WO2020247815A1 - Modèle de rongeur transgénique pour la fibrose pulmonaire et ses utilisations - Google Patents

Modèle de rongeur transgénique pour la fibrose pulmonaire et ses utilisations Download PDF

Info

Publication number
WO2020247815A1
WO2020247815A1 PCT/US2020/036416 US2020036416W WO2020247815A1 WO 2020247815 A1 WO2020247815 A1 WO 2020247815A1 US 2020036416 W US2020036416 W US 2020036416W WO 2020247815 A1 WO2020247815 A1 WO 2020247815A1
Authority
WO
WIPO (PCT)
Prior art keywords
rodent
mfn1
aec2
nucleic acid
mfn2
Prior art date
Application number
PCT/US2020/036416
Other languages
English (en)
Inventor
Augustine M. K. CHOI
Kuei-Pin CHUNG
Original Assignee
Cornell University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Cornell University filed Critical Cornell University
Publication of WO2020247815A1 publication Critical patent/WO2020247815A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0278—Knock-in vertebrates, e.g. humanised vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/721—Steroid/thyroid hormone superfamily, e.g. GR, EcR, androgen receptor, oestrogen receptor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/072—Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/20—Animal model comprising regulated expression system
    • A01K2217/203—Animal model comprising inducible/conditional expression system, e.g. hormones, tet
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/20—Animal model comprising regulated expression system
    • A01K2217/206—Animal model comprising tissue-specific expression system, e.g. tissue specific expression of transgene, of Cre recombinase
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/035—Animal model for multifactorial diseases
    • A01K2267/0368—Animal model for inflammation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/60—Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present disclosure relates to genetically modified rodent models (e.g., mouse models) for pulmonary fibrosis (e.g., idiopathic pulmonary fibrosis), and methods of using the same to identify candidate agents to treat or prevent lung fibrosis.
  • rodent models e.g., mouse models
  • pulmonary fibrosis e.g., idiopathic pulmonary fibrosis
  • Pulmonary fibrosis is a devastating disorder that affects five million people worldwide. However, the actual numbers may be significantly higher as a possible consequence of misdiagnosis. Typically, patients develop pulmonary fibrosis in their forties and fifties with symptoms that include shortness of breath, chronic cough, fatigue, loss of appetite and rapid weight loss. The mean survival time following diagnosis is less than 5 years (Giri, S. N. (2003) Annu Rev Pharmacol Toxicol 43, 73-95). Since pulmonary fibrosis is a very complex disease, the prediction of longevity of patients after diagnosis varies greatly.
  • pulmonary fibrosis develops in mice with ectopic expression of the inflammatory mediator tumor necrosis factor a (TNF-a) in the lung (Miyazaki et al., (1995) J Clin Invest 96, 250-259). Additionally, in a bleomycin mouse model of pulmonary fibrosis, the fibrosis is preceded by profound inflammation, including the production of high levels of TNF-a (Piguet et al., (1989) J Exp Med 170, 655-663).
  • TNF-a tumor necrosis factor a
  • TNF-a-deficient or TNF-a receptor-deficient mice are resistant against bleomycin-induced pulmonary fibrosis (Ortiz et al., (1998) Exp Lung Res 24, 721-743). These results led to the assumption that fibrosis might be avoided when the inflammatory cascade was interrupted before irreversible tissue injury occurred and accounts for the initial enthusiasm for corticosteroid and cytotoxic therapy of pulmonary fibrosis. However, treatments intended to suppress inflammation have limited success in reducing the fibrotic progress. (Giri, S. N. (2003) Annu Rev Pharmacol Toxicol 43, 73-95). Other studies have attempted to show that fibrotic lung disorder is not an inflammatory disorder.
  • fibrotic lung disease can be triggered by adenoviral transfer of TGF-b to the lungs of animals with only a transient inflammatory response.
  • the present disclosure provides a genetically modified murine genome comprising at least one floxed full-length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4); and a transgene including a fusion protein (CreERT2) that comprises a Cre recombinase (Cre) fused to a tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2), wherein the fusion protein is operably linked to an alveolar type 2 epithelial cell (AEC2) expression control sequence, and wherein the mitofusin nucleic acid sequence is MFN1 and/or MFN2.
  • a transgene including a fusion protein (CreERT2) that comprises a Cre recombinase (Cre) fused to a tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2), wherein the fusion protein is operably linked to an alveolar type 2 epithelial cell (AEC2) expression control sequence, and wherein the
  • the at least one floxed full-length mitofusin nucleic acid sequence may be derived from a mammal selected from the group consisting of a mouse, a rat, and a human.
  • the at least one floxed full-length mitofusin nucleic acid sequence is a full length cDNA sequence of MFN1 and/or MFN2.
  • the at least one floxed full- length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) comprises the sequence of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18.
  • the at least one floxed full-length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) comprises a 5’ flanking loxP site and a 3’ flanking loxP site that are oriented in an identical direction.
  • the 5’ flanking loxP site and/or the 3’ flanking loxP site comprises the sequence of any one of SEQ ID NOs: 3-12.
  • the sequences of the 5’ flanking loxP site and the 3’ flanking loxP site may be identical or different.
  • the genetically modified murine genome of the present technology further comprises a detectable reporter gene such as a fluorescent reporter gene or a bioluminescent reporter gene.
  • the transgene comprises a detectable reporter gene such as a fluorescent reporter gene or a bioluminescent reporter gene.
  • fluorescent reporter genes include, but are not limited to, GFP, YFP, CFP, RFP, TagBFP, Azurite, EBFP2, mKalama1, Sirius, Sapphire, T-Sapphire, ECFP, Cerulean, SCFP3A, mTurquoise, monomeric Midoriishi-Cyan, TagCFP, mTFP1, EGFP, Emerald, Superfolder GFP, Monomeric Azami Green, TagGFP2, mUKG, mWasabi, EYFP, Citrine, Venus, SYFP2, TagYFP, Monomeric Kusabira-Orange, mKOk, mKO2, mOrange, mOrange2, mRaspberry, mCherry, dsRed, mStrawberry, mTangerine, tdTomato, TagRFP, TagRFP-T, mApple, mRuby, mPlum, HcRed-Tandem, mM
  • the AEC2 expression control sequence has a length ranging from 100 base pairs (bps) to 5 kilobases (kb). Additionally or alternatively, in some embodiments, the AEC2 expression control sequence is a surfactant protein C (Sftpc) promoter or a surfactant protein B (Sftpb) promoter.
  • Sftpc surfactant protein C
  • Sftpb surfactant protein B
  • the Cre recombinase (Cre) is fused to the tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2) via a peptide linker.
  • the Cre recombinase (Cre) may be fused to the N-terminus or C-terminus of the tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2).
  • the Cre recombinase (Cre) comprises the sequence of SEQ ID NO: 19 and/or the tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2) comprises the sequence of SEQ ID NO: 20.
  • the at least one floxed full- length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) and the transgene are located on different or identical chromosomes.
  • the at least one floxed full- length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) is configured to be deleted or excised when the genetically modified murine genome is contacted with an effective amount of tamoxifen.
  • the present disclosure provides a rodent comprising any genetically modified murine genome described herein, wherein the rodent is homozygous for a floxed full-length MFN1 nucleic acid sequence and/or a floxed full-length MFN1 nucleic acid sequence.
  • the rodent of the present technology does not comprise endogenous MFN1 and/or MFN2 genomic nucleic acid sequences that lack flanking loxP sites.
  • the rodent may be a rat or a mouse. Additionally or alternatively, in some
  • the floxed full-length MFN1 nucleic acid sequence has been knocked into a wild-type MFN1 locus, and/or wherein the floxed full-length MFN2 nucleic acid sequence has been knocked into a wild-type MFN2 locus.
  • the rodent develops lung fibrosis after being exposed to an effective amount of tamoxifen, and optionally an effective amount of bleomycin.
  • Signs or symptoms of lung fibrosis may include one or more of weight loss, low-grade fevers, fatigue, arthalgias, myalgias, shortness of breath, respiratory distress, aching joints, or shallow breathing.
  • the rodent is fertile and is capable of transmitting the genetically modified murine genome to its offspring.
  • the AEC2 cells of the rodent exhibit one or more signs of mitochondrial damage selected from the group consisting of fragmented mitochondria with decreased mitochondrial area, increased mitochondrial number, enlarged mitochondria with irregular and disrupted cristae, increased mitochondrial area, decreased mtDNA copy number, and reduced mitophagy after being exposed to an effective amount of tamoxifen.
  • the rodent exhibits excessive scar formation, increased localization of fibroblastic aggregates in lungs, increased lung collagen deposition, elevated expression of vimentin, a-smooth muscle actin, and/or collagen III, and altered lipid metabolism after being exposed to an effective amount of tamoxifen.
  • altered lipid metabolism comprises reduced levels of one or more of cholesterol, ceramides, phosphatidic acids, phosphatidylethanolamine, phosphatidylserine, plasmalogen phosphatidylethanolamine, phosphatidylglycerol, monoacylglycerol, diacylglycerol, acylcarnitines,
  • glycerophospholipids glycerophospholipids, sphingolipids, and phosphatidylcholines with long unsaturated aliphatic chains.
  • the present disclosure provides a method for identifying a candidate agent for preventing lung fibrosis comprising (a) administering a candidate agent to any embodiment of the rodent of the present technology, wherein the rodent has been exposed to an amount of tamoxifen that is effective to induce fibrosis, and (b) monitoring the development of lung fibrosis in the rodent of step (a), wherein a reduction in or delayed onset of lung fibrosis in the rodent of step (a) compared to any embodiment of the rodent of the present technology that has been exposed to an amount of tamoxifen that is effective to induce fibrosis and that has not received the candidate agent indicates that the candidate agent is effective in preventing lung fibrosis.
  • the present disclosure provides a method for identifying a candidate agent for treating lung fibrosis comprising (a) administering a candidate agent to any embodiment of the rodent of the present technology, wherein the rodent exhibits lung fibrosis after being exposed to an effective amount of tamoxifen, and (b) monitoring the progression of lung fibrosis in the rodent of step (a), wherein amelioration of lung fibrosis in the rodent of step (a) compared to any embodiment of the rodent of the present technology that exhibits lung fibrosis after being exposed to an effective amount of tamoxifen and that has not received the candidate agent indicates that the candidate agent is effective in treating lung fibrosis.
  • the present disclosure provides a method for determining an effective amount of a candidate agent for treating lung fibrosis comprising (a) administering a test amount of a candidate agent to any embodiment of the rodent of the present technology, wherein the rodent exhibits lung fibrosis after being exposed to an effective amount of tamoxifen, and (b) monitoring the progression of lung fibrosis in the rodent of step (a), wherein amelioration of lung fibrosis in the rodent of step (a) compared to any embodiment of the rodent of the present technology that exhibits lung fibrosis after being exposed to an effective amount of tamoxifen and that has not received the candidate agent indicates that the test amount of the candidate agent is effective in treating lung fibrosis.
  • amelioration of lung fibrosis comprises reduced scar formation, decreased localization of fibroblastic aggregates in lungs, decreased lung collagen deposition, reduced expression of vimentin, ⁇ -smooth muscle actin, and/or collagen III, and increased levels of one or more of lipids selected from among cholesterol, ceramides, phosphatidic acids, phosphatidylethanolamine, phosphatidylserine, plasmalogen
  • phosphatidylethanolamine phosphatidylglycerol
  • monoacylglycerol diacylglycerol
  • acylcarnitines glycerophospholipids
  • sphingolipids phosphatidylcholines with long unsaturated aliphatic chains.
