WO2020225454A1

WO2020225454A1 - Detection of fusion protein

Info

Publication number: WO2020225454A1
Application number: PCT/EP2020/063096
Authority: WO
Inventors: Richard GILBERTSON; Lisa RUFF; Mark Austin; Denice Tsz Yau CHAN; Maria Groves; Stuart HAYNES; Sarah HOLT; Lesley JENKINSON
Original assignee: Cancer Research Technology Limited; Medimmune Limited
Priority date: 2019-05-09
Filing date: 2020-05-11
Publication date: 2020-11-12
Also published as: GB201906578D0

Abstract

The invention relates to an isolated antigen-binding protein characterised in that it is capable of binding specifically to an epitope of human RELAFus1 of Peptide 1 (SEQ ID NO: 481) or Peptide 5 (SEQ ID NO: 485) and to uses thereof.

Description

Detection of Fusion Protein

Technical Field

The invention relates to antigen-binding proteins (e.g., antibodies) that bind specifically to the FUS1 variant of the C1 1 orf95-RELA fusion onco-protein (C1 1 orf95-RELA^FUS1). The invention also relates to use of such anti-C1 1 orf95-RELA^FUS1 onco-protein antibodies for detection of C1 1 orf95-RELA^FUS1 .

Background Art

Ependymomas are tumours that arise within the lining of the ventricular system throughout the central nervous system (Kleihues et al. , 2002). Originally, they were considered to be one disease and were broadly divided based on their anatomical location into supratentorial, posterior fossa in the brain and spinal subtypes. However, transcriptome profiling and whole genome sequencing has demonstrated that ependymomas comprise nine different subgroups (Taylor et al. , 2005, Johnson et al. , 2010, Parker et al. , 2014, Pajtler et al. 2015). Each subgroup is defined by a unique gene, chromosome copy number and, where applicable, mutational profile. Importantly, these subgroups also display distinct clinical behaviours and so have clinical significance. For example, whole genome in vivo screens of copy number alterations as well as whole genome sequencing of supratentorial ependymomas (SEP) have identified several ependymoma oncogenes including EPHB2, RTBDN and RAB3A (Johnson et al. , 2010, Mohankumar ef al. , 2015). The most significant finding in SEP was the discovery of the C1 1 orf95- RELA fusion protein, present in 70% of all SEP which marks an especially aggressive form of the disease (also referred to as SEP-CR[+] in this document) (Parker et al., 2014; Pajtler ef al. , 2015). Since 2016, this RELA-fusion subgroup of supratentorial ependymoma has officially been recognised as a distinct entity by the World Health Organization (WHO) in its“Classification of Tumours of the Central Nervous System” (Louis et al. 2016).

C11orf95-RELA fusion

A recent study sequenced the whole genomes of 41 ependymomas and the transcriptomes of 77 ependymomas identified recurrent structural variations clustered on chromosome 1 1 (Parker et al. , 2014). Further analyses revealed that a catastrophic genetic event termed chromothripsis, which describes the shattering and subsequent rearrangement of a chromosome, resulted in the fusion of two 1 1 q genes that are usually separated by 73 genes- C11orf95 and RELA (Parker et al. , 2014). While the function of RELA is well characterised as the main effector of canonical NF-KappaB signalling, the function of C1 1 orf95 remains unknown (Hansen et al. , 1994; Shih et al. , 201 1). Parker et al. further showed that splicing was required to produce the mature C1 1 orf95-RELA transcript of which there are seven different splice variants.

Fusion variants 1 and 2 (RELAFusl and RELAFus2) are the most common, accounting for more than 70% of all SEP-CR(+) (Parker et al. , 2014). Using a uniform DNA methylation classifier, Pajtler et al. demonstrated in 2015 that SEP-CR(+) ependymoma patients have a particularly poor 10-year overall survival when compared with other ependymoma subgroups of <50%. Progression-free survival analysis further revealed that only 20% of SEP-CR(+) patients have progression-free survival and therefore SEP-CR(+) patients have the poorest prognosis out of the three supratentorial ependymoma subgroups.

Due to these differences in clinical outcome, it has been suggested that patients from the different molecular subgroups will need different types of treatments (Taylor et al., 2005; Parker et al. , 2014; Mohankumar et al. , 2015). However, to ensure appropriate treatment, an accurate diagnosis of the specific ependymoma subgroup is essential. Currently, the SEP-CR(+) ependymoma subgroup can only be determined using sophisticated genomic technologies such as transcriptomics, or DNA methylome profiling (Taylor et al., 2005; Johnson et al. , 2010; Parker et al. , 2014) or break-apart FISH (Parker et al. , 2014). In 2019, Gessi et al. showed that immunohistochemistry (IHC) using antibodies for both L1 CAM and RELA may help when diagnosing Fus-positive ependymoma. They suggest that a negative IHC for both antibodies is a predictor of Fus-negativity of the tumour sample but also stress that, in case of a stain positive for just one of the antibodies, presence of the fusion will have to be verified using molecular analyses (Gessi et al. 2019). Hence, to diagnose a fusion-positive ependymoma, an ideal antibody for IHC would specifically recognise the fusion-protein without detecting RELA or C1 1 orf95 in their wild-type forms.

Statement of Invention

The invention provides:

1 . An isolated antigen-binding protein characterised in that it is capable of binding specifically to an epitope of human RELAFusl of Peptide 1 (SEQ ID NO: 481) or Peptide 5 (SEQ ID NO: 485).

2. An isolated antigen-binding protein of clause 1 , characterised in that it is capable of binding specifically to human C 1 1 orf95-RELA^{FU S 1} onco- protei n .

The invention provides an antigen-binding protein, such as an antibody or antigen-binding portion thereof, that binds specifically to C1 1 orf95-RELA Fusion variant 1 (RELAFusl , C1 1 orf95-RELA^FUS1) a human onco-protein associated with an especially aggressive form of the disease supratentorial ependymomas (SEP), referred to herein as SEP-CR[+] In preferred embodiments, the antigen-binding protein does not bind to C1 1 orf95 or RELA in their wild-type forms in a tissue sample.

3. An isolated antigen-binding protein of any preceding clause, comprising:

(a) a VH domain comprising a set of HCDRs: HCDR1 , HCDR2 and HCDR3, interspersed with framework regions (HFW1 -HCDR1 -HFW2-HCDR2-HFW3-HCDR3-HFW4), wherein the amino acid sequences of the set of HCDRs is selected from those of clone C0040154, C0040151 , C0040034, C0040036, C0040044, C0040033, C0040007, C0040012, C0040014, C0040035, C0040039, C0040018, C0040040, C0040032, C0040037, C0040045, C0040025, C0040074, C0040062, C0040047, C0040069, C0040060, C0040063, C0040067, C0040072, C0040066, C0040065, C0040061 , C0040145, C0040146, C0040147, C0040148, C0040150, C0040152, C0040153, C0040155, C0040156, C0040157, C0040158, C0040159, C0040160, C0040161 , C0040162,

C0040163, C0040164, C0040165, or C0040166; and / or

(b) a VL domain comprising a set of LCDRs: LCDR1 , LCDR2 and LCDR3, interspersed with framework regions (LFW1 -LCDR1 -LFW2-LCDR2-LFW3-LCDR3-LFW4), wherein the amino acid sequences of the set of LCDRs is selected from those of clone C0040154, C0040151 , C0040034, C0040036, C0040044,

C0040033, C0040007, C0040012, C0040014, C0040035, C0040039, C0040018, C0040040, C0040032, C0040037, C0040045, C0040025, C0040074, C0040062, C0040047, C0040069, C0040060, C0040063, C0040067, C0040072, C0040066, C0040065, C0040061 , C0040145, C0040146, C0040147, C0040148, C0040150, C0040152, C0040153, C0040155, C0040156, C0040157, C0040158, C0040159, C0040160, C0040161 , C0040162, C0040163, C0040164,

C0040165, or C0040166; and/or

(c) a VH domain comprising a set of HCDRs: HCDR1 , HCDR2 and HCDR3 interspersed with framework regions (HFW1 -HCDR1 -HFW2-HCDR2-HFW3-HCDR3-HFW4) and a VL domain comprising a set of LCDRs: LCDR1 , LCDR2 and LCDR3, interspersed with framework regions (LFW1 -LCDR1 -LFW2- LCDR2-LFW3-LCDR3-LFW4), wherein the amino acid sequences of the set of six CDRs (HCDR1 , HCDR2, HCDR3, LCDR1 , LCDR2 and LCDR3) is selected from the six CDRS of clone C0040154, C0040151 , C0040034, C0040036, C0040044, C0040033, C0040007, C0040012, C0040014,

C0040035, C0040039, C0040018, C0040040, C0040032, C0040037, C0040045, C0040025,

C0040074, C0040062, C0040047, C0040069, C0040060, C0040063, C0040067, C0040072,

C0040066, C0040065, C0040061 , C0040145, C0040146, C0040147, C0040148, C0040150,

C0040152, C0040153, C0040155, C0040156, C0040157, C0040158, C0040159, C0040160,

C0040161 , C0040162, C0040163, C0040164, C0040165, or C0040166, wherein the sequences are defined by Kabat nomenclature.

4. An isolated antigen-binding protein of any preceding clause, comprising:

(a) a VH domain selected from those of any of clones C0040154, C0040151 , C0040034, C0040036,

C0040044, C0040033, C0040007, C0040012, C0040014, C0040035, C0040039, C0040018,

C0040040, C0040032, C0040037, C0040045, C0040025, C0040074, C0040062, C0040047,

C0040069, C0040060, C0040063, C0040067, C0040072, C0040066, C0040065, C0040061 ,

C0040145, C0040146, C0040147, C0040148, C0040150, C0040152, C0040153, C0040155,

C0040156, C0040157, C0040158, C0040159, C0040160, C0040161 , C0040162, C0040163,

C0040164, C0040165, or C0040166 or a VH with at least 80% homology thereto, and / or

(b) a VL domain selected from those of any of clones C0040154, C0040151 , C0040034, C0040036,

C0040044, C0040033, C0040007, C0040012, C0040014, C0040035, C0040039, C0040018,

C0040040, C0040032, C0040037, C0040045, C0040025, C0040074, C0040062, C0040047,

C0040069, C0040060, C0040063, C0040067, C0040072, C0040066, C0040065, C0040061 , C0040145, C0040146, C0040147, C0040148, C0040150, C0040152, C0040153, C0040155,

C0040164, C0040165, or C0040166, or a VL with at least 80% homology thereto, and / or,

(c) a VH domain and VL domain of clone C0040154, C0040151 , C0040034, C0040036, C0040044, C0040033, C0040007, C0040012, C0040014, C0040035, C0040039, C0040018, C0040040,

C0040032, C0040037, C0040045, C0040025, C0040074, C0040062, C0040047, C0040069,

C0040060, C0040063, C0040067, C0040072, C0040066, C0040065, C0040061 , C0040145,

C0040146, C0040147, C0040148, C0040150, C0040152, C0040153, C0040155, C0040156,

C0040157, C0040158, C0040159, C0040160, C0040161 , C0040162, C0040163, C0040164,

C0040165, or C0040166; wherein the sequences are defined by Kabat nomenclature.

