tables 1-3, and a modified nucleotide sequence in which at least 10% of the C nucleotides are modified (e.g., 2'OMe-C). For example, an aptamer of the disclosure may have a modified nucleotide sequence in which at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the C nucleotides are modified (e.g.., 2’OMe-C). In some cases, an aptamer of the disclosure may have a modified nucleotide sequence wherein at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the C nucleotides (C) are modified according to Tables 1-3.

[00120] In some cases, an aptamer of the disclosure may have a primary nucleotide sequence of any aptamer sequence described in Tables 1-3, and a modified nucleotide sequence in which at least 10% of the A nucleotides are modified (e.g.., 2'OMe-A). For example, an aptamer of the disclosure may have a modified nucleotide sequence in which at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the A nucleotides are modified (e.g.., 2’OMe-A). In some cases, an aptamer of the disclosure may have a modified nucleotide sequence wherein at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the A nucleotides are modified according to Tables 1-3.

[00121] In some cases, an aptamer of the disclosure may have a primary nucleotide sequence of any aptamer sequence described in Tables 1-3, and a modified nucleotide sequence in which at least 10% of the U nucleotides are modified (e.g., 2'OMe-U). For example, an aptamer of the disclosure may have a modified nucleotide sequence in which at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the U nucleotides are modified (e.g.., 2'OMe-U). In some cases, an aptamer of the disclosure may have a modified nucleotide sequence wherein at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the U nucleotides are modified according to Tables 1-3.

[00122] In some cases, an aptamer of the disclosure may have a primary nucleotide sequence of any aptamer sequence described in Tables 1-3, and a modified nucleotide sequence in which at least 10% of the G nucleotides are modified (e.g.., 2'F-G, 2'OMe-G). For example, an aptamer of the disclosure may have a modified nucleotide sequence in which at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the G nucleotides are modified (e.g., 2'F-G, 2'OMe- G). In some cases, an aptamer of the disclosure may have a modified nucleotide sequence wherein at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the G nucleotides are modified according to Tables 1-3.

[00123] In some cases, an aptamer of the disclosure does not comprise any one of SEQ ID NOs:62-92 as described in Table4. Table 4. Aptamer Sequences

[00124] Aptamer 18 Structural Family

[00125] In some cases, the anti-Ang2 aptamer of the disclosure may comprise an H-type pseudoknot secondary structure. In some cases, the H-type pseudoknot secondary structure is described herein for the Aptamer 18 structural family of aptamers. In some cases, an aptamer of the Aptamer 18 family may have, in a 5’ to 3’ direction, a first side of a first base paired stem; a first side of a second base paired stem; a first loop; a first side of a third base paired stem; a second, complementary side of the first base paired stem; a second loop; a second,

complementary side of the third base paired stem; a third loop; a second, complementary side of the second base paired stem; and a 3’ unpaired terminal sequence. In some cases, an aptamer of the Aptamer 18 family may have, in a 5’ to 3’ direction, a first side of a first base paired stem; a fourth loop; a first side of a second base paired stem; a first loop; a first side of a third base paired stem; a second, complementary side of the first base paired stem; a second loop; a second, complementary side of the third base paired stem; a third loop; a second, complementary side of the second base paired stem; and a 3’ unpaired terminal sequence. In some cases, an aptamer of the Aptamer 18 family may have, in a 5’ to 3’ direction, a first side of a first base paired stem; a fourth loop; a first side of a second base paired stem; a first loop; a first side of a third base paired stem; a fifth loop; a second, complementary side of the first base paired stem; a second loop; a second, complementary side of the third base paired stem; a third loop; a second, complementary side of the second base paired stem; and a 3’ impaired terminal sequence. In some cases, an aptamer of the Aptamer 18 family may have, in a 5’ to 3’ direction, a first side of a first base paired stem; a first side of a second base paired stem; a first loop; a first side of a third base paired stem; a fifth loop; a second, complementary side of the first base paired stem; a second loop; a second, complementary side of the third base paired stem; a third loop; a second, complementary side of the second base paired stem; and a 3’ impaired terminal sequence.

[00126] In some embodiments, each element may be adjacent to each other. For example, the Aptamer 18 structural family may comprise aptamers having, in a 5’ to 3’ direction, a first side of a first base paired stem. The 3’ terminal end of the first side of the first base paired stem may be connected to the 5’ terminal end of the first side of the second base paired stem.

Alternatively, if a fourth loop is present, the fourth loop may be connected at its 5’ terminal end to the 3’ terminal end of first side of the first base paired stem, and the fourth loop may be connected at its 3’ terminal end to the 5’ terminal end of the first side of the second base paired stem. The first side of the second base paired stem may be connected at its 5’ terminal end to the 3’ end of the first side of the first base paired stem, and the first side of the second base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the first loop.

Alternatively, if a fourth loop is present, the first side of the second base paired stem may be connected at its 5^* terminal end to the 3’ terminal end of the fourth loop, and the first side of the second base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the first loop. The first loop may be connected at its 5’ terminal end to 3’ terminal end of the first side of the second stem, and the first loop may be connected at its 3’ terminal end to the 5’ terminal end of the first side of the third base paired stem. The first side of the third base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the first loop, and the first side of the third base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the second, complementary side of the first base paired stem. Alternatively, if a fifth loop is present, the fifth loop may be connected at its 5’ terminal end to the 3’ terminal end of first side of the third base paired stem, and the fifth loop may be connected at its 3’ terminal end to the 5’ terminal end of the second, complementary side of the first base paired stem. The second, complementary side of the first base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the first side of the third base paired stem, and the second, complementary side of the first base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the second loop. Alternatively, if a fifth loop is present, the second, complementary side of the first base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the fifth loop, and the second, complementary side of the first base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the second loop. The second loop may be connected at its 5’ terminal end to the 3’ terminal end of the second, complimentaiy side of the first base paired stem, and the second loop may be connected at its 3’ terminal end to the 5’ terminal end of the second, complementary side of the third base paired stem. The second, complementary side of the third base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the second loop, and the second, complementary side of the third base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the third loop. The third loop may be connected at its 5’ terminal end to the 3’ terminal end of the second, complementary side of the third base paired stem, and the third loop may be connected at its 3’ terminal end to the 5’ terminal end of the second, complementary side of the second base paired stem. The second, complementary side of the second base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the third loop, and the second, complementary side of the second base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the 3’ unpaired terminal sequence. In some cases, the Aptamer 18 structural family may include aptamers comprising two terminal stems. In some cases, the first terminal stem may be the first base paired stem. In some cases, the second terminal stem may be the second base paired stem. In some cases, the Aptamer 18 structural family may include aptamer comprising no terminal loops.

[00127] In a particular aspect, an aptamer of the Aptamer 18 family may have an H-type pseudoknot secondary structure comprising: (i) a first side of Stem 1 (S1); (ii) a first side of Stem 2 (S2) connected to the 3’ terminal end of the first side of S1 and the 5’ terminal end of Loop 1 (L1); (iii) L1 connected to the 3’ terminal end of the first side of S2 and the 5’ terminal end of the first side Stem 3 (S3); (iv) a first side of S3 connected to the 3’ terminal end of L1 and the 5’ terminal end of the second, complementary side of S1; (v) the second, complementary side of S1 connected to the 3’ terminal end of the first side of S3 and the 5’ terminal end of Loop 2 (L2); (vi) L2 connected to the 3’ terminal end of a second, complementary side of S1 and the 5’ terminal end of a second complementary side of S3; (vii) the second, complementary side of S3 connected to the 3’ terminal end of L2 and the 5’ terminal end of Loop 3 (L3); (viii) L3 connected to the 3’ terminal end of the second, complementary side of S3 and the 5’ terminal end of the second, complementary side of S2; (ix) the second, complementary side of S2 connected to the 3’ terminal end of L3 and the 5’ terminal end of the 3’ unpaired terminal sequence (3’T); (x) and 3’T connected to the 3’ terminal end of the second, complementary side of S2. In a particular aspect, an aptamer of the Aptamer 18 family may have an H-type pseudoknot secondary structure comprising: (i) a first side of Stem 1 (S1); (ii) Loop 4 (L4) connected to the 3’ terminal end of S1 and the 5’ terminal end of the first side of Stem 2 (S2) (iii) a first side of S2 connected to the 3’ terminal end of L4 and the 5’ terminal end of Loop 1 (L1); (iv) L1 connected to the 3’ terminal end of the first side of S2 and the 5’ terminal end of the first side Stem 3 (S3); (v) a first side of S3 connected to the 3’ terminal end of L1 and the 5’ terminal end of the second, complementary side of S1; (vi) the second, complementary side of S1 connected to the 3’ terminal side of the first side of S3 and the 5’ terminal end of Loop 2 (L2); (vii) L2 connected to the 3’ terminal end of a second, complementary side of S1 and the 5’ terminal end of a second complementary side of S3; (viii) the second, complementary side of S3 connected to the 3’ terminal end of L2 and the 5’ terminal end of Loop 3 (L3); (ix) L3 connected to the 3’ terminal end of the second, complementary side of S3 and the 5’ terminal end of the second,

complementary side of S2; (x) the second, complementary side of S2 connected to the 3’ terminal end of L3 and the 5’ terminal end of the 3’ unpaired terminal sequence (3’T); (xi) and 3’T connected to the 3’ terminal end of the second, complementary side of S2. In a particular aspect, an aptamer of the Aptamer 18 family may have an H-type pseudoknot secondary structure comprising: (i) a first side of Stem 1 (S1); (ii) Loop 4 (L4) connected to the 3’ terminal end of S1 and the 5’ terminal end of the first side of Stem 2 (S2) (iii) a first side of S2 connected to the 3’ terminal end of L4 and the 5’ terminal end of Loop 1 (L1); (iv) L1 connected to the 3’ terminal end of the first side of S2 and the 5’ terminal end of the first side Stem 3 (S3); (v) a first side of S3 connected to the 3’ terminal end of L1 and the 5’ terminal end of Loop 5 (L5); (vi) L5 connected to the 3’ terminal end of the first side of S3 and the 5’ terminal end of the second, complementary side of S1; (vii) the second, complementary side of S1 connected to the 3’ terminal end of L5 and the 5’ terminal end of Loop 2 (L2); (viii) L2 connected to the 3’ terminal end of a second, complementary side of S1 and the 5’ terminal end of a second complementary side of S3; (ix) the second, complementary side of S3 connected to the 3’ terminal end of L2 and the 5’ terminal end of Loop 3 (L3); (x) L3 connected to the 3’ terminal end of the second, complementaiy side of S3 and the 5’ terminal end of the second, complementary side of S2; (xi) the second, complementary side of S2 connected to the 3’ terminal end of L3 and the 5’ terminal end of the 3’ unpaired terminal sequence (3’T); (xii) and 3’T connected to the 3’ terminal end of the second, complementary side of S2. In a particular aspect, an aptamer of the Aptamer 18 family may have an H-type pseudoknot secondary structure comprising: (i) a first side of Stem 1 (S1); (ii) a first side of Stem 2 (S2) connected to the 3’ terminal end of the first side of S1 and the S’ terminal end of Loop 1 (L1); (iii) L1 connected to the 3’ terminal end of the first side of S2 and the 5’ terminal end of the first side Stem 3 (S3); (iv) a first side of S3 connected to the 3’ terminal end of L1 and the 5’ terminal end of Loop 5 (L5); (v) L5 connected to the 3’ terminal end of the first side of S3 and the 5’ terminal end of the second, complementary side of S1; (vi) the second, complementary side of S1 connected to the 3’ terminal end of L5 and the 5’ terminal end of Loop 2 (L2); (vii) L2 connected to the 3’ terminal end of a second, complementary side of S1 and the 5’ terminal end of a second complementary side of S3; (viii) the second,

complementary side of S3 connected to the 3’ terminal end of L2 and the 5’ terminal end of Loop 3 (L3); (ix) L3 connected to the 3’ terminal end of the second, complementary side of S3 and the 5’ terminal end of the second, complementary side of S2; (x) the second, complementary side of S2 connected to the 3’ terminal end of L3 and the 5’ terminal end of the 3’ unpaired terminal sequence (3’T); (ii) and 3’T connected to the 3’ terminal end of the second,

complementary side of S2.

[00128] In some cases, Stem 1 may have from three to five base pairs. For example, Stem 1 may have three, four, or five base pairs. In some cases, Stem 1 may have more than two, more than three or more than four base pairs. In some cases, Stem 1 may have less than six, less than five or less than four base pairs. In some cases, when Stem 1 has five base pairs, the sequence of the first side of Stem 1 may be 5’-UBSBK-3’, and the sequence of the second, complementary side may be 5’- VSSNA -3’where B is C, G or U, S is C or G, K is G or U, V is A, C or G, and N is any nucleotide. In some cases, when Stem 1 has four base pairs, the sequence of the first side of Stem 1 may be 5’-UVSG-3’, and the sequences of the second, complementary side may be 5’- CSBA-3’, where V is A, C or G, S is G or C, and B is C, G or U. In other cases, when Stem 1 has four base pairs, the sequence of the first side of Stem 1 may be 5’-DNNN-3’, and the sequences of the second, complementary side may be 5’-NNNN-3’, where D is A, G or U, and N is any nucleotide. In some cases, when Stem 1 has three base pairs, the sequence of the first side of Stem 1 may be 5’-UGG-3’, and the sequences of the second, complementary side may be 5’- CCA-3’. In some cases, Stem 1 is not highly conserved in sequence identity. In some cases,

Stem 1 may have an internal mismatch.

[00129] In some cases, Stem 2 may have from two to six base pairs. For example, Stem 2 may have two, three, four, five or six base pairs. In some cases, Stem 2 may have more than one, more than two, more than three, more than four, or more than five base pairs. In some cases,

Stem 2 may have less than seven, less than six, less than five, less than four, or less than three base pairs. In some cases, when Stem S2 has six base pairs, the sequence of the first side of Stem 2 may be 5’-GGUGAG-3’ and the sequence of the second, complementary side of Stem 2 may be 5’-UUUGCC-3’. In some cases, when Stem 2 has five base pairs, the sequence of the first side of Stem 2 may be 5’-GACUU-3’ and the sequence of the second, complementary side of Stem 2 may be 5-AAGUC-3’. In some cases, when Stem 2 has four base pairs, the sequence of the first side of Stem 2 may be 5’-RVND-3’and the sequence of the second, complementary side of Stem 2 may be 5’-BBBY-3’, where R is A or G, V is A, C or G, N is any nucleotide, D is A,

G or U, B is C, G or U and Y is C or U. In some cases, when Stem 2 has three base pairs, the sequence of the first side of Stem 2 may be 5’-GRC-3’ and the sequence of the second, complementary side of Stem 2 may be 5’-GYC-3’, where R is A or G and Y is C or U. In other cases, when Stem 2 has three base pairs, the sequence of the first side of Stem 2 may be 5’- GNN-3’ and the sequence of the second, complementary side of Stem 2 may be 5’-DHC-3’, where N is any nucleotide, D is A, G or U, and H is A, C or U. When Stem 2 has two base pairs, the sequence of the first side of Stem 2 may be 5’-GV-3’ and the sequences of the second, complementary side of Stem 2 may be 5’-BC-3’, where V is A, C or G and B is C, G or U. In some cases, Stem 2 may terminate with a G-C base pair (e.g.. 5’ terminal G of the first side of Stem 2 may pair with the 3’ terminal C of the second, complementary side of Stem 2). In some cases, Stem 2 may terminate with a G-C base pair at one end and a C-G base pair at the other end (e.g.. 5’ terminal G of the first side of Stem 2 may pair with the 3’ terminal C of the second, complementary side of Stem 2 and the 3’ terminal C of the first side of Stem 2 may pair with the 5’ terminal G of the second, complementary of Stem 2). In some cases, Stem 2 may have an internal mismatch.

[00130] In some cases, Loop 1 may have one to four nucleotides. For example, Loop 1 may have one, two, three or four nucleotides. In some cases, Loop 1 may have more than zero nucleotides. In some cases, Loop 1 may have less than five nucleotides. In some cases, Loop 1 may have more than zero, more than one, more than two, or more than three nucleotides. In some cases, Loop 1 may have less than five, less than four, less than three, or less than two nucleotides. In some cases, the sequence of Loop 1 is not highly conserved.

[00131] In some cases, Stem 3 may have three to five base pairs. For example, Stem 3 may have three, four or five base pairs. In some cases, Stem 3 may have more than two, more than three, or more than four base pairs. In some cases, Stem 3 may have less than six, less than five, or less than four base pairs. In some cases, when Stem 3 has 5 base pairs, the sequence of the first side of Stem 3 may be 5’-BMCBG-3’, and the sequence of the second, complementary side of Stem 2 may be 5’CVGKK-3’, where B is C, G or U, M is A or C, V is A, C or G, and K is G or U. In some cases, when Stem 3 has 4 base pairs, the sequence of the first side of Stem 3 may be 5’-CCUG-3’, and the sequence of the second, complementary side of Stem 3 may be 5’- CAGG-3’. In other cases, when Stem 3 has 4 base pairs, Stem 3 is not highly conserved in sequence identity. In some cases, when Stem 3 has 3 base pairs, the sequence of the first side of Stem 3 may be 5’-VYB-3’, and the sequence of the second, complementary side of Stem 3 may be 5’-VRB-3’, where V is A, C or G, Y is C or U, B is C, G or U, and R is A or G.

[00132] In some cases, Loop 2 may have from two to six nucleotides. For example, Loop 2 may have two, three, four, five or six nucleotides. In some cases, Loop 2 may have more than one nucleotide. In some cases, Loop 2 may have less than seven nucleotides. In some cases, Loop 2 may have more than one, more than two, more than three, more than four, or more than five nucleotides. In some cases, Loop 2 may have less than seven, less than six, less than five, less than four, or less than three nucleotides. In some cases, when Loop 2 has six nucleotides, the sequence of Loop 2 may be 5’-WYWWHA-3’, where W is A or U, Y is C or U and H is A, C or U. In some cases, when Loop 2 has five nucleotides, the sequence of Loop 2 may be 5’- DNDWR-3’, where D is A, G or U, N is any nucleotide, W is A or U, and R is A or G. In some cases, when Loop 2 has four nucleotides, the sequence of Loop 2 may be 5’-NNND-3’, where N is any nucleotide and D is A, G or U. In some cases, when Loop 2 has three nucleotides, the sequence of Loop 2 may be 5’-HWA-3’, where H is A, C or U, and W is A or U. In some cases, when Loop 2 is two nucleotides long, the consensus sequence for L2 is 5’-UA-3’ . In some cases, the 3’ terminal nucleotide of Loop 2 is 5’-A-’. [00133] In some cases, Loop 3 may have from zero to seven nucleotides. For example, Loop 3 may have zero, one, two, three, four, five, six or seven nucleotides. In some cases, Loop 3 may have more than zero nucleotides. In some cases, Loop 3 may have less than eight nucleotides. In some cases, Loop 3 may have more than zero, more than one, more than two, more than three, more than four, more than five, or more than six nucleotides. In some cases, Loop 3 may have less than eight, less than seven, less than six, less than five, less than four, less than three, less than two or less than one nucleotide. In some cases, when loop L3 has seven nucleotides, the sequence of Loop 3 may be 5’-AUAAGUA-’. In some cases, when Loop 3 has six nucleotides, the sequence of Loop 3 may be 5’-WWBMRY-3’, where W is A or U, B is C, G or U, M is A or C, R is A or G, and Y is C or U. In some cases, when Loop 3 has five nucleotides, the sequence of Loop 3 may be 5’-NNNDN-3’, where N is any nucleotide and D is A, G or U. In some cases, when Loop 3 has four nucleotides long, the sequence of Loop 3 may be 5’-HNVN-3’, where H is A, C or U, N is any nucleotide, and V is A, C or G. In other cases, when Loop 3 has four nucleotides, the sequence of Loop 3 may be 5’-YAVN-3’, where Y is C or U, V is A, C or G, and N is any nucleotide. In some cases, when Loop 3 has one nucleotide, the sequence of Loop 3 may be 5’-A-3’. In some cases, when Loop 3 has five nucleotides or less, Loop 3 is not highly conserved in sequence identity.

[00134] In some cases, the 3’ unpaired terminal sequence may have from zero to six nucleotides. For example, the 3’ unpaired terminal sequence may have zero, one, two, three, four, five or six nucleotides. In some cases, the 3’ unpaired terminal sequence may have more than zero nucleotides. In some cases, the 3’ unpaired terminal sequence may have less than seven nucleotides. In some cases, the 3’ unpaired terminal sequence may have more than zero, more than one, more than two, more than three, more than 4 or more than five nucleotides. In some cases, the 3’ unpaired terminal sequence may have less than seven, less than six, less than five, less than four, less than 3, less than two or less than one nucleotides. In some cases, when the 3’ unpaired terminal sequence has six nucleotides, the sequence may be 5’-GDDBHU-3’, where D is A, G or U, B is C, G or U, and H is A, C or U. In some cases, when the 3’ unpaired terminal sequence has five nucleotides, the sequence may be 5’-GDNNU-3’, where D is A, G or U, and N is any nucleotide. In some cases, when the 3’ unpaired terminal sequence has four nucleotides, the sequence may be 5’-RDNU-3’, where R is A or G, D is A, G or U, and N is any nucleotide. In some cases, when the 3’ unpaired terminal sequence has three nucleotides, the sequence may be 5’-BNH-3’, where B is C, G or U, N is any nucleotide, and H is A, C or U. In some cases, when the 3’ terminal sequence has two nucleotides, the sequence may be 5’-GH-3’, where H is A, C or U.

[00135] In some cases, Loop 4 may have from zero to three nucleotides. For example, Loop 4 may have zero, one, two or three nucleotides. In some cases, Loop 4 may have more than zero nucleotides. In some cases, Loop 4 may have less than four nucleotides. In some cases, Loop 4 may have more than zero, more than one or more than two nucleotides. In some cases, Loop 4 may have less than four, less than three, less than two or less than one nucleotides. In some cases, the sequence of Loop 4 may be 5’-ACG-’. In some cases, the sequence of Loop 4 may be 5’-G-’.

[00136] In some cases, Loop 5 may have from zero to one nucleotides. For example, Loop 5 may have zero, or one nucleotides. In some cases, Loop 5 may have more than zero nucleotides. In some cases, Loop 5 may have less than two or less than one nucleotides. The sequence of Loop 5 may be 5’-A-3’.

[00137] ln some aspects, an aptamer of the disclosure may have a consensus nucleic acid sequence of 5’- UVSGGRCDNNCCUGCSBANNHACAGGHNVNGYCGNU-3’ (SEQ ID NO: 97), where V is A, C or G, S is G or C, R is A or G, D is A, G orU, N is any nucleotide, B is C , G or U, H is A, C or G, and Y is C or U. In some aspects, an aptamer of the disclosure may have a consensus nucleic acid sequence of 5’-

UVSGGRCRANCCUGC SB ANNHAC AGGHNVNGYCGNU-3’ (SEQ ID NO:98), where V is A, C or G, S is G or C, R is A or G, D is A, G or U, N is any nucleotide, B is C , G or U, H is A, C or G, and Y is C or U. In some aspects, an aptamer of the disclosure may have a consensus nucleic acid sequence of 5’-UVSGGRCDNNCCUGCSB ANNHACAGGY A VNGY CGNU- 3’(SEQ ID NO:99), where V is A, C or G, S is G or C, R is A or G, D is A, G or U, N is any nucleotide, B is C , G or U, H is A, C or G, and Y is C or U. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid sequence of 5’- NSGGGRCRNWVNNDCCSNNNNNHNNBYRVAGYCN-3’ (SEQ ID NO: 100), where N is any nucleotide, S is G or C, R is A or G, W is A or U, V is A, G or C, D is A, G or U, H is A, C or G, B is C , G or U, and Y is C or U. In some cases, an anti-Ang2 aptamer of the disclosure amy comprise a consensus nucleic acid sequence of 5’-

NSGGGRCRNWVNNDCCSNNNNNHNNBYRVAGYC-G-3’ (SEQ ID NO: 106), where N is any nucleotide, S is G or C, R is A or G, W is A or U, V is A, G or C, D is A, G or U, H is A, C or G, B is C , G or U, and Y is C or U. In some cases, an anti-Ang2 aptamer of the disclosure amy comprise a consensus nucleic acid sequence of 5’-

MCGGGGC AAUCCUGCCGKUUUACAGGUAAAGCCG-3’(SEQ ID NO: 102), where M is A or C, and K is G or U.

[00138] Aptamer 13 Structural Family

[00139] In some cases, the anti-Ang2 aptamer of the disclosure may comprise a stem-loop secondary structure. In some cases, the stem-loop secondary structure is described herein for the Aptamer 13 structural family of aptamers. In some cases, an aptamer of the Aptamer 13 family may have, in a 5’ to 3’ direction, a first side of a first base paired stem; a first loop; a first side of a second base paired stem; a second loop; a second, complementary side of the second base paired stem; a third loop; and a second, complementary side of the first base paired stem.