  • the present disclosure provides a method for determining an effective amount of a candidate agent for preventing lung fibrosis comprising (a)
  • the lung fibrosis is caused by connective tissue or collagen diseases (e.g., rheumatoid arthritis, scleroderma), exposure to asbestos, metal dusts or organic substances, sarcoidosis, and exposure to medical drugs and radiation.
  • the candidate agent is an antibody agent, a peptide, a polypeptide, a fusion protein, a small molecule, a siRNA, an antisense RNA, a sgRNA, or a shRNA.
  • kits comprising any embodiment of the rodent of the present technology and instructions for assaying the effectiveness of a candidate agent for treating or preventing lung fibrosis.
  • Also provided herein are methods of producing any embodiment of the genetically modified murine genome described herein comprising: (a) providing a first rodent having in its genome at least one floxed full-length mitofusin nucleic acid sequence, wherein the mitofusin nucleic acid sequence is MFN1 and/or MFN2, and wherein the first rodent does not comprise the transgene; (b) mating the first rodent with a second rodent, wherein the second rodent comprises in its genome the transgene, and wherein the second rodent does not comprise the at least one floxed full-length mitofusin nucleic acid sequence; and (c) selecting a progeny rodent from step (b) comprising the at least one floxed full-length mitofusin nucleic acid sequence, and the transgene; wherein each of the at least one floxed full-length mitofusin nucleic acid sequence and the transgene are located at distinct genomic sites in the progeny rodent.
  • the first rodent comprises a floxed full-length MFN1 nucleic acid sequence and a floxed full-length MFN2 nucleic acid sequence. Additionally or alternatively, in some embodiments, the flanking loxP sites of the floxed full-length MFN1 nucleic acid sequence are either identical to or distinct from the flanking loxP sites of the floxed full-length MFN2 nucleic acid sequence. In any and all embodiments of the methods disclosed herein, the first rodent is homozygous for the floxed full-length MFN1 nucleic acid sequence and/or the floxed full-length MFN2 nucleic acid sequence.
  • FIG.1A shows a schema demonstrating the generation of mice with tamoxifen- inducible tdTomato labeling in AEC2 cells.
  • tdTomato reporter mice Rosa26 tdTomato+/+
  • Sftpc CreERT2+/+ mice were crossed with Sftpc CreERT2+/+ mice.
  • FIG.1B shows a functional enrichment map generated using genes differently expressed between AEC2 cells with and those without bleomycin treatment, using the threshold of an adjusted p ⁇ 0.001 and a fold change > 1.2.
  • FIG.1C shows a heatmap showing upregulated genes under the annotation “mitochondrial organization (GO:0007005)” in AEC2 cells treated with bleomycin (BLM), compared to those treated with PBS.
  • FPKM fragment per kilobase of exon model per million mapped reads
  • FIG.1E shows a heatmap showing downregulated genes under the annotation “mitochondrial organization (GO:0007005)” in AEC2 cells treated with bleomycin, compared to those treated with PBS.
  • FIG.1F shows the representative TEM (transmission electron microscopy) images (50,000 ⁇ ) showing mitochondrial damage in AEC2 cells from Sftpc CreERT2+/- mice before and after bleomycin treatment (scale bar 500 nm).
  • FIG.1G shows the representative TEM images before and after bleomycin treatment (12,000 ⁇ ; scale bar 2 mm).
  • FIG.1H shows the quantification of mitochondrial number per mm2 of cytosolic area from the representative TEM images before and after bleomycin treatment.
  • FIG.1I shows the mitochondrial area (mm2) per mm2 of cytosolic area from the representative TEM images before and after bleomycin treatment.
  • each dot represents one AEC2 cell and the line indicates mean.
  • FIG.2A shows a schema demonstrating the generation of AEC2 cell specific mice deficient in Mfn1 or Mfn2 using a tamoxifen-inducible Sftpc-promoter driven CreERT2.
  • FIG.2E shows the quantification of the mitochondrial number per mm 2 of cytosolic area in each AEC2 cell, using TEM images (12,000 ⁇ ).
  • FIG.2F shows the mitochondrial area (mm 2 ) per mm 2 of cytosolic area in each AEC2 cell, using TEM images (12,000 ⁇ ).
  • each dot represents one AEC2 cell, and the line indicates mean.
  • FIG. 3C shows the quantification of mitochondria area of each mitochondrion (data presented as the median [interquartile range], and the comparison performed by Mann-Whitney U test). The percentage of total mitochondria after bleomycin treatment is shown in the order control, Mfn1 -/- , and Mfn2 -/- for each mitochondrial area value.
  • FIG.3D shows the mitochondrial number per mm 2 of cytosolic area in each AEC2 cell.
  • FIG. 3E shows the mitochondrial area (mm 2 ) in each AEC2 cell.
  • FIG. 3F shows the body weight changes of control, Mfn1 i DAEC2 and Mfn2 i DAEC2 mice after bleomycin treatment.
  • Data are mean ⁇ s.e.m. (results from 3 independent experiments; * Mfn1 i DAEC2 vs. control, # Mfn2 i DAEC2 vs. control; * and #, p ⁇ 0.05, ** and ##, p ⁇ 0.01, ###, p ⁇ 0.001, by unpaired Student’s t-test).
  • FIG. 3G shows the Kaplan–Meier survival curves of control, Mfn1 i DAEC2 and Mfn2 i DAEC2 mice after bleomycin treatment (results from 3 independent experiments; **p ⁇ 0.01, ***p ⁇ 0.001, by log-rank test).
  • FIG.4A shows a schema demonstrating the generation of mice with AEC2 cell specific tamoxifen-inducible deletion of MFN1 and MFN2 (a.k.a. Mfn1/2 -/- ). Sftpc CreERT2+/+ or Sftpc CreERT2+/- mice were used as controls.
  • SP-C surfactant protein-C
  • ER-TR7 magenta
  • Hoechst 33342 stain blue
  • FIG.5A shows a scatterplot showing genes (orange) that are differentially expressed (adjusted p ⁇ 0.05) and have the same regulation direction in both Mfn1 -/- and Mfn2 -/- AEC2 cells after bleomycin treatment, compared to the control.
  • FIG. 5B shows a functional enrichment map to illustrate the common GO terms enriched on differentially expressed genes of Mfn1 -/- and Mfn2 -/- AEC2 cells after bleomycin treatment.
  • FIG.5C shows a heatmap to demonstrate the changes in the expression of genes related to purine metabolism under the annotation“purine ribonucleoside triphosphate metabolic process (GO: GO:0009205)” based on the functional enrichment results FIG.5B.
  • FIG.5D shows a heatmap to demonstrate the changes in the expression of genes related to lipid metabolism under the annotation“fatty acid metabolic process (GO:0006631)” based on the functional enrichment results FIG.5B.
  • FIG. 5E shows a functional enrichment map generated using genes differently expressed between Mfn1/2 -/- AEC2 cells and control AEC2 cells, using the threshold of an adjusted p ⁇ 0.05.
  • FIG.5F shows the differentially regulated genes related to glycolysis, asparagine (Asn) synthesis, de novo serine/glycine synthesis, and mitochondrial one-carbon metabolism in Sftpc CreERT2+/+ versus MFN1/2 -/- AEC2 cells.
  • the fold change of FPKM is calculated relative to Sftpc CreERT2+/+ control (G6P, glucose-6-phosphate; G3P, glyceraldehyde- 3-phosphate;OAA, oxaloacetate; Asp, aspartate; Asn, asparagine; 3P-OH-pyruvate, 3- phosphohydropyruvate; P-ser, 3-phosphoserine; Ser, serine; Gly, glycine; THF, tetrahydrofolate; MTHF, methyltetrahydrofolate; FTHF, formyltetrahydropholate).
  • G6P glucose-6-phosphate
  • G3P glyceraldehyde- 3-phosphate
  • OAA oxaloacetate
  • Asp aspartate
  • Asn asparagine
  • 3P-OH-pyruvate 3- phosphohydropyruvate
  • P-ser 3-phosphoserine
  • Ser serine
  • LB lamellar bodies
  • FIG. 6F shows a schema outlining the generation of mice with tamoxifen-inducible Fasn knockout in AEC2 cells.
  • FIG. 6G shows the immunoblots showing MFN1, MFN2, TIM23 and b-actin expression in AEC2 cells from control or Fasn iDAEC2 mice.
  • FIG. 6H shows the Kaplan-Meier survival curves (*p ⁇ 0.05, by log-rank test) after bleomycin treatment.
  • FIG.7A shows the representative flow cytometry protocol and gating strategy to isolate tdTomato(+) cells from whole lung cell suspensions, with DAPI staining to exclude non-viable cells.
  • FIG.7B shows a schema demonstrating the protocol for the isolation AEC2 cells using magnetic-activated cell sorting (MACS) by CD45 negative selection and EpCAM positive selection. MACS.
  • MACS magnetic-activated cell sorting
  • FIG. 7D shows the purity of AEC2 cells isolated by MACS.
  • Representative flow cytometric analysis and gating strategy of SP-C of AEC2 cells isolated by MACS as measured by flow cytometric analysis. Shown is the analysis of cells in whole lung cell suspensions (upper left panel) and CD45(-)EpCAM(+) cells (lower left panel) with the percentage of SP-C positive cells quantified (right panel) in the respective populations (n 3 mice per group; data are mean ⁇ s.e.m.).
  • FIG. 8B shows the quantification of mitochondrial area of each mitochondrion in AEC2 cells before and after bleomycin treatment. For each mouse, 5-19 AEC2 cells were randomly sampled. Data presented are median [interquartile range], and the comparison is performed by Mann-Whitney U test.
  • FIG. 8D shows the quantification of MFN1, MFN2, OPA1, DRP1 by densitometric analysis through normalization to b-actin, expressed as the fold change relative to control (data are mean ⁇ s.e.m., ** p ⁇ 0.01 vs control, by unpaired Student’s t-test)
  • FIG. 8E shows the Volcano plot differently expressed genes between AEC2 cells isolated from mice treated with bleomycin and from mice treated with PBS control; threshold of an adjusted p ⁇ 0.001 and a fold change > 1.2.
  • FIG. 9A shows the representative TEM images (50,000 ⁇ ; scale bar 500 nm) highlighting two distinct mitochondrial morphologies in Mfn2 -/- AEC2 cells; 1) relatively normal mitochondria with enlarged size but regular cristae, and 2) abnormal mitochondria with disrupted and irregular cristae (marked by asterisk).
  • the arrows point to the residual cristae in a swollen mitochondrion (upper panel, left image).
  • FIG. 9B shows the quantification of mitochondrial area of each mitochondrion in AEC2 cells. For each mouse, 4-12 AEC2 cells were randomly sampled. Data presented are median [interquartile range], with comparison by Mann-Whitney U test.
  • FIG. 10B shows MitoTracker green staining of MLE 12 cells infected with shRNA targeted to MFN1 or MFN2.
  • the mitochondrial fluorescent dye MitoTracker green was used to label mitochondria (left panel; scale bar 5 mm). Lines with higher knockdown efficiency were selected for live-cell confocal imaging (a 3-dimensional reconstruction image from 2.46- m m-thick z stacks through a 63 ⁇ /1.4 oil immersion objective) and the percentages of cells with ⁇ 50% tubular mitochondria were quantified (right panel). Three high power fields were randomly selected, and 21-45 cells quantified in each high power field. Data are mean ⁇ s.e.m. (*p ⁇ 0.05, **p ⁇ 0.01, vs. control by unpaired Student’s t-test).
  • FIG.10C shows the immunoblots for Mfn1 and Mfn2 siRNA knockdown efficacy in the human AEC2 cell line A549.
  • FIG.11A shows the distribution of the mitochondrial area of each mitochondrion (data presented as the median [interquartile range] in Mfn1 -/- cells, with comparisons assessed by Mann-Whitney U test).
  • FIG.11B shows the distribution of the mitochondrial area of each mitochondrion (data presented as the median [interquartile range] in Mfn2 -/- cells, with comparisons assessed by Mann-Whitney U test).
  • FIG.11C and FIG.11E show the number of mitochondria per mm2 of cytosolic area in Mfn1 -/- AEC2 cells, and Mfn2 -/- AEC2 cells, respectively, with or without bleomycin treatment.
  • FIG.11D and FIG.11F show the total mitochondrial area (mm2) of each mitochondrion in Mfn1 -/- AEC2 cells, and Mfn2 -/- AEC2 cells, respectively, with or without bleomycin treatment.
  • each dot represents one AEC2 cell with the line indicating mean; *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001, vs. no bleomycin by unpaired Student’s t-test), using TEM images (12,000 ⁇ ).
  • FIG.11G shows the mtDNA/gDNA copy number ratios as assesses by real-time qPCR in isolated control, Mfn1 -/- , and Mfn2 -/- AEC2 cells with or without bleomycin treatment (NS, non-significant, by one-way ANOVA with post-hoc Bonferroni test).
  • FIGs. 12A to 12C show the total protein (FIG. 12A), total cells (FIG. 12B) and macrophages (FIG. 12C) measured in the bronchoalveolar lavage fluid (BALF) of mice exposed to bleomycin (5 days) or PBS (data presented as mean ⁇ s.e.m.; # bleomycin vs. PBS group, * vs. control; *p ⁇ 0.05, ## p ⁇ 0.01, ### p ⁇ 0.001, by one-way ANOVA with post- hoc Bonferroni test).
  • BALF bronchoalveolar lavage fluid
  • FIG.13D shows the real-time PCR quantification of mtDNA copy number per nuclear genome in Sftpc CreERT2+/+ and Mfn1/2 -/- AEC2 cells (data presented as mean ⁇ s.e.m.; ***p ⁇ 0.001, by unpaired Student’s t-test).