In particularly preferred embodiments, the antibody has a VH and VL selected from those of clones: C0040154, C0040151 , C0040034, C0040036, C0040044, C0040033, C0040007, C0040012,

C0040014, C0040035, C0040039, C0040018, C0040040, C0040032, C0040037, C0040045,

C0040025, C0040074, C0040062, C0040047, C0040069, C0040060, C0040063, C0040067,

C0040072, C0040066, C0040065, C0040061 , C0040145, C0040146, C0040147, C0040148,

C0040150, C0040152, C0040153, C0040155, C0040156, C0040157, C0040158, C0040159,

C0040160, C0040161 , C0040162, C0040163, C0040164, C0040165, or C0040166.

5. An isolated antigen-binding protein of any preceding clause characterised in that it is a monoclonal antibody or a fragment thereof.

6. An isolated antigen-binding protein of any preceding clause, characterised in that it is a human, nonhuman, humanised or chimeric antibody.

7. An isolated antigen-binding protein of any preceding clause, characterised in that it is a chimeric antibody comprising a human VH and / or VL.

8. An isolated antigen-binding protein of any preceding clause, characterised in that it comprises nonhuman heavy and / or light chain constant regions.

9. An isolated antigen-binding protein of any preceding clause, characterised in that it comprises a nonhuman heavy chain constant region CH1 , hinge, CH2 and / or CH3, and / or a non-human light chain constant region CL.

10. An isolated antigen-binding protein of any preceding clause, characterised in that the non-human antibody or region thereof is selected from those of rabbit, mouse, rat, goat, sheep, cattle, chicken, guinea pig, hamster, shark and camelid. 1 1 . An isolated antigen-binding protein of any preceding clause for use in detection of an epitope of peptide 1 (SEQ ID NO: 481), peptide 5 (SEQ ID NO: 485), or RELAFusl in a sample.

12. An isolated antigen-binding protein of any preceding clause for use in detection of C1 1 orf95- RELA^{FU S 1} in a sample.

13. An in vitro method for detecting C1 1 orf95-RELA^FUS1 in a sample, comprising incubating an antigenbinding protein according to any preceding clause with a sample of interest and detecting binding of the antibody to C1 1 orf95-RELA^FUS1 within the sample, wherein binding of the antigen-binding protein indicates the presence of C1 1 orf95-RELA^FUS1 in the sample.

14. An in vitro method according to clause 13, wherein the binding of the antigen-binding protein is detected using a method selected from immunohistochemistry (IHC), immunofluorescence, Western blot, immunoprecipitation (IP), ELISA and flow cytometry.

15. An isolated antigen-binding protein for use according to clause 1 1 or 12 or an in vitro method according to clause 13 or clause 14, wherein the sample is selected from brain tissue, cerebro-spinal fluid (CSF), primary or cultured cells or cell lines, cell supernatants, cell lysates, platelets, serum, plasma, vitreous fluid, lymph fluid, synovial fluid, follicular fluid, seminal fluid, amniotic fluid, milk, whole blood, plasma, serum, blood-derived cells, urine, saliva, sputum, tears, perspiration, mucus, tumor lysates, and tissue culture medium, tissue extracts such as homogenized tissue, tumor tissue, cellular extracts, and combinations thereof.

16. An isolated antigen-binding protein according to any one of clauses 1 to 12 for use:

(i) in vitro as a diagnostic or in an in vitro diagnostic method,

(ii) in an in vitro method of detecting or diagnosing a disease or disorder,

(iii) in the manufacture of a diagnostic product for use in the in vitro detection or diagnosis of a disease or disorder; or

(iv) in a kit for use in an in vitro method of detecting or diagnosing a disease or disorder in an individual, the kit comprising an antigen-binding protein as described herein and optionally further comprising instructions for use and / or one or more reagents.

17. An isolated antigen-binding protein for use according to clause 16, wherein the disease or disorder is an ependymoma, e.g., supratentorial ependymoma.

18. An isolated recombinant peptide comprising the amino acids sequence of Peptide 1 (SEQ I D NO : 481 ) or Peptid e 5 (SEQ I D : 485) , o ption ally comprising a n N- or C- termin al biotin .

19. An isolated nucleic acid or set of nucleic acids encoding an antigen-binding protein according to any of clauses 1 to 12. 20. A host cell in vitro transformed with nucleic acid or set of nucleic acids according to clause 19.

21 . A method of producing an antigen-binding protein according to any of clauses 1 to 12, comprising culturing host cells according to clause 20 under conditions for production of the antigen-binding protein.

22. A method according to clause 21 , further comprising isolating and/or purifying the antigen-binding protein.

23. A method according to clause 22, further comprising formulating the antigen-binding protein into a composition comprising at least one additional component.

24. A composition comprising an antigen-binding protein of any of clauses 1 to 12 and an excipient.

The invention further provides an antigen-binding protein of the invention for use in identifying a subject with C1 1 orf95-RELA Fusion variant 1 .

The invention further provides a method for identifying a subject with C1 1 orf95-RELA Fusion variant 1 , which method comprises:

(a) providing a sample obtained from a patient suspected of having SEP-CR[+] associated with RELAFusl ,

(b) assaying the sample in vitro by using an antigen-binding protein of the invention to detect the presence or absence of RELAFusl in the sample,

(c) identifying a subject in whose sample RELAFusl is present, as a subject likely to be afflicted with SEP-CR[+j.

The sample may be brain tissue sample or CSF. Assaying may be performed by detecting antibody- antigen interaction, i.e., by detecting the binding of an antigen-binding protein of the invention to C1 1 orf95-RELA Fusion variant 1 , e.g., by IHC, immunofluorescence, Western blot, ELISA, immunoprecipitation (IP) or flow cytometry.

Detailed Description

The invention relates to antigen-binding proteins, in particular antibodies and antigen-binding fragments thereof that comprise an antigen-binding site for an epitope within peptide 1 or peptide 5, which peptide sequences span the fusion junction of C1 1 orf95 and RELA in human C1 1 orf95-RELA^FUS1.

The C1 1 orf-95-RELA^FUS1 peptides 1 and 5 are of identical amino acid sequence but differ in that they are biotinylated at the N-terminus (Peptide 1) or C-terminus (Peptide 5). These C1 1 orf-95-RELA^FUS1 peptides were designed specifically to encompass the canonical fusion 1 translocation junction sequence (C1 1 orf95-RELA fusions drive oncogenic NF-kappaB signalling in ependymoma (Parker et at, 2014). The N-terminal C1 1 orf95 component of Peptides 1 and 5 specifically encompass residues Glu-Glu-Glu-Glu-Gly-Ala-Gly-Val-Pro-Ala-Cys-Pro-Pro-Lys-Gly-Pro encoded by exon 2 of C1 1 orf95. The C-terminal RELA component of peptides 1 and 5 specifically contains RELA residues Glu-Leu- Phe-Pro-Leu-lle-Phe-Pro-Ala-Glu-Pro-Ala-Gln-Ala-Ser-Gly-Pro.

An antibody or antigen-binding fragment thereof of the invention may be produced by recombinant means. A “recombinant antibody” is an antibody which has been produced by a recombinantly engineered host cell. An antibody or antigen-binding fragment thereof in accordance with the invention is optionally isolated or purified.

The term “antibody” describes an immunoglobulin whether natural or partly or wholly synthetically produced. The antibody may be human humanised, non-human or chimeric. The term "antibody" herein is used in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments so long as they exhibit the desired antigen-binding activity. The antibody is preferably a monoclonal antibody, more preferably a human monoclonal antibody. Examples of antibodies are the immunoglobulin isotypes, such as immunoglobulin G, and their isotypic subclasses, such as lgG1 , lgG2, lgG3 and lgG4, as well as fragments thereof. The four human subclasses (lgG1 , lgG2, lgG3 and lgG4) each contain a different heavy chain; but they are highly homologous and differ mainly in the hinge region and the extent to which they activate the host immune system. lgG1 and lgG4 contain two inter-chain disulphide bonds in the hinge region, lgG2 has 4 and lgG3 has 1 1 interchain disulphide bonds.

The terms“antibody” and“antibody molecule”, as used herein, includes antibody fragments, such as Fab and scFv fragments, provided that said fragments comprise a CDR-based antigen-binding site for C1 19orf5-RELA^FUS1. An "antibody fragment" refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the antigen to which the intact antibody binds. Examples of antibody fragments include but are not limited to Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; and single-chain antibody molecules (e.g., scFv). Unless the context requires otherwise, the terms“antigen-binding proteins”,“antibody” or“antibody molecule”, as used herein, are thus equivalent to“antibody or antigen-binding fragment thereof.

Antibodies are immunoglobulins, which have the same basic structure consisting of two heavy and two light chains forming two Fab arms containing identical domains that are attached by a flexible hinge region to the stem of the antibody, the Fc domain, giving the classical Ύ’ shape. The Fab domains consist of two variable and two constant domains, with a variable heavy (VH) and constant heavy 1 (CH1) domain on the heavy chain and a variable light (VL) and constant light (CL) domain on the light chain. The two variable domains (VH and VL) form the variable fragment (Fv), which provides the CDR- based antigen specificity of the antibody, with the constant domains (CH1 and VL) acting as a structural framework. Each variable domain contains three hypervariable loops, known as complementarity determining regions (CDRs). On each of the VH and VL the three CDRs (CDR1 , CDR2, and CDR3) are flanked by four less-variable framework (FR) regions (FR1 , FW2, FW3 and FW4) to give a structure FW1 -CDR1 -FW2-CDR2-FW3-CDR3-FW4. The CDRs provide a specific antigen recognition site on the surface of the antibody.

Generally, unless otherwise indicated (explicitly or by context) amino acid residues are numbered herein according to the Kabat numbering scheme (Kabat et al., 1991 ).

It is possible to take monoclonal and other antibodies and use techniques of recombinant DNA technology to produce other antibodies or chimeric antibodies which generally retain the specificity of the original antibody. Such techniques may involve introducing the CDRs into a different immunoglobulin framework, or grafting the variable regions onto a different immunoglobulin constant region. Introduction of the CDRs of one immunoglobulin into another immunoglobulin is described for example in EP-A-184187, GB2188638A or EP-A-239400. Methods for production of chimeric antibodies are well known in the art. Alternatively, a hybridoma or other cell producing an antibody molecule may be subject to genetic mutation or other changes, which may or may not alter the binding specificity of antibodies produced.