[00140] In some embodiments, each element may be adjacent to each other. For example, the Aptamer 13 structural family may comprise aptamers having, in a 5’ to 3’ direction, a first side of a first base paired stem. The 3’ terminal end of the first side of the first base paired stem may be connected to the 5’ terminal end of the first side of the first loop. The first loop may be connected at its 5’ terminal end to the 3’ terminal end of the first side of the first base paired stem, and the first loop may be connected at its 3’ terminal end to the 5’ terminal end of the first side of the second base paired stem. The first side of the second base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the first loop, and the first side of the second base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the second loop. The second loop may be connected at its 5’ terminal end to the 3’ terminal end of the first side of the second base paired stem, and the second loop may be connected at its 3’ terminal end to the 5’ terminal end of the second, complementary side of the second base paired stem. The second, complementary side of the second base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the second loop, and the second, complementary side of the second base paired stem may be connected at its 3’ terminal end to the 5’ terminal end of the third loop. The third loop may be connected at its 5’ terminal end to the 3’ terminal end of the second, complimentary side of the second base paired stem, and the third loop may be connected at its 3’ end to the second, complementary side of the first base paired stem. The second, complementary side of the first base paired stem may be connected at its 5’ terminal end to the 3’ terminal end of the third loop. In some cases, the Aptamer 13 structural family may include aptamers comprising a terminal stem. In some cases, the terminal stem may be the first base paired stem. In some cases, the Aptamer 13 structural family may include aptamers comprising a terminal loop. In some cases, the terminal loop may be the second loop.

[00141] In a particular aspect, an aptamer of the Aptamer 13 family may have a stem-loop secondary structure comprising: (i) a first side of Stem 1 (S1); (ii) Loop 1 (L1) connected to the 3’ terminal end of the first side of S1 and the first side of Stem 2 (S2); (iii) a first side of a S2 connected to the 3’ terminal end of L1 and the 5’ terminal end of Loop 2 (L2); (iv) L2 connected to the 3’ terminal end of the first side of S2 and the 5’ terminal end of the second,

complementary side of S2; (v) the second, complementary side of S2 connected to the 3’ terminal end of L2 and the 5’ terminal end of Loop 3 (L3); (vi) Loop 3 connected to the 3’ terminal end of the second, complementary side of S2 and the 5’ terminal end of the second, complementary side of S1; (vii) and the second, complementary side of S1 connected to the 3’ terminal end of the second, complementary side of S2.

[00142] In some cases, Stem 1 may have from two to six base pairs. For example, Stem 1 may two, three, four, five or six base pairs. In some cases, Stem 1 may have more than one, more than two, more than three, more than four or more than five base pairs. In some cases, Stem 1 may have less than seven, less than six, less than five, less than four, or less than three base pairs. In some cases, when Stem 1 has six base pairs, the sequence of the first side of Stem 1 may be 5’- DVDYKS-3’, and the sequence of the second, complementary side of Stem 1 may be 5’- SMRYBW -3’ where D is A, G or U, V is A, C or G, Y is C or U, K is G orU, S is G or C, M is A or C, R is A or G, B is C, G or U, and W is A or U. In some cases, when Stem 1 has five base pairs, the sequence of the first side of Stem 1 may be 5’-DNNGG-3’, and the sequence of the second, complementary side of Stem 1 may be 5’- CCNNW -3’ where D is A, G or U, N is any nucleotide, and W is A or U. In some cases, when Stem 1 has four base pairs, the sequence of the first side of Stem 1 may be 5’-NNBD-3’, and the sequence of the second, complementary side of Stem 1 may be 5’-HVNN-3’, where N is any nucleotide, B is C, G or U, D is A, G or U, and H is A, C or U. In some cases, when Stem 1 has three base pairs, the sequence of the first side of Stem 1 may be 5’-NKB-3’, and the sequence of the second, complementary side of Stem 1 may be 5’-VMN-3’, where N is any nucleotide, K is G or U, B is C, G or U, V is A, C or G and M is A or C. In some cases, when Stem 1 has two base pairs, the sequence of the first side of Stem 1 may be 5’-GG-3’, and the sequence of the second, complementary side of Stem 1 may be 5’-CC-’. In some cases, Stem 1 is not highly conserved in sequence identity. In some cases, Stem 1 may have an internal mismatch. In some cases, Stem 1 may have more than one internal mismatch. In some cases, one side of Stem 1 may be one nucleotide longer than the other, complementary side of Stem 1.

[00143] In some cases, Loop 1 may have from one to eight nucleotides. For example, Loop 1 may have one, two, three, four, five, six, seven or eight nucleotides. In some cases, Loop 1 may have greater than zero nucleotides. In some cases, Loop 1 may have less than nine nucleotides. In some cases, Loop 1 may have more than zero, more than one, more than two, more than three, more than four, more than five, more than six or more than seven nucleotides.

In some cases, Loop 1 may have less than nine, less than eight, less than seven, less than six, less than five, less than four, less than three or less than two nucleotides. In some cases, when Loop 1 has eight nucleotides, the sequence of Loop 1 may be 5’-KGMRWURM-3’, where K is G or U, M is A or C, R is A or G, and W is A or U. In some cases, when Loop 1 has six nucleotides, the sequence of Loop 1 may be 5’-CGAGAA-’. In some cases, when Loop 1 has five nucleotides, the sequence of Loop 1 may be 5’-HDWWW-3’, where H is A, C or U, D is A, G or U, and W is A or U. In some cases, when Loop 1 has four nucleotides, the sequence of Loop 1 may be 5’- HNDW-3’, where H is A, C or U, N is any nucleotide, D is A, G or U, and W is A or U. In other cases, when Loop 1 has four nucleotides, the sequence of Loop 1 may be 5’-MADA-3’, where M is A or C, and D is A, G, or U. In some cases, when Loop 1 has three nucleotides, the sequence of Loop 1 may be 5’-NNW-3’, where N is any nucleotide and W is A or U. In some cases, when Loop 1 has two nucleotides, the sequence of Loop 1 may be 5’-WU-3’, where W is A or U. In some cases, when Loop 1 has one nucleotide, the sequence of Loop 1 may be 5’-U-’.

[00144] In some cases, Stem 2 may have two to three base pairs. For example, Stem 2 may have two or three base pairs. In some cases, Stem 2 may have more than one or more than two base pairs. In some cases, Stem 2 may have less than four or less than three base pairs. In some cases, when Stem 2 has three base pairs, the sequence of the first side of Stem 2 may be 5’-DGN-3’, and the sequence of the second, complementary side of Stem 2 may be 5’-NCH-3’, where D is A, G or U, N is any nucleotide, and H is A, C or U. In some cases, when Stem 2 has two base pairs, the sequence of the first side of Stem 2 may be 5’-GG-3’ and the sequence of the second, complementary side of Stem 2 may be 5’-CC-’. [00145] In some cases, Loop 2 may have eight to eleven nucleotides. For example, Loop 2 may have eight, nine, ten or eleven nucleotides. In some cases, Loop 2 may have more than seven nucleotides. In some cases, Loop 2 may have less than twelve nucleotides. In some cases, Loop 2 may have more than seven, more than eight, more than nine or more than ten nucleotides. In some cases, Loop 2 may have less than twelve, less than eleven, less than ten nucleotides or less than nine nucleotides. In some cases, when Loop 2 has eleven nucleotides, the sequence of Loop 2 may be 5’ -MMAAAHM AS YM-3’ (SEQ ID NO: 479), where M is A or C, H is A, C or U, S is G or C and Y is C or U. In some cases, when Loop 2 has ten nucleotides, the sequence of Loop 2 may be 5’- C AAAHC ANMA-3’ (SEQ ID NO: 480), where H is A, C or U, N is any nucleotide, and M is A or C. In other cases, when Loop 2 has ten nucleotides, the sequence of Loop 2 may be 5’-HDVDNNNNNH-3’(SEQ ID NO: 481), where H is A, C or U, D is A, G or U, V is A, C or G, and N is any nucleotide. In some cases, when Loop 2 has nine nucleotides, the sequence of Loop 2 may be 5’- MRAWHHDNM-3’ , where M is A or C, R is A or G, W is A or U, H is A, C or U, D is A, G or U and N is any nucleotide. In some cases, when Loop 2 has eight nucleotides, the sequence of Loop 2 may be 5’-RRAKVWNM-3’, where R is A of G, K is G or U, V is A, C or G, W is A or U, N is any nucleotide, and M is A or C.

[00146] In some cases, Loop 3 may have three to twelve nucleotides. For example, Loop 3 may have three, four, five, six, seven, eight, nine, ten, eleven or twelve nucleotides. In some cases, Loop 3 may have more than two nucleotides. In some cases, Loop 3 may have less than thirteen nucleotides. In some cases, Loop 3 may have more than two, more than three, more than four, more than five, more than six, more than seven, more than eight, more than nine, more than ten, or more than eleven nucleotides. In some cases, Loop 3 may have less than thirteen, less than twelve, less than eleven, less than ten, less than nine, less than eight, less than seven, less than six, less than five or less than four nucleotides. In some cases, when Loop 3 has twelve nucleotides, the sequence of Loop 3 may be 5’- GGUACACCGUGG-3’(SEQ ID NO: 103). In some cases, when Loop 3 has nine nucleotides, the sequence of Loop 3 may be 5’- GAGUCGCAC-3’. In some cases, when Loop 3 has eight nucleotides, the sequence of Loop 3 may be 5’-SKKAUGAW-3’, where S is G or C, K is G or U, and W is A or U. In some cases, when Loop 3 has seven nucleotides, the sequence of Loop 3 may be 5’- GWNNHMM -3’, where W is A or U, N is any nucleotide H is A, C or U and M is A or C. In other cases, when Loop 3 has seven nucleotides, the sequence of Loop 3 may be 5’-RNNNNNN-3’, where R is A or G and N is any nucleotide. In some cases, when Loop 3 has six nucleotides, the sequence of Loop 3 may be 5’-DNNHNN-3’, where D is A, G or U, N is any nucleotide and H is A, C or U. In some cases, when Loop 3 has five nucleotides, the sequence of Loop 3 may be 5’- DHNNH-3, where D is A, G or U, H is A, C or U and N is any nucleotide. In some cases, when Loop 3 has four nucleotides, the sequence of Loop 3 may be 5’-KBMY-3’, where K is G or U, B is C, G or U, M is A or C, and Y is C or U. In some cases, when Loop 3 has three nucleotides, the sequence of Loop 3 may be 5’-GGG-3’.

[00147] In some aspects, an aptamer of the disclosure may have a consensus nucleic acid sequence of 5’-USGGMADAGGCAAAHCANMACCGWNNHMMCCSAHNU -3’(SEQ ID NO: 10), where S is G or C, M is A or C, D is A, G, or U, H is A, C or U, W is A or U, and N is any nucleotide. In some aspects, an aptamer of the disclosure may have a consensus nucleic acid sequence of 5’-NNBDHNDWGGHDVDNNNNNHCCRNNNNNNHVNNNNU-3’(SEQ ID NO: 105), where B is C, G, or U, D is A, G or U, W is A or U, R is G or A, V is A, C or G, and N is any nucleotide.

[00148] Aptamer Consensus Sequences

[00149] In some aspects, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid sequence. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic add structure of 5’- GGUACACCGUGG-3’(SEQ ID NO: 103).

In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucldc acid structure of 5’-GAGUCGCAC-’. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucldc add structure of 5’-SKKAUGAW-3’, where S is G or C, K is G or U, and W is A or U. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid structure of 5’- GWNNHMM -3’, where W is A or U, N is any nucleotide, H is A, C or U, and M is A or C. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid structure of 5’-

UVSGGRCDNNCCUGCSBANNHACAGGHNVNGYCGNU-3’(SEQ ID NO:97), where V is A, C or G, S is G or C, R is A or G, D is A, G or U, N is any nucleotide, B is C, G or U, H is A, C or G, and Y is C or U. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid structure of 5’-

UVSGGRCRANCCUGC SBANNHACAGGHNVNGYCGNU-3’ (SEQ ID NO:98), where V is A, C or G, S is G or C, R is A or G, D is A, G orU, N is any nucleotide, B is C , G or U, H is A, C or G, and Y is C or U. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid structure 5’-

U VSGGRCDNNCCUGCSB ANNHACAGGY AVNGYCGNU-3’(SEQ ID NO:99), where V is A, C or G, S is G or C, R is A or G, D is A, G or U, N is any nucleotide, B is C, G or U, H is A, C, or G, and Y is C or U. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid structure of 5’-

NSGGGRCRNWVNNDCC SNNNNNHNNB YR VAGY CN-3’ (SEQ ID N0:100), where N is any nucleotide, S is G or C, R is A or G, W is A or U, V is A, G or C, D is A, G or U, H is A, C or G, B is C, G or U, and Y is C or U. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid structure of 5’-

NSGGGRCRNWVNNDCCSNNNNNHNNBYRVAGYC-G-3 (SEQ ID NO: 106), where N is any nucleotide, S is G or C, R is A or G, W is A or U, V is A, G or C, D is A, G or U, H is A, C or G, B is C , G or U, and Y is C or U. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid structure of 5’-

MCGGGGC AAUCCUGCCGKUUUACAGGUAAAGCCG-3’(SEQ ID NO:102), where M is A or C, and K is G or U. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid structure of 5’-

USGGMADAGGCAAAHCANMACCGWNNHMMCCSAHNU -3’(SEQ ID NO: 104), where S is G or C, M is A or C, D is A, G, or U, H is A, C or U, W is A or U, and N is any nucleotide. In some cases, an anti-Ang2 aptamer of the disclosure may comprise a consensus nucleic acid structure of 5’-NNBD-HNDWGGHDVDNNNNNHCCRNNNNNNHVNNNNU-3’(SEQ ID NO: 482), where B is C, G, or U, D is A, G or U, W is A or U, R is G or A, V is A C or G, and N is any nucleotide.

Anti-Ang2 Compositions

[00150] In some aspects, the disclosure provides anti-Ang2 compositions that inhibit a function associated with Ang2. The anti-Ang2 compositions may include one or more anti-Ang2 aptamers that bind to specific regions of Ang2 with high specificity and high affinity. In some cases, the anti-Ang2 compositions may include one or more anti-Ang2 aptamers that bind to a region of Ang2 that includes the receptor binding domain or the fibrinogen-like binding domain of Ang2. In some cases, the anti-Ang2 compositions may include one or more anti-Ang2 aptamers that bind to a region of Ang2 that includes the coiled-coil motif of Ang2. In some cases, the anti-Ang2 compositions may include one or more aptamers that bind to a region of Ang2 and prevents association of Ang2 with specific cell-surface co-receptors as described herein.

Anti-Ang2 Aptamers That Bind to the Fibrinogen-Like Binding Domain of Ang2

[00151] In some aspects, the anti-Ang2 compositions may include one or more anti-Ang2 aptamers that bind to Ang2 at a region that includes the receptor binding domain or the fibrinogen-like binding domain or a portion thereof. Non-limiting examples of binding sites on the receptor binding domain or the fibrinogen-like binding domain of Ang2 to which aptamers of the disclosure may bind are provided below.

[00152] In some cases, anti-Ang2 aptamers of the disclosure may bind to a region of Ang2 that includes loop b6-a5 (Thr409-Cys435) within the P domain of Ang2. Without wishing to be bound by theory, such aptamers may inhibit or reduce the binding of Ang2 to Tie2. Aptamers capable of binding to loop b6-a5 (Thr409-Cys435) of Ang2, or a portion thereof, may bind within the receptor binding interface of Ang2 and may block or reduce its ability to interact with Tie2 (see, Examples 4, 5, 8, 15, 16, 26 and 27).

[00153] In some cases, anti-Ang2 aptamers of the disclosure may bind to a region of Ang2 that includes loop a5-b7 (Leu441-Pro452) within the P domain of Ang2. Without wishing to be bound by theory, such aptamers may inhibit or reduce the binding of Ang2 to Tie2. Aptamers capable of binding to loop a5-b7 (Leu441-Pro452) of Ang2, or a portion thereof, may bind within the receptor binding interface of Ang2 and may block or reduce its ability to interact with Tie2 (see, Examples 4, 5, 8, 15, 16, 26 and 27).

[00154] In some cases, anti-Ang2 aptamers of the disclosure may bind to a region of Ang2 that includes loop b7-b8 (Asn456-He472) within the P domain of Ang2. Without wishing to be bound by theory, such aptamers may inhibit or reduce the binding of Ang2 to Tie2. Aptamers capable of binding to loop b7-b8 (Asn456-Ile472) of Ang2, or a portion thereof, may bind within the receptor binding interface of Ang2 and may block or reduce its ability to interact with Tie2 (see, Examples 4, 5, 8, 15, 16, 26 and 27).

[00155] In some cases, anti-Ang2 aptamers of the disclosure may bind to a region of Ang2 that includes loop a6-b9 (Ser480-Lys485) within the P domain of Ang2. Without wishing to be bound by theory, such aptamers may inhibit or reduce the binding of Ang2 to Tie2. Aptamers capable of binding to loop a6-b9 (Ser480-Lys485) of Ang2, or a portion thereof, may bind within the receptor binding interface of Ang2 and may block or reduce its ability to interact with Tie2 (see, Examples 4, 5, 8, 15, 16, 26 and 27).

[00156] In some cases, anti-Ang2 aptamers of the disclosure may bind to a region of Ang2 that includes strand b8 (Lys473-Trp474) within the P domain of Ang2. Without wishing to be bound by theory, such aptamers may inhibit or reduce the binding of Ang2 to Tie2. Aptamers capable of binding to strand b8 (Lys473-Trp474) of Ang2, or a portion thereof, may bind within the receptor binding interface of Ang2 and may block or reduce its ability to interact with Tie2 (see, Examples 4, 5, 8, 15, 16, 26 and 27).

[00157] In some cases, anti-Ang2 aptamers of the disclosure may bind to a region of Ang2 that includes helix a6 (Tyr475-Gly479) within the P domain of Ang2. Without wishing to be bound by theory, such aptamers may inhibit or reduce the binding of Ang2 to Tie2. Aptamers capable of binding to helix a6 (Tyr475-Gly479) of Ang2, or a portion thereof, may bind within the receptor binding interface of Ang2 and may block or reduce its ability to interact with Tie2 (see, Examples 4, 5, 8, 15, 16, 26 and 27).

[00158] In some cases, anti-Ang2 aptamers of the disclosure may bind to a region of Ang2 that includes Lys468 of Ang2. Without wishing to be bound by theory, such aptamers may inhibit or reduce the binding of Ang2 to Tie2 (see, Examples 4, 5, 8, 15, 16, 26 and 27).

[00159] In some cases, anti-Ang2 aptamers of the disclosure may bind to a region of Ang2 that includes Phe469 of Ang2. Without wishing to be bound by theory, such aptamers may inhibit or reduce the binding of Ang2 to Tie2. Phe469 of Ang2 may interact with Phel61 and Hel94 of Tie2 and this residue may be important for the binding of Ang2 to Tie2. Therefore, aptamers that bind to a region of Ang2 that includes Phe469 may inhibit the ability of Ang2 to interact with Phel61 and Hel94 of Tie2, and may inhibit or reduce formation of the Ang2-Tie2 ligand- receptor complex (see, Examples 4, 5, 8, 15, 16, 26 and 27).

[00160] In some cases, anti-Ang2 aptamers of the disclosure may bind to a region of Ang2 that includes Lys473. Without wishing to be bound by theory, such aptamers may inhibit or reduce the binding of Ang2 to Tie2. Lys473 of Ang2 may be capable of forming a hydrogen bond with Seri 64 of Tie2 and this residue may be important for the binding of Ang2 to Tie2 (see,

Examples 4, 5, 8, 15, 16, 26 and 27). [00161] In some cases, anti-Ang2 aptamers of the disclosure may bind to a region of Ang2 that includes Tyr475. Without wishing to be bound by theory, such aptamers may inhibit or reduce the binding of Ang2 to Tie2. Tyr475 of Ang2 may interact with Prol66 of Tie2 and this residue may be important for the binding of Ang2 to Tie2 (see, Examples 4, 5, 8, 15, 16, 26 and 27).

[00162] In some cases, anti-Ang2 aptamers of the disclosure may bind to a region of Ang2 that includes Tyr476. Without wishing to be bound by theory, such aptamers may inhibit or reduce the binding of Ang2 to Tie2. Tyr476 of Ang2 may interact with Prol66 of Tie2 and this residue may be important for the binding of Ang2 to Tie2 (see, Examples 4, 5, 8, 15, 16, 26 and 27).

[00163] In some cases, an anti-Ang2 aptamer may bind to a region of Ang2 that includes the 1300 Å molecular binding surface that engages with Tie2. Without wishing to be bound by theory, such aptamers may inhibit or reduce the binding of Ang2 to Tie2 (see, Examples 4, 5, 8, 15, 16, 26 and 27).

[00164] In some instances, aptamers that bind to the receptor binding domain or the fibrinogen- like binding domain of Ang2 as described herein may be identified using biochemical assays such as time-resolved fluorescence energy transfer (TR-FRET) to assess binding (see Examples 3, 14 and 25). Binding may be expected to be observed between the aptamer and the full-length protein, as well as the Ang2 C-terminal fibrinogen-like binding domain produced in isolation. Additionally or alternatively, aptamer inhibitors of Ang2 may be identified by using

fluorescently-labelled aptamers and confirming binding to Ang2, or the Ang2 C-terminal fibrinogen-like binding domain produced in isolation, by using flow cytometry (see Example 2). Additionally or alternatively, biochemical assays, such as enzyme-linked immunosorbent assay (ELISA), time-resolved fluorescence resonance energy transfer (TR-FRET) assays,

ALPHASCREEN^® assays, ALPHALISA^® assays, or surface plasmon resonance (SPR) assays, may be used to directly demonstrate competition between the aptamer possessing these mechanisms of action for binding Ang2 or the Ang2 C-terminal fibrinogen-like binding domain produced in isolation, and the receptor, Tie2. These assays may also be used to determine the half maximal inhibitory concentrations (IC₅₀) of these molecules (see Examples 4, 8, 15 and 26). Additionally or alternatively, cell-based assays may be used to demonstrate competition between an anti-Ang2 aptamer and an Ang2 C-terminal fibrinogen-like binding domain protein that has been produced in isolation, for the Tie2 receptor expressed on the surface of cells. Further, Ang2-Tie2 activation assays using HEK293T cells engineered to express Tie2 may identify aptamers capable of inhibiting Ang2 binding to Tie2 by this mechanism of action and may be detected by inhibition of Ang2-mediated Tie2 phosphorylation and modulation of downstream intracellular signaling components, for example, the AKT/RKB kinase and MEK/ERK signaling system, the ABIN-2/NFkappaB signaling system, the STAT3/STAT5 signaling system, or any combination thereof (see Examples 5, 16 and 27). Aptamer inhibitors of Ang2 that utilize any of the mechanisms of action listed above may also be identified using three-dimensional endothelial cell angiogenesis assays, for example, sprouting angiogenesis assays or tube formation assays. Here, endothelial cells cultured with Ang1 and Ang2, along with aptamer inhibitors of Ang2 may observe increases in sprouting endothelial cells and primitive tube formation due to the inhibition of the antagonistic activities of Ang2 upon Ang1, and subsequent activation of Tie2. Additionally or alternatively, endothelial cells cultured with Ang2 may observe increases in sprouting endothelial cells and primitive tube formation, which may be inhibited by anti-Ang2 aptamers.

Anti-Ang2 Aptcmers That Prevent Recognition of Ang2 by Cell Surface Co-Receptors

[00165] In some aspects, anti-Ang2 aptamers of the disclosure may bind to and prevent or reduce the recognition of Ang2 by specific cell surface co-receptors. In some cases, anti-Ang2 aptamers of the disclosure may bind to a region of Ang2 that includes the PQR tripeptide sequence present within the b6-b7 loop of Ang2. In some cases, aptamers capable of binding to a region of Ang2 that includes the PQR tripeptide sequence may provide specificity towards Ang2 (e.g., over Ang1) (see, Example 17 and Example 28). Additionally, such aptamers may antagonize Ang2 (see, Examples 4, 5, 8, 15, 16, 26 and 27).

[00166] In some cases, an anti-Ang2 aptamer of the disclosure may bind to a region of Ang2 that includes the PQR sequence/b6-b7 loop of Ang2. Without wishing to be bound by theory, such aptamers may inhibit or reduce the formation of the Ang2-Tie2 ligand-receptor complex (see, Examples 4, 5, 8, 15, 16, 26 and 27). In some cases, such aptamers may demonstrate increased specificity for Ang2 over Ang1 (see, Example 17 and Example 28). In some cases, such aptamers may sterically hinder the ability of the receptor binding interface to engage with Tie2. In some cases, such aptamers may permit binding of Ang2 to Tie2, but may sterically hinder the ability of Tie2 to heterodimerize with Tie1.

[00167] In some cases, an anti-Ang2 aptamer of the disclosure may bind to a region of Ang2 that includes the PQR sequence/b6-b7 loop of Ang2. Without wishing to be bound by theory, such aptamers may inhibit or reduce the association of Ang2 with co-receptors such as integrins a_vb₃, ( a_vb₅, and a_vb₁, which may assist with the recognition of angiopoietins bound to Tie2. In some instances, this mechanism of action may be determined through the in vitro FRET-based Tie2- Tie1-integrin proximity assays, analysis of Tie2 activation by monitoring levels of Tie2 phosphorylation and activities of downstream signaling mediators, and the use of recombinantly expressed Ang2-TAG and Ang1-PQR chimeric proteins, for example, as performed by Seegar et al. (Tie1-Tie2 interactions mediate functional differences between angiopoietin ligands. Mol.