  • FIG.13E shows the representative TEM images (upper panel, 25,000 ⁇ , scale bar 1 mm; lower panel, 50,000 ⁇ , scale bar 500 nm) that highlight mitochondria with disrupted cristae (marked by asterisk), showing cristae with abnormal morphology or irregular alignment (lower panel, left image), or focal loss of cristae (lower panel, middle image).
  • the arrows mark relatively“normal” mitochondria for comparison (lower panel, right image).
  • FIG. 14 shows the representative immunofluorescent staining images, showing 5 ⁇ 5 tiled confocal images (using 40 ⁇ objective) of frozen Mfn1/2 iDAEC2 mouse lung sections stained for podoplanin (green), surfactant protein-C (SP-C) (yellow), ER-TR7 (magenta), and Hoechst 33342 stain (blue) (scale bar 50 mm).
  • SP-C surfactant protein-C
  • ER-TR7 magenta
  • Hoechst 33342 stain blue
  • FIG. 16A shows a schema demonstrating the generation of Mfn1 iDAEC2/tdTomato-AEC2 and Mfn2 iDAEC2/tdTomato-AEC2 mice.
  • FIG. 16D shows a scatterplot to demonstrate genes (orange) that are differentially e xpressed (adjusted p ⁇ 0.05) and have the same directional regulation in both Mfn1 -/- and Mfn2 - /- AEC2 cells at baseline, when compared to the control.
  • FIG. 16E shows the mRNA expression of Atf4, Atf5, and genes related to de novo serine/glycine synthesis by transcriptome RNA-seq analysis.
  • the fold change of FPKM is calculated relative to control. The data are presented as mean ⁇ s.e.m. (**adjusted p ⁇ 0.01, ***adjusted p ⁇ 0.001 vs. control).
  • FIG.16F shows a functional enrichment map showing the common GO terms enriched i n the differentially expressed genes of Mfn1 -/- and Mfn2 -/- AEC2 cells at baseline.
  • FIGs. 17A-17B show the representative TUNEL staining of murine lung sections obtained 5 days after bleomycin treatment (FIG. 17A) with corresponding quantification of TUNEL positive tdTomato(+) cells (FIG.17B).
  • FIG. 17G shows the differential mRNA expression of genes related to fatty acid synthesis, activation and import in pathways identified by functional enrichment analyses in control, Mfn1 -/- and Mfn2 -/- AEC2 cells 5 days after PBS or BLM exposure.
  • the fold change of FPKM values were calculated by normalizing to control AEC2 cells with PBS treatment.
  • the data are presented as mean ⁇ s.e.m. (# PBS vs. BLM, * knockout vs. control; *adjusted p ⁇ 0.05, ## and **adjusted p ⁇ 0.01, ### and ***adjusted p ⁇ 0.001).
  • FIG. 18A shows the mRNA expression of genes related to mitochondrial stress responses.
  • the fold change of FPKM is calculated relative to Sftpc CreERT2+/+ control.
  • FIG.18B shows a scatterplot demonstrating the common genes (dark gray) regulated in Mfn1/2 -/- AEC2 cells at baseline and in AEC2 cells after bleomycin treatment, compared to the respective controls.
  • FIG. 18C shows the functional enrichment analyses that were then performed on the common genes from FIG.18B.
  • FIG.18D shows a gene-set enrichment analysis (GSEA) based on Kyoto Encyclopedia of Genes and Genomes (KEGG) database revealed upregulated purine metabolism in Mfn1/2- /- AEC2 cells at baseline (upper panel) and in AEC2 cells after bleomycin treatment (lower panel).
  • GSEA gene-set enrichment analysis
  • FIG.19A shows the abbreviations of various lipid species
  • the fold changes of specific lipid contents in AEC2 cells after bleomycin treatment relative to those after PBS treatment were calculated and log-transformed (base 2) (­ or ⁇ , p ⁇ 0.05, calculated fold changes vs. 1 by unpaired Student’s t-test). d
  • FIG.20D shows the surfactant protein genes (Sftpb and Sftpc) in AEC2 cells at day 5 after PBS or bleomycin treatment (# PBS vs. bleomycin, # adjusted p ⁇ 0.05, # adjusted p ⁇ 0.01, and ### adjusted p ⁇ 0.001). All the data in FIG.20A-20D are presented as mean ⁇ s.e.m.
  • FIG. 22 shows a schematic representation showing that loss of MFN1 or MFN2 aggravates lung fibrosis by superimposing abnormal lipid metabolism on extensive mitochondrial damage in AEC2 cells.
  • FIG.23A shows the full immunoblots from the FIG.2C.
  • FIG.23B shows the full immunoblots from the FIG.4C.
  • FIG.23C shows the full immunoblots from the FIG.6G.
  • FIG.23D shows the full immunoblots from the FIG.8C.
  • FIG.23E shows the full immunoblots from the FIG.10A.
  • FIG.23F shows the full immunoblots from the FIG.10C.
  • FIG.24 shows functional enrichment analyses of differential transcripts that exhibit a fold change that is > 1.2 (adjusted p ⁇ 0.001) between AEC2 cells isolated from mice treated with bleomycin and AEC2 cells from control.
  • FIG.25 shows functional enrichment analyses of differential transcripts (adjusted p ⁇ 0.05) between Mfn1-/- (column 2) or Mfn2-/- (column 3) AEC2 cells vs. control AEC2 cells at baseline.
  • FIG.26 shows functional enrichment analyses of differential transcripts (adjusted p ⁇ 0.05) between Mfn1-/- (column 2) or Mfn2-/- (column 3) AEC2 cells vs. control AEC2 cells isolated from mouse lungs 5 days after bleomycin treatment.
  • FIG.27 shows functional enrichment analyses of differential transcripts (adjusted p ⁇ 0.05) between Mfn1-/- Mfn2-/- double mutant AEC2 cells and control AEC2 cells at baseline.
  • the present disclosure relates to genetically modified rodent models (e.g., mouse models) for pulmonary fibrosis (e.g., idiopathic pulmonary fibrosis), and methods of using the same to identify candidate agents to treat or prevent lung fibrosis.
  • rodent models e.g., mouse models
  • pulmonary fibrosis e.g., idiopathic pulmonary fibrosis
  • AEC2 alveolar type 2 epithelial cells
  • the genetically modified rodent models disclosed herein directly link mitochondrial damage-associated lipid metabolism in AEC2 cells and lung fibrosis.
  • Mitochondrial damage was exclusively introduced in AEC2 cells using the AEC2 cell specific Sftpc-promoter.
  • Persistent mitochondrial damage in AEC2 cells is pathogenic in the lung fibrotic process in IPF lungs and murine models.
  • IPF may be“single-cell” disease affecting AEC2 cells, which may in turn promote the activation of highly activated fibroblasts and myofibroblasts.
  • injury to AEC2 cells hampers the maintenance of the epithelial cell barrier integrity, which in turn may encourage the aberrant alveolar repair process leading to the extensive lung remodeling observed in IPF.
  • MFN1 and MFN2 regulate lipid metabolism in murine AEC2 cells, which has important ramifications for surfactant lipid production in these cells and the development of lung fibrosis.
  • the Examples described herein confirm that mitochondrial fragmentation and increased synthesis of cholesterol, ceramides, and specific glycerophospholipids in response to bleomycin-induced mitochondrial damage.
  • AEC2 cells in response to mitochondrial damage, upregulate these lipids to maintain surfactant lipid production under conditions of AEC2 cell injury. Loss of surfactant integrity leads to loss of normal lung physiology and may promote the development of lung fibrosis.
  • the term“about” in reference to a number is generally taken to include numbers that fall within a range of 1%, 5%, or 10% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value).
  • biological sample means sample material derived from living cells.
  • Biological samples may include tissues, cells, protein or membrane extracts of cells, and biological fluids (e.g., ascites fluid or cerebrospinal fluid (CSF)) isolated from a subject, as well as tissues, cells and fluids present within a subject.
  • biological fluids e.g., ascites fluid or cerebrospinal fluid (CSF)
  • Biological samples of the present technology include, but are not limited to, samples taken from breast tissue, renal tissue, the uterine cervix, the endometrium, the head or neck, the gallbladder, parotid tissue, the prostate, the brain, the pituitary gland, kidney tissue, muscle, the esophagus, the stomach, the small intestine, the colon, the liver, the spleen, the pancreas, thyroid tissue, heart tissue, lung tissue, the bladder, adipose tissue, lymph node tissue, the uterus, ovarian tissue, adrenal tissue, testis tissue, the tonsils, thymus, blood, hair, buccal, skin, serum, plasma, CSF, semen, prostate fluid, seminal fluid, urine, feces, sweat, saliva, sputum, mucus, bone marrow, lymph, and tears.
  • Biological samples can also be obtained from biopsies of internal organs.
  • Biological samples can be obtained from subjects for diagnosis or research or can be obtained from non-diseased individuals, as controls or for basic research. Samples may be obtained by standard methods including, e.g., venous puncture and surgical biopsy. In certain
  • the biological sample is a tissue sample obtained by needle biopsy.
  • a "control" is an alternative sample used in an experiment for comparison purpose.
  • a control can be "positive” or “negative.”
  • a positive control a compound or composition known to exhibit the desired therapeutic effect
  • a negative control a subject or a sample that does not receive the therapy or receives a placebo
  • Cre recombinase or“Cre” refers to a tyrosine recombinase enzyme derived from the P1 bacteriophage.
  • the Cre enzyme 38kDa
  • the Cre enzyme is a member of the integrase family of site specific recombinases, and uses a topoisomerase I-like mechanism to carry out site specific recombination events between two DNA recognition sites (LoxP sites).
  • the products of Cre-mediated recombination at loxP sites are dependent upon the location and relative orientation of the loxP sites.
  • the term“effective amount” refers to a quantity sufficient to achieve a desired effect, e.g., an amount which results in the deletion/excision of a floxed full-length mitofusin nucleic acid sequence, or the induction of lung fibrosis, or the prevention of or a decrease in a disease or condition described herein or one or more signs or symptoms associated with a disease or condition described herein.
  • the amount of a composition administered to the subject will vary depending on the composition, the degree, type, and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs.
  • compositions can also be administered in combination with one or more additional therapeutic compounds.
  • the therapeutic compositions may be administered to a subject having one or more signs or symptoms of a disease or condition described herein.
  • a "therapeutically effective amount" of a composition refers to composition levels in which the physiological effects of a disease or condition are ameliorated or eliminated. A therapeutically effective amount can be given in one or more administrations.
  • “expression” includes one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into protein (including codon usage and tRNA availability); and glycosylation and/or other modifications of the translation product, if required for proper expression and function.
  • an“expression control sequence” refers to polynucleotide sequences which are necessary to affect the expression of coding sequences to which they are operably linked. Expression control sequences are sequences which control the transcription, post- transcriptional events and translation of nucleic acid sequences.
  • Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (e.g., ribosome binding sites); sequences that enhance protein stability; and when desired, sequences that enhance protein secretion.
  • RNA processing signals such as splicing and polyadenylation signals
  • sequences that enhance translation efficiency e.g., ribosome binding sites
  • sequences that enhance protein stability e.g., ribosome binding sites
  • sequences that enhance protein secretion e.g., ribosome binding sites
  • control sequences generally include promoter, ribosomal binding site, and transcription termination sequence.
  • control sequences is intended to encompass, at a minimum, any component whose presence is essential for expression, and can also encompass an additional component whose presence is advantageous, for example, leader sequences.
  • floxing or“flanking by LoxP” refer to the sandwiching of a DNA sequence (which is then said to be floxed) between two lox P sites.
  • Floxing a gene sequence allows it to be conditionally deleted (knocked out), translocated or inverted via Cre recombinase activity in a specific tissue in vivo and/or during a particular temporal window.
  • the products of Cre mediated recombination depend upon the orientation of the loxP sites.
  • a DNA sequence found between two loxP sites oriented in the same direction will be excised as a circular loop of DNA, whereas intervening DNA between two loxP sites that are opposingly orientated will be inverted.
  • a loxP site may be inserted at one or both ends of a DNA sequence using CRISPR/Cas9, sgRNA, and donor DNA oligonucleotide including the loxP site.
  • fusion protein refers to a hybrid polypeptide which comprises protein domains from at least two different proteins.