As antibodies can be modified in a number of ways, the term "antibody" should be construed as covering antibody fragments, derivatives, functional equivalents and homologues of antibodies, including any polypeptide comprising an immunoglobulin binding domain, whether natural or wholly or partially synthetic.

An antigen-binding protein, such as an antibody or antigen-binding fragment of the invention binds to human C1 1 orf95-RELA^FUS1. Binding in this context may refer to specific binding. The term "specific" may refer to the situation in which the antigen-binding protein will not show any significant binding to molecules other than its specific binding partner(s), here, Peptide 1 , Peptide 5 and C1 1 orf95-RELA^FUS1. The term“specific” is also applicable where the antibody molecule is specific for particular epitopes, such as epitopes on C1 1 orf95-RELA^FUS1 , that are carried by a number of antigens in which case the antibody molecule will be able to bind to the various antigens carrying the epitope.

An antibody that binds to the same epitope as, or an epitope overlapping with, a reference antibody refers to an antibody that blocks binding of the reference antibody to its binding partner (e.g., an antigen) in a competition assay by 50% or more, and conversely, the reference antibody blocks binding of the antibody to its binding partner in a competition assay by 50% or more. Such antibodies are said to compete for binding to an epitope of interest.

The invention provides an antigen-binding protein, such as an antibody, that competes for binding to Peptide 1 or to Peptide 5 with an antibody selected from: C0040154, C0040151 , C0040034, C0040036, C0040044, C0040033, C0040007, C0040012, C0040014, C0040035, C0040039, C0040018,

C0040040, C0040032, C0040037, C0040045, C0040025, C0040074, C0040062, C0040047, C0040069, C0040060, C0040063, C0040067, C0040072, C0040066, C0040065, C0040061 ,

C0040145, C0040146, C0040147, C0040148, C0040150, C0040152, C0040153, C0040155,

C0040164, C0040165, or C0040166 in a competition assay, such as a HTRF™ assay.

Amino acids may be referred to by their one letter or three letter codes, or by their full name. The one and three letter codes, as well as the full names, of each of the twenty standard amino acids are set out below.

Table 1 Amino acids, one and three-letter codes

In preferred embodiments, an antibody of the invention comprises HCDR1 , HCDR2 and HCDR3 of a VH and / or a LCDR1 , LCDR2 and LCDR3 of a VL of an antibody selected from: C0040154, C0040151 , C0040034, C0040036, C0040044, C0040033, C0040007, C0040012, C0040014, C0040035, C0040039, C0040018, C0040040, C0040032, C0040037, C0040045, C0040025, C0040074,

C0040062, C0040047, C0040069, C0040060, C0040063, C0040067, C0040072, C0040066,

C0040065, C0040061 , C0040145, C0040146, C0040147, C0040148, C0040150, C0040152, C0040153, C0040155, C0040156, C0040157, C0040158, C0040159, C0040160, C0040161 , C0040162, C0040163, C0040164, C0040165, or C0040166.

More preferably, an antibody of the invention comprises a VH and / or VL with at least 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence homology to an antibody selected from: C0040154, C0040151 ,

C0040034, C0040036, C0040044, C0040033, C0040007, C0040012, C0040014, C0040035,

C0040039, C0040018, C0040040, C0040032, C0040037, C0040045, C0040025, C0040074,

C0040062, C0040047, C0040069, C0040060, C0040063, C0040067, C0040072, C0040066,

C0040065, C0040061 , C0040145, C0040146, C0040147, C0040148, C0040150, C0040152,

C0040153, C0040155, C0040156, C0040157, C0040158, C0040159, C0040160, C0040161 ,

C0040162, C0040163, C0040164, C0040165, or C0040166.

In further preferred embodiments, an antibody of the invention comprises a VH comprising HCDR1 , HCDR2 and HCDR3 and / or VL comprising LCDR1 , LCDR2 and LCDR3, wherein the VH and / or VL have at least 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence homology to the VH and / or VL of an antibody selected from: C0040154, C0040151 , C0040034, C0040036, C0040044, C0040033, C0040007, C0040012, C0040014, C0040035, C0040039, C0040018, C0040040, C0040032,

C0040037, C0040045, C0040025, C0040074, C0040062, C0040047, C0040069, C0040060,

C0040063, C0040067, C0040072, C0040066, C0040065, C0040061 , C0040145, C0040146,

C0040147, C0040148, C0040150, C0040152, C0040153, C0040155, C0040156, C0040157,

C0040158, C0040159, C0040160, C0040161 , C0040162, C0040163, C0040164, C0040165, or C0040166.

In particularly preferred embodiments, an antibody of the invention comprises a VH and a VL of an antibody selected from: C0040154, C0040151 , C0040034, C0040036, C0040044, C0040033, C0040007, C0040012, C0040014, C0040035, C0040039, C0040018, C0040040, C0040032,

C0040037, C0040045, C0040025, C0040074, C0040062, C0040047, C0040069, C0040060,

C0040147, C0040148, C0040150, C0040152, C0040153, C0040155, C0040156, C0040157,

Sequence identity may be defined using the Bioedit, ClustalW algorithm (Thompson et a!., (1994). Unless otherwise indicated, Sequence homology is assessed using the Clustal W method alignment (Thompson et al., 1994).

The antibodies herein specifically include "chimeric" antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (see, e.g., U.S. Pat. No. 4,816,567; and Morrison et al., Proc. Natl. Acad. Sci. USA 81 :6851 -6855 (1984)).

A "human antibody" is one which possesses an amino acid sequence which corresponds to that of an antibody produced by a human or a human cell or derived from a non-human source that utilizes human antibody repertoires or other human antibody-encoding sequences. This definition of a human antibody specifically excludes a humanized antibody comprising non-human antigen-binding residues.

"Humanized" forms of non-human (e.g., rodent) antibodies are chimeric antibodies that contain minimal sequence derived from the non-human antibody. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or non-human primate having the desired antibody specificity, affinity, and capability. In some instances, FR residues of the human immunoglobulin are replaced by corresponding nonhuman residues. Furthermore, humanized antibodies can comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence. The humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature 321 :522-525, 1986; Riechmann et al., Nature 332:323-329, 1 988; and Presta, Curr. Op. Struct. Biol. 2:593-596, 1992.

An antigen-binding protein of the invention may be an antibody, preferably a monoclonal antibody, and may be human or non-human, chimeric or humanised. An antigen-binding protein of the invention may be a human antibody, preferably a human monoclonal antibody. An antigen-binding protein of the invention may be a rabbit antibody, preferably a rabbit monoclonal antibody. An antigen-binding protein of the invention may be chimeric with a human VH and VL and a non-human constant regions, e.g., with a human VH and VL and a rabbit IgG constant regions (e.g., heavy chain CH1 , hinge, CH2 and CH3 and light chain CL).

The antibody may comprise a CH2 domain. The CH2 domain is preferably located at the N-terminus of the CH3 domain of the IgG molecule. The CH2 domain of the antibody may be of human or non-human origin. Human antibody may have the CH2 domain of human lgG1 , lgG2, lgG3, or lgG4, more preferably the CH2 domain of human lgG1 or lgG2. The sequences of human IgG domains and those of nonhuman species are known in the art. The antibody may comprise an immunoglobulin hinge region, or part thereof, at the N-terminus of the CH2 domain. The immunoglobulin hinge region allows the two CH2-CH3 domain sequences to associate and form a dimer. The hinge region, or part thereof, may be a human or non-human species hinge region. The human hinge region may be an lgG1 , lgG2, lgG3 or lgG4 hinge region, or part thereof.

The sequence of the CH3 domain, is not particularly limited. The CH3 domain of the antibody may be of human or non-human origin. The CH3 domain may be a human IgG domain, such as a human lgG1 , lgG2, lgG3, or lgG4 CH3 domain.

An antibody of the invention may comprise a human or non-human species IgG constant region. An antibody of the invention may comprise a human lgG1 , lgG2, lgG3, or lgG4 constant region. The sequences of human lgG1 , lgG2, lgG3, or lgG4 CH3 domains are known in the art. Examples of nonhuman species IgG include those of rabbit, mouse, rat, sheep, cattle, pigs, poultry (such as chickens), goats, guinea pig, hamster and camelid.

The rabbit IgG molecule (~150-kDa) contains two identical k or A light chains paired with two identical heavy chains. The light chain consists of an N-terminal variable domain (VL), with three CDRs, followed by one constant domain (CL). The heavy chain consists of an N-terminal variable domain (VH), with three CDRs, followed by three constant domains (CH1 , CH2 and CH3). CH1 and CH2 are linked through a flexible hinge region and three disulphide bridges of the IgG molecule, one for each of the two light- and heavy-chain pairs, and one for the heavy-chain pair. The rabbit has two k light chain options, K1 and K2. The more frequent k light chain, K1 , contains an additional disulphide bridge that links VL and CL. Rabbits of the New Zealand White strain have approximately 90% lgG-k (K1), 10% IgG-K (K2) and <1 % lgG-l antibodies.

The antibody molecules of the invention may be useful in the detection of C1 1 orf95-RELA^FUS1 , thus, the present invention relates to the use of an antibody of the invention for detecting the presence of C1 1 orf95-RELA^FUS1 in a sample. The antibody molecule may be conjugated to a detectable label as described elsewhere herein.

Also provided is an in vitro method of detecting C11 orf95-RELA^FUS1 , wherein the method comprises incubating an antibody of the invention with a sample of interest and detecting binding of the antibody to C1 1 orf95-RELA^FUS1 within the sample. Binding of the antibody molecule may be detected using an IHC, immunofluorescence, Western blot, ELISA, IP or flow cytometry, for example.

In a preferred embodiment, the present invention relates to an in vitro method of detecting C1 1 orf95- RELA^FUS1 in a sample, wherein the method comprises incubating an antibody of the invention with a sample of interest, and determining binding of the antibody to C1 1 orf95-RELA^FUS1 present in the sample, wherein binding of the antibody indicates the presence of C1 1 orf95-RELA^FUS1 in the sample. Methods for detecting binding of an antibody molecule to its target antigen are known in the art and include IHC, immunofluorescence, Western blot, immunoprecipitation (IP), ELISA and flow cytometry.

The sample of interest may be a sample obtained from an individual. The individual may be human. Samples include, but are not limited to, tissue such as brain tissue, cerebro-spinal fluid (CSF), primary or cultured cells or cell lines, cell supernatants, cell lysates, platelets, serum, plasma, vitreous fluid, lymph fluid, synovial fluid, follicular fluid, seminal fluid, amniotic fluid, milk, whole blood, plasma, serum, blood-derived cells, urine, saliva, sputum, tears, perspiration, mucus, tumour lysates, and tissue culture medium, tissue extracts such as homogenized tissue, tumourtissue, cellular extracts, and combinations thereof.