Cell 37, 643-655 (2010)) and Yu etal. (Structural basis for angiopoietin- 1 -mediated signalling initiation. Proceedings of the National Academy of Sciences 110, 7205-7210 (2013)). Aptamers determined biochemically to specifically recognize Ang2 via the PQR sequence and not the Ang1-TAG sequence, may demonstrate the reverse pattern of recognition when using the chimeric Ang2-TAG and Ang1-PQR proteins. While these assays may be capable of resolving aptamers that bind to the b6-b7 loop and inhibit binding of Ang2 to bind Tie2, in the scenario where aptamers bind to the b6-b7 loop and do not inhibit binding to Tie2, the in vitro FRET- based Tie2-Tie1 proximity assays and Tie2 activity assays may confirm whether these aptamers disrupt Tie2-Tie1 receptor clustering and Tie2 activity. In scenarios where aptamers bind to the Ang2-PQR sequence within loop b6-b7 and do not inhibit binding of Ang2 to Tie2, or inhibit Tie2-Tie1 receptor clustering, analysis of the activity of downstream signaling pathways initiated by Tie2 co-receptors such as the integrins a_vb₃, a_vb₅ and a₅b₁ may demonstrate changes in the pattern of, for example, activation of the FAK and Racl signaling pathways.

[00168] In some cases, aptamer binding to any of the aforementioned regions of Ang2 may interfere with direct interactions with the integrins themselves, thereby inhibiting any potential Tie2 independent signaling processes. Direct binding to integrins may be assessed by competition ELISAs using Ang2 and any potential integrin binding partner (e.g., a_vb₃, a_vb₅, a₅b₁) or by using functional assays to monitor downstream activation patterns of the FAK and Rac1 signaling pathways.

Anti-Ang2 Aptamers That Bind to the Coiled-Coil Motif of Ang2

[00169] In some aspects, anti-Ang2 aptamers may bind to a region of Ang2 that includes the N- terminal coiled-coil motif (Asp75-Gln248). In some case, multimerization of the angiopoietins may be important for the activation of Tie2. Thus, in some cases, the anti-Ang2 aptamers may inhibit the formation of Ang2 tetramers, hexamers and higher-order oligomers. In some cases, antagonization of Ang2 multimerization by aptamer binding to the N-terminal coiled-coil motif may decrease the multimerization status of Ang2. Such aptamers may prevent or reduce Tie2 receptor clustering and specific co-receptor clustering, thereby inhibiting the activities of Ang2 upon Tie2 (see, Examples 4, 5, 8, 15, 16, 26 and 27).

[00170] In some cases, aptamers of the disclosure that function by this mechanism of action may be identified by incubating aptamers with recombinant Ang2 followed by analysis using native PAGE or size exclusion chromatography to identify changes in multimerization status of Ang2. The multimerization status of Ang2 may also be confirmed in vitro using engineered

recombinant Ang2 multimers to confirm whether they activate Tie2 in cellular activation assays similar to that previously performed in prior studies (e.g.., Kim, K.-T. et al. Oligomerization and multimerization are critical for angiopoietin-1 to bind and phosphorylate Tie2. J. Biol. Chem. 280, 20126-20131 (2005)).

Binding Affinity

[00171] The dissociation constant (K_d) can be used to describe the affinity of an aptamer for a target (or to describe how tightly the aptamer binds to the target) or to describe the affinity of an aptamer for a specific epitope of a target. The dissociation constant may be defined as the molar concentration at which half of the binding sites of a target are occupied by the aptamer. Thus, the smaller the K_d, the tighter the binding of the aptamer to its target. In some cases, an anti- Ang2 aptamer of the disclosure may bind to an Ang2 protein with a K_d of less than about 500 nM, less than about 100 nM, less than 10 nM, less than 1 nM. In some cases, an anti-Ang2 aptamer of the disclosure may bind to an Ang2 protein with a K_d of less than about 1000 pM, for example, less than about 500 pM, less than about 100 pM, less than about 50 pM, less than about 10 pM, less than about 5 pM, less than about 1 pM, less than about 0.5 pM, or less than about 0.1 pM. In some cases, an anti-Ang2 aptamer may bind to an Ang2 protein with a K_d of less than about 50 nM. In some cases, an anti-Ang2 aptamer may bind to an Ang2 protein with a K_d of less than about 25 nM. In some cases, an anti-Ang2 aptamer may bind to an Ang2 protein with a K_d of less than about 10 nM. In some cases, an anti-Ang2 aptamer may bind to an Ang2 protein with a K_d of less than about 5 nM. In some cases, an anti-Ang2 aptamer may bind to an Ang2 protein with a K_d of less than about 500 pM. In some cases, an anti-Ang2 aptamer may bind to an Ang2 protein with a K_d of less than about 50 pM. In some cases, an anti-Ang2 aptamer may bind to an Ang2 protein with a K_d of less than about 10 pM. In some cases, an anti-Ang2 aptamer may bind to an Ang2 protein with a K_d of less than about 5 pM. In some cases, an anti- Ang2 aptamer may bind to an Ang2 protein with a K_d of less than about 1 pM. In some cases, an anti-Ang2 aptamer may bind to an Ang2 protein with a K_d of less than about 0.5 pM. In some cases, an anti-Ang2 aptamer may bind to an Ang2 protein with a K_d of less than about 0.1 pM.

In some cases, an anti-Ang2 aptamer of the disclosure may bind to any epitope of Ang2 described herein with a K_d of less than about 500 nM, less than about 100 nM, less than about 50 nM, less than about 25 nM, less than about 10 nM, less than about 5 nM, or less than about 1 nM. In some cases, an anti-Ang2 aptamer of the disclosure may bind to any epitope of Ang2 described herein with a K_d of less than about 1000 pM, for example, less than about 500 pM, less than about 100 pM, less than about 50 pM, less than about 10 pM, less than about 5 pM, less than about 1 pM, less than about 0.5 pM, or less than about 0.1 pM. In some cases, an anti-Ang2 aptamer of the disclosure may bind to the fibrinogen-like binding domain or the coiled-coil motif of Ang2 with a K_d of less than about 500 nM, less than about 100 nM, less than about 50 nM, less than about 25 nM, less than about 10 nM, less than about 5 nM, or less than about 1 nM. In some cases, an anti-Ang2 aptamer of the disclosure may bind to the fibrinogen-like binding domain or the coiled-coil motif of Ang2 with a K_d of less than about 1000 pM, for example, less than about 500 pM, less than about 50 pM, less than about 10 pM, less than about 5 pM, less than about 1 pM, less than about 0.5 pM, or less than about 0.1 pM. In some cases, the anti- Ang2 aptamer binds to the fibrinogen-like binding domain or the coiled-coil motif of Ang2 with a K_d from about 0.1 pM to about 10 pM, from about 5 pM to about 250 pM, from about 100 pM to about 500 pM, from about 500 pM to about 1 nM, or from about 1 nM to about 10 nM. In some cases, the K_d is determined by a flow cytometry assay or TR-FRET assay, with such assays being performed in a direct binding or a competition binding format, as described herein (see Examples 2,3, 8, 14, 15, 25 and 26).

[00172] In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g.., the fibrinogen-like binding domain) with a K_d of less than about 100 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 500 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g.., the fibrinogen-like binding domain) with a K_d of less than about 100 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 250 pM as measured by an Ang2-Tie2 competition assay ( see Examples 4, 8, 15 and 26)or a Tie2 phosphorylation assay assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 100 pM as measured by a flow cytometry assay (see

Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 100 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 100 pM as measured by a flow cytometry assay (see Example 2) or a TR- FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 50 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 100 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 10 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26).

[00173] In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 50 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 500 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26)or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 50 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 250 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26)or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 50 pM as measured by a flow cytometry assay (see Example 2) or a TR- FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 100 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g.., the fibrinogen-like binding domain) with a K_d of less than about 50 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 50 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g.., the fibrinogen-like binding domain) with a K_d of less than about 50 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 10 pM as measured by an Ang2-Tie2 competition (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26).

[00174] In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 10 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 500 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 10 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay ((see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 250 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 10 pM as measured by a flow cytometry assay (see Example 2) or a TR- FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 100 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 10 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 50 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 10 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay ( see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 10 pM as measured by an Ang2-Tie2 competition assay ( see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see

Examples 5, 16 and 26).

[00175] In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g.., the fibrinogen-like binding domain) with a K_d of less than about 5 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 500 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26)or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 5 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 250 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 5 pM as measured by a flow cytometry assay (see Example 2) or a TR- FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 100 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 5 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 50 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 5 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 10 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see

Examples 5, 16 and 26). [00176] In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 1 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay ( see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 500 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26)or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g.., the fibrinogen-like binding domain) with a K_d of less than about 1 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 250 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g.., the fibrinogen-like binding domain) with a K_d of less than about 1 pM as measured by a flow cytometry assay (see Example 2) or a TR- FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 100 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g.., the fibrinogen-like binding domain) with a K_d of less than about 1 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 50 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g.., the fibrinogen-like binding domain) with a K_d of less than about 1 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 10 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see

Examples 5, 16 and 26).

[00177] In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g.., the fibrinogen-like binding domain) with a K_d of less than about 0.5 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 500 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g.., the fibrinogen-like binding domain) with a K_d of less than about 0.5 pM as measured by a flow cytometry assay (see Example 2) or a TR-FKET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 250 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g.., the fibrinogen-like binding domain) with a K_d of less than about 0.5 pM as measured by a flow cytometry assay (see Example 2) or a TR- FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 100 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g.., the fibrinogen-like binding domain) with a K_d of less than about 0.5 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 50 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 0.5 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 10 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26)or a Tie2 phosphorylation assay (see

Examples 5, 16 and 26).

[00178] In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 0.1 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 500 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 0.1 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 250 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g., the fibrinogen-like binding domain) with a K_d of less than about 0.1 pM as measured by a flow cytometry assay (see Example 2) or a TR- FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 100 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g.., the fibrinogen-like binding domain) with a K_d of less than about 0.1 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 50 pM as measured by an Ang2-Tie2 competition assay ((see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 26). In some cases, the aptamers disclosed herein may bind to a region of Ang2 (e.g.., the fibrinogen-like binding domain) with a K_d of less than about 0.1 pM as measured by a flow cytometry assay (see Example 2) or a TR-FRET assay (see Examples 3, 14 and 25), and may have an IC₅₀ of less than about 10 pM as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15 and 26) or a Tie2 phosphorylation assay (see

Examples 5, 16 and 26).

[00179] In some aspects, the aptamers disclosed herein may have an improved half-life as compared to other therapeutics, including antibodies. In some cases, the aptamers may have an improved half-life in a biological fluid or solution as compared to an antibody. In some cases, the aptamers may have an improved half-life in vivo as compared to an antibody. In one example, the aptamers may have an improved half-life when injected into the eye (intraocular half-life) as compared to an antibody. In some cases, the aptamers may have an improved intraocular half-life when injected into the eye of a human. In some cases, the aptamers may demonstrate improved stability over antibodies under physiological conditions.

[00180] In some cases, the aptamers described herein may have an intraocular half-life of at least 7 days in a human. In some cases, the aptamers described herein may have an intraocular half-life of at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 20 days or greater in a human.

[00181] In some cases, the aptamers described herein may have an intraocular half-life of at least 1 day in a non-human animal (e.g.., a rodent such as a rat or rabbit, a monkey, a pig, or a dog). In some cases, the aptamers described herein may have an intraocular half-life of at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days or greater in a non-human animal such as a rodent, monkey, pig or dog. [00182] In some aspects, the aptamers described herein may have a shorter half-life as compared to other therapeutics. For example, an unmodified or unconjugated aptamer may have a lower half-life as compared to a modified or conjugated aptamer, however, the low molecular weight of the unmodified or unconjugated forms may allow for orders of magnitude greater initial concentrations, thereby achieving greater duration/efficacy. In some examples, the aptamer may have an intraocular half-life of less than about 7 days in a human. In some examples, the aptamers described herein may have an intraocular half-life of less than about 6 days, less than about 5 days or even less than about 4 days in a human.

[00183] The aptamers disclosed herein may demonstrate high specificity for Ang2 versus other angiopoietins (e.g.., Ang1, Ang3, Ang4). Generally, the aptamer may be selected such that the aptamer has high affinity for Ang2, but with little to no affinity for other angiopoietins (e.g., Ang1, Ang3, Ang4). In some cases, the aptamers of the disclosure may bind to Ang2 with a specificity of at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 250-fold, at least 500-fold, at least 1,000-fold, at least 5,000-fold, at least 10,000-fold, at least 50,000-fold, or at least 100,000-fold, or greater than the aptamers bind to any of Ang1, Ang3, or Ang4 at relative serum concentrations. In some cases, the anti-Ang2 aptamers of the disclosure may exhibit low binding affinity for any of Ang1, Ang3, or Ang4.

For example, the anti-Ang2 aptamers of the disclosure may bind to any of Ang1, Ang3, or Ang4 with a K_d of greater than about 1 mM, 5 mM, 10 mM, 50 mM, or 100 mM.

[00184] The activity of a therapeutic agent can be characterized by the half maximal inhibitory concentration (IC₅₀). The IC₅₀ may be calculated as the concentration of therapeutic agent in nM at which half of the maximum inhibitoiy effect of the therapeutic agent is achieved. The IC₅₀ may be dependent upon the assay utilized to calculate the value. In some examples, the IC₅₀ of an aptamer described herein may be less than about 100 nM, less than about 50 nM, less than about 25 nM, less than about 10 nM, less than about 5 nM, or less than about 1 nM, as measured by an Ang2-Tie2 competitionassay (see Examples 4, 8, 15, and 26). In some cases, the IC₅₀ of an anti-Ang2 aptamer described herein may be less than about 1000 pM, for example, less than about 750 pM, less than about 500 pM, less than about 250 pM, less than about 100 pM, less than about 50 pM, less than about 25 pM, less than about 10 pM, less than about 5 pM, or less than about 1 pm, as measured by an Ang2-Tie2 competition assay (see Examples 4, 8, 15, and 26).. In some cases, the IC₅₀ of an anti-Ang2 aptamer described herein may be less than about 100 nM, less than about 50 nM, less than about 25 nM, less than about 10 nM, less than about 5 nM, or less than about 1 nM, as measured by a Tie2 phosphorylation assay (see Examples 5, 16 and 16). In some cases, an anti-Ang2 aptamer of the disclosure may have an IC₅₀ of less than about 1000 pM, for example, less than about 750 pM, less than about 500 pM, less than about 250 pM, less than about 100 pM, less than about 50 pM, less than about 10 pM, less than about 5 pM, or less than about 1 pM, as measured by a Tie2 phosphorylation assay (see Examples 5, 16 and 16). In particular cases, an anti-Ang2 aptamer of the disclosure may have an IC₅₀ of about 10 pM to about 250 pM, as measured by either an Ang2-Tie2 competition assay (see Examples 4, 8, 15, and 26) or a Tie2 phosphorylation assay (see Examples 5, 16 and 16).

[00185] Aptamers generally have high stability at ambient temperatures for extended periods of time. The aptamers described herein may demonstrate greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater 90%, greater than 91%, greater than 92%, greater than 93%, greater than 94%, greater than 95%, greater than 96%, greater than 97%, greater than 98%, greater than 99%, greater than 99.5%, or greater than 99.9% activity in solution under physiological conditions at 30 days or later.

[00186] In some cases, a composition of the disclosure comprises anti-Ang2 aptamers, wherein essentially 100% of the anti-Ang2 aptamers comprise nucleotides having ribose in the b-D- ribofuranose configuration. In other examples, a composition of the disclosure may comprise anti-Ang2 aptamers, wherein at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or greater than 90% of the anti-Ang2 aptamers have ribose in the b-D-ribofuranose

configuration.

Indications

[00187] In some aspects, the methods and compositions provided herein are suitable for the treatment of ocular diseases or disorders. In some aspects, the methods and compositions provided herein are suitable for the prevention of ocular diseases or disorders. In some aspects, the methods and compositions provided herein are suitable to slow or halt the progression of ocular diseases or disorders. In some cases, the ocular disease or disorder comprises dry age- related macular degeneration. In some cases, age-related macular degeneration comprises wet age-related macular degeneration. In some cases, the ocular disease or disorder comprises proliferative diabetic retinopathy. In some cases, the ocular disease or disorder comprises non- proliferative diabetic retinopathy. In some cases, the ocular disease or disorder comprises a macular edema. In some cases, the ocular disease or disorder comprises diabetic macular edema. In some cases, the ocular disease or disorder comprises central retinal vein occlusion. In some cases, the ocular disease or disorder is retinopathy of prematurity. In some cases, the ocular disease or disorder comprises rhegmatogenous retinal detachment. In some cases, the ocular disease or disorder comprises choroidal neovascularization. In some cases, the ocular disease or disorder comprises proliferative vitreoretinopathy.

[00188] In some aspects, the methods and compositions provided herein are suitable for the treatment of an ocular disease or disorder that has a partial or incomplete response to anti-VEGF therapy. In some cases, methods and compositions provided herein may be suitable for the treatment of an ocular disease or disorder that has not responded, or has only partially responded, to anti-VEGF therapy. Non-limiting examples of such ocular diseases or disorders include: dry age-related macular degeneration, wet age-related macular degeneration, proliferative diabetic retinopathy, non-proliferative diabetic retinopathy, macular edema, diabetic macular edema, central retinal vein occlusion, retinopathy of prematurity, rhegmatogenous retinal detachment, choroidal neovascularization, pathologic myopia, or proliferative vitreoretinopathy.

[00189] Additional examples of ocular diseases or disorders that may be amendable to treatment by the methods and compositions provided herein may include, without limitation, inflammatory conjunctivitis, including allergic and giant papillary conjunctivitis, macular edema, uveitis, endophthalmitis, scleritis, corneal ulcers, dry eye syndrome, glaucoma, ischemic retinal disease, corneal transplant rejection, complications related to intraocular surgery such intraocular lens implantation and inflammation associated with cataract surgery, Behcet's disease, Stargardt disease, immune complex vasculitis, Fuch's disease, Vogt-Koyanagi-Harada disease, subretinal fibrosis, keratitis, vitreo-retinal inflammation, ocular parasitic infestation/migration, retinitis pigmentosa, cytomeglavirus retinitis and choroidal inflammation, ectropion, lagophthalmos, blepharochalasis, ptosis, xanthelasma of the eyelid, parasitic infestation of the eyelid, dermatitis of the eyelid, dacryoadenitis, epiphora, dysthyroid exophthalmos, conjunctivitis, scleritis, keratitis, corneal ulcer, corneal abrasion, snow blindness, arc eye, Thygeson’s superficial punctate keratopathy, corneal neovascularization, Fuchs’ dystrophy, keratoconus,

keratoconjunctivitis sicca, iritis, sympathetic ophthalmia, cataracts, chorioretinal inflammation, focal chorioretinal inflammation, focal chorioretinitis, focal choroiditis, focal retinitis, focal retinochoroiditis, disseminated chorioretinal inflammation, disseminated chorioretinitis, disseminated choroiditis, disseminated retinitis, disseminated retinochoroiditis, exudative retinopathy, posterior cyclitis, pars planitis, Harada’s disease, chorioretinal scars, macula scars of posterior pole, solar retinopathy, choroidal degeneration, choroidal atrophy, choroidal sclerosis, angioid streaks, hereditary choroidal dystrophy, choroideremia, choroidal dystrophy (central arealor), gyrate atrophy (choroid), omithinaemia, choroidal haemorrhage and rupture, choroidal haemorrhage (not otherwise specified), choroidal haemorrhage (expulsive), choroidal detachment, retinoschisis, retinal artery occlusion, retinal vein occlusion, hypertensive retinopathy, diabetic retinopathy, retinopathy, retinopathy of prematurity, macular degeneration, Bull’s Eye maculopathy, epiretinal membrane, peripheral retinal degeneration, hereditary retinal dystrophy, retinitis pigmentosa, retinal haemorrhage, separation of retinal layers, central serous retinopathy, retinal detachment, macular edema, glaucoma - optic neuropathy, glaucoma suspect - ocular hypertension, primary open-angle glaucoma, primary angle-closure glaucoma, floaters, Leber’s hereditary' optic neuropathy, optic disc drusen, strabismus, ophthalmoparesis, progressive external ophtiialoplegia, esotropia, exotropia, disorders of refraction and

accommodation, hypermetropia, myopia, astigmastism, anisometropia, presbyopia, internal ophthalmoplegia, amblyopia, Leber’s congenital amaurosis, scotoma, anopsia, color blindness, achromatopsia, tnaskun, nyctalopia, blindness, River blindness, micropthalmia, coloboma, red eye, Argyll Robertson pupil, keratomycosis, xerophthalmia, aniridia, sickle cell retinopathy, ocular neovascularization, retinal neovascularization, subretinal neovascularization; rubeosis iritis inflammatory diseases, chronic posterior and pan uveitis, neoplasms, retinoblastoma, pseudoglioma, neovascular glaucoma; neovascularization resulting following a combined vitrectomy-2 and lensectomy, vascular diseases, retinal ischemia, choroidal vascular

insufficiency, choroidal thrombosis, neovascularization of the optic nerve, diabetic macular edema, cystoid macular edema, proliferative vitreoretinopathy, and neovascularization due to penetration of the eye or ocular injury.

[00190] In some aspects, the methods and compositions provided herein are suitable for the treatment of diseases causing ocular symptoms. Examples of symptoms which may be amenable to treatment with the methods disclosed herein include: increased drusen volume, reduced reading speed, reduced color vision, increased retinal thickening, increase in central retinal volume and/or, macular sensitivity, loss of retinal cells, increase in area of retinal atrophy, reduced best corrected visual acuity such as measured by Snellen or ETDRS scales, reduced Best Corrected Visual Acuity under low luminance conditions, impaired night vision, impaired light sensitivity, impaired dark adaptation, impaired contrast sensitivity, and worsened patient reported outcomes.

[00191] In some cases, the methods and compositions provided herein may alleviate or reduce a symptom of a disease. In some cases, treatment with an aptamer provided herein may result in a reduction in the severity of any of the symptoms described herein. In some cases, treatment with an aptamer described herein may slow, halt or reverse the progression of any of the symptoms described herein. In some cases, treatment with an aptamer described herein may prevent the development of any of the symptoms described herein. In some cases, treatment with an aptamer described herein may slow, halt or reverse the progression of a disease, as measured by the number and severity of symptoms experienced. Examples of symptoms and relevant endpoints where the aptamer may have a therapeutic effect include increased drusen volume, reduced reading speed, reduced color vision, retinal thickening, increase in central retinal volume and/or, macular sensitivity, loss of retinal cells, increase in area of retinal atrophy, reduced best corrected visual acuity such as measured by Snellen or ETDRS scales, reduced Best Corrected Visual Acuity under low luminance conditions, impaired night vision, impaired light sensitivity, impaired dark adaptation, impaired contrast sensitivity, and worsening patient reported outcomes. In some instances, treatment with an aptamer described herein may have beneficial effects as measured by clinical endpoints including drusen volume, reading speed, retinal thickness as measured by Optical Coherence Tomography or other techniques, central retinal volume, number and density of retinal cells, area of retinal atrophy as measured by Fundus Photography or Fundus Autofluoresence or other techniques, best corrected visual acuity such as measured by Snellen or ETDRS scales, Best Corrected Visual Acuity under low luminance conditions, light sensitivity, dark adaptation, contrast sensitivity, and patient reported outcomes as measured by such tools as the National Eye Institute Visual Function Questionnaire and Health Related Quality of Life Questionnaires.

Subjects

[00192] The terms“subject” and“patient” are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, research animals, farm animals, sport animals, and pets. In some cases, the methods described herein may be used on tissues or cells derived from a subject and the progeny of such tissues or cells. For example, aptamers described herein may be used to affect some function in tissues or cells of a subject. The tissues or cells may be obtained from a subject in vivo. In some cases, the tissues or cells are cultured in vitro and contacted with a composition provided herein (e.g.., an aptamer).

[00193] In some aspects, the methods and compositions provided herein are used to treat a subject in need thereof. In some cases, the subject suffers from an ocular disease or disorder. In some cases, the subject is a human. In some cases, the human is a patient at a hospital or a clinic. In some cases, the subject is a non-human animal, for example, a non-human primate, a livestock animal, a domestic pet, or a laboratory animal. For example, a non-human animal can be an ape (e.g.., a chimpanzee, a baboon, a gorilla, or an orangutan), an old world monkey (e.g.., a rhesus monkey), a new world monkey, a dog, a cat, a bison, a camel, a cow, a deer, a pig, a donkey, a horse, a mule, a lama, a sheep, a goat, a buffalo, a reindeer, a yak, a mouse, a rat, a rabbit, or any other non-human animal.

[00194] In cases where the subject is a human, the subject may be of any age. In some cases, the subject has an age-related ocular disease or disorder (e.g., age-related macular degeneration). In some cases, the subject is about 50 years or older. In some cases, the subject is about 55 years or older. In some cases, the subject is about 60 years or older. In some cases, the subject is about 65 years or older. In some cases, the subject is about 70 years or older. In some cases, the subject is about 75 years or older. In some cases, the subject is about 80 years or older. In some cases, the subject is about 85 years or older. In some cases, the subject is about 90 years or older. In some cases, the subject is about 95 years or older. In some cases, the subject is about 100 years or older. In some cases, the subject is about 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or greater than 100 years old. In some cases, the subject is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or greater than 20 years old.

[00195] In some aspects, the methods and compositions provided herein may be used to treat a subject having, suspected of having, or at risk of developing ocular symptoms as described herein. In some aspects, the methods and compositions provided herein may be used to treat a subject having, suspected of having, or at risk of developing an ocular disease as provided herein. In some cases, the methods and compositions provided herein may be used to treat a subject having, suspected of having, or at risk of developing wet age-related macular degeneration. In some cases, the methods and compositions provided herein may be used to treat a subject having, suspected of having, or at risk of developing dry age-related macular degeneration. In some cases, the methods and compositions provided herein may be used to treat a subject having, suspected of having, or at risk of developing proliferative diabetic retinopathy. In some cases, the methods and compositions provided herein may be used to treat a subject having, suspected of having, or at risk of developing non-proliferative diabetic retinopathy. In some cases, the methods and compositions provided herein may be used to treat a subject having, suspected of having, or at risk of developing diabetic macular edema. In some cases, the methods and compositions provided herein may be used to treat a subject having, suspected of having, or at risk of developing central retinal vein occlusion. In some cases, the methods and compositions provided herein may be used to treat a subject having, suspected of having, or at risk of developing retinopathy of prematurity. In some cases, the methods and compositions provided herein may be used to treat a subject having, suspected of having, or at risk of developing rhegmatogenous retinal detachment.