  • One protein may be located at the amino-terminal (N-terminal) portion of the fusion protein or at the carboxy-terminal (C-terminal) protein thus forming an "amino-terminal fusion protein” or a "carboxy-terminal fusion protein,” respectively.
  • a protein may comprise different domains, for example, a Cre recombinase (Cre) and a tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2).
  • the mutation in the estrogen ligand-binding domain prevents binding of its natural ligand (17b-estradiol) at normal physiological concentrations, but renders the ERT2 domain responsive to 4-hydroxy (OH)-tamoxifen.
  • Fusion of Cre with ERT2 leads to the ERT2-dependent cytoplasmic sequestration of Cre by Hsp90, thereby preventing Cre-mediated recombination events in the nucleus.
  • binding of 4OH- tamoxifen leads to a disruption of the interaction with Hsp90, permitting access of Cre- ERTM to the nucleus and initiation of recombination.
  • a protein is in a complex with, or is in association with, a nucleic acid, e.g., DNA.
  • a nucleic acid e.g., DNA.
  • Any of the proteins provided herein may be produced by any method known in the art.
  • the proteins provided herein may be produced via recombinant protein expression and purification, which is especially suited for fusion proteins comprising a peptide linker. Methods for recombinant protein expression and purification are well known, and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4.sup.th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)), the entire contents of which are incorporated herein by reference.
  • the term“gene” means a segment of DNA that contains all the information for the regulated biosynthesis of an RNA product, including promoters, exons, introns, and other untranslated regions that control expression.
  • the terms“individual”,“patient”, or“subject” can be an individual organism, a vertebrate, a mammal, or a human.
  • the individual, patient or subject is a human or a rodent (e.g., mouse).
  • mutation refers to a substitution of a residue within a sequence, e.g., a nucleic acid or amino acid sequence, with another residue, or a deletion or insertion of one or more residues within a sequence. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue. Various methods for making the amino acid substitutions (mutations) provided herein are well known in the art, and are provided by, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual (4.sup.th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)).
  • loxP is a 34 base pair (bp) site on the bacteriophage P1 and includes an asymmetric 8 bp sequence, variable except for the middle two bases, flanked by two sets of symmetric, 13 bp sequences.
  • the wild-type loxP site sequence is
  • ATAACTTCGTATAATGTATGCTATACGAAGTTAT SEQ ID NO: 3
  • the 13 bp sequences are palindromic but the 8 bp spacer is not, thus giving the loxP sequence a certain direction. If the two loxP sites are in the same orientation, the floxed sequence (sequence flanked by two loxP sites) is excised; however if the two loxP sites are in the opposite orientation, the floxed sequence is inverted. Examples of alternate loxP sites include
  • 'N' indicates bases which may vary, and lowercase letters indicate bases that have been mutated from the wild-type.
  • mitochondrial fusogenic proteins refer to the Mfn1 and Mfn2 fusogenic proteins which belong to the family of ubiquitous transmembrane GTPases, and are embedded in the outer membrane of the mitochondria.
  • Human Mfn1 (741 residues) and Mfn2 (757 residues) are nuclear encoded by 18 exons on chromosome 3 (3q26.33) and 20 exons on chromosome 1 (1p36.22), respectively.
  • Mfn1 and Mfn2 share approximately 80% sequence similarity and the same relevant structural motifs.
  • Their essential amino-terminal GTPase domain contains five motifs, each of them playing a crucial function in binding and hydrolyzing GTP.
  • Mfn1 and Mfn2 also possess two coiled-coil domains (also called heptad-repeat domains, HR1 and HR2).
  • “operably linked” means that expression control sequences are positioned relative to the nucleic acid of interest to initiate, regulate or otherwise control transcription of the nucleic acid of interest.
  • transcription of a polynucleotide operably linked to an expression control element e.g., a promoter
  • an expression control element e.g., a promoter
  • polynucleotide or“nucleic acid” means any RNA or DNA, which may be unmodified or modified RNA or DNA.
  • Polynucleotides include, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, RNA that is mixture of single- and double-stranded regions, and hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double- stranded regions.
  • polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • the term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.
  • polypeptide As used herein, the terms“polypeptide,”“peptide” and“protein” are used interchangeably herein to mean a polymer comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres.
  • Polypeptide refers to both short chains, commonly referred to as peptides, glycopeptides or oligomers, and to longer chains, generally referred to as proteins.
  • Polypeptides may contain amino acids other than the 20 gene-encoded amino acids.
  • Polypeptides include amino acid sequences modified either by natural processes, such as post-translational processing, or by chemical modification techniques that are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature.
  • prevention or“preventing” of a disease or medical condition refers to a compound that, in a statistical sample, reduces the occurrence of the disease or medical condition in the treated sample relative to an untreated control sample, or delays the onset of one or more symptoms of the disease or medical condition relative to the untreated control sample.
  • promoter refers to any sequence that regulates the expression of a coding sequence, such as a gene. Promoters may be constitutive, inducible, repressible, or tissue-specific, for example.
  • A“promoter” is a control sequence that is a region of a polynucleotide sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind such as RNA polymerase and other transcription factors.
  • the promoter is an alveolar type 2 epithelial cell (AEC2) promoter such as surfactant protein C (Sftpc) or surfactant protein B (Sftpb).
  • the term“recombinant” when used with reference, e.g., to a cell, or nucleic acid, protein, or vector indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the material is derived from a cell so modified.
  • recombinant cells express genes that are not found within the native (non- recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.
  • A“transgenic animal” is a non-human animal, such as a mammal, generally a rodent such as a rat or mouse, in which one or more of the cells of the animal includes a transgene as described herein.
  • Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, and the like.
  • A“transgene” is exogenous DNA that is integrated into the genome of a cell from which a transgenic animal develops and thus remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal. Knock-in animals, which include a gene insertion, are included in the definition of transgenic animals.
  • Treating” or“treatment” as used herein covers the treatment of a disease or disorder described herein, in a subject, such as a human, and includes: (i) inhibiting a disease or disorder, i.e., arresting its development; (ii) relieving a disease or disorder, i.e., causing regression of the disorder; (iii) slowing progression of the disorder; and/or (iv) inhibiting, relieving, or slowing progression of one or more symptoms of the disease or disorder.
  • treatment means that the symptoms associated with the disease are, e.g., alleviated, reduced, cured, or placed in a state of remission.
  • the various modes of treatment of disorders as described herein are intended to mean“substantial,” which includes total but also less than total treatment, and wherein some biologically or medically relevant result is achieved.
  • the treatment may be a continuous prolonged treatment for a chronic disease or a single, or few time administrations for the treatment of an acute condition.
  • Pulmonary fibrosis is not seen as a separate entity but develops usually in the context of environmental exposures or as an accompaniment of a syndrome. Common causes are exposure to asbestos, metal dusts or organic substances, sarcoidosis (a disease characterized by the formation of granulomas), exposure to medical drugs and radiation. Often pulmonary fibrosis is associated with connective tissue or collagen diseases such as rheumatoid arthritis and scleroderma (Giri, S. N. (2003) Annu Rev Pharmacol Toxicol 43, 73-95).
  • the disease is characterized by chronic inflammation and collagen production within fibroblastic foci in the lung.
  • Myofibroblasts are a distinguishing feature of fibroblastic foci.
  • the disease typically proceeds with scarring of the lung and the alveoli which become lined by fibrotic tissue. When the scar forms, the tissue becomes thicker causing an irreversible loss in efficiency of the tissue's ability to transfer oxygen into the bloodstream.
  • pulmonary fibrosis Several growth factors have been implicated in the pathogenesis of pulmonary fibrosis. These factors have been identified by virtue of their ability to stimulate fibroblast division and extracellular matrix (ECM) production, as well as their presence in the lungs and lung fluids of patients or animals with fibrotic lung disease. These growth factors include TGF-b, insulin-like growth factor (IGF)-I, platelet-derived growth factor (PDGF), members of the fibroblast growth factor (FGF) family and keratinocyte growth factor (KGF) (Krein, P. M., and Winston, B. W. (2002) Chest 122, 289S-293S). Since pulmonary fibrosis is a very complex disease, the prediction of longevity of patients after diagnosis varies greatly.
  • IGF insulin-like growth factor
  • PDGF platelet-derived growth factor
  • FGF fibroblast growth factor
  • KGF keratinocyte growth factor
  • the present disclosure provides a genetically modified murine genome comprising at least one floxed full-length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4); and a transgene including a fusion protein (CreERT2) that comprises a Cre recombinase (Cre) fused to a tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2), wherein the fusion protein is operably linked to an alveolar type 2 epithelial cell (AEC2) expression control sequence, and wherein the mitofusin nucleic acid sequence is MFN1 and/or MFN2.
  • a transgene including a fusion protein (CreERT2) that comprises a Cre recombinase (Cre) fused to a tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2), wherein the fusion protein is operably linked to an alveolar type 2 epithelial cell (AEC2) expression control sequence, and wherein the
  • the at least one floxed full-length mitofusin nucleic acid sequence may be derived from a mammal selected from the group consisting of a mouse, a rat, and a human.
  • the at least one floxed full-length mitofusin nucleic acid sequence is a full length cDNA sequence of MFN1 and/or MFN2.
  • MFN1 and/or MFN2 nucleic acid sequences are provided below:
  • the at least one floxed full- length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) comprises the sequence of SEQ ID 4838- NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18.
  • the at least one floxed full-length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) comprises a 5’ flanking loxP site and a 3’ flanking loxP site that are oriented in an identical direction.
  • the 5’ flanking loxP site and/or the 3’ flanking loxP site comprises the sequence of any one of SEQ ID NOs: 3-12.
  • the sequences of the 5’ flanking loxP site and the 3’ flanking loxP site may be identical or different.
  • the genetically modified murine genome of the present technology comprises a floxed full-length MFN1 nucleic acid sequence and a floxed full- length MFN2 nucleic acid sequence that are located at distinct genomic sites.
  • the 5’ and 3’ flanking loxP sites of the floxed full-length MFN1 nucleic acid sequence are distinct from the 5’ and 3’ flanking loxP sites of the floxed full-length MFN2 nucleic acid sequence.
  • the genetically modified murine genome of the present technology further comprises a detectable reporter gene such as a fluorescent reporter gene, a chemiluminescent reporter gene, or a bioluminescent reporter gene.
  • the transgene comprises a detectable reporter gene such as a fluorescent reporter gene, a chemiluminescent reporter gene, or a bioluminescent reporter gene.
  • fluorescent reporter genes include, but are not limited to, GFP, YFP, CFP, RFP, TagBFP, Azurite, EBFP2, mKalama1, Sirius, Sapphire, T-Sapphire, ECFP, Cerulean, SCFP3A, mTurquoise, monomeric Midoriishi-Cyan, TagCFP, mTFP1, EGFP, Emerald, Superfolder GFP, Monomeric Azami Green, TagGFP2, mUKG, mWasabi, EYFP, Citrine, Venus, SYFP2, TagYFP, Monomeric Kusabira-Orange, mKOk, mKO2, mOrange, mOrange2, mRaspberry, mCherry, dsRed, mStrawberry, mTangerine, tdTomato, TagRFP, TagRFP-T, mApple, mRuby, mPlum, HcRed-Tandem, mM