Following incubation, antibody binding is visualized using an appropriate detection system. The method of detection can be direct or indirect, and may generate a fluorescent or chromogenic signal. Direct detection involves the use of primary antibodies that are directly conjugated to a label. Indirect detection methods employ a labelled secondary antibody raised against the primary antibody host species. Indirect methods may include amplification steps to increase signal intensity. Commonly used labels for the visualization of epitope-antibody interactions include fluorophores and enzymes that convert soluble substrates into insoluble, chromogenic end products.

The term "detecting" is used herein in the broadest sense to include both qualitative and quantitative measurements of a target molecule. Detecting includes identifying the mere presence of the target molecule in a sample as well as determining whether the target molecule is present in the sample at detectable levels. Detecting may be direct or indirect.

An antibody of the invention may be conjugated to a detectable label. In this case, the antibody molecule may be referred to as a conjugate. Such conjugates may find application for the detection (e.g., in vitro detection) of C1 1 orf95-RELA^FUS1 and diagnosis of diseases as described herein.

Suitable detectable labels which may be conjugated to antibody molecules are known in the art and include radioisotopes such as iodine-125, iodine-131 , yttrium-90, indium-1 1 1 and technetium-99; fluorochromes, such as fluorescein, rhodamine, phycoerythrin, Texas Red and cyanine dye derivatives for example, Cy7, Alexa750 and Alexa Fluor 647; chromogenic dyes, such as diaminobenzidine; latex beads; enzyme labels such as horseradish peroxidase; phosphor or laser dyes with spectrally isolated absorption or emission characteristics; and chemical moieties, such as biotin, which may be detected via binding to a specific cognate detectable moiety, e.g. labelled avidin or streptavidin.

An antibody of the invention may be conjugated to the detectable label by means of any suitable covalent or non-covalent linkage, such as a disulphide or peptide bond. The invention also provides a nucleic acid or set of nucleic acids encoding an antibody or antigenbinding fragment of the invention, as well as a vector or vectors comprising such a nucleic acid or set of nucleic acids.

Where the nucleic acid encodes the VH and VL domain, or heavy and light chain, of an antibody molecule of the invention, the two domains or chains may be encoded on two separate nucleic acid molecules or on the same nucleic acid molecule.

An isolated nucleic acid molecule may be used to express an antibody molecule of the invention. The nucleic acid will generally be provided in the form of a recombinant vector for expression. Another aspect of the invention thus provides a vector comprising a nucleic acid as described above. Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. Preferably, the vector contains appropriate regulatory sequences to drive the expression of the nucleic acid in a host cell. Vectors may be plasmids, viral e.g., phage, or phagemid, as appropriate.

A nucleic acid molecule or vector as described herein may be introduced into a host cell. Techniques for the introduction of nucleic acid or vectors into host cells are well established in the art and any suitable technique may be employed. A range of host cells suitable for the production of recombinant antibody molecules are known in the art, and include bacterial, yeast, insect or mammalian host cells. A preferred host cell is a mammalian cell, such as a CHO, NS0, or HEK cell, for example a HEK293 cell.

A recombinant host cell comprising a nucleic acid or the vector of the invention is also provided. Such a recombinant host cell may be used to produce an antibody of the invention. Thus, also provided is a method of producing an antibody of the invention, the method comprising culturing the recombinant host cell under conditions suitable for production of the antibody. The method may further comprise a step of isolating and/or purifying the antibody molecule.

Thus, the invention provides a method of producing an antibody of the invention comprising expressing a nucleic acid encoding the antibody in a host cell and optionally isolating and/or purifying the antibody thus produced. Methods for culturing host cells are well-known in the art. Techniques forthe purification of recombinant antibody are well-known in the art and include, for example HPLC, FPLC or affinity chromatography, e.g., using Protein A or Protein L. In some embodiments, purification may be performed using an affinity tag on antibody. The method may also comprise formulating the antibody into a composition with an excipient. The invention also provides a composition comprising an antigenbinding protein of the invention and an excipient. The antibodies and compositions of the invention are expected to be useful in diagnostic applications, in particular in humans for conditions associated with the presence of C1 1 orf95-RELA^FUS1 onco-protein fusions, such as those found in supratentorial ependymoma. C1 1 orf95-RELA fusion proteins are present in 70% of all supratentorial ependymoma (SEP) and are associated with especially aggressive forms of the disease, referred to as SEP-CR[+]

Antibodies to FUS1 variants of the C1 1 orf95-RELA fusion onco-proteins enable detection of C1 1 orf95- RELA^FUS1 variants and may thus be for use in in vitro methods for diagnosis of supratentorial ependymoma in patients. Methods in which anti-C1 1 orf95-RELA^FUS1 antibodies of the invention may be used include immunohistochemistry, immunofluorescence, Western blot, ELISA, immunoprecipitation and flow cytometry.

Related aspects of the invention thus provide;

(i) an antibody of the invention for use in vitro as a diagnostic or in an in vitro diagnostic method,

(ii) an antibody of the invention for use in an in vitro method of detecting or diagnosing a disease or disorder,

(iii) the use of an antibody of the invention in the manufacture of a diagnostic product for use in the in vitro detection or diagnosis of a disease or disorder;

(iv) an in vitro method of detecting or diagnosing a disease or disorder in an individual that employs an antibody of the invention; and

(v) a kit for use in an in vitro method of detecting or diagnosing a disease or disorder in an individual, the kit comprising an antibody of the invention as described herein and optionally further comprising instructions for use and / or one or more reagents.

The disease or disorder may be an ependymoma, in particular supratentorial ependymoma.

Antibody molecules of the invention are expected to be useful for: improving the accuracy of diagnosis of supratentorial ependymoma, differential diagnosis between ependymoma and glioblastoma, informing the choice of treatment for patient subjects (e.g., monitoring, or radical tumorectomy and / or postoperative radiation therapy), informing prognosis, assessing likelihood and duration of survival or progression-free survival and in selecting subjects for clinical trials.

As used herein, the terms "individual," "patient," or "subject" are used interchangeably and refer to any single animal, more preferably a mammal (including such non-human animals as, for example, cats, dogs, horses, rabbits, zoo animals, cows, pigs, sheep, and non-human primates). In particular embodiments, the subject herein is a human.

Further aspects and embodiments of the invention will be apparent to those skilled in the art given the present disclosure, including the following experimental exemplification. All documents mentioned in this specification are incorporated herein by reference in their entirety. When“and/or” is used herein this is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example,“A and/or B” is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein.

Unless context dictates otherwise, the descriptions and definitions of the features set out above are not limited to any particular aspect or embodiment of the invention and apply equally to all aspects and embodiments which are described.

Certain aspects and embodiments of the invention will now be illustrated by way of example and with reference to the figures provided herein.

Figures

Figure 1. (A) Fusion 1 of chromosome 1 1 q genes C11orf95 and RELA. (B) C1 1 orf95-RELA^FUS1 peptide reagents. Biotinylated C1 1 orf95-RELAFUS1 selection peptide and biotinylated control de-selection peptide sequences. Biotin moieties are separated from peptide sequences via an 8-amino-3,6-dioxa- octanoic acid, polar, flexible spacer (AEEAc). All peptides synthesised as trifluoroactetate salt. Amino acids identified by their one-letter code as defined by lUPAC-IUB Joint Commission on Biochemical Nomenclature (JCBN) (Nomenclature 1984)

Figure 2. C1 1 orf95-RELA peptide direct binding FRET assay (rabbit IgG)

Fig u re 3. IHC profiling of candidate antibodies resulted in lead isolation of rabbit lgGs-C0040034 and C0040036. Formalin-fixed paraffin embedded (FFPE) tissue with tumours positive or negative for

FUS1 RTBDN

C1 1 orf95-RELA , (mSEP-CR[+] or mSEP-CR[-] , respectively) were stained with candidate rabbit clones. The mSEP-CR(+) tumour tissues stained with C0040034 and C0040036 display a very distinct positive nuclear staining pattern. Representative staining for candidate antibodies that did not display a very particular staining pattern are shown on tissue stained with C0040063 (black arrow).

Fig u re 4. (A) C0040034 and (B) C0040036 Epitope Co mpetition Assay (h u man I g G 1 ) with affin ity matu red antibod ies .

Fig u re 5. Scheme for Epitope Competitio n Assay (rabbit IgG) (A) FRET (B) No FRET.

Fig u re 6. Representative IHC images of human C1 1 orf95-RELA^FUS1 positive mSEP-CR(+) and negative mSEP-CR(-)^RTBDN mouse tumours probed with C0040151 , C0040154 or C0040159 rabbit IgGs. FFPE tissue with tumours positive or negative for C1 1 orf95-RELA^FUS1 (mSEP-CR[+] or mSEP- CR[-]RTBDN, respectively) were stained with C0040151 , C0040154 or C0040159 rabbit IgGs. Tissues from mSEP-CR(+) tumours display a very distinct positive nuclear staining pattern when stained with lgGsC0040151 or C0040154. Tissues stained IgG C0040159 does not display positive staining.

Figure 7. Representative IHC images of human ependymoma patient tissue probed with C0040151, C0040154 orC0040159 rabbit IgGs.

A. Representative IHC images of C11orf95-RELA fusion-positive supratentorial ependymoma (SEP- CR[+]) patient samples probed with C0040151, C0040154 or C0040159 rabbit IgGs. FFPE tissue of tumours positive for C11orf95-RELA fusion were stained with C0040151 , C0040154 or C0040159 rabbit IgGs. Tissue from these tumours display very distinct nuclear staining pattern. The best staining results are achieved when staining with C0040151 or C0040154.

B. Representative IHC images of C11orf95-RELA fusion-negative posterior fossa ependymoma patient samples probed with C0040151 , C0040154 or C0040159 rabbit IgGs. FFPE tissue of tumours negative for C11orf95-RELA fusion were stained with C0040151, C0040154 or C0040159 rabbit IgGs. Most tissue samples from these tumours are negative for nuclear staining pattern (1). Some tissue samples display distinct nuclear staining pattern (2). The same staining pattern is also observed with the control antibody against RELA p65. There is a similarity between this nuclear staining pattern and that found in C11orf95-RELA.

Some staining was seen in posterior fossa ependymomas. There are several reasons why posterior fossa ependymomas may stain positive with the C11orf95-RELA. The genomic and RNA sequence of the fusion has never been detected in posterior fossa tumours, thus staining is not likely to be because of expression in these cancers. It is possible that these tumours are actually forebrain in origin and have metastasised to the posterior fossa, or were originally misclassified fusion positive tissue samples (Figure 7A).