[00196] In some aspects, the methods and compositions provided herein may be used to treat a subject with a highly active immune system. In some cases, the methods and compositions provided herein may be used to treat a subject with an autoimmune disease. In some cases, the methods and compositions provided herein may be used to treat a subject with an inflammatory disease. In some cases, the methods and compositions provided herein may be used to treat a subject undergoing an inflammatory reaction to a disease such as an infectious disease. For example, the aptamers described herein may be used to treat a subject with a fever. In some cases, the aptamers described herein may be used to treat a subject with an allergy. In some cases, the aptamers described herein may be used to treat a subject suffering from an allergic response. In some cases, the aptamers described herein may be particularly useful for treating a subject who has experienced an allergic reaction to an antibody treatment, and/or who has developed neutralizing antibodies against an antibody treatment.

Pharmaceutical compositions or medicaments

[00197] Disclosed herein are pharmaceutical compositions or medicaments, used

interchangeably, for use in a method of therapy, or for use in a method of medical treatment. Such use may be for the treatment of ocular diseases. In some cases, the pharmaceutical compositions can be used for the treatment of wet age-related macular degeneration. In some cases, the pharmaceutical compositions can be used for the treatment of dry age-related macular degeneration. In some cases, the pharmaceutical compositions can be used for the treatment of proliferative diabetic retinopathy. In some cases, the pharmaceutical compositions can be used for the treatment of non-proliferative diabetic retinopathy. In some cases, the pharmaceutical compositions can be used for the treatment of diabetic macular edema. In some cases, the pharmaceutical compositions can be used for the treatment of central retinal vein occlusion. In some cases, the pharmaceutical compositions can be used for the treatment of retinopathy of prematurity. In some cases, the pharmaceutical compositions can be used for the treatment of rhegmatogenous retinal detachment.

[00198] Pharmaceutical compositions described herein may include one or more aptamers for the treatment of wet age-related macular degeneration. Pharmaceutical compositions described herein may include one or more aptamers for the treatment of dry age-related macular degeneration. Pharmaceutical compositions described herein may include one or more aptamers for the treatment of proliferative diabetic retinopathy. Pharmaceutical compositions described herein may include one or more aptamers for the treatment of non-proliferative diabetic retinopathy. Pharmaceutical compositions described herein may include one or more aptamers for the treatment of diabetic macular edema. Pharmaceutical compositions described herein may include one or more aptamers for the treatment of central retinal vein occlusion. Pharmaceutical compositions described herein may include one or more aptamers for the treatment of retinopathy of prematurity. Pharmaceutical compositions described herein may include one or more aptamers for the treatment of rhegmatogenous retinal detachment. In some cases, the one or more aptamers bind to Ang2. In some cases, the one or more aptamers bind to a fibrinogen- like binding domain of Ang2. In some cases, the one or more aptamers bind to the coiled-coil motif of Ang2. In some cases, the one or more aptamers prevent or reduce binding of Ang2 to Tie2 as described herein. In some cases, the one or more aptamers prevent or reduce

oligomerization of Ang2 as described herein.

[00199] In some cases, the compositions may include, e.g.., an effective amount of the aptamer, alone or in combination, with one or more vehicles (e.g., pharmaceutically acceptable compositions or e.g., pharmaceutically acceptable carriers). In some cases, the compositions described herein are administered with one or more additional pharmaceutical treatments (e.g., co-administered, sequentially administered or co-formulated). In some examples, the compositions described herein are co-administered with one or more of an anti-vascular endothelial growth factor (VEGF) therapy, an anti-Factor P therapy, an anti-complement component 5 (C5) therapy, an anti-complement component 3 (C3) therapy, an anti-hypoxia- inducible factor 1-alpha (HIFla) therapy, an anti-FAS therapy, an anti-integrin therapy or an anti-platelet-derived growth factor (PDGF) therapy.

[00200] In some aspects, the anti-Ang2 compositions described herein may be administered in combination with an anti-VEGF or an anti- VEGF Receptor composition, for the treatment of an ocular disease or disorder. An anti-VEGF or an anti-VEGF Receptor composition may include any composition that inhibits a function associated with VEGF or a VEGF receptor. Non- limiting examples of anti-VEGF and or an anti-VEGF Receptor composition that may be used with the anti-Ang2 compositions to treat an ocular disease or disorder include: bevacizumab, ranibizumab, pegaptanib, aflibercept, axitinib (N-methyl-2-[3-((E)-2-pyridm-2-yl-viny1)- 1H- indazol-6-ylsulfanyl]-benzamide), Ramucirumab (CYRMZA®;), Brolucizumab; Faricimab/ faricimabum; VGX-100: VEGF-C mAb VGX-100; aflibercept (VEGF-Trap), Pazopanib (5-[[4- [(2,3-dimethyl-2H-indazol-6-yl)methylamino]-2-pyrimidinyl]amino]-2-methyl- benzenesulfonamide); sunitinib (SUTENT®); brivanib (BMS-582664); sorafenib

(NEXAVAR®); SU5416; conbercept; abicipar pegol; or any biosimilar thereof.

Formulations

[00201] Compositions as described herein may comprise a liquid formulation, a solid formulation or a combination thereof. Non-limiting examples of formulations may include a tablet, a capsule, a gel, a paste, a liquid solution and a cream. The compositions of the present disclosure may further comprise any number of excipients. Excipients may include any and all solvents, coatings, flavorings, colorings, lubricants, disintegrants, preservatives, sweeteners, binders, diluents, and vehicles (or carriers). Generally, the excipient is compatible with the therapeutic compositions of the present disclosure. The pharmaceutical composition may also contain minor amounts of non-toxic auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and other substances such as, for example, sodium acetate, and triethanolamine oleate. Dosage and Routes of Administration

[00202] Therapeutic doses of formulations of the disclosure can be administered to a subject in need thereof. In some cases, a formulation is administered to the eye of a subject for the treatment of an ocular disease as described herein. Administration to the eye can be; b) local ocular delivery; or c) systemic. A topical formulation can be applied directly to the eye (e.g., eye drops, contact lens loaded with the formulation) or to the eyelid (e.g., cream, lotion, gel). In some cases, topical administration can be to a site remote from the eye, for example, to the skin of an extremity. This form of administration may be suitable for targets that are not produced directly by the eye. In some cases, a formulation of the disclosure is administered by local ocular delivery. Non-limiting examples of local ocular delivery include intravitreal (IVT), intracamarel, subconjunctival, subtenon, retrobulbar, posterior juxtascleral, and peribulbar. In some cases, a formulation of the disclosure is delivered by intravitreal administration (IVT) (e.g.., injection into the vitreous). Local ocular delivery may generally involve injection of a liquid formulation. In other cases, a formulation of the disclosure is administered systemically.

Systemic administration can involve oral administration. In some cases, systemic administration can be intravenous administration, subcutaneous administration, infusion, implantation, and the like.

[00203] Other formulations suitable for delivery of the pharmaceutical compositions described herein may include a sustained release gel or polymer formulations by surgical implantation of a biodegradable microsize polymer system, e.g.., microdevice, microparticle, or sponge, or other slow release transscleral devices, implanted during the treatment of an ophthalmic disease, or by an ocular delivery device, e.g., polymer contact lens sustained delivery device. In some cases, the formulation is a polymer gel, a self-assembling gel, a durable implant, an eluting implant, a biodegradable matrix or biodegradable polymers. In some cases, the formulation is a hydrogel and the aptamer is coated on, attached to, or embedded within the hydrogel matrix. In some cases, the formulation may be administered by iontophoresis using electric current to drive the composition from the surface to the posterior of the eye. In some cases, the formulation may be administered by a surgically implanted port with an intravitreal reservoir, an extra-vitreal reservoir or a combination thereof. Examples of implantable ocular devices can include, without limitation, the Durasert™ technology developed by Bausch & Lomb, the ODTx device developed by On Demand Therapeutics, the Port Delivery System developed by ForSight VISION4 and the Replenish MicroPump™ System developed by Replenish, Inc. In some cases, nanotechnologies can be used to deliver the pharmaceutical compositions including nanospheres, nanoparticles, nanocapsules, liposomes, nanomicelles and dendrimers.

[00204] A composition of the disclosure can be administered once or more than once each day.

In some cases, the composition is administered as a single dose (i.e., one-time use). In this example, the single dose may be curative. In other cases, the composition may be administered serially (e.g., taken every day without a break for the duration of the treatment regimen). In some cases, the treatment regime can be less than a week, a week, two weeks, three weeks, a month, or greater than a month. In some cases, the composition is administered over a period of at least 12 weeks. In other cases, the composition is administered for a day, at least two consecutive days, at least three consecutive days, at least four consecutive days, at least five consecutive days, at least six consecutive days, at least seven consecutive days, at least eight consecutive days, at least nine consecutive days, at least ten consecutive days, or at least greater than ten consecutive days. In some cases, a therapeutically effective amount can be administered one time per week, two times per week, three times per week, four times per week, five times per week, six times per week, seven times per week, eight times per week, nine times per week, 10 times per week, 11 times per week, 12 times per week, 13 times per week, 14 times per week, 15 times per week, 16 times per week, 17 times per week, 18 times per week, 19 times per week, 20 times per week, 25 times per week, 30 times per week, 35 times per week, 40 times per week, or greater than 40 times per week. In some cases, a therapeutically effective amount can be administered one time per day, two times per day, three times per day, four times per day, five times per day, six times per day, seven times per day, eight times per day, nine times per day, 10 times per day, or greater than 10 times per day. In some cases, the composition is administered at least twice a day. In further cases, the composition is administered at least every hour, at least every two hours, at least every three hours, at least every four hours, at least every five hours, at least every six hours, at least every seven hours, at least every eight hours, at least every nine hours, at least every 10 hours, at least every 11 hours, at least every 12 hours, at least every 13 hours, at least every 14 hours, at least every 15 hours, at least every 16 hours, at least every 17 hours, at least every 18 hours, at least every 19 hours, at least every 20 hours, at least every 21 hours, at least every 22 hours, at least every 23 hours, or at least every day. [00205] Aptamers as described herein may be particularly advantageous over antibodies as they may sustain therapeutic intravitreal concentrations of drug for longer periods of time, thus requiring less frequent administration. The aptamers described herein may have a longer intraocular half-life, and/or sustain therapeutic intravitreal concentrations of drug for longer periods of time than an anti-Ang2 antibody therapy and can be dosed less frequently. In some cases, the aptamers of the disclosure are dosed at least once every 4 weeks (q4w), once every 5 weeks (q5w), once every 6 weeks (q6w), once every 7 weeks (q7w), once every 8 weeks (q8w), once every 9 weeks (q9w), once every 10 weeks (qlOw), once every 11 weeks, once every 12 weeks (ql2w) or greater than q12w.

[00206] Aptamers as described herein may be particularly advantageous over antibodies as they may sustain therapeutic intravitreal concentrations of drug for longer periods of time, thus requiring less frequent administration. The aptamers described herein may have a longer intraocular half-life, and/or sustain therapeutic intravitreal concentrations of drug for longer periods of time than an anti-Ang2 antibody therapy and can be dosed less frequently.

[00207] In some aspects, a therapeutically effective amount of the aptamer is administered. A “therapeutically effective amount’ or“therapeutically effective dose” are used interchangeably herein and refer to an amount of a therapeutic agent (e.g., an aptamer) that provokes a therapeutic or desired response in a subject. The therapeutically effective amount of the composition may be dependent on the route of administration. In the case of systemic administration, a therapeutically effective amount may be about 10 mg/kg to about 100 mg/kg.

In some cases, a therapeutically effective amount may be about 10 mg/kg to about 1000 mg/kg for systemic administration. For intravitreal administration, a therapeutically effective amount can be about 0.01 mg to about 150 mg in about 25 ml to about 100 ml volume per eye.

Methods

[00208] Disclosed herein are methods for the treatment of ocular diseases. In some cases, the ocular disease comprises wet age-related macular degeneration. In some cases, the ocular disease comprises dry age-related macular degeneration. In some cases, the ocular disease comprises proliferative diabetic retinopathy. In some cases, the ocular disease comprises non- proliferative diabetic retinopathy. In some cases, the ocular disease comprises diabetic macular edema. In some cases, the ocular disease comprises central retinal vein occlusion. In some cases, the ocular disease comprises retinopathy of prematurity. In some cases, the ocular disease comprises rhegmatogenous retinal detachment.

[00209] In some cases, the method involves administering a therapeutically effective amount of a composition to a subject to treat an ocular disease. In some cases, the composition includes one or more aptamers as described herein. The aptamers may bind to and inhibit a function associated with Ang2 as described herein. Additionally or alternatively, the methods may involve administering a therapeutically effective amount of an anti-Ang2 composition described herein in combination with an anti-VEGF composition (e.g.., bevacizumab, ranibizumab, aflibercept, pegaptanib, axitinib (N-methyl-2-[3-((E)-2-pyridin-2-yl-vinyl)- 1H-indazol-6- ylsulfanyl]-benzamide), Ramucirumab (CYRMZA®;), Brolucizumab; Faricimab/ faricimabum; VGX-100: VEGF-C mAb VGX-100; aflibercept (VEGF-Trap), Pazopanib (5-[[4-[(2,3-dimethyl- 2H-indazol-6-yl)methylamino]-2-pyrimidinyl]amino]-2-methyl-benzenesulfonamide); sunitinib (SUTENT®); brivanib (BMS-582664); sorafenib (NEXAVAR®); SU5416; conbercept; abicipar pegol; or any biosimilar thereof. In some cases, the anti-Ang2 composition and the anti-VEGF composition are administered to a subject separately. In other cases, the anti-Ang2 composition and the anti-VEGF composition are co-formulated and administered to a subject at the same time. The methods can be performed at a hospital or a clinic, for example, the pharmaceutical compositions can be administered by a health-care professional. In other cases, the

pharmaceutical compositions can be self-administered by the subject. Treatment may commence with the diagnosis of a subject with an ocular disease. In the event that further treatments are necessary, follow-up appointments may be scheduled for the administration of subsequent doses of the composition, for example, administration once every 4 weeks, once every 8 weeks, or once every 12 weeks.

[00210] Further disclosed herein are methods of using an anti-Ang2 composition of the disclosure to inhibit a function associated with Ang2. For example, the methods may involve administering a composition of the disclosure, including one or more anti-Ang2 aptamers, to a biological system (e.g.., biological cells, biological tissue, a subject) to inhibit a function associated with Ang2. In some cases, the anti-Ang2 aptamers may bind to the receptor binding domain or fibrinogen-like binding domain of Ang2. In some cases, the anti-Ang2 aptamers may bind to the coiled-coil motif of Ang2. In some cases, the anti-Ang2 aptamers may bind to a region of Ang2 that is involved in association with cell-surface co-receptors. In some cases, the methods may be used to prevent binding of Ang2 with the Tie2 receptor. In some cases, the methods may be used to prevent oligomerization of Ang2. In some cases, the methods may be used to inhibit downstream signaling pathways associated with Ang2. Additionally or alternatively, the methods may involve administering an anti-Ang2 composition of the disclosure, in combination with an anti-VEGF composition to a biological system.

Methods of Generating Aptamers

The SELEX™ Method

[00211] The aptamers described herein can be generated by any method suitable for generating aptamers. In some cases, the aptamers described herein are generated by a process known as Systematic Evolution of Ligands by Exponential Enrichment" ("SELEX™"). The SELEX™ process is described in, e.g.., U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990, now abandoned, U.S. Pat. No. 5,475,096 entitled "Nucleic Acid Ligands", and U.S. Pat. No. 5,270,163 (see also WO 91/19813) entitled "Nucleic Acid Ligands", each of which are herein incorporated by reference. By performing iterative cycles of selection and amplification, SELEX™ may be used to obtain aptamers with any desired level of target binding affinity.

[00212] The SELEX™ method generally relies as a starting point upon a large library or pool of single stranded oligonucleotides comprising randomized sequences. The oligonucleotides can be modified or unmodified DNA, RNA, or DNA/RNA hybrids. In some examples, the pool comprises 100% random or partially random oligonucleotides. In other examples, the pool comprises random or partially random oligonucleotides containing at least one fixed sequence and/or conserved sequence incorporated within randomized sequence. In other examples, the pool comprises random or partially random oligonucleotides containing at least one fixed sequence and/or conserved sequence at its 5' and/or 3' end which may comprise a sequence shared by all the molecules of the oligonucleotide pool. Fixed sequences are sequences common to oligonucleotides in the pool which are incorporated for a preselected purpose such as, CpG motifs, hybridization sites for PCR primers, promoter sequences for RNA polymerases (e.g.., T3, T4, T7, and SP6), sequences to form stems to present the randomized region of the library within a defined terminal stem structure, restriction sites, or homopolymeric sequences, such as poly A or poly T tracts, catalytic cores, sites for selective binding to affinity columns, and other sequences to facilitate cloning and/or sequencing of an oligonucleotide of interest. Conserved sequences are sequences, other than the previously described fixed sequences, shared by a number of aptamers that bind to the same target.

[00213] The oligonucleotides of the pool can include a randomized sequence portion as well as fixed sequences necessary for efficient amplification. Typically the oligonucleotides of the starting pool contain fixed 5' and 3' terminal sequences which flank an internal region of 30-50 random nucleotides. The randomized nucleotides can be produced in a number of ways including chemical synthesis and size selection from randomly cleaved cellular nucleic acids. Sequence variation in test nucleic acids can also be introduced or increased by mutagenesis before or during the selection/amplification iterations.

[00214] The random sequence portion of the oligonucleotide can be of any length and can comprise ribonucleotides and/or deoxyribonucleotides and can include modified or non-natural nucleotides or nucleotide analogs. Typical syntheses carried out on automated DNA synthesis equipment yield 10¹⁴-10¹⁶ individual molecules, a number sufficient for most SELEX™ experiments. Sufficiently large regions of random sequence in the sequence design increases the likelihood that each synthesized molecule is likely to represent a unique sequence.

[00215] The starting library of oligonucleotides may be generated by automated chemical synthesis on a DNA synthesizer. To synthesize randomized sequences, mixtures of all four nucleotides are added at each nucleotide addition step during the synthesis process, allowing for random incorporation of nucleotides. As stated above, in some cases, random oligonucleotides comprise entirely random sequences; however, in other cases, random oligonucleotides can comprise stretches of nonrandom or partially random sequences. Partially random sequences can be created by adding the four nucleotides in different molar ratios at each addition step.

[00216] The starting library of oligonucleotides may be RNA, DNA, substituted RNA or DNA or combinations thereof. In those instances where an RNA library is to be used as the starting library it is typically generated by synthesizing a DNA library, optionally PCR amplifying, then transcribing the DNA library in vitro using a phage RNA polymerase or modified phage RNA polymerase, and purifying the transcribed library. The nucleic acid library is then mixed with the target under conditions favorable for binding and subjected to step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. More specifically, starting with a mixture containing the starting pool of nucleic acids, the SELEX™ method includes steps of: (a) contacting the mixture with the target under conditions favorable for binding; (b) partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules; (c) dissociating the nucleic acid-target complexes; (d) amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched mixture of nucleic acids; and (e) reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid ligands to the target molecule. In those instances where RNA aptamers are being selected, the SELEX™ method further comprises the steps of: (i) reverse transcribing the nucleic acids dissociated from the nucleic acid-target complexes before amplification in step (d); and (ii) transcribing the amplified nucleic acids from step (d) before restarting the process.

[00217] Within a nucleic acid mixture containing a large number of possible sequences and structures, there is a wide range of binding affinities for a given target. Those which have the higher affinity (lower dissociation constants) for the target are most likely to bind to the target. After partitioning, dissociation and amplification, a second nucleic acid mixture is generated, enriched for the higher binding affinity candidates. Additional rounds of selection progressively favor the best ligands until the resulting nucleic acid mixture is predominantly composed of only one or a few sequences. These can then be cloned, sequenced and individually tested as ligands or aptamers for 1) target binding affinity; and 2) ability to effect target function.

[00218] Cycles of selection and amplification are repeated until a desired goal is achieved. In the most general case, selection/amplification is continued until no significant improvement in binding strength is achieved on repetition of the cycle. The method is typically used to sample approximately 10¹⁴ different nucleic acid species but may be used to sample as many as about 10¹⁸ different nucleic acid species. Generally, nucleic acid aptamer molecules are selected in a 3 to 20 cycle procedure.

[00219] In some cases, the aptamers of the disclosure are generated using the SELEX™ method as described above. In other cases, the aptamers of the disclosure are generated using any modification or variant of the SELEX™ method.

[00220] In some cases, the aptamers described herein have been generated using methodologies to select for specific sites related to activity or function of a target protein. In some cases, the aptamers described herein may be selected using methods that improve the chances of selecting an aptamer with a desired function or desired binding site. In some cases, the aptamers described herein are generated using methods that increase the chances of selecting an aptamer that binds to the fibrinogen-like binding domain or the coiled-coil motif of Ang2.

EXAMPLES

[00221] The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. The present examples, along with the methods described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art.

[00222] Example 1. Identification of modified RNA aptamers to Angiopoietin-2.

[00223] A. Selection of anti-Angiopoietin-2 aptamers

[00224] Anti-Angiopoietin-2 (Ang2) aptamers were identified using an N35 library comprised of a 35-nucleotide random region flanked by constant regions at the 5’ end (solid underline) and the 3’ end (dotted underline) as depicted in FIG. 1A. The sequence in italics represents the forward and reverse primer binding sites. FIG. IB depicts a representation of the N35 library with the reverse oligo (N35.R; SEQ ID NO:95) hybridized to the 3’ constant region. For nuclease stability, the library was composed of 2'-fluoro-G (2’F GTP) and 2'-0-methyl (2'OMe) A/C/U. FIG. 1C depicts structures of modified nucleotides used to generate the N35 library for selection against target Ang-2. For simplicity, the nucleosides, and not the nucleotide

triphosphates are shown. The library sequence and the sequence of oligos used to amplify the library are described in Table 3.

Table 3. Library sequence and sequence of oligos used to amplify the library.

[00225] The starting library was transcribed from a pool of ~10¹⁴ double-stranded DNA

(dsDNA) molecules. The dsDNA library was generated by primer extension using Klenow exo (-) DNA polymerase, the pool forward primer (N35.F; SEQ ID NO:94) and synthetic single- stranded DNA (ssDNA) molecule encoding the library. The dsDNA was subsequently converted to 100% backbone modified RNA via transcription using a mixture of 2’F GTp, 2’OMe

ATP/CTP/UTP and a modified phage RNA polymerase in buffer optimized to facilitate efficient transcription. Following transcription, RNAs were treated with DNAse to remove the template dsDNA and purified.

[00226] The selection targeting Ang2 was facilitated by the use of a recombinant C-terminal His-tagged (His-His-His-His-His-His; SEQ ID NO:96) full length human Angiopoietin-2 protein (Ang2-WT; R&D Systems), or with a recombinant N-terminal His-tagged human angiopoietin-2 receptor binding domain protein (Ang2-RBD; aa275-aa496; Sino Biological) and magnetic His capture beads (Dynabeads™ His-Tag Isolation and Pulldown; Thermofisher). Briefly, beads (the amount varied with the amount of target protein coupled) were washed three times with immobilization buffer (50 mM sodium phosphate, pH 8.0, 300 mM NaCl, 0.01% Tween-20) and were re-suspended in 50 mL of immobilization buffer. Ang2-WT or Ang2-RBD, in immobilization buffer, was then added to the beads and incubated at room temperature for 30 minutes. The amount of target protein varied with the rounds (Table 4). The beads were washed three times with binding buffer SB IT (40 mM HEPES, pH 7.5, 125 mM NaCl, 5 mM KC1, 1 mM MgCl₂, 1 mM CaCl₂, 0.05% Tween-20) to remove any unbound protein and then re- suspended in 50 mL SB1T buffer. In rounds 2, 3, 4 and 5, the Ang2-WT coated beads were re- suspended in 50 mL SB IT buffer containing 0.1% BSA. In rounds 6 and 7, the Ang2-RBD coated beads were re-suspended in 50 mL SB1T buffer containing 1 mg/pl ssDNA and 0.1%

BSA.

[00227] For the first round of selection, ~1.5 nanomoles of the Round 1 RNA pool comprising ~4 copies of ~ 2 x10¹⁴ sequences was used. Prior to each round, the library was thermally equilibrated by heating at 90°C for 6 minutes and cooled at room temperature for 5 minutes in the presence of a 1.5-fold molar excess of reverse primer (N35.R; SEQ ID NO:95) to allow the library to refold and simultaneously block the 3’ end of the pool. Following renaturation, the final volume of the reaction was adjusted to 50 mL in SB IT. [00228] For the first round, the library was added to the Ang2-WT protein immobilized on beads and incubated at 37°C for 30 minutes with intermittent mixing. After 30 minutes, the beads were washed three times using 0.5 ml SB IT buffer per wash to remove unbound aptamers. Each wash step was incubated for 5 minutes. After washing, bound aptamers were eluted using 200 mL elution buffer (2M Guanidine-HCl in SB1T buffer) two times (total volume 400 mL).