  • TagRFP657 IFP1.4, iRFP, mKeima Red, LSS-mKate1, LSS-mKate2, PA-GFP,
  • bioluminescent reporter genes include, but are not limited to, Aequorin, firefly luciferase, Renilla luciferase, red luciferase, luxAB, and nanoluciferase.
  • suitable chemiluminescent reporter genes include b-galactosidase, horseradish peroxidase (HRP), and alkaline phosphatase.
  • Peroxidases generate peroxide that oxidizes luminol in a reaction that generates light, whereas alkaline phosphatases remove a phosphate from a substrate molecule, destabilizing it and initiating a cascade that results in the emission of light.
  • the AEC2 expression control sequence has a length ranging from 100 base pairs (bps) to 5 kilobases (kb). In certain embodiments, the AEC2 expression control sequence has a length of about 100 bps, about 150 bps, about 200 bps, about 250 bps, about 300 bps, about 350 bps, about 400 bps, about 450 bps, about 500 bps, about 550 bps, about 600 bps, about 650 bps, about 700 bps, about 750 bps, about 800 bps, about 850 bps, about 900 bps, about 950 bps, about 1.1 kb, about 1.2 kb, about 1.3 kb, about 1.4 kb, about 1.5 kb, about 1.6 kb, about 1.7 kb, about 1.8 kb, about 1.9 kb, about 2.1 kb, about 2.2 kb, about 2.3 kb, about 2.4 k
  • the AEC2 expression control sequence is a surfactant protein C (Sftpc) promoter or a surfactant protein B (Sftpb) promoter.
  • the Cre recombinase (Cre) is fused to the tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2) via a peptide linker.
  • the Cre recombinase (Cre) may be fused to the N-terminus or C-terminus of the tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2).
  • the Cre recombinase (Cre) comprises the sequence of SEQ ID NO: 19 and/or the tamoxifen-inducible mutant estrogen ligand-binding domain (ERT2) comprises the sequence of SEQ ID NO: 20.
  • the at least one floxed full- length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) and the transgene are located on different or identical chromosomes.
  • the at least one floxed full- length mitofusin nucleic acid sequence (e.g., 1, 2, 3, 4) is configured to be deleted or excised when the genetically modified murine genome is contacted with an effective amount of tamoxifen.
  • the present disclosure provides a rodent comprising any genetically modified murine genome described herein, wherein the rodent is homozygous for a floxed full-length MFN1 nucleic acid sequence and/or a floxed full-length MFN1 nucleic acid sequence.
  • the rodent of the present technology does not comprise endogenous MFN1 and/or MFN2 genomic nucleic acid sequences that lack flanking loxP sites.
  • the rodent may be a rat or a mouse. Additionally or alternatively, in some
  • the floxed full-length MFN1 nucleic acid sequence has been knocked into a wild-type MFN1 locus, and/or wherein the floxed full-length MFN2 nucleic acid sequence has been knocked into a wild-type MFN2 locus.
  • the rodent develops lung fibrosis after being exposed to an effective amount of tamoxifen, and optionally an effective amount of bleomycin.
  • Signs or symptoms of lung fibrosis may include one or more of weight loss, low-grade fevers, fatigue, arthalgias, myalgias, shortness of breath, respiratory distress, aching joints, or shallow breathing.
  • the rodent develops lung fibrosis after being exposed to an effective amount of tamoxifen, and optionally an effective amount of bleomycin.
  • Signs or symptoms of lung fibrosis may include one or more of weight loss, low-grade fevers, fatigue, arthalgias, myalgias, shortness of breath, respiratory distress, aching joints, or shallow breathing.
  • the rodent develops lung fibrosis after being exposed to an effective amount of tamoxifen, and optionally an effective amount of bleomycin.
  • Signs or symptoms of lung fibrosis may include one or more of weight loss,
  • rodent is fertile and is capable of transmitting the genetically modified murine genome to its offspring.
  • the AEC2 cells of the rodent exhibit one or more signs of mitochondrial damage selected from the group consisting of fragmented mitochondria with decreased mitochondrial area, increased mitochondrial number, enlarged mitochondria with irregular and disrupted cristae, increased mitochondrial area, decreased mtDNA copy number, and reduced mitophagy after being exposed to an effective amount of tamoxifen.
  • the rodent exhibits excessive scar formation, increased localization of fibroblastic aggregates in lungs, increased lung collagen deposition, elevated expression of vimentin, a-smooth muscle actin, and/or collagen III, and altered lipid metabolism after being exposed to an effective amount of tamoxifen.
  • altered lipid metabolism comprises reduced levels of one or more of cholesterol, ceramides, phosphatidic acids,
  • phosphatidylethanolamine phosphatidylserine, plasmalogen phosphatidylethanolamine, phosphatidylglycerol, monoacylglycerol, diacylglycerol, acylcarnitines,
  • glycerophospholipids glycerophospholipids, sphingolipids, and phosphatidylcholines with long unsaturated aliphatic chains.
  • the present disclosure provides a method for identifying a candidate agent for preventing lung fibrosis comprising (a) administering a candidate agent to any embodiment of the rodent of the present technology, wherein the rodent has been exposed to an amount of tamoxifen that is effective to induce fibrosis, and (b) monitoring the development of lung fibrosis in the rodent of step (a), wherein a reduction in or delayed onset of lung fibrosis in the rodent of step (a) compared to any embodiment of the rodent of the present technology that has been exposed to an amount of tamoxifen that is effective to induce fibrosis and that has not received the candidate agent indicates that the candidate agent is effective in preventing lung fibrosis.
  • the present disclosure provides a method for identifying a candidate agent for treating lung fibrosis comprising (a) administering a candidate agent to any embodiment of the rodent of the present technology, wherein the rodent exhibits lung fibrosis after being exposed to an effective amount of tamoxifen, and (b) monitoring the progression of lung fibrosis in the rodent of step (a), wherein amelioration of lung fibrosis in the rodent of step (a) compared to any embodiment of the rodent of the present technology that exhibits lung fibrosis after being exposed to an effective amount of tamoxifen and that has not 4838-
  • the present disclosure provides a method for determining an effective amount of a candidate agent for treating lung fibrosis comprising (a) administering a test amount of a candidate agent to any embodiment of the rodent of the present technology, wherein the rodent exhibits lung fibrosis after being exposed to an effective amount of tamoxifen, and (b) monitoring the progression of lung fibrosis in the rodent of step (a), wherein amelioration of lung fibrosis in the rodent of step (a) compared to any embodiment of the rodent of the present technology that exhibits lung fibrosis after being exposed to an effective amount of tamoxifen and that has not received the candidate agent indicates that the test amount of the candidate agent is effective in treating lung fibrosis.
  • amelioration of lung fibrosis comprises reduced scar formation, decreased localization of fibroblastic aggregates in lungs, decreased lung collagen deposition, reduced expression of vimentin, ⁇ -smooth muscle actin, and/or collagen III, and increased levels of one or more of lipids selected from among cholesterol, ceramides, phosphatidic acids, phosphatidylethanolamine, phosphatidylserine, plasmalogen
  • phosphatidylethanolamine phosphatidylglycerol
  • monoacylglycerol diacylglycerol
  • acylcarnitines glycerophospholipids
  • sphingolipids phosphatidylcholines with long unsaturated aliphatic chains.
  • the present disclosure provides a method for determining an effective amount of a candidate agent for preventing lung fibrosis comprising (a)
  • the lung fibrosis is caused by connective tissue or collagen diseases (e.g., rheumatoid arthritis, scleroderma), exposure to asbestos, metal dusts or organic substances, sarcoidosis, and exposure to medical drugs and radiation. Additionally or alternatively, in some embodiments of the methods
  • the candidate agent is an antibody agent, a peptide, a polypeptide, a fusion protein, a small molecule, a siRNA, an antisense RNA, a sgRNA, or a shRNA.
  • kits comprising any embodiment of the rodent of the present technology and instructions for assaying the effectiveness of a candidate agent for treating or preventing lung fibrosis.
  • the kits can also contain a control sample or a series of control samples, which can be assayed and compared to the test sample.
  • Each component of the kit can be enclosed within an individual container and all of the various containers can be within a single package, along with instructions for interpreting the results of the assays performed using the kit.
  • the kits of the present technology may contain a written product on or in the kit container.
  • the use of the reagents can be according to the methods of the present technology.
  • the kits further comprise reagents for detecting levels of vimentin, a-smooth muscle actin, collagen, and one or more lipids selected from among cholesterol, ceramides, phosphatidic acids,
  • phosphatidylethanolamine phosphatidylserine, plasmalogen phosphatidylethanolamine, phosphatidylglycerol, monoacylglycerol, diacylglycerol, acylcarnitines,
  • the written product describes how to use the reagents contained in the kit, e.g., for screening for a candidate agent that prevents or treats lung fibrosis.
  • Also disclosed herein are methods of producing any embodiment of the genetically modified murine genome described herein comprising: (a) providing a first rodent having in its genome at least one floxed full-length mitofusin nucleic acid sequence, wherein the mitofusin nucleic acid sequence is MFN1 and/or MFN2, and wherein the first rodent does not comprise the transgene; (b) mating the first rodent with a second rodent, wherein the second rodent comprises in its genome the transgene, and wherein the second rodent does not comprise the at least one floxed full-length mitofusin nucleic acid sequence; and (c) selecting a progeny rodent from step (b) comprising the at least one floxed full-length mitofusin nucleic acid sequence, and the transgene; wherein each of the at least one floxed full-length mitofusin nucleic acid sequence and the transgene are located at distinct genomic sites in the progeny rodent.
  • the first rodent comprises a floxed full-length MFN1 nucleic acid sequence and a floxed full-length MFN2 nucleic acid sequence. Additionally or alternatively, in some embodiments, the flanking loxP sites of the floxed full-length MFN1 nucleic acid sequence are either identical to or distinct from the flanking loxP sites of the floxed full-length MFN2 nucleic acid sequence. In any and all embodiments of the methods 4838- disclosed herein, the first rodent is homozygous for the floxed full-length MFN1 nucleic acid sequence and/or the floxed full-length MFN2 nucleic acid sequence.
  • mice Mfn1 loxp/loxp (stock 029901-UCD) and Mfn2 loxp/loxp (stock 029902-UCD) mice were both generated by David C Chan (Chen et al., Cell 130, 548-562 (2007)), and were purchased from Mutant Mouse Resource & Research Centers (MMRRC). Sftpc CreERT2+/+ mice were shared from Dr. Brigid Hogan. PolgA D257A/D257A mice were purchased from the Jackson Laboratory. Fasn loxp/loxp mice were kindly provided by Dr. Clay F Semenkovich, Washington University School of Medicine.
  • Mfn1 loxp/loxp Mfn2 loxp/loxp
  • Fasn loxp/loxp were crossed to Sftpc CreERT2+/+ mice.
  • Sftpc CreERT2+/- or Sftpc CreERT2+/+ mice were used as control for experiments.
  • ROSA26 tdTomato+/+ mice (stock 007914) were purchased from the Jackson Laboratory, and were bred with Sftpc CreERT2+/+ to express tamoxifen-inducible tdTomato fluorescence in AEC2 cells.
  • ROSA26 tdTomato+/+ mice were crossed to Mfn1 loxp/loxp or Mfn2 loxp/loxp mice to respectively generate Mfn1 loxp/loxp ROSA26 tdTomato+/+ or Mfn2 loxp/loxp ROSA26 tdTomato+/+ mice, which were subsequently crossed to
  • Bleomycin model of lung fibrosis 12-week-old sex and weight matched mice were used for bleomycin instillations. Induction of anesthesia was performed in the induction chamber by 3.5% Isoflurane, and 0.5 -0.75 mg/kg bleomycin (Catalog 13877, Cayman Chemical Company) in 50mL phosphate-buffered saline (PBS) was then given by intra- tracheal instillation, through gel-loading tips under the assistance of direct laryngoscopy using the otoscope. Control mice received intra-tracheal instillation of 50mL PBS only. The 4838-