Examples

Example 1. Anti-C11 orf95-RELA^FUS1 specific antibody isolation and lead selections.

1.1 Peptide design.

Biotinylated peptides were chemically synthesised as their trifluoroacetate salt (Bachem, Switzerland). All peptides were purified by analytical High-Performance Liquid Chromatography (HPLC) and their respective identities confirmed by Matrix-Assisted Laser Desorption/lonization-mass spectrometry. Biotin moieties were conjugated N- terminally via an 8-amino-3,6-dioxa-octanoic acid flexible spacer (Biotinyl-AEEAc) or C- terminally via an AEEAc spacer with an additional C-terminal Lysine residue (AEEAc- Lys(biotinyl)-OH).

1.1.1 Biotinylated C orf95-RELA^FUS1 peptides. N-terminal (Peptide 1) or C-terminal (Peptide 5) biotinylated C11 orf-95-RELA^FUS1 peptides were designed that specifically encompassed the canonical fusion 1 translocation junction sequence (C11 orf95-RELA fusions drive oncogenic NF-kappaB signalling in ependymoma. Parker et al., 2014). The N-terminal C11 orf95 component of Peptides 1 and 5 specifically encompass residues Glu-Glu-Glu-Glu-Gly-Ala-Gly-Val-Pro- Ala-Cys-Pro-Pro-Lys-Gly-Pro encoded by exon 2 of C11orf95. The C-terminal RELA component of Peptides 1 and 5 specifically contains RELA residues Glu-Leu-Phe-Pro- Leu-lle-Phe-Pro-Ala-Glu-Pro-Ala-Gln-Ala-Ser-Gly-Pro. Peptides 1 and 5 were both solubilised to 1 mg/ml in 1% Acetic acid.

1.1.2 Biotinylated C11orf95 peptide.

An N-terminal biotinylated C11orf95 peptide was synthesised as a control for‘C11orf95- only’ binding (Peptide 2). Peptide 2 were solubilised to 1 mg/ml in 1% acetic acid.

1.1.3 Biotinylated RELA peptide

A C-terminal biotinylated RELA peptide was synthesised as a control for ‘RELA-only’ binding (Peptide 3). Peptide 3 were solubilised to 1mg/ml in dimethylformamide.

1.1.4 Biotinylated Scrambled peptide.

An N-terminal biotinylated ‘scrambled’ peptide was synthesised as a control for non specific binders (Peptide 4). Peptide 4 was solubilised to 1 mg/ml in 1% Acetic acid.

The C11 orf95-RELA^FUS1 Peptide Reagents are shown in Figure 1(B).

1.2 Phage display selections to isolate C11 orf95-RELA^FUS1 specific scFvs.

Soluble phage display selections were performed using five naive libraries (nFL, DP47, CS, BMV and EG3) cloned into a phagemid vector based on the filamentous phage M13 (Vaughan et al., 1996; Lloyd et al., 2009).

Anti-C11 orf95-RELA^FUS1 scFv antibodies were isolated from the phage display libraries using a series of selection cycles on biotinylated peptides essentially as previously described (Hawkins et al., 1992; Vaughan et al., 1996). For the first round of selections, Peptide 5 (C11 orf95-RELA^FUS1-bio peptide) in Dulbecco’s phosphate buffered saline (DPBS, pH 7) was added to a final concentration of 100nM to purified phage particles that had been pre-incubated for 1 hour in Marvel-PBS (3% w/v) containing Streptavidin- coupled paramag netic beads (Dynabeads® M280, I nvitrogen Life Sciences, UK) . Streptavidin beads were removed prior to addition of antigen . Phage particles that bound to Peptide 5 were captured using fresh Streptavidin-coupled paramagnetic beads, and weakly-bou nd phage were removed by a series of wash cycles using PBS-Tween (0.1 % v/v) . Bound phage particles were eluted from the beads using Trypsin (1 0ng/ml final concentration diluted in 0.1 M sod ium phosphate buffer; pH 7) , infected into E. coli TG 1 bacteria and rescued for the next round of selection (Vaughan et al. , 1 996). Two subseq uent rounds of selections were carried out as previously described , with Peptide 1 (bio-C1 1 orf95-RELA^FUS1 peptide) as antigen during Rou nd 2, alternating back to Peptide 5 as antigen during Rou nd 3, at a final concentration of 50 nM and 25 nM respectively.

Parallel strands of selections with de-selection strategies, in wh ich phage binders to unwanted peptides were removed prior to addition of antigen , was also performed . This involves the pre-incubation of blocked phage particles with Peptides 2, 3 and 4 (at 33 nM each) for 45 min utes, then an incubation with streptavidin beads for another 45 minutes, after which the streptavidin beads were removed and discarded . The target antigen (Peptide 1 or 5) was then added and selections proceeded as described .

1 .3 Identification of C1 1 orf95-RELA^FUS1 specific scFv fragments using a direct-bind ing homogeneous time resolved fluorescence assay (u npurified scFv)

Un pu rified scFv from periplasmic preparations were screened in a homogeneous time- resolved fluorescence (HTRF™, CisBio Bioassays, France) binding assay using a Pherastar plate reader (BMG Labtech , Germany) . I n this assay, binding of unpurified scFv to peptide 1 , peptide 2 and peptide 3 was assessed by measu ring the fluorescence resonance energy transfer (FRET) between the c-myc tagged scFv and the biotinylated peptide using streptavidin cryptate and anti-c-myc-XL665 detection reagents (CisBio I nternational, France; cat: 61 0SAKLB and 61 MYCXLB respectively) . Selection outputs were screened as unpu rified bacterial periplasmic extracts containing scFv, prepared in 200 mM TRIS buffer pH 7.4, 0.5 mM EDTA and 0.5 M sucrose. 2.5 microlitres of un pu rified scFv samples were added to a Greiner® 384 well assay plate (Greiner Bio- one, UK; cat: 784076). This was followed by the addition of 2.5 ml of 80 nM peptide 1 , 80 nM peptide 2 or 40 nM peptide 3, 2.5 ml of 6.67 nM streptavidin cryptate and 2.5 ml 80 nM anti-c-myc-XL665. Non-specific binding wells (negative controls) were defined for each plate by using a negative control un purified scFv in place of the test scFv sample. All d ilutions were performed in phosphate buffered saline (ThermoFisher Scientific, U K; cat: 141 90-094) containing 0.4 M KF (VWR, UK; cat: 26820.236) and 0.1 % bovine serum albumin (Sig ma, UK; cat: A9576) (assay buffer) . Assay plates were incu bated overn ight at 4°C prior to reading time resolved fluorescence on a Pherastar plate reader (PerkinElmer, USA) using an excitation wavelength of 320 n m and measuring the emission at 620 nm and 665 nm (1 00 flashes) .

Data were analysed by calcu lating % Delta F values for each sample. % Delta F was determined according to eq uation 1 .

Equation 1 :

% Delta F = (sample 665 nm / 620 nm ratio) - (negative control 665 nm / 620 nm ratio) x 100

Clones were characterised as binders or non binders depending on their % Delta F value. Clones with % Delta F values >50 were classified as binders, clones with % Delta F values <50 were classified as none binders.

Hits were identified as clones that were binders to peptide 1 and non binders to peptides 2 and 3.

1 .4 Identification of C1 1 orf95-RELA^FUS1 specific scFv using a direct binding HTRF assay (purified scFv).

Unpurified scFv periplasm extracts that showed specific binding to peptide 1 by HTRF™ assay were subjected to DNA sequencing (Osbourn et al. , 1 996 ; Vaug han et al. , 1 996) . The scFv with uniq ue protein sequences were expressed in E. coli and purified by affin ity chromatography (essentially as described (Bannister et al. , 2006)) . The peptide bind ing profile of each pu rified scFv was determined by testing a dilution series of the pu rified scFv in the direct binding assay described in section 1 .3, substituting the unpurified scFv periplasmic preparation with the purified scFv. The pu rified scFv were tested concu rrently for binding to Peptide 1 , Peptide 2, Peptide 3, Peptide 4 and Peptide 5. Data were analysed by calcu lating the % Delta F values as described in section 1 .3.

Clones were characterised as binders or non binders depending on their % Delta F value. Clones with maximu m % Delta F values >50 were classified as binders, clones with maximu m % Delta F values <50 were classified as non binders. The req uired bind ing profile was for binding to Peptides 1 and 5 but not to Peptides 2, 3 and 4. Clones meeting these criteria were reformatted as IgG .

1 .5 Reformatting of C1 1 orf95-RELA^FUS1 specific antibodies from scFv to rabbit IgG and hu man I g G 1 . Specific clones were converted from scFv to rabbit IgG by sub-cloning the variable heavy chain (VH) and variable light chain (VL) domains into vectors expressing whole rabbit antibody heavy and light chains respectively. The term“rabbit IgG” in the examples and figures refers to chimeric antibody with a human VH and VL and a rabbit IgG heavy and light constant domains, i.e. the constant regions are rabbit IgG.

The variable heavy chains were cloned into a mammalian expression vector (pEU33) containing the rabbit heavy chain constant domains and regulatory elements to express whole IgG heavy chain in mammalian cells. Similarly, the variable light chain domains were cloned into a mammalian expression vector for the expression of the rabbit lambda lig ht chain constant domains (pEU35) or rabbit kappa light chain constant domains (pEU34) and regu latory elements to express whole IgG light chain in mammalian cells. Vectors for the expression of heavy chains and lig ht chains were originally described in Persic et al. and modified in-house to express rabbit IgGs (Persic et al. , 1 997) . To obtain clones as IgG, the heavy and light chain IgG expression vectors were transiently transfected into ExpiCHO (ThermoScientific UK; cat. nu mber: A291 33) cells where the antibody was expressed and secreted into the medium. Harvested media was filtered prior to purification . The IgGs were purified using Protein A chromatog raphy (MabSelect SuRe, GE Healthcare, UK) . Culture supernatants were loaded onto an appropriate Protein A colu mn pre-eq uilibrated in 25mM Tris pH 7.4, 50mM NaCI. Bound IgG was eluted from the column using 0.1 M Sodium Citrate pH 3.0, 1 00mM NaCI. The IgGs were buffer exchanged into PBS. The pu rified IgGs were passed throug h a 0.2 micrometer filter and the concentration of IgG was determined by absorbance at 280 n m using an extinction coefficient based on the amino acid sequence of the IgG . The pu rified IgGs were analysed for aggregation or degradation using SEC-HPLC and SDS-PAGE techniq ues.

Selected clones were also cloned and expressed as hu man I g G 1 for assay development purposes, using the same process but with pEU 1 .3 as the hu man heavy chain vector, pEU4.4 as the h uman lambda light chain vector, and pEU3.4 and the hu man kappa lig ht chain vector.