The eluted aptamers, in 400 mL of elution buffer, were precipitated by adding 40 mL 3M NaOAc, pH 5.2, 1 ml ethanol and 4 pi glycogen and were incubated at -80°C for 15 minutes. The recovered library was converted to DNA by reverse transcription and the ssDNA was subsequently amplified by PCR. The resulting dsDNA library was subsequently converted back into modified RNA via transcription as described above. DNased, purified RNA was used for subsequent rounds.

[00229] Following round 1, the input RNA was kept fixed at 25 picomoles (Table 4).

Additionally, after the first round, two sequential negative selection steps were included in rounds 2, 3, 4 and 5. For the negative selections in rounds 2, 3, 4 and 5, the RNA pool was prepared as described before and was incubated with non-labelled beads for 30 minutes at 37°C in SB 1 T buffer. The beads were then spun down and the supernatant containing molecules that did not bind to the unlabeled beads was incubated with recombinant C-terminal His-tagged full length Human Angiopoietin-1 (Ang1-WT; R&D Systems) labeled beads for an additional 30 minutes at 37°C. The beads were then spun down following the incubation with Ang1 -labeled beads and the supernatant containing molecules that did not bind to the unlabeled beads or Ang1- labeled beads was incubated with Ang2-labeled beads for an additional 30 minutes at 37°C. For the negative selections in rounds 6 and 7, the RNA pool was prepared as described before and incubated with non-labelled beads for 30 minutes at 37°C in SB IT buffer. The beads were then spun down and the supermatant containing molecules that did not bind the unlabeled beads was incubated with beads labeled with Ang2-RBD protein for an additional 30 minutes at 37°C. The details are summarized in Table 4.

[00230] Table 4. Selection details

[00231] B. Assessing the progress of selection

[00232] Flow cytometry was used to assess the progress of the selection. For these assays, RNA from each round of selection was first hybridized with reverse complement oligonucleotide composed of 2'OMe RNA labeled with DYLIGHT® 650 (Dy650-N35.R.OMe). Briefly, the library was combined with 1.5-fold molar excess of Dy650-N35.R.OMe, heated at 90°C for 6 minutes and allowed to cool at room temperature for 5 minutes, after which it was incubated with beads labelled with Ang2-WT protein, in SB IT buffer containing 0.1% BSA and 1 mg/ml ssDNA. As a control for determining that selected aptamers had specificity towards Ang2 and not Ang1, the libraries were also prepared in an identical fashion and incubated with Ang1-WT labeled beads. Following incubation for 30 minutes at 37°C with Ang2-WT and Ang1-WT labeled beads, the beads were washed 3 times with SB IT, re-suspended in SB IT buffer and analyzed by flow cytometry. As shown in FIG. 2, an improvement in fluorescent signal with the progressing rounds on Ang2-WT labeled beads was seen as early as Round 3. No fluorescent signal was seen with unlabeled beads or Ang1-WT labeled beads, demonstrating that Ang2 targeted aptamer libraries were specific to Ang2. After Round 5, there was little change in the binding signal through Round 7 when using Ang2-RBD protein labeled beads (FIG. 3).

[00233] Using this approach, the apparent binding affinity was measured for selection rounds using the His-tagged Ang2-RBD. Briefly, serial dilutions of the fluorescently labeled library rounds were incubated with beads labelled with Ang2-RBD, in SB1T buffer containing 0.1% BSA and 1 mg/ml ssDNA. Following incubation for 30 minutes at 37°C, the beads were washed three times with SB IT, re-suspended in SB1T buffer and analyzed by flow cytometry. A plot of the relative median fluorescent intensity versus aptamer concentration (FIG. 4) was fit using the equation Y = Bmax*X/(K_d + X) and revealed a K_d ^app of 89.5 nM in Round 3, K_d ^app of 80.3 nM in Round 4, K_d ^app of 33.8 nM in Round 5, K_d ^app of 61.0 nM in Round 6 and a K_d ^app of 23.2 nM in Round 7 (Table 5).

[00234] Table 5. Affinity constant of selected rounds and aptamers generated in selection to Ang2.

[00235] C. Selection, purification and characterization of clones

[00236] The enriched aptamer populations recovered from Rounds 2 through 7 of the selection were sequenced to identify individual functional clones. Sequencing data from >250,000 individual reads was processed by trimming the flanking constant regions and was aligned using the ClustalW alignment algorithm. Aptamers were ranked by frequency within the libraries and organized into families by clustering aptamers with similar sequence relatedness. All in silico analyses were performed using Geneious software (Biomatters Inc. Newark NJ, USA). From an analysis of Rounds 2-7, 20 individual clones were selected for testing. A summary of the full- length clones identified for testing from the selection are shown in Table 6. Aptamers composed of only the portion of the aptamer sequence derived from the random region, listed in Table 6, were subsequently generated by chemical synthesis. The sequences of the chemically synthesized aptamers are summarized in Table 7. Synthesis was performed on a BioAutomation MerMade 48X using the 2'-fluoro-G (2’F GTP) and 2'-0-methyl (2'OMe) A/C/U modified phosphoramidites. Following synthesis, aptamers were cleaved from the solid support, the bases and terminal amines were deprotected, purified and desalted into nuclease free H₂O via buffer exchange, before being used for further analysis.

[00237] Table 6. Sequences of full-length Ang2 aptamers.

[00238] Table 7. Sequences of Ang2 truncated aptamers generated by chemical synthesis.

[00239] D. Assaying individually synthesized aptamers for binding

[00240] Chemically synthesized aptamers, Aptamer 3 through Aptamer 13, (Table 7) were labeled with Alexa Fluor 647 and evaluated for binding to Ang-2-RBD protein in the bead-based flow cytometry assay. Briefly, Ang2-RBD protein was immobilized on magnetic His capture beads. Labeled aptamers were thermally equilibrated by heating to 90°C for 3 minutes and allowed to cool at room temperature for 5 minutes. 10 nM and 100 nM labeled aptamers were then incubated for 30 minutes at 37°C with Ang2-RBD labeled beads in SB1T buffer containing 0.1% BSA and 1 mg/ml ssDNA. Following incubation for 30 minutes, the beads were washed 3 times with SB IT, re-suspended in SB IT buffer and analyzed by flow cytometry. As shown in FIG. 5, the aptamers showed varying levels of binding to Ang2-RBD protein. Aptamer 4 and Aptamer 5 were confirmed to be non-functional due to them demonstrating no binding to Ang2- RBD labeled beads. The lack of activity for Aptamer 4 and Aptamer 5 may be a consequence of not including sequences from the library constant regions in the chemical synthesis of the aptamers, which can alter aptamer folding and thus function. Aptamers 4 and Aptamer 5 were excluded from any of the additional analysis methods highlighted below. Aptamer 13 though Aptamer 22 were not used for this analysis.

[00241] Example 2: Determination of apparent binding constants bv flow cytometry.

[00242] Flow cytometry was used to determine the apparent binding constants of all chemically synthesized aptamers (Table 7). Aptamer 4 and Aptamer 5 were excluded from this analysis as they did not show target binding in the two-point assay (see Example ID). To measure the apparent K_d of the Ang2 aptamers, the Alexa Fluor 647 labeled aptamers were thermally equilibrated and then serially diluted in SB IT buffer and incubated with Ang2-RBD labeled beads (nominal Ang2 concentration not greater than 4 nM) in buffer containing 0.1% BSA and 1 mg/ml ssDNA. After incubating the aptamers with the beads for 30 minutes at 37°C, the beads were washed 3 times with SB1T, re-suspended in SB1T buffer and analyzed by flow cytometry. A plot of median fluorescent intensity versus aptamer concentration (FIG. 6) was fit using the equation Y = Bmax*X/(K_d + X) to determine the apparent binding constants for Ang2-RBD which ranged from 3.9 to 50.4 nM (Table 8).

[00243] Table 8. Apparent binding constants of chemically synthesized aptamers by flow cytometry

[00244] Example 3. Determination of apparent binding constants bv TR-FRET. [00245] Chemically synthesized aptamers were labeled with Alexa Fluor 647 and their affinity for Ang2 was determined using TR-FRET. The Alexa Fluor 647 labeled aptamers were individually diluted two-fold in assay buffer (50 mM MOPS, pH 7.4, 125 mM NaCl, 5 mM KC1, 50 mM CHAPS, 0.1 mg/mL BSA, ImM CaCl₂ and ImM MgCl₂) and added to an equal volume of 30 nM His-tagged Ang2 receptor binding domain (Ang2-RBD; Aero Biosystems) in assay buffer in a Coming Black 96 well ½ area plate (Coming). The buffer control for each aptamer was used for background subtraction. All wells then received 10 mL of 15 nM europium labeled anti-His tagged antibody (Perkin Elmer) and were incubated for 2 hours and then read on a Biotek CYTATION™ 5 Plate Reader. Samples were excited at 330 nm and fluorescent values at 665 nm were collected. The final concentration of Ang2 RBD was 10 nM.

[00246] The background value without added Ang2-RBD for each aptamer concentration was subtracted from the value obtained for each aptamer concentration that contained Ang2. The resulting value was fit to one site specific binding in GraphPad Prism version 7.03 (GraphPad Software, Inc). Representative data for an individual aptamer (Aptamer 3) is shown in FIG. 7. The apparent K_dS obtained for all the fits are shown in Table 9. Aptamer 3 through Aptamer 12 bound to 20 nM Ang2 with affinities of 6 - 36 nM. Since the Ang2-RBD was present at 10 nM, these results are consistent with aptamers binding Ang2-RBD with affinities of at least 10 nM, and half-maximal binding being limited by the concentration of Ang2 (10 nM) in this assay.

[00247] Table 9. Apparent K_d for solution binding TR-FRET assay

[00248] Examnle 4. Inhibition of Ang2 binding to Tie2 receptor by competition ELISA

[00249] Chemically synthesized aptamers were tested for the ability to inhibit Ang2 binding to the Tie2 receptor using a competition ELISA. A Nunc Maxisorp Plate (Thermo Fisher) was coated with 50 mL of 20 nM Fc-His-Tie2 (R&D Systems) in PBS, then the plate was sealed and stored at 4°C overnight. The coating liquid was removed and the plate was washed three times with 200 mL PBST, then blocked with PBS + 0.5% BSA at room temperature for a minimum of 1 hour. The aptamers were diluted 3-fold in assay buffer (PBS + 0.1% BSA, 1 mM CaCl₂ and 1 mM MgCl₂), then an equal volume of 1 nM biotinylated Ang2-WT (R&D Systems) in assay buffer was added to the diluted aptamers to yield 100 mL of 500 pM Ang2 and aptamers. The Maxisorb assay plate was then washed three times with wash buffer and 75 mL of the aptamer- Ang2 mixture was added to the plate, to allow Ang2 that was not inhibited by aptamers to bind to the immobilized Tie2. The plate was sealed with a plate sealer and mixed gently for 2 hours at 400 rpm on a plate shaker at room temperature, then washed three times with 200 mL of wash buffer. In order to detect biotinylated Ang2 that was bound to the immobilized Tie2, 50 mL of Streptavidin HRP (ABCAM), diluted 1 : 10,000 in assay buffer, was added to the washed plate and mixed at 400 rpm on a plate shaker for 1 hour. The plate was then washed with 200 mL of wash buffer and 100 mL TMB substrate (Thermo Fisher) was added. The plate was quenched at 15 minutes with 50 mL of 2N sulfuric acid (ICCA) and absorbance at 450 nM was read on a BioTek CYTATION™ 5 plate reader.

[00250] Absorbance values were normalized to % inhibition of maximal binding and IC₅₀s were determined by fitting the % inhibition values in GraphPad Prism. Representative data from select fitted curves are shown in FIG. 8 with a summary of the IC₅₀ values for all aptamers tested shown in Table 10.

[00251] Most of the aptamers tested in this assay inhibited Ang2 binding to immobilized Tie2. For example, all aptamers tested in this assay half-maximally inhibited 500 pM Ang2 binding to immobilized Tie2 with IC₅₀ values ranging from 0.21 to 21 nM, with the exception of Aptamer 21, which did not inhibit binding (Table 10). These data are consistent with the aptamers having low nM and sub nM affinity for Ang2 and potently inhibiting Ang2 binding to Tie2. Aptamer 13 and Aptamer 18 are potentially more potent than reported, as the IC₅₀ values determined in this assay are limited by the half-maximal inhibition of Ang2 binding to Tie2, which is fixed by the concentration of Ang2 (0.5 nM) used in the assay.

[00252] Table 10. ICso values for Ang2 aptamers in Ang2-Tie2 Competition ELISA

[00253] Example 5. Inhibition of Tie2 phosphorylation

[00254] Chemically synthesized aptamers were tested for inhibition of Ang2-induced Tie2 phosphorylation in HEK293T cells that were transiently transfected to overexpress Tie2.

HEK293T cells were transiently transfected with a Tie2 expression plasmid (Sino Biological) using Lipofectamine™P3000 for 5 to 6 hours in OPTI-MEM. Following incubation, the media was exchanged for DMEM+10% FBS and the cells incubated were overnight. Cells were harvested approximately 24 hours post transfection by gently tapping the plate to remove the cells, which were then pelleted in phenol red-free DMEM + 0.2% FBS. The cells were then plated into poly-d-lysine-coated 96 well plates at 50,000 cells per well in 100 mL and allowed to attach to the plate for 5 to 6 hours.

[00255] Aptamer based inhibition was determined by adding 50 mL of Ang2-WT (R&D Systems) plus and minus inhibitors to 50,000 cells in a final volume of 100 mL per well, and incubated for 30 minutes. The final concentration of Ang2 and inhibitors was 50 nM and 250 nM, respectively. After 30 minutes, media was removed and cells were lysed with 100 mL of RIPA buffer (Thermo Scientific) supplemented with Halt™ protease and phosphatase inhibitor cocktail with EDTA (Thermo Scientific.

[00256] Lysates were diluted 25-fold in RIPA buffer. Phosphorylated Tie2 was quantified using the Human Phospho-Tie2 DuoSET IC ELISA (R&D Systems) according to the product protocol. Percent inhibition of Ang2-stimulated phosphorylation of Tie2 was calculated in respect to the negative and positive control. Inhibition values are shown in Table 11 and represented graphically in FIG. 9. Aptamer 3 through Aptamer 12 inhibited Tie2 phosphorylation by >50% (Table 11 and FIG. 9), with the exception of Aptamer 4 and Aptamer 5 which do not bind Ang2-RBD (Example ID).

[00257] Table 11. % Inhibition of Ang2-induced Tie2 phosphorylation

[00258] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby. [00259] Example 6. Sequence analysis and structure determination of H-tvpe pseudoknot inhibitors of Ang2

[00260] Sequencing data from the round 7 of the primary selection against Ang2 produced >250,000 individual reads. Sequences were trimmed to remove the constant regions from the 5’ and 3’ ends, leaving the central 34 nucleotide region from the prepared library and the flanking terminal U nucleotide spacers on the 5’ and 3’ ends. Identical sequences were clustered together to form“stacks” of identical sequences. These stacks were then placed in rank order by the total number of identical sequences contained within each stack. The rank ordering of stacks of sequences gives a first approximation of aptamer fitness, as the number of times an individual sequence is present within the library correlates with molecular function, i.e. more functional molecules appear with greater frequency within a given library.

[00261] We used the sequence, CCUGCCCAAUAACAGG (SEQ ID NO: 483) located within Aptamer 18 to identify sequences within the top 5000 stacks from the primary selection. To broaden the search window, we allowed for as many as 5 mutations to occur within the sequence during the search. The analysis revealed 135 sequences related to Aptamer 18 and demonstrated that these molecules conformed to a H-type pseudoknot configuration defined by two interacting stem loop structures. In the case of the Aptamer 18 family of molecules, the H-type pseudoknot is composed of 3 stems (S1, S2 and S3), and as many as 5 intervening loop regions (L1, L2, L3, L4 and L5; FIG. 10A and FIG. 10B). Aptamer 18 comprised of stems S1, S2, S3 and loops L1, L2 and L3 readily conforms to this structure FIG. 11 A. As further illustrated by the

representative 31 of 135 sequences shown in Table 12, all other molecules within the Aptamer 18 family adopt an H-type pseudoknot configuration.

[00262] The common H-type pseudoknot adopted by the Aptamer 18 family of sequences presented in Table 12 may be comprised (in a 5’ to 3’ direction) of a first stem (S1), a second stem (S2), a first loop (L1), a third stem (S3), a second loop (L2), a third loop (L3), and a 3’ unpaired terminal sequence (3’T). In some cases, Aptamer 18 family members further contain a fourth loop (L4) between S1 and S2, and a fifth loop (L5) between S3 and S1 (FIG. 10A and FIG. 10B). As provided in FIG. 10A and 10B, the 3’ terminal end of S1 may be connected to the 5’ terminal end of S2. Alternatively, if L4 is present, L4 may be connected to the 3’ terminal end of S1 and the 5’ terminal end of S2. L1 may be connected to the 3’ terminal end of S2 and the 5’ terminal end of S3. The 3’ terminal end of S3 connects to the 5’ terminal end of the complementary region of S1. Alternatively, if L5 is present, L5 may be connected to the 3’ terminal end of S3 and the 5’ terminal end of the complementary region of S1. L2 may be connected to the 3’ end of the complementary region of S1 and the 5’ end of the complementary region of S3. L3 may be connected to the 3’ end of the complementary region of S3 and the 5’ end of the complementary region of S2. The 3’T is connected to the 3’ end of the

complementary region of S2.

[00263] Analysis of all Aptamer 18 related sequences from the initial selections revealed that stem S1 can range from three to five base pairs in length. All unique variations identified in stem S1 from the alignment of the 135 members of the Aptamer 18 family of molecules are listed in Table 13 and demonstrate that stem S1 can be formed using 32 alternative sequence pairing configurations. They also demonstrate that stem S1 is not highly conserved in sequence identity and can contain at least one mismatched residue. Covariation within this region strongly supports the formation of a stem. When stem S1 is 5 base pairs in length, the consensus sequence for the 5’ side of stem S1 is 5’-UBSBK-3’, and for the 3’side of stem S1 is 5’- VSSNA -3’where B is C, G orU, S is C or G, K is G or U, V is A, C or G, and N is any nucleotide. When S1 is 4 base pairs in length, the consensus sequence for the 5’ side of S1 is 5’-DNNN-3’, and for the 3’side of stem S1 is 5’-NNNN-3’, where D is A, G or U, and N is any nucleotide. When stem S1 is 3 base pairs in length, the consensus sequence for the 5’ side of stem S1 is 5’-UGG-3’ and for the 3’ side of stem S1 is 5’-CCA-3’. The high degree of sequence conservation for the first U nucleotide within the 5’ side of S1 is because this base pair often forms using the invariant U- spacer flanking the N35 randomized portion of the library. In some cases, the anti-Ang2 aptamer may have mispairings within stem S1 (mispaired nucleotides within S1 are underlined in Table

13).

[00264]

[00265] All unique variations identified in stem S2 from the alignment of the 135 members of the Aptamer 18 family of molecules are listed in Table 14. Stem S2 can be formed using 28 alternative sequence pairing configurations that range from 2 to 6 base pairs in length.

Covariation within this region strongly supports the formation of a stem. In some cases, the first nucleotide within the 5’ side of stem S2 is G and the last nucleotide within the 3’ side of stem S2 is a C, which forms a G-C pair with >99% conservation. In other instances, the first nucleotide on the 5’ side of stem S2 is A and the last nucleotide within the 3’ side of stem S2 is U, which forms an A-U pair with <1% conservation. When stem S2 is 6 base pairs in length, the consensus sequence for the 5’ side of stem S2 is 5’-GGUGAG-3’ and for the 3’ side of stem S2 is 5’- UUUGCC-3’. When stem S2 is 5 base pairs in length, the consensus sequence for the 5’ side of S2 is 5’-GACUU-3’ and for the 3’ side of stem S2 is 5-AAGUC-3’. When stem S2 is 4 base pairs in length, the consensus sequence for the 5’ side of S2 is 5’-RVND-3’and for the 3’ side of stem S2 is 5’-BBBY-3’, where R is A or G, V is A, C or G, N is any nucleotide, D is A, G or U, B is C, G orU and Y is C or U. When stem S2 is 3 base pairs in length, the consensus sequence for the 5’ side of stem S2 is 5’-GNN-3’ and for the 3’ side of stem S2 is 5’-DHC-3’, where N is any nucleotide, D is A, G or U, and H is A, C or U. When stem S2 is 2 base pairs in length, the consensus sequence for the 5’ side of S2 is 5’-GV-3’ and the 3’ side of stem S2 is 5’-BC-3’, where V is A, C or G and B is C, G or U. In some cases, the anti-Ang2 aptamer may have mispairings within stem S2 (mispaired nucleotides within stem S2 are underlined in Table 14).

[00266] All unique variations identified in stem S3 from the alignment of the 135 members of the Aptamer 18 family of molecules are listed in Table 15. Stem S3 is comprised of 32 unique sequence pairing configurations that range from three to five base pairs in length. Covariation within this region strongly supports the formation of a stem. When stem S3 is 5 base pairs in length, the consensus sequence for the 5’ side of stem S3 is 5’-BMCBG-3’, and the consensus sequence for the 3’ side of stem S3 is 5’CVGKK-3’, where B is C, G or U, M is A or C, V is A, C or G and K is G or U. When stem S3 is 4 base pairs in length, the consensus sequence for the 5’ side of stem S3 is 5’-NNNN-3’and the 3’ side of stem S3 is 5’-NNNN-3’, where N is any nucleotide. When stem S3 is 3 base pairs in length, the consensus sequence for the 5’ side of S3 is 5’-VYB-3’ and the 3’ side of stem S3 is 5’-YRB-3’, where V is A, C or G, Y is C or U, B is C, G orU and R is A or G.

[00267] All unique variations identified in loop L1 from the alignment of the 135 members of the Aptamer 18 family of molecules are listed in Table 16. Loop L1 can range from one to four nucleotides in length and is not highly conserved in sequence identity. There are 58 unique sequences that can form loop L1. When L1 is 4 nucleotides long, the consensus sequence for L1 is 5’-VNNN-3’, where V is A, C or G and N is any nucleotide. When L1 is 3 nucleotides long, the consensus sequence for L1 is 5’-NNN-3’, where N is any nucleotide. When L1 is 2 nucleotides long, the consensus sequence for L1 is 5’-NN-3’, where N is any nucleotide. When L1 is 1 nucleotide long, the consensus sequence for L1 is 5’-H-3’, where H is A, C or U.

[00268] All unique variations identified in loop L2 from the alignment of the 135 members of the Aptamer 18 family of molecules are listed in Table 17. Loop L2 can range from two to six nucleotides in length and is not highly conserved in sequence identity. There are 41 alternative sequences that can form loop L2. When loop L2 is 6 nucleotides long, the consensus sequence for L2 is 5’-WYWWHA-3’, where W is A or U, Y is C or U and H is A, C or U. When L2 is 5 nucleotides long, the consensus sequence for L2 is 5’-DNDWR-3’, where D is A, G or U, N is any nucleotide, W is A or U and R is A or G. When L2 is 4 nucleotides long, the consensus sequence for L2 is 5’-NNND-3’, where N is any nucleotide and D is A, G or U. When L2 is 3 nucleotides long, the consensus sequence for L2 is 5’-HWA-3’, where H is A, C or U and W is A or U. When L2 is 2 nucleotides long, the consensus sequence for L2 is 5’-UA-3’.

[00269] All unique variations identified in loop L3 from the alignment of the 135 members of the Aptamer 18 family of molecules are listed in Table 18. Loop L3 may include from zero to seven nucleotides and is not highly conserved in sequence identity. As illustrated in Table 18, there are 86 unique sequence identities for loop L3. When loop L3 is 7 nucleotides long, the consensus sequence for loop L3 is 5’-AUAAGUA-’. When loop L3 is 6 nucleotides long, the consensus sequence for loop L3 is 5’-WWBMRY-3’, where W is A or U, B is C, G or U, M is A or C, R is A or G and Y is C or U. When loop L3 is 5 nucleotides long, the consensus sequence for loop L3 is 5’-NNNDN-3’, where N is any nucleotide and D is A, G or U. When loop L3 is 4 nucleotides long, the consensus sequence for loop L3 is 5’-NNNN-3’, where N is any nucleotide. When loop L3 is 3 nucleotides long, the consensus sequence for loop L3 is 5’-NNN-3’, where N is any nucleotide. When loop L3 is 2 nucleotides long, the consensus sequence for loop L3 is 5’- NN-3’, where N is any nucleotide. When loop L3 is 1 nucleotide in length, the nucleotide identity for loop L3 is A.

[00270] All unique variations identified in 3’ terminal, 3’T, from the alignment of the 135 members of the Aptamer 18 family of molecules are listed in Table 19. The 3’ unpaired terminal sequence can range from two to six nucleotides. There are 34 unique sequences that can form the 3’ terminal sequence. The first G nucleotide within the 3’ terminal sequence is highly conserved (>90%). When the 3’ terminal sequence is 6 nucleotides long, the consensus sequence is 5’- GDDBHU-3’, where D is A, G or U, B is C, G or U and H is A, C or U. When the 3’ terminal sequence is 5 nucleotides long, the consensus sequence is 5’-GDNNU-3’, where D is A, G or U and N is any nucleotide. When the 3’ terminal sequence is 4 nucleotides long, the consensus sequence is 5’-RDNU-3’, where R is A or G, D is A, G or U and N is any nucleotide. When the 3’ terminal sequence is 3 nucleotides long, the consensus sequence is 5’-BNH-3’, where B is C, G or U, N is any nucleotide and H is A, C orU. When the 3’ terminal sequence is 2 nucleotides long, the consensus sequence is 5’-GH-3’, where H is A, C or U.