  • mice weight of mice was recorded before and every 2 days after bleomycin treatment. Mice were euthanized at different time points after bleomycin instillation for sample harvest as outlined in the manuscript and figure legends.
  • Sircol assay Murine lungs were harvested 14 days after bleomycin or PBS instillation for quantification of the acid soluble collagen, using the Sircol assay (Catalog S1000, Biocolor). Murine lungs were first perfused using PBS, and the right lungs were obtained for the measurements, according to the manufacturer’s instructions.
  • Thermo Fisher BCA protein assay kit
  • Cell pellets were re-suspended in 100mL PBS.
  • the cell number was quantified using 10mL cell suspension by a Countess II Automated Cell Counter (Thermo Fisher), and cytospin slides were prepared using 40mL of the cell suspension with 160mL of PBS (500 r.p.m. for 5 minutes). Slides were stained using the Hemacolor Rapid staining kit (EMD Millipore), and the numbers of macrophages, leukocytes and neutrophils were counted in a total of at least 200 cells.
  • EMD Millipore Hemacolor Rapid staining kit
  • AEC2 cells were isolated from murine lungs as previously described. Briefly, mice were euthanized by intraperitoneal injection of 8 mg pentobarbital, and a thoracotomy was performed. Murine lungs were perfused through the right ventricle using PBS, and then inflated with 1.5mL dispase (Catalog 354235, BD Biosciences) and 0.5mL 1% low-melting point agarose (Catalog 16520-050, Invitrogen). After cooling on ice for 2 minutes, the lungs were excised and were transferred to a 50ml polypropylene tube containing 2mL dispase.
  • the lungs were homogenized manually using the plunger of a 1mL syringe in a 10cm petri dish with Dulbecco’s modified Eagle’s medium (DMEM) containing 200 U/mL DNase (Catalog D-4527, Sigma-Aldrich). After filtration sequentially through 100mm, 40mm (BD Biosciences), and 0.22mm (EMD Millipore) strainers, and centrifugation, whole lung cell suspensions were obtained.
  • DMEM Dulbecco’s modified Eagle’s medium
  • CD45 CD45 microbeads Catalog 130-052-301, Miltenyi Biotec
  • biotin-conjugated anti-EpCAM antibody Catalog 13-5791-82, eBioscience
  • streptavidin microbeads Catalog 130-048-102, Miltenyi Biotec
  • the resulting CD45(-)EpCAM(+) population was enriched for AEC2 4838-
  • CD45(-)EpCAM(+) cells were fixed by 4% PFA in a flow cytometry tube for 12 minutes under room temperature, and were transferred to slides by cytospin centrifugation at 350 rpm for 3 minutes.
  • the CD45(-)EpCAM(-) population was used to prepare cytospin slides for negative control. Blocking and permeabilization were performed at room temperature for 1 hour, using the buffer containing 5% normal goat serum (Vector Laboratories) and 0.3% Triton X-100 (Sigma-Aldrich) in tris-buffered saline (TBS).
  • Flow cytometry analysis Flow cytometric analyses of EpCAM or SP-C positivity were performed using a LSRFortessa cell analyzer (BD Biosciences). For the staining of EpCAM, cells were fixed by 1% PFA for 15 minutes at room temperature, followed by EpCAM binding with biotin-conjugated anti-EpCAM (1:50; eBioscience) and FcR blocking reagent (1:10; catalog 130-092-575, Miltenyi Biotec) for 1 hour on ice. After washing, a FITC-conjugated anti-biotin antibody (1:10; catalog 130-098-796, Miltenyi Biotec) was added for 10 minutes on ice in the dark.
  • Mitophagy measurement was performed by the pH-sensitive mtKeima fluorescence by the excitation using 405nm (for detecting mtKeima at pH 7.0) and 561nm (for detecting acidic mtKeima at pH 4.0) lasers, as previously described.
  • the intensity of mitophagy was calculated by the ratio of cell percentage with acidic 4838- mtKeima (upper gate) to cell percentage with neural mtKeima (lower gate) (see also FIG. 10F).
  • the flow cytometric data were analyzed with FlowJo analytical software (version 10) (BD Biosciences).
  • AEC2 cell isolation by tdTomato fluorescence To isolate AEC2 cells through tdTomato fluorescence, whole lung cell suspension was obtained after digestion and homogenization of mouse lungs, as described for AEC2 cell isolation by MACS separation. DAPI (0.1 mg/mL) was added to assess cell viability. Flow cytometric cell sorting was then performed by an Influx cell sorter (BD Biosciences) (see also FIG.7A).
  • Genotyping for Mfn1 deletion in AEC2 cells DNA samples were extracted from AEC2 cells obtained from Sftpc CreERT2+/- , Mfn1 i DAEC2 , Mfn1/2 i ⁇ AEC2 , control tdTomato-AEC2 , and Mfn1 i DAEC2/tdTomato-AEC2 mice using DNeasy blood and tissue kit (Qiagen), and were used for genotyping through PCR reactions and the subsequent resolution by agarose gel
  • the murine AEC2 cell line MLE 12 and human AEC2 cell line A549 were purchased from ATCC (CRL-2100 and CCL-185, respectively), and were maintained in RPMI 1640 medium containing 10% FBS and 1% penicillin-streptomycin (Gibco).
  • RPMI 1640 medium containing 10% FBS and 1% penicillin-streptomycin (Gibco).
  • Mfn1 TRCN0000081398, TRCN0000081401, and TRCN0000081402; Sigma-Aldrich
  • Mfn2 TRCN0000080610, TRCN0000080611 and TRCN0000080612; Sigma-Aldrich
  • SHC016 non-target shRNA
  • MLE 12 cells were transduced by shRNA lentiviral particles, followed by puromycin (2mg/mL; catalog A11138-03, Gibco) positive selection for 10-14 days, and were then maintained in RPMI 1640 medium containing 2mg/mL puromycin and 0.5% penicillin- streptomycin.
  • Retroviral packaging plasmids were gifts from David C Chan.
  • the retroviral construct pCHAC-mt-mKeima was a gift from Richard Youle (Addgene plasmid #72342), and was used to express mtKeima in MLE 12 cells through retroviral transduction. Cell sorting by Influx sorter (BD Biosciences) was performed to obtain mtKeima-positive cells.
  • A549 cells were transfected with non-targeting control siRNA (Dharmacon, D-001206-14-05) or siRNA targeting at human Mfn1 (Dharmacon SMARTpool, M-010670-01-0005) or Mfn2 (Dharmacon SMARTpool, M-012961-00-0005) mRNA using Lipofectamine® RNAiMAX Transfection Reagent (Life Technologies).
  • the above cell lines were free of mycoplasma infection, assessed using EZ-PCR TM Mycoplasma detection kit (Biological Industries).
  • Immunoblots were performed using lysates of MLE 12 or MACS®- isolated AEC2 cells. Briefly, RIPA buffer with protease inhibitor cocktail (Cell Signaling Technology) was used to prepared the lysates, and the protein concentrations were measured using BCA protein assay (Thermo Fisher). Proteins were resolved by NuPAGE 4%-12% Bis- Tris gel or 3%-8% Tris-Acetate gel (Invitrogen) electrophoresis, followed by transfer to PVDF membranes (EMD Millipore). For immunoblots using A549 lysates, proteins were resolved using 8% Tris-glycine gels.
  • the following primary antibodies were used to detect murine MFN1 (1:1000, Antibodies Incorporated 75-162), human MFN1 (1:1000, Proteintech 13798-1-AP), MFN2 (1:1000, Cell Signaling Technology 9482), OPA1 (1:1000, GeneTex GTX48589), DRP1 (1:500, BD Biosciences, 611112), FASN (1:1000, Cell Signaling
  • HRP horseradish peroxidase
  • IHC staining Primary antibodies against vimentin (1:100, Cell Signaling Technology, 5741), a-smooth muscle actin (1:640, Cell Signaling Technology, 19245), and collagen III (1:1000, Abcam, ab7778) were used for IHC staining.
  • the paraffin- embedded lung sections were first baked and deparaffinized. To retrieve antigen, the slides were heated on the Bond III Autostainer at 99-100 °C, and the sections subjected to sequential incubation with an endogenous peroxidase block, primary antibody, secondary antibody, polymer, diaminobezidine, and hematoxylin. Finally, the sections were dehydrated in 100% ethanol, and mounted in Cytoseal XYL (Richard Allan Scientific). Appropriate positive and negative controls were included.
  • cryosections for immunofluorescent staining murine lungs were inflated using 1.2mL 4% PFA. The lungs were then excised and transferred to a 50mL polypropylene tube containing 10mL 4% PFA for 24-hour fixation at 4 °C. After fixation, the lobes were separated, and transferred to 30% sucrose (Sigma-Aldrich) solution for 24 hours at 4 °C. Thereafter, the lung lobes were placed in a cryomold (Tissue-Tek), and embedded by optimum cutting
  • cryosections were retrieved on silane-coated slides immediately before immunofluorescent staining. Blocking and permeation of the cryosections was performed using TBS buffer containing 5% normal donkey serum (Jackson ImmunoResearch) and 0.3% Triton X-100 (Sigma-Aldrich).
  • Cryosections were covered with diluted primary antibodies and incubated in a humidified chamber overnight at 4 °C. Sixteen to 24 hours later, the cryosections were incubated with secondary antibodies for 1 hour under room temperature, with protection from light exposure. Hoechst 33342 (1:1000 dilution in TBS) was used to stain the nucleus. The slides were mounted using Prolong Gold antifade solution (Invitrogen), and the images of the slides were obtained by confocal microscopy.
  • TUNEL staining Mouse lung cryosections were used for TUNEL staining by ApoAlert TM DNA fragmentation assay kit (Clontech), according to the manufacturer’s instructions with some modifications. Briefly, cryosections were permeabilized with PBS containing 0.2% Triton X-100 at 4 °C for 5 minutes. The samples were then covered with the equilibration buffer for 10 minutes at room temperature. The TdT incubation buffer was prepared according to the manufacturer’s protocol, and was added onto the samples. The slides were then placed in a humidified chamber with light protection, and were incubated at 37 °C for 1 hour.
  • SSC saline-sodium citrate solution (2X) was then used to immerse the slides at room temperature for 15 minutes, and Hoechst 33342 (1:1000) was used to stain the nucleus.
  • the slides were mounted using Prolong Gold antifade solution (Invitrogen), and the images were obtained by confocal microscopy.
  • Confocal microscopy Confocal microscopy was used to obtain images of immunofluorescent staining, and for the visualization of mitochondria in MLE 12 and A549 cells.
  • the fluorophores were excited with a 405nm laser diode (Hoechst 33342), a 488nm argon laser (Alexa Fluor-488), a 561nm diode-pumped solid-state laser (Alexa Fluor-568), or a 633nm HeNe laser (Alexa Fluor-647).
  • mitochondrial morphology in MLE 12 and A549 cells cells were cultured in glass-bottom dishes (MatTek Corporation). Mitochondria were stained by 200nM MitoTracker Green (Invitrogen) at 37 °C for 30 minutes. DMEM medium free of phenol red was used to wash the cells and for maintaining the cells for live-cell imaging. The fluorescence of MitoTracker Green was excited by a 488nm argon laser. The morphology of mitochondria (fragmented or tubular) was determined and quantified as previously described.
  • TEM Transmission Electron Microscopy
  • Fixatives for TEM sample preparation were composed of 4% paraformaldehyde, 2.5% glutaraldehyde, 0.02% picric acid in 0.1M sodium cacodylate buffer (pH 7.3).
  • Murine lungs were inflated with 1.2mL TEM fixative, and were then excised and transferred to a 50mL polypropylene tube containing 10mL TEM fixative, and were submitted to the WCMC Microscopy and Image Analysis Core Facility for sample processing and image acquisition.
  • a Jeol electron microscope (JEM-1400) was used to obtain images with an accelerating voltage of 100 kV.
  • AEC2 cells were identified according to the appearance of lamellar bodies and the microvilli at the apical cell membrane. The quantification of the number (#/mm 2 cytosolic area) and the area (mm 2 ) of mitochondria or lamellar bodies was performed using FIJI running ImageJ software.
  • RNA-Seq analysis in AEC2 cells were obtained from MACS-isolated AEC2 cells from Sftpc CreERT2+/+ and Mfn1/2 i ⁇ AEC2 mice, or from AEC2 cells isolated by tdTomato(+) cell sorting from control tdTomato-AEC2 , Mfn1 i DAEC2/tdTomato-AEC2 , and
  • Lipid extracts were prepared using a modified Bligh and Dyer procedure as described previously 68,69 , spiked with appropriate internal standards, and analyzed using a 6490 Triple Quadrupole LC/MS system (Agilent Technologies). Glycerophospholipids and sphingolipids were separated with normal-phase HPLC as described before, with a few modifications.
  • the fold changes of the lipid levels in AEC2 cells after bleomycin treatment were calculated relative to the levels in AEC2 cells after PBS treatment, and were log 2 -transformed.
  • the heatmap was plotted based on the log 2 (fold change), using Heatmap Illustrator software (Heml 1.0).
  • a unique AEC2 cell reporter mouse was generated by crossing Sftpc CreERT2+/+ mice with ROSA26 tdTomato+/+ mice, creating mice with tamoxifen-inducible tdTomato florescence in AEC2 cells (Sftpc CreERT2+/- ROSA26 tdTomato+/- , referred to as control tdTomato-AEC2 ).
  • Sftpc CreERT2+/- ROSA26 tdTomato+/- referred to as control tdTomato-AEC2 .