1 .6 Confirming bind ing profile of C1 1 orf95-RELA^FUS1 specific rabbit IgG to C1 1 orf95- RELA^FUS1 peptide using a d irect binding HTRF assay

The pu rified scFv fragments that bound specifically to biotinylated C1 1 orf95-RELA^FUS1 peptide (peptide 1 and peptide 5) in HTRF assays were converted to recombinant rabbit IgG . The peptide binding profile of each recombinant rabbit IgG was determined by testing a dilution series of the recombinant rabbit IgG in the d irect bind ing HTRF assay described in section 1.3, substituting the unpurified scFv periplasmic preparation with the recombinant rabbit IgG.

A further modification to the assay was the substitution of anti-c-myc-XL665 detection reagent with anti-rabbit AlexaFluor 647 detection reagent (ThermoFisher Scientific, UK; cat: A21244) as the recombinant IgG had no c-myc tag (Figure 2).

The recombinant rabbit IgG were tested concurrently for binding to peptide 1, peptide 2, peptide 3 and peptide 4 (see Figure 1 (B) for description of peptides). Data were analysed by calculating the % Delta F values as described in section 1.3.

Clones were characterised as binders or non binders depending on their % Delta F value. Clones with maximum % Delta F values >300 were classified as binders, clones with maximum % Delta F values <300 were classified as non binders. The required binding profile was for binding to peptide 1 but not to peptides 2, 3 and 4. The maximum % Delta F values for lead isolation rabbit IgG clones are summarised in Table 2.

Table 2. Maximum binding signal (Delta F%), in a direct binding assay, of lead isolation rabbit IgGs to peptides 1 , 2, 3 and 4 from direct binding assays. NIP228 represents an irrelevant rabbit IgG isotype control for the assay.

1.7 Immunohistochemistry of mouse ependymoma tumours expressing C1 1 orf95-RELA^FUS1 using C1 1 orf95-RELA^FUS1 specific rabbit IgG.

Immunohistochemistry was performed on mouse brain sections. First, paraffin sections (5mM) of formalin-fixed tissue were dewaxed, rehydrated and subjected to heat-induced epitope- retrieval at 126 °C for 10 min using either TRIS-EDTA (pH 9.0) or sodium citrate buffer (pH 6.0) or proteolytic-induced epitope retrieval using proteinase K (37 °C for 10min). Heat-induced epitope antigen retrieval using Tris-EDTA buffer produced the best stainings and was therefore chosen for most of the stainings. The Novolink polymer kit was used for further preparation of the tissue according to the Man ufactu rer’s instructions omitting the step with the post-primary solution (Novolin k Polymer DS, RE7140-CE) . Primary antibod ies were incubated for 1 h r at room temperature. In control stains , the presence of C 1 1 orf95-RELA^FUS1 was detected using an NF- D B p65 antibody (#8242, Cell Sig nalling , 1 :800 dilution) (Figu re 3) . The C1 1 orf95-RELA^FUS1 specific rabbit IgGs were at different dilutions (1 : 1 0, 1 :50, 1 : 1 00, 1 :200, 1 :500). DAB substrate was used for detection .

Exam ple 2. Affinity maturation of parental lead isolation antibodies specific for C1 1 orf95-RELA^FUS1 using error-prone mutagenesis and ribosome display.

2.1 Construction of C0040034 and C0040036 error prone libraries.

Error-prone libraries were built based on the scFv constructs of two antibody candidates, C0040034 and C0040036. Error-prone PCR was used to introduce random mutations into the scFv region of the constructs. The libraries of mutated scFv constructs were then mod ified into the ribosome display format using standard molecu lar biology methods. The ribosome display construct include the structural features necessary for ribosome display, including a 5’ and 3’ stem loop to prevent deg radation of the mRNA transcript by exonucleases, a Sh ine-Dalgarno sequence to promote ribosome binding to the mRNA transcript, and a gene l l l spacer that allows the translated scFv molecu le to fold while still remaining attached to the ribosome (Groves et al. , 2005) .

2.2 Ribosome d isplay affinity selections using C0040034 and C0040036 error prone libraries.

The libraries were used in affin ity-based soluble ribosome display selections to en rich for variants with higher affin ity for the peptide antigen(s) . The selections were performed essentially as described in Hanes et al. , 2000. I n brief, each library was ind ividually transcribed into mRNA. Using a process of stalled translation , mRNA-ribosome-scFv tertiary complexes were formed (Hanes et al. , 1 997). These complexes were then subjected to five rounds of selection incubated in the presence of decreasing concentrations (60 - 0.3 nM) of biotinylated peptide antigen (alternating between Peptide 1 and 5) to select for variants with higher affinity. Those complexes that bou nd to the antigen were then captured on streptavidin-coated paramagnetic beads (Dynabeads™, I nvitrogen , UK; cat: 1 12-05D) and non-specific ribosome complexes were washed away. The mRNA was subsequently isolated from the bound ribosomal complexes, reverse transcribed to cDNA and then amplified by PCR. Th is DNA was used for the next rou nd of selection . After affinity maturation, the selection outputs were cloned out for screening purposes. The scFv isolated by ribosome display were cloned into the phagemid vector pCANTAB6 by Notl/Ncol restriction endonuclease digestion of the ribosome display construct (New England BioLabs, USA; cat: R0189L, R0193L) followed by ligation into Notl/Ncol digested pCANTAB6 using T4 DNA ligase (New England BioLabs, USA; cat: M0202L) essentially as described by McCafferty et al., 1994.

2.3 Identification of improved scFv clones from ribosome display selection outputs using C11 orf95-RELA^FUS1 peptide epitope competition assays set up with rabbit C0040034 IgG or rabbit C0040036 IgG.

One thousand three hundred and twenty scFv chosen at random from selection rounds 2 and 3 of the error prone mutagenesis approach described in sections 2.1 and 2.2 were expressed in E. coli to produce unpurified periplasmic scFv. Those scFv capable of binding C11 orf95-RELA^FUS1 peptide via the same epitope as C0040034 IgG or C0040036 IgG were elucidated in a competition format assays, using the HTRF™ platform. Specifically, fluorescence resonance energy transfer (FRET) was measured between streptavidin cryptate (associated with biotinylated C11 orf95-RELA^FUS1 peptide) and anti rabbit Alexa Fluor 647 (associated with rabbit C0040034 IgG or rabbit C0040036 IgG) in the presence of a single concentration of each unpurified periplasmic test scFv. Successful occupation of the C0040034 IgG or C0040036 IgG epitope on the peptide by scFv, displacing the IgG, resulted in a reduction in FRET, as measured on a fluorescence plate reader.

A ‘Maximum’ binding signal was determined by analysing the binding of C0040034 IgG or C0040036 IgG to biotinylated C11 orf95-RELA^FUS1 peptide in the absence of competitor scFv. The‘Sample’ signals were derived from analysing the binding of C0040034 IgG or C0040036 IgG to biotinylated C11 orf95-RELA^FUS1 peptide in the presence of a test scFv sample. Finally, a ‘Background’ signal was determined by analysing the fluorescence generated in the absence of C0040034 IgG or C0040036 IgG.

Unpurified periplasmic scFv were supplied in sample buffer consisting of 200 mM Trizma base, pH 7.4, 0.5 mM EDTA, and 0.5 M sucrose.2.5 ml of each scFv were transferred to the ‘Sample’ wells of a black, shallow, solid bottom, non-binding 384-well assay plate using a liquid handling robot. The remaining reagents (prepared in assay buffer) were added to the assay plate by multichannel pipette in the following order: 2.5 ml detection cocktail, consisting of 6.6 nM streptavidin cryptate and 40 nM anti-rabbit AlexaFluor 647 (to all wells), 2.5 ml 12 nM biotinylated C11 orf95-RELA^FUS1 peptide (to all wells), 2.5 ml 6 nM C0040034 IgG or 2.5 ml 16 nM C0040036 IgG (to ‘Sample’ and ‘Maximum’ wells), and 2.5 ml sample buffer (to background wells). Assay plates were sealed and then incubated overnight at 4°C, prior to measuring time-resolved fluorescence at 620 and 665 nm emission wavelengths on a fluorescence plate reader.

Data were analysed by calculating % Delta F values for each sample. % Delta F was determined according to equation 1.

Equation 1 :

Delta F values were subsequently used to calculate normalised binding values as described in equation 4.

Equation 4:

Normalised data (% Control) = % Delta F of sample x 100

Unpurified periplasmic scFv demonstrating significant inhibition of C0040034 IgG or C0040036 IgG binding to biotinylated C11 orf95-RELA^FUS1 peptide were subjected to DNA sequencing (Osbourn et al., 1996; Vaughan et al., 1996). The scFv found to have unique protein sequences were expressed in E. coli and purified by affinity chromatography followed by buffer exchange.

The potency of each purified scFv was determined by testing a dilution series of the scFv (typically 4 pM - 1200 nM) in the epitope competition assay described above. Data were again analysed by calculating the % Delta F and % Control binding values for each sample. scFv sample concentration was plotted against % Control using scientific graphing software, and any concentration-dependent responses were fitted with non-linear regression curves. IC50 values were obtained from these analyses (Figure 4A and Figure 4B; Table 3 and Table 4).

Table 3. IC₅₀ values of clones (scFv) derived from human C0040034 I g G 1 epitope competition assay.

Table 4. IC50 values of clones (scFv) derived from human C0040036 I g G 1 epitope competition assay.

Reagent/Equipment sources: Trizma base (Sigma, UK; cat: RDD008), potassium fluoride (VWR chemicals, Belgium; cat: 26820.236), bovine serum albumin solution (Sigma, UK; cat: A7284), C0040034 IgG and C0040036 IgG (produced in-house), biotinylated

C11 orf95-RELA^FUS1 peptide (Bachem, Switzerland; cat: 3015407), Streptavidin cryptate (Cisbio, France; cat: 610SAKLB), anti-rabbit Alexa Fluor 647 (ThermoFisher Scientific, UK; cat: A21244), 384-well assay plates (Greiner BioOne, Germany; cat: 784076), 384- well dilution plates (Greiner BioOne, Germany; cat: 781280), liquid handling robot (Hamilton Star™, Hamilton , USA) , fluorescence plate reader (Pherastar™, BMG Labtech , USA) , HTRF technology (Cisbio I nternational, France), graphing/statistical software (Prism, Graphpad USA) .

2.4 Reformatting of affin ity matu red , C 1 1 orf95-RELA^FUS1 specific scFv to rabbit IgG .

Antibody cand idates of interest were converted into rabbit IgG format as described in section 1 .5.