[00271] Some members of the Aptamer 18 family members contain a fourth loop (L4) between stems S1 and S2, and a fifth loop (L5) between stems S3 and S1 (FIG. 10A and FIG. 10B). Within the alignment of the 135 members of the Aptamer 18 family of molecules, L4 was found to be 5’-G-3’ or 5’-ACG-’. The sequence of loop L5 was 5’-A-’.

[00272] The motif variations for each structural element (eg. S1, L4 S2, L1, S3, L5, L2, L3, 3’T) within members of the Aptamer 18 family reported in Tables 13, 14, 15, 16, 17, 18 and 19 represent the total variation observed within the top 5000 sequence stacks identified from sequence analysis of the primary selection. By combining the provided motifs for the respective structural elements of this aptamer family in the proper order and orientation (FIG. 10), one can thus assemble extant or novel Aptamer 18-like molecules with anti-Ang2 activity.

Example 7; Degenerate selection of H-type pseudoknot inhibitors of Ang2

[00273] To further define the secondary structure of the Aptamer 18 class of anti-Ang2 aptamers, as well as to potentially identify Ang2 aptamers with increased potency, a secondary selection was performed utilizing a partially randomized library consisting of 70% of the Aptamer 18 parental sequence, plus 10% of the other 3 nucleotides at positions 2-35 within Aptamer 18 and flanked by the built-in terminal U nucleotide spacers on the 5’ and 3’ ends of the 36-mer along with the 5’ and 3’ constant regions. Note that as the libraries for the secondary selection are built based on the sequence of Aptamer 18, the size of the structural elements (S1, S2, L1, S3, L2, L3 and 3’T) are generally fixed to the length in which they occur in Aptamer 18, with little or no variation in length during the secondary selection. Further, as structural elements L4 and L5 are not present in Aptamer 18, they are therefore not included in the library design for the secondary selection. Five rounds of selection against Ang2 were conducted using this library under conditions defined in Table 20. The progress of the selections was monitored by flow cytometry to ensure enrichment for function (data not shown). For rounds 1 through 4, His-tagged protein was immobilized on magnetic His capture beads as described for the primary selection. For the fifth round of selection we further increased the selection stringency by performing a solution capture of aptamer/target protein complexes with glycan biotinylated Ang2 (R&D Systems) and streptavidin tagged paramagnetic beads (ThermoFisher Scientific). In short, 25 pi comoles of library was prepared in a final reaction volume of 50 mL in SB1T and thermally equilibrated using the standard library preparation protocol. Once the library had cooled to room temperature, biotinylated Ang2-WT protein was added to the library at a final concentration of 1 nM and incubated with the library at 37°C for 30 minutes with intermittent mixing. During this step, streptavidin tagged paramagnetic beads were washed three times with SB IT buffer and resuspended a fourth time before being transferred to the reaction tubes containing the Ang2 protein-aptamer mixture. Beads were incubated with Ang2 protein/aptamer complexes for 30 minutes at 37°C with intermittent mixing and washed three times using 0.5ml SB IT buffer per wash to remove all unbound protein and aptamers from the streptavidin beads. After washing, Ang2-bound aptamers were eluted using 200 mL elution buffer and processed further using the standard selection protocol described previously.

[00274] Following the fifth round of selection, the libraries from each round were barcoded, pooled and sequenced on a MiniSeq high throughput sequencer (Illumina), which yielded approximately ~400,000 sequences per round. Sequences were trimmed to remove the constant regions from the 5’ and 3’ ends, leaving the central 34 nucleotide region from the prepared library and the flanking terminal U nucleotide spacers on the 5’ and 3’ ends. Identical sequences were clustered together to form“stacks” of identical sequences. These stacks were then placed in rank order by the total number of identical sequences contained within each stack. The rank ordering of stacks of sequences gives a first approximation of aptamer fitness, as the number of times an individual sequence is present within the library correlates with molecular function, i.e. more functional molecules appear with greater frequency within a given library. Furthermore, stacks that observed significant increases in their ranking between Round 4 to Round 5 when the stringency of the selection was increased, were deemed to have increased fitness in this round of selection and potentially reflect an increased potency towards Ang2.

[00275] Alignment of the top 250 stacks of sequences within the Round 4 library, which contained ~68,500 stacks of sequences and comprised the top performing ~40% (168,306 / 400,642 total sequences) of the selected population of aptamers from the secondary selections was used to determine the nucleotide conservation for each position within Aptamer 18 (FIG. 12). Aside from a few nucleotide positions which we poorly conserved (<70%), most of the nucleotide positions demonstrated conservation levels >90% with many positions demonstrating absolute (100%) conservation. Further investigation of the aligned stacks of sequences further confirm the Aptamer 18 family of anti-Ang2 aptamers conform to the predicted H-type pseudoknot structure.

[00276] Comparison of the top 250 stacks of sequences from Round 4 revealed observable co- variation within S1 at positions 2 and 3; the observed covariation at these positions provides further support for the formation of stem S1 (Table 21). The consensus sequence for the 5’ side of stem S1 is 5’-UVSG-3’, where V is A, C or G and S is G or C. The consensus sequence for the 3’ side is 5’-CSBA-3’, where S is G or C and B is C, G or U (FIG. 11B).

[00277] Analysis of stem S2 within the top 250 stacks of sequences demonstrated an extremely high-degree of sequence conservation with the parent Aptamer 18 sequence with 248 of the 250 sequence stacks matching the wild-type S2 sequences. However, two stacks demonstrate co- variation within this region further supporting the formation of S2 within the H-type pseudoknot family of anti-Ang2 aptamers (Table 22; P7-018.R4-158, P7-018.R4-222). Thus, the consensus sequence for the 5’ side of stem S2 is 5’-GRC-3’, where R is A or G and the consensus sequence for the 3’ side of stem S2 is 5’-GYC-3’, where Y is C or U (FIG. 11B).

[00278] In the context of the Aptamer 18 sequence, the identity of stem S3 following the analysis of the secondary selections revealed that S3 is 100% conserved and completely invariant. The 5’ arm of S3 is comprised of the sequence 5’-CCUG-3’ and the 3’ arm of S3 is comprised of the sequence 5’-CAGG-3’ (FIG. 11B).

[00279] Investigation of loop L1 within the top 250 stacks of sequences demonstrated that loop is variable. Interestingly, although the terminal 5’ and 3’ nucleotides of L1 demonstrated >90% conservation during the selection, the central U found in the parent Aptamer 18 was only 52% conserved (FIG. 12), and showed a marked preference (40%) for conversion from U to A. Thus, the consensus sequence for L1 is 5’-DNN-3’, where D is A, G or U and N is any nucleotide (FIG. 11B and Table 23). In a preferred embodiment, the consensus sequence for L1 is 5’- RAN-3’.

[00280] Analysis of loop L2 revealed that aside from the terminal 3’ A nucleotide (position 22) within loop L2, which demonstrates 100% conservation (FIG. 12), the rest of the nucleotides within L2 are highly variable with modest conservation in position 20 (84%; FIG. 12) and essentially no conservation at positions 19 and 21 (70% and 67%; FIG. 12). Interestingly, for position 21, a U in the parent Aptamer 18, the only observed substitution was to an A (32%; FIG. 12). Thus, based on the analysis of the top 250 stacks from the secondary selection, the consensus for L2 is 5’-NNHA-3’, where N is any nucleotide and H is A, C or U (FIG. 11B and Table 24).

[00281] The analysis of loop L3 within the top 250 stacks of sequences of the secondary selection revealed generally modest sequence variation (Table 25). Positions 27, 29 and 30 were most highly conserved (95%, 97% and 99%; FIG. 12). Position 28 showed little conservation for the parental G (76% versus 70% in the starting library) but showed a modest preference for conversion to A (17% versus 10% in in the starting library). Thus, the consensus sequence for loop L3 is 5’-HNVN-3’, where H is A, C or U, N is any nucleotide and V is A, C or G (FIG. 11B). In a preferred embodiment, the consensus sequence for loop L3 is 5’-YAVN-’.

[00282] The analysis of the 3’ terminal sequence within the top 250 stacks revealed that the first G nucleotide at position 34 is extremely well conserved (100% sequence conservation; FIG 12 and Table 26). The A at position 35 was partially conserved (~84%; FIG. 12). The conservation of the U nucleotide at position 36 was to be expected as this position was not partially randomized in the design of the library for the secondary selection. This information correlates nicely with the information from the analysis of the 135 Aptamer 18 related sequences, where the first G nucleotide within the 3’ unpaired terminal sequence is highly conserved, and the following nucleotide is highly variable (Table 12). Based on these results the consensus of the 3’ terminal sequence is 5’-GNU-3’ (FIG. 11B).

[00283] When combined, the data from the degenerate selection of Aptamer 18, provide a consensus sequence of 5’- UVSG-GRC-DNN-CCUG-CSBA-NNHA-CAGG-HNVN-GYC- GNU-3’, (FIG. 11B; SEQ ID NO: 97) where V is A, C or G, S is G or C, R is A or G, D is A, G or U, N is any nucleotide, B is C , G or U, H is A, C or G, and Y is C or U. The structural elements within the aptamer are separated by dashes ( - ). In a preferred embodiment, the consensus is 5’-UVSG-GRC-RAN-CCUG-CSBA-NNHA-CAGG-HNVN-GYC-GNU-3’(SEQ ID NO:98), where V is A, C or G, S is G or C, R is A or G, D is A, G or U, N is any nucleotide, B is C , G or U, H is A, C or G, and Y is C or U. The structural elements within the aptamer are separated by dashes ( - ). In another preferred embodiment, the consensus is 5’-UVSG-GRC- DNN-CCUG-CSBA-NNHA-CAGG-YAVN-GYC-GNU-3’(SEQ ID NO:99), where V is A, C or G, S is G or C, R is A or G, D is A, G orU, N is any nucleotide, B is C , G or U, H is A, C or G, and Y is C or U. The structural elements within the aptamer are separated by dashes ( - ).

[00284] Example 8. Mutational analysis of S1 and S2

[00285] To further test and validate the structure of the Aptamer 18 family of H-type pseudoknot anti-Ang2 aptamers, a series of constructs were synthesized and tested to probe the structure and further optimize the anti-Ang2 aptamer. Generally, constructs were characterized using competition TR-FRET and ΊΊE2 receptor competition AlphaScreen assays, as follows. Briefly, for competition TR-FRET 2-fold dilutions of thermally equilibrated aptamers were made in TR-FRET Buffer (50 mM MOPS, pH 7.4, 125 mM NaCl, 5 mM KC1, 50 mM CHAPS, 0.1 mg/rnL BSA, 1 mM CaC12, and 1 mM MgC12) in a 384 well polypropylene plate. 5 mL was transferred to a black low volume 384 well Optiplate (Perikin Elmer). Additions were then made to the Optiplate in the following order: 5 uL of ALEXA FLUOR® 647 labelled Aptamer 18 (TR- FRET acceptor), 5 uL of His tagged recombinant Ang2 (R&D Systems), 5 uL of europium labelled anti-his antibody (Perkin Elmer). The final concentrations of ALEXA FLUOR® 647 labelled Aptamer 18, His tagged ANG2 and europium labelled anti His antibody was 30nM, 5 nM and 2.5 nM respectively. Excess un-labelled Aptamer 18 at 2 uM was used as a positive control to determine background and buffer only is used as the negative control to determine 0% inhibition. The plate was covered with a plate seal and subsequently incubated in the dark for 2 hours at room temperature. The plate was read on a Biotek CYTATION™ 5 plate reader.

Samples were excited at 330 nm and fluorescent values were collected at 665 nm. Data analysis was performed by subtracting the average background value and plotting as percent inhibition, normalized to baseline (buffer only) in the absence of competitor. The low control was determined using excess anti-Ang2 inhibitor and the high control was determined by buffer only. [00286] Percent inhibition for each sample was calculated by the following formula:

% inhibition = 1 -(sample-low contiol)/(high control- low control)* 100 The values were fit by [Inhibitor] vs. response - Variable slope (four parameters) using

GraphPad Prism Version 7.0 and then normalized to aptamer control to obtain an IC₅₀ relative to parent aptamer. Data is presented as log values of relative IC₅₀.

[00287] For receptor binding inhibition, 2-fold dilutions of thermally equilibrated aptamers were made in TR-FRET Buffer (50 mM MOPS, pH 7.4, 125 mM NaCl, 5 mM KC1, 50 mM CHAPS, 0.1 mg/mL BSA, 1 mM CaC12, and 1 mM MgC12) in a polypropylene plate. 5 mL was transferred to a white low volume 384 well Optiplate (Perkin Elmer). A mixture of glycan biotinylated Ang2 (R&D Systems), Fc-TIE2 (R&D Systems), AlphaScreen® Protein A acceptor beads (Perkin Elmer) and AlphaScreen streptavidin donor beads (Perkin Elmer) was then prepared and 10 mL was added to the assay plate containing 5uL of aptamer or anti Ang2. The final concentration of glycan biotinylated Ang2, Fc-TIE2 and AlphaScreen® beads was 500 pM,

2 nM and 5ugZmL respectively. Excess un-labelled Aptamer 18 at 2 uM was used as the positive control (High control) to determine background and buffer only is used as the negative control (low control) to determine 0% inhibition. The assay plate was sealed and incubated in the dark for approximately 2 hours then was read on a Biotek CYTATION™ 5 plate reader using the Alpha 384 well optical cube.

[00288] Percent inhibition for each sample was calculated by the following formula:

% inhibition = 1 -(sample-low control)/(high control- low control)* 100 The values were fit by [Inhibitor] vs. response - Variable slope (four parameters) using

[00289] Nucleotides within the aptamer variants that were predicted to be present in stem regions were either co-varied to maintain pairing (Aptamer 55, 56, 57; Table 27 and Table 30) or mutated to abolish stem formation (Aptamer 65, 66, 136; Table 27 and FIG. 13). Co-varying the first and second base pairs of stem S1 (Aptamer 55, 56, 57; Table 27 and FIG. 13), and the second base pair of stem S2 (Table 31 and FIG. 16), had either little or no effect on aptamer function, or resulted in a improvements in function (> 2-fold) when compared against the parent Aptamer 18 sequence in competition binding and AlphaScreen activity. In contrast, mutations that created mispairing within S1 (Aptamer 65) and S2 (Aptamers 66), resulted in a significant loss of activity in the competition binding and AlphaScreen activity assays (Table 27 and FIG.

13).

[00290] Taken together, these data demonstrate the importance of pairing in stems S1 and S2 and further support the predicted H-type pseudoknot structure model for the Aptamer 18 family of anti-Ang2 aptamers. In the case of S1, based on these data the permissible sequence variation within stem S1 to 5’-NSGG-3’ for the 5’ side and 5’-CCSN-3’for the 3’ side, where N is any nucleotide, V is A, C or G, and S is C or G (FIG. 11C). When combined with the data from the secondary selection, this further expands the consensus for stem S1 to 5’NVSG-3’ for the 5’ side and 5’-CNNN-3’for the 3’ side, where N is any nucleotide, V is A, C or G, and S is C or G (FIG. 11D). When combined with all of the 4 base pair stem S1 variants for observed in the primary selection for the Aptamer 18 family members, the sequences for the 5’ and 3’ sides of S1 are 5’- NNNN-3’, where N is any nucleotide.

[00291] In the case of stem S2, these data confirm the variation observed in this stem from the primary selection. Based on these data, the stem S2 consensus is 5’-GRC-3’ for the 5’ side of stem S2 and GYC for the 3’ side of stem S2 (FIG. 11C) and in a preferred embodiment, the sequence is 5’-GGC-3’for the 5’ side of stem S3 and 5’-CCG-3’ for the 3’side of stem S2. When combined with all 3 base pair stem S2 variants observed in the primary selection for the Aptamer 18 family members, the sequence for the 5’ side of S2 is 5’-GNN-3’ and the sequence for the 3’ complementary side is DNC, where N is any nucleotide and D is A, G or U.

[00292] Example 9. Mutational analysis of S3

[00293] Stem S3 was invariant (100% conserved; FIG. 12) in the analysis of the top 250 stacks from the secondary selection. However, from the primary selection we observed that this motif within the Aptamer 18 family related sequences was not highly constrained in sequence or in length (Table 12). We designed a set of constructs to further investigate the importance of stem S3 within the context of the Aptamer 18. As shown in Table 27 and FIG. 13, while covarying mutations at the third and the closing fourth base pairs on the 5’ arm of S3 ( positions 13 and 14; Aptamers 154 - 156 and Aptamer 164) resulted in a moderate loss of function (~4-6 fold), constructs that explored alternative sequences with a greater degree of variation within S3 demonstrated a more significant loss of aptamer function (>100-fold; Table 27 and FIG. 13). Thus, while there are a wider number of permissible sequences that can form stem S3 within the Aptamer 18 family (Table 12 and Table 15), it is likely that the sequence identity for the doped selection which was focused on variants of single sequence, Aptamer 18, was constrained by the surrounding sequence within this molecule. However, because of the potency of the parent molecule, Aptamer 18, even the worst performing molecules still demonstrate activity in the high nM range and are thus still active.

[00294] Taken together, these data reveal an expanded consensus sequence for stem S3 of 5’- VNND-3’ for the S’ side of stem S3, where V is A, C or G; N is any nucleotide, D is A, G or U, and 5’-HNNB-3’ for the 3’ side of stem S3, where H is A, C or U, N is any nucleotide, and B is C, G or U (FIG. 11C). In a preferred embodiment, the analysis of the top performing anti-Ang2 aptamers demonstrates that the preferred sequence for S3 is 5’-CCUG-3’ for the 5’ arm and 5’- CAGG-3’ for the 3’ arm of stem S3. When combined with data from the secondary selection this consensus remains unchanged (FIG. 11D). However, when considered in the context of the primary selection data which demonstrates significant variation in this stem, the sequence for the 5’ and 3’ arms of S3 is 5’-NNNN-3’, where N is any nucleotide.

Example 10. Structure activity relationshios within loon regions

[00295] Analysis of the top 250 stacks from the doped selection revealed that loop regions within the Aptamer 18 family of anti-Ang2 aptamers observed far greater sequence variation when compared to the stem regions. To further understand the sequence requirements within these loop regions, we synthesized and tested a large number of constructs in which

modifications such as mutations and replacement of nucleotides with non-nucleotide 3 -carbon spacers (Sp3) allowed us to explore the importance of sequence identity on function.

[00296] As shown in FIG. 14 and Table 28, all three positions of loop L1 can to some extent be replaced by other nucleotides or a non-nucleotidyl linker (Sp3). Replacement of if the first position with loop L1 (position 8) resulted in a modest ~2-5-fold loss in activity (Aptamer 26, and 133), while modification at the third position (position 10) with Sp3 resulted in a significant loss in activity (Aptamer 135; > 10-fold). Interestingly, sequence analysis of the second nucleotide in the loop, position 9, revealed a preference for conversion from the wildtype U (51%) to an A (40%; FIG. 12). However, when we tested this mutation (Aptamer 27) a modest lost in activity (~3-5 fold) was observed. Similar activity was also observed when this position was mutated to a C or a G (Aptamer 25 and 28) suggesting that the strong preference for conversion from U to A may rely on other variations within the sequence of this molecule. Interestingly, replacement with a Sp3 at this position significantly (>10-fold) impaired activity (Aptamer 134) suggesting the potential importance for the sugar at this position. Here again, however, we note that because of the potency of the parent molecule, Aptamer 18, even the worst performing molecules (Aptamer 134 and 135) still demonstrate activity in the high nM range and are thus still active molecules. Together these data provide a consensus for loop L1 of 5’-RNW-3’ (Table 23 and FIG. 11C). In a preferred embodiment, the consensus sequence for this motif is L1 is 5’-RAN-’. When combined with data from the secondary selection, the consensus sequence for L1 is 5’-DNN-3’, where D is A, G or U and N is any nucleotide (FIG. 11D). When combined with the loop L1 variants identified from the primary selection composed of 3 nucleotides the consensus sequence for this motif is loop L1 is 5’-NNN-3’

[00297] The analyses of both the primary and secondary selections revealed that loop L2 is highly variable and that there was a preference for the terminal 3’ nucleotide of loop L2 (position 22) to be an A. (100% conservation; FIG. 12). Indeed, replacement of position 22 with any other base or an Sp3 linker resulted in a significant loss in aptamer function (Aptamer 165 - 167, 140; Table 28 and FIG. 14), indicating an important role of the sugar and base at this position within L2. Consistent with the sequence data analysis (FIG. 12), position 19 could be mutated to a U or C with little effect on activity (Aptamers 38, 40), while mutation to a G (Aptamer 38) demonstrated a modest negative effect (~3-5 fold). Similarly, position 20 could be mutated to G with little effect (see for example Aptamer 42, 44, and 45; Table 28), but mutation to either an A or C had a more significant negative impact (~3-5 fold; see for example Aptamer 39 and 048; Table 28). Interestingly, sequence analysis of position 21 revealed a strong preference for conversion from the wildtype A (32%) to a U (~68%; FIG. 12). While the addition of this mutation alone (Aptamer 33) had little effect on aptamer function, when combined with mutation of position 19 to U, the resultant molecule, Aptamer 43, demonstrated a significant improvement in activity (5 - 10 fold). Here again, however, we note that because of the potency of the parent molecule, Aptamer 18, even the worst performing loop L2 mutants still demonstrate activity in the high nM range and are thus still active molecules. Thus, loop L2 is 4 nucleotides long and the consensus for the motif can be further extended to 5’-NNNN-3’, where N is any nucleotide (FIG. 11C). In a preferred embodiment the consensus sequence of loop L2 is 5’-NNNA-3’, where N is any nucleotide. In another preferred embodiment the consensus sequence of loop L2 is 5’-NNHA-3’, where N is any nucleotide and H is A, C or U. In another preferred embodiment the consensus sequence of loop L2 is 5’-NNUA-’. In another preferred embodiment the preferred sequence of loop L2 is 5’-UUUA-’. When combined with data from the secondary selection and/or the primary selection the consensus remains the same (FIG. 11D). [00298] The primaiy and secondary selection analyses of loop L3 (Table 12, 18 and 25) revealed that this loop is not highly conserved in sequence identity and can also vary

considerably in length (zero to seven nucleotides; Table 12). Despite these results, the analysis of the top 250 stacks from the secondary selection of Aptamer 18 demonstrated that three out of the four nucleotides within loop L3 (positions 27, 29 and 30) observed >93% conservation (FIG. 12), with the G nucleotide at position 28 observing ~76% base conservation. As illustrated in FIG. 14 and Table 28, replacement of nucleotides 27-30 with Sp3 (Aptamer 141-144) significantly impacted the function of the aptamer, with all molecules observing > 10-fold decreases in potency towards Ang2. Despite the significant losses in potency towards Ang2 for each of these aptamers, they still remained functional. Additionally, when nucleotide 28 within the parent Aptamer 18 sequence was mutated from a G to an A (Aptamer 52), which was the preferred alternative nucleotide at this position following the secondary selections (FIG. 12), this mutation resulted in a moderate ~5-fold reduction in potency. However, the impact of this mutation appeared context dependent, as when this mutation was included alongside the additional mutations observed in L1 and L2, the G to an A mutation at nucleotide 28 conferred an increase in potency towards Ang2 (see Aptamer 24 versus Aptamer 53 and Aptamer 27 versus Aptamer 30; FIG. 14 and Table 28).

[00299] Thus, the consensus of loop L3 is 5’-YRVA-3’, where Y is C or U, R is A or G, and V is A, C or G (FIG. 11C). In a preferred embodiment the consensus of loop L3 is 5’-YAAA-’. When combined with data from the secondary selection the consensus is 5’-HNVN-3’, where H is A, C or U, N is any nucleotide and V is A, C or G (FIG. 11D). However, when combined with the data from the primary selection for all Aptamer 18 family member with a 4 nucleotides3in loop L3, the consensus is 5’-NNNN-3’, where N is any nucleotide.

[00300] Example 11. Truncation and minimization of H-type pseudoknot inhibitors of

Ang2

[00301] The analysis of the initial N35 selections and top 250 stacks of sequences from the secondary selections revealed that the nucleotides that followed 3’ side of stem S2 were likely unpaired and did not appear to play a role in the predicted H-type pseudoknot structure. Despite the lack of a clear role for these nucleotides in the formation of the secondary structure, the analysis of the top 250 stacks from the secondary selections revealed that the G at position 34 was absolutely conserved (FIG. 12) while position 35 was only somewhat conserved (>80%: FIG. 12). The 3’ terminal U (nucleotide 36) was expected to be maintained at 100% due to the design of the library for the secondary selections. To further understand the terminal ends of this novel class of anti-Ang2 aptamers and facilitate the chemical synthesis of these aptamers by minimizing their size, a series of truncated versions of the parent Aptamer 18 sequence were engineered to further probe the structure of this family of aptamers. As shown in FIG. 15 and Table 29, while the terminal two positions in the library could be changed to any other nucleotides with only modest effects on function (Aptamer 149-153), mutation of the highly conserved G at position 34 (Aptamer 146-148) resulted in a significant decrease in activity (>10 fold). However, we note that because of the potency of the parent molecule, Aptamer 18, even the worst performing these molecules still maintain activity in the high nM range and are thus still active molecules.