  • FIG.7A five days after bleomycin treatment AEC2 cells were isolated for RNA next-generation sequencing (RNA-seq) utilizing flow cytometric cell sorting of tdTomato positive cells.
  • genes included in the“mitochondrial organization” annotation revealed the upregulation of genes involved in mitochondrial dynamic regulation (such as Mfn1, Mfn2, Dnm1l, and March5) mitochondrial apoptotic control (such as Bcl2l1, Mcl1, Bax, Bid, and Bak1), and mitochondrial oxidative phosphorylation (such as Ndufb6, Ndufs6 and Ndufa12 for complex I, Sdhd for complex II, Cyc1, Cycs, Uqcrb, and Uqcrq for complex III, and Cox5a, Cox5b, Cox6a1 and Cox7c for complex IV) (FIGs.1C-1D and 24), while there was downregulation of genes involved in mitophagy (Pink1, Bnip3, and Atg13) (FIG. 1E). This data highlighted similar transcriptomic responses between murine AEC2 cells after bleomycin treatment and human AEC2 cells from IPF lungs.
  • mitochondrial dynamic regulation such as Mfn
  • Example 3 Loss of Mfn1 or Mfn2 in AEC2 cells promotes lung fibrosis
  • Mfn1 and Mfn2 genes in murine AEC2 cells were conditionally deleted. Specifically, genetically modified mice harboring Mfn1 or Mfn2 flanked by two loxP sites were crossed with Sftpc CreERT2+/+ mice (FIG.2A). AEC2 cells were isolated from murine lungs, through CD45 negative selection and subsequent EpCAM positive selection (FIGs.7B-7E). Tamoxifen treatment resulted in the selective deletion of Mfn1 and Mfn2 genes in AEC2 cells
  • FIG.2G these mitochondrial morphological changes were restricted to AEC2 cells and were not observed in other lung cells, such as bronchial epithelial cells.
  • MFN1 or MFN2 in the murine AEC2 cell line MLE 12 were depleted through shRNA lentiviral transduction (FIG.10A).
  • FIG.10B loss of MFN1 induced more mitochondrial fragmentation than loss of MFN2 in MLE 12 cells.
  • Depletion of MFN1 or MFN2 in the human AEC2 cell line A549 also altered mitochondrial morphology (FIGs.10C- 10D).
  • Mfn1 i DAEC2 and Mfn2 i DAEC2 mice continued to thrive at 28-32 weeks post tamoxifen treatment, without remarkable lung pathologies.
  • Mfn1 i DAEC2 and Mfn2 i DAEC2 mice were instilled with bleomycin.
  • TEM analysis showed that Mfn1 or Mfn2 deletion enhanced bleomycin-induced mitochondrial damage in AEC2 cells (FIGs.3A-3B).
  • Mfn1 -/- AEC2 cells showed decreased mitochondrial area and increased mitochondrial number, while Mfn2 -/- AEC2 cells showed increased mitochondrial area and decreased mitochondrial number (FIGs.3C-3E and FIGs.11A-11F).
  • the data suggested that Mfn1 deletion led to excessive mitochondrial fragmentation, while Mfn2 deletion led to swollen mitochondria in AEC2 cells after bleomycin treatment.
  • bleomycin treatment and deletion of Mfn1 or Mfn2 did not alter the amount of mtDNA present in AEC2 cells.
  • mice in which both Mfn1 and Mfn2 were simultaneously deleted in AEC2 cells were generated and confirmed by genotyping and immunoblotting (FIG.4A-4C).
  • TEM analysis of mitochondrial ultrastructure showed loss of both Mfn1/2 led to increased mitochondrial area (FIG.13A-13C), decreased mtDNA copy number (FIG.13D), and considerable
  • FIG.4D and FIG.13E the morphological and pathological assessment of lung sections from surviving ( ⁇ 17 weeks post tamoxifen treatment) Mfn1/2 i DAEC2 mice revealed significant increases in Masson trichrome positive staining for collagen deposition, indicative of lung fibrosis. All the remaining surviving mice which displayed signs of respiratory distress (i.e.
  • Mfn1 loxP/loxP Sftpc CreERT2+/- ROSA26 tdTomato+/- mice were generated (FIG.16A), and performed transcriptomic profiling in Mfn1- and Mfn2-deficient AEC2 cells.
  • mice allowed for tamoxifen-inducible tdTomato fluorescent labeling in Mfn1- and Mfn2-deficient AEC2 cells, and was confirmed by demonstrating excision of the floxed allele after tamoxifen injection (FIGs.16B-16C).
  • tamoxifen-inducible tdTomato fluorescent labeling in Mfn1- and Mfn2-deficient AEC2 cells, and was confirmed by demonstrating excision of the floxed allele after tamoxifen injection (FIGs.16B-16C).
  • bleomycin-induced lung fibrosis model it was not observed that Mfn1 -/- or Mfn2 -/- AEC2 cells had significantly increased cell death 5 days after bleomycin administration (FIGs.17A-17D).
  • RNA-Seq data The expression levels of the proliferative marker Mki67 (RNA-Seq data) in AEC2 cells did not significantly increase (FIG.17E), and was not significantly different between controls and Mfn1 i DAEC2 and Mfn2 i DAEC2 mice 5 days after bleomycin exposure (FIG.26). Minimal Ki67 positive nuclear staining was further observed in tdTomato positive AEC2 cells, 10 days after bleomycin treatment (FIG.17F).
  • transcriptomic profiling at baseline showed Mfn2 deletion, compared to Mfn1 deletion, resulted in more robust changes in gene expressions in AEC2 cells (FIG.25).
  • Mfn2 -/- AEC2 cells activated genes involved in ATF5-mediated mitochondrial unfolded protein responses (UPR MT ) (Atf5, Lonp1, Clpp, and Hspa9), ATF4-mediated stress pathways (Atf4, Ddit3, Asns, Chac1, Pck2, and Trib3), along with genes involved in de novo serine/glycine synthesis pathways (Phgdh, Psat1, Shmt2) (FIG.16E).
  • Mfn1 -/- or Mfn2 -/- AEC2 cells activated genes related to UPR ER , such as Hspa5, Atf6, Pdia2, Ero1l, Xbp1, Hsp90b1, and Calr.
  • genes related to UPR ER such as Hspa5, Atf6, Pdia2, Ero1l, Xbp1, Hsp90b1, and Calr.
  • the common metabolic biological processes revealed by functional enrichment analyses included“lipid localization”,“nucleotide phosphate metabolic process”, and“alcohol metabolic process” (FIG.16F).
  • acylglycerol metabolic process “carbohydrate derivative biosynthetic and nucleoside triphosphate metabolic process” and“cofactor metabolic process” as the major metabolic processes affected in both Mfn1 -/- and Mfn2 -/- AEC2 cells after bleomycin treatment (FIG. 5B).
  • genes found included in the“carbohydrate derivative biosynthetic and nucleoside triphosphate metabolic process” upregulation of genes involving oxidative respiratory complexes, and genes involving purine metabolism, particularly nucleoside diphosphate kinase, adenylate kinase, polyribonucleotide nucleotidyltransferase, and adenosine monophosphate deaminase (FIG.5C).
  • Mfn1/2 i ⁇ AEC2 mice develop spontaneous lung fibrosis, whether the transcriptomic response in Mfn1/2 -/- AEC2 cells at baseline resembled those in the Mfn1 -/- or Mfn2 -/- AEC2 cells after bleomycin treatment, and whether Mfn1/2 -/- AEC2 cells had functional annotations in common with control AEC2 cells after bleomycin treatment were evaluated.
  • GSEA Gene-set enrichment analysis based on the Kyoto Encyclopedia of Genes and Genomes (KEGG) database further revealed that Mfn1/2 -/- AEC2 cells, compared with AEC2 cells after bleomycin treatment, markedly enhance the upregulation of purine metabolism (FIG.18D).
  • GSEA Gene-set enrichment analysis
  • KEGG Kyoto Encyclopedia of Genes and Genomes
  • Purine synthesis and phospholipid synthesis share common upstream substrates, including serine and derivatives from glycolysis. Changes in the preferential flux of these substrates towards purine metabolism (as observed in Mfn1 -/- and Mfn2 -/- AEC2 cells after bleomycin treatment, and in Mfn1/2 -/- AEC2 cells) and away from lipid synthesis pathways (as observed in Mfn1 -/- and Mfn2 -/- AEC2 cells after bleomycin treatment) may alter the innate function of the AEC2 cells to generate phospholipids for surfactant production.
  • AEC2 cells require proper lipid metabolism to continuously produce and store (in lamellar bodies) lung surfactant, a lipoprotein complex primarily composed of lipids (90%) (particularly phosphatidylcholines and phosphatidylglycerol, and cholesterol).
  • lung surfactant a lipoprotein complex primarily composed of lipids (90%) (particularly phosphatidylcholines and phosphatidylglycerol, and cholesterol).
  • phosphatidylserine and plasmalogen phosphatidylethanolamine were all increased in AEC2 cells 8 days after bleomycin exposure (FIGs.6C-6D).
  • these lipids were significantly decreased in Mfn1 -/- or Mfn2 -/- AEC2 cells treated with bleomycin.
  • acylcarnitines and phosphatidylcholines with long unsaturated aliphatic chains increased in control AEC2 cells treated with bleomycin, but not in the Mfn1 -/- or Mfn2 -/- AEC2 cells treated with bleomycin (FIG.20A-20B).
  • lipidome of Mfn1/2 -/- AEC2 cells was next evaluated. Strikingly, lipidomic changes in cholesterol, acylcarnitine, monoacylglycerol, diacylglycerol, phosphatidylserine, and phosphatidylglycerol were distinctly apparent in the Mfn1/2 -/- AEC2 cells, when compared to controls (FIG.6E). Specifically, long-chain acylcarnitines significantly were found to be decreased in Mfn1/2 -/- AEC2 cells, when compared to control AEC2 cells (FIG. 21A).
  • Phosphatidylglycerol synthesized in mitochondria were the major phospholipid species affected in Mfn1/2 -/- AEC2 cells (FIG.21B). Furthermore, diacylglycerol, which is derived from phosphatidic acid, is required for the synthesis of glycerophospholipids in the ER. Several diacylglycerol species (FIG.21C) and certain glycerophospholipids and sphingolipids (FIG.21D) were all markedly decreased in the Mfn1/2 -/- AEC2 cells.
  • Surfactant protein gene (Sftpb, Sftpc) expression was not altered between control and Mfn1/2- /- AEC2 cells (FIG.21E). The above results together strongly implicate perturbed lipid metabolism in Mfn1/2 -/- AEC2 cells.
  • FASN encodes the principal enzyme that catalyzes the synthesis of palmitoyl-CoA, the substrate required for glycerophospholipid and sphingolipid synthesis (FIG.17G). Mice with tamoxifen-inducible Fasn deletion in AEC2 cells
  • Fasn iDAEC2 Fasn loxP/loxP Sftpc CreERT2+/- , referred to as Fasn iDAEC2
  • Fasn is mainly expressed in AEC2 cells, and immunoblots of AEC2 cell lysates showed FASN depletion after tamoxifen injection (FIG.6G). Notably, Fasn-deletion did not alter the expression levels of MFN1 and MFN2 (FIG.6G). Exposure of Fasn iDAEC2 mice to bleomycin resulted in higher mortality (FIG. 6H), more weight loss (FIG.6I), and increased collagen deposition and lung fibrosis (FIG. 6J-6K), when compared to Sftpc CreERT2+/- controls.
  • Intra-tracheal bleomycin administration induces acute lung inflammation and epithelial cell injury, followed by epithelial cell repair and fibrotic reactions.
  • any difference in inflammation or altered AEC2 cell death or proliferation in Mfn1 i DAEC2 and Mfn2 i DAEC2 mice were not observed, suggesting AEC2 cell dysfunction may promote lung fibrosis independent of inflammation and cell injury.
  • data generated using PolgA D257A/D257A mice indicates that failure of mitochondrial bioenergetics alone may not account for the phenotypes observed in the Mfn1 i DAEC2 , Mfn2 i DAEC2 , or Mfn1/2 i ⁇ AEC2 mice.
  • results described herein demonstrate that alterations in the lipidome of the lung microenvironment may promote the activation of fibroblasts and myofibroblasts.
  • FASN is a TGF- b-regulated target in fibroblasts in vitro and in response to bleomycin in vivo and pharmacologically inhibiting this pathway reverses the pro-fibrotic response in the lung, suggesting that lipid synthesis plays a distinct role in AEC2 cells and fibroblasts of the lung.
  • the correct regulation of purine and lipid metabolism during mitochondrial damage is important for the diversion and utilization of common upstream substrates shared by both of these pathways, and the present disclosure demonstrates that mitofusins and mitochondrial fusion are essential in balancing such metabolic reprogramming.
  • the biological significance of increased purine synthesis upregulation may occur as a compensatory mechanism to ATP synthesis when mitochondrial bioenergetic function is impaired. Altered purine synthesis has been shown to promote lung inflammation and collagen deposition in murine models and inhibiting purine synthesis may offer therapeutic potential for IPF.
  • the marked upregulation of purine metabolism in Mfn1/2 -/- AEC2 cells and in bleomycin-treated Mfn1- or Mfn2-deficient AEC2 cells may play a direct role in promoting lung fibrosis.
  • a range includes each individual member.
  • a group having 1-3 cells refers to groups having 1, 2, or 3 cells.
  • a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Environmental Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Veterinary Medicine (AREA)
  • Endocrinology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des modèles de rongeurs génétiquement modifiés (par exemple des modèles de souris) pour une fibrose pulmonaire (par exemple, la fibrose pulmonaire idiopathique) et leurs méthodes d'utilisation pour identifier des agents candidats de traitement ou de prévention d'une fibrose pulmonaire.<i /> <i />
PCT/US2020/036416 2019-06-06 2020-06-05 Modèle de rongeur transgénique pour la fibrose pulmonaire et ses utilisations WO2020247815A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201962858010P 2019-06-06 2019-06-06
US62/858,010 2019-06-06