2.6 Confirming bind ing profile of affinity matured C 1 1 orf95-RELA^FUS1 specific rabbit IgG to C1 1 orf95-RELA^FUS1 peptide using a C1 1 orf95-RELA^FUS1 peptide epitope competition assay set up with h uman C0040034 I g G 1 or C0040036 IgG .

The pu rified scFv frag ments of interest identified in the recombinant rabbit C0040034 IgG or recombinant rabbit C0040036 IgG epitope competition assays were converted to recombinant rabbit IgG and re-tested in epitope competition assays reformatted with recombinant hu man C0040034 IgG and recombinant hu man C0040036 IgGs (Figu re 5A and Figure 5B) . These assays were performed as described in section 2.3 substituting 6 nM recombinant rabbit C0040034 IgG with 2 nM recombinant h uman C0040034 IgG 1 and 16 nM recombinant rabbit C0040036 IgG with 4 nM recombinant human C0040036 I g G 1 .

A fu rther modification to the assay was the su bstitution of 40 n M anti-rabbit Alexa Fluor 647 detection reagent with 40 nM anti-human Fc XL665 detection reagent (Cisbio, France; cat: 61 HFCXLB) .

2.7 I mmunohistochemistry of mouse ependymoma tu mours expressing C1 1 orf95- RELA^FUS1 using C 1 1 orf95-RELA^FUS1 -specific affinity-matured rabbit IgG .

Immunohistochemistry was performed on mouse brain sections. First, paraffin sections (5pM) of formalin-fixed tissue were dewaxed, rehydrated and subjected to heat-induced epitope-retrieval using either Tris-EDTA (pH 9.0) or sodium citrate buffer (pH 6.0) before continuing the staining using the Novolink polymer kit according to the Manufacturer’s instructions but omitting the step with the postprimary solution (Novolink Polymer DS, RE7140-CE). Primary antibodies were diluted in TBST + 10% goat serum and incubated for 1 h at room temperature. In control stains, the presence of C11 orf95- RELA^FUS was detected using an NF-DB p65 antibody (#8242, Cell Signalling, 1 :800 dilution). The C1 1 orf95-RELA^FUS1 specific affinity matured rabbit IgGs were tested using different dilutions (1 :100, 1 :200, 1 :500, 1 :1000, 1 :2500, 1 :6000). While IgG C0040151 works best at a dilution of 1 :2500, IgG C0040154 gives best staining results when diluted at 1 :6000/7000 and IgG C0040159 works best at a dilution of 1 :1000. DAB substrate was used for signal detection. The results are shown in Figure 6. 2.8 Immunohistochemistry of human ependymoma tissue sections using C1 1 orf95-RELA^FUS1 -specific affinity-matured rabbit IgG.

Ethical approval was obtained for use of human material HBREC2020.13. Immunohistochemistry was performed on human tissue sections from ependymoma patients. First, paraffin sections (2pM) of formalin-fixed (FFPE) tissue were dewaxed, rehydrated and subjected to heat-induced epitope-retrieval using sodium citrate buffer (pH 6.0) before continuing the staining using the Novolink polymer kit according to the Manufacturer’s instructions but omitting the step with the post-primary solution (Novolink Polymer DS, RE7140-CE). Primary antibodies were diluted in TBST + 10% goat serum and incubated for 1 h at room temperature. In control stains, the presence of C1 1 orf95-RELA^FUS was detected using an NF-■B p65 antibody (#8242, Cell Signalling, 1 :800 dilution). The C1 1 orf95-RELA^FUS1 specific affinity matured rabbit IgGs were tested using different dilutions (IgG C0040151 at 1 :3000, 1 :5000; IgG C0040154 at 1 :7000 and 1 :8000; IgG C0040159 at 1 :2000 and 1 :3500). While IgG C0040151 works best at a dilution of 1 :5000, IgG C0040154 gives best staining results when diluted at 1 :8000 and IgG C0040149 at a dilution of 1 :3000. DAB substrate was used for signal detection. The results are shown in Figure 7.

Further Experiments

Affinity matured IgGs are tested towards their specificity and selectivity in additional molecular assays. To investigate the binding of IgGs further, immunoprecipitations (IP) using IgGs C0040151 , C0040154 and C0040159 are carried out on C1 1 orf95-RELAFus1 positive- and negative cells. Collected proteins are visualized and separated in SDS-pages and proteins of interest are analysed by mass spectrometry (MS).

Further optimization of staining methods using IgGs C0040151 , C0040154 and C0040159 is performed on human tissue sections positive and negative for C1 1 orf95-RELA fusion. All three IgGs are optimised for immunohistochemistry assays as well as immunofluorescent (IF) assays. Utilizing confocal microscopy for IF stained sections, the subcellular binding of IgGs to the protein of interest is investigated. Appropriate negative and positive control antibodies are used for all experiments.

References

Bannister et al., 2006. Biotechnol Bioeng.; 94(5): 931 -7. Parallel, high-throughput purification of recombinant antibodies for in vivo cell assays.

Gessi et al., 2019. (2019) Role of IHC in the identification of supratentorial C1 1 orf95-RELA fused ependymoma in routine neuropathology January 2019 Am J Surg Pathol., Volume 43, Number 1 , January 2019.

Groves et al. , 2005. Applications of ribosome d isplay to a nti body d rug d iscovery, Expe rt Opin Bio l Th er 5 : 1 25-1 35.

Hawkins et al. , 1 992. Selectio n of phage anti bod ies by bi nd ing affi n ity. Mimicking affin ity matu ratio n . J Mol Biol ; 226 : 88.9. Hanes et al., 1997. In vitro selection and evolution of functional proteins by using ribosome display. Proc. Natl. Acad. Sci. U.S.A.94 (10): 4937-42.

Hanes etal., 2000. Picomolar affinity antibodies from a fully synthetic naive library selected and evolved by ribosome display, Nat Biotechnol.18: 1287-1292.

Hansen et at, 1994. Purification, reconstitution, and I kappa B association of the c-Rel-p65 (RelA) complex, a strong activator of transcription. Mol Cell Biol.1994 Apr; 14(4): 2593-2603.

Johnson et a/., 2010 Cross-species genomics matches driver mutations and cell compartments to model ependymoma. Nature 466: 632-636.

Jones et a!., 1986, Nature 321 : 522-525.

Kabatand Wu„ 1991. J. Immunol., 1991, vol.147 (pg.1709-1719).

Kleihues et a/., 2002 The WHO Classification of Tumors of the Nervous System.Journal of Neuropathology & Experimental Neurology, Volume 61, Issue 3, March 2002, Pages 215-225 Lloyd et al., 2009. Protein Engineering, Design and Selection, Volume 22, Issue 3, March 2009, Pages 159-168

Louis etal.2016 The 2016 World Health Organization Classification of Tumors of the Central Nervous System- a summary. Acta Neuropathol.2016 Jun; 131(6):803-20.

McCafferty et al., 1994. Appl. Biochem. Biotechnol., 1994, vol. 47 (pg. 157-171) discussion 171-153.

Mohankumaref al., 2015 An in vivo screen identifies ependymoma oncogenes and tumour-suppressor genes. Nat Genet.2015 Aug; 47(8): 878-87.

Morrison et al., 1984. Proc. Natl. Acad. Sci. USA 81: 6851 -6855.

Nomenclature, I. -I. J. C. o. B., 1984 lUPAC-IUB Joint Commission on Biochemical Nomenclature (JCBN).

Osbourne etal., 1996 Immunotechnology, 1996.2(3): p.181-96.

Pajtler et al., 2015 Molecular Classification of Ependymal Tumors across All CNS Compartments, Histopathological Grades and Age Groups. Cancer Cell.2015 May 11 ; 27(5): 728-743.

Parker et al., 2014 C11orf95-RELA fusions drive oncogenic NF-kB signalling in ependymoma. Nature. 2014 Feb 27; 506(7489):451-5.

Persic et al., 1997. Gene 187; 9-18

Presta, Curr. Op. Struct. Biol.2: 593-596, 1992.

Riechmann et al., 1988 Nature 332: 323-329.

Shih et al., 2011 A single NFKB system for both canonical and non-canonical signalling. Cell Research volume 21 , pages86-102.

Taylor et al., 2005, Radial glia cells are candidate stem cells of ependymoma. Cancer Cell.2005 Oct; 8(4):323-35.

Thompson et al., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res.1994 Nov 11; 22(22):4673-80.

Vaughan et al., 1996 Nat Biotechnol, 14(3): p.309-14. Sequence Listing Information

SEQ ID NO: 481 Peptide 1 amino acid sequence

Glu-Glu-Glu-Glu-Gly-Ala-Gly-Val-Pro-Ala-Cys-Pro-Pro-Lys-Gly-Pro-Glu-Leu-Phe-Pro-

Leu-lle-Phe-Pro-Ala-Glu-Pro-Ala-Gln-Ala-Ser-Gly-Pro

Peptide 1 (bio-C11 orf95-RELA^FUS1 peptide)

Biotinyl-AEEAc-Glu-Glu-Glu-Glu-Gly-Ala-Gly-Val-Pro-Ala-Cys-Pro-Pro-Lys-Gly-Pro-Glu-

Leu-Phe-Pro-Leu-lle-Phe-Pro-Ala-Glu-Pro-Ala-GIn-Ala-Ser-Gly-Pro-OH

SEQ ID NO: 482 Peptide 2 amino acid sequence

Glu-Glu-Glu-Glu-Gly-Ala-Gly-Val-Pro-Ala-Cys-Pro-Pro-Lys-Gly-Pro-Gly-Lys-Ala-Pro-

Ala-Gly

Peptide 2 (bio-C11 orf95FUS1 Control peptide)

Biotinyl-AEEAc-Glu-Glu-Glu-Glu-Gly-Ala-Gly-Val-Pro-Ala-Cys-Pro-Pro-Lys-Gly-Pro-Gly-

Lys-Ala-Pro-Ala-Gly-OH

SEQ ID NO: 483: Peptide 3 amino acid sequence

Met-Asp-Glu-Leu-Phe-Pro-Leu-lle-Phe-Pro-Ala-Glu-Pro-Ala-Gln-Ala-Ser-Gly-Pro Peptide 3 (bio-RELA Control peptide)

H-Met-Asp-Glu-Leu-Phe-Pro-Leu-lle-Phe-Pro-Ala-Glu-Pro-Ala-Gln-Ala-Ser-Gly-Pro-

AEEAc-Lys(biotinyl)-OH

SEQ ID NO: 484 Peptide 4 amino acid sequence

Phe-Ala-Ala-Cys-Pro-Glu-Ala-Glu-Glu-Pro-Val-Ala-Glu-Leu-Gly-Pro-Ala-Glu-Ser-Pro-

Leu-Phe-lle-Gly-Pro-Pro-Gln-Gly-Pro-Gly-Pro-Glu-Lys

Peptide 4 (bio-Scrambled peptide)

Biotinyl-AEEAc-Phe-Ala-Ala-Cys-Pro-Glu-Ala-Glu-Glu-Pro-Val-Ala-Glu-Leu-Gly-Pro-

Ala-Glu-Ser-Pro-Leu-Phe-lle-Gly-Pro-Pro-GIn-Gly-Pro-Gly-Pro-Glu-Lys-OH SEQ I D NO: 485 Peptide 5 amino acid sequence

Glu-Glu-Glu-Glu-Gly-Ala-Gly-Val-Pro-Ala-Cys-Pro-Pro-Lys-Gly-Pro-Glu-Leu-Phe-Pro- Leu-lle-Phe-Pro-Ala-Glu-Pro-Ala-Gln-Ala-Ser-Gly-Pro

Peptide 5 (C1 1 orf95-RELA^FUS1-bio peptide)

H-Glu-Glu-Glu-Glu-Gly-Ala-Gly-Val-Pro-Ala-Cys-Pro-Pro-Lys-Gly-Pro-Glu-Leu-Phe-Pro-

Leu-lle-Phe-Pro-Ala-Glu-Pro-Ala-Gln-Ala-Ser-Gly-Pro-AEEAc-Lys(biotinyl)-OH

SEQ I D NO: 486 Amino acid sequence of N-terminal C11 orf95 component of peptides 1 and 5 encoded by exon 2 of C11 orf95.