[00302] Consistent with these results, the nucleotide at position 36 could be deleted with little effect on aptamer function (Aptamer 61 and 129; Table 29 and FIG. 15). Further truncation, however, resulted in more significant losses in activity (Aptamer 58 and 130; Table 29 and FIG. 15). When truncations from the 3’ end were combined with 5’ truncation that shortened the length of stem S1, further reductions in activity were observed (Table 29 and FIG. 15). These data support the preferential formation of a four base-pair S1 and importance of the first two positions within the 3’T of Aptamer 18.

[00303] Together, the results from these assays along with the analysis of the top 250 stacks from the secondary selection support that when the 3’T is 3 nucleotides in length, the preferred consensus sequence is 5’-DNN-3’, where D is A, G or U, and N is any nucleotide. In another embodiment when the 3’T is 3 nucleotides in length, the preferred consensus sequence is 5’- GDN-3’. When the first position of the 3’T is a C, the resultant molecule takes a more significant loss in activity ~ 200 fold), however, because of the potency of the parent molecule, Aptamer 18, these molecules still demonstrate activity in the high nM range and are thus still active. Therefore, when the 3’T is 3 nucleotides, the consensus can be expanded to NNN.

[00304] The 3’T can be further shortened to 2 nucleotides with only a modest loss in activity observed (3 to 5-fold). When the 3’ T is shortened to 2 nucleotides, the consensus sequence is 5’- DN-3’, where D is A, G or U, and N is any nucleotide. When the 3’T is shortened to 1 nucleotide the molecule takes a more significant loss in activity (~10-fold), however, because of the potency of the parent molecule, Aptamer 18, these molecules still demonstrate activity in the high nM range and are thus still active. When the 3’T is shortened to 1 nucleotide the consensus sequence is 5’-D-3’, where D is A, G or U. In a preferred embodiment, when the 3’T is shortened to 1 nucleotide the sequence is G. In some instances, the 3’ T can be removed entirely. When the 3’T is removed from Aptamer 18 entirely, the resultant molecule takes a more significant loss in activity ( ~ 200 fold), however, because of the potency of the parent molecule, Aptamer 18, these molecules these still demonstrate activity in the high nM range and are thus still active.

[00305] When combined, the data described in Examples 8, 9 and 10, and 11 provide a consensus sequence of, 5’-NSGG-GRC-KNW-VNND-CCSN-NNNN-HNNB-YRVA-GYC- NNN-3’(FIG. 11C; SEQ ID NO: 484) where N is any nucleotide, S is G or C, R is A or G, W is A or T, V is A, G or C, D is A, G or U, H is A, C or G, B is C , G or U, and Y is C or U. The structural elements within the aptamer are separated by dashes ( - ). In a preferred embodiment, the consensus is 5’ -NSGG-GRC-RNW- VNND-CC SN-NNNN-HNNB-YRVA-GYC-DNN-3’ (SEQ ID NO: 486) where N is any nucleotide, S is G or C, R is A or G, W is A or T, V is A, G or C, D is A, G or U, H is A, C or G, B is C , G or U, and Y is C or U. The structural elements within the aptamer are separated by dashes ( - ). In a another preferred embodiment, the consensus is 5’-NSGG-GRC-RNW-VNND-CCSN-NNNN-HNNB-YRVA-GYC-GDN-3’ (SEQ ID NO: 487) where N is any nucleotide, S is G or C, R is A or G, W is A or T, V is A, G or C, D is A, G or U, H is A, C or G, B is C , G or U, and Y is C orU. The structural elements within the aptamer are separated by dashes ( - ). In another preferred embodiment, the consensus is 5’- NSGG-GGC-RNW-VNND-CCSN-NNNN-HNNB-YRVA-CCG-NNN-3’ (SEQ ID NO: 488) where N is any nucleotide, S is G or C, R is A or G, W is A or T, V is A, G or C, D is A, G orU, H is A, C or G, B is C , G or U, and Y is C or U. The structural elements within the aptamer are separated by dashes ( - ). In another preferred embodiment, the consensus is 5’-NSGG-GRC- RNW -CCUG-CCSN-NNNN-CAGG-YRVA-GY C-NNN-3’ (SEQ ID NO: 489), where N is any nucleotide, S is G or C, R is A or G, W is A or T, V is A, G or C, D is A, G or U, H is A, C or G, B is C , G or U, and Y is C or U. The structural elements within the aptamer are separated by dashes ( - ). In another preferred embodiment, the consensus is 5’-NSGG-GRC-RAN-VNND- CCSN-NNNN-HNNB-YRVA-GY C-NNN-3’ (SEQ ID NO: 490), where N is any nucleotide, S is G or C, R is A or G, W is A or T, V is A, G or C, D is A, G or U, H is A, C or G, B is C , G or U, and Y is C or U. The structural elements within the aptamer are separated by dashes ( - ). In another preferred embodiment, the consensus is 5’-NSGG-GRC-RNW-VNND-CCSN-NNNA- HNNB-YRVA-GYC-NNN-3’ (SEQ ID NO: 491), where N is any nucleotide, S is G or C, R is A or G, W is A or T, V is A, G or C, D is A, G or U, H is A, C or G, B is C , G or U, and Y is C or U. The structural elements within the aptamer are separated by dashes ( - ). In another preferred embodiment, the consensus is 5’ -NSGG-GRC-RNW- VNND-CC SN-NNHA-HNNB- YRVA-GY C-NNN-3’ (SEQ ID NO: 492), where N is any nucleotide, S is G or C, R is A or G, W is A or T, V is A, G or C, D is A, G or U, H is A, C or G, B is C , G or U, and Y is C orU. The structural elements within the aptamer are separated by dashes ( - ). In another preferred embodiment, the consensus is 5’-NSGG-GRC-RNW-VNND-CCSN-NNUA-HNNB-YRVA- GYC-NNN-3’ (SEQ D) NO: 493), where N is any nucleotide, S is G or C, R is A or G, W is A or T, V is A, G or C, D is A, G orU, H is A, C or G, B is C , G or U, and Y is C orU. The structural elements within the aptamer are separated by dashes ( - ). In another preferred embodiment, the consensus is 5’-NSGG-GRC-RNW-VNND-CCSN-UUUA-HNNB-YRVA- GYC-NNN-3’ (SEQ ID NO: 494), where N is any nucleotide, S is G or C, R is A or G, W is A or T, V is A, G or C, D is A, G orU, H is A, C or G, B is C , G or U, and Y is C orU. The structural elements within the aptamer are separated by dashes ( - ). In another preferred embodiment, the consensus is 5’-NSGG-GRC-RNW-VNND-CCSN-NNNN-HNNB-YAAA- GYC-NNN-3’(SEQ ID NO: 495), where N is any nucleotide, S is G or C, R is A or G, W is A or T, V is A, G or C, D is A, G or U, H is A, C or G, B is C , G or U, and Y is C or U. The structural elements within the aptamer are separated by dashes ( - ).

[00306] When the data from Examples 8, 9 and 10 and 11 are combined with the data from the degenerate selection, the consensus sequence is, 5’-NVSG-GRC-DNN-VNND-CNNN-NNNN- HNNB-HNVN-GY C-NNN-3’ (FIG. 11D; SEQ ID NO: 485) where N is any nucleotide, S is G or C, R is A or G, W is A or T, V is A, G or C, D is A, G or U, H is A, C or G, B is C , G or U, and Y is C or U. The structural elements within the aptamer are separated by dashes ( - ).

[00307] Example 12. Optimized H-type pseudoknot inhibitors of Ang2

[00308] Analysis of the primary and secondary selection sequencing data in conjunction with activity data Examples 8 through 11, suggested that correlative mutations might exist between the loops within Aptamer 18. For example, while single or double mutations to Aptamer 18 had a neutral or sometimes negative effect on function (compare Aptamer 18, 27, 33, 52, 24, 30), a combination of the mutations within these molecules resulted in a significant improvement in activity (Aptamer 53; Table 30).

[00309] In order to explore whether the mutations within stems could be combined with those known to be beneficial within the loops of the anti-Ang2 aptamer, a series of constructs were synthesized to identify whether these mutations could be merged together and elicit further increases in aptamer potency towards Ang2. As illustrated in Table 31 and FIG. 16, excluding Aptamer 123, all anti-Ang2 aptamers that incorporated positive mutations across S1 and S2, as well as loops L1, L2 and L3, observed marked increases in potency towards Ang2 using our competition TR-FRET assay.

[00310] Importantly, when we explored the function of 3’ truncates based on these molecules using the competition Alpha screen, truncates of Aptamer 122 and Aptamer 124 (Aptamer 185 and 186) demonstrated significant improvement (>10-fold) in activity. These results are especially striking when compared to the same truncate generated from the parent Aptamer 18, Aptamer 58 (Table 29) which lost >10-fold activity. Together, these results suggest that the added mutations not only lead to improved target engagement, but likely stabilize the tertiary fold of the molecule making it more amenable to truncation.

[00311] Thus, the consensus sequence for Aptamer 18 family members can also be, 5’- NSGG- GRC-RNW- VNND-CCSN-NNNN-HNNB-YRVA-GY C-N-3’ (SEQ ID NO: 100), where N is any nucleotide, S is G or C, R is A or G, W is A or T, V is A, G or C, D is A, G or U, H is A, C or G, B is C , G or U, and Y is C or U. The structural elements within the aptamer are separated by dashes ( - ). In a preferred embodiment, the consensus sequence is 5’ - NSGG-GRC-RNW- VNND-CCSN-NNNN-HNNB-YRVA-GYC-G-3’(SEQ ID NO: 101), where N is any nucleotide, S is G or C, R is A or G, W is A or T, V is A, G or C, D is A, G or U, H is A, C or G, B is C , G or U, and Y is C or U. The structural elements within the aptamer are separated by dashes ( - ). In another preferred embodiment, the consensus sequence is, 5’- MCGG-GGC- AAU-CCUG-CCGK-UUUA-C AGG-UAAA-GCC-G-3’ (SEQ ID NO: 102), where M is A or C, and K is G or T. The structural elements within the aptamer are separated by dashes ( - ).

[00312] Example 13. Optimization of Aptamer Family 18 by 2’OMe sugar substitutions

2’OMe modifications may impart higher duplex stability, increased metabolic stability in serum and vitreous, and may have greater coupling efficiency during synthesis compared to 2’F- containing nucleotides. The use of these nucleotides may also avoid the potential loss of the 2’F group during production, which can happen during deprotection steps and exposure to heat. To probe the effect of 2’F-G to 2’OMe-G substitution on target binding, variants of Aptamer 185 were synthesized where 2’F-G was selectively substituted with 2’OMe-G (Table 32) and assayed for activity by competition TR-FRET using ALEXA FLUOR® 647-labeled parent Aptamer 185 and receptor competition AlphaScreen® as described in Example 8. As shown in Table 32 and FIG. 17, 2’OMe-G replacement was well tolerated in certain positions within the molecule (Aptamer 196, 197, 199, 200, 201, 204, 204 and 205). These positions can be combined to yield aptamer variants that contain multiple 2’OMe-G replacements. Replacement at other positions within the molecule resulted in significant loss in activity (Aptamer 198, 202).

[00313] Example 14. Aptamer 18 family lead characterization bv TR-FRET

[00314] We used TR-FRET to characterize the binding affinities of lead aptamers and an anti- Ang2 cross-mAb that binds both Ang2 and VEGF to Ang2. Assays were performed similarly to those described in Example 3 but utilized glycan biotinylated full length Ang2 (10 nM final; R&D Systems) instead of the Ang2-RBD. [00315] Representative binding affinity curves of Aptamers 18, 53, 185 and 204, compared to the anti-ANG2 cross-mAb, are shown in FIG. 18. Results indicated that Aptamers 18, 53 and 185 and 204 have a binding affinity to Ang2 with calculated Kd values of 474 ± 103 pM, 547 ± 58 pM, and 669 ± 30 pM, and 823 ± 42 pM respectively. However, these results are limited by the fraction of active Ang2 in the 10 nM sample which we estimate to be ~ 10% (1 nM). The Kd value for the crossMab, 17.7 ± 1.6 nM was consistent with literature values (EMBO Mol Med. 2016 Nov 2;8(11): 1265-1288. doi: 10.15252/emmm.201505889).

[00316] Example 15: Aptamer 18 family lead characterization bv receptor inhibition

AlphaScreen®

[00317] Lead aptamers were characterized by interrogating their ability to inhibit the

Ang2:TIE2 interaction. To do this, Aptamers 18, 53, 185 and 204, and a comparator anti-Ang2 cross-mAb were analyzed by an AlphaScreen^® assay as described in Example 8. Except the final concentration of glycan biotinylated Ang2 was 100 pM. The final Fc-TIE2 and AlphaScreen^® beads was 2 nM and 5ug/mL respectively.

[00318] Representative curves of Aptamers 18, 53, 185 and 204, are shown in FIG. 19. The calculated IC50 values for Aptamers 18, 53, 185 and 204 were 131 ± 77 pM, 19 ± 6 pM, and 7 ± 1 pM, and 14 ± 4 pM respectively. The fraction of active Ang2 in the 100 pM sample was estimated to be approximately 10% (10 pM); IC50 values for Aptamer 185 may be protein limited. Thus, Aptamers 18, 53, 185 and 204 directly blocked the interaction of Ang2 with

TIE2.

[00319] Example 16: Aptamer 18 family lead characterization bv receptor phosphorylation

[00320] Lead aptamers were characterized by interrogating their ability to inhibit TIE2 receptor phosphorylation using HEK293T cells engineered to overexpress Ang2 as described in Example

5.

[00321] Representative curves of Aptamers 185 and 204, compared to the anti-ANG2 cross- mAb, are shown in FIG. 20. The calculated IC50 values for Aptamers 185 and 204 were 6 nM and 9 nM. However, these values are limited by concentration of Ang2 used in the assay (20 nM). The IC50 value for the cross-Mab was 117 nM. These results confirm that lead aptamer candidates directly blocked the interaction of Ang2 with TIE2 with high potency.

[00322] Example 17: Binding specificity of Aptamer 18 family lead candidate. Aptamer

204

[00323] The specificity of lead aptamer, Aptamer 204, or an anti-Ang2 cross-mAb were characterized by interrogating the ability to inhibit the Ang1 :TIE2 interaction and the Ang2:TIE2 interaction using a competition AlphaScreen® assay as described in Example 8. Ang1:TIE2 assays used, glycan biotinylated Ang1 (R&D Systems), Fc-TIE2 and AlphaScreen® beads at 500 pM, 2 nM and 5ug/mL respectively. Ang2:TIE2 assays used glycan biotinylated Ang2, Fc-TIE2 and AlphaScreen® beads at 100 pM, 2 nM and 5ug/mL respectively.

[00324] Representative curves of Aptamers 204, compared to the anti-Ang2 cross-mAb, are shown in FIG. 21. From these data we estimate the specificity of Aptamer 204 for Ang2 versus Ang1 is approximately 10⁶-fold. This value is approximately 1000-fold better than the specificity observed for the anti-Ang2 cross-mAb, which we estimate to be approximately 10³-fold.

[00325] Example 18: Pegylation of Aptamer 13 family lead candidate

[00326] The Ang2 inhibiting Aptamer 185 was conjugated to a 40 kDa branched PEG to evaluate the tolerance of Aptamer 18 family members for pegylation. Briefly, a concentrated feed solution consisting of aptamer in DMSO, 16 to 25 mM borate and water was combined with a solution consisting of several equivalents 2,3-Bis(methylpolyoxyethylene-oxy)-l-{3-[(l,5- dioxo-5- succinimidyloxy, pentyl)amino]propyloxy} propane (for example SUNBRIGHT® GL2- 400GS2) in acetonitrile, and incubated at approximately 35°C for approximately 1 hour with mixing to effect conjugation of the PEG to the amine moiety of the hexyl amine linker present on the 5' terminus of the aptamer. Following the pegylation reaction, each PEG-aptamer was purified by anion exchange chromatography to collect the pegylated aptamer and remove unreacted PEG and unreacted aptamer. The anion exchange purified PEG-aptamer was desalted by ultrafiltration into water prior to functional characterization. The pegylated versions of Aptamer 185 is termed Aptamer P02.

[00327] Example 19. In vitro characterization of pegvlated Aptamer 18 variant. Apatmer

P02 [00328] The potency of the Aptamer P02 was compared to its non-pegylated counterpart, Aptamer 185, in a receptor competition AlphaScreen® assay as described in Example 8, using glycan biotinylated Ang2, Fc-TIE2 and AlphaScreen® beads at 100 pM, 2 nM and 5ug/mL respectively. As shown in FIG. 22, this class of aptamer tolerates pegylation well, with only a modest lost approximately 3-fold, in activity (7 ± 1 pM vs. 23 ± 9 pM).

[00329] Example 20. Sequence analysis and structure determination of Family 13 anti-

Ang2 inhibitors

[00330] Sequencing data from the round 7 of the primary selection against Ang2 produced >250,000 individual reads. Sequences were trimmed to remove the constant regions from the 5’ and 3’ ends, leaving the central 34 nucleotide region from the prepared library and the flanking terminal U nucleotide spacers on the 5’ and 3’ ends. Identical sequences were clustered together to form“stacks” of identical sequences. These stacks were then placed in rank order by the total number of identical sequences contained within each stack. The rank ordering of stacks of sequences gives a first approximation of aptamer fitness, as the number of times an individual sequence is present within the library correlates with molecular function, i.e. more functional molecules appear with greater frequency within a given library.

[00331] We used the sequence, 5’ -AGGC A AATCAGAACCG-3’ (SEQ ID NO: 496) located within Aptamer 13 to identify sequences within the top 5000 stacks from the primary selection. To broaden the search window, we allowed for as many as 5 mutations to occur within the sequence during the search. The analysis revealed 110 sequences related to Aptamer 13 that conformed to a stem-loop structure defined by two stems, and three loops (FIG. 23A). As further illustrated by the representative 25 of 111 sequences shown in Table 33, all other molecules within the Aptamer 13 family adopt a similar stem loop structure.

[00332] The common stem-loop structure adopted by the Aptamer 13 family of sequences presented in Table 33 may be comprised (in a 5’ to 3’ direction) of a first stem (S1), a first loop (L1), a second stem (S2), a second loop (L2), and a third loop (L3; FIG. 23A). Aptamer 13 family members may also contain a 5’ and 3’ unpaired regions (5’ Tail or 3’ Tail; Table 33). As shown in FIG. 23A the 3’-terminal end of S1 may be connected to the 5’ terminal end of L1. Loop L 1 may be connected to the 3’ terminal end of S2. The 3’ terminal end of S2 may be connected to the 5’ terminal end of L2. The 3’ terminal end of L2 may be connected to the 5’ terminal end of the complementary region of S2. The 3’ terminal end of the complementary region of S2 may be connected to the 5’ terminal end of L3 and the 3’ terminal end of L3 may be connected to the 5’ end of the complementary region of S1.

[00333] Analysis of all Aptamer 13 related sequences from the initial selections revealed that stem S1 can range from two to six base pairs in length. All unique variations identified in stem S1 from the alignment of the 111 members of the Aptamer 13 family of molecules are listed in Table 34 and demonstrate that stem S1 can be formed using 59 alternative sequence paired configurations. They also demonstrate that stem S1 is not highly conserved in sequence identity. Covariation within this region strongly sports the formation of a stem. In the broadest sense, the sequence ofboth sides of stem S1 can be 5’-NNNNNN-3’, 5’-NNNNN-3’, 5’-NNNN-3’, 5’- NNN-3’, or 5’-NN-3’, provided that pairing between the complementary sides is maintained. In some instances, stem S1 can contain a mismatched residue on one ofboth sides of the stem. In such instances, one side of the stem maybe one nucleotide longer than the other. In a preferred embodiments, when stem S1 is 6 base pairs in length, the consensus sequence for the 5’ side of stem S1 is 5’-DVDYKS-3’, and for the 3’side of stem S1 is 5’- SMRYBW -3’where D is A, G or

T, V is A, C or G, Y is C or U, K is G or U, S is G or C, M is A or C, R is A or G, and W is A or

U. When stem S1 is 5 base pairs in length, the consensus sequence for the 5’ side of stem S1 is 5’-DNNGG-3’ and for the 3’side of stem S1 is 5’- CCNNW -3’where D is A, G or T, N is any nucleotide and W is A or U. When S1 is 4 base pairs in length, the consensus sequence for the 5’ side of S1 is 5’-NNBD-3’, and for the 3’side of stem S1 is 5’-HVNN-3’, N is any nucleotide,

B is C, G or U, D is A, G or U, and H is A, C or U. When stem S1 is 3 base pairs in length, the consensus sequence for the 5’ side of stem S1 is 5’-NKB-3’ and for the 3’ side of stem S1 is 5’- VMN-3’, where N is any nucleotide, K is G or U, B is C, G or U, Y is A, C or G and M is A or C. When stem S1is 2 base pairs in length, the consensus sequence for the 5’ side of stem S1 is 5’-GG-3’ and for the 3’ side of stem S1 is 5’-CC-3’.

Table 34. Unique stem 1 variants of Aptamer 13 family from primary selection

Bold indicates that the sequence is different from parent sequence.

Underline indicates mispairing. [00334] All unique variations identified in stem S2 from the alignment of the 111 members of the Aptamer 13 family of molecules are listed in Table 35. Stem S2 is two or three base pairs long and can be formed using 8 alternative sequence configurations. They also demonstrate that stem S2 is not highly conserved in sequence identity. Covariation within this region strongly supports the formation of a stem. When stem S2 is 3 base pairs in length, the preferred consensus sequence for the 5’ side of stem S1 is 5’-DGN-3’ and for the 3’ side of stem S1 is 5’- 1NCH-3’, where D is A, G or U, N is any nucleotide, and H is A, C or U. When stem S2 is 2 base pairs in length, the preferred sequence for the 5’ side of stem S1 is 5’-GG-3’ and for the 3’ side of stem S1 is 5’-CC-3’.

Table 35. Unique stem 2 variants of

Aptamer 13 family from primary

selection

[00335] All unique variations identified in loop L1 from the alignment of the 111 members of the Aptamer 13 family of molecules are listed in Table 36. Loop L1 is one to eight nucleotides long and can be formed using 46 alternative sequence variations. When loop L1 is eight nucleotides long, the consensus sequence for loop L1 is, 5’ -KGMRWURM-3’ , where K is G or U, M is A or C, R is A or G, and W is A or U. When loop L1 is six nucleotides long, the consensus sequence for loop L1 is 5’-CGAGAA-’. When loop L1 is five nucleotides long, the consensus sequence for loop L1 is, 5’-HDWWW-3’, where H is A, C or U, D is A, G or T, and W is A or U. When loop L1 is four nucleotides long, the consensus sequence for loop L1 is, 5’- HNDW-3’, where H is A, C or U, N is any nucleotide, D is A, G or T, and W is A or U. When loop L1 is three nucleotides long, the consensus sequence for loop L1 is, 5’-NNW-3’, where N is any nucleotide and W is A or U. When loop L1 is two nucleotides long, the consensus sequence for loop L1 is, 5’-WU-3’, where W is A or U. When loop L1 is one nucleotide long, the consensus sequence for loop L1 is, 5’-U-’.

[00336] All unique variations identified in loop L2 from the alignment of the 111 members of the Aptamer 13 family of molecules are listed in Table 37. Loop L2 is eight to eleven nucleotides long and can be formed using 78 alternative sequence variations. When loop L2 is eleven nucleotides in length, the consensus sequence is, 5’-MMAAAHMASYM-3’(SEQ ID NO: 479), where M is A or C, H is A, C or U, S is G or C and Y is C or U. When loop L2 is ten nucleotides in length, the consensus sequence is, 5’-HDVDNNNNNH-3’(SEQ ID NO: 481), where H is A, C or U, D is A, G or U, V is A C or G, and N is any nucleotide. When loop L2 is nine nucleotides in length, the consensus sequence is, 5’- MRAWHHDNM-3’, where M is A or C, R is A or G, W is A or U, H is A, C or U, D is A, G or U and N is any nucleotide. When loop L2 is eight nucleotides in length, the consensus sequence is, 5’-RRAKVWNM-3’, where R is A of G, K is G or U, V is A, C or G , W is A or U, N is any nucleotide and M is A or C.

[00337] All unique variations identified in loop L3 from the alignment of the 111 members of the Aptamer 13 family of molecules are listed in Table 38 and demonstrate that loop L3 is three to twelve nucleotides long and can be formed using 94 alternative sequence variations. When loop L3 is twelve nucleotides in length, the sequence is, 5’- GGUAC ACCGUGG-3’ (SEQ ID NO: 103). When loop L3 is nine nucleotides in length, the sequence is, 5’ -GAGUCGC AC-3’ . When loop L3 is eight nucleotides in length, the consensus sequence is, 5’-SKKAUGAW-3’, where S is G or C, K is G or U, and W is A or U. When loop L3 is seven nucleotides in length, the consensus sequence is, 5’-RNNNNNN-3’, where R is A or G and N is any nucleotide. When loop L3 is six nucleotides in length, the consensus sequence is, 5’-DNNHNN-3’, where D is A, G or U, N is any nucleotide and H is A, C orU. When loop L3 is five nucleotides in length, the consensus sequence is, 5’- DHNNH-3, where D is A, G or U, H is A, C or U and N is any nucleotide. When loop L3 is four nucleotides in length, the consensus sequence is 5’-KBMY-3’, where K is G or U, B is C, G or U, M is A or C and Y is C or U. When loop L3 is three nucleotides in length, the sequence of loop L3 is 5’-GGG-’.

[00338] All unique variations identified in the 5’ and 3’ tails identified in the alignment of the 111 members of the Aptamer 13 family of molecules are listed in Table 39. The length of the 5’ tails ranged from zero to seven nucleotides in length. The length of the 3’ tails ranged from zero to five nucleotides in length. However, as described in more detail below, neither of these structure elements proved important for function; they could be removed in their entirety.