Publications (1)

Publication Number Publication Date
WO2020247815A1 true WO2020247815A1 (fr) 2020-12-10

Family

ID=73653374

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2020/036416 WO2020247815A1 (fr) 2019-06-06 2020-06-05 Modèle de rongeur transgénique pour la fibrose pulmonaire et ses utilisations

Country Status (1)

Country Link
WO (1) WO2020247815A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023049846A1 (fr) * 2021-09-24 2023-03-30 The Trustees Of The University Of Pennsylvania Compositions utiles pour le traitement de la maladie de charcot-marie-tooth
WO2023073738A1 (fr) * 2021-10-29 2023-05-04 Universita' Degli Studi Di Trento Construction génétique pour le suivi et/ou l'ablation de cellules quiescentes
CN117981712A (zh) * 2023-07-24 2024-05-07 南京鼓楼医院 一种腺病毒诱导肺纤维化急性加重动物模型的建立方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7112715B2 (en) * 2000-10-03 2006-09-26 Gie-Cerbm, Centre Europeen De Recherche En Biologie Et En Medecine (Gie) Transgenic mouse for targeted recombination mediated by modified Cre-ER
WO2018129203A2 (fr) * 2017-01-06 2018-07-12 The Regents Of The University Of California Procédé d'administration temporelle de médicament spécifique au tissu et recombinaison induite d'acide nucléique

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7112715B2 (en) * 2000-10-03 2006-09-26 Gie-Cerbm, Centre Europeen De Recherche En Biologie Et En Medecine (Gie) Transgenic mouse for targeted recombination mediated by modified Cre-ER
WO2018129203A2 (fr) * 2017-01-06 2018-07-12 The Regents Of The University Of California Procédé d'administration temporelle de médicament spécifique au tissu et recombinaison induite d'acide nucléique

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
GIACOMO MANCINI, KEVIN PIRRUCCIO, XIAOYONG YANG, MATTHIAS BLÜHER, MATTHEW RODEHEFFER, TAMAS L. HORVATH: "Mitofusin 2 in Mature Adipocytes Controls Adiposity and Body Weight", CELL REPORTS, vol. 26, no. 11, 12 March 2019 (2019-03-12), pages 2849 - 2858, XP055769035, DOI: 10.1016/j.ceirep. 2019.02.03 9 *
KUEI-PIN CHUNG, HSU CHIA-LANG, FAN LI-CHAO, HUANG ZILING, BHATIA DIVYA, CHEN YI-JUNG, HISATA SHU, CHO SOO JUNG, NAKAHIRA KIICHI, I: "Mitofusins regulate lipid metabolism to mediate the development of lung fibrosis", NATURE COMMUNICATIONS, vol. 10, no. 1, 29 July 2019 (2019-07-29), pages 1 - 17, XP055769040, DOI: 10.1038/s41467-019-11327-1 *
KUEI-PIN CHUNG, KIICHI NAKAHIRA , CHONG-JEN YU , SUZANNE M. CLOONAN , AND AUGUSTINE M.K. CHOI: "Mitofusins In Type 2 Alveolar Cells Are Required For Metabolic Adaptation In Pulmonary Fibrosis", CELL AND MOLECULAR BIOLOGY, vol. 23, no. S2, 20 November 2018 (2018-11-20), pages 63 - 64, XP055769038, DOI: 10.1111/resp.13419_153 *
XU, Y ET AL.: "Single- cell RNA sequencing identifies diverse roles of epithelial cells in idiopathic pulmonary fibrosis", JCI INSIGHT, vol. 1, no. 20, 8 December 2016 (2016-12-08), pages e90558, XP055494557, DOI: 10.1172/jci.insight.90558 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023049846A1 (fr) * 2021-09-24 2023-03-30 The Trustees Of The University Of Pennsylvania Compositions utiles pour le traitement de la maladie de charcot-marie-tooth
WO2023073738A1 (fr) * 2021-10-29 2023-05-04 Universita' Degli Studi Di Trento Construction génétique pour le suivi et/ou l'ablation de cellules quiescentes
CN117981712A (zh) * 2023-07-24 2024-05-07 南京鼓楼医院 一种腺病毒诱导肺纤维化急性加重动物模型的建立方法

Similar Documents

Publication Publication Date Title
Chung et al. Mitofusins regulate lipid metabolism to mediate the development of lung fibrosis
Bulek et al. Epithelial-derived gasdermin D mediates nonlytic IL-1β release during experimental colitis
Zhang et al. YAP1 alleviates sepsis-induced acute lung injury via inhibiting ferritinophagy-mediated ferroptosis
Zheng et al. CRISPR interference-based specific and efficient gene inactivation in the brain
Sun et al. Maternal Ybx1 safeguards zebrafish oocyte maturation and maternal-to-zygotic transition by repressing global translation
Vogl et al. Neddylation inhibition impairs spine development, destabilizes synapses and deteriorates cognition
Deng et al. RACK1 suppresses gastric tumorigenesis by stabilizing the β-catenin destruction complex
WO2020247815A1 (fr) Modèle de rongeur transgénique pour la fibrose pulmonaire et ses utilisations
Gupta et al. Lysosomal retargeting of Myoferlin mitigates membrane stress to enable pancreatic cancer growth
Gu et al. The disordered N-terminal domain of DNMT3A recognizes H2AK119ub and is required for postnatal development
Hernández et al. Decapping protein EDC4 regulates DNA repair and phenocopies BRCA1
Balderas et al. Mitochondrial calcium uniporter stabilization preserves energetic homeostasis during complex I impairment
Kumar et al. Microvillar and ciliary defects in zebrafish lacking an actin-binding bioactive peptide amidating enzyme
Zhang et al. The transcription factor GATA3 is required for homologous recombination repair by regulating CtIP expression
Thierer et al. Pla2g12b drives expansion of triglyceride-rich lipoproteins
Wang et al. SCARB2 drives hepatocellular carcinoma tumor initiating cells via enhanced MYC transcriptional activity
Zhang et al. CD44 connects autophagy decline and ageing in the vascular endothelium
Feng et al. Exosomal STIMATE derived from type II alveolar epithelial cells controls metabolic reprogramming of tissue-resident alveolar macrophages
Krishnan et al. RNF8 ubiquitylation of XRN2 facilitates R-loop resolution and restrains genomic instability in BRCA1 mutant cells
Liang et al. Neuron-specific apolipoprotein E4 (1-272) fragment induces tau hyperphosphorylation and axonopathy via triggering endoplasmic reticulum stress
Zhang et al. RUNDC1 inhibits autolysosome formation and survival of zebrafish via clasping ATG14-STX17-SNAP29 complex
Miyauchi et al. Altered replication stress response due to CARD14 mutations promotes recombination-induced revertant mosaicism
TWI805739B (zh) 阻斷緊迫導致腫瘤生成之方法
Bischof et al. mitoBKCa is functionally expressed in murine and human breast cancer cells and promotes metabolic reprogramming
Li et al. Succinate dehydrogenase is essential for epigenetic and metabolic homeostasis in hearts

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20818173

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20818173

Country of ref document: EP

Kind code of ref document: A1