Glu-Glu-Glu-Glu-Gly-Ala-Gly-Val-Pro-Ala-Cys-Pro-Pro-Lys-Gly-Pro

SEQ I D NO: 487 Amino acid sequence of C-terminal RELA component of peptides 1 and 5. Glu-Leu-Phe-Pro-Leu-lle-Phe-Pro-Ala-Glu-Pro-Ala-Gln-Ala-Ser-Gly-Pro

SEQ I D NO: 488 Amino acid sequence of C1 1 orf95-RELA canonical fusion 1 translocation junction (Figure 1A)

Pro-Ala-Cys-Pro-Pro-Lys-Gly-Pro-Glu-Leu-Phe-Pro-Leu-lle-Phe SEQ I D NO: 489 nucleic acid sequence of C11 orf95-RELA canonical fusion 1 translocation junction (Figure 1A)

5’ CCAGCTTGCCCGCCCAAGGGCCCAGAACTGTTCCCCCTCATCTTC 3’

Claims

1 . An isolated antigen-binding protein characterised in that it is capable of binding specifically to an epitope of human RELA^FUS1 of Peptide 1 (SEQ ID NO: 481) or Peptide 5 (SEQ ID NO: 485).

2. An isolated antigen-binding protein of claim 1 , characterised in that it is capable of binding specifically to human C 1 1 orf95-RELA^{FU S 1} onco- protei n .

3. An isolated antigen-binding protein of any preceding claim, comprising:

(a) a VH domain comprising a set of HCDRs: HCDR1 , HCDR2 and HCDR3, interspersed with framework regions (HFW1 -HCDR1 -HFW2-HCDR2-HFW3-HCDR3-HFW4), wherein the amino acid sequences of the set of HCDRs is selected from those of clone C0040154, C0040151 , C0040034, C0040036, C0040044, C0040033, C0040007, C0040012, C0040014, C0040035, C0040039,

C0040018, C0040040, C0040032, C0040037, C0040045, C0040025, C0040074, C0040062,

C0040047, C0040069, C0040060, C0040063, C0040067, C0040072, C0040066, C0040065,

C0040061 , C0040145, C0040146, C0040147, C0040148, C0040150, C0040152, C0040153,

C0040155, C0040156, C0040157, C0040158, C0040159, C0040160, C0040161 , C0040162,

C0040163, C0040164, C0040165, or C0040166; and / or,

(b) a VL domain comprising a set of LCDRs: LCDR1 , LCDR2 and LCDR3, interspersed with framework regions (LFW1 -LCDR1 -LFW2-LCDR2-LFW3-LCDR3-LFW4), wherein the amino acid sequences of the set of LCDRs is selected from those of clone C0040154, C0040151 , C0040034, C0040036, C0040044, C0040033, C0040007, C0040012, C0040014, C0040035, C0040039, C0040018, C0040040,

C0040032, C0040037, C0040045, C0040025, C0040074, C0040062, C0040047, C0040069,

C0040146, C0040147, C0040148, C0040150, C0040152, C0040153, C0040155, C0040156,

C0040165, or C0040166, and/or,

(c) a VH domain comprising a set of HCDRs: HCDR1 , HCDR2 and HCDR3 interspersed with framework regions (HFW1 -HCDR1 -HFW2-HCDR2-HFW3-HCDR3-HFW4) and a VL domain comprising a set of LCDRs: LCDR1 , LCDR2 and LCDR3, interspersed with framework regions (LFW1 -LCDR1 -LFW2- LCDR2-LFW3-LCDR3-LFW4), wherein the amino acid sequences of the six CDRs (HCDR1 , HCDR2, HCDR3, LCDR1 , LCDR2 and LCDR3) is selected from the six CDRS of clone C0040154, C0040151 , C0040034, C0040036, C0040044, C0040033, C0040007, C0040012, C0040014, C0040035,

C0040039, C0040018, C0040040, C0040032, C0040037, C0040045, C0040025, C0040074,

C0040062, C0040047, C0040069, C0040060, C0040063, C0040067, C0040072, C0040066,

C0040162, C0040163, C0040164, C0040165, or C0040166, wherein the sequences are defined by Kabat nomenclature.

4. An isolated antigen-binding protein of any preceding claim, comprising:

C0040044, C0040033, C0040007, C0040012, C0040014, C0040035, C0040039, C0040018,

C0040040, C0040032, C0040037, C0040045, C0040025, C0040074, C0040062, C0040047,

C0040145, C0040146, C0040147, C0040148, C0040150, C0040152, C0040153, C0040155,

C0040164, C0040165, or C0040166 or a VH with at least 80% homology thereto, and / or,

C0040044, C0040033, C0040007, C0040012, C0040014, C0040035, C0040039, C0040018,

C0040040, C0040032, C0040037, C0040045, C0040025, C0040074, C0040062, C0040047,

C0040145, C0040146, C0040147, C0040148, C0040150, C0040152, C0040153, C0040155,

C0040164, C0040165, or C0040166, or a VL with at least 80% homology thereto, and/or,

(c) a VH domain and VL domain of clone C0040154, C0040151 , C0040034, C0040036, C0040044,

C0040033, C0040007, C0040012, C0040014, C0040035, C0040039, C0040018, C0040040,

C0040032, C0040037, C0040045, C0040025, C0040074, C0040062, C0040047, C0040069,

C0040146, C0040147, C0040148, C0040150, C0040152, C0040153, C0040155, C0040156,

C0040165, or C0040166; wherein the sequences are defined by Kabat nomenclature.

5. An isolated antigen-binding protein of any preceding claim characterised in that it is a monoclonal antibody or a fragment thereof.

6. An isolated antigen-binding protein of any preceding claim, characterised in that it is a human, nonhuman, humanised or chimeric antibody.

7. An isolated antigen-binding protein of any preceding claim, characterised in that it is a chimeric antibody comprising a human VH and / or VL.

8. An isolated antigen-binding protein of any preceding claim, characterised in that it comprises nonhuman heavy and / or light chain constant regions.

9. An isolated antigen-binding protein of any preceding claim, characterised in that it comprises a nonhuman heavy chain constant region CH1 , hinge, CH2 and / or CH3, and / or a non-human light chain constant region CL.

10. An isolated antigen-binding protein of any preceding claim, characterised in that the non-human antibody or region thereof is selected from those of rabbit, mouse, rat, goat, sheep, cattle, chicken, guinea pig, hamster, shark and camelid.

1 1 . An isolated antigen-binding protein of any preceding claim for use in detection of an epitope of Peptide 1 (SEQ ID NO: 481), Peptide 5 (SEQ ID NO: 485), or C1 1 orf95-RELA^FUS1 (RELAFusl) in a sample.

12. An isolated antigen-binding protein of any preceding claim for use in detection of C1 1 orf95- RELA^{FU S 1} in a sample.

13. An in vitro method for detecting C1 1 orf95-RELA^FUS1 in a sample, comprising incubating an antigenbinding protein according to any preceding claim with a sample of interest and detecting binding of the antigen-binding protein to C1 1 orf95-RELA^FUS1 within the sample, wherein binding of the antigen-binding protein indicates the presence of C1 1 orf95-RELA^FUS1 in the sample.

14. An in vitro method according to claim 13, wherein the binding of the antigen-binding protein is detected using a method selected from immunohistochemistry (IHC), immunofluorescence, Western blot, immunoprecipitation (IP), ELISA and flow cytometry.

15. An isolated antigen-binding protein for use according to claim 1 1 or 12 or an in vitro method according to claim 13 or claim 14, wherein the sample is selected from brain tissue, cerebro-spinal fluid (CSF), primary or cultured cells or cell lines, cell supernatants, cell lysates, platelets, serum, plasma, vitreous fluid, lymph fluid, synovial fluid, follicular fluid, seminal fluid, amniotic fluid, milk, whole blood, plasma, serum, blood-derived cells, urine, saliva, sputum, tears, perspiration, mucus, tumor lysates, and tissue culture medium, tissue extracts such as homogenized tissue, tumor tissue, cellular extracts, and combinations thereof.

16. An isolated antigen-binding protein according to any one of claims 1 to 12 for use:

(i) in vitro as a diagnostic or in an in vitro diagnostic method,

(ii) in an in vitro method of detecting or diagnosing a disease or disorder,

(iii) in the manufacture of a diagnostic product for use in the in vitro detection or diagnosis of a disease or disorder; or,

17. An isolated antigen-binding protein for use according to claim 16, wherein the disease or disorder is an ependymoma, e.g., supratentorial ependymoma.

18. An isolated recombinant peptide comprising the amino acid sequence of Peptide 1 (SEQ ID NO: 481) or Peptide 5 (SEQ ID: 485), optionally comprising an N- or C- terminal biotin.

19. An isolated nucleic acid or set of nucleic acids encoding an antigen-binding protein according to any of claims 1 to 12.

20. A host cell in vitro transformed with nucleic acid or set of nucleic acids according to claim 19.

21. A method of producing an antigen-binding protein according to any of claims 1 to 12, comprising culturing host cells according to claim 20 under conditions for production of the antigen-binding protein.

22. A method according to claim 21 , further comprising isolating and/or purifying the antigen-binding protein.

23. A method according to claim 22, further comprising formulating the antigen-binding protein into a composition comprising at least one additional component.

24. A composition comprising an antigen-binding protein of any of claims 1 to 12 and an excipient.