[00339] The motif variations for each structural element (eg. S1, L1, S2, L2, L3) within members of the Aptamer 13 family reported in Tables 34, 35, 36, 37, 38, and 39 represent the total variation observed within the top 5000 sequence stacks identified from sequence analysis of the primary selection. By combining the provided motifs for the respective structural elements of this aptamer family in the proper order and orientation (FIG. 23A), one can assemble extant or novel Aptamer 13-like molecules with anti-Ang2 activity.

[00340] Example 21: Degenerate selection of stem-loon inhibitors of Ang2

[00341] To further define the secondary structure of the Aptamer 13 class of anti-Ang2 aptamers, as well as to potentially identify Ang2 aptamers with increased potency, a secondary selection was performed utilizing a partially randomized (degenerate) library consisting of 70% of the Aptamer 13 parental sequence, plus 10% of the other 3 nucleotides at positions 2-35 within Aptamer 183and flanked by the built-in terminal U nucleotide spacers on the 5’ and 3’ ends of the 36-mer along with the 5’ and 3’ constant regions. Note that as the libraries for the secondary selection are built based on the sequence of Aptamer 13, the size of the structural elements (S1, L1, S2, L2, L3) are generally fixed to the length in which they occur in Aptamer 13, with little or no variation in length during the secondary selection. Five rounds of selection against Ang2 were conducted using this library under conditions defined in Table 40. The progress of the selections was monitored by flow cytometry to ensure enrichment for function (data not shown). For rounds 1 through 4, His-tagged protein was immobilized on magnetic His capture beads as described for the primary selection. For the fifth round of selection we further increased the selection stringency by performing a solution capture of aptamer/target protein complexes with glycan biotinylated Ang2 (R&D Systems) and streptavidin tagged paramagnetic beads (ThermoFisher Scientific). In short, 25 picomoles of library was prepared in a final reaction volume of 50 mL in SB IT and thermally equilibrated using the standard library preparation protocol. Once the library had cooled to room temperature, biotinylated Ang2-WT protein was added to the library at a final concentration of 1 nM and incubated with the library at 37°C for 30 minutes with intermittent mixing. During this step, streptavidin tagged paramagnetic beads were washed three times with SB IT buffer and resuspended a fourth time before being transferred to the reaction tubes containing the Ang2 protein-aptamer mixture. Beads were incubated with Ang2 protein/aptamer complexes for 30 minutes at 37°C with intermittent mixing and washed three times using 0.5ml SB1T buffer per wash to remove all unbound protein and aptamers from the streptavidin beads. After washing, Ang2-bound aptamers were eluted using 200 mL elution buffer and processed further using the standard selection protocol described previously.

[00342] Following the fifth round of selection, the libraries from each round were barcoded, pooled and sequenced on a MiniSeq high throughput sequencer (Illumina), which yielded approximately ~400,000 sequences per round. Sequences were trimmed to remove the constant regions from the 5’ and 3’ ends, leaving the central 34 nucleotide region from the prepared library and the flanking terminal U nucleotide spacers on the 5’ and 3’ ends. Identical sequences were clustered together to form“stacks” of identical sequences. These stacks were then placed in rank order by the total number of identical sequences contained within each stack. The rank ordering of stacks of sequences gives a first approximation of aptamer fitness, as the number of times an individual sequence is present within the library correlates with molecular function, i.e. more functional molecules appear with greater frequency within a given library. Furthermore, stacks that observed significant increases in their ranking between Round 4 to Round 5 when the stringency of the selection was increased, were deemed to have increased fitness in this round of selection and potentially reflect an increased potency towards Ang2.

[00343] Alignment of the top 250 stacks of sequences within the Round 4 library, which contained -82,500 (82,536) stacks of sequences and comprised the top performing -40% (193,608 / 477,822 total sequences) of the selected population of aptamers from the secondary selections was used to determine the nucleotide conservation for each position within Aptamer 13 (FIG. 24) Aside from a few nucleotide positions which were poorly conserved (<70%), most of the nucleotide positions demonstrated conservation levels >90% with many positions demonstrating absolute (100%) conservation. Investigation of the aligned stacks of sequences further confirm the Aptamer 13 family of anti-Ang2 aptamers conform to the predicted stem- loop structure.

[00344] Comparison of the top 250 stacks of sequences from Round 4 revealed observable co- variation within S1 at position 2; the observed covariation at this position provides further support for the formation of stem S1 (Table 41). The consensus sequence for the 5’ side of stem S1 is 5’-USGG-3’and for the 3’ side is 5’-CCSA-3’, where S is G or C and B is C, G or U. The consensus is depicted in the context of the secondary structure in (FIG. 23B). When combined with the data from the primary selection for sequences which possess a four nucleotide stem S1, this sequence can further expands to 5’-NNBD-3’ for the 5’ side of the stem and 5’HVNN-3’ for the 3’ side of the stem, where N is any nucleotide, B is C, G or U, D is A, G or U, H is A, C or U and V is A, C or G. The consensus is depicted in the context of the secondary structure in (FIG. 23C).

[00345] Comparison of the top 250 stacks of sequences from Round 4 revealed the identity of stem S2 to be invariant. The sequence of stem S2 was 5’-GG-3’ for the 5’ side of the stem and 5’-CC-3’ for the 3’ side of the stem. When compared with the data from the primary selection, the lack of variation within this stem variation suggest that this is the preferred sequence for a two base pair stem S2 in any context (FIG. 23A).

[00346] Comparison of the top 250 stacks of sequences from Round 4 revealed variations permitted in loop L1 and provide the consensus sequence when loop L1 is four nucleotides long and in the context of other Aptamer 13 sequence constraints (Table 42). The consensus sequence for loop L1 is 5’-MADA-3’, where M is A or C and D is A, G or U. This consensus is depicted in the context of the secondary structure in (FIG. 23B). When combined with the data from the primary selection for sequences which possess four nucleotides in loop L1, the consensus further expands to, 5’-HNDW-’. This consensus is depicted in the context of the secondary structure in (FIG. 23C).

[00347] Comparison of the top 250 stacks of sequences from Round 4 revealed variations permitted in loop L2 and provide the consensus a sequence when loop L2 is ten nucleotides long and in the context of other Aptamer 13 sequence constraints (Table 43). The consensus sequence for loop L2 is 5’- C AAAHCANM A-3’ (SEQ ID NO: 480), where H is A, C or U, N is any nucleotide and M is A or C. This consensus is depicted in the context of the secondary structure in (FIG. 23B). When combined with the data from the primary selection for sequences which possess a four nucleotide in loop L2, the consensus further expands to, 5’- HDVDNNNNNH-3’ (SEQ ID NO: 481). This consensus is depicted in the context of the secondary structure in (FIG. 23C).

[00348] Comparison of the top 250 stacks of sequences from Round 4 revealed variations permitted in loop L3 and provide the consensus a sequence when loop L3 is seven nucleotides long and in the context of other Aptamer 13 sequence constraints (Table 44). The consensus sequence for loop L3 is 5’- GWNNHMM -3’, where W is A or U, N is any nucleotide H is A, C or U and M is A or C. This consensus is depicted in the context of the secondary structure in (FIG. 23B). When combined with the data from the primary selection for sequences which possess seven nucleotides, the consensus sequence of loop L3 consensus further expands to, 5’- RNNNNNN-3’. This consensus is depicted in the context of the secondary structure in (FIG. 23C).

[00349] When combined, the data from the degenerate selection of Aptamer 13, provide a consensus sequence of 5’ -USGG-MADA-GG-C AAAHCANMA-CC-GWNNHMM-CCS A-HNT -3’, (FIG. 23B; SEQ ID NO: 487) where S is G or C, M is A or C, D is A, G, or U, H is A, C or U, and N is any nucleotide. When combined with the data from the primary selection for motif lengths that match those of Aptamer 13, the consensus sequence for Aptamer 13 can be further expanded to, 5’ -NNBD-HNDW-GG-HDVDNNNNNH-CC-RNNNNNN-HVNN-NNT-3’ (FIG. 23C; SEQ ID NO: 108), where N is any nucleotide, B is C, G or U„ D is A, G or U, H is A, C or U, W is A or U, and V is A, C or G. The structural elements within the aptamer are separated by dashes ( - ).

[00350] Example 22: Optimization of Aptamer 13 family variants.

[00351] We chemically synthesized and screened variants of Aptamer 13 generated by replacing loop regions within the parent aptamer with variants identified during the degenerate selection (Example 21), or that were rationally designed. Constructs were characterized using competition TR-FRET and TIE2 receptor competition AlphaScreen assays as described in Example 8.

[00352] As shown Table 45 and FIG. 25, the inclusion of alternate loop variants identified during the doped selection resulted in either no effect, or a marked improvement in aptamer activity. The best performing molecules displayed a > 10-fold improvement in activity when compared to the parent molecule, Aptamer 13. Together, these results highlight the modular nature of these motifs within Aptamer 13. That is, the motif variations for structural elements (eg. S1, L1, S2, L2, L3) within members of the Aptamer 13 can be combined to generate novel Aptamer 13-like molecules with anti-Ang2 activity provided the motifs for the respective structural elements of this aptamer family are placed in the proper order and orientation. [00353] Additionally, it is interesting to note that the worst variant observed in this screen, Aptamer 106, contained a mutation in loop L1 (C at position 7) that was not observed in the degenerate selection (see Table 42). This observation is consistent with the fact that this molecule, with greatly diminished activity, would have been disadvantaged during the selection process. However, because of the potency of the parent molecule, Aptamer 13, even this molecule is still active (IC50 = approximately 3 nM; data not shown). Thus, the consensus for loop L1 can be expanded from 5’-MADA-3’, observed in the doped selection to 5’-M ANA-3’. When further combined with the data from the primary selection for sequences that possess four nucleotides in loop L1, the consensus further expands to, 5’-HNNW-’.

[00354] Example 23: Minimization of Aptamer 13 family variants.

[00355] We chemically synthesized and screened minimized variants of Aptamer 13, or Aptamer 116, a variant with improved performance (Table 45) using competition TR-FRET and ΊΊE2 receptor competition AlphaScreen assays as described in Example 8.

[00356] Consistent with the predicted model structure for Aptamer 13, the three single stranded nucleotides that form the 3’ tail (FIG. 23 A) could be removed entirely with essentially no effect on aptamer activity (Table 46). Additionally, consistent with the observed variation in the primary selection, in the length of stem S1 could be shortened from 4 base pairs to 3 base pairs with little to no effect on aptamer activity.

[00357] When these same truncations we made in the context of Aptamer 116, an optimized variant of Aptamer 3, the resultant molecules, Aptamer 180 and 184, demonstrated

approximately a 3-fold improvement over the parent molecule, yielding variants with activity >50-fold more potent than Aptamer 13.

[00358] Thus, the consensus sequence for Aptamer 13 family members can also be, 5’-USGG- MAD A-GG-CAAAHCANMA-CC-GWNNHMM-CCSA-3’ (SEQ ID NO: 497), where S is G or C, M is A or C, D is A, G, or U, H is A, C or U, and N is any nucleotide. The structural elements within the aptamer are separated by dashes ( - ). When combined with the data from the primary' for motif lengths that match those of Aptamer 13, the consensus sequence for Aptamer 13 like sequences can be further expanded to, 5’-NNBD-HNDW-GG-HDVDNNNNNH-CC- RNNNNNN-HVNN-3’ (SEQ ID NO: 498), where N is any nucleotide, B is C, G or U, D is A,

G or U, H is A, C or U, W is A or U, and V is A, C or G. The structural elements within the aptamer are separated by dashes ( - ).

[00359] Example 24. Optimization of Aptamer Family 13 by 2’OMe sugar substitutions

[00360] 2’OMe modifications may impart higher duplex stability, increased metabolic stability in serum and vitreous, and may have greater coupling efficiency during synthesis compared to 2’F-containing nucleotides. The use of these nucleotides may also avoid the potential loss of the 2’F group during production, which can happen during deprotection steps and exposure to heat. To probe the effect of 2’F-Gto 2’OMe-G substitution on target binding, variants of Aptamer 184 were synthesized where 2’F-G was selectively substituted with 2’OMe-G (Table 47) and assayed for activity by competition TR-FRET using ALEXA FLUOR® 647-labeled parent Aptamer 185 and receptor competition AlphaScreen® as described in Example 8.

[00361] As shown in Table 47 and FIG. 26, 2’OMe-G replacement was well tolerated throughout the molecule. These positions can be combined to yield aptamer variants that contain multiple 2’OMe-G replacements.

[00362] Example 25. Antamer 13 family lead characterization bv TR-FRET

[00363] We used TR-FRET to characterize the binding affinities of lead aptamers and an anti- Ang2 cross-mAb that binds both Ang2 and VEGF to Ang2. Assays were performed similarly to those described in Example 14.

[00364] Representative binding affinity curves of Aptamers 13, 116, 184 and 188, compared to the anti-ANG2 cross-mAb, are shown in FIG. 27. Results indicated that Aptamers 13, 116, 184 and 188, have a binding affinity to Ang2 with calculated Kd values of 798 ± 50 pM and 1110 ±

5 pM, and 635 ± 5 pM, and 1079 ± 259 pM respectively. However, these results are limited by the fraction of active Ang2 in the 10 nM sample which we estimate to be ~ 10% (1 nM). The Kd value for the crossMab, 17.7 ± 1.6 nM was consistent with literature values (EMBO Mol Med. 2016 Nov 2;8(11): 1265-1288. doi: 10.15252/emmm.201505889).

[00365] Example 26: Antamer 13 family lead characterization by receptor inhibition

AlphaScreen®

[00366] Lead aptamers were characterized by interrogating their ability to inhibit the

Ang2:TIE2 interaction. To do this, Aptamers 13, 116, 184 and 188 and a comparator anti-Ang2 cross-mAb were analyzed by an AlphaScreen® assay as described in Example 15.

[00367] Representative curves of Aptamers 13, 116, 184 , 188, and Anti Ang2 cross-Mab are shown in FIG. 28. The calculated IC50 values for 13, 116, 184 , 188 and Anti Ang2 cross-Mab are 219 ± 7 pM, 6 ± 3 pM, 7 ± 1 pM, 6 ± 1 pM and 18000 ± 721 pM respectively. The fraction of active Ang2 in the 100 pM sample was estimated to be approximately 10% (10 pM); IC50 values for Aptamers 116, 184 and 188 may be protein limited. Thus, Aptamers 13, 116, 184 and 185 directly blocked the interaction of Ang2 with TIE2.

[00368] Example 27: Aptamer 13 family lead characterization bv receptor phosphorylation

[00369] Lead aptamers were characterized by interrogating their ability to inhibit TIE2 receptor phosphorylation using HEK293T cells engineered to overexpress Ang2 as described in Example

16.

[00370] Representative curves of Aptamers 13 and 116 compared to the anti-ANG2 cross-mAb, are shown in FIG. 29. The calculated IC50 values for Aptamers 13 and 116 were 11 nM and 9 nM. However, these values are limited by concentration of Ang2 used in the assay (20 nM). The IC50 value for the cross-Mab was 117 nM. These results confirm that lead aptamer candidates directly blocked the interaction of Ang2 with TIE2 with high potency.

[00371] Example 28: Binding specificity of Aptamer 13 family lead candidates

[00372] The specificity of lead aptamer, Aptamers 188 or an anti-Ang2 cross-mAb were characterized by interrogating the ability to inhibit the Ang1 :TIE2 interaction and the Ang2:TIE2 interaction using a competition AlphaScreen® assay as described in Example 17.

[00373] Representative curves of Aptamers 188, compared to the anti-Ang2 cross-mAb, are shown in FIG. 30. From these data we estimate the specificity of Aptamer 204 for Ang2 versus Ang1 is approximately 10⁶-fold. This value is approximately 1000-fold better than the specificity observed for the anti-Ang2 cross-mAb, which we estimate to be approximately 10³-fold.

[00374] Example 29: Pegylation of Aptamer 13 family lead candidates

[00375] The Ang2 inhibiting Aptamer 184 was conjugated to a 40 kDa branched PEG to evaluate the tolerance of Aptamer 13 family members for pegylation. Briefly, a concentrated feed solution consisting of aptamer in DMSO, 16 to 25 mM borate and water was combined with a solution consisting of several equivalents 2,3-Bis(methylpolyoxyethylene-oxy)-l-{3-[(1,5- dioxo-5- succinimidyloxy, pentyl)amino]propyloxy} propane (for example SUNBRIGHT^® GL2- 400GS2) in acetonitrile, and incubated at approximately 35°C for approximately 1 hour with mixing to effect conjugation of the PEG to the amine moiety of the hexyl amine linker present on the 5' terminus of the aptamer. Following the pegylation reaction, each PEG-aptamer was purified by anion exchange chromatography to collect the pegylated aptamer and remove unreacted PEG and unreacted aptamer. The anion exchange purified PEG-aptamer was desalted by ultrafiltration into water prior to functional characterization. The pegylated versions of Aptamer 184 is termed Aptamer P01.

[00376] Example 30. In vitro characterization of pegylated Aptamer 13 variant. P01

[00377] The potency of the Aptamer P01 was compared to its non-pegylated counterpart, Aptamer 184, in a receptor competition AlphaScreen^® assay as described in Example 8, using glycan biotinylated Ang2, Fc-TIE2 and AlphaScreen^® beads at 100 pM, 2 nM and 5ug/mL respectively. As shown in FIG. 31, this class of aptamer tolerates pegylation well, with no loss in activity (7 ± 1 pM vs. 9 ± 1 pM).

[00378] While preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims

CLAIMS WHAT IS CLAIMED IS:

1. An aptamer comprising a nucleic acid sequence that selectively binds to Angiopoietin-2 (Ang2), wherein said aptamer inhibits a function associated with Ang2 with an ICso of less than about 500 pM.

2. An aptamer comprising a nucleic acid sequence that selectively binds to Angiopoietin-2 (Ang2) with a K_d of less than about 500 pM.

3. An aptamer comprising a nucleic acid sequence that selectively blocks the fibrinogen-like binding domain of Angiopoietin-2 (Ang2), or the receptor binding domain of Ang2, and inhibits a function associated with Ang2.

4. The aptamer of any of claims 1-3, wherein said aptamer inhibits a function associated with Ang2 with an ICso of less than about 250 pM.

5. The aptamer of any of claims 1-4, wherein said aptamer inhibits a function associated with Ang2 with an ICso of less than about 100 pM.

6. The aptamer of any of claims 1-5, wherein said aptamer inhibits a function associated with Ang2 with an ICso of less than about 50 pM.

7. The aptamer of any of claims 1-6, wherein said aptamer inhibits a function associated with Ang2 with an ICso of less than about 10 pM.

8. The aptamer of any of claims 1, 2, or 4-7, wherein said ICso is measured by an Ang2-Tie2 competition ELISA assay or a Tie2 phosphorylation assay.

9. The aptamer of any of claims 1-8, wherein said aptamer binds to Ang2 with a K_d of less than about 100 pM.

10. The aptamer of any of claims 1 -9, wherein said aptamer binds to Ang2 with a K_d of less than about 50 pM.

11. The aptamer of any of claims 1-10, wherein said aptamer binds to Ang2 with a K_d of less than about 10 pM.

12. The aptamer of any of claims 1-11, wherein said aptamer binds to Ang2 with a K_d of less than about 1 pM.

13. The aptamer of any of claims 1-12, wherein said aptamer binds to Ang2 with a K_d of less than about 0.5 pM.

14. The aptamer of any of claims 1-13, wherein said aptamer is an RNA aptamer or a modified RNA aptamer.

15. The aptamer of any of claims 1-14, wherein at least 50% of said nucleic acid sequence comprises one or more modified nucleotides.

16. The aptamer of any of claims 1-15, wherein said one or more modified nucleotides comprises a 2'F-modified nucleotide, a 2'OMe-modified nucleotide, or a combination thereof.

17. The aptamer of claim 16, wherein said one or more modified nucleotides are selected from the group consisting of: 2'F-G, 2'OMe-G, 2'OMe-U, 2'OMe-A, 2'OMe-C, a 3' terminal inverted deoxythymidine, and any combination thereof.

18. The aptamer of any of claims 1-17, wherein said aptamer comprises a nuclease-stabilized nucleic acid backbone.

19. The aptamer of any of claims 1-18, wherein said aptamer prevents or reduces association of Ang2 with Tie2.

20. The aptamer of any of claims 1-19, wherein said nucleic acid sequence has from about 30 to about 90 nucleotides or modified nucleotides, or a combination of nucleotides and modified nucleotides.

21. The aptamer of any of claims 1 -20, wherein said aptamer is conjugated to a polyethylene glycol (PEG) molecule.

22. The aptamer of claim 21, wherein said PEG molecule has a molecular weight of about 40 kDa or less.

23. The aptamer of any of claims 1-22, wherein said nucleic acid sequence does not comprise any one of SEQ ID NOs:62-92.

24. The aptamer of any of claims 1-23, wherein said nucleic acid sequence comprises any one of SEQ ID NOs:2-61, SEQ ID NOs: 97-474, and SEQ ID NOs: 479-498.

25. An aptamer having a nucleic acid sequence comprising any one of SEQ P) NOs:2-61 or a nucleic acid sequence having at least 50% sequence identity to any one of SEQ ID NOs:2-61.

26. An aptamer selected from the group consisting of: Aptamer 3 as described in Table 2, Aptamer 4 as described in Table 2, Aptamer 5 as described in Table 2, Aptamer 6 as described in Table 2, Aptamer 7 as described in Table 2, Aptamer 8 as described in Table 2, Aptamer 9 as described in Table 2, Aptamer 9 as described in Table 2, Aptamer 10 as described in Table 2, Aptamer 11 as described in Table 2, Aptamer 12 as described in Table 2, Aptamer 13 as described in Table 2, Aptamer 14 as described in Table 2, Aptamer 15 as described in Table 2, Aptamer 16 as described in Table 2, Aptamer 17 as described in Table 2, Aptamer 18 as described in Table 2, Aptamer 19 as described in Table 2, Aptamer 20 as described in Table 2, Aptamer 21 as described in Table 2, and Aptamer 22 as described in Table 2.

27. A method for modulating Angiopoietin-2 (Ang2) in a biological system, said method comprising: administering to said biological system an aptamer according to any of claims 1-26, thereby modulating Ang2 in said biological system.

28. The method of claim 27, wherein said biological system comprises a biological tissue or biological cells.

29. The method of claim 28, wherein said biological system is a subject.

30. The method of claim 29, wherein said subject is a human.

31. The method of any of claims 27-30, wherein said modulating comprises inhibiting a function associated with Ang2.

32. The method of claim 31 , wherein said modulating comprises preventing or reducing an association of Ang2 with Tie2.

33. The method of any of claims 27-32, wherein said method further comprises administering to said biological system a therapeutically effective amount of an anti-VEGF composition.

34. The method of claim 33, wherein said anti-VEGF composition comprises bevacizumab. ranibizumab, pegaptanib, brolucizumab, abicipar pegol, conbercept, or aflibercept.

35. The method of claim 33 or 34, wherein said aptamer and said anti-VEGF composition are administered to said biological system at the same time.

36. The method of claim 33 or 34, wherein said aptamer and said anti-VEGF composition are administered to said biological system sequentially or separately.

37. An aptamer comprising a nucleic acid sequence that selectively binds to Angiopoietin-2 (Ang2) and having an H-type pseudoknot secondary structure comprising, in a 5' to 3' direction, a first side of a first base paired stem; a first side of a second base paired stem; a first loop; a first side of a third base paired stem; a second, complementary side of the first base paired stem; a second loop; a second, complementary side of the third base paired stem; a third loop; a second, complementary side of the second base paired stem; and a 3’ unpaired terminal sequence.

38. An aptamer comprising a nucleic acid sequence that selectively binds to Angiopoietin-2 (Ang2) and having an H-type pseudoknot secondary structure comprising, in a 5' to 3' direction, a first side of a first base paired stem; a fourth loop; a first side of a second base paired stem; a first loop; a first side of a third base paired stem; a second, complementary side of the first base paired stem; a second loop; a second, complementary side of the third base paired stem; a third loop; a second, complementary side of the second base paired stem; and a 3’ unpaired terminal sequence.

39. An aptamer comprising a nucleic acid sequence that selectively binds to Angiopoietin-2 (Ang2) and having an H-type pseudoknot secondary structure comprising, in a 5' to 3' direction, a first side of a first base paired stem; a fourth loop; a first side of a second base paired stem; a first loop; a first side of a third base paired stem; a fifth loop; a second, complementary side of the first base paired stem; a second loop; a second, complementary side of the third base paired stem; a third loop; a second, complementary side of the second base paired stem; and a 3’ unpaired terminal sequence.

40. An aptamer comprising a nucleic acid sequence that selectively binds to Angiopoietin-2 (Ang2) and having an H-type pseudoknot secondary structure comprising, in a 5' to 3' direction, a first side of a first base paired stem; a first side of a second base paired stem; a first loop; a first side of a third base paired stem; a fifth loop; a second, complementary side of the first base paired stem; a second loop; a second, complementary side of the third base paired stem; a third loop; a second, complementary side of the second base paired stem; and a 3’ unpaired terminal sequence.

41. An aptamer comprising a nucleic acid sequence that selectively binds to Angiopoietin-2 (Ang2) and having a stem-loop secondary structure comprising, in a 5' to 3' direction, a first side of a first base paired stem; a first loop; a first side of a second base paired stem; a second loop; a second, complementary side of the second base paired stem; a third loop; a second, complementary side of the first base paired stem.